Science.gov

Sample records for a-t base pair

  1. Choline Ions Stabilize A-T Base Pairs by Fitting into Minor Groove

    NASA Astrophysics Data System (ADS)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    In a Watson-Crick base paired DNA duplex, G-C base pairs are more stable than A-T base pairs. However, in solvent containing choline ions, the stabilities of these base pairs are reversed. To elucidate the mechanism through which choline ions exert this effect from a microscopic viewpoint, we performed molecular dynamics simulations. We found that choline ions interact with a DNA duplex through multiple hydrogen bonds. The affinity of choline ion for the minor groove of A-T base pairs was higher than that for the major groove. The binding of choline ions to the minor groove of A-T base pairs supports groove formation without disturbing the formation of hydrogen bonds between the base pairs. In contrast, choline ions inhibit the formation of hydrogen bonds between G-C base pairs by binding to atoms of these bases that are involved in Watson-Crick hydrogen bonding. These findings will help us understand the stabilities of canonical DNA structures under the crowded conditions inside cells.

  2. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  3. Robust IR-based detection of stable and fractionally populated G-C(+) and A-T Hoogsteen base pairs in duplex DNA.

    PubMed

    Stelling, Allison L; Xu, Yu; Zhou, Huiqing; Choi, Seung H; Clay, Mary C; Merriman, Dawn K; Al-Hashimi, Hashim M

    2017-06-01

    Noncanonical G-C(+) and A-T Hoogsteen base pairs can form in duplex DNA and play roles in recognition, damage repair, and replication. Identifying Hoogsteen base pairs in DNA duplexes remains challenging due to difficulties in resolving syn versus antipurine bases with X-ray crystallography; and size limitations and line broadening can make them difficult to characterize by NMR spectroscopy. Here, we show how infrared (IR) spectroscopy can identify G-C(+) and A-T Hoogsteen base pairs in duplex DNA across a range of different structural contexts. The utility of IR-based detection of Hoogsteen base pairs is demonstrated by characterizing the first example of adjacent A-T and G-C(+) Hoogsteen base pairs in a DNA duplex where severe broadening complicates detection with NMR. © 2017 Federation of European Biochemical Societies.

  4. [Structural and energetic properties of the four configurations of the A.T and G.C DNA base pairs].

    PubMed

    Brovarets', O O

    2013-01-01

    Using the methods of non-empirical quantum chemistry at the MP2/6-311++G(2df,pd)// B3LYP/6-311++G(d,p) level of theory it was established for the first time, that Hoogsteen, reverse Hoogsteen, Watson-Crick and reverse Watson-Crick configurations of the A.T and G.C DNA base pairs are isoelectronic and isomorphic structures with similar dynamic properties. Based on these results, non-ionisation mechanism of the Hoogsteen <"breathing" of the G*.C* DNA base pair, namely transformation of the tautomerised (Lowdin's) G-C base pair with Watson-Crick geometry into the Hoogsteen electroneutral G*.C* H base pair stabilized by the three O6H...N4, N3H...N7 and C8H...02 H-bonds, was postulated. It is suggested that such scenario activates only in those cases, when DNA is not located in aqueous solution, but works together with proteins and cytosine protonation at the N3 atom is precluded.

  5. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    SciTech Connect

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  6. Vacuum UV CD spectra of homopolymer duplexes and triplexes containing A.T or A.U base pairs.

    PubMed Central

    Johnson, K H; Gray, D M; Sutherland, J C

    1991-01-01

    Vacuum UV circular dichroism (CD) spectra were measured down to 174 nm for five homopolymers, five duplexes, and four triplexes containing adenine, uracil, and thymine. Near 190 nm, the CD bands of poly[d(A)] and poly[r(A)] were larger than the CD bands of the polypyrimidines, poly[d(T)], poly[d(U)], and poly[r(U)]. Little change was observed in the 190 nm region upon formation of the duplexes (poly[d(A).d(T)], poly[d(A).d(U)], poly[r(A).d(T)], poly[r(A).d(U)], and poly[r(A).r(U)]) or upon formation of two of the triplexes (poly[d(T).d(A).d(T)] and poly[d(U).d(A).d(U)]). This showed that the purine strand had the same or a similar structure in these duplexes and triplexes as when free in solution. Both A.U and A.T base pairing induced positive bands at 177 and 202 nm. For three triplexes containing poly[d(A)], the formation of a triplex from a duplex and a free pyrimidine strand induced a negative band centered between 210 and 215 nm. The induction of a band between 210 and 215 nm indicated that these triplexes had aspects of the A conformation. PMID:2041768

  7. Choline ion interactions with DNA atoms explain unique stabilization of A-T base pairs in DNA duplexes: a microscopic view.

    PubMed

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Sugimoto, Naoki

    2014-01-16

    Under physiological conditions, G-C base pairs are more stable than A-T base pairs. In a previous study, we showed that in the hydrated ionic liquid of choline dihydrogen phosphate, the stabilities of these base pairs are reversed. In the present study, we elucidated the unique binding interactions of choline ions with DNA atoms from a microscopic viewpoint using molecular dynamics simulations. Three times more choline ions bind to the DNA duplex than sodium ions. Sodium ions bind closely but not stably; in contrast, the choline ions bind through multiple hydrogen bonding networks with DNA atoms stably. The affinity of choline ion for the minor groove of A-T base pairs is more than 2 times that for other groove areas. In the narrow A-T minor groove, choline ion has high affinity for the ribose atoms of thymine. Choline ions also destabilize the formation of hydrogen bonds between G-C base pairs by binding to base atoms preferentially for both of duplex and single-strand DNA, which are associated with the bonds between G-C base pairs. Our new finding will not only lead to better control of DNA stability for use in DNA nanodevices, but also provide new insight into the stability of DNA duplexes under crowding conditions found in living cells.

  8. Evaluation of binding selectivity of a polyamide probe to single base-pair different DNA in A.T-rich region by electrospray ionization mass spectrometry.

