Microbial communities and arsenic biogeochemistry at the outflow of an alkaline sulfide-rich hot spring

PubMed Central

Jiang, Zhou; Li, Ping; Van Nostrand, Joy D.; Zhang, Ping; Zhou, Jizhong; Wang, Yanhong; Dai, Xinyue; Zhang, Rui; Jiang, Dawei; Wang, Yanxin

2016-01-01

Alkaline sulfide-rich hot springs provide a unique environment for microbial community and arsenic (As) biogeochemistry. In this study, a representative alkaline sulfide-rich hot spring, Zimeiquan in the Tengchong geothermal area, was chosen to study arsenic geochemistry and microbial community using Illumina MiSeq sequencing. Over 0.26 million 16S rRNA sequence reads were obtained from 5-paired parallel water and sediment samples along the hot spring’s outflow channel. High ratios of As(V)/AsSum (total combined arsenate and arsenite concentrations) (0.59–0.78), coupled with high sulfide (up to 5.87 mg/L), were present in the hot spring’s pools, which suggested As(III) oxidation occurred. Along the outflow channel, AsSum increased from 5.45 to 13.86 μmol/L, and the combined sulfide and sulfate concentrations increased from 292.02 to 364.28 μmol/L. These increases were primarily attributed to thioarsenic transformation. Temperature, sulfide, As and dissolved oxygen significantly shaped the microbial communities between not only the pools and downstream samples, but also water and sediment samples. Results implied that the upstream Thermocrinis was responsible for the transformation of thioarsenic to As(III) and the downstream Thermus contributed to derived As(III) oxidation. This study improves our understanding of microbially-mediated As transformation in alkaline sulfide-rich hot springs. PMID:27126380

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

PubMed Central

Haut, Donald D.; Pintel, D. J.

1998-01-01

Alternative splicing of pre-mRNAs plays a critical role in maximizing the coding capacity of the small parvovirus genome. The small-intron region of minute virus of mice (MVM) pre-mRNAs undergoes an unusual pattern of overlapping alternative splicing—using two donors (D1 and D2) and two acceptors (A1 and A2) within a region of 120 nucleotides—that determines the steady-state ratios of the various viral mRNAs. In this report, we show that the determinants that govern excision of the small intron are complex and are also required for efficient definition of the upstream exon. For the MVM small intron in its natural context, the two donors appear to compete for the splicing machinery: the position of D1 favors its usage, while the primary sequence of D2 must be more like the consensus sequence than is D1 to be used efficiently. We have genetically defined the branch points that are used for generation of the major and minor spliced forms and show that recognition of components of the small-intron acceptors is likely to be the dominant determinant in alternative small-intron excision. We have also identified a G-rich intronic enhancer sequence within the small intron that is essential for splicing of the minor form (D2 to A2) but not the major form (D1 to A1) of MVM mRNAs and is required for efficient definition of the upstream NS2-specific exon. In its natural context, the small intron appears to be excised by a mechanism consistent with intron definition. When the MVM small intron is expanded, various parameters of its excision are altered, indicating that critical cis-acting signals are context dependent. Relative use of the donors and acceptors is altered, and the upstream NS2-specific exon is no longer efficiently defined. The fact that definition of the upstream NS2-specific exon can be achieved by the MVM small intron in its natural context, but not when it is expanded, suggests that the multiple determinants that govern definition and excision of the small intron are required, in concert, for upstream exon definition. Our data are consistent with a model in which alternative splicing of the MVM P4-generated pre-mRNAs is governed by a hybrid of intron- and exon-defining mechanisms. PMID:9499034

Variation in local abundance and species richness of stream fishes in relation to dispersal barriers: Implications for management and conservation

USGS Publications Warehouse

Nislow, K.H.; Hudy, M.; Letcher, B.H.; Smith, E.P.

2011-01-01

1.Barriers to immigration, all else being equal, should in principle depress local abundance and reduce local species richness. These issues are particularly relevant to stream-dwelling species when improperly designed road crossings act as barriers to migration with potential impacts on the viability of upstream populations. However, because abundance and richness are highly spatially and temporally heterogeneous and the relative importance of immigration on demography is uncertain, population- and community-level effects can be difficult to detect. 2.In this study, we tested the effects of potential barriers to upstream movements on the local abundance and species richness of a diverse assemblage of resident stream fishes in the Monongahela National Forest, West Virginia, U.S.A. Fishes were sampled using simple standard techniques above- and below road crossings that were either likely or unlikely to be barriers to upstream fish movements (based on physical dimensions of the crossing). We predicted that abundance of resident fishes would be lower in the upstream sections of streams with predicted impassable barriers, that the strength of the effect would vary among species and that variable effects on abundance would translate into lower species richness. 3.Supporting these predictions, the statistical model that best accounted for variation in abundance and species richness included a significant interaction between location (upstream or downstream of crossing) and type (passable or impassable crossing). Stream sections located above predicated impassable culverts had fewer than half the number of species and less than half the total fish abundance, while stream sections above and below passable culverts had essentially equivalent richness and abundance. 4.Our results are consistent with the importance of immigration and population connectivity to local abundance and species richness of stream fishes. In turn, these results suggest that when measured at appropriate scales (multiple streams within catchments), with simple protocols amenable to use by management agencies, differences in local abundance and species richness may serve as indicators of the extent to which road crossings are barriers to fish movement and help determine whether road-crossing improvements have restored connectivity to stream fish populations and communities. Published 2011. This article is a US Government work and is in the public domain in the USA.

New insights into replication origin characteristics in metazoans

PubMed Central

Puy, Aurore; Rialle, Stéphanie; Kaplan, Noam; Segal, Eran

2012-01-01

We recently reported the identification and characterization of DNA replication origins (Oris) in metazoan cell lines. Here, we describe additional bioinformatic analyses showing that the previously identified GC-rich sequence elements form origin G-rich repeated elements (OGREs) that are present in 67% to 90% of the DNA replication origins from Drosophila to human cells, respectively. Our analyses also show that initiation of DNA synthesis takes place precisely at 160 bp (Drosophila) and 280 bp (mouse) from the OGRE. We also found that in most CpG islands, an OGRE is positioned in opposite orientation on each of the two DNA strands and detected two sites of initiation of DNA synthesis upstream or downstream of each OGRE. Conversely, Oris not associated with CpG islands have a single initiation site. OGRE density along chromosomes correlated with previously published replication timing data. Ori sequences centered on the OGRE are also predicted to have high intrinsic nucleosome occupancy. Finally, OGREs predict G-quadruplex structures at Oris that might be structural elements controlling the choice or activation of replication origins. PMID:22373526

Nucleosome exclusion from the interspecies-conserved central AT-rich region of the Ars insulator.

PubMed

Takagi, Haruna; Inai, Yuta; Watanabe, Shun-ichiro; Tatemoto, Sayuri; Yajima, Mamiko; Akasaka, Koji; Yamamoto, Takashi; Sakamoto, Naoaki

2012-01-01

The Ars insulator is a boundary element identified in the upstream region of the arylsulfatase (HpArs) gene in the sea urchin, Hemicentrotus pulcherrimus, and possesses the ability to both block enhancer-promoter communications and protect transgenes from silent chromatin. To understand the molecular mechanism of the Ars insulator, we investigated the correlation between chromatin structure, DNA structure and insulator activity. Nuclease digestion of nuclei isolated from sea urchin embryos revealed the presence of a nuclease-hypersensitive site within the Ars insulator. Analysis of micrococcal nuclease-sensitive sites in the Ars insulator, reconstituted with nucleosomes, showed the exclusion of nucleosomes from the central AT-rich region. Furthermore, the central AT-rich region in naked DNA was sensitive to nucleotide base modification by diethylpyrocarbonate (DEPC). These observations suggest that non-B-DNA structures in the central AT-rich region may inhibit nucleosomal formation, which leads to nuclease hypersensitivity. Furthermore, comparison of nucleotide sequences between the HpArs gene and its ortholog in Strongylocentrotus purpuratus revealed that the central AT-rich region of the Ars insulator is conserved, and this conserved region showed significant enhancer blocking activity. These results suggest that the central AT-rich nucleosome-free region plays an important role in the function of the Ars insulator.

Probing the Potential Role of Non-B DNA Structures at Yeast Meiosis-Specific DNA Double-Strand Breaks.

PubMed

Kshirsagar, Rucha; Khan, Krishnendu; Joshi, Mamata V; Hosur, Ramakrishna V; Muniyappa, K

2017-05-23

A plethora of evidence suggests that different types of DNA quadruplexes are widely present in the genome of all organisms. The existence of a growing number of proteins that selectively bind and/or process these structures underscores their biological relevance. Moreover, G-quadruplex DNA has been implicated in the alignment of four sister chromatids by forming parallel guanine quadruplexes during meiosis; however, the underlying mechanism is not well defined. Here we show that a G/C-rich motif associated with a meiosis-specific DNA double-strand break (DSB) in Saccharomyces cerevisiae folds into G-quadruplex, and the C-rich sequence complementary to the G-rich sequence forms an i-motif. The presence of G-quadruplex or i-motif structures upstream of the green fluorescent protein-coding sequence markedly reduces the levels of gfp mRNA expression in S. cerevisiae cells, with a concomitant decrease in green fluorescent protein abundance, and blocks primer extension by DNA polymerase, thereby demonstrating the functional significance of these structures. Surprisingly, although S. cerevisiae Hop1, a component of synaptonemal complex axial/lateral elements, exhibits strong affinity to G-quadruplex DNA, it displays a much weaker affinity for the i-motif structure. However, the Hop1 C-terminal but not the N-terminal domain possesses strong i-motif binding activity, implying that the C-terminal domain has a distinct substrate specificity. Additionally, we found that Hop1 promotes intermolecular pairing between G/C-rich DNA segments associated with a meiosis-specific DSB site. Our results support the idea that the G/C-rich motifs associated with meiosis-specific DSBs fold into intramolecular G-quadruplex and i-motif structures, both in vitro and in vivo, thus revealing an important link between non-B form DNA structures and Hop1 in meiotic chromosome synapsis and recombination. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro

PubMed Central

De Avila, Miguel; Vassall, Kenrick A.; Smith, Graham S. T.; Bamm, Vladimir V.; Harauz, George

2014-01-01

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92–R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP–Fyn–SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62–L68), and demonstrate further that residues (V83–P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn–SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex. PMID:25343306

The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro.

PubMed

De Avila, Miguel; Vassall, Kenrick A; Smith, Graham S T; Bamm, Vladimir V; Harauz, George

2014-12-08

The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92-R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP-Fyn-SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62-L68), and demonstrate further that residues (V83-P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn-SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex.

Thinking Upstream: A 25-Year Retrospective and Conceptual Model Aimed at Reducing Health Inequities.

PubMed

Butterfield, Patricia G

Thinking upstream was first introduced into the nursing vernacular in 1990 with the goal of advancing broad and context-rich perspectives of health. Initially invoked as conceptual framing language, upstream precepts were subsequently adopted and adapted by a generation of thoughtful nursing scholars. Their work reduced health inequities by redirecting actions further up etiologic pathways and by emphasizing economic, political, and environmental health determinants. US health care reform has fostered a much broader adoption of upstream language in policy documents. This article includes a semantic exploration of thinking upstream and a new model, the Butterfield Upstream Model for Population Health (BUMP Health).

(S)-3-hydroxy-3-methylglutaryl coenzyme A reductase, a product of the mva operon of Pseudomonas mevalonii, is regulated at the transcriptional level.

PubMed Central

Wang, Y L; Beach, M J; Rodwell, V W

1989-01-01

We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Engineering Promoter Architecture in Oleaginous Yeast Yarrowia lipolytica.

PubMed

Shabbir Hussain, Murtaza; Gambill, Lauren; Smith, Spencer; Blenner, Mark A

2016-03-18

Eukaryotic promoters have a complex architecture to control both the strength and timing of gene transcription spanning up to thousands of bases from the initiation site. This complexity makes rational fine-tuning of promoters in fungi difficult to predict; however, this very same complexity enables multiple possible strategies for engineering promoter strength. Here, we studied promoter architecture in the oleaginous yeast, Yarrowia lipolytica. While recent studies have focused on upstream activating sequences, we systematically examined various components common in fungal promoters. Here, we examine several promoter components including upstream activating sequences, proximal promoter sequences, core promoters, and the TATA box in autonomously replicating expression plasmids and integrated into the genome. Our findings show that promoter strength can be fine-tuned through the engineering of the TATA box sequence, core promoter, and upstream activating sequences. Additionally, we identified a previously unreported oleic acid responsive transcription enhancement in the XPR2 upstream activating sequences, which illustrates the complexity of fungal promoters. The promoters engineered here provide new genetic tools for metabolic engineering in Y. lipolytica and provide promoter engineering strategies that may be useful in engineering other non-model fungal systems.

Determination of the promoter region of mouse ribosomal RNA gene by an in vitro transcription system.

PubMed Central

Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M

1984-01-01

Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants

PubMed Central

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B.; Tóth, Gábor; Ortutay, Csaba P.; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21 061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically. PMID:15608291

DoOP: Databases of Orthologous Promoters, collections of clusters of orthologous upstream sequences from chordates and plants.

PubMed

Barta, Endre; Sebestyén, Endre; Pálfy, Tamás B; Tóth, Gábor; Ortutay, Csaba P; Patthy, László

2005-01-01

DoOP (http://doop.abc.hu/) is a database of eukaryotic promoter sequences (upstream regions) aiming to facilitate the recognition of regulatory sites conserved between species. The annotated first exons of human and Arabidopsis thaliana genes were used as queries in BLAST searches to collect the most closely related orthologous first exon sequences from Chordata and Viridiplantae species. Up to 3000 bp DNA segments upstream from these first exons constitute the clusters in the chordate and plant sections of the Database of Orthologous Promoters. Release 1.0 of DoOP contains 21,061 chordate clusters from 284 different species and 7548 plant clusters from 269 different species. The database can be used to find and retrieve promoter sequences of a given gene from various species and it is also suitable to see the most trivial conserved sequence blocks in the orthologous upstream regions. Users can search DoOP with either sequence or text (annotation) to find promoter clusters of various genes. In addition to the sequence data, the positions of the conserved sequence blocks derived from multiple alignments, the positions of repetitive elements and the positions of transcription start sites known from the Eukaryotic Promoter Database (EPD) can be viewed graphically.

Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography

PubMed Central

Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.

2013-01-01

Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564

Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

PubMed

Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

1989-10-05

We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Osteoblast-specific transcription factor Osterix (Osx) is an upstream regulator of Satb2 during bone formation.

PubMed

Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi

2011-09-23

Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

PubMed

Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

2008-04-30

The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

Bed load tracer mobility in a mixed bedrock/alluvial channel

NASA Astrophysics Data System (ADS)

Ferguson, R. I.; Sharma, B. P.; Hodge, R. A.; Hardy, R. J.; Warburton, J.

2017-04-01

The presence of bare or partially covered rock in an otherwise alluvial river implies a downstream change in transport capacity relative to supply. Field investigations of this change and what causes it are lacking. We used two sets of magnet-tagged tracer clasts to investigate bed load transport during the same sequence of floods in fully alluvial, bare rock, and partial-cover reaches of an upland stream. High-flow shear stresses in different reaches were calculated by using stage loggers. Tracers seeded in the upstream alluvial channel moved more slowly than elsewhere until the frontrunners reached bare rock and sped up. Tracers seeded on bare rock moved rapidly off it and accumulated just upstream from, and later in, a partial-cover zone with many boulders. The backwater effect of the boulder-rich zone is significant in reducing tracer mobility. Tracer movement over full or partial sediment cover was size selective but dispersion over bare rock was not. Along-channel changes in tracer mobility are interpreted in terms of measured differences in shear stress and estimated differences in threshold stress.

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae).

PubMed

Kim, Seong Ryeol; Kim, Man Il; Hong, Mee Yeon; Kim, Kee Young; Kang, Pil Don; Hwang, Jae Sam; Han, Yeon Soo; Jin, Byung Rae; Kim, Iksoo

2009-09-01

The 15,338-bp long complete mitochondrial genome (mitogenome) of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae) was determined. This genome has a gene arrangement identical to those of all other sequenced lepidopteran insects, but differs from the most common type, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA(Ile). No typical start codon of the A. yamamai COI gene is available. Instead, a tetranucleotide, TTAG, which is found at the beginning context of all sequenced lepidopteran insects was tentatively designated as the start codon for A. yamamai COI gene. Three of the 13 protein-coding genes (PCGs) harbor the incomplete termination codon, T or TA. All tRNAs formed stable stem-and-loop structures, with the exception of tRNA(Ser)(AGN), the DHU arm of which formed a simple loop as has been observed in many other metazoan mt tRNA(Ser)(AGN). The 334-bp long A + T-rich region is noteworthy in that it harbors tRNA-like structures, as has also been seen in the A + T-rich regions of other insect mitogenomes. Phylogenetic analyses of the available species of Bombycoidea, Pyraloidea, and Tortricidea bolstered the current morphology-based hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As has been previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (A. yamamai and Caligula boisduvalii) formed a reciprocal monophyletic group.

Identification of a Novel Transcript and Regulatory Mechanism for Microsomal Triglyceride Transfer Protein

PubMed Central

Suzuki, Takashi; Brown, Judy J.; Swift, Larry L.

2016-01-01

Microsomal triglyceride transfer protein (MTP) is essential for the assembly of triglyceride-rich apolipoprotein B-containing lipoproteins. Previous studies in our laboratory identified a novel splice variant of MTP in mice that we named MTP-B. MTP-B has a unique first exon (1B) located 2.7 kB upstream of the first exon (1A) for canonical MTP (MTP-A). The two mature isoforms, though nearly identical in sequence and function, have different tissue expression patterns. In this study we report the identification of a second MTP splice variant (MTP-C), which contains both exons 1B and 1A. MTP-C is expressed in all the tissues we tested. In cells transfected with MTP-C, protein expression was less than 15% of that found when the cells were transfected with MTP-A or MTP-B. In silico analysis of the 5’-UTR of MTP-C revealed seven ATGs upstream of the start site for MTP-A, which is the only viable start site in frame with the main coding sequence. One of those ATGs was located in the 5’-UTR for MTP-A. We generated reporter constructs in which the 5’-UTRs of MTP-A or MTP-C were inserted between an SV40 promoter and the coding sequence of the luciferase gene and transfected these constructs into HEK 293 cells. Luciferase activity was significantly reduced by the MTP-C 5’-UTR, but not by the MTP-A 5’-UTR. We conclude that alternative splicing plays a key role in regulating MTP expression by introducing unique 5’-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP levels and activity. PMID:26771188

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

The yeast DNA ligase gene CDC9 is controlled by six orientation specific upstream activating sequences that respond to cellular proliferation but which alone cannot mediate cell cycle regulation.

PubMed Central

White, J H; Johnson, A L; Lowndes, N F; Johnston, L H

1991-01-01

By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644

Simian virus 40 major late promoter: an upstream DNA sequence required for efficient in vitro transcription.

PubMed Central

Brady, J; Radonovich, M; Thoren, M; Das, G; Salzman, N P

1984-01-01

We have previously identified an 11-base DNA sequence, 5'-G-G-T-A-C-C-T-A-A-C-C-3' (simian virus 40 [SV40] map position 294 to 304), which is important in the control of SV40 late RNA expression in vitro and in vivo (Brady et al., Cell 31:625-633, 1982). We report here the identification of another domain of the SV40 late promoter. A series of mutants with deletions extending from SV40 map position 0 to 300 was prepared by nuclease BAL 31 treatment. The cloned templates were then analyzed for efficiency and accuracy of late SV40 RNA expression in the Manley in vitro transcription system. Our studies showed that, in addition to the promoter domain near map position 300, there are essential DNA sequences between nucleotide positions 74 and 95 that are required for efficient expression of late SV40 RNA. Included in this SV40 DNA sequence were two of the six GGGCGG SV40 repeat sequences and an 11-nucleotide segment which showed strong homology with the upstream sequences required for the efficient in vitro and in vivo expression of the histone H2A gene. This upstream promoter sequence supported transcription with the same efficiency even when it was moved 72 nucleotides closer to the major late cap site. In vitro promoter competition analysis demonstrated that the upstream promoter sequence, independent of the 294 to 304 promoter element, is capable of binding polymerase-transcription factors required for SV40 late gene transcription. Finally, we show that DNA sequences which control the specificity of RNA initiation at nucleotide 325 lie downstream of map position 294. Images PMID:6321950

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, J.; Liu, C.; Koopman, W.J.

Ligation of the Fas cell-surface molecule induces apoptosis. Defective Fas-mediated apoptosis has been associated with spontaneous autoimmunity in mice. Using human Fas/Apo-1 cDNA as a probe, the authors have molecularly cloned and characterized the human Fas chromosomal gene. The gene consists of nine exons and spans more than 26 kilobases of DNA. The lengths of introns vary from > 14 kilobases at the 5` end of the gene to 152 base pairs upstream of the exon encoding the transmembrane domain. The domain structure of the human Fas is encoded by an exon or a set of exons. Primer extension analysismore » revealed three major transcription initiation sites. The promoter region lacked canonical {open_quotes}TATA{close_quotes} and {open_quotes}CAAT{close_quotes} boxes but was a {open_quotes}GC-rich{close_quotes} sequence, and contained consensus sequences for AP-1, GF-1, NY-Y, CP-2, EBP20, and c-myb. These data provide the first characterization of the human Fas gene and insight into its regulatory region. 54 refs., 3 figs., 1 tab.« less

Virtual Genome Walking across the 32 Gb Ambystoma mexicanum genome; assembling gene models and intronic sequence.

PubMed

Evans, Teri; Johnson, Andrew D; Loose, Matthew

2018-01-12

Large repeat rich genomes present challenges for assembly using short read technologies. The 32 Gb axolotl genome is estimated to contain ~19 Gb of repetitive DNA making an assembly from short reads alone effectively impossible. Indeed, this model species has been sequenced to 20× coverage but the reads could not be conventionally assembled. Using an alternative strategy, we have assembled subsets of these reads into scaffolds describing over 19,000 gene models. We call this method Virtual Genome Walking as it locally assembles whole genome reads based on a reference transcriptome, identifying exons and iteratively extending them into surrounding genomic sequence. These assemblies are then linked and refined to generate gene models including upstream and downstream genomic, and intronic, sequence. Our assemblies are validated by comparison with previously published axolotl bacterial artificial chromosome (BAC) sequences. Our analyses of axolotl intron length, intron-exon structure, repeat content and synteny provide novel insights into the genic structure of this model species. This resource will enable new experimental approaches in axolotl, such as ChIP-Seq and CRISPR and aid in future whole genome sequencing efforts. The assembled sequences and annotations presented here are freely available for download from https://tinyurl.com/y8gydc6n . The software pipeline is available from https://github.com/LooseLab/iterassemble .

Docking and molecular dynamics simulations of the Fyn-SH3 domain with free and phospholipid bilayer-associated 18.5-kDa myelin basic protein (MBP)-Insights into a noncanonical and fuzzy interaction.

PubMed

Bessonov, Kyrylo; Vassall, Kenrick A; Harauz, George

2017-07-01

The molecular details of the association between the human Fyn-SH3 domain, and the fragment of 18.5-kDa myelin basic protein (MBP) spanning residues S38-S107 (denoted as xα2-peptide, murine sequence numbering), were studied in silico via docking and molecular dynamics over 50-ns trajectories. The results show that interaction between the two proteins is energetically favorable and heavily dependent on the MBP proline-rich region (P93-P98) in both aqueous and membrane environments. In aqueous conditions, the xα2-peptide/Fyn-SH3 complex adopts a "sandwich"-like structure. In the membrane context, the xα2-peptide interacts with the Fyn-SH3 domain via the proline-rich region and the β-sheets of Fyn-SH3, with the latter wrapping around the proline-rich region in a form of a clip. Moreover, the simulations corroborate prior experimental evidence of the importance of upstream segments beyond the canonical SH3-ligand. This study thus provides a more-detailed glimpse into the context-dependent interaction dynamics and importance of the β-sheets in Fyn-SH3 and proline-rich region of MBP. Proteins 2017; 85:1336-1350. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Molecular cloning and functional characterization of the promoter region of the human uncoupling protein-2 gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U

1999-11-19

As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.

The immunoglobulin heavy chain locus of the duck. Genomic organization and expression of D, J, and C region genes.

PubMed

Lundqvist, M L; Middleton, D L; Hazard, S; Warr, G W

2001-12-14

The region of the duck IgH locus extending from upstream of the proximal diversity (D) segment to downstream of the constant gene cluster has been cloned and mapped. A sequence contig of 48,796 base pairs established that the organization of the genes is D-J(H)-mu-alpha-upsilon. No evidence for a functional homologue (or remnant) of a delta gene was found. The alpha gene is in inverted transcriptional orientation; class switch to IgA expression thus requires inversion of the approximately 27-kilobase pair region that includes both mu and alpha genes. The secreted forms of duck alpha and mu are each encoded by 4 constant region exons, and the hydrophobic C-terminal regions of the membrane receptor forms of alpha and mu are encoded by one and two transmembrane exons, respectively. Putative switch (S) regions were identified for duck mu and upsilon by comparison with chicken Smu and Supsilon sequences and for duck alpha by comparison with mouse Salpha. The duck IgH locus is rich in complex variable number tandem repeats, which occupy approximately 60% of the sequenced region, and occur at a much higher frequency in the IgH locus than in other sequenced regions of the duck genome.

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

PubMed

Trotta, Edoardo

2016-05-17

The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

Immediate changes in stream channel geomorphology, aquatic habitat, and fish assemblages following dam removal in a small upland catchment

NASA Astrophysics Data System (ADS)

Magilligan, F. J.; Nislow, K. H.; Kynard, B. E.; Hackman, A. M.

2016-01-01

Dam removal is becoming an increasingly important component of river restoration, with > 1100 dams having been removed nationwide over the past three decades. Despite this recent progression of removals, the lack of pre- to post-removal monitoring and assessment limits our understanding of the magnitude, rate, and sequence of geomorphic and/or ecological recovery to dam removal. Taking advantage of the November 2012 removal of an old ( 190 year-old) 6-m high, run-of-river industrial dam on Amethyst Brook (26 km2) in central Massachusetts, we identify the immediate eco-geomorphic responses to removal. To capture the geomorphic responses to dam removal, we collected baseline data at multiple scales, both upstream ( 300 m) and downstream (> 750 m) of the dam, including monumented cross sections, detailed channel-bed longitudinal profiles, embeddedness surveys, and channel-bed grain size measurements, which were repeated during the summer of 2013. These geomorphic assessments were combined with detailed quantitative electrofishing surveys of stream fish richness and abundance above and below the dam site and throughout the watershed and visual surveys of native anadromous sea lamprey (Petromyzon marinus) nest sites. Post-removal assessments were complicated by two events: (1) upstream knickpoint migration exhumed an older (ca. late eighteenth century) intact wooden crib dam 120 m upstream of the former stone dam, and (2) the occurrence of a 10-20 year RI flood 6 months after removal that caused further upstream incision and downstream aggradation. Now that the downstream reach has been reconnected to upstream sediment supply, the predominant geomorphic response was bed aggradation and associated fining (30-60% reduction). At dam proximal locations, aggradation ranged from 0.3 to > 1 m where a large woody debris jam enhanced aggradation. Although less pronounced, distal locations still showed aggradation with a mean depth of deposition of 0.20 m over the 750-m downstream reach. Post-removal, but pre-flood, bed surveys indicate 2 m of incision had migrated 25 m upstream of the former reservoir before encountering the exhumed dam, which now acts as the new grade control, limiting progressive headcutting. Approximately 1000 m3 of sediment was evacuated in the first year, with 67% of the volume occurring by pre-flood, process-driven (e.g., changes in base level) controls. The combination of changes in channel-bed sedimentology, the occurrence of a large magnitude flood, and the emergence of the new crib dam that is a likely barrier to fish movement was associated with major reductions in abundance and richness in sites downstream and immediately upstream adjacent to the former dam in post-removal sampling. At the same time, we documented the presence of four species of fish, including sea lamprey, which were not present above the dam prior to removal, indicating that upstream passage has been achieved; and we also documented lamprey spawning activity at sites immediately below the dam, which had previously been unsuitable owing to an excessively coarse and armored riverbed. Our results point to the importance of interactions between dam removal and flood disturbance effects, with important implications for short- and long-term monitoring and assessment of dam impacts to river systems.

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Identification and characterization of novel and potent transcription promoters of Francisella tularensis.

PubMed

Zaide, Galia; Grosfeld, Haim; Ehrlich, Sharon; Zvi, Anat; Cohen, Ofer; Shafferman, Avigdor

2011-03-01

Two alternative promoter trap libraries, based on the green fluorescence protein (gfp) reporter and on the chloramphenicol acetyltransferase (cat) cassette, were constructed for isolation of potent Francisella tularensis promoters. Of the 26,000 F. tularensis strain LVS gfp library clones, only 3 exhibited visible fluorescence following UV illumination and all appeared to carry the bacterioferritin promoter (Pbfr). Out of a total of 2,000 chloramphenicol-resistant LVS clones isolated from the cat promoter library, we arbitrarily selected 40 for further analysis. Over 80% of these clones carry unique F. tularensis DNA sequences which appear to drive a wide range of protein expression, as determined by specific chloramphenicol acetyltransferase (CAT) Western dot blot and enzymatic assays. The DNA sequence information for the 33 unique and novel F. tularensis promoters reported here, along with the results of in silico and primer extension analyses, suggest that F. tularensis possesses classical Escherichia coli σ(70)-related promoter motifs. These motifs include the -10 (TATAAT) and -35 [TTGA(C/T)A] domains and an AT-rich region upstream from -35, reminiscent of but distinct from the E. coli upstream region that is termed the UP element. The most efficient promoter identified (Pbfr) appears to be about 10 times more potent than the F. tularensis groEL promoter and is probably among the strongest promoters in F. tularensis. The battery of promoters identified in this work will be useful, among other things, for genetic manipulation in the background of F. tularensis intended to gain better understanding of the mechanisms involved in pathogenesis and virulence, as well as for vaccine development studies.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Growth rate regulation of Escherichia coli acetyl coenzyme A carboxylase, which catalyzes the first committed step of lipid biosynthesis.

PubMed Central

Li, S J; Cronan, J E

1993-01-01

Acetyl coenzyme A (CoA) carboxylase catalyzes the synthesis of malonyl-CoA, the first intermediate of fatty acid synthesis. The Escherichia coli enzyme is encoded by four subunits located at three different positions on the E. coli chromosome. The accBC genes lie in a small operon at min 72, whereas accA and accD are located at min 4.3 and 50, respectively. We examined the expression of the genes that encode the E. coli acetyl-CoA carboxylase subunits (accA, accBC, and accD) under a variety of growth conditions by quantitative Northern (RNA) blot analysis. We found a direct correlation between the levels of transcription of the acc genes and the rate of cellular growth. Consistent results were also obtained upon nutritional upshift and downshift experiments and upon dilution of stationary-phase cultures into fresh media. We also determined the 5' end of the accA and accD mRNAs by primer extension and did transcriptional fusion analysis of the previously reported accBC promoter. Several interesting features were found in the promoter regions of these genes, including a bent DNA sequence and an open reading frame within the unusually long leader mRNA of the accBC operon, potential stem-loop structures in the accA and accD mRNA leader regions, and a stretch of GC-rich sequences followed by AT-rich sequences common to all three promoters. In addition, both accA and accD are located in complex gene clusters. For example, the accA promoter was localized within the upstream polC gene (which encodes the DNA polymerase III catalytic subunit), suggesting that additional regulatory mechanisms exist. Images PMID:7678242

Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.

PubMed

Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E

2001-06-01

Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.

Flow of wormlike micellar solutions around confined microfluidic cylinders.

PubMed

Zhao, Ya; Shen, Amy Q; Haward, Simon J

2016-10-26

Wormlike micellar (WLM) solutions are frequently used in enhanced oil and gas recovery applications in porous rock beds where complex microscopic geometries result in mixed flow kinematics with strong shear and extensional components. Experiments with WLM solutions through model microfluidic porous media have revealed a variety of complex flow phenomena, including the formation of stable gel-like structures known as a Flow-Induced Structured Phase (FISP), which undoubtedly play an important role in applications of WLM fluids, but are still poorly understood. A first step in understanding flows of WLM fluids through porous media can be made by examining the flow around a single micro-scale cylinder aligned on the flow axis. Here we study flow behavior of an aqueous WLM solution consisting of cationic surfactant cetyltrimethylammonium bromide (CTAB) and a stable hydrotropic salt 3-hydroxy naphthalene-2-carboxylate (SHNC) in microfluidic devices with three different cylinder blockage ratios, β. We observe a rich sequence of flow instabilities depending on β as the Weissenberg number (Wi) is increased to large values while the Reynolds number (Re) remains low. Instabilities upstream of the cylinder are associated with high stresses in fluid that accelerates into the narrow gap between the cylinder and the channel wall; vortex growth upstream is reminiscent of that seen in microfluidic contraction geometries. Instability downstream of the cylinder is associated with stresses generated at the trailing stagnation point and the resulting flow modification in the wake, coupled with the onset of time-dependent flow upstream and the asymmetric division of flow around the cylinder.

The genomic structure of the human UFO receptor.

PubMed

Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W

1993-02-01

Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.

The complete mitochondrial genome of the pink stem borer, Sesamia inferens, in comparison with four other Noctuid moths.

PubMed

Chai, Huan-Na; Du, Yu-Zhou

2012-01-01

The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif "ATAGA" followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite "(AT)(7)", without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae.

The Complete Mitochondrial Genome of the Pink Stem Borer, Sesamia inferens, in Comparison with Four Other Noctuid Moths

PubMed Central

Chai, Huan-Na; Du, Yu-Zhou

2012-01-01

The complete 15,413-bp mitochondrial genome (mitogenome) of Sesamia inferens (Walker) (Lepidoptera: Noctuidae) was sequenced and compared with those of four other noctuid moths. All of the mitogenomes analyzed displayed similar characteristics with respect to gene content, genome organization, nucleotide comparison, and codon usages. Twelve-one protein-coding genes (PCGs) utilized the standard ATN, but the cox1 gene used CGA as the initiation codon; cox1, cox2, and nad4 genes had the truncated termination codon T in the S. inferens mitogenome. All of the tRNA genes had typical cloverleaf secondary structures except for trnS1(AGN), in which the dihydrouridine (DHU) arm did not form a stable stem-loop structure. Both the secondary structures of rrnL and rrnS genes inferred from the S. inferens mitogenome closely resembled those of other noctuid moths. In the A+T-rich region, the conserved motif “ATAGA” followed by a long T-stretch was observed in all noctuid moths, but other specific tandem-repeat elements were more variable. Additionally, the S. inferens mitogenome contained a potential stem-loop structure, a duplicated 17-bp repeat element, a decuplicated segment, and a microsatellite “(AT)7”, without a poly-A element upstream of the trnM in the A+T-rich region. Finally, the phylogenetic relationships were reconstructed based on amino acid sequences of mitochondrial 13 PCGs, which support the traditional morphologically based view of relationships within the Noctuidae. PMID:22949858

Lactose/whey utilization and ethanol production by transformed Saccharomyces cerevisiae cells.

PubMed

Porro, D; Martegani, E; Ranzi, B M; Alberghina, L

1992-04-05

Strains of Saccharomyces cerevisiae transformed with a multicopy expression vector bearing both the Escherichia coli beta-galactosidase gene under the control of the upstream activating sequence of the GAL1-10 genes and the GAL4 activator gene release part of beta-galactosidase in the growth medium. This release is due to cell lysis of the older mother cells; the enzyme maintains its activity in buffered growth media. Fermentation studies with transformed yeast strains showed that the release of beta-galactosidase allowed an efficient growth on buffered media containing lactose as carbon source as well as on whey-based media. The transformed strains utilized up to 95% of the lactose and a high growth yield was obtained in rich media. High productions of ethanol were also observed in stationary phase after growth in lactose minimal media.

Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

PubMed Central

Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

1982-01-01

The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

Core histone genes of Giardia intestinalis: genomic organization, promoter structure, and expression

PubMed Central

Yee, Janet; Tang, Anita; Lau, Wei-Ling; Ritter, Heather; Delport, Dewald; Page, Melissa; Adam, Rodney D; Müller, Miklós; Wu, Gang

2007-01-01

Background Giardia intestinalis is a protist found in freshwaters worldwide, and is the most common cause of parasitic diarrhea in humans. The phylogenetic position of this parasite is still much debated. Histones are small, highly conserved proteins that associate tightly with DNA to form chromatin within the nucleus. There are two classes of core histone genes in higher eukaryotes: DNA replication-independent histones and DNA replication-dependent ones. Results We identified two copies each of the core histone H2a, H2b and H3 genes, and three copies of the H4 gene, at separate locations on chromosomes 3, 4 and 5 within the genome of Giardia intestinalis, but no gene encoding a H1 linker histone could be recognized. The copies of each gene share extensive DNA sequence identities throughout their coding and 5' noncoding regions, which suggests these copies have arisen from relatively recent gene duplications or gene conversions. The transcription start sites are at triplet A sequences 1–27 nucleotides upstream of the translation start codon for each gene. We determined that a 50 bp region upstream from the start of the histone H4 coding region is the minimal promoter, and a highly conserved 15 bp sequence called the histone motif (him) is essential for its activity. The Giardia core histone genes are constitutively expressed at approximately equivalent levels and their mRNAs are polyadenylated. Competition gel-shift experiments suggest that a factor within the protein complex that binds him may also be a part of the protein complexes that bind other promoter elements described previously in Giardia. Conclusion In contrast to other eukaryotes, the Giardia genome has only a single class of core histone genes that encode replication-independent histones. Our inability to locate a gene encoding the linker histone H1 leads us to speculate that the H1 protein may not be required for the compaction of Giardia's small and gene-rich genome. PMID:17425802

Arabidopsis intragenomic conserved noncoding sequence

PubMed Central

Thomas, Brian C.; Rapaka, Lakshmi; Lyons, Eric; Pedersen, Brent; Freeling, Michael

2007-01-01

After the most recent tetraploidy in the Arabidopsis lineage, most gene pairs lost one, but not both, of their duplicates. We manually inspected the 3,179 retained gene pairs and their surrounding gene space still present in the genome using a custom-made viewer application. The display of these pairs allowed us to define intragenic conserved noncoding sequences (CNSs), identify exon annotation errors, and discover potentially new genes. Using a strict algorithm to sort high-scoring pair sequences from the bl2seq data, we created a database of 14,944 intragenomic Arabidopsis CNSs. The mean CNS length is 31 bp, ranging from 15 to 285 bp. There are ≈1.7 CNSs associated with a typical gene, and Arabidopsis CNSs are found in all areas around exons, most frequently in the 5′ upstream region. Gene ontology classifications related to transcription, regulation, or “response to …” external or endogenous stimuli, especially hormones, tend to be significantly overrepresented among genes containing a large number of CNSs, whereas protein localization, transport, and metabolism are common among genes with no CNSs. There is a 1.5% overlap between these CNSs and the 218,982 putative RNAs in the Arabidopsis Small RNA Project database, allowing for two mismatches. These CNSs provide a unique set of noncoding sequences enriched for function. CNS function is implied by evolutionary conservation and independently supported because CNS-richness predicts regulatory gene ontology categories. PMID:17301222

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

PubMed

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

Differences in sedge fen vegetation upstream and downstream from a managed impoundment

USGS Publications Warehouse

Kowalski, Kurt P.; Wilcox, Douglas A.

2003-01-01

The U.S. Fish and Wildlife Service proposed the restoration of wetlands impacted by a series of drainage ditches and pools located in an extensive undeveloped peatland in the Seney National Wildlife Refuge, Michigan. This study examined the nature and extent of degradation to the Marsh Creek wetlands caused by alteration of natural hydrology by a water-storage pool (C-3 Pool) that intersects the Marsh Creek channel. We tested the hypothesis that a reduction in moderate-intensity disturbance associated with natural water-level fluctuations below the C-3 dike contributed to lower species richness, reduced floristic quality and a larger tree and shrub component than vegetation upstream from the pool. Wetland plant communities were sampled quantitatively and analyzed for species richness, floristic quality and physiognomy. Aerial photographs, GIS databases and GPS data contributed to the characterization and analysis of the Marsh Creek wetlands. Results showed that there was lower species richness in vegetated areas downstream from the pool, but not the anticipated growth in shrubs. Wetland vegetation upstream and downstream from the pool had similar floristic quality, except for a greater number of weedy taxa above the pool. Seepage through the pool dike and localized ground-water discharge created conditions very similar to those observed around beaver dams in Marsh Creek. In essence, the dike containing the C-3 Pool affected hydrology and wetland plant communities in a manner similar to an enormous beaver dam, except that it did not allow seasonal flooding episodes to occur. Management actions to release water from the pool into the original Marsh Creek channel at certain times and in certain amounts that mimic the natural flow regime would be expected to promote greater plant species richness and minimize the negative impacts of the dike.

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

Special AT-rich sequence binding protein 1 promotes tumor growth and metastasis of esophageal squamous cell carcinoma.

PubMed

Ma, Jun; Wu, Kaiming; Zhao, Zhenxian; Miao, Rong; Xu, Zhe

2017-03-01

Esophageal squamous cell carcinoma is one of the most aggressive malignancies worldwide. Special AT-rich sequence binding protein 1 is a nuclear matrix attachment region binding protein which participates in higher order chromatin organization and tissue-specific gene expression. However, the role of special AT-rich sequence binding protein 1 in esophageal squamous cell carcinoma remains unknown. In this study, western blot and quantitative real-time polymerase chain reaction analysis were performed to identify differentially expressed special AT-rich sequence binding protein 1 in a series of esophageal squamous cell carcinoma tissue samples. The effects of special AT-rich sequence binding protein 1 silencing by two short-hairpin RNAs on cell proliferation, migration, and invasion were assessed by the CCK-8 assay and transwell assays in esophageal squamous cell carcinoma in vitro. Special AT-rich sequence binding protein 1 was significantly upregulated in esophageal squamous cell carcinoma tissue samples and cell lines. Silencing of special AT-rich sequence binding protein 1 inhibited the proliferation of KYSE450 and EC9706 cells which have a relatively high level of special AT-rich sequence binding protein 1, and the ability of migration and invasion of KYSE450 and EC9706 cells was distinctly suppressed. Special AT-rich sequence binding protein 1 could be a potential target for the treatment of esophageal squamous cell carcinoma and inhibition of special AT-rich sequence binding protein 1 may provide a new strategy for the prevention of esophageal squamous cell carcinoma invasion and metastasis.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

PubMed

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Water withdrawals reduce native fish diversity across the sunbelt of the US

NASA Astrophysics Data System (ADS)

Sabo, J. L.; Bowling, L. C.; Roath, J.; Sinha, T.; Kominoski, J.; Fuller, P.