    PubMed

    Li, Huihui; Yuan, Gu

    2006-12-01

    In this study, electrospray ionization mass spectrometry (ESI-MS) was used for the evaluation of the binding selectivity of a polyamide probe to single-base pair different DNA in an A.T-rich region. In this procedure, DeltaIr(dsn) was introduced as a parameter to compare the binding affinities of the polyamides with the duplex DNA. The results show that ESI-MS is a very useful tool for analysis of binding selectivity of a polyamide probe to single-base pair different DNA.

  9. Compensating Bends in a 16 base-pair DNA Oligomer Containing a T3A3 Segment: A NMR Study of Global DNA Curvature

    SciTech Connect

    McAteer, Kathleen; Aceves Gaona, Alejandro; Michalczyk, Ryszard; Buchko, Garry W.; Isern, Nancy G.; Silks, Louis A.; Miller, John H.; Kennedy, Michael A.

    2004-12-15

    DNA curvature but no single model has been able to explain all the experimental data. An intriguing observation is that AnTn segments ligated in phase exhibit retarded migration in polyacrylamide gel electrophoresis (PAGE) but TnAn segments do not. We have determined a high-resolution structure of a 16 base-pair DNA oligomer [d(CGAGGTTTAAACCTCG)2] containing a T3A3 tract. The refinement included residual dipolar coupling (RDC) restraints. A radius of curvature, Rc, analysis was used to measure the overall bending in the molecule. A plot of the helical axis reference points showed a sigmoidal shape indicating a discontinuity at the central TpA step in the overall curvature. Because of the length of the 16mer it was possible to accurately measure Rc for the two halves of the molecule centered about the TpA step. The Rc for the overall molecule (Rc=128 nm) is large, i.e. a low overall magnitude of global bending, whereas the Rc for the two halves of the molecule (Rc=72 nm) is small indicating a much larger magnitude of localized bending. However the direction of bending in the two halves is in partial opposition leading to cancellation of the overall bending. This indicates that TnAn-containing DNA sequences are strongly and multiply bent locally, but are nearly straight globally which is consistent with PAGE results. The RDC refined structure lacked anomalous features present in NOE-only structures indicating the RDC and NOE measurements have a different sensitivity to conformational dynamics at the central TpA step. Because of its increased length and refinement using RDC restraints, the structure of the 16mer reported here provides new insight into the structural origins of the enigmatic PAGE behavior of AnTn and TnAn tracts and the large amplitude, slow base dynamics observed at TpA steps.

  10. Flexibility of A.T pairs in left-handed DNA helices.

    PubMed

    Vlach, J; Sponar, J

    1990-04-01

    We have analysed by various approaches the structure of cloned synthetic sequences in supercoiled plasmids. Individual inserts were formed by d(C-G)n blocks interrupted by the presence of A.T pairs positioned either in phase or out of phase of pur-pyr alternation. Based on the thermodynamic analysis we obtained results confirming that A.T pairs are easily incorporated into left-handed helices without significant energetic penalty. Sequences GTAC which are known to form cruciform structures in multiple repetition underwent a B-Z transition. In the case of plasmids containing AA/TT code words and substantial discontinuities in purine-pyrimidine alternation our analysis indicates that Z-Z junctions formed by A.T pairs contributed little to the overall energetic demands of the B-Z transition probably thanks to their high conformational flexibility.

  11. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  12. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  13. Chain folding and A:T pairing in human telomeric DNA: a model-building and molecular dynamics study.

    PubMed Central

    Mohanty, D; Bansal, M

    1995-01-01

    The various types of chain folding and possible intraloop as well as interloop base pairing in human telomeric DNA containing d(TTAG3) repeats have been investigated by model-building, molecular mechanics, and molecular dynamics techniques. Model-building and molecular mechanics studies indicate that it is possible to build a variety of energetically favorable folded-back structures with the two TTA loops on same side and the 5' end thymines in the two loops forming TATA tetrads involving a number of different intraloop as well as interloop A:T pairing schemes. In these folded-back structures, although both intraloop and interloop Watson-Crick pairing is feasible, no structure is possible with interloop Hoogsteen pairing. MD studies of representative structures indicate that the guanine-tetraplex stem is very rigid and, while the loop regions are relatively much more flexible, most of the hydrogen bonds remain intact throughout the 350-ps in vacuo simulation. The various possible TTA loop structures, although they are energetically similar, have characteristic inter proton distances, which could give rise to unique cross-peaks in two-dimensional nuclear Overhauser effect spectroscopy (NOESY) experiments. These folded-back structures with A:T pairings in the loop region help in rationalizing the data from chemical probing and other biochemical studies on human telomeric DNA. PMID:8519959

  14. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  15. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  16. In vivo effect of DNA repair on the transition frequency produced from a single O6-methyl- or O6-n-butyl-guanine in a T:G base pair.

    PubMed

    Chambers, R W; Sledziewska-Gojska, E; Hirani-Hojatti, S

    1988-08-01

    We have previously reported some effects of DNA repair on the transition frequencies produced by an O6-methyl-guanine (MeG) or an O6-n-butyl-guanine (BuG) paired with C at the first position of the third codon in gene G of bacteriophage phi X174 form I' DNA (Chambers et al. 1985). We now report experiments in which the transition is produced from T:MeG or T:BuG, instead of C:MeG or C:BuG, located at this site. The site-modified DNAs were transfected into cells with normal DNA repair as well as into cells with repair defects (uvrA, uvrB, uvrC, recA, uvrArecA). The lysates were screened for phage carrying the expected transition using a characteristic change in phenotype. The data demonstrate that the transition frequency from T:BuG is low (0.3% of total phage progeny) in cells with normal repair (Escherichia coli AB1157) and increases 7-fold in uvrA cells (E. coli AB1886). A similar increase is seen in uvrB and uvrC cells (AB1885, AB1884). These data, like our previous data, indicate BuG is repaired primarily by excision. In contrast to this, the transition frequency from T:MeG is high (5 +/- 2%) in cells with normal repair. After induction of alkyl transfer repair in E. coli AB1157, the transition frequency goes up 5-fold. Compared with cells with normal repair, the transition frequency goes up 2-fold in uvrA, uvrB and uvrC cells; it goes up 1.5-fold in recA cells (E. coli AB2463). The data reinforce our earlier conclusion that MeG is repaired primarily by alkyl transfer, but the ABC excinuclease as well as RecA protein inhibit this repair process.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  18. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract.

  19. Alternative DNA base pairing through metal coordination.

    PubMed

    Clever, Guido H; Shionoya, Mitsuhiko

    2012-01-01

    Base-pairing in the naturally occurring DNA and RNA oligonucleotide duplexes is based on π-stacking, hydrogen bonding, and shape complementarity between the nucleobases adenine, thymine, guanine, and cytosine as well as on the hydrophobic-hydrophilic balance in aqueous media. This complex system of multiple supramolecular interactions is the product of a long-term evolutionary process and thus highly optimized to serve its biological functions such as information storage and processing. After the successful implementation of automated DNA synthesis, chemists have begun to introduce artificial modifications inside the core of the DNA double helix in order to study various aspects of base pairing, generate new base pairs orthogonal to the natural ones, and equip the biopolymer with entirely new functions. The idea to replace the hydrogen bonding interactions with metal coordination between ligand-like nucleosides and suitable transition metal ions culminated in the development of a plethora of artificial base-pairing systems termed "metal base-pairs" which were shown to strongly enhance the DNA duplex stability. Furthermore, they show great potential for the use of DNA as a molecular wire in nanoscale electronic architectures. Although single electrons have proven to be transmitted by natural DNA over a distance of several base pairs, the high ohmic resistance of unmodified oligonucleotides was identified as a serious obstacle. By exchanging some or all of the Watson-Crick base pairs in DNA with metal complexes, this problem may be solved. In the future, these research efforts are supposed to lead to DNA-like materials with superior conductivity for nano-electronic applications. Other fields of potential application such as DNA-based supramolecular architecture and catalysis may be strongly influenced by these developments as well. This text is meant to illustrate the basic concepts of metal-base pairing and give an outline over recent developments in this field.

  20. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  1. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  2. Hydrophobic, Non-Hydrogen-Bonding Bases and Base Pairs in DNA

    PubMed Central

    Schweitzer, Barbara A.; Kool, Eric T.

    2009-01-01

    We report the properties of hydrophobic isosteres of pyrimidines and purines in synthetic DNA duplexes. Phenyl nucleosides 1 and 2 are nonpolar isosteres of the natural thymidine nucleoside, and indole nucleoside 3 is an analog of the complementary purine 2-aminodeoxyadenosine. The nucleosides were incorporated into synthetic oligodeoxynucleotides and were paired against each other and against the natural bases. Thermal denaturation experiments were used to measure the stabilities of the duplexes at neutral pH. It is found that the hydrophobic base analogs are nonselective in pairing with the four natural bases but selective for pairing with each other rather than with the natural bases. For example, compound 2 selectively pairs with itself rather than with A, T, G, or C; the magnitude of this selectivity is found to be 6.5–9.3 °C in Tm or 1.5–1.8 kcal/mol in free energy (25 °C). All possible hydrophobic pairing combinations of 1, 2, and 3 were examined. Results show that the pairing affinity depends on the nature of the pairs and on position in the duplex. The highest affinity pairs are found to be the 1–1 and 2–2 self-pairs and the 1–2 heteropair. The best stabilization occurs when the pairs are placed at the ends of duplexes rather than internally; the internal pairs may be destabilized by imperfect steric mimicry which leads to non-ideal duplex structure. In some cases the hydrophobic pairs are significantly stabilizing to the DNA duplex; for example, when situated at the end of a duplex, the 1–1 pair is more stabilizing than a T–A pair. When situated internally, the affinity of the 1–1 pair is the same as, or slightly better than, the analogous T–T mismatch pair, which is known to have two hydrogen bonds. The studies raise the possibility that hydrogen bonds may not always be required for the formation of stable duplex DNA-like structure. In addition, the results point out the importance of solvation and desolvation in natural base pairing

  3. Theoretical investigation of hydrogen transfer mechanism in the adenine thymine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni

    2005-09-01

    We have studied the quantum dynamics of the hydrogen bonds in the adenine-thymine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick A-T, the imino-enol A*-T* and the zwitterionic (the form with charge separation) A +-T - and A --T + structures. The common idea in the literature is that only A-T exists either because the difference of energy among this tautomer and the others is large or because the other structures are transformed quickly in A-T. Here, we show a detailed theoretical study that suggests the following conclusion: A-T is the stablest tautomer, a partially charged system is important and a small amount of the imino-enol A*-T* tautomer is present at any time. The mechanism of passage from A-T tautomer to the others has also been investigated.

  4. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  5. Amplification of Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry

    NASA Astrophysics Data System (ADS)

    Islam, SK Firoz; Saha, Arijit

    2017-09-01

    Motivated by the recent experiments [Scientific Reports 6, 23051 (2016), 10.1038/srep23051; Phys. Rev. Lett. 114, 096602 (2015), 10.1103/PhysRevLett.114.096602], we theoretically investigate Cooper pair splitting current in a graphene-based Cooper pair beam splitter geometry. By considering the graphene-based superconductor as an entangler device, instead of normal [two-dimensional (2D)] BCS superconductor, we show that the Cooper pair splitting current mediated by the crossed Andreev process is amplified compared to its normal superconductor counterpart. This amplification is attributed to the strong suppression of the local normal Andreev reflection process (arising from the Cooper pair splitting) from the graphene-based superconductor to lead via the same quantum dot, in comparison to the usual 2D superconductor. Due to the vanishing density of states at the Dirac point of undoped graphene, a doped graphene-based superconductor is considered here and it is observed that Cooper pair splitting current is very insensitive to the doping level in comparison to the usual 2D superconductor. The transport process of nonlocal spin-entangled electrons also depends on the type of pairing, i.e., whether the electron-hole pairing is onsite, intersublattice or the combination of both. The intersublattice pairing of graphene causes the maximum nonlocal Cooper pair splitting current, whereas the presence of both pairings reduces the Cooper pair splitting current.