2012-12-01

Water withdrawals for urban, industrial and agricultural uses are known to have negative effects on freshwater biodiversity, but this conclusion is based largely on a small number of place based studies. In this talk we will present results from a continental scale analysis of water withdrawals on the species richness of native and non-native fishes in the coterminous US. To do this we compiled data from the USGS on water withdrawals and the species richness of non-native fishes. We obtained data on the native fish species richness from NatureServe's native fish database. We also compiled spatial data on cropland area and urban impervious surfaces. Finally, we used gridded estimates of streamflow from the Variable Infiltration Capacity model and a routing model to estimate streamflow (less upstream water withdrawal). We estimate the water stress index (WSI) as withdrawals standardized by streamflow (local and upstream deliveries) and use this as a metric of sustainability of human water use. All data were compiled at the spatial resolution of 8-digit hydrologic unit code hydrologic accounting units. Our key finding is that human water use (WSI)--and not impervious surfaces or cropland area--has a strong negative effect on native, but not non-native biodiversity in rivers. This result was robust across the US sunbelt but weaker across the coterminous US. Our result suggests that the effects of cities and farms on native freshwater fauna are outweighed by the upstream and cross-basin extraction of water to support these land uses.

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.

PubMed

Joshee, N; Kisaka, H; Kitagawa, Y

1998-01-01

One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Identification of a second flagellin gene and functional characterization of a sigma70-like promoter upstream of a Leptospira borgpetersenii flaB gene.

PubMed

Lin, Min; Dan, Hanhong; Li, Yijing

2004-02-01

Leptospira borgpetersenii, one of the causative agents of leptospirosis in both animals and humans, is a bacterial pathogen with characteristic motility that is mediated by the rotation of two periplasmic flagella (PF). The flaB gene coding for a core polypeptide subunit of PF was previously characterized by sequence analysis of its open reading frame (ORF) (M. Lin, J Biochem Mol Biol Biophys 2:181-187, 1999). The present study was undertaken to isolate and clone the uncharacterized sequence upstream of the flaB gene by using a PCR-based genome walking procedure. This has resulted in a 1470-bp genomic DNA sequence in which an 846-bp ORF coding for a 281-amino acid polypeptide (31.3 kDa) is identified 455 bp upstream from the flaB start codon. The encoded protein exhibits 72% amino acid identity to the deduced FlaB protein sequence of L. borgpetersenii and a high degree of sequence homology to the FlaB proteins of other spirochaetes. This has demonstrated for the first time that a second flaB gene homolog is present in a Leptospira species. The newly identified gene is designated flaB1, and the previously cloned flaB renamed flaB2. Within the intergenic sequence between flaB1 and flaB2, a potential stem-loop structure (12-bp inverted repeats) was identified 25 bp downstream of the flaB1 stop codon; this could serve as a transcription terminator for the flaB1 mRNA. Three E. coli-like promoter regions (I, II, and III) for binding Esigma(70), a regulatory sequence uncommonly found in flagellar genes, were predicted upstream of the flaB2 ORF. Only promoter region II contains a promoter that is functional in E. coli, as revealed at phenotypic and transcriptional levels by its capability of directing the expression of the chloramphenicol acetyltransferase (CAT) gene in the promoter probe vector pKK232-8. These observations may suggest that flaB1 and flaB2 are transcribed separately and do not form a transcriptional operon controlled by a single promoter.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

PubMed

Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

2016-02-01

It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

Piloted rich-catalytic lean-burn hybrid combustor

DOEpatents

Newburry, Donald Maurice

2002-01-01

A catalytic combustor assembly which includes, an air source, a fuel delivery means, a catalytic reactor assembly, a mixing chamber, and a means for igniting a fuel/air mixture. The catalytic reactor assembly is in fluid communication with the air source and fuel delivery means and has a fuel/air plenum which is coated with a catalytic material. The fuel/air plenum has cooling air conduits passing therethrough which have an upstream end. The upstream end of the cooling conduits is in fluid communication with the air source but not the fuel delivery means.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

Functional identification and regulatory analysis of Δ6-fatty acid desaturase from the oleaginous fungus Mucor sp. EIM-10.

PubMed

Jiang, Xianzhang; Liu, Hongjiao; Niu, Yongchao; Qi, Feng; Zhang, Mingliang; Huang, Jianzhong

2017-03-01

To enlarge the diversity of the desaturases associated with PUFA biosynthesis and to better understand the transcriptional regulation of desaturases, a Δ 6 -desaturase gene (Md6) from Mucor sp. and its 5'-upstream sequence was functionally identified in Saccharomyces cerevisiae. Expression of the Δ 6 -fatty acid desaturase (Md6) in S. cerevisiae showed that Md6 could convert linolenic acid to γ-linolenic acid. Computational analysis of the promoter of Md6 suggested it contains several eukaryotic fundamental transcription regulatory elements. In vivo functional analysis of the promoter showed the 5'-upstream sequence of Md6 could initiate expression of GFP and Md6 itself in S. cerevisiae. A series deletion analysis of the promoter suggested that sequence between -919 to -784 bp (relative to start site) named as eMd6 is the key factor for high activity of Δ 6 -desaturase. The activity of Δ 6 -desaturase was increased by 2.8-fold and 2.5-fold when the eMd6 sequence was placed upstream of -434 with forward or reverse orientations respectively. To our best knowledge, the native promoter of Md6 from Mucor is the strongest promoter for Δ 6 -desaturase reported so far and the sequence between -919 to -784 bp is an enhancer for Δ 6 -desaturase activity.

Cloning and sequence analysis of the LEU2 homologue gene from Pichia anomala.

PubMed

De la Rosa, J M; Pérez, J A; Gutiérrez, F; González, J M; Ruiz, T; Rodríguez, L

2001-11-01

The Pichia anomala LEU2 gene (PaLEU2) was isolated by complementation of a leu2 Saccharomyces cerevisiae mutant. The cloned gene also allowed growth of a Escherichia coli leuB mutant in leucine-lacking medium, indicating that it encodes a product able to complement the beta-isopropylmalate dehydrogenase deficiency of the mutants. The sequenced DNA fragment contains a complete ORF of 1092 bp, and the deduced polypeptide shares significant homologies with the products of the LEU2 genes from S. cerevisiae (84% identity) and other yeast species. A sequence resembling the GC-rich palindrome motif identified in the 5' region of S. cerevisiae LEU2 gene as the binding site for the transcription activating factor encoded by the LEU3 gene was found at the promoter region. In addition, upstream of the PaLEU2 the 3'-terminal half of a gene of the same orientation, encoding a homologue of the S. cerevisiae NFS1/SPL1 gene that encodes a mitochondrial cysteine desulphurase involved in both tRNA processing and mitochondrial metabolism, was found. The genomic organization of the PaNFS1-PaLEU2 gene pair is similar to that found in several other yeast species, including S. cerevisiae and Candida albicans, except that in some of them the LEU2 gene appears in the reverse orientation. Copyright 2001 John Wiley & Sons, Ltd.

Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

PubMed Central

Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

2011-01-01

Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

DNA sequence requirements for the accurate transcription of a protein-coding plastid gene in a plastid in vitro system from mustard (Sinapis alba L.)

PubMed Central

Link, Gerhard

1984-01-01

A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Hormone-induced modifications of the chromatin structure surrounding upstream regulatory regions conserved between the mouse and rabbit whey acidic protein genes.

PubMed Central

Millot, Benjamin; Montoliu, Lluís; Fontaine, Marie-Louise; Mata, Teresa; Devinoy, Eve

2003-01-01

The upstream regulatory regions of the mouse and rabbit whey acidic protein (WAP) genes have been used extensively to target the efficient expression of foreign genes into the mammary gland of transgenic animals. Therefore both regions have been studied to elucidate fully the mechanisms controlling WAP gene expression. Three DNase I-hypersensitive sites (HSS0, HSS1 and HSS2) have been described upstream of the rabbit WAP gene in the lactating mammary gland and correspond to important regulatory regions. These sites are surrounded by variable chromatin structures during mammary-gland development. In the present study, we describe the upstream sequence of the mouse WAP gene. Analysis of genomic sequences shows that the mouse WAP gene is situated between two widely expressed genes (Cpr2 and Ramp3). We show that the hypersensitive sites found upstream of the rabbit WAP gene are also detected in the mouse WAP gene. Further, they encompass functional signal transducer and activator of transcription 5-binding sites, as has been observed in the rabbit. A new hypersensitive site (HSS3), not specific to the mammary gland, was mapped 8 kb upstream of the rabbit WAP gene. Unlike the three HSSs described above, HSS3 is also detected in the liver, but similar to HSS1, it does not depend on lactogenic hormone treatments during cell culture. The region surrounding HSS3 encompasses a potential matrix attachment region, which is also conserved upstream of the mouse WAP gene and contains a functional transcription factor Ets-1 (E26 transformation-specific-1)-binding site. Finally, we demonstrate for the first time that variations in the chromatin structure are dependent on prolactin alone. PMID:12580766

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

The COUP-TFs compose a family of functionally related transcription factors

PubMed Central

Wang, Lee-Ho; Ing, Nancy H.; Tsai, Sophia Y.; O’Malley, Bert W.; Tsai, Ming-Jer

1991-01-01

The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members of the steroid/thyroid hormone receptor superfamily and function in transcriptional regulation of a wide variety of genes. The COUP-TFs purified from HeLa nuclear extract by COUP-affinity chromatography are composed of multiple Mr forms. The Low Mr COUP-TFs (43,000, 44,000, 46,000, and 47,000 Mr) produce a relatively fast migrating complex (Cl) with DNA in electrophoresis mobility shift assays, while the high Mr forms (66,000, 68,000, 72,000, and 74,000 Mr) produce a slower migrating (C2) complex. The high Mr COUP-TFs were purified by gel filtration chromatography and independently formed the C2 DNA complex, probably acting as dimers. The high Mr forms are indistinguishable from the low Mr COUP-TFs in DNA binding and in enhancement of in vitro transcription from the ovalbumin promoter. The finding of multiple COUP-TF forms led us to clone a second low Mr COUP-TF, “COUP-TF2.” The COUP-TF2 sequence has very strong homology with COUP-TF1. The N-termini of COUP-TF1 and COUP-TF2 are least similar, but both contain glutamine-rich and proline-rich motifs, putative activation domains. PMID:1820218

Exploration of G-quadruplex function in c-Myb gene and its transcriptional regulation by topotecan.

PubMed

Li, Fangyuan; Zhou, Jiang; Xu, Ming; Yuan, Gu

2018-02-01

Our bioinformatics research shows that there are four G-rich sequences (S1-S4) in the upstream region of the transcription start site of c-Myb gene, and we have proved that these sequences have the ability to form G-quadruplex structures. This work mainly focuses on G-quadruplex function, recognition and transcription regulation in c-Myb gene, revealing a novel regulatory element in c-Myb proximal promoter region, and its transcription regulation by G-quadruplex binder. The research has identified that the enhancer effect in c-Myb transcription was primarily affected by the G-quadruplex formed by S1 sequence, and the up-regulation effect may due to the removal of repressive progress of MZF-1 by stabilizing G-quadruplex. Attentions were being paid to the development of G-quadruplex binders for selective recognition, and topotecan was found to have high binding affinity in vitro and could effectively affect the c-Myb transcription activities in cells. The regulation of G-quadruplex with binders in transcriptional, translational levels by Q-RT-PCR and western blot was in expectation of providing a strategy for gene expression modulation. In conclusion, our study revealed a G-quadruplex structure in c-Myb proximal promoter region, which was of great importance in the regulation of c-Myb function. Copyright © 2017 Elsevier B.V. All rights reserved.

Low-head sea lamprey barrier effects on stream habitat and fish communities in the Great Lakes basin

USGS Publications Warehouse

Dodd, H.R.; Hayes, D.B.; Baylis, J.R.; Carl, L.M.; Goldstein, J.D.; McLaughlin, R.L.; Noakes, D.L.G.; Porto, L.M.; Jones, M.L.

2003-01-01

Low-head barriers are used to block adult sea lamprey (Petromyzon marinus) from upstream spawning habitat. However, these barriers may impact stream fish communities through restriction of fish movement and habitat alteration. During the summer of 1996, the fish community and habitat conditions in twenty-four stream pairs were sampled across the Great Lakes basin. Seven of these stream pairs were re-sampled in 1997. Each pair consisted of a barrier stream with a low-head barrier and a reference stream without a low-head barrier. On average, barrier streams were significantly deeper (df = 179, P = 0.0018) and wider (df = 179, P = 0.0236) than reference streams, but temperature and substrate were similar (df = 183, P = 0.9027; df = 179, P = 0.999). Barrier streams contained approximately four more fish species on average than reference streams. However, streams with low-head barriers showed a greater upstream decline in species richness compared to reference streams with a net loss of 2.4 species. Barrier streams also showed a peak in richness directly downstream of the barriers, indicating that these barriers block fish movement upstream. Using S??renson's similarity index (based on presence/absence), a comparison of fish community assemblages above and below low-head barriers was not significantly different than upstream and downstream sites on reference streams (n = 96, P > 0.05), implying they have relatively little effect on overall fish assemblage composition. Differences in the frequency of occurrence and abundance between barrier and reference streams was apparent for some species, suggesting their sensitivity to barriers.

Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

PubMed

Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

2015-03-20

Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

Engineering an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium/Rhodotorula species.

PubMed

Liu, Yanbin; Koh, Chong Mei John; Ngoh, Si Te; Ji, Lianghui

2015-10-26

Rhodosporidium and Rhodotorula are two genera of oleaginous red yeast with great potential for industrial biotechnology. To date, there is no effective method for inducible expression of proteins and RNAs in these hosts. We have developed a luciferase gene reporter assay based on a new codon-optimized LUC2 reporter gene (RtLUC2), which is flanked with CAR2 homology arms and can be integrated into the CAR2 locus in the nuclear genome at >90 % efficiency. We characterized the upstream DNA sequence of a D-amino acid oxidase gene (DAO1) from R. toruloides ATCC 10657 by nested deletions. By comparing the upstream DNA sequences of several putative DAO1 homologs of Basidiomycetous fungi, we identified a conserved DNA motif with a consensus sequence of AGGXXGXAGX11GAXGAXGG within a 0.2 kb region from the mRNA translation initiation site. Deletion of this motif led to strong mRNA transcription under non-inducing conditions. Interestingly, DAO1 promoter activity was enhanced about fivefold when the 108 bp intron 1 was included in the reporter construct. We identified a conserved CT-rich motif in the intron with a consensus sequence of TYTCCCYCTCCYCCCCACWYCCGA, deletion or point mutations of which drastically reduced promoter strength under both inducing and non-inducing conditions. Additionally, we created a selection marker-free DAO1-null mutant (∆dao1e) which displayed greatly improved inducible gene expression, particularly when both glucose and nitrogen were present in high levels. To avoid adding unwanted peptide to proteins to be expressed, we converted the original translation initiation codon to ATC and re-created a translation initiation codon at the start of exon 2. This promoter, named P DAO1-in1m1 , showed very similar luciferase activity to the wild-type promoter upon induction with D-alanine. The inducible system was tunable by adjusting the levels of inducers, carbon source and nitrogen source. The intron 1-containing DAO1 promoters coupled with a DAO1 null mutant makes an efficient and tight D-amino acid-inducible gene expression system in Rhodosporidium and Rhodotorula genera. The system will be a valuable tool for metabolic engineering and enzyme expression in these yeast hosts.

Building a dictionary for genomes: Identification of presumptive regulatory sites by statistical analysis

PubMed Central

Bussemaker, Harmen J.; Li, Hao; Siggia, Eric D.

2000-01-01

The availability of complete genome sequences and mRNA expression data for all genes creates new opportunities and challenges for identifying DNA sequence motifs that control gene expression. An algorithm, “MobyDick,” is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words. This method is applicable to any set of DNA sequences: for example, all upstream regions in a genome or all genes expressed under certain conditions. Identification of words is based on a probabilistic segmentation model in which the significance of longer words is deduced from the frequency of shorter ones of various lengths, eliminating the need for a separate set of reference data to define probabilities. We have built a dictionary with 1,200 words for the 6,000 upstream regulatory regions in the yeast genome; the 500 most significant words (some with as few as 10 copies in all of the upstream regions) match 114 of 443 experimentally determined sites (a significance level of 18 standard deviations). When analyzing all of the genes up-regulated during sporulation as a group, we find many motifs in addition to the few previously identified by analyzing the subclusters individually to the expression subclusters. Applying MobyDick to the genes derepressed when the general repressor Tup1 is deleted, we find known as well as putative binding sites for its regulatory partners. PMID:10944202

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

Komatiites and nickel sulfide ores of the Black Swan area, Yilgarn Craton, Western Australia. 4. Platinum group element distribution in the ores, and genetic implications

NASA Astrophysics Data System (ADS)

Barnes, Stephen J.

2004-11-01

The Black Swan komatiite sequence, in the Eastern Goldfields province of the Archaean Yilgarn Craton in Western Australia, is a body of dominantly olivine-rich cumulates with lesser volumes of spinifex textured rocks, interpreted as a section through an extensive komatiite lava flow field. The sequence hosts a number of nickel sulfide orebodies, including the Silver Swan massive shoot and the Cygnet and Black Swan disseminated orebodies. The massive sulfide orebodies of the Black Swan Succession are pervasively depleted in all platinum group elements (PGEs), particularly Pt and Pd, despite very high Ni contents. This depletion cannot be explained by R-factor variations, which would also require relatively low Ni tenors. The PGE depletion could be explained in part if the ores are enriched in a monosulfide solid solution (MSS) cumulate component, but requires some additional fractional segregation of sulfide melt upstream from the site of deposition. The Silver Swan orebody shows a remarkably consistent vertical zonation in PGE contents, particularly in Ir, Ru, Rh, Os, which increase systematically from very low levels at the stratigraphic base of the sulfide body to maxima corresponding roughly with the top of a lower layer of the orebody rich in silicate inclusions. Platinum shows the opposite trend, but is somewhat modified by remobilisation during talc carbonate alteration. A similar pattern is also observed in the adjacent White Swan orebody. This zonation is interpreted and modelled as the result of fractional crystallisation of MSS from the molten sulfide pool. The strong IPGE depletion towards the base of the orebody may be a consequence of sulfide liquid crystallisation in an inverted thermal gradient, between a thin rapidly cooling upper rind of komatiite lava and a hot substrate.

Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

PubMed Central

Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

2013-01-01

The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

Sequence Requirements of the 5-Enolpyruvylshikimate-3-phosphate Synthase 5[prime]-Upstream Region for Tissue-Specific Expression in Flowers and Seedlings.

PubMed Central

Benfey, PN; Takatsuji, H; Ren, L; Shah, DM; Chua, NH

1990-01-01

We have analyzed expression from deletion derivatives of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) 5[prime]-upstream region in transgenic petunia flowers and seedlings. In seedlings, expression was strongest in root cortex cells and in trichomes. High-level expression in petals and in seedling roots was conferred by large (>500 base-pair) stretches of sequence, but was lost when smaller fragments were analyzed individually. This apparent requirement for extensive sequence suggests that combinations of cis-elements that are widely separated control tissue-specific expression from the EPSPS promoter. We have also used the high-level, petal-specific expression of the EPSPS promoter to change petal color in two mutant petunia lines. PMID:12354968

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Shifting patterns of nitrogen excretion and amino acid catabolism capacity during the life cycle of the sea lamprey (Petromyzon marinus).

PubMed

Wilkie, Michael P; Claude, Jaime F; Cockshutt, Amanda; Holmes, John A; Wang, Yuxiang S; Youson, John H; Walsh, Patrick J

2006-01-01

The jawless fish, the sea lamprey (Petromyzon marinus), spends part of its life as a burrow-dwelling, suspension-feeding larva (ammocoete) before undergoing a metamorphosis into a free swimming, parasitic juvenile that feeds on the blood of fishes. We predicted that animals in this juvenile, parasitic stage have a great capacity for catabolizing amino acids when large quantities of protein-rich blood are ingested. The sixfold to 20-fold greater ammonia excretion rates (J(Amm)) in postmetamorphic (nonfeeding) and parasitic lampreys compared with ammocoetes suggested that basal rates of amino acid catabolism increased following metamorphosis. This was likely due to a greater basal amino acid catabolizing capacity in which there was a sixfold higher hepatic glutamate dehydrogenase (GDH) activity in parasitic lampreys compared with ammocoetes. Immunoblotting also revealed that GDH quantity was 10-fold and threefold greater in parasitic lampreys than in ammocoetes and upstream migrant lampreys, respectively. Higher hepatic alanine and aspartate aminotransferase activities in the parasitic lampreys also suggested an enhanced amino acid catabolizing capacity in this life stage. In contrast to parasitic lampreys, the twofold larger free amino acid pool in the muscle of upstream migrant lampreys confirmed that this period of natural starvation is accompanied by a prominent proteolysis. Carbamoyl phosphate synthetase III was detected at low levels in the liver of parasitic and upstream migrant lampreys, but there was no evidence of extrahepatic (muscle, intestine) urea production via the ornithine urea cycle. However, detection of arginase activity and high concentrations of arginine in the liver at all life stages examined infers that arginine hydrolysis is an important source of urea. We conclude that metamorphosis is accompanied by a metabolic reorganization that increases the capacity of parasitic sea lampreys to catabolize intermittently large amino acid loads arising from the ingestion of protein rich blood from their prey/hosts. The subsequent generation of energy-rich carbon skeletons can then be oxidized or retained for glycogen and fatty acid synthesis, which are essential fuels for the upstream migratory and spawning phases of the sea lamprey's life cycle.

B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

PubMed Central

Selinger, David A.; Chandler, Vicki L.

2001-01-01

The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

Two alternative ways of start site selection in human norovirus reinitiation of translation.

PubMed

Luttermann, Christine; Meyers, Gregor

2014-04-25

The calicivirus minor capsid protein VP2 is expressed via termination/reinitiation. This process depends on an upstream sequence element denoted termination upstream ribosomal binding site (TURBS). We have shown for feline calicivirus and rabbit hemorrhagic disease virus that the TURBS contains three sequence motifs essential for reinitiation. Motif 1 is conserved among caliciviruses and is complementary to a sequence in the 18 S rRNA leading to the model that hybridization between motif 1 and 18 S rRNA tethers the post-termination ribosome to the mRNA. Motif 2 and motif 2* are proposed to establish a secondary structure positioning the ribosome relative to the start site of the terminal ORF. Here, we analyzed human norovirus (huNV) sequences for the presence and importance of these motifs. The three motifs were identified by sequence analyses in the region upstream of the VP2 start site, and we showed that these motifs are essential for reinitiation of huNV VP2 translation. More detailed analyses revealed that the site of reinitiation is not fixed to a single codon and does not need to be an AUG, even though this codon is clearly preferred. Interestingly, we were able to show that reinitiation can occur at AUG codons downstream of the canonical start/stop site in huNV and feline calicivirus but not in rabbit hemorrhagic disease virus. Although reinitiation at the original start site is independent of the Kozak context, downstream initiation exhibits requirements for start site sequence context known for linear scanning. These analyses on start codon recognition give a more detailed insight into this fascinating mechanism of gene expression.

Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

USDA-ARS?s Scientific Manuscript database

Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

Distribution and abundance of stream fishes in relation to barriers: implications for monitoring stream recovery after barrier removal

USGS Publications Warehouse

Zydlewski, Joseph D.; Coghlan, Stephen M.; Gardner, C.; Saunders, R.

2011-01-01

Dams are ubiquitous in coastal regions and have altered stream habitats and the distribution and abundance of stream fishes in those habitats by disrupting hydrology, temperature regime and habitat connectivity. Dam removal is a common restoration tool, but often the response of the fish assemblage is not monitored rigorously. Sedgeunkedunk Stream, a small tributary to the Penobscot River (Maine, USA), has been the focus of a restoration effort that includes the removal of two low-head dams. In this study, we quantified fish assemblage metrics along a longitudinal gradient in Sedgeunkedunk Stream and also in a nearby reference stream. By establishing pre-removal baseline conditions and associated variability and the conditions and variability immediately following removal, we can characterize future changes in the system associated with dam removal. Over 2 years prior to dam removal, species richness and abundance in Sedgeunkedunk Stream were highest downstream of the lowest dam, lowest immediately upstream of that dam and intermediate farther upstream; patterns were similar in the reference stream. Although seasonal and annual variation in metrics within each site was substantial, the overall upstream-to-downstream pattern along the stream gradient was remarkably consistent prior to dam removal. Immediately after dam removal, we saw significant decreases in richness and abundance downstream of the former dam site and a corresponding increase in fish abundance upstream of the former dam site. No such changes occurred in reference sites. Our results show that by quantifying baseline conditions in a small stream before restoration, the effects of stream restoration efforts on fish assemblages can be monitored successfully. These data set the stage for the long-term assessment of Sedgeunkedunk Stream and provide a simple methodology for assessment in other restoration projects.

Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

PubMed Central

2014-01-01

Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

Mutational Analysis of the TnrA-Binding Sites in the Bacillus subtilis nrgAB and gabP Promoter Regions

PubMed Central

Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.

1998-01-01

Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors.

PubMed

Jamsari, Amirul Firdaus Jamaluddin; Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and F(ST) revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area.

Genetic structure of the snakehead murrel, Channa striata (channidae) based on the cytochrome c oxidase subunit I gene: Influence of historical and geomorphological factors

PubMed Central

Jamaluddin, Jamsari Amirul Firdaus; Pau, Tan Min; Siti-Azizah, Mohd Nor

2011-01-01

Nucleotide sequences of a partial cytochrome c oxidase subunit I gene were used to assess the manner in which historical processes and geomorphological effects may have influenced genetic structuring and phylogeographic patterns in Channa striata. Assaying was based on individuals from twelve populations in four river systems, which were separated into two regions, the eastern and western, of the biodiversely rich state of Perak in central Peninsular Malaysia. In 238 specimens, a total of 368-bp sequences with ten polymorphic sites and eleven unique haplotypes were detected. Data on all the twelve populations revealed incomplete divergence due to past historical coalescence and the short period of separation. Nevertheless, SAMOVA and FST revealed geographical structuring existed to a certain extent in both regions. For the eastern region, the data also showed that the upstream populations were genetically significantly different compared to the mid- and downstream ones. It is inferred that physical barriers and historical processes played a dominant role in structuring the genetic dispersal of the species. A further inference is that the Grik, Tanjung Rambutan and Sungkai are potential candidates for conservation and aquaculture programmes since they contained most of the total diversity in this area. PMID:21637559

Motility Determinants in WASP Family ProteinsD⃞

PubMed Central

Yarar, Defne; D'Alessio, Joseph A.; Jeng, Robert L.; Welch, Matthew D.

2002-01-01

In response to upstream signals, proteins in the Wiskott-Aldrich Syndrome protein (WASP) family regulate actin nucleation via the Arp2/3 complex. Despite intensive study of the function of WASP family proteins in nucleation, it is not yet understood how their distinct structural organization contributes to actin-based motility. Herein, we analyzed the activities of WASP and Scar1 truncation derivatives by using a bead-based motility assay. The minimal region of WASP sufficient to direct movement was the C-terminal WCA fragment, whereas the corresponding region of Scar1 was insufficient. In addition, the proline-rich regions of WASP and Scar1 and the Ena/VASP homology 1 (EVH1) domain of WASP independently enhanced motility rates. The contributions of these regions to motility could not be accounted for by their direct effects on actin nucleation with the Arp2/3 complex, suggesting that they stimulate motility by recruiting additional factors. We have identified profilin as one such factor. WASP- and Scar1-coated bead motility rates were significantly reduced by depletion of profilin and VASP and could be more efficiently rescued by a combination of VASP and wild-type profilin than by VASP and a mutant profilin that cannot bind proline-rich sequences. Moreover, motility of WASP WCA beads was not affected by the depletion or addback of VASP and profilin. Our results suggest that recruitment of factors, including profilin, by the proline-rich regions of WASP and Scar1 and the EVH1 domain of WASP stimulates cellular actin-based motility. PMID:12429845

Characterization and expression analysis of Toll-like receptor 3 cDNA from Atlantic salmon (Salmo salar).

PubMed

Vidal, R; González, R; Gil, F

2015-06-10

Innate pathway activation is fundamental for early anti-viral defense in fish, but currently there is insufficient understanding of how salmonid fish identify viral molecules and activate these pathways. The Toll-like receptor (TLR) is believed to play a crucial role in host defense of pathogenic microbes in the innate immune system. In the present study, the full-length cDNA of Salmo salar TLR3 (ssTLR3) was cloned. The ssTLR3 cDNA sequence was 6071 bp long, containing an open reading frame of 2754 bp and encoding 971 amino acids. The TLR group motifs, such as leucine-rich repeat (LRR) domains and Toll-interleukin-1 receptor (TIR) domains, were maintained in ssTLR3, with sixteen LRR domains and one TIR domain. In contrast to descriptions of the TLR3 in rainbow trout and the murine (TATA-less), we found a putative TATA box in the proximal promoter region 29 bp upstream of the transcription start point of ssTLR3. Multiple-sequence alignment analysis of the ssTLR3 protein-coding sequence with other known TLR3 sequences showed the sequence to be conserved among all species analyzed, implying that the function of the TLR3 had been sustained throughout evolution. The ssTLR3 mRNA expression patterns were measured using real-time PCR. The results revealed that TLR3 is widely expressed in various healthy tissues. Individuals challenged with infectious pancreatic necrosis virus and immunostimulated with polyinosinic:polycytidylic acid exhibited increased expression of TLR3 at the mRNA level, indicating that ssTLR3 may be involved in pathogen recognition in the early innate immune system.

Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river

PubMed Central

Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

2013-01-01

Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47–48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. PMID:23520129

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

Nuclear accumulation of the Arabidopsis immune receptor RPS4 is necessary for triggering EDS1-dependent defense.

PubMed

Wirthmueller, Lennart; Zhang, Yan; Jones, Jonathan D G; Parker, Jane E

2007-12-04

Recognition of specific pathogen molecules inside the cell by nucleotide-binding domain and leucine-rich repeat (NB-LRR) receptors constitutes an important layer of innate immunity in plants. Receptor activation triggers host cellular reprogramming involving transcriptional potentiation of basal defenses and localized programmed cell death. The sites and modes of action of NB-LRR receptors are, however, poorly understood. Arabidopsis Toll/Interleukin-1 (TIR) type NB-LRR receptor RPS4 recognizes the bacterial type III effector AvrRps4. We show that epitope-tagged RPS4 expressed under its native regulatory sequences distributes between endomembranes and nuclei in healthy and AvrRps4-triggered tissues. RPS4 accumulation in the nucleus, mediated by a bipartite nuclear localization sequence (NLS) at its C terminus, is necessary for triggering immunity through authentic activation by AvrRps4 in Arabidopsis or as an effector-independent "deregulated" receptor in tobacco. A strikingly conserved feature of TIR-NB-LRR receptors is their recruitment of the nucleocytoplasmic basal-defense regulator EDS1 in resistance to diverse pathogens. We find that EDS1 is an indispensable component of RPS4 signaling and that it functions downstream of RPS4 activation but upstream of RPS4-mediated transcriptional reprogramming in the nucleus.

Occurrence of polycyclic aromatic hydrocarbons below coal-tar-sealed parking lots and effects on stream benthic macroinvertebrate communities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scoggins, M.; McClintock, N.L.; Gosselink, L.

2007-12-15

Parking-lot pavement sealants recently have been recognized as a major source of polycyclic aromatic hydrocarbons (PAHs) in urban stream sediments in Austin, Texas. Laboratory and field studies have shown that PAHs in sediments can be toxic to aquatic organisms and can degrade aquatic communities. After identifying increases in concentrations of PAHs in sediments below seal-coated parking lots, we investigated whether the increases had significant effects on stream biota in 5 Austin streams. We sampled sediment chemistry and biological communities above and below the point at which stormwater runoff from the parking lots discharged into the streams, thus providing 5 upstreammore » reference sites and 5 downstream treatment sites. Differences between upstream and downstream concentrations of total PAH ranged from 3.9 to 32 mg/kg. Analysis of the species occurrence data from pool and riffle habitats indicated a significant decrease in community health at the downstream sites, including decreases in richness, intolerant taxa, Diptera taxa, and density. In pool sediments, Chironomidae density was negatively correlated with PAH concentrations, whereas Oligochaeta density responded positively to PAH concentrations. In general, pool taxa responded more strongly than riffle taxa to PAHs, but riffle taxa responded more broadly than pool taxa. Increases in PAH sediment-toxicity units between upstream and downstream sites explained decreases in taxon richness and density in pools between upstream and downstream sites.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Macrolide resistance in Legionella pneumophila: the role of LpeAB efflux pump.

PubMed

Massip, Clémence; Descours, Ghislaine; Ginevra, Christophe; Doublet, Patricia; Jarraud, Sophie; Gilbert, Christophe

2017-05-01

A previous study on 12 in vitro -selected azithromycin-resistant Legionella pneumophila lineages showed that ribosomal mutations were major macrolide resistance determinants. In addition to these mechanisms that have been well described in many species, mutations upstream of lpeAB operon, homologous to acrAB in Escherichia coli , were identified in two lineages. In this study, we investigated the role of LpeAB and of these mutations in macrolide resistance of L. pneumophila . The role of LpeAB was studied by testing the antibiotic susceptibility of WT, deleted and complemented L. pneumophila Paris strains. Translational fusion experiments using GFP as a reporter were conducted to investigate the consequences of the mutations observed in the upstream sequence of lpeAB operon. We demonstrated the involvement of LpeAB in an efflux pump responsible for a macrolide-specific reduced susceptibility of L. pneumophila Paris strain. Mutations in the upstream sequence of lpeAB operon were associated with an increased protein expression. Increased expression was also observed under sub-inhibitory macrolide concentrations in strains with both mutated and WT promoting regions. LpeAB are components of an efflux pump, which is a macrolide resistance determinant in L. pneumophila Paris strain. Mutations observed in the upstream sequence of lpeAB operon in resistant lineages led to an overexpression of this efflux pump. Sub-inhibitory concentrations of macrolides themselves participated in upregulating this efflux and could constitute a first step in the acquisition of a high macrolide resistance level. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Myostatin-2 gene structure and polymorphism of the promoter and first intron in the marine fish Sparus aurata: evidence for DNA duplications and/or translocations.

PubMed

Nadjar-Boger, Elisabeth; Funkenstein, Bruria

2011-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily that functions as a negative regulator of skeletal muscle development and growth in mammals. Fish express at least two genes for MSTN: MSTN-1 and MSTN-2. To date, MSTN-2 promoters have been cloned only from salmonids and zebrafish. Here we described the cloning and sequence analysis of MSTN-2 gene and its 5' flanking region in the marine fish Sparus aurata (saMSTN-2). We demonstrate the existence of three alleles of the promoter and three alleles of the first intron. Sequence comparison of the promoter region in the three alleles revealed that although the sequences of the first 1050 bp upstream of the translation start site are almost identical in the three alleles, a substantial sequence divergence is seen further upstream. Careful sequence analysis of the region upstream of the first 1050 bp in the three alleles identified several elements that appear to be repeated in some or all sequences, at different positions. This suggests that the promoter region of saMSTN-2 has been subjected to various chromosomal rearrangements during the course of evolution, reflecting either insertion or deletion events. Screening of several genomic DNA collections indicated differences in allele frequency, with allele 'b' being the most abundant, followed by allele 'c', whereas allele 'a' is relatively rare. Sequence analysis of saMSTN-2 gene also revealed polymorphism in the first intron, identifying three alleles. The length difference in alleles '1R' and '2R' of the first intron is due to the presence of one or two copies of a repeated block of approximately 150 bp, located at the 5' end of the first intron. The third allele, '4R', has an additional insertion of 323 bp located 116 bp upstream of the 3' end of the first intron. Analysis of several DNA collections showed that the '2R' allele is the most common, followed by the '4R' allele, whereas the '1R' allele is relatively rare. Progeny analysis of a full-sib family showed a Mendelian mode of inheritance of the two genetic loci. No clear association was found between the two genetic markers and growth rate. These results show for the first time a substantial degree of polymorphism in both the promoter and first intron of MSTN-2 gene in a perciform fish species which points to chromosomal rearrangements that took place during evolution.

LuFLA1PRO and LuBGAL1PRO promote gene expression in the phloem fibres of flax (Linum usitatissimum).

PubMed

Hobson, Neil; Deyholos, Michael K

2013-04-01

Cell type-specific promoters were identified that drive gene expression in an industrially important product. To identify flax (Linum usitatissimum) gene promoters, we analyzed the genomic regions upstream of a fasciclin-like arabinogalactan protein (LuFLA1) and a beta-galactosidase (LuBGAL1). Both of these genes encode transcripts that have been found to be highly enriched in tissues bearing phloem fibres. Using a beta-glucuronidase (GUS) reporter construct, we found that a 908-bp genomic sequence upstream of LuFLA1 (LuFLA1PRO) directed GUS expression with high specificity to phloem fibres undergoing secondary cell wall development. The DNA sequence upstream of LuBGAL1 (LuBGAL1PRO) likewise produced GUS staining in phloem fibres with developing secondary walls, as well as in tissues of developing flowers and seed bolls. These data provide further evidence of a specific role for LuFLA1 in phloem fibre development, and demonstrate the utility of LuFLA1PRO and LuBGAL1PRO as tools for biotechnology and further investigations of phloem fibre development.

Parasite fauna of Etheostoma nigrum (Percidae: Etheostomatinae) in localities of varying pollution stress in the St. Lawrence River, Quebec, Canada.

PubMed

Krause, Rachel J; McLaughlin, J Daniel; Marcogliese, David J

2010-07-01

Parasite communities were examined in johnny darters (Etheostoma nigrum) collected from five localities in the St. Lawrence River in southwestern Quebec: two reference localities, one polluted locality upstream of the Island of Montreal and downstream of industrial and agricultural activity, and two polluted localities downstream of the Island of Montreal in the plume from the wastewater treatment facility. Twenty-four helminth species were found. Fish from the upstream polluted locality had the highest parasite species richness and total parasite numbers, and fish from the downstream polluted localities the lowest. Nonmetric multivariate analyses were conducted using square-root-transformed Bray-Curtis dissimilarity index. An analysis of similarity, dendrogram of centroids, and a permutational multivariate analysis of variance with contrasts all showed that fish from the reference localities had different parasite community composition than those from the polluted localities, and fish from the upstream polluted locality had different parasite communities than fish from the downstream polluted localities. Differences between reference and polluted localities were mainly due to higher abundances of the brain-encysting trematode, Ornithodiplostomum sp., at the reference localities. Differences between upstream and downstream polluted localities were mainly due to a higher diversity and abundance of trematodes in fish at the upstream locality.

Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

PubMed

Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

2007-05-01

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

Transcription elongation rate has a tissue-specific impact on alternative cleavage and polyadenylation in Drosophila melanogaster.

PubMed

Liu, Xiaochuan; Freitas, Jaime; Zheng, Dinghai; Oliveira, Marta S; Hoque, Mainul; Martins, Torcato; Henriques, Telmo; Tian, Bin; Moreira, Alexandra

2017-12-01

Alternative polyadenylation (APA) is a mechanism that generates multiple mRNA isoforms with different 3'UTRs and/or coding sequences from a single gene. Here, using 3' region extraction and deep sequencing (3'READS), we have systematically mapped cleavage and polyadenylation sites (PASs) in Drosophila melanogaster , expanding the total repertoire of PASs previously identified for the species, especially those located in A-rich genomic sequences. Cis -element analysis revealed distinct sequence motifs around fly PASs when compared to mammalian ones, including the greater enrichment of upstream UAUA elements and the less prominent presence of downstream UGUG elements. We found that over 75% of mRNA genes in Drosophila melanogaster undergo APA. The head tissue tends to use distal PASs when compared to the body, leading to preferential expression of APA isoforms with long 3'UTRs as well as with distal terminal exons. The distance between the APA sites and intron location of PAS are important parameters for APA difference between body and head, suggesting distinct PAS selection contexts. APA analysis of the RpII215 C4 mutant strain, which harbors a mutant RNA polymerase II (RNAPII) with a slower elongation rate, revealed that a 50% decrease in transcriptional elongation rate leads to a mild trend of more usage of proximal, weaker PASs, both in 3'UTRs and in introns, consistent with the "first come, first served" model of APA regulation. However, this trend was not observed in the head, suggesting a different regulatory context in neuronal cells. Together, our data expand the PAS collection for Drosophila melanogaster and reveal a tissue-specific effect of APA regulation by RNAPII elongation rate. © 2017 Liu et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

HrpW of Erwinia amylovora, a New Harpin That Contains a Domain Homologous to Pectate Lyases of a Distinct Class

PubMed Central

Kim, Jihyun F.; Beer, Steven V.

1998-01-01

Harpins, such as HrpN of Erwinia amylovora, are extracellular glycine-rich proteins that elicit the hypersensitive reaction (HR). We identified hrpW of E. amylovora, which encodes a protein similar to known harpins in that it is acidic, rich in glycine and serine, and lacks cysteine. A putative HrpL-dependent promoter was identified upstream of hrpW, and Western blot analysis of hrpL mutants indicated that the production of HrpW is regulated by hrpL. HrpW is secreted via the Hrp (type III) pathway based on analysis of wild-type strains and hrp secretion mutants. When infiltrated into plants, HrpW induced rapid tissue collapse, which required active plant metabolism. The HR-eliciting activity was heat stable and protease sensitive. Thus, we concluded that HrpW is a new harpin. HrpW of E. amylovora consists of two domains connected by a Pro and Ser-rich sequence. A fragment containing the N-terminal domain was sufficient to elicit the HR. Although no pectate lyase activity was detected, the C-terminal region of HrpW is homologous to pectate lyases of a unique class, suggesting that HrpW may be targeted to the plant cell wall. Southern analysis indicated that hrpW is conserved among several Erwinia species, and hrpW, provided in trans, enhanced the HR-inducing ability of a hrpN mutant. However, HrpW did not increase the virulence of a hrpN mutant in host tissue, and hrpW mutants retained the wild-type ability to elicit the HR in nonhosts and to cause disease in hosts. PMID:9748455

EXONSAMPLER: a computer program for genome-wide and candidate gene exon sampling for targeted next-generation sequencing.

PubMed

Cosart, Ted; Beja-Pereira, Albano; Luikart, Gordon

2014-11-01

The computer program EXONSAMPLER automates the sampling of thousands of exon sequences from publicly available reference genome sequences and gene annotation databases. It was designed to provide exon sequences for the efficient, next-generation gene sequencing method called exon capture. The exon sequences can be sampled by a list of gene name abbreviations (e.g. IFNG, TLR1), or by sampling exons from genes spaced evenly across chromosomes. It provides a list of genomic coordinates (a bed file), as well as a set of sequences in fasta format. User-adjustable parameters for collecting exon sequences include a minimum and maximum acceptable exon length, maximum number of exonic base pairs (bp) to sample per gene, and maximum total bp for the entire collection. It allows for partial sampling of very large exons. It can preferentially sample upstream (5 prime) exons, downstream (3 prime) exons, both external exons, or all internal exons. It is written in the Python programming language using its free libraries. We describe the use of EXONSAMPLER to collect exon sequences from the domestic cow (Bos taurus) genome for the design of an exon-capture microarray to sequence exons from related species, including the zebu cow and wild bison. We collected ~10% of the exome (~3 million bp), including 155 candidate genes, and ~16,000 exons evenly spaced genomewide. We prioritized the collection of 5 prime exons to facilitate discovery and genotyping of SNPs near upstream gene regulatory DNA sequences, which control gene expression and are often under natural selection. © 2014 John Wiley & Sons Ltd.

The conserved upstream region of lscB/C determines expression of different levansucrase genes in plant pathogen Pseudomonas syringae

PubMed Central

2014-01-01

Background Pseudomonas syringae pv. glycinea PG4180 is an opportunistic plant pathogen which causes bacterial blight of soybean plants. It produces the exopolysaccharide levan by the enzyme levansucrase. Levansucrase has three gene copies in PG4180, two of which, lscB and lscC, are expressed while the third, lscA, is cryptic. Previously, nucleotide sequence alignments of lscB/C variants in various P. syringae showed that a ~450-bp phage-associated promoter element (PAPE) including the first 48 nucleotides of the ORF is absent in lscA. Results Herein, we tested whether this upstream region is responsible for the expression of lscB/C and lscA. Initially, the transcriptional start site for lscB/C was determined. A fusion of the PAPE with the ORF of lscA (lscB UpN A) was generated and introduced to a levan-negative mutant of PG4180. Additionally, fusions comprising of the non-coding part of the upstream region of lscB with lscA (lscB Up A) or the upstream region of lscA with lscB (lscA Up B) were generated. Transformants harboring the lscB UpN A or the lscB Up A fusion, respectively, showed levan formation while the transformant carrying lscA Up B did not. qRT-PCR and Western blot analyses showed that lscB UpN A had an expression similar to lscB while lscB Up A had a lower expression. Accuracy of protein fusions was confirmed by MALDI-TOF peptide fingerprinting. Conclusions Our data suggested that the upstream sequence of lscB is essential for expression of levansucrase while the N-terminus of LscB mediates an enhanced expression. In contrast, the upstream region of lscA does not lead to expression of lscB. We propose that lscA might be an ancestral levansucrase variant upstream of which the PAPE got inserted by potentially phage-mediated transposition events leading to expression of levansucrase in P. syringae. PMID:24670199

High-resolution three-dimensional NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation.

PubMed

Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya A; Mergny, Jean-Louis; Salgado, Gilmar F

2017-05-12

Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection

NASA Technical Reports Server (NTRS)

Harada, Kazuo; Orgel, Leslie E.

1993-01-01

We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine–homopyrimidine sequence localized in the vicinity of the promoter

PubMed Central

Soo Shin, Jane Hae

2017-01-01

Abstract Guanine-rich (G-rich) homopurine–homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA–DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA–DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription ‘bursting’) and may also have practical implications for the design of expression vectors. PMID:28498974

Strong transcription blockage mediated by R-loop formation within a G-rich homopurine-homopyrimidine sequence localized in the vicinity of the promoter.

PubMed

Belotserkovskii, Boris P; Soo Shin, Jane Hae; Hanawalt, Philip C

2017-06-20

Guanine-rich (G-rich) homopurine-homopyrimidine nucleotide sequences can block transcription with an efficiency that depends upon their orientation, composition and length, as well as the presence of negative supercoiling or breaks in the non-template DNA strand. We report that a G-rich sequence in the non-template strand reduces the yield of T7 RNA polymerase transcription by more than an order of magnitude when positioned close (9 bp) to the promoter, in comparison to that for a distal (∼250 bp) location of the same sequence. This transcription blockage is much less pronounced for a C-rich sequence, and is not significant for an A-rich sequence. Remarkably, the blockage is not pronounced if transcription is performed in the presence of RNase H, which specifically digests the RNA strands within RNA-DNA hybrids. The blockage also becomes less pronounced upon reduced RNA polymerase concentration. Based upon these observations and those from control experiments, we conclude that the blockage is primarily due to the formation of stable RNA-DNA hybrids (R-loops), which inhibit successive rounds of transcription. Our results could be relevant to transcription dynamics in vivo (e.g. transcription 'bursting') and may also have practical implications for the design of expression vectors. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Reducing DNA context dependence in bacterial promoters

PubMed Central

Carr, Swati B.; Densmore, Douglas M.

2017-01-01

Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

PubMed Central

Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

2001-01-01

Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

PubMed

Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

1994-12-01

We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

Control of rRNA transcription in Escherichia coli.

PubMed Central

Condon, C; Squires, C; Squires, C L

1995-01-01

The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Sense transcription through the S region is essential for immunoglobulin class switch recombination

PubMed Central

Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine

2011-01-01

Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751

Cloning and characterization of the mouse XPAC gene.

PubMed Central

van Oostrom, C T; de Vries, A; Verbeek, S J; van Kreijl, C F; van Steeg, H

1994-01-01

Xeroderma Pigmentosum is a human disease, which is, among others, characterized by a high incidence of (sunlight induced) skin cancer, due to a defect in nucleotide excision repair (NER). The human DNA repair gene XPAC corrects this defect in cells isolated from Xeroderma Pigmentosum complementation group A (XP-A) patients. To enable the development of a transgenic mouse model for XP-A by gene targeting in embryonic stem cells, we cloned and characterized the mouse homologue of the XPAC gene. The mouse XPAC gene was found to consist of 6 exons, spanning approximately 21 kb. The nucleotide sequence of the exons is identical to that of the also cloned the mouse XPAC cDNA. Furthermore, the deduced amino acid sequence of the XPAC protein is the same as the one published previously by Tanaka et al. From CAT assay analysis, the promoter of the XPAC gene appeared to be located within 313 bp upstream of the assumed transcriptional start site. Like the promoters of other eukaryotic DNA repair genes (i.e. ERCC-1 and XPBC/ERCC-3), the mouse XPAC promoter region lacks classical promoter elements like TATA-, GC- and CAAT boxes. However, it contains an unique polypyrimidine-rich box, which is so far only found in genes encoding DNA repair enzymes. The function of this box in the regulation of transcription is still unclear. PMID:8127648

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

Fish-community composition in Canacadea Creek, in the vicinity of Almond Lake, Allegany and Steuben counties, New York, 2000

USGS Publications Warehouse

Brightbill, R.A.; Bilger, Michael D.

2001-01-01

The U.S. Army Corps of Engineers, Baltimore District, has been conducting biological surveys of the inflow and outflow streams of Almond Lake since the early 1980's. These surveys are made to identify possible detrimental effects as well as benefits of the reservoir and to better understand the aquatic communities in the vicinity of the lake at the present and over time. The U.S. Army Corps of Engineers and the U.S. Geological Survey jointly conducted a survey of the fish communities upstream and downstream of the lake in Canacadea Creek in September 2000. The fish communities upstream and downstream were compared and any differences or similarities seen in the communities were noted.This study found the fish communities to be in fair condition upstream and good condition downstream of Almond Lake, with Index of Biotic Integrity (IBI) scores of 3.5 and 5.0, respectively. The habitat conditions of both reaches were of suboptimal quality, with a score of 14 upstream and 15 downstream as determined by use of the U.S. Environmental Protection Agency's (USEPA) Rapid Bioassessment Protocols, and are capable of supporting fish communities. The Shannon Index indicates species richness and evenness and was 1.87 upstream and 3.22 downstream of the lake, indicating the upstream reach is severely impacted and the downstream reach appears to be not impacted. The Jaccards Coefficient and the Index of Similarity statistically show these communities are similar with scores of 0.55 and 0.71, respectively. Of the 12 species captured upstream, 11 of those also were captured downstream along with 8 other species for a total of 19 species downstream.

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river.

PubMed

Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

2013-06-01

Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47-48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. © 2013 The Authors. Microbiology Open published by John Wiley & Sons Ltd.

Refunctionalization of the ancient rice blast disease resistance gene Pit by the recruitment of a retrotransposon as a promoter.

PubMed

Hayashi, Keiko; Yoshida, Hitoshi

2009-02-01

The plant genome contains a large number of disease resistance (R) genes that have evolved through diverse mechanisms. Here, we report that a long terminal repeat (LTR) retrotransposon contributed to the evolution of the rice blast resistance gene Pit. Pit confers race-specific resistance against the fungal pathogen Magnaporthe grisea, and is a member of the nucleotide-binding site leucine-rich repeat (NBS-LRR) family of R genes. Compared with the non-functional allele Pit(Npb), the functional allele Pit(K59) contains four amino acid substitutions, and has the LTR retrotransposon Renovator inserted upstream. Pathogenesis assays using chimeric constructs carrying the various regions of Pit(K59) and Pit(Npb) suggest that amino acid substitutions might have a potential effect in Pit resistance; more importantly, the upregulated promoter activity conferred by the Renovator sequence is essential for Pit function. Our data suggest that transposon-mediated transcriptional activation may play an important role in the refunctionalization of additional 'sleeping' R genes in the plant genome.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Overexpression of the Lactobacillus plantarum peptidoglycan biosynthesis murA2 gene increases the tolerance of Escherichia coli to alcohols and enhances ethanol production.

PubMed

Yuan, Yongbo; Bi, Changhao; Nicolaou, Sergios A; Zingaro, Kyle A; Ralston, Matthew; Papoutsakis, Eleftherios T

2014-10-01

A major challenge in producing chemicals and biofuels is to increase the tolerance of the host organism to toxic products or byproducts. An Escherichia coli strain with superior ethanol and more generally alcohol tolerance was identified by screening a library constructed by randomly integrating Lactobacillus plantarum genomic DNA fragments into the E. coli chromosome via Cre-lox recombination. Sequencing identified the inserted DNA fragment as the murA2 gene and its upstream intergenic 973-bp sequence, both coded on the negative genomic DNA strand. Overexpression of this murA2 gene and its upstream 973-bp sequence significantly enhanced ethanol tolerance in both E. coli EC100 and wild type E. coli MG1655 strains by 4.1-fold and 2.0-fold compared to control strains, respectively. Tolerance to n-butanol and i-butanol in E. coli MG1655 was increased by 1.85-fold and 1.91-fold, respectively. We show that the intergenic 973-bp sequence contains a native promoter for the murA2 gene along with a long 5' UTR (286 nt) on the negative strand, while a noncoding, small RNA, named MurA2S, is expressed off the positive strand. MurA2S is expressed in E. coli and may interact with murA2, but it does not affect murA2's ability to enhance alcohol tolerance in E. coli. Overexpression of murA2 with its upstream region in the ethanologenic E. coli KO11 strain significantly improved ethanol production in cultures that simulate the industrial Melle-Boinot fermentation process.

Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae).

PubMed

Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo

2013-12-01

The larch hawk moth, Sphinx morio, belongs to the lepidopteran family Sphingidae that has long been studied as a family of model insects in a diverse field. In this study, we describe the complete mitochondrial genome (mitogenome) sequences of the species in terms of general genomic features and characteristic short repetitive sequences found in the A + T-rich region. The 15,299-bp-long genome consisted of a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes) and one major non-coding A + T-rich region, with the typical arrangement found in Lepidoptera. The 316-bp-long A + T-rich region located between srRNA and tRNA(Met) harbored the conserved sequence blocks that are typically found in lepidopteran insects. Additionally, the A + T-rich region of S. morio contained three characteristic repeat sequences that are rarely found in Lepidoptera: two identical 12-bp repeat, three identical 5-bp-long tandem repeat, and six nearly identical 5-6 bp long repeat sequences.

End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

PubMed

Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

2015-12-01

Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

NO formation in the burnout region of a partially premixed methane-air flame with upstream heat loss

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mokhov, A.V.; Levinsky, H.B.

Measurements of temperature and NO concentration in laminar, partially premixed methane-air flames stabilized on a ceramic burner in coflow are reported. The NO concentration and temperature were determined by laser-induced fluorescence (LIF) and coherent anti-Stokes Raman scattering (CARS), respectively. Upstream heat loss to the burner was varied by changing the exit velocity of the fuel-air mixture at a constant equivalence ratio of 1,3; this alters the structure of the flame from an axisymmetric Bunsen-type to a strongly stabilized flat flame. To facilitate analysis of the results, a method is derived for separating the effects of dilution from those of chemicalmore » reaction based on the relation between the measured temperature and the local mixture fraction, including the effects of upstream heat loss. Using this method, the amount of NO formed during burnout of the hot, fuel-rich combustion products can be ascertained. In the Bunsen-type flame, it is seen that {approximately}40 ppm of NO are produced in this burnout region, at temperatures between {approximately}2,100 K and {approximately}1,900 K, probably via the Zeldovich mechanism. Reducing the exit velocity of 12 cm/s reduces the flame temperature substantially, and effectively eliminates this contribution. At velocities of 12 and 8 cm/s, {approximately}10 ppm of NO are formed in the burnout region, even though the gas temperatures are too low for Zeldovich NO to be significant. Although the mechanism responsible for these observations is as yet unclear, the results are consistent with the idea that the low temperatures in the fuel-rich gases caused by upstream heat loss retard the conversion of HCN (formed via the Fenimore mechanism) to NO, with this residual HCN then being converted to NO during burnout.« less

Activation of HIV-1 pre-mRNA 3' processing in vitro requires both an upstream element and TAR.

PubMed Central

Gilmartin, G M; Fleming, E S; Oetjen, J

1992-01-01

The architecture of the human immunodeficiency virus type 1 (HIV-1) genome presents an intriguing dilemma for the 3' processing of viral transcripts--to disregard a canonical 'core' poly(A) site processing signal present at the 5' end of the transcript and yet to utilize efficiently an identical signal that resides at the 3' end of the message. The choice of processing sites in HIV-1 appears to be influenced by two factors: (i) proximity to the cap site, and (ii) sequences upstream of the core poly(A) site. We now demonstrate that an in vivo-defined upstream element that resides within the U3 region, 76 nucleotides upstream of the AAUAAA hexamer, acts specifically to enhance 3' processing at the HIV-1 core poly(A) site in vitro. We furthermore show that efficient in vitro 3' processing requires the RNA stem-loop structure of TAR, which serves to juxtapose spatially the upstream element and the core poly(A) site. An analysis of the stability of 3' processing complexes formed at the HIV-1 poly(A) site in vitro suggests that the upstream element may function by increasing processing complex stability at the core poly(A) site. Images PMID:1425577

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.

Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

PubMed Central

Borchert, S; Stachelhaus, T; Marahiel, M A

1994-01-01

The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

Spatiotemporal variation of macroinvertebrates in relation to canopy cover and other environmental factors in Eriora River, Niger Delta, Nigeria.

PubMed

Arimoro, Francis O; Obi-Iyeke, Grace E; Obukeni, Prince J O

2012-10-01

Canopy cover is well known to influence the distribution of macroinvertebrates in temperate streams. Very little is known about how this factor influences stream communities in Afrotropical streams. The effects and possible interactions of environmental factors and canopy cover on macroinvertebrate community structure (abundance, richness, and diversity) were examined in four stations in Eriora River, southern Nigeria bimonthly from May to November 2010. The river supported diverse macroinvertebrates in which the upstream sampling stations with dense canopy cover were dominated by Decapoda, Ephemeroptera, Odonata, Gastropoda, Trichoptera, and Coleoptera while Diptera and Coleoptera were the benthic organisms found predominant at downstream stations with less canopy cover. Some caddisfly species such as Agapetus agilis, Trichosetodes species and the stonefly Neoperla species were present upstream and were found to be potential bioindicators for a clean ecosystem. The blood worm Chironomus species and Tabanus sp. were abundant at the downstream of the river and are considered potential bioindicators for an organically degrading ecosystem. Some environmental factors varied temporally with significantly higher macroinvertebrate abundance and richness in May. We found out that canopy cover and environmental factors affected macroinvertebrates abundance, diversity, and richness and that the individual taxon had varying responses to these factors. These results help identify the mechanisms underlying the effects of canopy cover and other environmental factors on Afrotropical stream invertebrate communities.

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

Long-period oxygen-rich optical Miras in the solar neighborhood

NASA Technical Reports Server (NTRS)

Jura, M.; Yamamoto, A.; Kleinmann, S. G.

1993-01-01

The spatial distribution of the oxygen-rich Miras with periods longer than 400 days in the neighborhood of the sun were determined using available survey and the K-band period luminosity relationship. It is found that the exponential scale height of these stars is near 240 pc. There is a marked contrast between the Mira population at about 1 kpc from the Galactic center where there are nearly as many long-period oxygen-rich Miras as intermediate-period oxygen-rich Miras. It is hypothesized that, at about 1 kpc from the Galactic center, the main sequence stars with masses larger than 1 solar mass have higher metallicities than main-sequence stars with the same masses in the solar neighborhood. In the solar neighborhood such main sequence stars become carbon-rich on the AGB and in the region near the Galactic center they become long-period oxygen-rich Miras.

Fish-community composition in Otselic River, in the vicinity of Whitney Point Lake, Broome and Cortland counties, New York, 2000

USGS Publications Warehouse

Brightbill, R.A.; Bilger, Michael D.

2001-01-01

The U.S. Army Corps of Engineers, Baltimore District, has been conducting biological surveys of the inflow and outflow streams of Whitney Point Lake since the early 1980's. These surveys are made to identify possible detrimental effects as well as benefits of the reservoir and to better understand the aquatic communities in the vicinity of the lake at the present and over time. The U.S. Army Corps of Engineers and the U.S. Geological Survey jointly conducted a survey of the fish communities upstream and downstream of the reservoir in Otselic River in September 2000. The fish communities upstream and downstream were compared and any differences or similarities seen in the communities were noted.This study found the fish communities upstream and downstream of Whitney Point Lake to be in good condition, with Index of Biotic Integrity (IBI) scores 4.3 upstream and 4.5 downstream. The habitat conditions of both reaches were of suboptimal quality, with a score of 15 for both reaches as determined by use of the U.S. Environmental Protection Agency's Rapid Bioassessment Protocols, yet are capable of supporting fish communities. The Shannon Index was 3.83 upstream and 3.16 downstream of the lake, indicating that both reaches are slightly impacted by species richness and lack of individual evenness among the species. The communities also were different from each other. Only 11 of the 21 species upstream were also captured downstream. The Jaccards Coefficient and the Index of Similarity reflect this community difference with scores of 0.39 and 0.56, respectively.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

PubMed

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-04-08

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

VIZARD: analysis of Affymetrix Arabidopsis GeneChip data

NASA Technical Reports Server (NTRS)

Moseyko, Nick; Feldman, Lewis J.

2002-01-01

SUMMARY: The Affymetrix GeneChip Arabidopsis genome array has proved to be a very powerful tool for the analysis of gene expression in Arabidopsis thaliana, the most commonly studied plant model organism. VIZARD is a Java program created at the University of California, Berkeley, to facilitate analysis of Arabidopsis GeneChip data. It includes several integrated tools for filtering, sorting, clustering and visualization of gene expression data as well as tools for the discovery of regulatory motifs in upstream sequences. VIZARD also includes annotation and upstream sequence databases for the majority of genes represented on the Affymetrix Arabidopsis GeneChip array. AVAILABILITY: VIZARD is available free of charge for educational, research, and not-for-profit purposes, and can be downloaded at http://www.anm.f2s.com/research/vizard/ CONTACT: moseyko@uclink4.berkeley.edu.

Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

PubMed Central

Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

2006-01-01

The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-02-15

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed Central

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-01-01

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

Genetic diversity among the Eurytemora affinis species complex in the Scheldt estuary and its tributaries using ISSR-PCR marker assay

NASA Astrophysics Data System (ADS)

Gasmi, S.; Ferval, M.; Pelissier, C.; D'Amico, F.; Maris, T.; Tackx, M.; Legal, L.

2014-05-01

As an estuary being restored, the Scheldt (Belgium/The Netherlands) offers an interesting setting to study the response of organisms and ecosystems to changing conditions. This study specifically deals with this with regard to the spatio-temporal distribution and possible genetic differentiation among the species complex Eurytemora affinis (copepoda, calanoida). Until the 1990s, E. affinis typically occurred downstream the Scheldt estuary (Belgium/The Netherlands). In parallel to water quality improvement, E.affinis has recently also occurred upstream the estuary and in some of the tributaries. This paper aims to assess the origin of the copepod sibling species complex E. affinis occurring upstream the Scheldt estuary through genetic characterization. Using the Inter Simple Sequence Repeat (ISSR) technique, we explored genetic pools of the E. affinis complex in three Scheldt localities (downstream, middle-estuary and upstream) and two of its tributaries. Four ISSR primers produced 75 polymorphic loci. Bayesian and hierarchical analysis revealed different but close genetic entities in both down and upstream localities. The middle-estuary individuals were genetically a composite mix of downstream and upstream populations (84% from downstream and 16% from upstream). A distinctive separation of the tributaries and the main Scheldt stream populations suggests that two fully independent genetic pools are present. It is of note that the tributaries showed a lack of genetic subdivision, that upstream and downstream E. affinis populations are closely related, and that the downstream population is most likely at the origin of the upstream one, which implies the necessity to guarantee sufficient oxygen concentration levels throughout the estuarine continuum to guarantee the presence of this species upstream. The results of the ISSR technique are discussed in comparison with genetic studies on E. affinis using COI barcoding.

Trichomonas vaginalis ribosomal RNA: identification and characterisation of the transcription promoter and terminator sequences.

PubMed

Franco, Bernardo; Hernández, Roberto; López-Villaseñor, Imelda

2012-09-01

Trichomonas vaginalis is a parasitic protozoan of both medical and biological relevance. Transcriptional studies in this organism have focused mainly on type II pol promoters, whereas the elements necessary for transcription by polI or polIII have not been investigated. Here, with the aid of a transient transcription system, we characterised the rDNA intergenic region, defining both the promoter and the terminator sequences required for transcription. We defined the promoter as a compact region of approximately 180 bp. We also identified a potential upstream control element (UCE) that was located 80 bp upstream of the transcription start point (TSP). A transcription termination element was identified within a 34 bp region that was located immediately downstream of the 28S coding sequence. The function of this element depends upon polarity and the presence of both a stretch of uridine residues (U's) and a hairpin structure in the transcript. Our observations provide a strong basis for the study of DNA recognition by the polI transcriptional machinery in this early divergent organism. Copyright © 2012 Elsevier B.V. All rights reserved.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

PubMed

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

NASA Astrophysics Data System (ADS)

Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

2015-02-01

In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

Responses of riparian reptile communities to damming and urbanization

USGS Publications Warehouse

Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

2013-01-01

Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

Translation of the mRNA of the maize transcriptional activator Opaque-2 is inhibited by upstream open reading frames present in the leader sequence.

PubMed Central

Lohmer, S; Maddaloni, M; Motto, M; Salamini, F; Thompson, R D

1993-01-01

The protein encoded by the Opaque-2 (O2) gene is a transcription factor, translated from an mRNA that possesses an unusually long 5' leader sequence containing three upstream open reading frames (uORFs). The efficiency of translation of O2 mRNA has been tested in vivo by a transient assay in which the level of activation of the b32 promoter, a natural target of O2 protein, is measured. We show that uORF-less O2 alleles possess a higher transactivation value than the wild-type allele and that the reduction in transactivation due to the uORFs is a cis-dominant effect. The data presented indicate that both uORF1 and uORF2 are involved in the reducing effect and suggest that both are likely to be translated. PMID:8439744

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Double air-fuel ratio sensor system having double-skip function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katsuno, T.

1988-01-26

A method for controlling the air-fuel ratio in an internal combustion engine is described having a catalyst converter for removing pollutants in the exhaust gas thereof, and upstream-side and downstream-side air-fuel ratio sensors disposed upstream and downstream, respectively, of the catalyst converter for detecting a concentration of a specific component in an exhaust gas, comprising the steps of: comparing the output of the upstream-side air-fuel ratio sensor with a first predetermined value; gradually changing a first air-fuel ratio correction amount in accordance with a result of the comparison of the output of the upstream-side air-fuel ratio sensor with the predeterminedmore » value; shifting the first air-fuel ratio correction amount by a first skip amount during a predetermined time period after the result of the comparison of the upstream-side air-fuel ratio sensor is changed; shifting the first air-fuel ratio correction amount by a second skip amount smaller than the first skip amount after the predetermined time period has passed; comparing the output of the downstream-side air-fuel ratio with a second predetermined value, calculating a second air-fuel ratio correction amount in accordance with the comparison result of the output of the downstream-side air-fuel ratio sensor with the second predetermined value; and adjusting the actual air-fuel ratio in accordance with the first and second air-fuel ratio correction amounts; wherein the gradually-changing step comprises the steps of: gradually decreasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the rich side with respect to the first predetermined value; and gradually increasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the lean side with respect to the first predetermined value.« less

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Determinants of fish assemblage structure in Northwestern Great Plains streams

USGS Publications Warehouse

Mullen, J.A.; Bramblett, R.G.; Guy, C.S.; Zale, A.V.; Roberts, D.W.

2011-01-01

Prairie streams are known for their harsh and stochastic physical conditions, and the fish assemblages therein have been shown to be temporally variable. We assessed the spatial and temporal variation in fish assemblage structure in five intermittent, adventitious northwestern Great Plains streams representing a gradient of watershed areas. Fish assemblages and abiotic conditions varied more spatially than temporally. The most important variables explaining fish assemblage structure were longitudinal position and the proportion of fine substrates. The proportion of fine substrates increased proceeding upstream, approaching 100% in all five streams, and species richness declined upstream with increasing fine substrates. High levels of fine substrate in the upper reaches appeared to limit the distribution of obligate lithophilic fish species to reaches further downstream. Species richness and substrates were similar among all five streams at the lowermost and uppermost sites. However, in the middle reaches, species richness increased, the amount of fine substrate decreased, and connectivity increased as watershed area increased. Season and some dimensions of habitat (including thalweg depth, absolute distance to the main-stem river, and watershed size) were not essential in explaining the variation in fish assemblages. Fish species richness varied more temporally than overall fish assemblage structure did because common species were consistently abundant across seasons, whereas rare species were sometimes absent or perhaps not detected by sampling. The similarity in our results among five streams varying in watershed size and those from other studies supports the generalization that spatial variation exceeds temporal variation in the fish assemblages of prairie and warmwater streams. Furthermore, given longitudinal position, substrate, and stream size, general predictions regarding fish assemblage structure and function in prairie streams are possible. ?? American Fisheries Society 2011.

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Mutations that alter a conserved element upstream of the potato virus X triple block and coat protein genes affect subgenomic RNA accumulation.

PubMed

Kim, K H; Hemenway, C

1997-05-26

The putative subgenomic RNA (sgRNA) promoter regions upstream of the potato virus X (PVX) triple block and coat protein (CP) genes contain sequences common to other potexviruses. The importance of these sequences to PVX sgRNA accumulation was determined by inoculation of Nicotiana tabacum NT1 cell suspension protoplasts with transcripts derived from wild-type and modified PVX cDNA clones. Analyses of RNA accumulation by S1 nuclease digestion and primer extension indicated that a conserved octanucleotide sequence element and the spacing between this element and the start-site for sgRNA synthesis are critical for accumulation of the two major sgRNA species. The impact of mutations on CP sgRNA levels was also reflected in the accumulation of CP. In contrast, genomic minus- and plus-strand RNA accumulation were not significantly affected by mutations in these regions. Studies involving inoculation of tobacco plants with the modified transcripts suggested that the conserved octanucleotide element functions in sgRNA accumulation and some other aspect of the infection process.

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed

Levis, R; Schlesinger, S; Huang, H V

1990-04-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.

Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

PubMed

Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

2015-08-01

Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of Cer-1 cis-regulatory region during early Xenopus development.

PubMed

Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

2011-05-01

Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

Antimicrobial Peptides from Plants

PubMed Central

Tam, James P.; Wang, Shujing; Wong, Ka H.; Tan, Wei Liang

2015-01-01

Plant antimicrobial peptides (AMPs) have evolved differently from AMPs from other life forms. They are generally rich in cysteine residues which form multiple disulfides. In turn, the disulfides cross-braced plant AMPs as cystine-rich peptides to confer them with extraordinary high chemical, thermal and proteolytic stability. The cystine-rich or commonly known as cysteine-rich peptides (CRPs) of plant AMPs are classified into families based on their sequence similarity, cysteine motifs that determine their distinctive disulfide bond patterns and tertiary structure fold. Cystine-rich plant AMP families include thionins, defensins, hevein-like peptides, knottin-type peptides (linear and cyclic), lipid transfer proteins, α-hairpinin and snakins family. In addition, there are AMPs which are rich in other amino acids. The ability of plant AMPs to organize into specific families with conserved structural folds that enable sequence variation of non-Cys residues encased in the same scaffold within a particular family to play multiple functions. Furthermore, the ability of plant AMPs to tolerate hypervariable sequences using a conserved scaffold provides diversity to recognize different targets by varying the sequence of the non-cysteine residues. These properties bode well for developing plant AMPs as potential therapeutics and for protection of crops through transgenic methods. This review provides an overview of the major families of plant AMPs, including their structures, functions, and putative mechanisms. PMID:26580629

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Unlocking hidden genomic sequence

PubMed Central

Keith, Jonathan M.; Cochran, Duncan A. E.; Lala, Gita H.; Adams, Peter; Bryant, Darryn; Mitchelson, Keith R.

2004-01-01

Despite the success of conventional Sanger sequencing, significant regions of many genomes still present major obstacles to sequencing. Here we propose a novel approach with the potential to alleviate a wide range of sequencing difficulties. The technique involves extracting target DNA sequence from variants generated by introduction of random mutations. The introduction of mutations does not destroy original sequence information, but distributes it amongst multiple variants. Some of these variants lack problematic features of the target and are more amenable to conventional sequencing. The technique has been successfully demonstrated with mutation levels up to an average 18% base substitution and has been used to read previously intractable poly(A), AT-rich and GC-rich motifs. PMID:14973330

Heterogeneic dynamics of the structures of multiple gene clusters in two pathogenetically different lines originating from the same phytoplasma.

PubMed

Arashida, Ryo; Kakizawa, Shigeyuki; Hoshi, Ayaka; Ishii, Yoshiko; Jung, Hee-Young; Kagiwada, Satoshi; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou

2008-04-01

Phytoplasmas are phloem-limited plant pathogens that are transmitted by insect vectors and are associated with diseases in hundreds of plant species. Despite their small sizes, phytoplasma genomes have repeat-rich sequences, which are due to several genes that are encoded as multiple copies. These multiple genes exist in a gene cluster, the potential mobile unit (PMU). PMUs are present at several distinct regions in the phytoplasma genome. The multicopy genes encoded by PMUs (herein named mobile unit genes [MUGs]) and similar genes elsewhere in the genome (herein named fundamental genes [FUGs]) are likely to have the same function based on their annotations. In this manuscript we show evidence that MUGs and FUGs do not cluster together within the same clade. Each MUG is in a cluster with a short branch length, suggesting that MUGs are recently diverged paralogs, whereas the origin of FUGs is different from that of MUGs. We also compared the genome structures around the lplA gene in two derivative lines of the 'Candidatus Phytoplasma asteris' OY strain, the severe-symptom line W (OY-W) and the mild-symptom line M (OY-M). The gene organizations of the nucleotide sequences upstream of the lplA genes of OY-W and OY-M were dramatically different. The tra5 insertion sequence, an element of PMUs, was found only in this region in OY-W. These results suggest that transposition of entire PMUs and PMU sections has occurred frequently in the OY phytoplasma genome. The difference in the pathogenicities of OY-W and OY-M might be caused by the duplication and transposition of PMUs, followed by genome rearrangement.

Rich bacterial assemblages from Maritime Antarctica (Potter Cove, South Shetlands) reveal several kinds of endemic and undescribed phylotypes.

PubMed

Landone Vescovo, Ignacio A; Golemba, Marcelo D; Di Lello, Federico A; Culasso, Andrés C A; Levin, Gustavo; Ruberto, Lucas; Mac Cormack, Walter P; López, José L

2014-01-01

Bacterial richness in maritime Antarctica has been poorly described to date. Phylogenetic affiliation of seawater free-living microbial assemblages was studied from three locations near the Argentinean Jubany Station during two Antarctic summers. Sixty 16S RNA cloned sequences were phylogenetically affiliated to Alphaproteobacteria (30/60 clones), Gammaproteobacteria(19/60 clones), Betaproteobacteria and Cytophaga-Flavobacteriia-Bacteroides (CFB), which were (2/60) and (3/60) respectively. Furthermore, six out of 60 clones could not be classified. Both, Alphaproteobacteria and Gammaproteobacteria, showed several endemic and previously undescribed sequences. Moreover, the absence of Cyanobacteria sequences in our samples is remarkable. In conclusion, we are reporting a rich sequence assemblage composed of widely divergent isolates among themselves and distant from the most closely related sequences currently deposited in data banks. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Modulation of tissue repair by regeneration enhancer elements.

PubMed

Kang, Junsu; Hu, Jianxin; Karra, Ravi; Dickson, Amy L; Tornini, Valerie A; Nachtrab, Gregory; Gemberling, Matthew; Goldman, Joseph A; Black, Brian L; Poss, Kenneth D

2016-04-14

How tissue regeneration programs are triggered by injury has received limited research attention. Here we investigate the existence of enhancer regulatory elements that are activated in regenerating tissue. Transcriptomic analyses reveal that leptin b (lepb) is highly induced in regenerating hearts and fins of zebrafish. Epigenetic profiling identified a short DNA sequence element upstream and distal to lepb that acquires open chromatin marks during regeneration and enables injury-dependent expression from minimal promoters. This element could activate expression in injured neonatal mouse tissues and was divisible into tissue-specific modules sufficient for expression in regenerating zebrafish fins or hearts. Simple enhancer-effector transgenes employing lepb-linked sequences upstream of pro- or anti-regenerative factors controlled the efficacy of regeneration in zebrafish. Our findings provide evidence for 'tissue regeneration enhancer elements' (TREEs) that trigger gene expression in injury sites and can be engineered to modulate the regenerative potential of vertebrate organs.

Human Promoters Are Intrinsically Directional

PubMed Central

Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe

2015-01-01

Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469

Mapping contacts between gRNA and mRNA in trypanosome RNA editing.

PubMed

Leung, S S; Koslowsky, D J

1999-02-01

All guide RNAs (gRNAs) identified to date have defined 5' anchor sequences, guiding sequences and a non-encoded 3' uridylate tail. The 5' anchor is required for in vitro editing and is thought to be responsible for selection and binding to the pre-edited mRNA. Little is known, however, about how the gRNAs are used to direct RNA editing. Utilizing the photo-reactive crosslinking agent, azidophenacyl (APA), attached to the 5'- or 3'-terminus of the gRNA, we have begun to map the structural relationships between the different defined regions of the gRNA with the pre-edited mRNA. Analyses of crosslinked conjugates produced with a 5'-terminal APA group confirm that the anchor of the gRNA is correctly positioning the interacting molecules. 3' Crosslinks (X-linker placed at the 3'-end of a U10tail) have also been mapped for three different gRNA/mRNA pairs. In all cases, analyses indicate that the U-tail can interact with a range of nucleotides located upstream of the first edited site. It appears that the U-tail prefers purine-rich sites, close to the first few editing sites. These results suggest that the U-tail may act in concert with the anchor to melt out secondary structure in the mRNA in the immediate editing domain, possibly increasing the accessibility of the editing complex to the proper editing sites.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

PubMed Central

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-01-01

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

Microarray pathway analysis indicated that mitogen-activated protein kinase/extracellular signal-regulated kinase and insulin growth factor 1 signaling pathways were inhibited by small interfering RNA against AT-rich interactive domain 1A in endometrial cancer

PubMed Central

Yang, Ye; Bao, Wei; Sang, Zhengyu; Yang, Yongbing; Lu, Meng; Xi, Xiaowei

2018-01-01

Mutations in the gene encoding AT-rich interactive domain 1A (ARID1A) are frequently observed in endometrial cancer (EC) but the molecular mechanisms linking the genetic changes remain to be fully understood. The present study aimed to elucidate the influence of ARID1A mutations on signaling pathways. Missense, synonymous and nonsense heterozygous ARID1A mutations in the EC HEC-1-A cell line were verified by Sanger sequencing. Mutated ARID1A small interfering RNA was transfected into HEC-1-A cells. Biochemical microarray analysis revealed 13 upregulated pathways, 17 downregulated pathways, 14 significantly affected disease states and functions, 662 upstream and 512 downstream genes in mutated ARID1A-depleted HEC-1-A cells, among which the mitogen-activated protein kinase/extracellular signal-regulated kinase and insulin-like growth factor-1 (IGF1) signaling pathways were the 2 most downregulated pathways. Furthermore, the forkhead box protein O1 pathway was upregulated, while the IGF1 receptor, insulin receptor substrate 1 and phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit b pathways were downregulated. Carcinoma tumorigenesis, tumor cell mitosis and tumor cell death were significantly upregulated disease states and functions, while cell proliferation and tumor growth were significantly downregulated. The results of the present study suggested that ARID1A may be a potential prognostic and therapeutic molecular drug target for the prevention of EC progression. PMID:29399196

75 FR 13151 - In the Matter of the Applications of EDGX Exchange, Inc., and EDGA Exchange, Inc. for...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-18

... Frankfurt AG (``Eurex Frankfurt,'' and, with Deutsche B[ouml]rse AG, the ``German Upstream Owners''). Eurex... jointly owned by Deutsche B[ouml]rse AG and SIX Swiss Exchange AG (``SWX''), a wholly-owned subsidiary of... Frankfurt, Deutsche B[ouml]rse AG, Eurex Z[uuml]rich, SWX, SWX Group, and Verein SWX Swiss Exchange. \\16\\ In...

The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae)

PubMed Central

Liao, Fang; Wang, Lin; Wu, Song; Li, Yu-Ping; Zhao, Lei; Huang, Guo-Ming; Niu, Chun-Jing; Liu, Yan-Qun; Li, Ming-Gang

2010-01-01

The complete mitochondrial genome (mitogenome) of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae) was determined. The genome is a circular molecule 15 481 bp long. It presents a typical gene organization and order for completely sequenced lepidopteran mitogenomes, but differs from the insect ancestral type for the placement of tRNAMet. The nucleotide composition of the genome is also highly A + T biased, accounting for 80.38%, with a slightly positive AT skewness (0.010), indicating the occurrence of more As than Ts, as found in the Noctuoidea species. All protein-coding genes (PCGs) are initiated by ATN codons, except for COI, which is tentatively designated by the CGA codon as observed in other lepidopterans. Four of 13 PCGs harbor the incomplete termination codon, T or TA. All tRNAs have a typical clover-leaf structure of mitochondrial tRNAs, except for tRNASer(AGN), the DHU arm of which could not form a stable stem-loop structure. The intergenic spacer sequence between tRNASer(AGN) and ND1 also contains the ATACTAA motif, which is conserved across the Lepidoptera order. The H. cunea A+T-rich region of 357 bp is comprised of non-repetitive sequences, but harbors several features common to the Lepidoptera insects, including the motif ATAGA followed by an 18 bp poly-T stretch, a microsatellite-like (AT)8 element preceded by the ATTTA motif, an 11 bp poly-A present immediately upstream tRNAMet. The phylogenetic analyses support the view that the H. cunea is closerly related to the Lymantria dispar than Ochrogaster lunifer, and support the hypothesis that Noctuoidea (H. cunea, L. dispar, and O. lunifer) and Geometroidea (Phthonandria atrilineata) are monophyletic. However, in the phylogenetic trees based on mitogenome sequences among the lepidopteran superfamilies, Papillonoidea (Artogeia melete, Acraea issoria, and Coreana raphaelis) joined basally within the monophyly of Lepidoptera, which is different to the traditional classification. PMID:20376208

Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

USGS Publications Warehouse

Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

1998-01-01

Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

Riparian influences on stream fish assemblage structure in urbanizing streams

USGS Publications Warehouse

Roy, A.H.; Freeman, B.J.; Freeman, Mary C.

2007-01-01

We assessed the influence of land cover at multiple spatial extents on fish assemblage integrity, and the degree to which riparian forests can mitigate the negative effects of catchment urbanization on stream fish assemblages. Riparian cover (urban, forest, and agriculture) was determined within 30 m buffers at longitudinal distances of 200 m, 1 km, and the entire network upstream of 59 non-nested fish sampling locations. Catchment and riparian land cover within the upstream network were highly correlated, so we were unable to distinguish between those variables. Most fish assemblage variables were related to % forest and % urban land cover, with the strongest relations at the largest spatial extent of land cover (catchment), followed by riparian land cover in the 1-km and 200-m reach, respectively. For fish variables related to urban land cover in the catchment, we asked whether the influence of riparian land cover on fish assemblages was dependent on the amount of urban development in the catchment. Several fish assemblage metrics (endemic richness, endemic:cosmopolitan abundance, insectivorous cyprinid richness and abundance, and fluvial specialist richness) were all best predicted by single variable models with % urban land cover. However, endemic:cosmopolitan richness, cosmopolitan abundance, and lentic tolerant abundance were related to % forest cover in the 1-km stream reach, but only in streams that had <15% catchment urban land cover. In these cases, catchment urbanization overwhelmed the potential mitigating effects of riparian forests on stream fishes. Together, these results suggest that catchment land cover is an important driver of fish assemblages in urbanizing catchments, and riparian forests are important but not sufficient for protecting stream ecosystems from the impacts of high levels of urbanization.