  6. DNA base pair hybridization and water-mediated metastable structures studied by molecular dynamics simulations.

    PubMed

    Qi, Wenpeng; Song, Bo; Lei, Xiaoling; Wang, Chunlei; Fang, Haiping

    2011-11-08

    The base pair hybridization of a DNA segment was studied using molecular dynamics simulation. The results show the obvious correlation between the probability of successful hybridization and the accessible surface area to water of two successive base pairs, including the unpaired base pair adjacent to paired base pair and this adjacent paired base pair. Importantly, two metastable structures in an A-T base pair were discovered by the analysis of the free energy landscape. Both structures involved addition of a water molecule to the linkage between the two nucleobases in one base pair. The existence of the metastable structures provide potential barriers to the Watson-Crick base pair, and numerical simulations show that those potential barriers can be surmounted by thermal fluctuations at higher temperatures. These studies contribute an important step toward the understanding of the mechanism in DNA hybridization, particularly the effect of temperature on DNA hybridization and polymerase chain reaction. These observations are expected to be helpful for facilitating experimental bio/nanotechnology designs involving fast hybridization.

  7. NMR analysis of base-pair opening kinetics in DNA.

    PubMed

    Szulik, Marta W; Voehler, Markus; Stone, Michael P

    2014-12-12

    Base pairing in nucleic acids plays a crucial role in their structure and function. Differences in the base-pair opening and closing kinetics of individual double-stranded DNA sequences or between chemically modified base pairs provide insight into the recognition of these base pairs by DNA processing enzymes. This unit describes how to quantify the kinetics for localized base pairs by observing changes in the imino proton signals by nuclear magnetic resonance spectroscopy. The determination of all relevant parameters using state-of-the art techniques and NMR instrumentation, including cryoprobes, is discussed.

  8. Reversibly locked thionucleobase pairs in DNA to study base flipping enzymes.

    PubMed

    Beuck, Christine; Weinhold, Elmar

    2014-01-01

    Covalently interstrand cross-linked DNA is an interesting tool to study DNA binding proteins that locally open up the DNA duplex by flipping single bases out of the DNA helix or melting whole stretches of base pairs to perform their function. The ideal DNA cross-link to study protein-DNA interactions should be specific and easy to synthesize, be stable during protein binding experiments, have a short covalent linker to avoid steric hindrance of protein binding, and should be available as a mimic for both A/T and G/C base pairs to cover all possible binding specificities. Several covalent interstrand cross-links have been described in the literature, but most of them fall short of at least one of the above criteria. We developed an efficient method to site-specifically and reversibly cross-link thionucleoside base pairs in synthetic duplex oligodeoxynucleotides by bisalkylation with 1,2-diiodoethane resulting in an ethylene-bridged base pair. Both linked A/T and G/C base pair analogs can conveniently be prepared which allows studying any base pair-opening enzyme regardless of its sequence specificity. The cross-link is stable in the absence of reducing agents but the linker can be quickly and tracelessly removed by the addition of thiol reagents like dithiothreitol. This property makes the cross-linking reaction fully reversible and allows for a switching of the linked base pair from locked to unlocked during biochemical experiments. Using the DNA methyltransferase from Thermus aquaticus (M.TaqI) as example, we demonstrate that the presented cross-linked DNA with an ethylene-linked A/T base pair analog at the target position is a useful tool to determine the base-flipping equilibrium constant of a base-flipping enzyme which lies mostly on the extrahelical side for M.TaqI.

  9. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  10. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  11. Nucleic Acid Duplexes Incorporating a Dissociable Covalent Base Pair

    NASA Astrophysics Data System (ADS)

    Gao, Kui; Orgel, Leslie E.

    1999-12-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  12. Natural versus artificial creation of base pairs in DNA: origin of nucleobases from the perspectives of unnatural base pair studies.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Yamashige, Rie

    2012-12-18

    Since life began on Earth, the four types of bases (A, G, C, and T(U)) that form two sets of base pairs have remained unchanged as the components of nucleic acids that replicate and transfer genetic information. Throughout evolution, except for the U to T modification, the four base structures have not changed. This constancy within the genetic code raises the question of how these complicated nucleotides were generated from the molecules in a primordial soup on the early Earth. At some prebiotic stage, the complementarity of base pairs might have accelerated the generation and accumulation of nucleotides or oligonucleotides. We have no clues whether one pair of nucleobases initially appeared on the early Earth during this process or a set of two base pairs appeared simultaneously. Recently, researchers have developed new artificial pairs of nucleobases (unnatural base pairs) that function alongside the natural base pairs. Some unnatural base pairs in duplex DNA can be efficiently and faithfully amplified in a polymerase chain reaction (PCR) using thermostable DNA polymerases. The addition of unnatural base pair systems could expand the genetic alphabet of DNA, thus providing a new mechanism for the generation novel biopolymers by the site-specific incorporation of functional components into nucleic acids and proteins. Furthermore, the process of unnatural base pair development might provide clues to the origin of the natural base pairs in a primordial soup on the early Earth. In this Account, we describe the development of three representative types of unnatural base pairs that function as a third pair of nucleobases in PCR and reconsider the origin of the natural nucleic acids. As researchers developing unnatural base pairs, they use repeated "proof of concept" experiments. As researchers design new base pairs, they improve the structures that function in PCR and eliminate those that do not. We expect that this process is similar to the one functioning in the

  13. Silver(I)-mediated Hoogsteen-type base pairs.

    PubMed

    Megger, Dominik A; Fonseca Guerra, Célia; Bickelhaupt, F Matthias; Müller, Jens

    2011-11-01

    Metal-mediated Hoogsteen-type base pairs are useful for the construction of DNA duplexes containing contiguous stretches of metal ions along the helical axis. To fine-tune the stability of such base pairs and the selectivity toward different metal ions, the availability of a selection of artificial nucleobases is highly desirable. In this study, we follow a theoretical approach utilizing dispersion-corrected density functional methods to evaluate a variety of artificial nucleobases as candidates for metal-mediated Hoogsteen-type base pairs. We focus on silver(I)-mediated Hoogsteen- and reverse Hoogsteen-type base pairs formed between 1-deaza- and 1,3-dideazapurine-derived nucleobases, respectively, and cytosine. Apart from two coordinative bonds, these base pairs are stabilized by a hydrogen bond. We elucidate the impact of different substituents at the C6 position and the presence or absence of an endocyclic N3 nitrogen atom on the overall stability of a base pair and concomitantly on the strength of the hydrogen and coordinative bonds. All artificial base pairs investigated in this study are less stable than the experimentally established benchmark base pair C-Ag(+)-G. The base pair formed from 1,3-dideaza-6-methoxypurine is isoenergetic to the experimentally observed C-Ag(+)-C base pair. This makes 1,3-dideaza-6-methoxypurine a promising candidate for the use as an artificial nucleobase in DNA.

  14. DNA base-pair flipping with fluorescent perylenediimide pincers.

    PubMed

    Zeidan, Tarek A; Hariharan, Mahesh; Siegmund, Karsten; Lewis, Frederick D

    2010-07-30

    The synthesis, structure, and electronic spectra of a series of DNA hairpins possessing two perylenediimide (PDI) base pair surrogates are reported. The PDI chromophores are located in opposite strands of the hairpin base pair domain opposite abasic sites and are either adjacent to each other or separated by a variable number of AT or GC base pairs. Molecular modeling of the conjugate having adjacent PDI chromophores shows that they adopt a slipped, pi-stacked geometry with an angle of 40 degrees between the PDI long axes. The electronic absorption, fluorescence, and circular dichroism of this conjugate are consistent with a stacked PDI structure. Conjugates having one or two GC base pairs between the PDI chromophores display spectra that are consistent with isolated PDIs. Conjugates having 1-4 AT base pairs have more complex spectra, suggestive of an equilibrium between base paired and flipped structures having stacked PDIs. Heating of the conjugates possessing isolated PDI chromophores results in base pair flipping. The free energy for PDI stacking is greater than that for a single AT base pair and comparable to that for a single GC base pair or two AT base pairs.

  15. Principles of RNA base pairing: structures and energies of the trans Watson-Crick/sugar edge base pairs.

    PubMed

    Sponer, Judit E; Spackova, Nad'a; Leszczynski, Jerzy; Sponer, Jirí

    2005-06-09

    Due to the presence of the 2'-OH hydroxyl group of ribose, RNA molecules utilize an astonishing variability of base pairing patterns to build up their structures and perform the biological functions. Many of the key RNA base pairing families have no counterparts in DNA. In this study, the trans Watson-Crick/sugar edge (trans WC/SE) RNA base pair family has been characterized using quantum chemical and molecular mechanics calculations. Gas-phase optimized geometries from density functional theory (DFT) calculations and RIMP2 interaction energies are reported for the 10 crystallographically identified trans WC/SE base pairing patterns. Further, stable structures are predicted for all of the remaining six possible members of this family not seen in RNAs so far. Among these novel six base pairs, the computations substantially refine two structures suggested earlier based on simple isosteric considerations. For two additional trans WC/SE base pairs predicted in this study, no arrangement was suggested before. Thus, our study brings a complete set of trans WC/SE base pairing patterns. The present results are also contrasted with calculations reported recently for the cis WC/SE base pair family. The computed base pair sizes are in sound correlation with the X-ray data for all WC/SE pairing patterns including both their cis and trans isomers. This confirms that the isostericity of RNA base pairs, which is one of the key factors determining the RNA sequence conservation patterns, originates in the properties of the isolated base pairs. In contrast to the cis structures, however, the isosteric subgroups of the trans WC/SE family differ not only in their H-bonding patterns and steric dimensions but also in the intrinsic strength of the intermolecular interactions. The distribution of the total interaction energy over the sugar-base and base-base contributions is controlled by the cis-trans isomerism.

  16. Array-Based Discovery of Aptamer Pairs

    DTIC Science & Technology

    2014-12-11

    affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via...standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because...conventional selection methods preferentially yield aptamers that recognize a dominant “hot spot” epitope. Our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND

  17. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    SciTech Connect

    Mendel, D.; Dervan, P.B.

    1987-02-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired.

  18. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    SciTech Connect

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible.

  19. Structural, electronic, and optical properties of metallo base pairs in duplex DNA: a theoretical insight.

    PubMed

    Samanta, Pralok K; Manna, Arun K; Pati, Swapan K

    2012-11-01

    Using density functional theory calculations, we investigated the structural, energetic, electronic, and optical properties of recently synthesized duplex DNA containing metal-mediated base pairs. The studied duplex DNA consists of three imidazole (Im) units linked through metal (Im-M-Im, M = metal) and four flanking A:T base pairs (two on each side). We examined the role of artificial base pairing in the presence of two distinctive metal ions, diamagnetic Ag(+) and magnetic Cu(2+) ions, on the stability of duplex DNA. We found that metal-mediated base pairs form stable duplex DNA by direct metal ion coordination to the Im bases. Our results suggest a higher binding stability of base pairing mediated by Cu(2+) ions than by Ag(+) ions, which is attributed to a larger extent of orbital hybridization. We furthermore found that DNA modified with Im-Ag(+)-Im shows the low-energy optical absorption characteristic of π-π*orbital transition of WC A:T base pairs. On the other hand, we found that the low-energy optical absorption peaks for DNA modified with Im-Cu(2+)-Im originate from spin-spin interactions. Additionally, this complex exhibits weak ferromagnetic coupling between Cu(2+) ions and strong spin polarization, which could be used for memory devices. Moreover, analyzing the role of counter ions (Na(+)) and the presence of explicit water molecules on the structural stability and electronic properties of the DNA duplex modified with Im-Ag(+)-Im, we found that the impact of these two factors is negligible. Our results are fruitful for understanding the experimental data and suggest a potential route for constructing effective metal-mediated base pairs in duplex DNA for optoelectronic applications.