Transcriptional "silencer" element in rat repetitive sequences associated with the rat insulin 1 gene locus.

PubMed Central

Laimins, L; Holmgren-König, M; Khoury, G

1986-01-01

The enhancer elements from either simian virus 40 or murine sarcoma virus activate the expression of a transfected rat insulin 1 (rI1) gene when placed within 2.0 kilobases or less of the rI1 gene cap site. Inclusion of 4.0 kilobases of upstream rI1 sequence, however, results in a substantial reduction in the enhancer-dependent insulin gene expression. These observations suggested that a negative transcriptional regulatory element was present between 2.0 and 4.0 kilobases of the rI1 sequence. To test this notion, we employed a heterologous enhancer-dependent transcription assay in which the simian virus 40 72-base-pair repeat is linked to a human beta-globin gene. Addition of the upstream rI1 element to this system decreased the level of enhancer-dependent beta-globin transcription by a factor of 5 to 15. This rI1 "silencer" element functions in a manner relatively independent of position and orientation and requires a cis-dependent relationship to the transcription unit on which it acts. Thus, the silencer sequence seems to have a number of the characteristics of enhancer elements, and we suggest that it may function by the converse of the enhancer mechanism. The rI1 silencer sequence was identified as a member of a long interspersed rat repetitive family. Thus, a potential role for certain repetitive sequences interspersed throughout the eukaryotic genome may be to regulate gene expression by retaining transcriptional activity within defined domains. Images PMID:3010279

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing

PubMed Central

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-01-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome. PMID:20392818

Survey of the transcriptome of Aspergillus oryzae via massively parallel mRNA sequencing.

PubMed

Wang, Bin; Guo, Guangwu; Wang, Chao; Lin, Ying; Wang, Xiaoning; Zhao, Mouming; Guo, Yong; He, Minghui; Zhang, Yong; Pan, Li

2010-08-01

Aspergillus oryzae, an important filamentous fungus used in food fermentation and the enzyme industry, has been shown through genome sequencing and various other tools to have prominent features in its genomic composition. However, the functional complexity of the A. oryzae transcriptome has not yet been fully elucidated. Here, we applied direct high-throughput paired-end RNA-sequencing (RNA-Seq) to the transcriptome of A. oryzae under four different culture conditions. With the high resolution and sensitivity afforded by RNA-Seq, we were able to identify a substantial number of novel transcripts, new exons, untranslated regions, alternative upstream initiation codons and upstream open reading frames, which provide remarkable insight into the A. oryzae transcriptome. We were also able to assess the alternative mRNA isoforms in A. oryzae and found a large number of genes undergoing alternative splicing. Many genes and pathways that might be involved in higher levels of protein production in solid-state culture than in liquid culture were identified by comparing gene expression levels between different cultures. Our analysis indicated that the transcriptome of A. oryzae is much more complex than previously anticipated, and these results may provide a blueprint for further study of the A. oryzae transcriptome.

Major versus minor groove DNA binding of a bisarginylporphyrin hybrid molecule: A molecular mechanics investigation

NASA Astrophysics Data System (ADS)

Gresh, Nohad; Perrée-fauvet, Martine

1999-03-01

On the basis of theoretical computations, we have recently synthesised [Perrée-Fauvet, M. and Gresh, N., Tetrahedron Lett., 36 (1995) 4227] a bisarginyl conjugate of a tricationic porphyrin (BAP), designed to target, in the major groove of DNA, the d(GGC GCC)2 sequence which is part of the primary binding site of the HIV-1 retrovirus site [Wain-Hobson, S. et al., Cell, 40 (1985) 9]. In the theoretical model, the chromophore intercalates at the central d(CpG)2 step and each of the arginyl arms targets O6/N7belonging to guanine bases flanking the intercalation site. Recent IR and UV-visible spectroscopic studies have confirmed the essential features of these theoretical predictions [Mohammadi, S. et al., Biochemistry, 37 (1998) 6165]. In the present study, we compare the energies of competing intercalation modes of BAP to several double-stranded oligonucleotides, according to whether one, two or three N- methylpyridinium rings project into the major groove. Correspondingly, three minor groove binding modes were considered, the arginyl arms now targeting N3, O2 sites belonging to the purine or pyrimidine bases flanking the intercalation site. This investigation has shown that: (i) in both the major and minor grooves, the best-bound complexes have the three N-methylpyridinium rings in the groove opposite to that of the phenyl group bearing the arginyl arms; (ii) major groove binding is preferred over minor groove binding by a significant energy (29 kcal/mol); and (iii) the best-bound sequence in the major groove is d(GGC GCC)2 with two successive guanines upstream from the intercalation. On the other hand, due to the flexibility of the arginyl arms, other GC-rich sequences have close binding energies, two of them being less stable than it by less than 8 kcal/mol. These results serve as the basis for the design of derivatives of BAP with enhanced sequence selectivities in the major groove.

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Examining microbial community response to a strong chemical gradient: the effects of surface coal mining on stream bacteria

NASA Astrophysics Data System (ADS)

Bier, R.; Lindberg, T. T.; Wang, S.; Ellis, J. C.; Di Giulio, R. T.; Bernhardt, E. S.

2012-12-01

Surface coal mining is the dominant form of land cover change in northern and central Appalachia. In this process, shallow coal seams are exposed by removing overlying rock with explosives. The resulting fragmented carbonate rock and coal residues are disposed of in stream valleys. These valley fills generate alkaline mine drainage (AlkMD), dramatically increasing alkalinity, ionic strength, substrate supply (esp. SO42-), and trace element (Mn, Li, Se, U) concentrations in downstream rivers as well as significant losses of sensitive fish and macroinvertebrate species. In prior work within the Mud River, which drains the largest surface mine complex in Appalachia, we found that concentrations of AlkMD increase proportionally with the extent of upstream mining. Here we ask "How do stream microbial communities change along this strong chemical gradient?" We collected surface water and benthic biofilms from 25 stream reaches throughout the Mud River spanning the full range of surface mining impacts, with 0-96% of the contributing watershed area converted to surface coal mines. Microbial communities were collected from biofilms grown on a common substrate (red maple veneers) that were incubated in each stream reach for four months prior to collection in April, 2011. 16S rRNA genes from microbial communities at each study site were examined using 454 sequencing and compared with a generalized UniFrac distance matrix (674 sequence eveness) that was used in statistical analyses. Water chemistry at the sites was sampled monthly from July 2010 to December 2010 and again in April 2011. In April, surface water concentrations of SO42-, Ca2+, Mg2+, and Se2- increased linearly with the extent of upstream mining (all regressions R2 >0.43; p<0.004), with the resulting gradient in ionic strength extending from low conductivity (average 83 μS cm-1 S.E. 27.4) in unmined streams (n=6) to as high as 899 μS cm-1 in the mainstem and 1889 μS cm-1 immediately below the Connelly Branch valley fill. Across this gradient, we found that microbial community composition varied significantly between sites receiving mine drainage and those that were unexposed (NMDS ordination R2 =0.86; PERMANOVA; p=0.029). Bacterial diversity (OTU richness defined at 3% sequence difference) peaked at intermediate conductivities (600 μS cm-1). Environmental data that correlated significantly with the ordination axes were a variety of surface water ions characteristic of AlkMD (SO42-, Mg2+, Sr2+, Se2-, and U) as well as stream DOC concentrations (p < 0.001).

Density-dependent effects of non-native brown trout Salmo trutta on the species-area relationship in stream fish assemblages.

PubMed

Hasegawa, K; Mori, T; Yamazaki, C

2017-01-01

The spatial scale and density-dependent effects of non-native brown trout Salmo trutta on species richness of fish assemblages were examined at 48 study sites in Mamachi Stream, a tributary of Chitose River, Hokkaido, Japan. The density of age ≥1 year S. trutta was high in the upstream side of the main stem of Mamachi Stream. Fish species richness increased with increasing area of study sites (habitat size), but the increasing magnitude of the species richness with area decreased with increasing age of ≥1 year S. trutta density. The relationships between age ≥1 year S. trutta, however, and presence-absence of each species seemed to be different among species. Species richness was also determined by location and physical environmental variables, i.e. it was high on the downstream side and in structurally complex environments. © 2016 The Fisheries Society of the British Isles.

Dominant integration locus drives continuous diversification of plant immune receptors with exogenous domain fusions.

PubMed

Bailey, Paul C; Schudoma, Christian; Jackson, William; Baggs, Erin; Dagdas, Gulay; Haerty, Wilfried; Moscou, Matthew; Krasileva, Ksenia V

2018-02-19

The plant immune system is innate and encoded in the germline. Using it efficiently, plants are capable of recognizing a diverse range of rapidly evolving pathogens. A recently described phenomenon shows that plant immune receptors are able to recognize pathogen effectors through the acquisition of exogenous protein domains from other plant genes. We show that plant immune receptors with integrated domains are distributed unevenly across their phylogeny in grasses. Using phylogenetic analysis, we uncover a major integration clade, whose members underwent repeated independent integration events producing diverse fusions. This clade is ancestral in grasses with members often found on syntenic chromosomes. Analyses of these fusion events reveals that homologous receptors can be fused to diverse domains. Furthermore, we discover a 43 amino acid long motif associated with this dominant integration clade which is located immediately upstream of the fusion site. Sequence analysis reveals that DNA transposition and/or ectopic recombination are the most likely mechanisms of formation for nucleotide binding leucine rich repeat proteins with integrated domains. The identification of this subclass of plant immune receptors that is naturally adapted to new domain integration will inform biotechnological approaches for generating synthetic receptors with novel pathogen "baits."

The CUG-initiated larger form coat protein of Chinese wheat mosaic virus binds to the cysteine-rich RNA silencing suppressor.

PubMed

Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping

2013-10-01

Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.

RICH upgrade in LHCb experiment

NASA Astrophysics Data System (ADS)

Pistone, A.; LHCb RICH Collaboration

2017-01-01

The LHCb experiment is dedicated to precision measurements of CP violation and rare decays of B hadrons at the Large Hadron Collider (LHC) at CERN (Geneva). The second long shutdown of the LHC is currently scheduled to begin in 2019. During this period the LHCb experiment with all its sub-detectors will be upgraded in order to run at an instantaneous luminosity of 2 × 10^{33} cm ^{-2} s ^{-1} , about a factor 5 higher than the current luminosity, and to read out data at a rate of 40MHz into a flexible software-based trigger. The Ring Imaging CHerenkov (RICH) system will require new photon detectors and modifications to the optics of the upstream detector. Tests of the prototype of the smallest constituent of the new RICH system have been performed during testbeam sessions at the North Area test beam facility at CERN in the last years.

Development of a bioassay to screen for chemicals mimicking the anti-aging effects of calorie restriction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiba, Takuya, E-mail: takuya@nagasaki-u.ac.jp; Tsuchiya, Tomoshi; Komatsu, Toshimitsu

2010-10-15

Research highlights: {yields} We identified four sequence motifs lying upstream of putative pro-longevity genes. {yields} One of these motifs binds to HNF-4{alpha}. {yields} HNF-4{alpha}/PGC-1{alpha} could up-regulate the transcription of a reporter gene linked to this motif. {yields} The reporter system described here could be used to screen candidate anti-aging molecules. -- Abstract: Suppression of the growth hormone/insulin-like growth factor-I pathway in Ames dwarf (DF) mice, and caloric restriction (CR) in normal mice extends lifespan and delays the onset of age-related disorders. In combination, these interventions have an additive effect on lifespan in Ames DF mice. Therefore, common signaling pathways regulatedmore » by DF and CR could have additive effects on longevity. In this study, we tried to identity the signaling mechanism and develop a system to assess pro-longevity status in cells and mice. We previously identified genes up-regulated in the liver of DF and CR mice by DNA microarray analysis. Motif analysis of the upstream sequences of those genes revealed four major consensus sequence motifs, which have been named dwarfism and calorie restriction-responsive elements (DFCR-REs). One of the synthesized sequences bound to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}), an important transcription factor involved in liver metabolism. Furthermore, using this sequence information, we developed a highly sensitive bioassay to identify chemicals mimicking the anti-aging effects of CR. When the reporter construct, containing an element upstream of a secreted alkaline phosphatase (SEAP) gene, was co-transfected with HNF-4{alpha} and its regulator peroxisome proliferator-activated receptor (PPAR) {gamma} coactivator-1{alpha} (PGC-1{alpha}), SEAP activity was increased compared with untransfected controls. Moreover, transient transgenic mice established using this construct showed increased SEAP activity in CR mice compared with ad libitum-fed mice. These data suggest that because of its rapidity, ease of use, and specificity, our bioassay will be more useful than the systems currently employed to screen for CR mimetics, which mimic the beneficial effects of CR. Our system will be particularly useful for high-throughput screening of natural and synthetic candidate molecules.« less

Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.

PubMed Central

Levis, R; Schlesinger, S; Huang, H V

1990-01-01

Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651

Novel mechanism of conjoined gene formation in the human genome.

PubMed

Kim, Ryong Nam; Kim, Aeri; Choi, Sang-Haeng; Kim, Dae-Soo; Nam, Seong-Hyeuk; Kim, Dae-Won; Kim, Dong-Wook; Kang, Aram; Kim, Min-Young; Park, Kun-Hyang; Yoon, Byoung-Ha; Lee, Kang Seon; Park, Hong-Seog

2012-03-01

Recently, conjoined genes (CGs) have emerged as important genetic factors necessary for understanding the human genome. However, their formation mechanism and precise structures have remained mysterious. Based on a detailed structural analysis of 57 human CG transcript variants (CGTVs, discovered in this study) and all (833) known CGs in the human genome, we discovered that the poly(A) signal site from the upstream parent gene region is completely removed via the skipping or truncation of the final exon; consequently, CG transcription is terminated at the poly(A) signal site of the downstream parent gene. This result led us to propose a novel mechanism of CG formation: the complete removal of the poly(A) signal site from the upstream parent gene is a prerequisite for the CG transcriptional machinery to continue transcribing uninterrupted into the intergenic region and downstream parent gene. The removal of the poly(A) signal sequence from the upstream gene region appears to be caused by a deletion or truncation mutation in the human genome rather than post-transcriptional trans-splicing events. With respect to the characteristics of CG sequence structures, we found that intergenic regions are hot spots for novel exon creation during CGTV formation and that exons farther from the intergenic regions are more highly conserved in the CGTVs. Interestingly, many novel exons newly created within the intergenic and intragenic regions originated from transposable element sequences. Additionally, the CGTVs showed tumor tissue-biased expression. In conclusion, our study provides novel insights into the CG formation mechanism and expands the present concepts of the genetic structural landscape, gene regulation, and gene formation mechanisms in the human genome.

Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

PubMed Central

Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

2015-01-01

Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

The barium iron ruthenium oxide system

NASA Technical Reports Server (NTRS)

Kemmler-Sack, S.; Ehmann, A.

1986-01-01

In the system BaFe(1-x)Ru(x)O(3-y), three phases, separated by immiscibility gaps, are present: an Fe-rich phase (x = 0 to 0.75) with hexagonal BaTiO3 structure (6H; sequence (hcc)2), a Ru-rich phase (x = 0.9) of hexagonal 4H-type (sequence (hc)2), and the pure Ru compounds BaRuO3 with rhombohedral 9R structure (sequence (hhc)3). By vibrational spectroscopic investigations in the 6H phase a transition from n-type semiconduction (Fe-rich compounds with complete O lattice) can be detected. The 4H and 9R stacking polytypes are good, metal-like conductors. The lattice parameters are given.

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses

PubMed Central

KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu

2017-01-01

Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

Human CST Facilitates Genome-wide RAD51 Recruitment to GC-Rich Repetitive Sequences in Response to Replication Stress.

PubMed

Chastain, Megan; Zhou, Qing; Shiva, Olga; Fadri-Moskwik, Maria; Whitmore, Leanne; Jia, Pingping; Dai, Xueyu; Huang, Chenhui; Ye, Ping; Chai, Weihang

2016-08-02

The telomeric CTC1/STN1/TEN1 (CST) complex has been implicated in promoting replication recovery under replication stress at genomic regions, yet its precise role is unclear. Here, we report that STN1 is enriched at GC-rich repetitive sequences genome-wide in response to hydroxyurea (HU)-induced replication stress. STN1 deficiency exacerbates the fragility of these sequences under replication stress, resulting in chromosome fragmentation. We find that upon fork stalling, CST proteins form distinct nuclear foci that colocalize with RAD51. Furthermore, replication stress induces physical association of CST with RAD51 in an ATR-dependent manner. Strikingly, CST deficiency diminishes HU-induced RAD51 foci formation and reduces RAD51 recruitment to telomeres and non-telomeric GC-rich fragile sequences. Collectively, our findings establish that CST promotes RAD51 recruitment to GC-rich repetitive sequences in response to replication stress to facilitate replication restart, thereby providing insights into the mechanism underlying genome stability maintenance. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsugu, H.; Horowitz, R.; Gibson, N.

1994-12-01

Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.

PubMed

Hutsul, J A; Worobec, E

1994-02-01

An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.

The nonamer UUAUUUAUU is the key AU-rich sequence motif that mediates mRNA degradation.

PubMed Central

Zubiaga, A M; Belasco, J G; Greenberg, M E

1995-01-01

Labile mRNAs that encode cytokine and immediate-early gene products often contain AU-rich sequences within their 3' untranslated region (UTR). These AU-rich sequences appear to be key determinants of the short half-lives of these mRNAs, although the sequence features of these elements and the mechanism by which they target mRNAs for rapid decay have not been fully defined. We have examined the features of AU-rich elements (AREs) that are crucial for their function as determinants of mRNA instability in mammalian cells by testing the ability of various mutant c-fos AREs and synthetic AREs to direct rapid mRNA deadenylation and decay when inserted within the 3' UTR of the normally stable beta-globin mRNA. Evidence is presented that the pentamer AUUUA, which previously was suggested to be the minimal determinant of instability present in mammalian AREs, cannot direct rapid mRNA deadenylation and decay. Instead, the nonomer UUAUUUAUU is the elemental AU-rich sequence motif that destabilizes mRNA. Removal of one uridine residue from either end of the nonamer (UUAUUUAU or UAUUUAUU) results in a decrease of potency of the element, while removal of a uridine residue from both ends of the nonamer (UAUUUAU) eliminates detectable destabilizing activity. The inclusion of an additional uridine residue at both ends of the nonamer (UUUAUUUAUUU) does not further increase the efficacy of the element. Taken together, these findings suggest that the nonamer UUAUUUAUU is the minimal AU-rich motif that effectively destabilizes mRNA. Additional ARE potency is achieved by combining multiple copies of this nonamer in a single mRNA 3' UTR. Furthermore, analysis of poly(A) shortening rates for ARE-containing mRNAs reveals that the UUAUUUAUU sequence also accelerates mRNA deadenylation and suggests that the UUAUUUAUU motif targets mRNA for rapid deadenylation as an early step in the mRNA decay process. PMID:7891716

Dual Transcriptomic Profiling of Host and Microbiota during Health and Disease in Pediatric Asthma.

PubMed

Pérez-Losada, Marcos; Castro-Nallar, Eduardo; Bendall, Matthew L; Freishtat, Robert J; Crandall, Keith A

2015-01-01

High-throughput sequencing (HTS) analysis of microbial communities from the respiratory airways has heavily relied on the 16S rRNA gene. Given the intrinsic limitations of this approach, airway microbiome research has focused on assessing bacterial composition during health and disease, and its variation in relation to clinical and environmental factors, or other microbiomes. Consequently, very little effort has been dedicated to describing the functional characteristics of the airway microbiota and even less to explore the microbe-host interactions. Here we present a simultaneous assessment of microbiome and host functional diversity and host-microbe interactions from the same RNA-seq experiment, while accounting for variation in clinical metadata. Transcriptomic (host) and metatranscriptomic (microbiota) sequences from the nasal epithelium of 8 asthmatics and 6 healthy controls were separated in silico and mapped to available human and NCBI-NR protein reference databases. Human genes differentially expressed in asthmatics and controls were then used to infer upstream regulators involved in immune and inflammatory responses. Concomitantly, microbial genes were mapped to metabolic databases (COG, SEED, and KEGG) to infer microbial functions differentially expressed in asthmatics and controls. Finally, multivariate analysis was applied to find associations between microbiome characteristics and host upstream regulators while accounting for clinical variation. Our study showed significant differences in the metabolism of microbiomes from asthmatic and non-asthmatic children for up to 25% of the functional properties tested. Enrichment analysis of 499 differentially expressed host genes for inflammatory and immune responses revealed 43 upstream regulators differentially activated in asthma. Microbial adhesion (virulence) and Proteobacteria abundance were significantly associated with variation in the expression of the upstream regulator IL1A; suggesting that microbiome characteristics modulate host inflammatory and immune systems during asthma.

GC-Rich DNA Elements Enable Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris

PubMed Central

Liachko, Ivan; Youngblood, Rachel A.; Tsui, Kyle; Bubb, Kerry L.; Queitsch, Christine; Raghuraman, M. K.; Nislow, Corey; Brewer, Bonita J.; Dunham, Maitreya J.

2014-01-01

The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins—a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation. PMID:24603708

GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

PubMed

Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

2014-03-01

The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

DNA methylation inhibits expression and transposition of the Neurospora Tad retrotransposon.

PubMed

Zhou, Y; Cambareri, E B; Kinsey, J A

2001-06-01

Tad is a LINE-like retrotransposon of the filamentous fungus Neurospora crassa. We have analyzed both expression and transposition of this element using strains with a single copy of Tad located in the 5' noncoding sequences of the am (glutamate dehydrogenase) gene. Tad in this position has been shown to carry a de novo cytosine methylation signal which causes reversible methylation of both Tad and am upstream sequences. Here we find that methylation of the Tad sequences inhibits both Tad expression and transposition. This inhibition can be relieved by the use of 5-azacytidine, a drug which reduces cytosine methylation, or by placing the Tad/am sequences in a dim-2 genetic background.

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

PubMed

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

The impacts of Phalaris arundinacea (reed canary grass) invasion on wetland plant richness in the Oregon Coast Range, USA, depend on beavers

USGS Publications Warehouse

Perkins, T.; Wilson, M.

2005-01-01

Invasive plants can threaten diversity and ecosystem function. We examined the relationship between the invasive Phalaris arundinacea (reed canarygrass) and species richness in beaver wetlands in Oregon, USA. Four basins (drainages) were chosen and three sites each of beaver impoundments, unimpounded areas and areas upstream of debris jams were randomly chosen in each basin for further study (n = 36). Analysis of covariance (ANCOVA) showed that the relationship between Phalaris and species richness differed significantly (p = 0.01) by site type. Dam sites (beaver impoundments) exhibited a strong inverse relationship between Phalaris and species richness (bD = a??0.15), with one species lost for each 7% increase in Phalaris cover. In contrast, there was essentially no relationship between Phalaris cover and species richness in jam sites (debris jam impoundments formed by flooding; bJ = +0.01) and unimpounded sites (bU = a??0.03). The cycle of beaver impoundment and abandonment both disrupts the native community and provides an ideal environment for Phalaris, which once established tends to exclude development of herbaceous communities and limits species richness. Because beaver wetlands are a dominant wetland type in the Coast Range, Phalaris invasion presents a real threat to landscape heterogeneity and ecosystem function in the region.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

PubMed

Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

2014-01-01

T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain

PubMed Central

Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

2014-01-01

T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein–nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5′ TOPs (5′ terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations. PMID:24824036

Increasing fish taxonomic and functional richness affects ecosystem properties of small headwater prairie streams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Erika C.; Gido, Keith B.; Bello, Nora

Stream fish can regulate their environment through direct and indirect pathways, and the relative influence of communities with different taxonomic and functional richness on ecosystem properties likely depends on habitat structure. Given this complexity, it is not surprising that observational studies of how stream fish communities influence ecosystems have shown mixed results. In this study, we evaluated the effect of an observed gradient of taxonomic (zero, one, two or three species) and functional (zero, one or two groups) richness of fishes on several key ecosystem properties in experimental stream mesocosms. Our study simulated small (less than two metres wide) headwatermore » prairie streams with a succession of three pool-riffle structures (upstream, middle and downstream) per mesocosm. Additionally, ecosystem responses included chlorophyll a from floating algal mats and benthic algae, benthic organic matter, macroinvertebrates (all as mass per unit area), algal filament length and stream metabolism (photosynthesis and respiration rate). Ecosystem responses were analysed individually using general linear mixed models. Significant treatment (taxonomic and functional richness) by habitat (pools and riffles) interactions were found for all but one ecosystem response variable. After accounting for location (upstream, middle and downstream) effects, the presence of one or two grazers resulted in shorter mean algal filament lengths in pools compared to no-fish controls. These observations suggest grazers can maintain short algal filaments in pools, which may inhibit long filaments from reaching the surface. Accordingly, floating algal mats decreased in mid- and downstream locations in grazer treatment relative to no-fish controls. At the scale of the entire reach, gross primary productivity and respiration were greater in treatments with two grazer species compared to mixed grazer/insectivore or control treatments. Lastly, the distribution of stream resources across habitat types and locations within a reach can therefore be influenced by the taxonomic and functional composition of fishes in small prairie streams. Thus, disturbances that alter diversity of these systems might have unexpected ecosystem-level consequences.« less

Increasing fish taxonomic and functional richness affects ecosystem properties of small headwater prairie streams

DOE PAGES

Martin, Erika C.; Gido, Keith B.; Bello, Nora; ...

2016-04-06

Stream fish can regulate their environment through direct and indirect pathways, and the relative influence of communities with different taxonomic and functional richness on ecosystem properties likely depends on habitat structure. Given this complexity, it is not surprising that observational studies of how stream fish communities influence ecosystems have shown mixed results. In this study, we evaluated the effect of an observed gradient of taxonomic (zero, one, two or three species) and functional (zero, one or two groups) richness of fishes on several key ecosystem properties in experimental stream mesocosms. Our study simulated small (less than two metres wide) headwatermore » prairie streams with a succession of three pool-riffle structures (upstream, middle and downstream) per mesocosm. Additionally, ecosystem responses included chlorophyll a from floating algal mats and benthic algae, benthic organic matter, macroinvertebrates (all as mass per unit area), algal filament length and stream metabolism (photosynthesis and respiration rate). Ecosystem responses were analysed individually using general linear mixed models. Significant treatment (taxonomic and functional richness) by habitat (pools and riffles) interactions were found for all but one ecosystem response variable. After accounting for location (upstream, middle and downstream) effects, the presence of one or two grazers resulted in shorter mean algal filament lengths in pools compared to no-fish controls. These observations suggest grazers can maintain short algal filaments in pools, which may inhibit long filaments from reaching the surface. Accordingly, floating algal mats decreased in mid- and downstream locations in grazer treatment relative to no-fish controls. At the scale of the entire reach, gross primary productivity and respiration were greater in treatments with two grazer species compared to mixed grazer/insectivore or control treatments. Lastly, the distribution of stream resources across habitat types and locations within a reach can therefore be influenced by the taxonomic and functional composition of fishes in small prairie streams. Thus, disturbances that alter diversity of these systems might have unexpected ecosystem-level consequences.« less

Genetic characterization of the UCS and Kex1 loci of Pneumocystis jirovecii.

PubMed

Esteves, F; Tavares, A; Costa, M C; Gaspar, J; Antunes, F; Matos, O

2009-02-01

Nucleotide variation in the Pneumocystis jirovecii upstream conserved sequence (UCS) and kexin-like serine protease (Kex1) loci was studied in pulmonary specimens from Portuguese HIV-positive patients. DNA was extracted and used for specific molecular sequence analysis. The number of UCS tandem repeats detected in 13 successfully sequenced isolates ranged from three (9 isolates, 69%) to four (4 isolates, 31%). A novel tandem repeat pattern and two novel polymorphisms were detected in the UCS region. For the Kex1 gene, the wild-type (24 isolates, 86%) was the most frequent sequence detected among the 28 sequenced isolates. Nevertheless, a nonsynonymous (1 isolate, 3%) and three synonymous (3 isolates, 11%) polymorphisms were detected and are described here for the first time.

TIA-1 RRM23 binding and recognition of target oligonucleotides

PubMed Central

Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

2017-01-01

Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

TIA-1 RRM23 binding and recognition of target oligonucleotides.

PubMed

Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

2017-05-05

TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

PubMed

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

PubMed Central

Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

2012-01-01

Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

PubMed

Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

1994-06-03

An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

Ichthyoplankton use of a thermally influenced macrophyte bed in the New River, Virginia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeager, M.M.; Cherry, D.S.; Yeager, J.L.

The ichthyoplankton community of an extensive macrophyte bed in a thermally influenced reach of the New River, Virginia was compared with the ichthyoplankton communities in smaller macrophyte beds located upstream and downstream of the thermal effluent. Ichthyoplankton trapping was carried out biweekly between April and September, 1994, using wire mesh traps baited with bread and cylume light sticks. Qualitative dipnetting was conducted monthly in the macrophyte bed to check for trap bias. Temperature ranged from 16.1 C to 28 C in the reference areas and from 20.5 C to 34 C in the thermally influenced macrophyte bed. The lowest dissolvedmore » oxygen value (4.6 mg/L) was recorded in the effluent influenced area where the D.O. ranged from 4.6 to 8.8 mg/L. The D.O. in the reference macrophyte beds ranged from 5.8 to 12.3 mg/L. The smaller reference macrophyte beds had higher abundance and taxa richness than the thermally influenced macrophyte bed on 8 of the 10 trapping dates. In late May, the thermally influenced macrophyte bed had significantly higher ichthyoplankton abundance and richness (p < 0.05) than the reference areas. Significant differences occurred once more on September 21, 1994 when no fish were collected in the thermally influenced area resulting in significantly higher richness and abundance in the upstream reference area (p < 0.05). The communities were dominated by Centrarchidae of the genera Ambloplites, Micropterus and Lepomis. Catostomids and Cyprinids were collected at both the thermally influenced and reference stations. The sculpin, Cottus, was the only genus collected in a reference area that was not collected in the thermally influenced area. It appears that the macrophyte bed below the industrial facility was being utilized as a refugia for ichthyoplankton.« less

Novel Strategies for Upstream and Downstream Processing of Tannin Acyl Hydrolase

PubMed Central

Rodríguez-Durán, Luis V.; Valdivia-Urdiales, Blanca; Contreras-Esquivel, Juan C.; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N.

2011-01-01

Tannin acyl hydrolase also referred as tannase is an enzyme with important applications in several science and technology fields. Due to its hydrolytic and synthetic properties, tannase could be used to reduce the negative effects of tannins in beverages, food, feed, and tannery effluents, for the production of gallic acid from tannin-rich materials, the elucidation of tannin structure, and the synthesis of gallic acid esters in nonaqueous media. However, industrial applications of tannase are still very limited due to its high production cost. Thus, there is a growing interest in the production, recovery, and purification of this enzyme. Recently, there have been published a number of papers on the improvement of upstream and downstream processing of the enzyme. These papers dealt with the search for new tannase producing microorganisms, the application of novel fermentation systems, optimization of culture conditions, the production of the enzyme by recombinant microorganism, and the design of efficient protocols for tannase recovery and purification. The present work reviews the state of the art of basic and biotechnological aspects of tannin acyl hydrolase, focusing on the recent advances in the upstream and downstream processing of the enzyme. PMID:21941633

Observations on the Growth of Roughness Elements Into Icing Feathers

NASA Technical Reports Server (NTRS)

Vargas, Mario; Tsao, Jen, Ching

2007-01-01

This work presents the results of an experiment conducted in the Icing Research Tunnel at NASA Glenn Research Center to understand the process by which icing feathers are formed in the initial stages of ice accretion formation on swept wings. Close-up photographic data were taken on an aluminum NACA 0012 swept wing tip airfoil. Two types of photographic data were obtained: time sequence close-up photographic data during the run and close-up photographic data of the ice accretion at the end of each run. Icing runs were conducted for short ice accretion times from 10 to 180 sec. The time sequence close-up photographic data was used to study the process frame by frame and to create movies of how the process developed. The movies confirmed that at glaze icing conditions in the attachment line area icing feathers develop from roughness elements. The close-up photographic data at the end of each run showed that roughness elements change into a pointed shape with an upstream facet and join on the side with other elements having the same change to form ridges with pointed shape and upstream facet. The ridges develop into feathers when the upstream facet grows away to form the stem of the feather. The ridges and their growth into feathers were observed to form the initial scallop tips present in complete scallops.

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana.

PubMed

Qin, Yuxiang; Tian, Yanchen; Han, Lu; Yang, Xinchao

2013-10-25

The isolation and characterization of TaWRKY79, a wheat class II WRKY transcription factor, is described. Its 1297 bp coding region includes a 987 bp long open reading frame. TaWRKY79 was induced by stressing seedlings with either NaCl or abscisic acid (ABA). When a fusion between an 843 bp segment upstream of the TaWRKY79 coding sequence and GUS was introduced into Arabidopsis thaliana, GUS staining indicated that this upstream segment captured the sequence(s) required to respond to ABA or NaCl treatment. When TaWRKY79 was constitutively expressed as a transgene in A. thaliana, the transgenic plants showed an improved capacity to extend their primary root in the presence of either 100 mM NaCl, 10 mM LiCl or 2 μM ABA. The inference was that TaWRKY79 enhanced the level of tolerance to both salinity and ionic stress, while reducing the level of sensitivity to ABA. The ABA-related genes ABA1, ABA2 ABI1 and ABI5 were all up-regulated in the TaWRKY79 transgenic plants, suggesting that the transcription factor operates in an ABA-dependent pathway. Copyright © 2013. Published by Elsevier Inc.

Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

PubMed

Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

2013-07-01

The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

PubMed

Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

2014-10-01

This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

An Inhibitory Motif on the 5’UTR of Several Rotavirus Genome Segments Affects Protein Expression and Reverse Genetics Strategies

PubMed Central

Papa, Guido; Eichwald, Catherine; Burrone, Oscar R.

2016-01-01

Rotavirus genome consists of eleven segments of dsRNA, each encoding one single protein. Viral mRNAs contain an open reading frame (ORF) flanked by relatively short untranslated regions (UTRs), whose role in the viral cycle remains elusive. Here we investigated the role of 5’UTRs in T7 polymerase-driven cDNAs expression in uninfected cells. The 5’UTRs of eight genome segments (gs3, gs5-6, gs7-11) of the simian SA11 strain showed a strong inhibitory effect on the expression of viral proteins. Decreased protein expression was due to both compromised transcription and translation and was independent of the ORF and the 3’UTR sequences. Analysis of several mutants of the 21-nucleotide long 5’UTR of gs 11 defined an inhibitory motif (IM) represented by its primary sequence rather than its secondary structure. IM was mapped to the 5’ terminal 6-nucleotide long pyrimidine-rich tract 5’-GGY(U/A)UY-3’. The 5’ terminal position within the mRNA was shown to be essentially required, as inhibitory activity was lost when IM was moved to an internal position. We identified two mutations (insertion of a G upstream the 5’UTR and the U to A mutation of the fifth nucleotide of IM) that render IM non-functional and increase the transcription and translation rate to levels that could considerably improve the efficiency of virus helper-free reverse genetics strategies. PMID:27846320

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

An intronless form of the tobacco extensin gene terminator strongly enhances transient gene expression in plant leaves.

PubMed

Rosenthal, Sun Hee; Diamos, Andrew G; Mason, Hugh S

2018-03-01

We have found interesting features of a plant gene (extensin) 3' flanking region, including extremely efficient polyadenylation which greatly improves transient expression of transgenes when an intron is removed. Its use will greatly benefit studies of gene expression in plants, research in molecular biology, and applications for recombinant proteins. Plants are a promising platform for the production of recombinant proteins. To express high-value proteins in plants efficiently, the optimization of expression cassettes using appropriate regulatory sequences is critical. Here, we characterize the activity of the tobacco extensin (Ext) gene terminator by transient expression in Nicotiana benthamiana, tobacco, and lettuce. Ext is a member of the hydroxyproline-rich glycoprotein (HRGP) superfamily and constitutes the major protein component of cell walls. The present study demonstrates that the Ext terminator with its native intron removed increased transient gene expression up to 13.5-fold compared to previously established terminators. The enhanced transgene expression was correlated with increased mRNA accumulation and reduced levels of read-through transcripts, which could impair gene expression. Analysis of transcript 3'-ends found that the majority of polyadenylated transcripts were cleaved at a YA dinucleotide downstream from a canonical AAUAAA motif and a UG-rich region, both of which were found to be highly conserved among related extensin terminators. Deletion of either of these regions eliminated most of the activity of the terminator. Additionally, a 45 nt polypurine sequence ~ 175 nt upstream from the polyadenylation sites was found to also be necessary for the enhanced expression. We conclude that the use of Ext terminator has great potential to benefit the production of recombinant proteins in plants.

Programming molecular self-assembly of intrinsically disordered proteins containing sequences of low complexity

NASA Astrophysics Data System (ADS)

Simon, Joseph R.; Carroll, Nick J.; Rubinstein, Michael; Chilkoti, Ashutosh; López, Gabriel P.

2017-06-01

Dynamic protein-rich intracellular structures that contain phase-separated intrinsically disordered proteins (IDPs) composed of sequences of low complexity (SLC) have been shown to serve a variety of important cellular functions, which include signalling, compartmentalization and stabilization. However, our understanding of these structures and our ability to synthesize models of them have been limited. We present design rules for IDPs possessing SLCs that phase separate into diverse assemblies within droplet microenvironments. Using theoretical analyses, we interpret the phase behaviour of archetypal IDP sequences and demonstrate the rational design of a vast library of multicomponent protein-rich structures that ranges from uniform nano-, meso- and microscale puncta (distinct protein droplets) to multilayered orthogonally phase-separated granular structures. The ability to predict and program IDP-rich assemblies in this fashion offers new insights into (1) genetic-to-molecular-to-macroscale relationships that encode hierarchical IDP assemblies, (2) design rules of such assemblies in cell biology and (3) molecular-level engineering of self-assembled recombinant IDP-rich materials.

Promoters, toll like receptors and microRNAs: a strange association.

PubMed

Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K

2013-06-01

Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

PubMed

Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

2017-11-01

The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

Enhancement of fine-scale mixing for fuel-rich plume combustion

NASA Astrophysics Data System (ADS)

Schadow, K. C.; Gutmark, E.; Parr, T. P.; Parr, D. M.; Wilson, K. J.; Ferrell, G. B.

1987-01-01

The effect of enhancing small-scale turbulent structures on the combustion intensity and flame stability was studied in nonreacting and reacting flows. Hot-wire anemometry was used to map the mean and turbulent flow fields of the nonreacting flows. Reacting flows were studied in a free flame and in a ducted gas-generator fuel-rich plume using Planar Laser Induced Fluorescence, a rake of thermocouples and high speed photography. A modified circular nozzle having several backward facing steps upstream of its exit was used to introduce numerous inflection points in the initial mean velocity profiles, thus producing multiple corresponding sources of small-scale turbulence generators. Cold flow tests showed turbulence increases of up to six times the initial turbulence level relative to a circular nozzle. The ensuing result was that the flame of this nozzle was more intense with a homogeneous heat release. The fuel-rich plume was stable even in supersonic speeds, and secondary ignition was obtained under conditions that prevented sustained afterburning using the circular nozzle.

Influence of Forced Flow on the Dendritic Growth of Fe-C Alloy: 3D vs 2D Simulation

NASA Astrophysics Data System (ADS)

Wang, Weiling; Wang, Zhaohui; Luo, Sen; Ji, Cheng; Zhu, Miaoyong

2017-12-01

A 3D parallel cellular automaton-finite volume method (CA-FVM) model was used to simulate the equiaxed dendritic growth of an Fe-0.82 wt pct C alloy with xy- in- out and xyz- in- out type forced flows and the columnar dendritic growth with y- in- out type forced flow. In addition, the similarities and differences between the results of the 3D and 2D models are discussed and summarized in detail. The capabilities of the 3D and 2D CA-FVM models to predict the dendritic growth of the alloy with forced flow are validated through comparison with the boundary layer correction and Oseen-Ivanstov models, respectively. Because the forced flow can pass around perpendicular arms of the dendrites, the secondary arms at the sides upstream from the perpendicular arms are more developed than those on the upstream side of the upstream arms, especially at higher inlet velocities. In addition, compared to the xy- in- out case, the growth of the downstream arms is less inhibited and the secondary arms are more developed in the xyz- in- out case because of the greater lateral flow around their tips. Compared to the 3D case, the 2D equiaxed dendrites are more asymmetrical and lack secondary arms because of the thicker solute envelope. In the 3D case, the columnar dendrites on the upstream side (left one) are promoted, while the middle and downstream dendrites are inhibited in sequence. However, the sequential inhibition starts on the upstream side in the 2D case. This is mainly because the melt can pass around the upstream branch in 3D space. However, it can only climb over the upstream tip in 2D space. Additionally, the secondary arms show upstream development, which is more significant with increasing inlet velocity. The level of development of the secondary arms is also affected by the decay of the forced flow in the flow direction.

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Discordant expression and variable numbers of neighboring GGA- and GAA-rich triplet repeats in the 3' untranslated regions of two groups of messenger RNAs encoded by the rat polymeric immunoglobulin receptor gene.

PubMed Central

Koch, K S; Gleiberman, A S; Aoki, T; Leffert, H L; Feren, A; Jones, A L; Fodor, E J

1995-01-01

An unusual S1-nuclease sensitive microsatellite (STMS) has been found in the single copy, rat polymeric immunoglobulin receptor gene (PIGR) terminal exon. In Fisher rats, elements within or beyond the STMS are expressed variably in the 3' untranslated regions (3'UTRs) of two 'Groups' of PIGR-encoded hepatic mRNAs (pIg-R) during liver regeneration. STMS elements include neighboring constant regions (a 60-bp d[GA]-rich tract with a chi-like octamer, followed by 15 tandem d[GGA] repeats) that merge directly with 36 or 39 tandem d[GAA] repeats (Fisher or Wistar strains, respectively) interrupted by d[AA] between their 5th-6th repeat units. The Wistar STMS is flanked upstream by two regions of nearly contiguous d[CA] or d[CT] repeats in the 3' end of intron 8; and downstream, by a 283 bp 'unit' containing several inversions at its 5' end, and two polyadenylation signals at its 3' end. The 283 nt unit is expressed in Group 1 pIg-R mRNAs; but it is absent in the Group 2 family so that their GAA repeats merge with their poly A tails. In contrast to genomic sequence, GGA triplet repeats are amplified (n > or = 24-26), whereas GAA triplet repeats are truncated variably (n < or = 9-37) and expressed uninterruptedly in both mRNA Groups. These results suggest that 3' end processing of the rat PIGR gene may involve misalignment, slippage and premature termination of RNA polymerase II. The function of this unusual processing and possible roles of chi-like octamers in quiescent or extrahepatic tissues are discussed. Images PMID:7739889

Zadoff-Chu sequence-based hitless ranging scheme for OFDMA-PON configured 5G fronthaul uplinks

NASA Astrophysics Data System (ADS)

Reza, Ahmed Galib; Rhee, June-Koo Kevin

2017-05-01

A Zadoff-Chu (ZC) sequence-based low-complexity hitless upstream time synchronization scheme is proposed for an orthogonal frequency division multiple access passive optical network configured cloud radio access network fronthaul. The algorithm is based on gradual loading of the ZC sequences, where the phase discontinuity due to the cyclic prefix is alleviated by a frequency domain phase precoder, eliminating the requirements of guard bands to mitigate intersymbol interference and inter-carrier interference. Simulation results for uncontrolled-wavelength asynchronous transmissions from four concurrent transmitting optical network units are presented to demonstrate the effectiveness of the proposed scheme.

Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity

PubMed Central

Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

2014-01-01

Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity. PMID:25423449

Molecular characterization of Lactobacillus plantarum DMDL 9010, a strain with efficient nitrite degradation capacity.

PubMed

Fei, Yong-tao; Liu, Dong-mei; Luo, Tong-hui; Chen, Gu; Wu, Hui; Li, Li; Yu, Yi-gang

2014-01-01

Nitrites commonly found in food, especially in fermented vegetables, are potential carcinogens. Therefore, limiting nitrites in food is critically important for food safety. A Lactobacillus strain (Lactobacillus sp. DMDL 9010) was previously isolated from fermented vegetables by our group, and is not yet fully characterized. A number of phenotypical and genotypical approaches were employed to characterize Lactobacillus sp. DMDL 9010. Its nitrite degradation capacity was compared with four other Lactobacillus strains, including Lactobacillus casei subsp. rhamnosus 719, Lactobacillus delbrueckii subsp. bulgaricu 1.83, Streptococcus thermophilus 1.204, and lactobacillus plantarum 8140, on MRS medium. Compared to these four Lactobacillus strains, Lactobacillus sp. DMDL 9010 had a significantly higher nitrite degradation capacity (P<0.001). Based on 16S rDNA sequencing and sequence comparison, Lactobacillus sp. DMDL 9010 was identified as either Lactobacillus plantarum or Lactobacillus pentosus. To further identify this strain, the flanking regions (922 bp and 806 bp upstream and downstream, respectively) of the L-lactate dehydrogenase 1 (L-ldh1) gene were amplified and sequenced. Lactobacillus sp. DMDL 9010 had 98.92 and 76.98% sequence identity in the upstream region with L. plantarum WCFS1 and L. pentosus IG1, respectively, suggesting that Lactobacillu sp. DMDL 9010 is an L. plantarum strain. It was therefore named L. plantarum DMDL 9010. Our study provides a platform for genetic engineering of L. plantarum DMDL 9010, in order to further improve its nitrite degradation capacity.

The chicken skeletal alpha-actin gene promoter region exhibits partial dyad symmetry and a capacity to drive bidirectional transcription.

PubMed Central

Grichnik, J M; French, B A; Schwartz, R J

1988-01-01

The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124

Genomic organization of the human gene (CA5) and pseudogene for mitochondrial carbonic anhydrase V and their localization to chromosomes 16q and 16p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagao, Yoshiro; Sly, W.S.; Batanian, J.R.

1995-08-10

Carbonic anhydrase V (CA V) is expressed in mitochondrial matrix in liver and several other tissues. It is of interest for its putative roles in providing bicarbonate to carbamoyl phosphate synthetase for ureagenesis and to pyruvate carboxylase for gluconeogenesis and its possible importance in explaining certain inherited metabolic disorders with hyperammonemia and hypoglycemia. Following the recent characterization of the cDNA for human CA V, we report the isolation of the human gene from two {lambda} genomic libraries and its characterization. The CA V gene (CA5) is approximately 50 kb long and contains 7 exons and 6 introns. The exon-intron boundariesmore » are found in positions identical to those determined for the previously described CA II, CA III, and CA VII genes. Like the CA VII gene, CA5 does not contain typical TATA and CAAT promoter elements in the 5{prime} flanking region but does contain a TTTAA sequence 147 nucleotides upstream of the initiation codon. CA5 also contains a 12-bp GT-rich segment beginning 13 bp downstream of the polyadenylation signal in the 3{prime} untranslated region of exon 7. FISH analysis allowed CA5 to be assigned to chromosome 16q24.3. An unprocessed pseudogene containing sequence homologous to exons 3-7 and introns 3-6 was also isolated and was assigned by FISH analysis to chromosome 16p11.2-p12. 22 refs., 4 figs., 1 tab.« less

Alkali injection system with controlled CO.sub.2 /O.sub.2 ratios for combustion of coal

DOEpatents

Berry, Gregory F.

1988-01-01

A high temperature combustion process for an organic fuel containing sulfur n which the nitrogen of air is replaced by carbon dioxide for combination with oxygen with the ratio of CO.sub.2 /O.sub.2 being controlled to generate combustion temperatures above 2000 K. for a gas-gas reaction with SO.sub.2 and an alkali metal compound to produce a sulfate and in which a portion of the carbon-dioxide rich gas is recycled for mixing with oxygen and/or for injection as a cooling gas upstream from heating exchangers to limit fouling of the exchangers, with the remaining carbon-dioxide rich gas being available as a source of CO.sub.2 for oil recovery and other purposes.

A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

PubMed

Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

1995-01-01

Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Experimental Study of Cavity-Strut Combustion in Supersonic Flow (Postprint)

DTIC Science & Technology

2007-07-01

locally fuel-rich region. When air is directly injected into the cavity, the flame appears to be more intense with reduced flame length behind the...2. At a moderate upstream strut fueling (FST1), the increased combustion zone behind the struts is evident, especially with regard to the flame ... length . At the same cavity and strut fueling condition, the strut flame appears to extend farther downstream in the Strut 2 and Strut 3 configurations

Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

PubMed Central

Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

1994-01-01

Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Alterations of microbiota in urine from women with interstitial cystitis

PubMed Central

2012-01-01

Background Interstitial Cystitis (IC) is a chronic inflammatory condition of the bladder with unknown etiology. The aim of this study was to characterize the microbial community present in the urine from IC female patients by 454 high throughput sequencing of the 16S variable regions V1V2 and V6. The taxonomical composition, richness and diversity of the IC microbiota were determined and compared to the microbial profile of asymptomatic healthy female (HF) urine. Results The composition and distribution of bacterial sequences differed between the urine microbiota of IC patients and HFs. Reduced sequence richness and diversity were found in IC patient urine, and a significant difference in the community structure of IC urine in relation to HF urine was observed. More than 90% of the IC sequence reads were identified as belonging to the bacterial genus Lactobacillus, a marked increase compared to 60% in HF urine. Conclusion The 16S rDNA sequence data demonstrates a shift in the composition of the bacterial community in IC urine. The reduced microbial diversity and richness is accompanied by a higher abundance of the bacterial genus Lactobacillus, compared to HF urine. This study demonstrates that high throughput sequencing analysis of urine microbiota in IC patients is a powerful tool towards a better understanding of this enigmatic disease. PMID:22974186

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.

PubMed

Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P

2011-09-26

HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.

Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

PubMed Central

2011-01-01

Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362

Evaluating changes in stream fish species richness over a 50-year time-period within a landscape context

USGS Publications Warehouse

Midway, Stephen R.; Wagner, Tyler; Tracy, Bryn H.; Hogue, Gabriela M.; Starnes, Wayne C.

2015-01-01

Worldwide, streams and rivers are facing a suite of pressures that alter water quality and degrade physical habitat, both of which can lead to changes in the composition and richness of fish populations. These potential changes are of particular importance in the Southeast USA, home to one of the richest stream fish assemblages in North America. Using data from 83 stream sites in North Carolina sampled in the 1960’s and the past decade, we used hierarchical Bayesian models to evaluate relationships between species richness and catchment land use and land cover (e.g., agriculture and forest cover). In addition, we examined how the rate of change in species richness over 50 years was related to catchment land use and land cover. We found a negative and positive correlation between forest land cover and agricultural land use and average species richness, respectively. After controlling for introduced species, most (66 %) stream sites showed an increase in native fish species richness, and the magnitude of the rate of increase was positively correlated to the amount of forested land cover in the catchment. Site-specific trends in species richness were not positive, on average, until the percentage forest cover in the network catchment exceeded about 55 %. These results suggest that streams with catchments that have moderate to high (>55 %) levels of forested land in upstream network catchments may be better able to increase the number of native species at a faster rate compared to less-forested catchments.

Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

PubMed Central

2013-01-01

Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

Comparative studies of a new subfamily of human Ste20-like kinases: homodimerization, subcellular localization, and selective activation of MKK3 and p38.

PubMed

Yustein, Jason T; Xia, Liang; Kahlenburg, J Michelle; Robinson, Dan; Templeton, Dennis; Kung, Hsing-Jien

2003-09-18

The Sterile-20 or Ste20 family of serine/threonine kinases is a group of signaling molecules whose physiological roles within mammalian cells are just starting to be elucidated. Here, in this report we present the characterization of three human Ste20-like kinases with greater than 90% similarity within their catalytic domains that define a novel subfamily of Ste20s. Members of this kinase family include rat thousand and one (TAO1) and chicken KFC (kinase from chicken). For the lack of a consensus nomenclature in the literature, in this report, we shall call this family hKFC (for their homology to chicken KFC) and the three members hKFC-A, hKFC-B, and hKFC-C, respectively. These kinases have many similarities including an aminoterminal kinase domain, a serine-rich region, and a coiled-coil configuration within the C-terminus. All three kinases are able to activate the p38 MAP kinase pathway through the specific activation of the upstream MKK3 kinase. We also offer evidence, both theoretical and biochemical, showing that these kinases can undergo self-association. Despite these similarities, these kinases differ in tissue distribution, apparent subcellular localization, and feature structural differences largely within the carboxyl-terminal sequence.

The control of lambda DNA terminase synthesis.

PubMed Central

Murialdo, H; Davidson, A; Chow, S; Gold, M

1987-01-01

Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

Regulatory elements of Caenorhabditis elegans ribosomal protein genes

PubMed Central

2012-01-01

Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635

Complete mitochondrial genome of Chocolate Pansy, Junonia iphita (Lepidoptera: Nymphalidae: Nymphalinae).

PubMed

Vanlalruati, Catherine; Mandal, Surajit De; Gurusubramanian, Guruswami; Senthil Kumar, Nachimuthu

2016-07-01

The complete mitochondrial genome of Junonia iphita was determined to be 15,433 bp in length, including 37 typical mitochondrial genes and an AT-rich region. All the protein coding genes (PCGs) are initiated by typical ATN codons, except cox1 gene that is by CGA codon. Eight genes use complete termination codon (TAA), whereas the cox1, cox2 and nad5 genes end with single T; nad4 and nad1 ends with stop codon TA. All the tRNA show secondary cloverleaf structures except trnS1 (AGN). The A + T rich region is 546 bp in length containing ATAGA motif followed by a 18 bp poly-T stretch, two microsatellite-like (TA)9 elements and 8 bp poly-A stretch immediately upstream of trnM gene.

Probing the Rare Biosphere of the North-West Mediterranean Sea: An Experiment with High Sequencing Effort.

PubMed

Crespo, Bibiana G; Wallhead, Philip J; Logares, Ramiro; Pedrós-Alió, Carlos

2016-01-01

High-throughput sequencing (HTS) techniques have suggested the existence of a wealth of species with very low relative abundance: the rare biosphere. We attempted to exhaustively map this rare biosphere in two water samples by performing an exceptionally deep pyrosequencing analysis (~500,000 final reads per sample). Species data were derived by a 97% identity criterion and various parametric distributions were fitted to the observed counts. Using the best-fitting Sichel distribution we estimate a total species richness of 1,568-1,669 (95% Credible Interval) and 5,027-5,196 for surface and deep water samples respectively, implying that 84-89% of the total richness in those two samples was sequenced, and we predict that a quadrupling of the present sequencing effort would suffice to observe 90% of the total richness in both samples. Comparing the HTS results with a culturing approach we found that most of the cultured taxa were not obtained by HTS, despite the high sequencing effort. Culturing therefore remains a useful tool for uncovering marine bacterial diversity, in addition to its other uses for studying the ecology of marine bacteria.

Ejector-Enhanced, Pulsed, Pressure-Gain Combustor

NASA Technical Reports Server (NTRS)

Paxson, Daniel E.; Dougherty, Kevin T.

2009-01-01

An experimental combination of an off-the-shelf valved pulsejet combustor and an aerodynamically optimized ejector has shown promise as a prototype of improved combustors for gas turbine engines. Despite their name, the constant pressure combustors heretofore used in gas turbine engines exhibit typical pressure losses ranging from 4 to 8 percent of the total pressures delivered by upstream compressors. In contrast, the present ejector-enhanced pulsejet combustor exhibits a pressure rise of about 3.5 percent at overall enthalpy and temperature ratios compatible with those of modern turbomachines. The modest pressure rise translates to a comparable increase in overall engine efficiency and, consequently, a comparable decrease in specific fuel consumption. The ejector-enhanced pulsejet combustor may also offer potential for reducing the emission of harmful exhaust compounds by making it practical to employ a low-loss rich-burn/quench/lean-burn sequence. Like all prior concepts for pressure-gain combustion, the present concept involves an approximation of constant-volume combustion, which is inherently unsteady (in this case, more specifically, cyclic). The consequent unsteadiness in combustor exit flow is generally regarded as detrimental to the performance of downstream turbomachinery. Among other adverse effects, this unsteadiness tends to detract from the thermodynamic benefits of pressure gain. Therefore, it is desirable in any intermittent combustion process to minimize unsteadiness in the exhaust path.

Hmo1 directs pre-initiation complex assembly to an appropriate site on its target gene promoters by masking a nucleosome-free region

PubMed Central

Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro

2011-01-01

Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884

Alternative polyadenylation of the gene transcripts encoding a rat DNA polymerase beta.

PubMed

Konopiński, R; Nowak, R; Siedlecki, J A

1996-10-17

Rat cells produce two different transcripts of DNA polymerase beta (beta-Pol). The low-molecular-weight transcript (1.4 kb) was already sequenced. We report here the cloning and sequencing of the full-length cDNA, corresponding to the high-molecular-weight (HMW) transcript (4.0 kb) of beta-Pol. Sequence data strongly suggest that both transcripts are produced from a single gene by alternative polyadenylation. The HMW transcript contains the entire 1.4 kb transcript sequence and additional 2.2 kb on the 3' end. The 3' UTR of the HMW transcript contains some regulatory sequences which are not present in the 1.4-kb transcript. The A + U-rich fragment and (GU)21 sequence are believed to influence the stability of the mRNA. The functional significance of the A-rich region locally destabilizing double-stranded secondary structure remains unknown.

Functional analysis of the upstream regulatory region of chicken miR-17-92 cluster.

PubMed

Cheng, Min; Zhang, Wen-jian; Xing, Tian-yu; Yan, Xiao-hong; Li, Yu-mao; Li, Hui; Wang, Ning

2016-08-01

miR-17-92 cluster plays important roles in cell proliferation, differentiation, apoptosis, animal development and tumorigenesis. The transcriptional regulation of miR-17-92 cluster has been extensively studied in mammals, but not in birds. To date, avian miR-17-92 cluster genomic structure has not been fully determined. The promoter location and sequence of miR-17-92 cluster have not been determined, due to the existence of a genomic gap sequence upstream of miR-17-92 cluster in all the birds whose genomes have been sequenced. In this study, genome walking was used to close the genomic gap upstream of chicken miR-17-92 cluster. In addition, bioinformatics analysis, reporter gene assay and truncation mutagenesis were used to investigate functional role of the genomic gap sequence. Genome walking analysis showed that the gap region was 1704 bp long, and its GC content was 80.11%. Bioinformatics analysis showed that in the gap region, there was a 200 bp conserved sequence among the tested 10 species (Gallus gallus, Homo sapiens, Pan troglodytes, Bos taurus, Sus scrofa, Rattus norvegicus, Mus musculus, Possum, Danio rerio, Rana nigromaculata), which is core promoter region of mammalian miR-17-92 host gene (MIR17HG). Promoter luciferase reporter gene vector of the gap region was constructed and reporter assay was performed. The result showed that the promoter activity of pGL3-cMIR17HG (-4228/-2506) was 417 times than that of negative control (empty pGL3 basic vector), suggesting that chicken miR-17-92 cluster promoter exists in the gap region. To further gain insight into the promoter structure, two different truncations for the cloned gap sequence were generated by PCR. One had a truncation of 448 bp at the 5'-end and the other had a truncation of 894 bp at the 3'-end. Further reporter analysis showed that compared with the promoter activity of pGL3-cMIR17HG (-4228/-2506), the reporter activities of the 5'-end truncation and the 3'-end truncation were reduced by 19.82% and 60.14%, respectively. These data demonstrated that the important promoter region of chicken miR-17-92 cluster is located in the -3400/-2506 bp region. Our results lay the foundation for revealing the transcriptional regulatory mechanisms of chicken miR-17-92 cluster.

Transcriptional Activation of Pyoluteorin Operon Mediated by the LysR-Type Regulator PltR Bound at a 22 bp lys Box in Pseudomonas aeruginosa M18

PubMed Central

Wang, Guohao; Xu, Yuquan

2012-01-01

Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817

The genomic organization of the Fanconi anemia group A (FAA) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ianzano, L.; Centra, M.; Savino, M.

1997-05-01

Fanconi anemia (FA) is a genetically heterogeneous disease involving at least five genes on the basis of complementation analysis (FAA to FAE). The FAA gene has been recently isolated by two independent approaches, positional and functional cloning. In the present study we describe the genomic structure of the FAA gene. The gene contains 43 exons spanning approximately 80 kb as determined by the alignment of four cosmids and the fine localization of the first and the last exons in restriction fragments of these clones. Exons range from 34 to 188 bp. All but three of the splice sites were consistentmore » with the ag-gt rule. We also describe three alternative splicing events in cDNA clones that result in the loss of exon 37, a 23-bp deletion at the 5{prime} end of exon 41. Sequence analysis of the 5{prime} region upstream of the putative transcription start site showed no obvious TATA and CAAT boxes, but did show a GC-rich region, typical of housekeeping genes. Knowledge of the structure of the FAA gene will provide an invaluable resource for the discovery of mutations in the gene that accounts for about 60-66% of FA patients. 24 refs., 3 figs., 1 tab.« less

Short interspersed elements (SINEs) from insectivores. Two classes of mammalian SINEs distinguished by A-rich tail structure.

PubMed

Borodulina, O R; Kramerov, D A

2001-10-01

Four tRNA-related SINE families were isolated from the genome of the shrew Sorex araneus (SOR element), mole Mogera robusta (TAL element), and hedgehog Mesechinus dauuricus (ERI-1 and ERI-2 elements). Each of these SINEs families is specific for a single Insectivora family: SOR, for Soricidae (shrews); TAL, for Talpidae (moles and desmans); ERI-1 and ERI-2, for Erinaceidae (hedgehogs). There is a long polypyrimidine region (TC-motif) in TAL, ERI-1, and ERI-2 elements located immediately upstream of an A-rich tail with polyadenylation signals (AATAAA) and an RNA polymerase III terminator (T(4-6)) or TCT(3-4)). Ten out of 14 analyzed mammalian tRNA-related SINE families have an A-rich tail similar to that of TAL, ERI-1, and ERI-2 elements. These elements were assigned to class T+. The other four SINEs including SOR element have no polyadenylation signal and transcription terminator in their A-rich tail and were assigned to class T-. Class T+ SINEs occur only in mammals, and most of them have a long polypyrimidine region. Possible models of retroposition of class T+ and T- SINEs are discussed.

Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

PubMed

Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

2008-06-01

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

Balancing gene expression without library construction via a reusable sRNA pool.

PubMed

Ghodasara, Amar; Voigt, Christopher A

2017-07-27

Balancing protein expression is critical when optimizing genetic systems. Typically, this requires library construction to vary the genetic parts controlling each gene, which can be expensive and time-consuming. Here, we develop sRNAs corresponding to 15nt 'target' sequences that can be inserted upstream of a gene. The targeted gene can be repressed from 1.6- to 87-fold by controlling sRNA expression using promoters of different strength. A pool is built where six sRNAs are placed under the control of 16 promoters that span a ∼103-fold range of strengths, yielding ∼107 combinations. This pool can simultaneously optimize up to six genes in a system. This requires building only a single system-specific construct by placing a target sequence upstream of each gene and transforming it with the pre-built sRNA pool. The resulting library is screened and the top clone is sequenced to determine the promoter controlling each sRNA, from which the fold-repression of the genes can be inferred. The system is then rebuilt by rationally selecting parts that implement the optimal expression of each gene. We demonstrate the versatility of this approach by using the same pool to optimize a metabolic pathway (β-carotene) and genetic circuit (XNOR logic gate). © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Legacies of flood reduction on a dryland river

USGS Publications Warehouse

Stromberg, J.C.; Shafroth, P.B.; Hazelton, A.F.

2012-01-01

The Bill Williams (Arizona) is a regulated dryland river that is being managed, in part, for biodiversity via flow management. To inform management, we contrasted riparian plant communities between the Bill Williams and an upstream free-flowing tributary (Santa Maria). Goals of a first study (1996-1997) were to identify environmental controls on herbaceous species richness and compare richness among forest types. Analyses revealed that herbaceous species richness was negatively related to woody stem density, basal area and litter cover and positively related to light levels. Introduced Tamarix spp. was more frequent at the Bill Williams, but all three main forest types (Tamarix, Salix/Populus, Prosopis) had low understory richness, as well as high stem density and low light, on the Bill Williams as compared to the Santa Maria. The few edaphic differences between rivers (higher salinity at Bill Williams) had only weak connections with richness. A second study (2006-2007) focused on floristic richness at larger spatial scales. It revealed that during spring, and for the study cumulatively (spring and fall samplings combined), the riparian zone of the unregulated river had considerably more plant species. Annuals (vs. herbaceous perennials and woody species) showed the largest between-river difference. Relative richness of exotic (vs. native) species did not differ. We conclude that: (1) The legacy of reduced scouring frequency and extent at the Bill Williams has reduced the open space available for colonization by annuals; and (2) Change in forest biomass structure, more so than change in forest composition, is the major driver of changes in plant species richness along this flow-altered river. Our study informs dryland river management options by revealing trade-offs that exist between forest biomass structure and plant species richness. ?? 2010 John Wiley & Sons, Ltd.

Nucleotide sequences of Dictyostelium discoideum developmentally regulated cDNAs rich in (AAC) imply proteins that contain clusters of asparagine, glutamine, or threonine.

PubMed

Shaw, D R; Richter, H; Giorda, R; Ohmachi, T; Ennis, H L

1989-09-01

A Dictyostelium discoideum repetitive element composed of long repeats of the codon (AAC) is found in developmentally regulated transcripts. The concentration of (AAC) sequences is low in mRNA from dormant spores and growing cells and increases markedly during spore germination and multicellular development. The sequence hybridizes to many different sized Dictyostelium DNA restriction fragments indicating that it is scattered throughout the genome. Four cDNA clones isolated contain (AAC) sequences in the deduced coding region. Interestingly, the (AAC)-rich sequences are present in all three reading frames in the deduced proteins, i.e., AAC (asparagine), ACA (threonine) and CAA (glutamine). Three of the clones contain only one of these in-frame so that the individual proteins carry either asparagine, threonine, or glutamine clusters, not mixtures. However, one clone is both glutamine- and asparagine-rich. The (AAC) portion of the transcripts are reiterated 300 times in the haploid genome while the other portions of the cDNAs represent single copy genes, whose sequences show no similarity other than the (AAC) repeats. The repeated sequence is similar to the opa or M sequence found in Drosophila melanogaster notch and homeo box genes and in fly developmentally regulated transcripts. The transcripts are present on polysomes suggesting that they are translated. Although the function of these repeats is unknown, long amino acid repeats are a characteristic feature of extracellular proteins of lower eukaryotes.

Appearance of the pituitary factor Pit-1 increases chromatin remodeling at hypersensitive site III in the human GH locus.

PubMed

Yang, Xiaoyang; Jin, Yan; Cattini, Peter A

2010-07-01

Expression of pituitary and placental members of the human GH and chorionic somatomammotropin (CS) gene family is directed by an upstream remote locus control region (LCR). Pituitary-specific expression of GH requires direct binding of Pit-1 (listed as POU1F1 in the HUGO database) to sequences marked by a hypersensitive site (HS) region (HS I/II) 14.6 kb upstream of the GH-N gene (listed as GH1 in the HUGO database). We used human embryonic kidney 293 (HEK293) cells overexpressing wild-type and mutant Pit-1 proteins as a model system to gain insight into the mechanism by which Pit-1 gains access to the GH LCR. Addition of Pit-1 to these cells increased DNA accessibility at HS III, located 28 kb upstream of the human GH-N gene, in a POU homeodomain-dependent manner, as reflected by effects on histone hyperacetylation and RNA polymerase II activity. Direct binding of Pit-1 to HS III sequences is not supported. However, the potential for binding of ETS family members to this region has been demonstrated, and Pit-1 association with this ETS element in HS III sequences requires the POU homeodomain. Also, both ETS1 and ELK1 co-precipitate from human pituitary extracts using two independent sources of Pit-1 antibodies. Finally, overexpression of ELK1 or Pit-1 expression in HEK293 cells increased GH-N RNA levels. However, while ELK1 overexpression also stimulated placental CS RNA levels, the effect of Pit-1 appeared to correlate with ETS factor levels and target GH-N preferentially. These data are consistent with recruitment and an early role for Pit-1 in remodeling of the GH LCR at the constitutively open HS III through protein-protein interaction.

A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers.

PubMed

Quail, Michael A; Smith, Miriam; Coupland, Paul; Otto, Thomas D; Harris, Simon R; Connor, Thomas R; Bertoni, Anna; Swerdlow, Harold P; Gu, Yong

2012-07-24

Next generation sequencing (NGS) technology has revolutionized genomic and genetic research. The pace of change in this area is rapid with three major new sequencing platforms having been released in 2011: Ion Torrent's PGM, Pacific Biosciences' RS and the Illumina MiSeq. Here we compare the results obtained with those platforms to the performance of the Illumina HiSeq, the current market leader. In order to compare these platforms, and get sufficient coverage depth to allow meaningful analysis, we have sequenced a set of 4 microbial genomes with mean GC content ranging from 19.3 to 67.7%. Together, these represent a comprehensive range of genome content. Here we report our analysis of that sequence data in terms of coverage distribution, bias, GC distribution, variant detection and accuracy. Sequence generated by Ion Torrent, MiSeq and Pacific Biosciences technologies displays near perfect coverage behaviour on GC-rich, neutral and moderately AT-rich genomes, but a profound bias was observed upon sequencing the extremely AT-rich genome of Plasmodium falciparum on the PGM, resulting in no coverage for approximately 30% of the genome. We analysed the ability to call variants from each platform and found that we could call slightly more variants from Ion Torrent data compared to MiSeq data, but at the expense of a higher false positive rate. Variant calling from Pacific Biosciences data was possible but higher coverage depth was required. Context specific errors were observed in both PGM and MiSeq data, but not in that from the Pacific Biosciences platform. All three fast turnaround sequencers evaluated here were able to generate usable sequence. However there are key differences between the quality of that data and the applications it will support.

Diversity of Archaea in Brazilian savanna soils.

PubMed

Catão, E; Castro, A P; Barreto, C C; Krüger, R H; Kyaw, C M

2013-07-01

Although the richness of Bacteria and Fungi in Cerrado' soils has been reported, here we report, for the first time, the archaeal community in Cerrado's soils. DNA extracted from soil of two distinct vegetation types, a dense subtype of sensu strict (cerrado denso) and riverbank forest (mata de galeria), was used to amplify Archaea-specific 16S rRNA gene. All of the fragments sequenced were classified as Archaea into the phylum Thaumarchaeota, predominantly affiliated to groups I.1b and I.1c. Sequences affiliated to the group I.1a were found only in the soil from riverbank forest. Soils from 'cerrado denso' had greater Archaea richness than those from 'mata de galeria' based on the richness indexes and on the rarefaction curve. β-Diversity analysis showed significant differences between the sequences from the two soil areas studied because of their different thaumarchaeal group composition. These results provide information about the third domain of life from Cerrado soils.

Isolation, characterization, and structure analysis of a vacuolar processing enzyme gene (MhVPEγ) from Malus hupehensis (Pamp) Rehd.

PubMed

Ran, Kun; Yang, Hongqiang; Sun, Xiaoli; Li, Qiang; Jiang, Qianqian; Zhang, Weiwei; Shen, Wei

2014-05-01

Vacuolar processing enzymes (VPEs) have received considerable attention recently, as they exhibit caspase-1-like cleavage activity and regulate the process of PCD. However, knowledge about their detailed characteristics and structures is relatively limited. In this study, a gamma vacuolar processing enzyme gene, MhVPEγ, has been isolated from the leaves of Malus hupehensis (Ramp) Rehd. var pinyiensis Jiang. MhVPEγ coded-translated protein sequence comprised of 494 amino acids with a signal peptide and a transmembrane helix structure at N-terminal, peptidase_C13 domain, and vacuolar sorting signal at C-terminal. Consequently, genomic walking approach was performed for the isolation of its upstream sequence. Computational analysis demonstrated several motifs of the promoter exhibiting hypothetic MeJA, ABA, and light-induced characteristics, as well as some typical domains universally discovered in promoter, such as TATA-box and CAAT-box. MhVPEγ transcript level was enhanced during wounding treatment, and WUN-motif, as one of the cis-acting regulatory elements existing in the upstream sequence perhaps regulates its expression. In silico-constructed 3D models revealed that MhCPYL successively interacts with MhVPEγ like that of "Induced Fit-Lock and Key" model, providing molecular conformation evidence that CPY is a direct substrate of VPEγ. This study is the first stride to understand the molecular mechanism of VPEγ and CPYL interactions.

Novel variable number of tandem repeats of gibbon MAOA gene and its evolutionary significance.

PubMed

Choi, Yuri; Jung, Yi-Deun; Ayarpadikannan, Selvam; Koga, Akihiko; Imai, Hiroo; Hirai, Hirohisa; Roos, Christian; Kim, Heui-Soo

2014-08-01

Variable number of tandem repeats (VNTRs) are scattered throughout the primate genome, and genetic variation of these VNTRs have been accumulated during primate radiation. Here, we analyzed VNTRs upstream of the monoamine oxidase A (MAOA) gene in 11 different gibbon species. An abundance of truncated VNTR sequences and copy number differences were observed compared to those of human VNTR sequences. To better understand the biological role of these VNTRs, a luciferase activity assay was conducted and results indicated that selected VNTR sequences of the MAOA gene from human and three different gibbon species (Hylobates klossii, Hylobates lar, and Nomascus concolor) showed silencing ability. Together, these data could be useful for understanding the evolutionary history and functional significance of MAOA VNTR sequences in gibbon species.

The human luteinizing hormone receptor gene promoter: activation by Sp1 and Sp3 and inhibitory regulation.

PubMed

Geng, Y; Tsai-Morris, C H; Zhang, Y; Dufau, M L

1999-09-24

To understand the transcriptional mechanism(s) of human LH receptor (LHR) gene expression, we have identified the dominant functional cis-elements that regulate the activity of the promoter domain (-1 to -176 bp from ATG). Mutagenesis demonstrated that the promoter activity was dependent on two Sp1 domains (-79 bp, -120 bp) in a transformed normal placental cell (PLC) and the choriocarcinoma JAR cell. Both elements interacted with endogenous Sp1 and Sp3 factors but not with Sp2 or Sp4. In Drosophila SL2 cells, the promoter was activated by either Sp1 or Sp3. An ERE half-site (EREhs) at -174 bp was inhibitory (by 100%), but was unresponsive to estradiol and did not bind the estrogen receptor or orphan receptors ERR1 and SF-1. The 5' upstream sequence (-177 to -2056 bp) inhibited promoter activity in PLC by 60%, but only minimally in JAR cells. Activation of the human LHR promoter through Sp1/3 factors is negatively regulated through EREhs and upstream sequences to exert control of gene expression. Copyright 1999 Academic Press.

Nucleotide sequences and regulational analysis of genes involved in conversion of aniline to catechol in Pseudomonas putida UCC22(pTDN1).

PubMed Central

Fukumori, F; Saint, C P

1997-01-01

A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291

Relationships of field habitat measurements, visual habitat indices, and land cover to benthic macroinvertebrates in urbanized streams of the Santa Clara Valley, California

USGS Publications Warehouse

Fend, S.V.; Carter, J.L.; Kearns, F.R.

2005-01-01

We evaluated several approaches for measuring natural and anthropogenic habitat characteristics to predict benthic macroinvertebrate assemblages over a range of urban intensity at 85 stream sites in the Santa Clara Valley, California. Land cover was summarized as percentage urban land cover and impervious area within upstream buffers and the upstream subwatersheds. Field measurements characterized water chemistry, channel slope, sediment, and riparian canopy. In . addition to applying the visual-based habitat assessment in U.S. Environmental Protection Agency's rapid bioassessment protocol, we developed a simplified urban habitat assessment index based on turbidity, fine sediment deposition, riparian condition, and channel modification. Natural and anthropogenic habitat variables covaried along longitudinal stream gradients and were highly correlated with elevation. At the scale of the entire watershed, benthic macroinvertebrate measures were equally correlated with variables expressing natural gradients and urbanization effects. When natural gradients were reduced by partitioning sites into ecoregion subsection groupings, habitat variables most highly correlated with macroinvertebrate measures differed between upland and valley floor site groups. Among the valley floor sites, channel slope and physical modification of channel and riparian habitats appeared more important than upstream land cover or water quality in determining macroinvertebrate richness and ordination scores. Among upland sites, effects of upstream reservoir releases on habitat quality appeared important. Rapid habitat evaluation methods appeared to be an effective method for describing habitat features important to benthic macroinvertebrates when adapted for the region and the disturbance of interest. ?? 2005 by the American Fisheries Society.

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

PubMed

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

DNA sequence-specific dimeric bisbenzimidazoles DBP(n) and DBPA(n) as inhibitors of H-NS silencing in bacterial cells.

PubMed

Melkina, Olga E; Koval, Vasilii S; Ivanov, Alexander A; Zhuze, Alexei L; Zavilgelsky, Gennadii B

2018-03-01

DNA sequence-specific fluorescent dimeric bisbenzimidazoles DBP(n) and DBPA(n), noncovalently interacting with A-T pairs in the minor groove of double-stranded DNA were used for studying and monitoring the expression of histone-like H-NS-dependent promoters. Histone-like H-NS selectively binds to AT-rich segments of DNA and silences a large number of genes in bacterial chromosomes. The H-NS-dependent promoters of Quorum Sensing (QS)-regulated lux operons of the marine bacteria mesophilic Aliivibrio fischeri, psychrophilic Aliivibrio logei were used. Escherichia coli lux biosensors were constructed by cloning fragments bearing QS-regulated promoters into the vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE genes. It was shown that the dimeric bisbenzimidazoles DBP(n) and DBPA(n) counteract the H-NS silencing activity. Thus, the presence of DBP(n) or DBPA(n) in the medium leads to an approximately 10-100-fold increase in the level of transcription of QS promoters in E. coli hns + . The largest decrease in the level of H-NS repression was observed using ligands containing a linker with a length of ca. 18Å, such as DBP(2) and DBPA(2). Ligands containing linkers with n=1 and 3 are an order of magnitude less active; ligands with n=4 are inactive. DBPA(2) exhibits activity starting with a concentration of 0.5μM; the minimum concentration of DBP(2) is 5-7 times higher. It is suggested that A-T pairs located at five nucleotide pair intervals, which correspond to the linker length in highly active ligands with n=2, play a key role in the structure of H-NS-binding sites in QS-regulated promoters. Copyright © 2017 Elsevier GmbH. All rights reserved.

Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

PubMed Central

Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

1987-01-01

The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

PubMed

Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

2016-03-22

Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

Molecular equilibria and condensation sequences in carbon rich gases

NASA Technical Reports Server (NTRS)

Sharp, C. M.; Wasserburg, G. J.

1993-01-01

Chemical equilibria in stellar atmospheres have been investigated by many authors. Lattimer, Schramm, and Grossman presented calculations in both O rich and C rich environments and predicted possible presolar condensates. A recent paper by Cherchneff and Barker considered a C rich composition with PAH's included in the calculations. However, the condensation sequences of C bearing species have not been investigated in detail. In a carbon rich gas surrounding an AGB star, it is often assumed that graphite (or diamond) condenses out before TiC and SiC. However, Lattimer et al. found some conditions under which TiC condenses before graphite. We have performed molecular equilibrium calculations to establish the stability fields of C(s), TiC(s), and SiC(s) and other high temperature phases under conditions of different pressures and C/O. The preserved presolar interstellar dust grains so far discovered in meteorites are graphite, diamond, SiC, TiC, and possibly Al2O3.

Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

NASA Astrophysics Data System (ADS)

Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

2016-03-01

Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

Sensitivity of the North Atlantic Basin to cyclic climatic forcing during the early Cretaceous

USGS Publications Warehouse

Dean, W.E.; Arthur, M.A.

1999-01-01

Striking cyclic interbeds of laminated dark-olive to black marlstone and bioturbated white to light-gray limestone of Neocomian (Early Cretaceous) age have been recovered at Deep Sea Drilling Project (DSDP) and Ocean Drilling Project (ODP) sites in the North Atlantic. These Neocomian sequences are equivalent to the Maiolica Formation that outcrops in the Tethyan regions of the Mediterranean and to thick limestone sequences of the Vocontian Trough of France. This lithologic unit marks the widespread deposition of biogenic carbonate over much of the North Atlantic and Tethyan seafloor during a time of overall low sealevel and a deep carbonate compensation depth. The dark clay-rich interbeds typically are rich in organic carbon (OC) with up to 5.5% OC in sequences in the eastern North Atlantic. These eastern North Atlantic sequences off northwest Africa, contain more abundant and better preserved hydrogen-rich, algal organic matter (type II kerogen) relative to the western North Atlantic, probably in response to coastal upwelling induced by an eastern boundary current in the young North Atlantic Ocean. The more abundant algal organic matter in sequences in the eastern North Atlantic is also expressed in the isotopic composition of the carbon in that organic matter. In contrast, organic matter in Neocomian sequences in the western North Atlantic along the continental margin of North America has geochemical and optical characteristics of herbaceous, woody, hydrogen-poor, humic, type III kerogen. The inorganic geochemical characteristics of the dark clay-rich (80% CaCO3) interbeds in both the eastern and western basins of the North Atlantic suggest that they contain minor amounts of relatively unweathered eolian dust derived from northwest Africa during dry intervals.

Revisiting Robustness and Evolvability: Evolution in Weighted Genotype Spaces

PubMed Central

Partha, Raghavendran; Raman, Karthik

2014-01-01

Robustness and evolvability are highly intertwined properties of biological systems. The relationship between these properties determines how biological systems are able to withstand mutations and show variation in response to them. Computational studies have explored the relationship between these two properties using neutral networks of RNA sequences (genotype) and their secondary structures (phenotype) as a model system. However, these studies have assumed every mutation to a sequence to be equally likely; the differences in the likelihood of the occurrence of various mutations, and the consequence of probabilistic nature of the mutations in such a system have previously been ignored. Associating probabilities to mutations essentially results in the weighting of genotype space. We here perform a comparative analysis of weighted and unweighted neutral networks of RNA sequences, and subsequently explore the relationship between robustness and evolvability. We show that assuming an equal likelihood for all mutations (as in an unweighted network), underestimates robustness and overestimates evolvability of a system. In spite of discarding this assumption, we observe that a negative correlation between sequence (genotype) robustness and sequence evolvability persists, and also that structure (phenotype) robustness promotes structure evolvability, as observed in earlier studies using unweighted networks. We also study the effects of base composition bias on robustness and evolvability. Particularly, we explore the association between robustness and evolvability in a sequence space that is AU-rich – sequences with an AU content of 80% or higher, compared to a normal (unbiased) sequence space. We find that evolvability of both sequences and structures in an AU-rich space is lesser compared to the normal space, and robustness higher. We also observe that AU-rich populations evolving on neutral networks of phenotypes, can access less phenotypic variation compared to normal populations evolving on neutral networks. PMID:25390641

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

PubMed

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

PubMed Central

O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

2014-01-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Concrete alteration due to 55 years of exposure to river water: Chemical and mineralogical characterisation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosenqvist, Martin; Bertron, Alexandra; Fridh, Katja

This article presents a study on concrete alteration mechanisms due to 55 years of exposure to river water. Many hydro power structures in cold regions suffer from concrete deterioration at the waterline. Progressive disintegration of the concrete surface leads to exposure of the coarse aggregate and eventually the reinforcing steel. Concrete cylinders drilled out at four vertically different locations on the upstream face of a concrete dam were analysed by electron microprobe analysis, X-ray diffraction, thermogravimetry and scanning electron microscopy. Long-term exposure to the river water, which is regarded as soft water, has led to chemical and mineralogical zonation ofmore » the cement paste. Up to five zones with different chemical and mineralogical composition, parallel to the upstream face, were observed in the outermost 8–9 mm of the concrete. Decalcification, precipitation of secondary ettringite and the formation of a magnesium-rich silica gel constitute the major changes that define the zones.« less

Non-synonymous variations in cancer and their effects on the human proteome: workflow for NGS data biocuration and proteome-wide analysis of TCGA data.