  20. Neighbouring bases in template influence base-pairing of isoguanine.

    PubMed Central

    Maciejewska, Agnieszka M; Lichota, Katarzyna D; Kuśmierek, Jarosław T

    2003-01-01

    Assuming that the efficiency of the incorporation of 5-methyl-2'-deoxyisocytosine-5' triphosphate (dMiCTP) and dTTP opposite isoguanine (iG) is a measure of the proportion of the keto and enol tautomers of iG in the Thermus aquaticus DNA polymerase active centre, we studied the influence of temperature and iG-neighbouring bases in the template on base-pairing of iG. On the basis of experiments with four sequences (3'-TXT-5', 3'-GXG-5', 3'-CXC-5', 3'-CXT-5', where X=iG) at 37, 50, 65 and 80 degrees C, we found that 3'-neighbours decrease the fraction of the keto tautomer in the order C>G>or=T, whereas temperature apparently does not influence the tautomeric equilibrium of iG. The variability of the ratio of incorporation of dMiCTP versus dTTP (5-20) primarily reflects the variability of K (m) values, since V (max) values are roughly similar, which indicates that the iG.MiC and iG.T pairs fit the polymerase active centre equally well. The altering of the base-pairing of iG by sequence context is discussed in relation to tautomerism and miscoding of this oxidized adenine derivative. A key derivative for preparation oligodeoxynucleotides, O (2)-diphenylcarbamoyl- N (6)-[(dimethylamino)ethylidene]-2'-deoxyisoguanosine, is extremely labile (t (1/2)=3.5 min) in 3% trichloroacetic acid/dichloromethane, i.e. under the conditions of automated DNA synthesis, which results in low yield and length heterogeneity of templates. PMID:12387728

  1. High fidelity of base pairing by 2-selenothymidine in DNA.

    PubMed

    Hassan, Abdalla E A; Sheng, Jia; Zhang, Wen; Huang, Zhen

    2010-02-24

    The base pairs are the contributors to the sequence-dependent recognition of nucleic acids, genetic information storage, and high fidelity of DNA polymerase replication. However, the wobble base pairing, where T pairs with G instead of A, reduces specific base-pairing recognition and compromises the high fidelity of the enzymatic polymerization. Via the selenium atomic probing at the 2-position of thymidine, we have investigated the wobble discrimination by manipulating the steric and electronic effects at the 2-exo position, providing a unique chemical strategy to enhance the base pair specificity. We report here the first synthesis of the novel 2-Se-thymidine ((Se)T) derivative, its phosphoramidite, and the Se-DNAs. Our biophysical and structural studies of the 2-Se-T DNAs reveal that the bulky 2-Se atom with a weak hydrogen-bonding ability can largely increase mismatch discriminations (including T/G wobble and T/C mismatched base pairs) while maintaining the (Se)T/A virtually identical to the native T/A base pair. The 2-Se atom bulkiness and the electronic effect are probably the main factors responsible for the discrimination against the formation of the wobble (Se)T/G base pair. Our investigations provide a potential novel tool to investigate the specific recognition of base pairs, which is the basis of high fidelity during replication, transcription, and translation. Furthermore, this Se-atom-specific substitution and probing are useful for X-ray crystal structure and function studies of nucleic acids.

  2. Stretching single-stranded DNA: interplay of electrostatic, base-pairing, and base-pair stacking interactions.

    PubMed Central

    Zhang, Y; Zhou, H; Ou-Yang, Z C

    2001-01-01

    Recent single-macromolecule observations revealed that the force/extension characteristics of single-stranded DNA (ssDNA) are closely related to solution ionic concentration and DNA sequence composition. To understand this, we studied the elastic property of ssDNA through the Monte Carlo implementation of a modified freely jointed chain (FJC), with electrostatic, base-pairing, and base-pair stacking interactions all incorporated. The simulated force-extension profiles for both random and designed sequences have attained quantitative agreements with the experimental data. In low-salt solution, electrostatic interaction dominates, and at low forces, the molecule can be more easily aligned than an unmodified FJC. In high-salt solution, secondary hairpin structure appears in ssDNA by the formation of base pairs between complementary bases, and external stretching causes a hairpin-coil structural transition, which is continuous for ssDNA made of random sequences. In designed sequences such as poly(dA-dT) and poly(dG-dC), the stacking potential between base pairs encourages the aggregation of base pairs into bulk hairpins and makes the hairpin-coil transition a discontinuous (first-order) process. The sensitivity of elongation to the base-pairing rule is also investigated. The comparison of modeling calculations and the experimental data suggests that the base pairing of single-stranded polynucleotide molecules tends to form a nested and independent planar hairpin structure rather than a random intersecting pattern. PMID:11463654

  3. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  4. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  5. Tuning Locality of Pair Coherence in Graphene-based Andreev Interferometers

    PubMed Central

    Kim, Minsoo; Jeong, Dongchan; Lee, Gil-Ho; Shin, Yun-Sok; Lee, Hyun-Woo; Lee, Hu-Jong

    2015-01-01

    We report on gate-tuned locality of superconductivity-induced phase-coherent magnetoconductance oscillations in a graphene-based Andreev interferometer, consisting of a T-shaped graphene bar in contact with a superconducting Al loop. The conductance oscillations arose from the flux change through the superconducting Al loop, with gate-dependent Fraunhofer-type modulation of the envelope. We confirm a transitional change in the character of the pair coherence, between local and nonlocal, in the same device as the effective length-to-width ratio of the device was modulated by tuning the pair-coherence length ξT in the graphene layer. PMID:25737106

  6. Vibrational signatures of Watson-Crick base pairing in adenine-thymine mimics.

    PubMed

    Nosenko, Yevgeniy; Kunitski, Maksim; Stark, Tina; Göbel, Michael; Tarakeshwar, Pilarisetty; Brutschy, Bernhard

    2013-07-21

    The vibrational fingerprints of hydrogen-bonding associated with the adenine-thymine (A-T) Watson-Crick (WC) base pair have been identified in an infrared study of the A-T mimics 4-aminopyrimidine-1-methylthymine (4APM-1MT) and 4-aminopyrimidine-6-methyl-4-pyrimidinone (4APM-M4PMN) in the gas-phase. The IR vibrational spectra were measured via a double resonance scheme utilizing femtosecond multiphoton ionization. The changes in the molecular structure, anharmonic vibrational parameters, and the assignment of the observed vibrational spectra in the NH/CH stretch region were investigated by carrying out high-level theoretical calculations of the anharmonic spectra. The experimental observations and theoretical calculations indicate that the hydrogen bonds associated with WC base-pairing are relatively stronger than those associated with reverse WC (rWC) base pairing. This is manifested in a more pronounced red-shift of the H-bonded vibrational modes associated with the WC as compared with the rWC base-pairing. An analysis of the factors contributing to the anharmonicity of the vibrational modes associated with H-bonding reveals that the magnitude of the off-diagonal anharmonic coupling of the H-bonded -NH2 stretch and the -NH2 bend is much smaller in WC base-pairing than in the corresponding rWC base-pairing. The chemical and biological implications of these results, especially in the context of using vibrational spectroscopy as a tool for identifying the signatures of nucleotide base vibrations is addressed.

  7. G.U base pairing motifs in ribosomal RNA.

    PubMed

    Gautheret, D; Konings, D; Gutell, R R

    1995-10-01

    An increasing number of recognition mechanisms in RNA are found to involve G.U base pairs. In order to detect new functional sites of this type, we exhaustively analyzed the sequence alignments and secondary structures of eubacterial and chloroplast 16S and 23S rRNA, seeking positions with high levels of G.U pairs. Approximately 120 such sites were identified and classified according to their secondary structure and sequence environment. Overall biases in the distribution of G.U pairs are consistent with previously proposed structural rules: the side of the wobble pair that is subject to a loss of stacking is preferentially exposed to a secondary structure loop, where stacking is not as essential as in helical regions. However, multiple sites violate these rules and display highly conserved G.U pairs in orientations that could cause severe stacking problems. In addition, three motifs displaying a conserved G.U pair in a specific sequence/structure environment occur at an unusually high frequency. These motifs, of which two had not been reported before, involve sequences 5'UG3' 3'GA5' and 5'UG3' 3'GU5', as well as G.U pairs flanked by a bulge loop 3' of U. The possible structures and functions of these recurrent motifs are discussed.

  8. G.U base pairing motifs in ribosomal RNA.

    PubMed Central

    Gautheret, D; Konings, D; Gutell, R R

    1995-01-01

    An increasing number of recognition mechanisms in RNA are found to involve G.U base pairs. In order to detect new functional sites of this type, we exhaustively analyzed the sequence alignments and secondary structures of eubacterial and chloroplast 16S and 23S rRNA, seeking positions with high levels of G.U pairs. Approximately 120 such sites were identified and classified according to their secondary structure and sequence environment. Overall biases in the distribution of G.U pairs are consistent with previously proposed structural rules: the side of the wobble pair that is subject to a loss of stacking is preferentially exposed to a secondary structure loop, where stacking is not as essential as in helical regions. However, multiple sites violate these rules and display highly conserved G.U pairs in orientations that could cause severe stacking problems. In addition, three motifs displaying a conserved G.U pair in a specific sequence/structure environment occur at an unusually high frequency. These motifs, of which two had not been reported before, involve sequences 5'UG3' 3'GA5' and 5'UG3' 3'GU5', as well as G.U pairs flanked by a bulge loop 3' of U. The possible structures and functions of these recurrent motifs are discussed. PMID:7493326

  9. Probing the nature of hydrogen bonds in DNA base pairs.

    PubMed

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  10. Understanding the kinetic mechanism of RNA single base pair formation

    PubMed Central

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-01

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

  11. Dihydrogen Splitting Using Dialkylsilylene-Based Frustrated Lewis Pairs.

    PubMed

    Dong, Zhaowen; Li, Zhifang; Liu, Xupeng; Yan, Chenting; Wei, Ningka; Kira, Mitsuo; Müller, Thomas

    2017-06-01

    Isolable dialkylsilylene 5 reacts with dihydrogen in the presence of a small amount of a conventional Lewis acid (BPh3 , BEt3 ) or a base (PPh3 , PEt3 , NPh3 , NEt3 ) at low temperatures in a hydrocarbon solvent, giving the corresponding dihydrosilane 10 in high yields. Both 5/Lewis acid and Lewis base/5 pairs work as a frustrated Lewis pair (FLP) to split dihydrogen, being in accord with the amphoteric nature of silylene 5. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The thermodynamics and kinetics of a nucleotide base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Gong, Sha; Wang, Zhen; Zhang, Wenbing

    2016-03-01

    The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption of hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.

  13. Ultrafast dynamics in DNA base pairs following ultraviolet excitation.

    NASA Astrophysics Data System (ADS)

    Orr-Ewing, Andrew

    2015-03-01

    Photo-protective mechanisms in DNA are essential to maintain the integrity of the genetic code by preventing damage from absorption of solar ultraviolet (UV) radiation. We have used time-resolved infra-red (TRIR) spectroscopy to observe the dynamics of Watson-Crick nucleobase pairs following absorption of femtosecond UV laser pulses. The base pairs are prepared as nucleosides in solution, and photo-induced dynamics are probed in the carbonyl and N-H bond stretching regions using broadband IR pulses with picosecond time resolution. Results will be presented for the guanine-cytosine (G-C) base pair, contrasting the rapid recovery of ground-state products (the photo-protection pathway) with formation of other photoproducts which might represent photo-damage mechanisms. This work is a collaboration with the group of Prof F. Temps (Christian-Albrechts-Universitat zu Kiel). This research is supported by ERC Advanced Grant 290966 CAPRI.