PubMed

Cole, Charles; Krampis, Konstantinos; Karagiannis, Konstantinos; Almeida, Jonas S; Faison, William J; Motwani, Mona; Wan, Quan; Golikov, Anton; Pan, Yang; Simonyan, Vahan; Mazumder, Raja

2014-01-27

Next-generation sequencing (NGS) technologies have resulted in petabytes of scattered data, decentralized in archives, databases and sometimes in isolated hard-disks which are inaccessible for browsing and analysis. It is expected that curated secondary databases will help organize some of this Big Data thereby allowing users better navigate, search and compute on it. To address the above challenge, we have implemented a NGS biocuration workflow and are analyzing short read sequences and associated metadata from cancer patients to better understand the human variome. Curation of variation and other related information from control (normal tissue) and case (tumor) samples will provide comprehensive background information that can be used in genomic medicine research and application studies. Our approach includes a CloudBioLinux Virtual Machine which is used upstream of an integrated High-performance Integrated Virtual Environment (HIVE) that encapsulates Curated Short Read archive (CSR) and a proteome-wide variation effect analysis tool (SNVDis). As a proof-of-concept, we have curated and analyzed control and case breast cancer datasets from the NCI cancer genomics program - The Cancer Genome Atlas (TCGA). Our efforts include reviewing and recording in CSR available clinical information on patients, mapping of the reads to the reference followed by identification of non-synonymous Single Nucleotide Variations (nsSNVs) and integrating the data with tools that allow analysis of effect nsSNVs on the human proteome. Furthermore, we have also developed a novel phylogenetic analysis algorithm that uses SNV positions and can be used to classify the patient population. The workflow described here lays the foundation for analysis of short read sequence data to identify rare and novel SNVs that are not present in dbSNP and therefore provides a more comprehensive understanding of the human variome. Variation results for single genes as well as the entire study are available from the CSR website (http://hive.biochemistry.gwu.edu/dna.cgi?cmd=csr). Availability of thousands of sequenced samples from patients provides a rich repository of sequence information that can be utilized to identify individual level SNVs and their effect on the human proteome beyond what the dbSNP database provides.

Non-synonymous variations in cancer and their effects on the human proteome: workflow for NGS data biocuration and proteome-wide analysis of TCGA data

PubMed Central

2014-01-01

Background Next-generation sequencing (NGS) technologies have resulted in petabytes of scattered data, decentralized in archives, databases and sometimes in isolated hard-disks which are inaccessible for browsing and analysis. It is expected that curated secondary databases will help organize some of this Big Data thereby allowing users better navigate, search and compute on it. Results To address the above challenge, we have implemented a NGS biocuration workflow and are analyzing short read sequences and associated metadata from cancer patients to better understand the human variome. Curation of variation and other related information from control (normal tissue) and case (tumor) samples will provide comprehensive background information that can be used in genomic medicine research and application studies. Our approach includes a CloudBioLinux Virtual Machine which is used upstream of an integrated High-performance Integrated Virtual Environment (HIVE) that encapsulates Curated Short Read archive (CSR) and a proteome-wide variation effect analysis tool (SNVDis). As a proof-of-concept, we have curated and analyzed control and case breast cancer datasets from the NCI cancer genomics program - The Cancer Genome Atlas (TCGA). Our efforts include reviewing and recording in CSR available clinical information on patients, mapping of the reads to the reference followed by identification of non-synonymous Single Nucleotide Variations (nsSNVs) and integrating the data with tools that allow analysis of effect nsSNVs on the human proteome. Furthermore, we have also developed a novel phylogenetic analysis algorithm that uses SNV positions and can be used to classify the patient population. The workflow described here lays the foundation for analysis of short read sequence data to identify rare and novel SNVs that are not present in dbSNP and therefore provides a more comprehensive understanding of the human variome. Variation results for single genes as well as the entire study are available from the CSR website (http://hive.biochemistry.gwu.edu/dna.cgi?cmd=csr). Conclusions Availability of thousands of sequenced samples from patients provides a rich repository of sequence information that can be utilized to identify individual level SNVs and their effect on the human proteome beyond what the dbSNP database provides. PMID:24467687

Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

PubMed Central

Stewart, A F; Willis, I M; Mackinlay, A G

1984-01-01

The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

Looking Towards Curiosity's Canyon Path: a 4 km Sequence of Gully, Debris Deposits, and Fan/Deltas Which are Bordered by a Sloping Bedform-Capped Plain and Crossed by Lake Shorelines

NASA Technical Reports Server (NTRS)

Dietrich, W. E.; Palucis, M. C.; Parker, T.; Rubin, D.; dePablo, M. A.; Oehler, D. Z.; Bridges, N. T.

2014-01-01

The Curiosity Rover is headed towards layered outcrops that appear to be rich in phyllosilicates and sulphates with the expectation of an eventual ascent up Mt. Sharp. One likely will take the rover up a well-defined canyon. Inspection of CTX and HiRISE imagery and topography (5 m contour intervals) reveal a rich geomorphic sequence that may be encountered during the journey.

Biological assessment of aquaculture effects on effluent-receiving streams in Ghana using structural and functional composition of fish and macroinvertebrate assemblages.

PubMed

Ansah, Yaw Boamah; Frimpong, Emmanuel A; Amisah, Stephen

2012-07-01

Biological assessment of aquatic ecosystems is widely employed as an alternative or complement to chemical and toxicity testing due to numerous advantages of using biota to determine ecosystem condition. These advantages, especially to developing countries, include the relatively low cost and technical requirements. This study was conducted to determine the biological impacts of aquaculture operations on effluent-receiving streams in the Ashanti Region of Ghana. We collected water, fish and benthic macroinvertebrate samples from 12 aquaculture effluent-receiving streams upstream and downstream of fish farms and 12 reference streams between May and August of 2009, and then calculated structural and functional metrics for biotic assemblages. Fish species with non-guarding mode of reproduction were more abundant in reference streams than downstream (P = 0.0214) and upstream (P = 0.0251), and sand-detritus spawning fish were less predominant in reference stream than upstream (P = 0.0222) and marginally less in downstream locations (P = 0.0539). A possible subsidy-stress response of macroinvertebrate family richness and abundance was also observed, with nutrient (nitrogen) augmentation from aquaculture and other farming activities likely. Generally, there were no, or only marginal differences among locations downstream and upstream of fish farms and in reference streams in terms of several other biotic metrics considered. Therefore, the scale of impact in the future will depend not only on the management of nutrient augmentation from pond effluents, but also on the consideration of nutrient discharges from other industries like fruit and vegetable farming within the study area.

Optimizing Illumina next-generation sequencing library preparation for extremely AT-biased genomes.

PubMed

Oyola, Samuel O; Otto, Thomas D; Gu, Yong; Maslen, Gareth; Manske, Magnus; Campino, Susana; Turner, Daniel J; Macinnis, Bronwyn; Kwiatkowski, Dominic P; Swerdlow, Harold P; Quail, Michael A

2012-01-03

Massively parallel sequencing technology is revolutionizing approaches to genomic and genetic research. Since its advent, the scale and efficiency of Next-Generation Sequencing (NGS) has rapidly improved. In spite of this success, sequencing genomes or genomic regions with extremely biased base composition is still a great challenge to the currently available NGS platforms. The genomes of some important pathogenic organisms like Plasmodium falciparum (high AT content) and Mycobacterium tuberculosis (high GC content) display extremes of base composition. The standard library preparation procedures that employ PCR amplification have been shown to cause uneven read coverage particularly across AT and GC rich regions, leading to problems in genome assembly and variation analyses. Alternative library-preparation approaches that omit PCR amplification require large quantities of starting material and hence are not suitable for small amounts of DNA/RNA such as those from clinical isolates. We have developed and optimized library-preparation procedures suitable for low quantity starting material and tolerant to extremely high AT content sequences. We have used our optimized conditions in parallel with standard methods to prepare Illumina sequencing libraries from a non-clinical and a clinical isolate (containing ~53% host contamination). By analyzing and comparing the quality of sequence data generated, we show that our optimized conditions that involve a PCR additive (TMAC), produces amplified libraries with improved coverage of extremely AT-rich regions and reduced bias toward GC neutral templates. We have developed a robust and optimized Next-Generation Sequencing library amplification method suitable for extremely AT-rich genomes. The new amplification conditions significantly reduce bias and retain the complexity of either extremes of base composition. This development will greatly benefit sequencing clinical samples that often require amplification due to low mass of DNA starting material.

An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Damiani, R.D. Jr.; Wessler, S.R.

1993-09-01

The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open readingmore » frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.« less

Structural polymorphism of a cytosine-rich DNA sequence forming i-motif structure: Exploring pH based biosensors.

PubMed

Ahmed, Saami; Kaushik, Mahima; Chaudhary, Swati; Kukreti, Shrikant

2018-05-01

Sequence recognition and conformational polymorphism enable DNA to emerge out as a substantial tool in fabricating the devices within nano-dimensions. These DNA associated nano devices work on the principle of conformational switches, which can be facilitated by many factors like sequence of DNA/RNA strand, change in pH or temperature, enzyme or ligand interactions etc. Thus, controlling these DNA conformational changes to acquire the desired function is significant for evolving DNA hybridization biosensor, used in genetic screening and molecular diagnosis. For exploring this conformational switching ability of cytosine-rich DNA oligonucleotides as a function of pH for their potential usage as biosensors, this study has been designed. A C-rich stretch of DNA sequence (5'-TCCCCCAATTAATTCCCCCA-3'; SG20c) has been investigated using UV-Thermal denaturation, poly-acrylamide gel electrophoresis and CD spectroscopy. The SG20c sequence is shown to adopt various topologies of i-motif structure at low pH. This pH dependent transition of SG20c from unstructured single strand to unimolecular and bimolecular i-motif structures can further be exploited for its utilization as switching on/off pH-based biosensors. Copyright © 2018. Published by Elsevier B.V.

A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus

PubMed Central

May, Jared; Johnson, Philip; Saleem, Huma

2017-01-01

ABSTRACT To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5′ cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo. An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo. Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5′ cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary structure has IRES activity and produces low levels of viral coat protein in vitro and in vivo. Our findings may be applicable to cellular mRNA IRES that also have little or no sequences/structures in common. PMID:28179526

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar

PubMed Central

Smith, M. Alex; Fisher, Brian L; Hebert, Paul D.N

2005-01-01

The role of DNA barcoding as a tool to accelerate the inventory and analysis of diversity for hyperdiverse arthropods is tested using ants in Madagascar. We demonstrate how DNA barcoding helps address the failure of current inventory methods to rapidly respond to pressing biodiversity needs, specifically in the assessment of richness and turnover across landscapes with hyperdiverse taxa. In a comparison of inventories at four localities in northern Madagascar, patterns of richness were not significantly different when richness was determined using morphological taxonomy (morphospecies) or sequence divergence thresholds (Molecular Operational Taxonomic Unit(s); MOTU). However, sequence-based methods tended to yield greater richness and significantly lower indices of similarity than morphological taxonomy. MOTU determined using our molecular technique were a remarkably local phenomenon—indicative of highly restricted dispersal and/or long-term isolation. In cases where molecular and morphological methods differed in their assignment of individuals to categories, the morphological estimate was always more conservative than the molecular estimate. In those cases where morphospecies descriptions collapsed distinct molecular groups, sequence divergences of 16% (on average) were contained within the same morphospecies. Such high divergences highlight taxa for further detailed genetic, morphological, life history, and behavioral studies. PMID:16214741

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Time-resolved PIV investigation of flashback in stratified swirl flames of hydrogen-rich fuel

NASA Astrophysics Data System (ADS)

Ranjan, Rakesh; Clemens, Noel

2016-11-01

Hydrogen is one of the promising alternative fuels to achieve greener power generation. However, susceptibility of flashback in swirl flames of hydrogen-rich fuels acts as a major barrier to its adoption in gas turbine combustors. The current study seeks to understand the flow-flame interaction during the flashback of the hydrogen-rich flame in stratified conditions. Flashback experiments are conducted with a model combustor equipped with an axial swirler and a center-body. Fuel is injected in the main swirl flow via the fuel ports on the swirler vanes. To achieve mean radial stratification, these fuel ports are located at a radial location closer to the outer wall of the mixing tube. Stratification in the flow is assessed by employing Anisole PLIF imaging. Flashback is triggered by a rapid increase in the global equivalence ratio. The upstream propagation of the flame is investigated by employing time-resolved stereoscopic PIV and chemiluminescence imaging. Stratification leads to substantially different flame propagation behavior as well as increased flame surface wrinkling. We gratefully acknowledge the sponsorship by the DOE NETL under Grant DEFC2611-FE0007107.

New insights into the paleolake sequence of Baumkirchen (Austria): multiple lake phases and a minor ice advance during MIS 4?

NASA Astrophysics Data System (ADS)

Barrett, Samuel; Starnberger, Reinhard; Spötl, Christoph; Brauer, Achim; Tjallingii, Rik; Dulski, Peter; Abfalterer, Christof

2015-04-01

The sequence of pre-LGM lacustrine sediments at Baumkirchen (Austria) provides a key record in Alpine Quaternary stratigraphy. These sediments from within the boundary of the Alps potentially provide unique insights into the regional paleoclimate. Recent drilling revealed at least ~250m (the base was not reached) of almost entirely mm- to cm-scale lacustrine sediments. The laminated sediments are comprised of alternations between clayey silt and event layers of medium silt to fine sand. The sequence is interrupted only by a short section of gravel supported in an unlaminated clay-rich matrix. Optically stimulated luminescence dating identifies two distinct sequences: the upper sequence spanning mid-late Marine Isotope Stage (MIS) 3 (~33 to ~45 ka BP), agreeing with existing calibrated radiocarbon ages, and the lower section dating to MIS 4 (~59 to ~73 ka BP). Whether the hiatus is an erosional unconformity, or if the sequences represent two separate lake phases is unclear. Although the precise location of the hiatus is hard to identify, the gravel-rich section lies at the very top of the lower sequence. Pebbles in these gravels are largely angular and contain a significant proportion of non-local, regional lithologies. Such gravels are absent in the remainder of the entire 250 m-thick sequence and hence suggest a unique event rather than e.g. an interfingering local delta gravel foresets with the basin sediments. The gravels are therefore likely to be ice-rafted debris from icebergs from nearby glaciers calving into the lake. This therefore represents the first sedimentological evidence of a MIS 4 ice advance in the Eastern Alps. X-ray fluorescence analysis (ITRAX core scanning) of event layers indicates a strong change in the geochemical composition from generally K, Zr and Ti-rich layers in the upper sequence to mainly Ca and/or Si-rich layers in the lower sequence. X-ray diffraction analysis shows the Ca and Si signals to be controlled by carbonate (both calcite and dolomite) and quartz, respectively. This suggests a change in dominant sediment source and may indicate a change in catchment or paleolake configuration, re-raising the long outstanding question of how the lake or lakes were dammed.

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster.

PubMed

Pool, John E; Aquadro, Charles F

2007-07-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kb upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony.

[Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

PubMed

Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

2015-04-01

This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.

PubMed

Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R

1987-01-01

The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.

Plasmodium falciparum Nucleosomes Exhibit Reduced Stability and Lost Sequence Dependent Nucleosome Positioning

PubMed Central

Silberhorn, Elisabeth; Schwartz, Uwe; Symelka, Anne; de Koning-Ward, Tania; Längst, Gernot

2016-01-01

The packaging and organization of genomic DNA into chromatin represents an additional regulatory layer of gene expression, with specific nucleosome positions that restrict the accessibility of regulatory DNA elements. The mechanisms that position nucleosomes in vivo are thought to depend on the biophysical properties of the histones, sequence patterns, like phased di-nucleotide repeats and the architecture of the histone octamer that folds DNA in 1.65 tight turns. Comparative studies of human and P. falciparum histones reveal that the latter have a strongly reduced ability to recognize internal sequence dependent nucleosome positioning signals. In contrast, the nucleosomes are positioned by AT-repeat sequences flanking nucleosomes in vivo and in vitro. Further, the strong sequence variations in the plasmodium histones, compared to other mammalian histones, do not present adaptations to its AT-rich genome. Human and parasite histones bind with higher affinity to GC-rich DNA and with lower affinity to AT-rich DNA. However, the plasmodium nucleosomes are overall less stable, with increased temperature induced mobility, decreased salt stability of the histones H2A and H2B and considerable reduced binding affinity to GC-rich DNA, as compared with the human nucleosomes. In addition, we show that plasmodium histone octamers form the shortest known nucleosome repeat length (155bp) in vitro and in vivo. Our data suggest that the biochemical properties of the parasite histones are distinct from the typical characteristics of other eukaryotic histones and these properties reflect the increased accessibility of the P. falciparum genome. PMID:28033404

Deterministic chaos in a model of a simple delta network

NASA Astrophysics Data System (ADS)

Salter, G.; Voller, V. R.; Paola, C.

2017-12-01

An important aspect of delta dynamics is how sediment flux is partitioned to different parts of the delta through time, affecting patterns of land-building/loss, and the formation of stratigraphy. Here, we present results from a model of a simple distributary network consisting of two orders of bifurcations: an upstream channel splits into two branches, each of which splits into two additional branches. The 1D bed elevation profiles of each branch are modeled through time, and a nodal condition accounting for a transverse bed slope just upstream of the bifurcation is used to partition the flow at bifurcations. The model generates surprisingly complex dynamics despite its simplicity. Constrained by the need to distribute sediment evenly between branches in the long-run, the system undergoes repeated full and partial avulsions. We find that the solution to the system is aperiodic, but bounded. We also observe a sensitive dependence on the initial conditions: simulations started with slightly different initial conditions diverge exponentially. These observations are the hallmark of chaos, summarized by Edward Lorenz as "where the present determines the future, but the approximate present does not approximately determine the future." In our model, chaos results from the two-way coupling between upstream and downstream bifurcations. We find that a single bifurcation may be periodic, but it is never chaotic. However, when coupled, avulsions in the upstream channel change the upstream boundary conditions for the downstream bifurcations, and conversely, avulsions in the downstream bifurcations affect the slope of their feeder channel, propagating upstream to the first bifurcation. We explore how the system generates stratigraphy, using the Shields stress at the time of deposition as a proxy. We compare the stratigraphy to the single bifurcation case, which is periodic rather than chaotic. We also examine stratigraphic completeness, and find that hiatuses in the upstream portion of the domain tend to be erosional, whereas hiatuses further downstream tend to represent pauses. Our work suggests that deltas have a limited window of predictability, and indicates that chaotic and cyclic avulsion sequences should be distinguishable in the stratigraphic record.

Agaricus bisporus genome sequence: a commentary.

PubMed

Kerrigan, Richard W; Challen, Michael P; Burton, Kerry S

2013-06-01

The genomes of two isolates of Agaricus bisporus have been sequenced recently. This soil-inhabiting fungus has a wide geographical distribution in nature and it is also cultivated in an industrialized indoor process ($4.7bn annual worldwide value) to produce edible mushrooms. Previously this lignocellulosic fungus has resisted precise econutritional classification, i.e. into white- or brown-rot decomposers. The generation of the genome sequence and transcriptomic analyses has revealed a new classification, 'humicolous', for species adapted to grow in humic-rich, partially decomposed leaf material. The Agaricus biporus genomes contain a collection of polysaccharide and lignin-degrading genes and more interestingly an expanded number of genes (relative to other lignocellulosic fungi) that enhance degradation of lignin derivatives, i.e. heme-thiolate peroxidases and β-etherases. A motif that is hypothesized to be a promoter element in the humicolous adaptation suite is present in a large number of genes specifically up-regulated when the mycelium is grown on humic-rich substrate. The genome sequence of A. bisporus offers a platform to explore fungal biology in carbon-rich soil environments and terrestrial cycling of carbon, nitrogen, phosphorus and potassium. Copyright © 2013 Elsevier Inc. All rights reserved.

RRE: a tool for the extraction of non-coding regions surrounding annotated genes from genomic datasets.

PubMed

Lazzarato, F; Franceschinis, G; Botta, M; Cordero, F; Calogero, R A

2004-11-01

RRE allows the extraction of non-coding regions surrounding a coding sequence [i.e. gene upstream region, 5'-untranslated region (5'-UTR), introns, 3'-UTR, downstream region] from annotated genomic datasets available at NCBI. RRE parser and web-based interface are accessible at http://www.bioinformatica.unito.it/bioinformatics/rre/rre.html

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

Genomic analysis of a new mammalian distal-less gene: Dlx7.

PubMed

Nakamura, S; Stock, D W; Wydner, K L; Bollekens, J A; Takeshita, K; Nagai, B M; Chiba, S; Kitamura, T; Freeland, T M; Zhao, Z; Minowada, J; Lawrence, J B; Weiss, K M; Ruddle, F H

1996-12-15

We have cloned a new Dlx gene (Dlx7) from human and mouse that may represent the mammalian orthologue of the newt gene NvHBox-5. The homeodomains of these genes are highly similar to all other vertebrate Dlx genes, and regions of similarity also exist between mammalian Dlx7 and a subset of vertebrate Dlx genes downstream of the homeodomain. The sequence divergence between human and mouse Dlx7 in these regions is greater than that predicted from comparisons of other vertebrate Dlx genes, however, and there is little sequence similarity upstream of the homeodomain both between these two genes and with other Dlx genes. We present evidence for alternative splicing of mouse Dlx7 upstream of the homeodomain that may account for some of this divergence. We have mapped human DLX7 distal to the 5' end of the HOXB cluster at an estimated distance of between 1 and 2 Mb by FISH. Both the human and the mouse Dlx7 are shown to be closely linked to Dlx3 in a convergently transcribed orientation. These mapping results support the possibility that vertebrate distal-less genes have been duplicated in concert with the Hox clusters.

Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

1987-01-01

The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data

PubMed Central

2010-01-01

Background In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. Results The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Conclusions Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of interest, even when the latter display a high complexity (PROSITE signatures for example). In addition, these exact algorithms allow us to avoid the edge effect observed under the single sequence approximation, which leads to erroneous results, especially when the marginal distribution of the model displays a slow convergence toward the stationary distribution. We end up with a discussion on our method and on its potential improvements. PMID:20205909

Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data.

PubMed

Nuel, Gregory; Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude

2010-01-26

In bioinformatics it is common to search for a pattern of interest in a potentially large set of rather short sequences (upstream gene regions, proteins, exons, etc.). Although many methodological approaches allow practitioners to compute the distribution of a pattern count in a random sequence generated by a Markov source, no specific developments have taken into account the counting of occurrences in a set of independent sequences. We aim to address this problem by deriving efficient approaches and algorithms to perform these computations both for low and high complexity patterns in the framework of homogeneous or heterogeneous Markov models. The latest advances in the field allowed us to use a technique of optimal Markov chain embedding based on deterministic finite automata to introduce three innovative algorithms. Algorithm 1 is the only one able to deal with heterogeneous models. It also permits to avoid any product of convolution of the pattern distribution in individual sequences. When working with homogeneous models, Algorithm 2 yields a dramatic reduction in the complexity by taking advantage of previous computations to obtain moment generating functions efficiently. In the particular case of low or moderate complexity patterns, Algorithm 3 exploits power computation and binary decomposition to further reduce the time complexity to a logarithmic scale. All these algorithms and their relative interest in comparison with existing ones were then tested and discussed on a toy-example and three biological data sets: structural patterns in protein loop structures, PROSITE signatures in a bacterial proteome, and transcription factors in upstream gene regions. On these data sets, we also compared our exact approaches to the tempting approximation that consists in concatenating the sequences in the data set into a single sequence. Our algorithms prove to be effective and able to handle real data sets with multiple sequences, as well as biological patterns of interest, even when the latter display a high complexity (PROSITE signatures for example). In addition, these exact algorithms allow us to avoid the edge effect observed under the single sequence approximation, which leads to erroneous results, especially when the marginal distribution of the model displays a slow convergence toward the stationary distribution. We end up with a discussion on our method and on its potential improvements.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Comparative RNA-Sequence Transcriptome Analysis of Phenolic Acid Metabolism in Salvia miltiorrhiza, a Traditional Chinese Medicine Model Plant

PubMed Central

Song, Zhenqiao; Guo, Linlin; Liu, Tian; Lin, Caicai; Wang, Jianhua

2017-01-01

Salvia miltiorrhiza Bunge is an important traditional Chinese medicine (TCM). In this study, two S. miltiorrhiza genotypes (BH18 and ZH23) with different phenolic acid concentrations were used for de novo RNA sequencing (RNA-seq). A total of 170,787 transcripts and 56,216 unigenes were obtained. There were 670 differentially expressed genes (DEGs) identified between BH18 and ZH23, 250 of which were upregulated in ZH23, with genes involved in the phenylpropanoid biosynthesis pathway being the most upregulated genes. Nine genes involved in the lignin biosynthesis pathway were upregulated in BH18 and thus result in higher lignin content in BH18. However, expression profiles of most genes involved in the core common upstream phenylpropanoid biosynthesis pathway were higher in ZH23 than that in BH18. These results indicated that genes involved in the core common upstream phenylpropanoid biosynthesis pathway might play an important role in downstream secondary metabolism and demonstrated that lignin biosynthesis was a putative partially competing pathway with phenolic acid biosynthesis. The results of this study expanded our understanding of the regulation of phenolic acid biosynthesis in S. miltiorrhiza. PMID:28194403

Tracing redox processes during paleoclimatic changes in the Neoproterozoic: Stable chromium isotopic results from the Arroyo del Soldado Group (Ediacaran, Uruguay)

NASA Astrophysics Data System (ADS)

Frei, R.; Gaucher, C.

2007-12-01

Positive δ13C carbonate values, combined with the occurrence of Fe-rich cherts (oxide-facies BIF) and organic-rich black shales within the late Ediacaran (ca. 580-560 Ma) Yerbal Fm. of the Arroyo del Soldato Group (Uruguay) are compatible with paleoclimatic models which postulate that enhanced bioproductivity due to higher availability of nutrient (P, N, Fe) was essential for controlling Neoproterozoic glaciations. Tracing of associated redox processes (f.e. linked to oxygenation of bottom waters in restricted basins) that might have been responsible for the deposition of Fe-rich cherts (BIFs) is therefore an important tool to better understand the seawater changes during cold-warm periods. Besides the traditionally used Fe and Mo isotopic systems, the redox-sensitive element Cr (Cr(III); Cr(IV)) and its stable isotopes offer another complementary system to trace paleo-redox processes. We have applied Cr stable isotope systematics to a sequence of samples from a late Ediacaran sedimentary sequence in Uruguay, using a 52Cr-54Cr double spike (Schoenberg et al., Chem..Geol., subm.). The middle Yerbal Fm. is dominated by organic-rich, black shales and black dolostones (δ53Cr = -0.05‰), followed by organic-rich cherts (δ53Cr = +1.83 - +4.49 ‰) and BIF (δ53Cr = -0.31 +0.90 ‰) gradually changing into Fe-bearing, organic-rich cherts and shales (δ53Cr = -0.28 - -0.01 ‰), and another sequence with BIF and organic-rich cherts topped by carbonates of the lower Polanco Fm. (δ53Cr = -0.17 to -0.27 ‰). The strongly positively fractionated Cr isotopic signatures in organic-rich and Fe-rich cherts in the Yerbal Fm. may point to significant oxidation processes either directly in the seawater column and/or during early diagenetic processes at the sediment-water interface. While these strongly positive δ53Cr values are the first to be reported from Neoproterozoic sedimentary sequence, the exact nature of the chemical process that produced these anomalies is not yet understood. However, the occurrence of these anomalies in organic-rich and Fe-rich chemical sediments that were deposited in a period following a glacial (Gaskiers?) event is compatible with "Snowball Earth" scenarios whereby impulsive oxidation of the upper seawater was in response to ice cover retraction which allowed booming of the biosphere and concomitant oxidation of accumulated Fe2+ and subsequent precipitation of the Fe-oxyhydroxides to form the "BIF" during such epochs. Schoenberg et al. (subm.) The stable Cr isotope inventory of solid earth reservoirs determined by double-spike MC-ICP-MS. Chemical Geology

Bioinformatic dissecting of TP53 regulation pathway underlying butyrate-induced histone modification in epigenetic regulation

USDA-ARS?s Scientific Manuscript database

Butyrate affects cell proliferation, differentiation and motility. Butyrate inhibits histone deacetylase (HDAC) activities and induces cell cycle arrest and apoptosis. TP53 is one of the most active upstream regulators discovered by IPA in our RNA sequencing data set. The TP53 signaling pathway pl...

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Genes encoding Xenopus laevis Ig L chains: Implications for the evolution of [kappa] and [lambda] chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zezza, D.J.; Stewart, S.E.; Steiner, L.A.

1992-12-15

Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less

From rags to riches: insights from the first genomic sequence of a plant pathogenic bacterium

PubMed Central

Keen, Noel T; Korsi Dumenyo, C; Yang, Ching-Hong; Cooksey, Donald A

2000-01-01

The recently published genomic sequence of Xylella fastidiosa is the first for a free-living plant pathogen and provides clues to mechanisms of pathogenesis and survival in insect vectors. The sequence data should lead to improved control of this pathogen. PMID:11178244

Methods for sequencing GC-rich and CCT repeat DNA templates

DOEpatents

Robinson, Donna L.

2007-02-20

The present invention is directed to a PCR-based method of cycle sequencing DNA and other polynucleotide sequences having high CG content and regions of high GC content, and includes for example DNA strands with a high Cytosine and/or Guanosine content and repeated motifs such as CCT repeats.

Identification of upstream and intragenic regulatory elements that confer cell-type-restricted and differentiation-specific expression on the muscle creatine kinase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sternberg, E.A.; Spizz, G.; Perry, W.M.

1988-07-01

Terminal differentiation of skeletal myobalsts is accompanied by induction of a series of tissue-specific gene products, which includes the muscle isoenzymte of creatine kinase (MCK). To begin to define the sequences and signals involved in MCK regulation in developing muscle cells, the mouse MCK gene has been isolated. Sequence analysis of 4,147 bases of DNA surrounding the transcription initiation site revealed several interesting structural features, some of which are common to other muscle-specific genes and to cellular and viral enhancers.

Characterization of Rous sarcoma virus polyadenylation site use in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maciolek, Nicole L.; McNally, Mark T.

2008-05-10

Polyadenylation of Rous sarcoma virus (RSV) RNA is inefficient, as approximately 15% of RSV RNAs represent read-through transcripts that use a downstream cellular polyadenylation site (poly(A) site). Read-through transcription has implications for the virus and the host since it is associated with oncogene capture and tumor induction. To explore the basis of inefficient RSV RNA 3'-end formation, we characterized RSV polyadenylation in vitro using HeLa cell nuclear extracts and HEK293 whole cell extracts. RSV polyadenylation substrates composed of the natural 3' end of viral RNA and various lengths of upstream sequence showed little or no polyadenylation, indicating that the RSVmore » poly(A) site is suboptimal. Efficiently used poly(A) sites often have identifiable upstream and downstream elements (USEs and DSEs) in close proximity to the conserved AAUAAA signal. The sequences upstream and downstream of the RSV poly(A) site deviate from those found in efficiently used poly(A) sites, which may explain inefficient RSV polyadenylation. To assess the quality of the RSV USEs and DSEs, the well-characterized SV40 late USEs and/or DSEs were substituted for the RSV elements and vice versa, which showed that the USEs and DSEs from RSV are suboptimal but functional. CstF interacted poorly with the RSV polyadenylation substrate, and the inactivity of the RSV poly(A) site was at least in part due to poor CstF binding since tethering CstF to the RSV substrate activated polyadenylation. Our data are consistent with poor polyadenylation factor binding sites in both the USE and DSE as the basis for inefficient use of the RSV poly(A) site and point to the importance of additional elements within RSV RNA in promoting 3' end formation.« less

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

PubMed

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

PubMed

Wu, S W; De Lencastre, H

1999-01-01

Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions

PubMed Central

Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake

2015-01-01

Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

A mutation in an alternative untranslated exon of hexokinase 1 associated with hereditary motor and sensory neuropathy -- Russe (HMSNR).

PubMed

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald J A; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-12-01

Hereditary Motor and Sensory Neuropathy -- Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to approximately 70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to approximately 26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS).

A mutation in an alternative untranslated exon of hexokinase 1 associated with Hereditary Motor and Sensory Neuropathy – Russe (HMSNR)

PubMed Central

Hantke, Janina; Chandler, David; King, Rosalind; Wanders, Ronald JA; Angelicheva, Dora; Tournev, Ivailo; McNamara, Elyshia; Kwa, Marcel; Guergueltcheva, Velina; Kaneva, Radka; Baas, Frank; Kalaydjieva, Luba

2009-01-01

Hereditary Motor and Sensory Neuropathy – Russe (HMSNR) is a severe autosomal recessive disorder, identified in the Gypsy population. Our previous studies mapped the gene to 10q22-q23 and refined the gene region to ∼70 kb. Here we report the comprehensive sequencing analysis and fine mapping of this region, reducing it to ∼26 kb of fully characterised sequence spanning the upstream exons of Hexokinase 1 (HK1). We identified two sequence variants in complete linkage disequilibrium, a G>C in a novel alternative untranslated exon (AltT2) and a G>A in the adjacent intron, segregating with the disease in affected families and present in the heterozygote state in only 5/790 population controls. Sequence conservation of the AltT2 exon in 16 species with invariable preservation of the G allele at the mutated site, strongly favour the exonic change as the pathogenic mutation. Analysis of the Hk1 upstream region in mouse mRNA from testis and neural tissues showed an abundance of AltT2-containing transcripts generated by extensive, developmentally regulated alternative splicing. Expression is very low compared with ubiquitous Hk1 and all transcripts skip exon1, which encodes the protein domain responsible for binding to the outer mitochondrial membrane, and regulation of energy production and apoptosis. Hexokinase activity measurement and immunohistochemistry of the peripheral nerve showed no difference between patients and controls. The mutational mechanism and functional effects remain unknown and could involve disrupted translational regulation leading to increased anti-apoptotic activity (suggested by the profuse regenerative activity in affected nerves), or impairment of an unknown HK1 function in the peripheral nervous system (PNS). PMID:19536174

Elements in the murine c-mos messenger RNA 5'-untranslated region repress translation of downstream coding sequences.

PubMed

Steel, L F; Telly, D L; Leonard, J; Rice, B A; Monks, B; Sawicki, J A

1996-10-01

Murine c-mos transcripts isolated from testes have 5'-untranslated regions (5'UTRs) of approximately 300 nucleotides with a series of four overlapping open reading frames (ORFs) upstream of the AUG codon that initiates the Mos ORF. Ovarian c-mos transcripts have shorter 5'UTRs (70-80 nucleotides) and contain only 1-2 of the upstream ORFs (uORFs). To test whether these 5'UTRs affect translational efficiency, we have constructed plasmids for the expression of chimeric transcripts with a mos-derived 5'UTR fused to the Escherichia coli beta-galactosidase coding region. Translational efficiency has been evaluated by measuring beta-galactosidase activity NIH3T3 cells transiently transfected with these plasmids and with plasmids where various mutations have been introduced into the 5'UTR. We show that the 5'UTR characteristic of testis-specific c-mos mRNA strongly represses translation relative to the translation of transcripts that contain a 5'UTR derived from beta-globin mRNA, and this is mainly due to the four uORFs. Each of the four upstream AUG triplets can be recognized as a start site for translation, and no single uAUG dominates the repressive effect. The uORFs repress translation by a mechanism that is not affected by the amino acid sequence in the COOH-terminal region of the uORF-encoded peptides. The very short uORF (AUGUGA) present in ovary-specific transcripts does not repress translation. Staining of testis sections from transgenic mice carrying chimeric beta-galactosidase transgene constructs, which contain a mos 5'UTR with or without the uATGs, suggests that the uORFs can dramatically change the pattern of expression in spermatogenic cells.

Seismic signals of snow-slurry lahars in motion: 25 September 2007, Mt Ruapehu, New Zealand

NASA Astrophysics Data System (ADS)

Cole, S. E.; Cronin, S. J.; Sherburn, S.; Manville, V.

2009-05-01

Detection of ground shaking forms the basis of many lahar-warning systems. Seismic records of two lahar types at Ruapehu, New Zealand, in 2007 are used to examine their nature and internal dynamics. Upstream detection of a flow depends upon flow type and coupling with the ground. 3-D characteristics of seismic signals can be used to distinguish the dominant rheology and gross physical composition. Water-rich hyperconcentrated flows are turbulent; common inter-particle and particle-substrate collisions engender higher energy in cross-channel vibrations relative to channel-parallel. Plug-like snow-slurry lahars show greater energy in channel-parallel signals, due to lateral deposition insulating channel margins, and low turbulence. Direct comparison of flow size must account for flow rheology; a water-rich lahar will generate signals of greater amplitude than a similar-sized snow-slurry flow.

Geomorphological and ecological effects of check dams in mountain torrents of Southern Italy

NASA Astrophysics Data System (ADS)

Zema, Demetrio Antonio; Bombino, Giuseppe; Denisi, Pietro; Tamburino, Vincenzo; Marcello Zimbone, Santo

2017-04-01

It is known that installation of check dams noticeably influences torrent morphology and ecology. However, the effects of check dams on channel section and riparian vegetation of torrents are not yet completely understood. This paper provides a further contribution to a better comprehension of the actions played by check dams on hydrological and geomorphological processes in headwaters and their effects on riparian ecosystem. Field surveys on channel morphology, bed material and riparian vegetation were carried out close to five check dams in each of four mountain reaches of Calabria (Southern Italy). For each check dam three transects (one upstream, one downstream and one far from the check dam, located in the undisturbed zone and adopted as control) were identified; at each transect, a set of geomorphological and ecological indicators were surveyed as follows. Channel section morphology was assessed by the width/depth ratio (w/d); the median particle size (D50) and the finer sediment fraction (%fines) were chosen to characterize channel bed material; the specific discharge (q, the discharge per channel unit width) was assumed as measure of the flow regime. Vegetation cover and structure were evaluated by Global Canopy Cover (GCC) and Weighted Canopy Height (WCH) respectively (Bombino et al., 2008); the index of alpha-diversity (H-alpha, Hill, 1973) and the ratio between the number of alien species and the number of native species (NSA/NSN) were chosen as indicators of species richness/abundance and degree of vegetation integrity, respectively. Compared to the control transects, the values of w/d were higher upstream of check dams and lower downstream; conversely, q was lower upstream and higher in downstream sites. Upstream of the check dams D50 of bed material was lower and %fines was higher compared to the control transects; vice versa, the downstream transects showed higher D50 and lower %fines. The differences in the riparian vegetation among transects were found as the torrent ecological response to the strong contrasts surveyed in hydrological (q) and geomorphological (w/d, D50 and %fines) characteristics. Compared to control transects, vegetation was more extensive (higher GCC) and developed (higher WCH) in the upstream zones; the reverse pattern was noticed in the downstream transects (lower GCC and WCH). The indexes H-alpha and NSA/NSN were higher upstream of check dams: the presence of the check dams induced higher species richness and evenness, with alien species prevailing over native ones in the sedimentation wedge. Conversely, downstream of check dams H-alpha and NSA/NSN were lower: here, riparian vegetation lost some herbaceous species and assumed a terrestrial character. Overall, this study confirms on a quantitative approach that check dams have far reaching effects on geomorphology and ecology of mountain torrent channels; as a consequence, important and complex changes occur not only in the extent and development of riparian vegetation, but also in the species diversity and distribution. REFERENCES - Bombino G., Gurnell A.M., Tamburino V., Zema D.A., Zimbone S.M. 2008. Sediment size variation in torrents with check-dams: effects on riparian vegetation. Ecological Engineering 32(2), 166-177. - Hill MO. 1973. Diversity and evenness: a unifying notation and its consequences. Ecology 54: 427-431.

Structure of the human gene encoding the protein repair L-isoaspartyl (D-aspartyl) O-methyltransferase.

PubMed

DeVry, C G; Tsai, W; Clarke, S

1996-11-15

The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.

RNA-ID, a Powerful Tool for Identifying and Characterizing Regulatory Sequences.

PubMed

Brule, C E; Dean, K M; Grayhack, E J

2016-01-01

The identification and analysis of sequences that regulate gene expression is critical because regulated gene expression underlies biology. RNA-ID is an efficient and sensitive method to discover and investigate regulatory sequences in the yeast Saccharomyces cerevisiae, using fluorescence-based assays to detect green fluorescent protein (GFP) relative to a red fluorescent protein (RFP) control in individual cells. Putative regulatory sequences can be inserted either in-frame or upstream of a superfolder GFP fusion protein whose expression, like that of RFP, is driven by the bidirectional GAL1,10 promoter. In this chapter, we describe the methodology to identify and study cis-regulatory sequences in the RNA-ID system, explaining features and variations of the RNA-ID reporter, as well as some applications of this system. We describe in detail the methods to analyze a single regulatory sequence, from construction of a single GFP variant to assay of variants by flow cytometry, as well as modifications required to screen libraries of different strains simultaneously. We also describe subsequent analyses of regulatory sequences. © 2016 Elsevier Inc. All rights reserved.

Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.

PubMed

Li, Shisheng; Smerdon, Michael J

2004-04-02

Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.

Leaderless mRNAs are circularized in Chlamydomonas reinhardtii mitochondria.

PubMed

Cahoon, A Bruce; Qureshi, Ali A

2018-06-01

The mitochondrial genome of Chlamydomonas reinhardtii encodes eight protein coding genes transcribed on two polycistronic primary transcripts. The mRNAs are endonucleolytically cleaved from these transcripts directly upstream of their AUG start codons, creating leaderless mRNAs with 3' untranslated regions (UTR) comprised of most or all of their downstream intergenic regions. In this report, we provide evidence that these processed linear mRNAs are circularized, which places the 3' UTR upstream of the 5' start codon, creating a leader sequence ex post facto. The circular mRNAs were found to be ribosome associate by polysome profiling experiments suggesting they are translated. Sequencing of the 3'-5' junctions of the circularized mRNAs found the intra-molecular ligations occurred between fully processed 5' ends (the start AUG) and a variable 3' terminus. For five genes (cob, cox, nd2, nd4, and nd6), some of the 3' ends maintained an oligonucleotide addition during ligation, and for two of them, cob and nd6, these 3' termini were the most commonly recovered sequence. Previous reports have shown that after cleavage, three untemplated oligonucleotide additions may occur on the 3' termini of these mRNAs-adenylation, uridylylation, or cytidylation. These results suggest oligo(U) and oligo(C) additions may be part of the maturation process since they are maintained in the circular mRNAs. Circular RNAs occur in organisms across the biological spectrum, but their purpose in some systems, such as organelles (mitochondria and chloroplasts) is unclear. We hypothesize, that in C. reinhardtii mitochondria it may create a leader sequence to facilitate translation initiation, which may negate the need for an alternative translation initiation mechanism in this system, as previously speculated. In addition, circularization may play a protective role against exonucleases, and/or increase translational productivity.

Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee aremore » more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.« less

Sequence Analysis and Domain Motifs in the Porcine Skin Decorin Glycosaminoglycan Chain*

PubMed Central

Zhao, Xue; Yang, Bo; Solakylidirim, Kemal; Joo, Eun Ji; Toida, Toshihiko; Higashi, Kyohei; Linhardt, Robert J.; Li, Lingyun

2013-01-01

Decorin proteoglycan is comprised of a core protein containing a single O-linked dermatan sulfate/chondroitin sulfate glycosaminoglycan (GAG) chain. Although the sequence of the decorin core protein is determined by the gene encoding its structure, the structure of its GAG chain is determined in the Golgi. The recent application of modern MS to bikunin, a far simpler chondroitin sulfate proteoglycans, suggests that it has a single or small number of defined sequences. On this basis, a similar approach to sequence the decorin of porcine skin much larger and more structurally complex dermatan sulfate/chondroitin sulfate GAG chain was undertaken. This approach resulted in information on the consistency/variability of its linkage region at the reducing end of the GAG chain, its iduronic acid-rich domain, glucuronic acid-rich domain, and non-reducing end. A general motif for the porcine skin decorin GAG chain was established. A single small decorin GAG chain was sequenced using MS/MS analysis. The data obtained in the study suggest that the decorin GAG chain has a small or a limited number of sequences. PMID:23423381

Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

PubMed

Biedler, James K; Hu, Wanqi; Tae, Hongseok; Tu, Zhijian

2012-01-01

During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs) in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression) EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001) and 143 (P<0.05) nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1) contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

NASA Astrophysics Data System (ADS)

Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

1994-07-01

We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

Kin28 regulates the transient association of Mediator with core promoters.

PubMed

Jeronimo, Célia; Robert, François

2014-05-01

Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

PubMed

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Alu-derived cis-element regulates tumorigenesis-dependent gastric expression of GASDERMIN B (GSDMB).

PubMed

Komiyama, Hiromitsu; Aoki, Aya; Tanaka, Shigekazu; Maekawa, Hiroshi; Kato, Yoriko; Wada, Ryo; Maekawa, Takeo; Tamura, Masaru; Shiroishi, Toshihiko

2010-02-01

GASDERMIN B (GSDMB) belongs to the novel gene family GASDERMIN (GSDM). All GSDM family members are located in amplicons, genomic regions often amplified during cancer development. Given that GSDMB is highly expressed in cancerous cells and the locus resides in an amplicon, GSDMB may be involved in cancer development and/or progression. However, only limited information is available on GSDMB expression in tissues, normal and cancerous, from cancer patients. Furthermore, the molecular mechanisms that regulate GSDMB expression in gastric tissues are poorly understood. We investigated the spatiotemporal expression patterns of GSDMB in gastric cancer patients and the 5' regulatory sequences upstream of GSDMB. GSDMB was not expressed in the majority of normal gastric-tissue samples, and the expression level was very low in the few normal samples with GSDMB expression. Most pre-cancer samples showed moderate GSDMB expression, and most cancerous samples showed augmented GSDMB expression. Analysis of genome sequences revealed that an Alu element resides in the 5' region upstream of GSDMB. Reporter assays using intact, deleted, and mutated Alu elements clearly showed that this Alu element positively regulates GSDMB expression and that a putative IKZF binding motif in this element is crucial to upregulate GSDMB expression.

Conserved Sequences at the Origin of Adenovirus DNA Replication

PubMed Central

Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.

1982-01-01

The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575

Sequences downstream of AAUAAA signals affect pre-mRNA cleavage and polyadenylation in vitro both directly and indirectly.

PubMed Central

Ryner, L C; Takagaki, Y; Manley, J L

1989-01-01

To investigate the role of sequences lying downstream of the conserved AAUAAA hexanucleotide in pre-mRNA cleavage and polyadenylation, deletions or substitutions were constructed in polyadenylation signals from simian virus 40 and adenovirus, and their effects were assayed in both crude and fractionated HeLa cell nuclear extracts. As expected, these sequences influenced the efficiency of both cleavage and polyadenylation as well as the accuracy of the cleavage reaction. Sequences near or upstream of the actual site of poly(A) addition appeared to specify a unique cleavage site, since their deletion resulted, in some cases, in heterogeneous cleavage. Furthermore, the sequences that allowed the simian virus 40 late pre-RNA to be cleaved preferentially by partially purified cleavage activity were also those at the cleavage site itself. Interestingly, sequences downstream of the cleavage site interacted with factors not directly involved in catalyzing cleavage and polyadenylation, since the effects of deletions were substantially diminished when partially purified components were used in assays. In addition, these sequences contained elements that could affect 3'-end formation both positively and negatively. Images PMID:2566911

A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

PubMed Central

Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

2013-01-01

Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

Genome-wide mapping of autonomous promoter activity in human cells

PubMed Central

van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

2017-01-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

Genome-wide sequencing of longan (Dimocarpus longan Lour.) provides insights into molecular basis of its polyphenol-rich characteristics

PubMed Central

Lin, Yuling; Min, Jiumeng; Lai, Ruilian; Wu, Zhangyan; Chen, Yukun; Yu, Lili; Cheng, Chunzhen; Jin, Yuanchun; Tian, Qilin; Liu, Qingfeng; Liu, Weihua; Zhang, Chengguang; Lin, Lixia; Hu, Yan; Zhang, Dongmin; Thu, Minkyaw; Zhang, Zihao; Liu, Shengcai; Zhong, Chunshui; Fang, Xiaodong; Wang, Jian; Yang, Huanming

2017-01-01

Abstract Longan (Dimocarpus longan Lour.), an important subtropical fruit in the family Sapindaceae, is grown in more than 10 countries. Longan is an edible drupe fruit and a source of traditional medicine with polyphenol-rich traits. Tree size, alternate bearing, and witches' broom disease still pose serious problems. To gain insights into the genomic basis of longan traits, a draft genome sequence was assembled. The draft genome (about 471.88 Mb) of a Chinese longan cultivar, “Honghezi,” was estimated to contain 31 007 genes and 261.88 Mb of repetitive sequences. No recent whole-genome-wide duplication event was detected in the genome. Whole-genome resequencing and analysis of 13 cultivated D. longan accessions revealed the extent of genetic diversity. Comparative transcriptome studies combined with genome-wide analysis revealed polyphenol-rich and pathogen resistance characteristics. Genes involved in secondary metabolism, especially those from significantly expanded (DHS, SDH, F3΄H, ANR, and UFGT) and contracted (PAL, CHS, and F3΄5΄H) gene families with tissue-specific expression, may be important contributors to the high accumulation levels of polyphenolic compounds observed in longan fruit. The high number of genes encoding nucleotide-binding site leucine-rich repeat (NBS-LRR) and leucine-rich repeat receptor-like kinase proteins, as well as the recent expansion and contraction of the NBS-LRR family, suggested a genomic basis for resistance to insects, fungus, and bacteria in this fruit tree. These data provide insights into the evolution and diversity of the longan genome. The comparative genomic and transcriptome analyses provided information about longan-specific traits, particularly genes involved in its polyphenol-rich and pathogen resistance characteristics. PMID:28368449

Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

PubMed

Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

2008-06-01

The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

The genetic basis of adaptive pigmentation variation in Drosophila melanogaster

PubMed Central

Pool, John E.; Aquadro, Charles F.

2009-01-01

In a broad survey of Drosophila melanogaster population samples, levels of abdominal pigmentation were found to be highly variable and geographically differentiated. A strong positive correlation was found between dark pigmentation and high altitude, suggesting adaptation to specific environments. DNA sequence polymorphism at the candidate gene ebony revealed a clear association with the pigmentation of homozygous third chromosome lines. The darkest lines sequenced had nearly identical haplotypes spanning 14.5 kilobases upstream of the protein-coding exons of ebony. Thus, natural selection may have elevated the frequency of an allele that confers dark abdominal pigmentation by influencing the regulation of ebony. PMID:17614900

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Possible Ni-Rich Mafic-Ultramafic Magmatic Sequence in the Columbia Hills: Evidence from the Spirit Rover

NASA Technical Reports Server (NTRS)

Mittlefehldt, David W.; Gellert, R.; McCoy, T.; McSween, H. Y., Jr.; Li, R.

2006-01-01

The Spirit rover landed on geologic units of Hesperian age in Gusev Crater. The Columbia Hills rise above the surrounding plains materials, but orbital images show that the Columbia Hills are older [1, 2]. Spirit has recently descended the southeast slope of the Columbia Hills doing detailed measurements of a series of outcrops. The mineralogical and compositional data on these rocks are consistent with an interpretation as a magmatic sequence becoming increasingly olivine-rich down slope. The outcrop sequence is Larry s Bench, Seminole, Algonquin and Comanche. The "teeth" on the Rock Abrasion Tool (RAT) wore away prior to arrival at Larry s Bench; the data discussed are for RAT brushed surfaces.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

Total Nitrogen Sources of the Three Gorges Reservoir — A Spatio-Temporal Approach

PubMed Central

Ren, Chunping; Wang, Lijing; Zheng, Binghui; Holbach, Andreas

2015-01-01

Understanding the spatial and temporal variation of nutrient concentrations, loads, and their distribution from upstream tributaries is important for the management of large lakes and reservoirs. The Three Gorges Dam was built on the Yangtze River in China, the world’s third longest river, and impounded the famous Three Gorges Reservoir (TGR). In this study, we analyzed total nitrogen (TN) concentrations and inflow data from 2003 till 2010 for the main upstream tributaries of the TGR that contribute about 82% of the TGR’s total inflow. We used time series analysis for seasonal decomposition of TN concentrations and used non-parametric statistical tests (Kruskal-Walli H, Mann-Whitney U) as well as base flow segmentation to analyze significant spatial and temporal patterns of TN pollution input into the TGR. Our results show that TN concentrations had significant spatial heterogeneity across the study area (Tuo River> Yangtze River> Wu River> Min River> Jialing River>Jinsha River). Furthermore, we derived apparent seasonal changes in three out of five upstream tributaries of the TGR rivers (Kruskal-Walli H ρ = 0.009, 0.030 and 0.029 for Tuo River, Jinsha River and Min River in sequence). TN pollution from non-point sources in the upstream tributaries accounted for 68.9% of the total TN input into the TGR. Non-point source pollution of TN revealed increasing trends for 4 out of five upstream tributaries of the TGR. Land use/cover and soil type were identified as the dominant driving factors for the spatial distribution of TN. Intensifying agriculture and increasing urbanization in the upstream catchments of the TGR were the main driving factors for non-point source pollution of TN increase from 2003 till 2010. Land use and land cover management as well as chemical fertilizer use restriction were needed to overcome the threats of increasing TN pollution. PMID:26510158

Identification of cis-acting regulatory elements in the human oxytocin gene promoter.

PubMed

Richard, S; Zingg, H H

1991-12-01

The expression of hormone-inducible genes is determined by the interaction of trans-acting factors with hormone-inducible elements and elements mediating basal and cell-specific expression. We have shown earlier that the gene encoding the hypothalamic nonapeptide oxytocin (OT) is under the control of an estrogen response element (ERE). The present study was aimed at identifying cis-acting elements mediating basal expression of the OT gene. A construct containing sequences -381 to +36 of the human OT gene was linked to a reporter gene and transiently transfected into a series of neuronal and nonneuronal cell lines. Expression of this construct was cell specific: it was highest in the neuroblastoma-derived cell line, Neuro-2a, and lowest in NIH 3T3 and JEG-3 cells. By 5' deletion analysis, we determined that a segment from -49 to +36 was capable of mediating cells-pecific promoter activity. Within this segment, we identified three proximal promoter elements (PPE-1, PPE-2, and PPE-3) that are each required for promoter activity. Most notably, mutation of a conserved purine-rich element (GAGAGA) contained within PPE-2 leads to a 10-fold decrease in promoter strength. Gel mobility shift analysis with three different double-stranded oligonucleotides demonstrated that each proximal promoter element binds distinct nuclear factors. In each case, only the homologous oligonucleotide, but neither of the oligonucleotides corresponding to adjacent elements, was able to act as a competitor. Thus, a different set of factors appears to bind independently to each element. By reinserting the homologous ERE or a heterologous glucocorticoid response element upstream of intact or altered proximal promoter segments we determined that removal or mutation of proximal promoter elements decreases basal expression, but does not abrogate the hormone responsiveness of the promoter. In conclusion, these results indicate that an important component of the transcriptional activity of the OT promoter resides in a small region extending only 50 bases upstream of the cap site and that this activity is the result of a cooperative interaction of at least three distinct proximal promoter elements.

Recombined sequences between the non-coding control regions of JC and BK viruses found in the urine of a renal transplantation patient.

PubMed

Liaw, Yu-Ching; Chen, Cheng-Hsu; Shu, Kuo-Hsiung; Fang, Chiung-Yao; Ou, Wei-Chih; Chen, Pei-Lain; Shen, Cheng-Huang; Lin, Mien-Chun; Chang, Deching; Wang, Meilin

2012-12-01

Kidney cells are the common host for JC virus (JCV) and BK virus (BKV). Reactivation of JCV and/or BKV in patients after organ transplantation, such as renal transplantation, may cause hemorrhagic cystitis and polyomavirus-associated nephropathy. Furthermore, JCV and BKV may be shed in the urine after reactivation in the kidney. Rearranged as well as archetypal non-coding control regions (NCCRs) of JCV and BKV have been frequently identified in human samples. In this study, three JC/BK recombined NCCR sequences were identified in the urine of a patient who had undergone renal transplantation. They were designated as JC-BK hybrids 1, 2, and 3. The three JC/BK recombinant NCCRs contain up-stream JCV as well as down-stream BKV sequences. Deletions of both JCV and BKV sequences were found in these recombined NCCRs. Recombination of DNA sequences between JCV and BKV may occur during co-infection due to the relatively high homology of the two viral genomes.

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

PubMed Central

Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

2018-01-01

Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

Do rivermouths alter nutrient and seston delivery to the nearshore?

USGS Publications Warehouse

Larson, James H.; Frost, Paul C.; Vallazza, Jon M.; Nelson, John; Richardson, William B.

2016-01-01

Tributary inputs to lakes and seas are often measured at riverine gages, upstream of lentic influence. Between these riverine gages and the nearshore zones of large waterbodies lie rivermouths, which may retain, transform and contribute materials to the nearshore zone. However, the magnitude and timing of these rivermouth effects have rarely been measured.During the summer of 2011, 23 tributary systems of the Laurentian Great Lakes were sampled from river to nearshore for dissolved and particulate carbon (C), nitrogen (N) and phosphorus (P) concentrations, as well as bulk seston and chlorophyll a concentrations. Three locations per system were sampled: in the upstream river, in the nearshore zone and at the outflow from the rivermouth to the lake. Using stable oxygen isotopes, a water-mixing model was developed to estimate the nutrient concentration that would occur at the rivermouth if mixing was strictly conservative (i.e. if no processing occurred within the rivermouth). Deviations between these conservative mixing estimates and measured nutrient concentrations were identified as rivermouth effects on nutrient concentrations.Rivermouths had higher concentration of C and P than nearshore areas and more chlorophyll athan upstream river waters. Compared to the conservative mixing model, rivermouths as a class appeared to be summer-time sources of N, P and chlorophyll a. Substantial among rivermouth variation occurred both in the effect size and direction for all constituents.Using principal component analysis, two groups of rivermouths were identified: rivermouths that had a large effect on most constituents and those that had very little effect on any of the measured constituents. ‘High-effect’ rivermouths had more abundant upstream croplands, which were presumably the sources of inorganic nutrients. Cross-validated models built using characteristics of the rivermouth were not good predictors of variation in rivermouth effects on most constituents.For consumers feeding on seston and microbes and vascular autotrophs directly taking up dissolved nutrients, rivermouths are more resource-rich than upstream riverine or nearby Great Lakes waters. Given declines over time in open-lake productivity within the Great Lakes, rivermouths may contribute more productivity than their size would suggest to the Great Lakes food web.

The GC-rich mitochondrial and plastid genomes of the green alga Coccomyxa give insight into the evolution of organelle DNA nucleotide landscape

DOE PAGES

Smith, David Roy; Burki, Fabien; Yamada, Takashi; ...

2011-08-26

Here, most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features ofmore » this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.« less

The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, David Roy; Burki, Fabien; Yamada, Takashi

2011-05-13

Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of thismore » species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.« less

The CGTCA sequence motif is essential for biological activity of the vasoactive intestinal peptide gene cAMP-regulated enhancer.

PubMed Central

Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H

1988-01-01

cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Complete mitochondrial genome of the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae).

PubMed

Kim, Min Jee; Im, Hyun Hwak; Lee, Kwang Youll; Han, Yeon Soo; Kim, Iksoo

2014-06-01

Abstract The complete nucleotide sequences of the mitochondrial genome from the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae), was determined. The 20,319-bp long circular genome is the longest among completely sequenced Coleoptera. As is typical in animals, the P. brevitarsis genome consisted of two ribosomal RNAs, 22 transfer RNAs, 13 protein-coding genes and one A + T-rich region. Although the size of the coding genes was typical, the non-coding A + T-rich region was 5654 bp, which is the longest in insects. The extraordinary length of this region was composed of 28,117-bp tandem repeats and 782-bp tandem repeats. These repeat sequences were encompassed by three non-repeat sequences constituting 1804 bp.

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Application of a Depositional Facies Model to an Acid Mine Drainage Site▿ †

PubMed Central

Brown, Juliana F.; Jones, Daniel S.; Mills, Daniel B.; Macalady, Jennifer L.; Burgos, William D.

2011-01-01

Lower Red Eyes is an acid mine drainage site in Pennsylvania where low-pH Fe(II) oxidation has created a large, terraced iron mound downstream of an anoxic, acidic, metal-rich spring. Aqueous chemistry, mineral precipitates, microbial communities, and laboratory-based Fe(II) oxidation rates for this site were analyzed in the context of a depositional facies model. Depositional facies were defined as pools, terraces, or microterracettes based on cm-scale sediment morphology, irrespective of the distance downstream from the spring. The sediments were composed entirely of Fe precipitates and cemented organic matter. The Fe precipitates were identified as schwertmannite at all locations, regardless of facies. Microbial composition was studied with fluorescence in situ hybridization (FISH) and transitioned from a microaerophilic, Euglena-dominated community at the spring, to a Betaproteobacteria (primarily Ferrovum spp.)-dominated community at the upstream end of the iron mound, to a Gammaproteobacteria (primarily Acidithiobacillus)-dominated community at the downstream end of the iron mound. Microbial community structure was more strongly correlated with pH and geochemical conditions than depositional facies. Intact pieces of terrace and pool sediments from upstream and downstream locations were used in flowthrough laboratory reactors to measure the rate and extent of low-pH Fe(II) oxidation. No change in Fe(II) concentration was observed with 60Co-irradiated sediments or with no-sediment controls, indicating that abiotic Fe(II) oxidation was negligible. Upstream sediments attained lower effluent Fe(II) concentrations compared to downstream sediments, regardless of depositional facies. PMID:21097582

Holocentric chromosomes of psocids (Insecta, Psocoptera) analysed by C-banding, silver impregnation and sequence specific fluorochromes CMA3 and DAPI.

PubMed

Golub, Natalia V; Nokkala, Seppo; Kuznetsova, Valentina G

2004-01-01

The pattern of nucleolus attachment and C-heterochromatin distribution and molecular composition in the karyotypes of psocid species Psococerastis gibbosa (2n = 16+X), Blaste conspurcata (2n = 16+X) and Amphipsocus japonicus (2n = 14+neo-XY) were studied by C-banding, silver impregnation and sequence specific fluorochromes CMA3 and DAPI. Every species was found to have a single nucleolus in male meiosis. In P. gibbosa the nucleolus is attached to an autosomal bivalent; in B. conspurcata to the X-chromosome; in A. japonicus to the neo-XY bivalent. The species show a rather small amount of constitutive heterochromatin, C-blocks demonstrating telomeric localization with rare exceptions. P. gibbosa is characterized by a polymorphism for C-blocks occurrence and distribution. In the autosomes of this species, C-heterochromatin consists of AT-rich DNA except for the nucleolus organizing region, which is also GC-rich; the X-chromosome shows both AT- and GC-rich clusters. In A. japonicus and B. conspurcata, C-heterochromatin of the autosomes and sex chromosomes consists of both GC-rich and AT-rich DNA clusters, which are largely co-localized.

Phylogenetically Structured Differences in rRNA Gene Sequence Variation among Species of Arbuscular Mycorrhizal Fungi and Their Implications for Sequence Clustering

PubMed Central

Ekanayake, Saliya; Ruan, Yang; Schütte, Ursel M. E.; Kaonongbua, Wittaya; Fox, Geoffrey; Ye, Yuzhen; Bever, James D.

2016-01-01

ABSTRACT Arbuscular mycorrhizal (AM) fungi form mutualisms with plant roots that increase plant growth and shape plant communities. Each AM fungal cell contains a large amount of genetic diversity, but it is unclear if this diversity varies across evolutionary lineages. We found that sequence variation in the nuclear large-subunit (LSU) rRNA gene from 29 isolates representing 21 AM fungal species generally assorted into genus- and species-level clades, with the exception of species of the genera Claroideoglomus and Entrophospora. However, there were significant differences in the levels of sequence variation across the phylogeny and between genera, indicating that it is an evolutionarily constrained trait in AM fungi. These consistent patterns of sequence variation across both phylogenetic and taxonomic groups pose challenges to interpreting operational taxonomic units (OTUs) as approximations of species-level groups of AM fungi. We demonstrate that the OTUs produced by five sequence clustering methods using 97% or equivalent sequence similarity thresholds failed to match the expected species of AM fungi, although OTUs from AbundantOTU, CD-HIT-OTU, and CROP corresponded better to species than did OTUs from mothur or UPARSE. This lack of OTU-to-species correspondence resulted both from sequences of one species being split into multiple OTUs and from sequences of multiple species being lumped into the same OTU. The OTU richness therefore will not reliably correspond to the AM fungal species richness in environmental samples. Conservatively, this error can overestimate species richness by 4-fold or underestimate richness by one-half, and the direction of this error will depend on the genera represented in the sample. IMPORTANCE Arbuscular mycorrhizal (AM) fungi form important mutualisms with the roots of most plant species. Individual AM fungi are genetically diverse, but it is unclear whether the level of this diversity differs among evolutionary lineages. We found that the amount of sequence variation in an rRNA gene that is commonly used to identify AM fungal species varied significantly between evolutionary groups that correspond to different genera, with the exception of two genera that are genetically indistinguishable from each other. When we clustered groups of similar sequences into operational taxonomic units (OTUs) using five different clustering methods, these patterns of sequence variation caused the number of OTUs to either over- or underestimate the actual number of AM fungal species, depending on the genus. Our results indicate that OTU-based inferences about AM fungal species composition from environmental sequences can be improved if they take these taxonomically structured patterns of sequence variation into account. PMID:27260357

Evaluation of the effect of polymorphism on G-quadruplex-ligand interaction by means of spectroscopic and chromatographic techniques

NASA Astrophysics Data System (ADS)

Benito, S.; Ferrer, A.; Benabou, S.; Aviñó, A.; Eritja, R.; Gargallo, R.

2018-05-01

Guanine-rich sequences may fold into highly ordered structures known as G-quadruplexes. Apart from the monomeric G-quadruplex, these sequences may form multimeric structures that are not usually considered when studying interaction with ligands. This work studies the interaction of a ligand, crystal violet, with three guanine-rich DNA sequences with the capacity to form multimeric structures. These sequences correspond to short stretches found near the promoter regions of c-kit and SMARCA4 genes. Instrumental techniques (circular dichroism, molecular fluorescence, size-exclusion chromatography and electrospray ionization mass spectrometry) and multivariate data analysis were used for this purpose. The polymorphism of G-quadruplexes was characterized prior to the interaction studies. The ligand was shown to interact preferentially with the monomeric G-quadruplex; the binding stoichiometry was 1:1 and the binding constant was in the order of 105 M-1 for all three sequences. The results highlight the importance of DNA treatment prior to interaction studies.

Bacterial community structure analysis of sediment in the Sagami River, Japan using a rapid approach based on two-dimensional DNA gel electrophoresis mapping with selective primer pairs.

PubMed

Liu, Guo-hua; Rajendran, Narasimmalu; Amemiya, Takashi; Itoh, Kiminori

2011-11-01

A rapid approach based on two-dimensional DNA gel electrophroesis (2-DGE) mapping with selective primer pairs was employed to analyze bacterial community structure in sediments from upstream, midstream and downstream of Sagami River in Japan. The 2-DGE maps indicated that Alpha- and Delta-proteobacteria were major bacterial populations in the upstream and midstream sediments. Further bacterial community structure analysis showed that richness proportion of Alpha- and Delta-proteobacterial groups reflected a trend toward decreasing from the upstream to downstream sediments. The biomass proportion of bacterial populations in the midstream sediment showed a significantly difference from that in the other sediments, suggesting that there may be an environmental pressure on the midstream bacterial community. Lorenz curves, together with Gini coefficients were successfully applied to the 2-DGE mapping data for resolving evenness of bacterial populations, and showed that the plotted curve from high-resolution 2-DGE mapping became less linear and more an exponential function than that of the 1-DGE methods such as chain length analysis and denaturing gradient gel electrophoresis, suggesting that the 2-DGE mapping may achieve a more detailed evaluation of bacterial community. In conclusion, the 2-DGE mapping combined with the selective primer pairs enables bacterial community structure analysis in river sediment and thus it can also monitor sediment pollution based on the change of bacterial community structure.

Coliphage HK022 Nun protein inhibits RNA polymerase translocation

PubMed Central

Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

2014-01-01

The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

Conserved noncoding sequences (CNSs) in higher plants.

PubMed

Freeling, Michael; Subramaniam, Shabarinath

2009-04-01

Plant conserved noncoding sequences (CNSs)--a specific category of phylogenetic footprint--have been shown experimentally to function. No plant CNS is conserved to the extent that ultraconserved noncoding sequences are conserved in vertebrates. Plant CNSs are enriched in known transcription factor or other cis-acting binding sites, and are usually clustered around genes. Genes that encode transcription factors and/or those that respond to stimuli are particularly CNS-rich. Only rarely could this function involve small RNA binding. Some transcribed CNSs encode short translation products as a form of negative control. Approximately 4% of Arabidopsis gene content is estimated to be both CNS-rich and occupies a relatively long stretch of chromosome: Bigfoot genes (long phylogenetic footprints). We discuss a 'DNA-templated protein assembly' idea that might help explain Bigfoot gene CNSs.

Stable loop in the crystal structure of the intercalated four-stranded cytosine-rich metazoan telomere

NASA Technical Reports Server (NTRS)

Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.

1995-01-01

In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.

Global sequence variation in the histidine-rich proteins 2 and 3 of Plasmodium falciparum: implications for the performance of malaria rapid diagnostic tests

PubMed Central

2010-01-01

Background Accurate diagnosis is essential for prompt and appropriate treatment of malaria. While rapid diagnostic tests (RDTs) offer great potential to improve malaria diagnosis, the sensitivity of RDTs has been reported to be highly variable. One possible factor contributing to variable test performance is the diversity of parasite antigens. This is of particular concern for Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-detecting RDTs since PfHRP2 has been reported to be highly variable in isolates of the Asia-Pacific region. Methods The pfhrp2 exon 2 fragment from 458 isolates of P. falciparum collected from 38 countries was amplified and sequenced. For a subset of 80 isolates, the exon 2 fragment of histidine-rich protein 3 (pfhrp3) was also amplified and sequenced. DNA sequence and statistical analysis of the variation observed in these genes was conducted. The potential impact of the pfhrp2 variation on RDT detection rates was examined by analysing the relationship between sequence characteristics of this gene and the results of the WHO product testing of malaria RDTs: Round 1 (2008), for 34 PfHRP2-detecting RDTs. Results Sequence analysis revealed extensive variations in the number and arrangement of various repeats encoded by the genes in parasite populations world-wide. However, no statistically robust correlation between gene structure and RDT detection rate for P. falciparum parasites at 200 parasites per microlitre was identified. Conclusions The results suggest that despite extreme sequence variation, diversity of PfHRP2 does not appear to be a major cause of RDT sensitivity variation. PMID:20470441

Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

PubMed Central

Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

1992-01-01

In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

Mechanisms of activation of the paternally expressed genes by the Prader-Willi imprinting center in the Prader-Willi/Angelman syndromes domains

PubMed Central

Rabinovitz, Shiri; Kaufman, Yotam; Ludwig, Guy; Razin, Aharon; Shemer, Ruth

2012-01-01

The Prader-Willi syndrome/Angelman syndrome (PWS/AS) imprinted domain is regulated by a bipartite imprinting control center (IC) composed of a sequence around the SNRPN promoter (PWS-IC) and a 880-bp sequence located 35 kb upstream (AS-IC). The AS-IC imprint is established during gametogenesis and confers repression upon PWS-IC on the maternal allele. Mutation at PWS-IC on the paternal allele leads to gene silencing across the entire PWS/AS domain. This silencing implies that PWS-IC functions on the paternal allele as a bidirectional activator. Here we examine the mechanism by which PWS-IC activates the paternally expressed genes (PEGs) using transgenes that include the PWS-IC sequence in the presence or absence of AS-IC and NDN, an upstream PEG, as an experimental model. We demonstrate that PWS-IC is in fact an activator of NDN. This activation requires an unmethylated PWS-IC in the gametes and during early embryogenesis. PWS-IC is dispensable later in development. Interestingly, a similar activation of a nonimprinted gene (APOA1) was observed, implying that PWS-IC is a universal activator. To decipher the mechanism by which PWS-IC confers activation of remote genes, we performed methylated DNA immunoprecipitation (MeDIP) array analysis on lymphoblast cell lines that revealed dispersed, rather than continued differential methylation. However, chromatin conformation capture (3c) experiments revealed a physical interaction between PWS-IC and the PEGs, suggesting that activation of PEGs may require their proximity to PWS-IC. PMID:22529396

Comparison of simple sequence repeats in 19 Archaea.

PubMed

Trivedi, S

2006-12-05

All organisms that have been studied until now have been found to have differential distribution of simple sequence repeats (SSRs), with more SSRs in intergenic than in coding sequences. SSR distribution was investigated in Archaea genomes where complete chromosome sequences of 19 Archaea were analyzed with the program SPUTNIK to find di- to penta-nucleotide repeats. The number of repeats was determined for the complete chromosome sequences and for the coding and non-coding sequences. Different from what has been found for other groups of organisms, there is an abundance of SSRs in coding regions of the genome of some Archaea. Dinucleotide repeats were rare and CG repeats were found in only two Archaea. In general, trinucleotide repeats are the most abundant SSR motifs; however, pentanucleotide repeats are abundant in some Archaea. Some of the tetranucleotide and pentanucleotide repeat motifs are organism specific. In general, repeats are short and CG-rich repeats are present in Archaea having a CG-rich genome. Among the 19 Archaea, SSR density was not correlated with genome size or with optimum growth temperature. Pentanucleotide density had an inverse correlation with the CG content of the genome.

Isolation of a new class of cysteine–glycine–proline-rich beta-proteins (beta-keratins) and their expression in snake epidermis

PubMed Central

Dalla Valle, Luisa; Nardi, Alessia; Alibardi, Lorenzo

2010-01-01

Scales of snakes contain hard proteins (beta-keratins), now referred to as keratin-associated beta-proteins. In the present study we report the isolation, sequencing, and expression of a new group of these proteins from snake epidermis, designated cysteine–glycine–proline-rich proteins. One deduced protein from expressed mRNAs contains 128 amino acids (12.5 kDa) with a theoretical pI at 7.95, containing 10.2% cysteine and 15.6% glycine. The sequences of two more snake cysteine–proline-rich proteins have been identified from genomic DNA. In situ hybridization shows that the messengers for these proteins are present in the suprabasal and early differentiating beta-cells of the renewing scale epidermis. The present study shows that snake scales, as previously seen in scales of lizards, contain cysteine-rich beta-proteins in addition to glycine-rich beta-proteins. These keratin-associated beta-proteins mix with intermediate filament keratins (alpha-keratins) to produce the resistant corneous layer of snake scales. The specific proportion of these two subfamilies of proteins in different scales can determine various degrees of hardness in scales. PMID:20070430

Isolation of a new class of cysteine-glycine-proline-rich beta-proteins (beta-keratins) and their expression in snake epidermis.

PubMed

Dalla Valle, Luisa; Nardi, Alessia; Alibardi, Lorenzo

2010-03-01

Scales of snakes contain hard proteins (beta-keratins), now referred to as keratin-associated beta-proteins. In the present study we report the isolation, sequencing, and expression of a new group of these proteins from snake epidermis, designated cysteine-glycine-proline-rich proteins. One deduced protein from expressed mRNAs contains 128 amino acids (12.5 kDa) with a theoretical pI at 7.95, containing 10.2% cysteine and 15.6% glycine. The sequences of two more snake cysteine-proline-rich proteins have been identified from genomic DNA. In situ hybridization shows that the messengers for these proteins are present in the suprabasal and early differentiating beta-cells of the renewing scale epidermis. The present study shows that snake scales, as previously seen in scales of lizards, contain cysteine-rich beta-proteins in addition to glycine-rich beta-proteins. These keratin-associated beta-proteins mix with intermediate filament keratins (alpha-keratins) to produce the resistant corneous layer of snake scales. The specific proportion of these two subfamilies of proteins in different scales can determine various degrees of hardness in scales.

Spliced RNA of woodchuck hepatitis virus.

PubMed

Ogston, C W; Razman, D G

1992-07-01

Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

The REP2 Repeats of the Genome of Neisseria meningitidis Are Associated with Genes Coordinately Regulated during Bacterial Cell Interaction

PubMed Central

Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier

2003-01-01

Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

Tropical insular fish assemblages are resilient to flood disturbance

USGS Publications Warehouse

Smith, William E.; Kwak, Thomas J.

2015-01-01

Periods of stable environmental conditions, favoring development of ecological communities regulated by density-dependent processes, are interrupted by random periods of disturbance that may restructure communities. Disturbance may affect populations via habitat alteration, mortality, or displacement. We quantified fish habitat conditions, density, and movement before and after a major flood disturbance in a Caribbean island tropical river using habitat surveys, fish sampling and population estimates, radio telemetry, and passively monitored PIT tags. Native stream fish populations showed evidence of acute mortality and downstream displacement of surviving fish. All fish species were reduced in number at most life stages after the disturbance, but populations responded with recruitment and migration into vacated upstream habitats. Changes in density were uneven among size classes for most species, indicating altered size structures. Rapid recovery processes at the population level appeared to dampen effects at the assemblage level, as fish assemblage parameters (species richness and diversity) were unchanged by the flooding. The native fish assemblage appeared resilient to flood disturbance, rapidly compensating for mortality and displacement with increased recruitment and recolonization of upstream habitats.

Temporal and Spatial Expression of a Polygalacturonase during Leaf and Flower Abscission in Oilseed Rape and Arabidopsis1

PubMed Central

González-Carranza, Zinnia Haydé; Whitelaw, Catherine Ann; Swarup, Ranjan; Roberts, Jeremy Alan

2002-01-01

During leaf abscission in oilseed rape (Brassica napus), cell wall degradation is brought about by the action of several hydrolytic enzymes. One of these is thought to be polygalacturonase (PG). Degenerate primers were used to isolate a PG cDNA fragment by reverse transcriptase-polymerase chain reaction from RNA extracted from ethylene-promoted leaf abscission zones (AZs), and in turn a full-length clone (CAW471) from an oilseed rape AZ cDNA library. The highest homology of this cDNA (82%) was to an Arabidopsis sequence that was predicted to encode a PG protein. Analysis of expression revealed that CAW471 mRNA accumulated in the AZ of leaves and reached a peak 24 h after ethylene treatment. Ethylene-promoted leaf abscission in oilseed rape was not apparent until 42 h after exposure to the gas, reaching 50% at 48 h and 100% by 56 h. In floral organ abscission, expression of CAW471 correlated with cell separation. Genomic libraries from oilseed rape and Arabidopsis were screened with CAW471 and the respective genomic clones PGAZBRAN and PGAZAT isolated. Characterization of these PG genes revealed that they had substantial homology within both the coding regions and in the 5′-upstream sequences. Fusion of a 1,476-bp 5′-upstream sequence of PGAZAT to β-glucuronidase or green fluorescent protein and transformation of Arabidopsis revealed that this fragment was sufficient to drive expression of these reporter genes in the AZs at the base of the anther filaments, petals, and sepals. PMID:11842157

Common variants upstream of MLF1 at 3q25 and within CPZ at 4p16 associated with neuroblastoma.

PubMed

McDaniel, Lee D; Conkrite, Karina L; Chang, Xiao; Capasso, Mario; Vaksman, Zalman; Oldridge, Derek A; Zachariou, Anna; Horn, Millicent; Diamond, Maura; Hou, Cuiping; Iolascon, Achille; Hakonarson, Hakon; Rahman, Nazneen; Devoto, Marcella; Diskin, Sharon J

2017-05-01

Neuroblastoma is a cancer of the developing sympathetic nervous system that most commonly presents in young children and accounts for approximately 12% of pediatric oncology deaths. Here, we report on a genome-wide association study (GWAS) in a discovery cohort or 2,101 cases and 4,202 controls of European ancestry. We identify two new association signals at 3q25 and 4p16 that replicated robustly in multiple independent cohorts comprising 1,163 cases and 4,396 controls (3q25: rs6441201 combined P = 1.2x10-11, Odds Ratio 1.23, 95% CI:1.16-1.31; 4p16: rs3796727 combined P = 1.26x10-12, Odds Ratio 1.30, 95% CI: 1.21-1.40). The 4p16 signal maps within the carboxypeptidase Z (CPZ) gene. The 3q25 signal resides within the arginine/serine-rich coiled-coil 1 (RSRC1) gene and upstream of the myeloid leukemia factor 1 (MLF1) gene. Increased expression of MLF1 was observed in neuroblastoma cells homozygous for the rs6441201 risk allele (P = 0.02), and significant growth inhibition was observed upon depletion of MLF1 (P < 0.0001) in neuroblastoma cells. Taken together, we show that common DNA variants within CPZ at 4p16 and upstream of MLF1 at 3q25 influence neuroblastoma susceptibility and MLF1 likely plays an important role in neuroblastoma tumorigenesis.

Common variants upstream of MLF1 at 3q25 and within CPZ at 4p16 associated with neuroblastoma

PubMed Central

Capasso, Mario; Vaksman, Zalman; Zachariou, Anna; Horn, Millicent; Diamond, Maura; Hou, Cuiping; Iolascon, Achille; Hakonarson, Hakon; Rahman, Nazneen

2017-01-01

Neuroblastoma is a cancer of the developing sympathetic nervous system that most commonly presents in young children and accounts for approximately 12% of pediatric oncology deaths. Here, we report on a genome-wide association study (GWAS) in a discovery cohort or 2,101 cases and 4,202 controls of European ancestry. We identify two new association signals at 3q25 and 4p16 that replicated robustly in multiple independent cohorts comprising 1,163 cases and 4,396 controls (3q25: rs6441201 combined P = 1.2x10-11, Odds Ratio 1.23, 95% CI:1.16–1.31; 4p16: rs3796727 combined P = 1.26x10-12, Odds Ratio 1.30, 95% CI: 1.21–1.40). The 4p16 signal maps within the carboxypeptidase Z (CPZ) gene. The 3q25 signal resides within the arginine/serine-rich coiled-coil 1 (RSRC1) gene and upstream of the myeloid leukemia factor 1 (MLF1) gene. Increased expression of MLF1 was observed in neuroblastoma cells homozygous for the rs6441201 risk allele (P = 0.02), and significant growth inhibition was observed upon depletion of MLF1 (P < 0.0001) in neuroblastoma cells. Taken together, we show that common DNA variants within CPZ at 4p16 and upstream of MLF1 at 3q25 influence neuroblastoma susceptibility and MLF1 likely plays an important role in neuroblastoma tumorigenesis. PMID:28545128

Kin28 regulates the transient association of Mediator with core promoters

PubMed Central

Jeronimo, Célia; Robert, François

2014-01-01

Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787

Sequencing and diversity analyses reveal extensive similarities between some epsilon-toxin-encoding plasmids and the pCPF5603 Clostridium perfringens enterotoxin plasmid.

PubMed

Miyamoto, Kazuaki; Li, Jihong; Sayeed, Sameera; Akimoto, Shigeru; McClane, Bruce A

2008-11-01

Clostridium perfringens type B and D isolates produce epsilon-toxin, the third most potent clostridial toxin. The epsilon-toxin gene (etx) is plasmid borne in type D isolates, but etx genetics have been poorly studied in type B isolates. This study reports the first sequencing of any etx plasmid, i.e., pCP8533etx, from type B strain NCTC8533. This etx plasmid is 64.7 kb, carries tcp conjugative transfer genes, and encodes additional potential virulence factors including beta2-toxin, sortase, and collagen adhesin but not beta-toxin. Interestingly, nearly 80% of pCP8533etx open reading frames (ORFs) are also present on pCPF5603, an enterotoxin-encoding plasmid from type A isolate F5603. Pulsed-field gel electrophoresis and overlapping PCR indicated that a pCP8533etx-like etx plasmid is also present in most, if not all, other type B isolates and some beta2-toxin-positive, cpe-negative type D isolates, while other type D isolates carry different etx plasmids. Sequences upstream of the etx gene vary between type B isolates and some type D isolates that do not carry a pCP8533etx-like etx plasmid. However, nearly all type B and D isolates have an etx locus with an upstream IS1151, and those etx loci typically reside near a dcm ORF. These results suggest that pCPF5603 and pCP8533etx evolved from insertion of mobile genetic elements carrying enterotoxin or etx genes, respectively, onto a common progenitor plasmid.

Silurian sequence stratigraphy in the North American craton, Great Lakes area

USGS Publications Warehouse

Shaver, R.H.; ,

1996-01-01

A notable circumstance of late Early through Late Silurian sedimentation on the Great Lakes area craton is that at least two and possibly three cycles of third-order duration (if eustatically considered) are recognized in basin and shallow-platform settings alike. Both virtually pure and siliciclastic-rich carbonate rocks exist in parts of platform-situated sections in contrast to siliciclastic-rich to evaporite-dominated basin sections. Knowledge of the reef history, together with evidence of incidental periodic incursions of siliciclastic sediments, permitted understanding of a regional event or sequence stratigraphy more than 15 years ago before conventional biostratigraphic and physical stratigraphic evidence became adequate to corroborate. This midwestern US and Ontario Silurian record has become strategic for testing different schools of thought that champion either tectonism or eustasy to explain cyclical sequences.

Origin of spinel-rich chondrules and inclusions in carbonaceous and ordinary chondrites

NASA Technical Reports Server (NTRS)

Kornacki, A. S.; Fegley, B., Jr.

1984-01-01

The evaluation of three models of the origin of spinel-rich chondrules and inclusions presented here includes new calculations of the major-element refractory mineral condensation sequence from a gas of solar composition over a wide pressure interval. Condensation calculations show that spinel-rich chondrules did not crystallize from metastable liquid condensates, and that spinel-rich inclusions are not aggregates of refractory nebular condensates. It is proposed that spinel-rich objects are fractionated distillation residues of small aggregates of primitive dust that lost Ca, Si-rich partial melts by evaporation, ablation, or splashing during collisions. This model also explains why spinel-rich chondrules and inclusions (1) are usually smaller than melilite-rich chondrules and inclusions; (2) often have highly fractionated trace-element compositions; and (3) usually do not contain Pt-metal nuggets even when they are more enriched in the Pt-group metals than nugget-bearing melilite-rich objects.

Restructuring upstream bioprocessing: technological and economical aspects for production of a generic microbial feedstock from wheat.

PubMed

Koutinas, A A; Wang, R; Webb, C

2004-03-05

Restructuring and optimization of the conventional fermentation industry for fuel and chemical production is necessary to replace petrochemical production routes. Guided by this concept, a novel biorefinery process has been developed as an alternative to conventional upstream processing routes, leading to the production of a generic fermentation feedstock from wheat. The robustness of Aspergillus awamori as enzyme producer is exploited in a continuous fungal fermentation on whole wheat flour. Vital gluten is extracted as an added-value byproduct by the conventional Martin process from a fraction of the overall wheat used. Enzymatic hydrolysis of gluten-free flour by the enzyme complex produced by A. awamori during fermentation produces a liquid stream rich in glucose (320 g/L). Autolysis of fungal cells produces a micronutrient-rich solution similar to yeast extract (1.6 g/L nitrogen, 0.5 g/L phosphorus). The case-specific combination of these two liquid streams can provide a nutrient-complete fermentation medium for a spectrum of microbial bioconversions for the production of such chemicals as organic acids, amino acids, bioethanol, glycerol, solvents, and microbial biodegradable plastics. Preliminary economic analysis has shown that the operating cost required to produce the feedstock is dependent on the plant capacity, cereal market price, presence and market value of added-value byproducts, labor costs, and mode of processing (batch or continuous). Integration of this process in an existing fermentation plant could lead to the production of a generic feedstock at an operating cost lower than the market price of glucose syrup (90% to 99% glucose) in the EU, provided that the plant capacity exceeds 410 m(3)/day. Further process improvements are also suggested. Copyright 2004 Wiley Periodicals, Inc.

Characterization of a Fluorescent Protein Reporter System

DTIC Science & Technology

2008-03-01

pathways are initiated with the binding of a small molecule to a catalytic ribonucleic acid molecule (RNA), called a ribozyme (Thodima et al., 2006). The... ribozyme is part of a larger RNA construct, called a riboswitch, which initiates translation of a specific genetic sequence on a plasmid (circular...protein gene. Yen et al. (2004) reported insertion of a self-cleaving ribozyme upstream of the reporter gene. In the absence of a regulator (“off

Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.

PubMed

Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N

2014-07-01

Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Coupled transcription and processing of mouse ribosomal RNA in a cell-free system.

PubMed Central

Mishima, Y; Mitsuma, T; Ogata, K

1985-01-01

An in vitro processing system of mouse rRNA was achieved using an RNA polymerase I-specific transcription system, (S100) and recombinant plasmids consisting of mouse rRNA gene (rDNA) segments containing the transcription initiation and 5'-terminal region of 18S (or 41S) rRNA. Pulse-chase experiments showed that a specific processing occurred with transcripts of the plasmid DNAs when the direction of transcription was the correct orientation relative to the 18S rRNA coding sequence, but not with transcripts of the DNA templates in which this coding sequence was in the opposite orientation. From the S1 nuclease protection analyses, we concluded that there are several steps of endonucleolytic cleavage including one 105 nucleotides upstream from the 5' end of 18S rRNA. Intermediates cleaved at this site were identified in in vivo processing of rRNA. This result indicates that endonucleolytic cleavage takes place 105 nucleotides upstream from the 5' terminus of 18S rRNA prior to the formation of mature 18S rRNA. Trimming or cleavage of the 105 nucleotides may be involved in the formation of the 5' terminus of mature 18S rRNA. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. PMID:3004977

O2 and CO2 glow-discharge-assisted oxygen transport through Ag

NASA Astrophysics Data System (ADS)

Outlaw, R. A.

1990-08-01

The permeation of oxygen through Ag normally occurs by a sequence of steps which include the initial dissociative adsorption of molecular oxygen at the upstream surface, the dissolution of the atoms into the bulk, and the subsequent migration of the atoms between octahedral sites of the lattice until they arrive at the vacuum interface downstream. The dissociative adsorption step, however, proceeds slowly, as indicated by the low sticking coefficient of O2 on Ag(10-6-10-3). The application of a dc field in 0.5 Torr of O2 (E/n˜10-14 V cm2) on the upstream side of a Ag membrane generated gas phase atomic oxygen that substantially enhanced the transport. The transport flux was observed to increase from a value of 4.4×1013 cm-2 s-1 to a glow discharge value of 2.83×1014 cm-2 s-1 at a membrane temperature of 650 °C. This suggests that the dissociative adsorption step limits the supply of oxygen atoms to the upstream side of the membrane. When the upstream O2 was replaced by an equal pressure of CO2, only a small permeation signal was observed, but the application of the glow discharge substantially increased the transport flux from 3.25×1012 cm-2 s-1 to 1.74×1014 cm-2 s-1. This method of separating O2 from a CO2 environment may be a possible mechanism for providing a supply of oxygen for astronauts in a manned mission to Mars.

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

XX males SRY negative: a confirmed cause of infertility.

PubMed

Vetro, Annalisa; Ciccone, Roberto; Giorda, Roberto; Patricelli, Maria Grazia; Della Mina, Erika; Forlino, Antonella; Zuffardi, Orsetta

2011-10-01

SOX9 is a widely expressed transcription factor playing several relevant functions during development and essential for testes differentiation. It is considered to be the direct target gene of the protein encoded by SRY and its overexpression in an XX murine gonad can lead to male development in the absence of Sry. Recently, a family was reported with a 178 kb duplication in the gene desert region ending about 500 kb upstream of SOX9 in which 46,XY duplicated persons were completely normal and fertile whereas the 46,XX ones were males who came to clinical attention because of infertility. We report a family with two azoospermic brothers, both 46,XX, SRY negative, having a 96 kb triplication 500 kb upstream of SOX9. Both subjects have been analyzed trough oligonucleotide array-CGH and the triplication was confirmed and characterised through qPCR, defining the minimal region of amplification upstream of SOX9 associated with 46,XX infertile males, SRY negative. Our results confirm that even in absence of SRY, complete male differentiation may occur, possibly driven by overexpression of SOX9 in the gonadal ridge, as a consequence of the amplification of a gene desert region. We hypothesize that this region contains gonadal specific long-range regulation elements whose alteration may impair the normal sex development. Our data show that normal XX males, with alteration in copy number or, possibly, in the critical sequence upstream to SOX9 are a new category of infertility inherited in a dominant way with expression limited to the XX background.

Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mencinger, M.; Panagopoulos, I.; Andreasson, P.

1997-05-01

Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less

Complete mitochondrial genome of the stonefly Cryptoperla stilifera Sivec (Plecoptera: Peltoperlidae) and the phylogeny of Polyneopteran insects.

PubMed

Wu, Hai-Yan; Ji, Xiao-Yu; Yu, Wei-Wei; Du, Yu-Zhou

2014-03-10

We present the complete mitogenome of a stonefly, Cryptoperla stilifera Sivec (Plecoptera; Peltoperlidae). The mitogenome was a circular molecule consisting of 15,633 nucleotides, 37 genes and a A+T-rich region. C. stilifera mitogenome was similar to Pteronarcys princeps mitogenome (Plecoptera; Pteronarcyidae). All transfer RNA genes (tRNAs) had typical cloverleaf secondary structures except for trnSer (AGN), where the stem-loop structure of the dihydrouridine (DHU) arm was missing. The A+T-rich region of C. stilifera had two stem-loops and each had two interlink. Three conserved sequence blocks (CSBs) were present in the A+T-rich regions of C. stilifera, Peltoperla tarteri and Peltoperla arcuata. Moreover, many polynucleotide stretches (Poly N, N=A, T and C) in the A+T-rich region of C. stilifera Phylogenetic relationships of Polyneopteran species were constructed based on the nucleotide sequences of 13 protein coding genes (PCGs). Both maximum likelihood (ML) and Bayesian inference (BI) analyses supported Grylloblattodea as the sister group to Plecoptera+Dermaptera and Embiidina and Phasmatodea as sister groups. Copyright © 2014 Elsevier B.V. All rights reserved.

SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

PubMed

Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

1997-10-31

Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Promoter activity of polypyrimidine tract-binding protein genes of potato responds to environmental cues.

PubMed

Butler, Nathaniel M; Hannapel, David J

2012-12-01

Polypyrimidine tract-binding (PTB) proteins are RNA-binding proteins that target specific RNAs for post-transcriptional processing by binding cytosine/uracil motifs. PTBs have established functions in a range of RNA processes including splicing, translation, stability and long-distance transport. Six PTB-like genes identified in potato have been grouped into two clades based on homology to other known plant PTBs. StPTB1 and StPTB6 are closely related to a PTB protein discovered in pumpkin, designated CmRBP50, and contain four canonical RNA-recognition motifs. CmRBP50 is expressed in phloem tissues and functions as the core protein of a phloem-mobile RNA/protein complex. Sequence from the potato genome database was used to clone the upstream sequence of these two PTB genes and analyzed to identify conserved cis-elements. The promoter of StPTB6 was enriched for regulatory elements for light and sucrose induction and defense. Upstream sequence of both PTB genes was fused to β-glucuronidase and monitored in transgenic potato lines. In whole plants, the StPTB1 promoter was most active in leaf veins and petioles, whereas StPTB6 was most active in leaf mesophyll. Both genes are active in new tubers and tuber sprouts. StPTB6 expression was induced in stems and stolon sections in response to sucrose and in leaves or petioles in response to light, heat, drought and mechanical wounding. These results show that CmRBP50-like genes of potato exhibit distinct expression patterns and respond to both developmental and environmental cues.

The effects of DNA supercoiling on G-quadruplex formation.

PubMed

Sekibo, Doreen A T; Fox, Keith R

2017-12-01

Guanine-rich DNAs can fold into four-stranded structures that contain stacks of G-quartets. Bioinformatics studies have revealed that G-rich sequences with the potential to adopt these structures are unevenly distributed throughout genomes, and are especially found in gene promoter regions. With the exception of the single-stranded telomeric DNA, all genomic G-rich sequences will always be present along with their C-rich complements, and quadruplex formation will be in competition with the corresponding Watson-Crick duplex. Quadruplex formation must therefore first require local dissociation (melting) of the duplex strands. Since negative supercoiling is known to facilitate the formation of alternative DNA structures, we have investigated G-quadruplex formation within negatively supercoiled DNA plasmids. Plasmids containing multiple copies of (G3T)n and (G3T4)n repeats, were probed with dimethylsulphate, potassium permanganate and S1 nuclease. While dimethylsulphate footprinting revealed some evidence for G-quadruplex formation in (G3T)n sequences, this was not affected by supercoiling, and permanganate failed to detect exposed thymines in the loop regions. (G3T4)n sequences were not protected from DMS and showed no reaction with permanganate. Similarly, both S1 nuclease and 2D gel electrophoresis of DNA topoisomers did not detect any supercoil-dependent structural transitions. These results suggest that negative supercoiling alone is not sufficient to drive G-quadruplex formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

An Upstream Truncation of the furA-katG Operon Confers High-Level Isoniazid Resistance in a Mycobacterium tuberculosis Clinical Isolate with No Known Resistance-Associated Mutations

PubMed Central

Yam, Wing Cheong; Zhang, Ying; Kao, Richard Y. T.

2014-01-01

Although the major causes of isoniazid (INH) resistance in Mycobacterium tuberculosis are confined to structural mutations in katG and promoter mutations in the mabA-inhA operon, a significant proportion of INH-resistant strains have unknown resistance mechanisms. Recently, we identified a high-level INH-resistant M. tuberculosis clinical isolate, GB005, with no known resistance-associated mutations. A comprehensive study was performed to investigate the molecular basis of drug resistance in this strain. Although no mutations were found throughout the katG and furA-katG intergenic region, the katG expression and the catalase activity were greatly diminished compared to those in H37Rv (P < 0.01). Northern blotting revealed that the katG transcript from the isolate was smaller than that of H37Rv. Sequencing analysis of furA and upstream genes discovered a 7.2-kb truncation extended from the 96th base preceding the initiation codon of katG. Complementation of the M. tuberculosis Δ(furA-katG) strain with katG and different portions of the truncated region identified a 134-bp upstream fragment of furA that was essential for full catalase activity and INH susceptibility in M. tuberculosis. The promoter activity of this fragment was also shown to be stronger than that of the furA-katG intergenic region (P < 0.01). Collectively, these findings demonstrate that deletion of the 134-bp furA upstream fragment is responsible for the reduction in katG expression, resulting in INH resistance in GB005. To our knowledge, this is the first report showing that deletion of the upstream region preceding the furA-katG operon causes high-level INH resistance in a clinical isolate of M. tuberculosis. PMID:25092698

Aquatic insect community structure under the influence of small dams in a stream of the Mogi-Guaçu river basin, state of São Paulo.

PubMed

Saulino, H H L; Corbi, J J; Trivinho-Strixino, S

2014-02-01

The fragmentation of lotic systems caused by construction of dams has modified many aquatic communities. The objective of this study was to analyse changes in the aquatic insect community structure by discontinuity of habitat created by dams along the Ribeirão das Anhumas, a sub-basin of the Mogi-Guaçu River (state of São Paulo, Brazil). Entomofauna collection was carried out in 10 segments upstream and downstream of five dams along the longitudinal profile of the stream, with a quick sampling method using a D net (mesh 250 mm) with 2 minutes of sampling effort. The insects were sorted and identified to the lowest possible taxonomic level and analysed by the Shannon diversity index, β diversity, richness estimated by rarefaction curves and relative participation of functional feeding groups. The results showed a slight reduction in diversity in the downstream segments, as well as along the longitudinal profile of the stream. However, there were no significant differences in abundance and richness between the upstream and downstream segments, indicating that the dams did not influence these variables. Differences were observed in the functional feeding groups along the longitudinal profile. Predator and gatherer insects were dominant in all segments analysed. The feeding group of shredders was more abundant in the segment DSIII with the participation of Marilia Müller (Odontoceridae - Trichoptera), although we observed a decrease of shredders and scrapers with the decrease of the canopy cover reducing values of β diversity in the continuum of Ribeirão das Anhumas. This result demonstrated the importance of the conservation of the riparian vegetation in order to maintain the integrity of the stream.

Purification and characterization of moschins, arginine-glutamate-rich proteins with translation-inhibiting activity from brown pumpkin (Cucurbita moschata) seeds.

PubMed

Ng, T B; Parkash, A; Tso, W W

2002-10-01

From fresh brown pumpkin seeds, two proteins with a molecular mass of 12kDa and an N-terminal sequence rich in arginine and glutamate residues were obtained. The protein designated alpha-moschin closely resembled the fruitfly programmed-cell death gene product and the protein designated beta-moschin demonstrated striking similarity to prepro 2S albumin in N-terminal sequence. alpha- and beta-moschins inhibited translation in the rabbit reticulocyte lysate system with an IC(50) of 17 microM and 300nM, respectively.

Origins of the protein synthesis cycle

NASA Technical Reports Server (NTRS)

Fox, S. W.

1981-01-01

Largely derived from experiments in molecular evolution, a theory of protein synthesis cycles has been constructed. The sequence begins with ordered thermal proteins resulting from the self-sequencing of mixed amino acids. Ordered thermal proteins then aggregate to cell-like structures. When they contained proteinoids sufficiently rich in lysine, the structures were able to synthesize offspring peptides. Since lysine-rich proteinoid (LRP) also catalyzes the polymerization of nucleoside triphosphate to polynucleotides, the same microspheres containing LRP could have synthesized both original cellular proteins and cellular nucleic acids. The LRP within protocells would have provided proximity advantageous for the origin and evolution of the genetic code.

Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Markussen, Turhan; Jonassen, Christine Monceyron; Numanovic, Sanela

2008-05-10

Infectious salmon anaemia virus (ISAV) is an orthomyxovirus causing a multisystemic, emerging disease in Atlantic salmon. Here we present, for the first time, detailed sequence analyses of the full-genome sequence of a presumed avirulent isolate displaying a full-length hemagglutinin-esterase (HE) gene (HPR0), and compare this with full-genome sequences of 11 Norwegian ISAV isolates from clinically diseased fish. These analyses revealed the presence of a virulence marker right upstream of the putative cleavage site R{sub 267} in the fusion (F) protein, suggesting a Q{sub 266} {yields} L{sub 266} substitution to be a prerequisite for virulence. To gain virulence in isolates lackingmore » this substitution, a sequence insertion near the cleavage site seems to be required. This strongly suggests the involvement of a protease recognition pattern at the cleavage site of the fusion protein as a determinant of virulence, as seen in highly pathogenic influenza A virus H5 or H7 and the paramyxovirus Newcastle disease virus.« less

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

A Rapid Method for Engineering Recombinant Polioviruses or Other Enteroviruses.

PubMed

Bessaud, Maël; Pelletier, Isabelle; Blondel, Bruno; Delpeyroux, Francis

2016-01-01

The cloning of large enterovirus RNA sequences is labor-intensive because of the frequent instability in bacteria of plasmidic vectors containing the corresponding cDNAs. In order to circumvent this issue we have developed a PCR-based method that allows the generation of highly modified or chimeric full-length enterovirus genomes. This method relies on fusion PCR which enables the concatenation of several overlapping cDNA amplicons produced separately. A T7 promoter sequence added upstream the fusion PCR products allows its transcription into infectious genomic RNAs directly in transfected cells constitutively expressing the phage T7 RNA polymerase. This method permits the rapid recovery of modified viruses that can be subsequently amplified on adequate cell-lines.

Microbial diversity of an anoxic zone of a hydroelectric power station reservoir in Brazilian Amazonia.

PubMed

Graças, Diego A; Miranda, Paulo R; Baraúna, Rafael A; McCulloch, John A; Ghilardi, Rubens; Schneider, Maria Paula C; Silva, Artur

2011-11-01

Microbial diversity was evaluated in an anoxic zone of Tucuruí Hydroelectric Power Station reservoir in Brazilian Amazonia using a culture-independent approach by amplifying and sequencing fragments of the 16S rRNA gene using metagenomic DNA as a template. Samples obtained from the photic, aphotic (40 m) and sediment (60 m) layers were used to construct six 16S rDNA libraries containing a total of 1,152 clones. The sediment, aphotic and photic layers presented 64, 33 and 35 unique archaeal operational taxonomic units (OTUs). The estimated richness of these layers was evaluated to be 153, 106 and 79 archaeal OTUs, respectively, using the abundance-based coverage estimator (ACE) and 114, 83 and 77 OTUs using the Chao1 estimator. For bacterial sequences, 114, 69 and 57 OTUs were found in the sediment, aphotic and photic layers, which presented estimated richnesses of 1,414, 522 and 197 OTUs (ACE) and 1,059, 1,014 and 148 OTUs (Chao1), respectively. Phylogenetic analyses of the sequences obtained revealed a high richness of microorganisms which participate in the carbon cycle, namely, methanogenic archaea and methanotrophic proteobacteria. Most sequences obtained belong to non-culturable prokaryotes. The present study offers the first glimpse of the huge microbial diversity of an anoxic area of a man-made lacustrine environment in the tropics.

The pineapple AcMADS1 promoter confers high level expression in tomato and arabidopsis flowering and fruiting tissues, but AcMADS1 does not complement the tomato LeMADS-RIN (rin) mutant

USDA-ARS?s Scientific Manuscript database

A previous EST study identified a MADS box transcription factor coding sequence, AcMADS1, that is strongly induced during non-climacteric pineapple fruit ripening. Phylogenetic analyses place the AcMADS1 protein in the same superclade as LeMADS-RIN, a master regulator of fruit ripening upstream of e...

The Role of eIF4E Activity in Breast Cancer

DTIC Science & Technology

2010-08-01

ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

A family of long intergenic non-coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence

PubMed Central

2018-01-01

FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722

cDNA sequences and organization of IgM heavy chain genes in two holostean fish.

PubMed

Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W

1995-01-01

Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

PubMed

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

Leptoglycin: a new Glycine/Leucine-rich antimicrobial peptide isolated from the skin secretion of the South American frog Leptodactylus pentadactylus (Leptodactylidae).

PubMed

Sousa, Juliana C; Berto, Raquel F; Gois, Elicélia A; Fontenele-Cardi, Nauíla C; Honório, José E R; Konno, Katsuhiro; Richardson, Michael; Rocha, Marcos F G; Camargo, Antônio A C M; Pimenta, Daniel C; Cardi, Bruno A; Carvalho, Krishnamurti M

2009-07-01

Antimicrobial peptides are components of innate immunity that is the first-line defense against invading pathogens for a wide range of organisms. Here, we describe the isolation, biological characterization and amino acid sequencing of a novel neutral Glycine/Leucine-rich antimicrobial peptide from skin secretion of Leptodactylus pentadactylus named leptoglycin. The amino acid sequence of the peptide purified by RP-HPLC (C(18) column) was deduced by mass spectrometric de novo sequencing and confirmed by Edman degradation: GLLGGLLGPLLGGGGGGGGGLL. Leptoglycin was able to inhibit the growth of Gram-negative bacteria Pseudomonas aeruginosa, Escherichia coli and Citrobacter freundii with minimal inhibitory concentrations (MICs) of 8 microM, 50 microM, and 75 microM respectively, but it did not show antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis), yeasts (Candida albicans and Candida tropicalis) and dermatophytes fungi (Microsporum canis and Trichophyton rubrum). No hemolytic activity was observed at the 2-200 microM range concentration. The amino acid sequence of leptoglycin with high level of glycine (59.1%) and leucine (36.4%) containing an unusual central proline suggests the existence of a new class of Gly/Leu-rich antimicrobial peptides. Taken together, these results suggest that this natural antimicrobial peptide could be a tool to develop new antibiotics.

Microbial Community Structure and Arsenic Biogeochemistry in an Acid Vapor-Formed Spring in Tengchong Geothermal Area, China.

PubMed

Jiang, Zhou; Li, Ping; Jiang, Dawei; Dai, Xinyue; Zhang, Rui; Wang, Yanhong; Wang, Yanxin

2016-01-01

Arsenic biogeochemistry has been studied extensively in acid sulfate-chloride hot springs, but not in acid sulfate hot springs with low chloride. In this study, Zhenzhuquan in Tengchong geothermal area, a representative acid sulfate hot spring with low chloride, was chosen to study arsenic geochemistry and microbial community structure using Illumina MiSeq sequencing. Over 0.3 million 16S rRNA sequence reads were obtained from 6-paired parallel water and sediment samples along its outflow channel. Arsenic oxidation occurred in the Zhenxhuquan pool, with distinctly high ratios of arsenate to total dissolved arsenic (0.73-0.86). Coupled with iron and sulfur oxidation along the outflow channel, arsenic accumulated in downstream sediments with concentrations up to 16.44 g/kg and appeared to significantly constrain their microbial community diversity. These oxidations might be correlated with the appearance of some putative functional microbial populations, such as Aquificae and Pseudomonas (arsenic oxidation), Sulfolobus (sulfur and iron oxidation), Metallosphaera and Acidicaldus (iron oxidation). Temperature, total organic carbon and dissolved oxygen significantly shaped the microbial community structure of upstream and downstream samples. In the upstream outflow channel region, most microbial populations were microaerophilic/anaerobic thermophiles and hyperthermophiles, such as Sulfolobus, Nocardia, Fervidicoccus, Delftia, and Ralstonia. In the downstream region, aerobic heterotrophic mesophiles and thermophiles were identified, including Ktedonobacteria, Acidicaldus, Chthonomonas and Sphingobacteria. A total of 72.41-95.91% unassigned-genus sequences were derived from the downstream high arsenic sediments 16S rRNA clone libraries. This study could enable us to achieve an integrated understanding on arsenic biogeochemistry in acid hot springs.

Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

PubMed

Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

2006-12-01

Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

PubMed Central

Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

2014-01-01

Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

PubMed Central

Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

1991-01-01

The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

Classification of G-protein coupled receptors based on a rich generation of convolutional neural network, N-gram transformation and multiple sequence alignments.

PubMed

Li, Man; Ling, Cheng; Xu, Qi; Gao, Jingyang

2018-02-01

Sequence classification is crucial in predicting the function of newly discovered sequences. In recent years, the prediction of the incremental large-scale and diversity of sequences has heavily relied on the involvement of machine-learning algorithms. To improve prediction accuracy, these algorithms must confront the key challenge of extracting valuable features. In this work, we propose a feature-enhanced protein classification approach, considering the rich generation of multiple sequence alignment algorithms, N-gram probabilistic language model and the deep learning technique. The essence behind the proposed method is that if each group of sequences can be represented by one feature sequence, composed of homologous sites, there should be less loss when the sequence is rebuilt, when a more relevant sequence is added to the group. On the basis of this consideration, the prediction becomes whether a query sequence belonging to a group of sequences can be transferred to calculate the probability that the new feature sequence evolves from the original one. The proposed work focuses on the hierarchical classification of G-protein Coupled Receptors (GPCRs), which begins by extracting the feature sequences from the multiple sequence alignment results of the GPCRs sub-subfamilies. The N-gram model is then applied to construct the input vectors. Finally, these vectors are imported into a convolutional neural network to make a prediction. The experimental results elucidate that the proposed method provides significant performance improvements. The classification error rate of the proposed method is reduced by at least 4.67% (family level I) and 5.75% (family Level II), in comparison with the current state-of-the-art methods. The implementation program of the proposed work is freely available at: https://github.com/alanFchina/CNN .

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

Status of the Microbial Census

PubMed Central

Schloss, Patrick D.; Handelsman, Jo

2004-01-01

Over the past 20 years, more than 78,000 16S rRNA gene sequences have been deposited in GenBank and the Ribosomal Database Project, making the 16S rRNA gene the most widely studied gene for reconstructing bacterial phylogeny. While there is a general appreciation that these sequences are largely unique and derived from diverse species of bacteria, there has not been a quantitative attempt to describe the extent of sequencing efforts to date. We constructed rarefaction curves for each bacterial phylum and for the entire bacterial domain to assess the current state of sampling and the relative taxonomic richness of each phylum. This analysis quantifies the general sense among microbiologists that we are a long way from a complete census of the bacteria on Earth. Moreover, the analysis indicates that current sampling strategies might not be the most effective ones to describe novel diversity because there remain numerous phyla that are globally distributed yet poorly sampled. Based on the current level of sampling, it is not possible to estimate the total number of bacterial species on Earth, but the minimum species richness is 35,498. Considering previous global species richness estimates of 107 to 109, we are certain that this estimate will increase with additional sequencing efforts. The data support previous calls for extensive surveys of multiple chemically disparate environments and of specific phylogenetic groups to advance the census most rapidly. PMID:15590780

In Vivo Imaging of MDR1A Gene Expression

DTIC Science & Technology

2004-12-01

Engineer PGK-neo and Renilla luciferase cassettes, already available, with appropriate loxP sites, into mdrla locus. Repeat for HSV-tk reporter. The...of the gene-targeting vector. under the control of the PGK promoter. Luc: Renilla luciferase fused in- frame with the translated sequences of exon 2...between the two loxP sites, upstream of the Neo cassette. A cloning strategy was then devised to fuse Renilla luciferase in-frame with the translated

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7

PubMed Central

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain

2017-01-01

ABSTRACT Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent −12/−24 promoter consensus. The expression of an exaA::lacZ fusion was induced maximally by glycerol and was dependent on σ54. Bioinformatic analysis of the sequence flanking the −12/−24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA. EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense. We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ54-dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ54. The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ54 in other bacteria. PMID:28439037

Regulation of a Glycerol-Induced Quinoprotein Alcohol Dehydrogenase by σ54 and a LuxR-Type Regulator in Azospirillum brasilense Sp7.

PubMed

Singh, Vijay Shankar; Dubey, Ashutosh Prakash; Gupta, Ankush; Singh, Sudhir; Singh, Bhupendra Narain; Tripathi, Anil Kumar

2017-07-01

Azospirillum brasilense Sp7 uses glycerol as a carbon source for growth and nitrogen fixation. When grown in medium containing glycerol as a source of carbon, it upregulates the expression of a protein which was identified as quinoprotein alcohol dehydrogenase (ExaA). Inactivation of exaA adversely affects the growth of A. brasilense on glycerol. A determination of the transcription start site of exaA revealed an RpoN-dependent -12/-24 promoter consensus. The expression of an exaA :: lacZ fusion was induced maximally by glycerol and was dependent on σ 54 Bioinformatic analysis of the sequence flanking the -12/-24 promoter revealed a 17-bp sequence motif with a dyad symmetry of 6 nucleotides upstream of the promoter, the disruption of which caused a drastic reduction in promoter activity. The electrophoretic mobility of a DNA fragment containing the 17-bp sequence motif was retarded by purified EraR, a LuxR-type transcription regulator that is transcribed divergently from exaA EraR also showed a positive interaction with RpoN in two-hybrid and pulldown assays. IMPORTANCE Quinoprotein alcohol dehydrogenase (ExaA) plays an important role in the catabolism of alcohols in bacteria. Although exaA expression is thought to be regulated by a two-component system consisting of EraS and EraR, the mechanism of regulation was not known. This study shows the details of the regulation of expression of the exaA gene in A. brasilense We have shown here that exaA of A. brasilense is maximally induced by glycerol and harbors a σ 54 -dependent promoter. The response regulator EraR binds to an inverted repeat located upstream of the exaA promoter. This study shows that a LuxR-type response regulator (EraR) binds upstream of the exaA gene and physically interacts with σ 54 The unique feature of this regulation is that EraR is a LuxR-type transcription regulator that lacks the GAFTGA motif, a characteristic feature of the enhancer binding proteins that are known to interact with σ 54 in other bacteria. Copyright © 2017 American Society for Microbiology.

An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

PubMed

Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

2009-10-19

Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

Leaf Litter Decomposition as a Functional Assessment of a Natural Stream Channel Design Project

NASA Astrophysics Data System (ADS)

Gentry, A.; Word, D.; Carreiro, M.; Jack, J.

2005-05-01

In October 2003, a 965m reach of Wilson Creek (Bernheim Research Forest, Kentucky, USA) was relocated, and meanders and riffle-pool sequences were restored, providing a unique opportunity to measure the re-establishment of post-restoration stream functions. Leaf litter bags were placed across riffles in the restored reach, in an upstream reference site and in two reference streams. Bags were collected for nine months, and mass loss, N dynamics and fungal ergosterol were measured. Daily mass loss rates in the restored and reference riffles in Wilson Creek were faster (k= -0.00759 and k= -0.00855, respectively) than those of the two reference streams (k= -0.00511 and k= -0.00308). This is equivalent to litter mean residence times of 132 days for the restored reach in Wilson, 117 days in the upstream reference site, and 196 and 325 days for the reference streams. It appears that the decay rate in the restored reach is similar to the upstream portion of Wilson Creek, indicating rapid mass loss recovery in the restored reach. We also determined that same-stream reference sites are important for evaluating the restoration of stream functions, because of high decay rate variation among nearby streams within the same watershed.

Legume Genome Initiative at the University of Oklahoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruce A. Roe

2004-02-27

Consolidated Appropriations Resolution, 2003 Conference Report for the Department of Energy's Biological and Environmental Research (BER) program provided $481,000 for the Legume Genome Initiative at the University of Oklahoma. These funds were used to support our research that is aimed at determining the entire sequence of the gene rich regions of the genome of the legume, Medicago truncatula, by allowing us to obtain a greater degree of finished BAC sequences from the draft sequences we have already obtained through research funded by the Noble Foundation. During the funding period we increased the number of Medicago truncatula BACs with finished (Bermudamore » standard) sequences from 109 to 359, and the total number of BACs for which we collected sequence data from 584 to 842, 359 of which reached phase 2 (ordered and oriented contigs). We also sequenced a series of pooled BAC clones that cover additional euchromatic (gene rich) genomic regions. This work resulted in 6 refereed publications, see below. Genes whose sequence was determined during this study included multiple members of the plant disease resistance (R-gene) family as well as several genes involved in flavinoid biosynthesis, nitrogen fixation and plant-microbial symbosis. This work also served as a prelude to obtaining NSF funding for the international collaborative effort to complete the entire sequence of the Medicago truncatula genomic euchromatic regions using a BAC based approach.« less

X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

PubMed Central

Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks. PMID:10613874

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

PubMed

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks.

Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

PubMed

Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

2017-09-01

Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Effort versus Reward: Preparing Samples for Fungal Community Characterization in High-Throughput Sequencing Surveys of Soils

PubMed Central

Song, Zewei; Schlatter, Dan; Kennedy, Peter; Kinkel, Linda L.; Kistler, H. Corby; Nguyen, Nhu; Bates, Scott T.

2015-01-01

Next generation fungal amplicon sequencing is being used with increasing frequency to study fungal diversity in various ecosystems; however, the influence of sample preparation on the characterization of fungal community is poorly understood. We investigated the effects of four procedural modifications to library preparation for high-throughput sequencing (HTS). The following treatments were considered: 1) the amount of soil used in DNA extraction, 2) the inclusion of additional steps (freeze/thaw cycles, sonication, or hot water bath incubation) in the extraction procedure, 3) the amount of DNA template used in PCR, and 4) the effect of sample pooling, either physically or computationally. Soils from two different ecosystems in Minnesota, USA, one prairie and one forest site, were used to assess the generality of our results. The first three treatments did not significantly influence observed fungal OTU richness or community structure at either site. Physical pooling captured more OTU richness compared to individual samples, but total OTU richness at each site was highest when individual samples were computationally combined. We conclude that standard extraction kit protocols are well optimized for fungal HTS surveys, but because sample pooling can significantly influence OTU richness estimates, it is important to carefully consider the study aims when planning sampling procedures. PMID:25974078

[A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

PubMed

Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

2003-01-01

To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

Using "Arabidopsis" Genetic Sequences to Teach Bioinformatics

ERIC Educational Resources Information Center

Zhang, Xiaorong

2009-01-01

This article describes a new approach to teaching bioinformatics using "Arabidopsis" genetic sequences. Several open-ended and inquiry-based laboratory exercises have been designed to help students grasp key concepts and gain practical skills in bioinformatics, using "Arabidopsis" leucine-rich repeat receptor-like kinase (LRR…

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

Detailed analysis of stem I and its 5' and 3' neighbor regions in the trans-acting HDV ribozyme.

PubMed Central

Nishikawa, F; Roy, M; Fauzi, H; Nishikawa, S

1999-01-01

To determine the stem I structure of the human hepatitis delta virus (HDV) ribozyme, which is related to the substrate sequence in the trans -acting system, we kinetically studied stem I length and sequences. Stem I extension from 7 to 8 or 9 bp caused a loss of activity and a low amount of active complex with 9 bp in the trans -acting system. In a previous report, we presented cleavage in a 6 bp stem I. The observed reaction rates indicate that the original 7 bp stem I is in the most favorable location for catalytic reaction among the possible 6-8 bp stems. To test base specificity, we replaced the original GC-rich sequence in stem I with AU-rich sequences containing six AU or UA base pairs with the natural +1G.U wobble base pair at the cleavage site. The cis -acting AU-rich molecules demonstrated similar catalytic activity to that of the wild-type. In trans -acting molecules, due to stem I instability, reaction efficiency strongly depended on the concentration of the ribozyme-substrate complex and reaction temperature. Multiple turnover was observed at 37 degreesC, strongly suggesting that stem I has no base specificity and more efficient activity can be expected under multiple turnover conditions by substituting several UA or AU base pairs into stem I. We also studied the substrate damaging sequences linked to both ends of stem I for its development in therapeutic applications and confirmed the functions of the unique structure. PMID:9862958

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

The HIP1 initiator element plays a role in determining the in vitro requirement of the dihydrofolate reductase gene promoter for the C-terminal domain of RNA polymerase II.

PubMed

Buermeyer, A B; Thompson, N E; Strasheim, L A; Burgess, R R; Farnham, P J

1992-05-01

We examined the ability of purified RNA polymerase (RNAP) II lacking the carboxy-terminal heptapeptide repeat domain (CTD), called RNAP IIB, to transcribe a variety of promoters in HeLa extracts in which endogenous RNAP II activity was inhibited with anti-CTD monoclonal antibodies. Not all promoters were efficiently transcribed by RNAP IIB, and transcription did not correlate with the in vitro strength of the promoter or with the presence of a consensus TATA box. This was best illustrated by the GC-rich, non-TATA box promoters of the bidirectional dihydrofolate reductase (DHFR)-REP-encoding locus. Whereas the REP promoter was transcribed by RNAP IIB, the DHFR promoter remained inactive after addition of RNAP IIB to the antibody-inhibited reactions. However, both promoters were efficiently transcribed when purified RNAP with an intact CTD was added. We analyzed a series of promoter deletions to identify which cis elements determine the requirement for the CTD of RNAP II. All of the promoter deletions of both DHFR and REP retained the characteristics of their respective full-length promoters, suggesting that the information necessary to specify the requirement for the CTD is contained within approximately 65 bp near the initiation site. Furthermore, a synthetic minimal promoter of DHFR, consisting of a single binding site for Sp1 and a binding site for the HIP1 initiator cloned into a bacterial vector sequence, required RNAP II with an intact CTD for activity in vitro. Since the synthetic minimal promoter of DHFR and the smallest REP promoter deletion are both activated by Sp1, the differential response in this assay does not result from upstream activators. However, the sequences around the start sites of DHFR and REP are not similar and our data suggest that they bind different proteins. Therefore, we propose that specific initiator elements are important for determination of the requirement of some promoters for the CTD.

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

Structure and expression of the human XPBC/ERCC-3 gene involved in DNA repair disorders xeroderma pigmentosum and Cockayne's syndrome.

PubMed Central

Weeda, G; Ma, L B; van Ham, R C; van der Eb, A J; Hoeijmakers, J H

1991-01-01

The human XPBC/ERCC-3 was cloned by virtue of its ability to correct the excision repair defect of UV-sensitive rodent mutants of complementation group 3. The gene appeared to be in addition implicated in the human, cancer prone repair disorder xeroderma pigmentosum group B, which is also associated with Cockayne's syndrome. Here we present the genomic architecture of the gene and its expression. The XPBC/ERCC-3 gene consists of at least 14 exons spread over approximately 45 kb. Notably, the donor splice site of the third exon contains a GC instead of the canonical GT dinucleotide. The promoter region, first exon and intron comprise a CpG island with several putative GC boxes. The promoter was confined to a region of 260 bp upstream of the presumed cap site and acts bidirectionally. Like the promoter of another excision repair gene, ERCC-1, it lacks classical promoter elements such as CAAT and TATA boxes, but it shares with ERCC-1 a hitherto unknown 12 nucleotide sequence element, preceding a polypyrimidine track. Despite the presence of (AU)-rich elements in the 3'-untranslated region, which are thought to be associated with short mRNA half-life actinomycin-D experiments indicate that the mRNA is very stable (t 1/2 greater than 3h). Southern blot analysis revealed the presence of XPBC/ERCC-3 cross-hybridizing fragments elsewhere in the genome, which may belong to a related gene. Images PMID:1956789

A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

PubMed

Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

2004-07-01

The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

U2 small nuclear ribonucleoprotein particle (snRNP) auxiliary factor of 65 kDa, U2AF65, can promote U1 snRNP recruitment to 5' splice sites.

PubMed Central

Förch, Patrik; Merendino, Livia; Martínez, Concepción; Valcárcel, Juan

2003-01-01

The splicing factor U2AF(65), U2 small nuclear ribonucleoprotein particle (snRNP) auxillary factor of 65 kDa, binds to pyrimidine-rich sequences at 3' splice sites to recruit U2 snRNP to pre-mRNAs. We report that U2AF(65) can also promote the recruitment of U1 snRNP to weak 5' splice sites that are followed by uridine-rich sequences. The arginine- and serine-rich domain of U2AF(65) is critical for U1 recruitment, and we discuss the role of its RNA-RNA annealing activity in this novel function of U2AF(65). PMID:12558503

Tobacco chloroplast tRNALys(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron

PubMed Central

Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro

1985-01-01

The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561

Tobacco chloroplast tRNA(UUU) gene contains a 2.5-kilobase-pair intron: An open reading frame and a conserved boundary sequence in the intron.

PubMed

Sugita, M; Shinozaki, K; Sugiura, M

1985-06-01

The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.

High-cost, high-capacity backbone for global brain communication.

PubMed

van den Heuvel, Martijn P; Kahn, René S; Goñi, Joaquín; Sporns, Olaf

2012-07-10

Network studies of human brain structural connectivity have identified a specific set of brain regions that are both highly connected and highly central. Recent analyses have shown that these putative hub regions are mutually and densely interconnected, forming a "rich club" within the human brain. Here we show that the set of pathways linking rich club regions forms a central high-cost, high-capacity backbone for global brain communication. Diffusion tensor imaging (DTI) data of two sets of 40 healthy subjects were used to map structural brain networks. The contributions to network cost and communication capacity of global cortico-cortical connections were assessed through measures of their topology and spatial embedding. Rich club connections were found to be more costly than predicted by their density alone and accounted for 40% of the total communication cost. Furthermore, 69% of all minimally short paths between node pairs were found to travel through the rich club and a large proportion of these communication paths consisted of ordered sequences of edges ("path motifs") that first fed into, then traversed, and finally exited the rich club, while passing through nodes of increasing and then decreasing degree. The prevalence of short paths that follow such ordered degree sequences suggests that neural communication might take advantage of strategies for dynamic routing of information between brain regions, with an important role for a highly central rich club. Taken together, our results show that rich club connections make an important contribution to interregional signal traffic, forming a central high-cost, high-capacity backbone for global brain communication.