  14. Intermolecular magnetic interactions in stacked DNA base pairs.

    PubMed

    Martínez, Fernando A; Aucar, Gustavo A

    2017-10-09

    The influence of pi-stacking on the magnetic properties of atoms that belong to adenine-thymine and guanine-cytosine pairs in sequences of three and five layers of DNA base pairs was analysed. As probes we used NMR spectroscopic parameters, which are among the most useful tools to learn about the transmission of magnetic interactions in molecules. Four DFT functionals were employed: B3LYP, BHANDLYP, KT2 and KT3, together with the SOPPA method. Besides, given that the number of non-hydrogen atoms of the supramolecular systems studied here is larger than 50 we applied a locally dense basis set scheme. Our results show that the piling up of a few Watson-Crick base pairs above and below a given pair modifies its NMR spectroscopic parameters by an amount that may be measurable and the percentage of variation does not depend on dispersion. We found that magnetic shieldings are more sensitive than J-couplings, and also that some atoms are more sensitive than others. Stacking affects the shielding of non-hydrogen atoms like nitrogens, that are donors in hydrogen bonds, HBs, and the carbons bonded to them. The amount of variation of these shieldings was found to be from 2% to 5% when the pairs are considered first as isolated, and then, placed in the middle of a sequence of three layers of base pairs. Such a variation becomes vanishingly small when the sequence contains more than three layers, showing that the stacking effect on NMR spectroscopic parameters has a local nature. We have also found a pattern for shieldings. First, equivalent atoms of similar monomers (thymine and adenine, or guanine and cytosine) have similar values of absolute shieldings in isolated pairs, and the amount of variation from isolated pairs to aggregates of a few pairs is also similar, meaning that equivalent atoms are affected in a similar manner by pi-stacking. Second, the hydrogen atoms which belong to hydrogen bonds are more sensitive to the piling up than the non-hydrogen atoms.

  15. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  16. Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

    ERIC Educational Resources Information Center

    Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

    2012-01-01

    In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

  17. Micromechanics of base pair unzipping in the DNA duplex.

    PubMed

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov'yov, Andrey V

    2012-01-25

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G·C content and rather distinct for the parts with A·T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork.

  18. A T Matrix Method Based upon Scalar Basis Functions

    NASA Technical Reports Server (NTRS)

    Mackowski, D.W.; Kahnert, F. M.; Mishchenko, Michael I.

    2013-01-01

    A surface integral formulation is developed for the T matrix of a homogenous and isotropic particle of arbitrary shape, which employs scalar basis functions represented by the translation matrix elements of the vector spherical wave functions. The formulation begins with the volume integral equation for scattering by the particle, which is transformed so that the vector and dyadic components in the equation are replaced with associated dipole and multipole level scalar harmonic wave functions. The approach leads to a volume integral formulation for the T matrix, which can be extended, by use of Green's identities, to the surface integral formulation. The result is shown to be equivalent to the traditional surface integral formulas based on the VSWF basis.

  19. Configurations of base-pair complexes in solutions. [nucleotide chemistry

    NASA Technical Reports Server (NTRS)

    Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

    1978-01-01

    A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

  20. Semi-regular biorthogonal pairs and generalized Riesz bases

    NASA Astrophysics Data System (ADS)

    Inoue, H.

    2016-11-01

    In this paper we introduce general theories of semi-regular biorthogonal pairs, generalized Riesz bases and its physical applications. Here we deal with biorthogonal sequences {ϕn} and {ψn} in a Hilbert space H , with domains D ( ϕ ) = { x ∈ H ; ∑ k = 0 ∞ |" separators=" ( x | ϕ k ) | 2 < ∞ } and D ( ψ ) = { x ∈ H ; ∑ k = 0 ∞ |" separators=" ( x | ψ k ) | 2 < ∞ } and linear spans Dϕ ≡ Span{ϕn} and Dψ ≡ Span{ψn}. A biorthogonal pair ({ϕn}, {ψn}) is called regular if both Dϕ and Dψ are dense in H , and it is called semi-regular if either Dϕ and D(ϕ) or Dψ and D(ψ) are dense in H . In a previous paper [H. Inoue, J. Math. Phys. 57, 083511 (2016)], we have shown that if ({ϕn}, {ψn}) is a regular biorthogonal pair then both {ϕn} and {ψn} are generalized Riesz bases defined in the work of Inoue and Takakura [J. Math. Phys. 57, 083505 (2016)]. Here we shall show that the same result holds true if the pair is only semi-regular by using operators Tϕ,e, Te,ϕ, Tψ,e, and Te,ψ defined by an orthonormal basis e in H and a biorthogonal pair ({ϕn}, {ψn}). Furthermore, we shall apply this result to pseudo-bosons in the sense of the papers of Bagarello [J. Math. Phys. 51, 023531 (2010); J. Phys. A 44, 015205 (2011); Phys. Rev. A 88, 032120 (2013); and J. Math. Phys. 54, 063512 (2013)].

  1. On the deactivation mechanisms of adenine-thymine base pair.

    PubMed

    Gobbo, João Paulo; Saurí, Vicenta; Roca-Sanjuán, Daniel; Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos

    2012-04-05

    In this contribution, the multiconfigurational second-order perturbation theory method based on a complete active space reference wave function (CASSCF/CASPT2) is applied to study all possible single and double proton/hydrogen transfers between the nucleobases in the adenine-thymine (AT) base pair, analyzing the role of excited states with different nature [localized (LE) and charge transfer (CT)], and considering concerted as well as step-wise mechanisms. According to the findings, once the lowest excited states, localized in adenine, are populated during UV irradiation of the Watson-Crick base pair, the proton transfer in the N-O bridge does not require high energy in order to populate a CT state. The latter state will immediately relax toward a crossing with the ground state, which will funnel the system to either the canonical structure or the imino-enol tautomer. The base pair is also capable of repairing itself easily since the imino-enol species is unstable to thermal conversion.

  2. Cell pairing using microwell array electrodes based on dielectrophoresis.

    PubMed

    Yoshimura, Yuki; Tomita, Masahiro; Mizutani, Fumio; Yasukawa, Tomoyuki

    2014-07-15

    We report a simple device with an array of 10,000 (100 × 100) microwells for producing vertical pairs of cells in individual microwells with a rapid manipulation based on positive dielectrophoresis (p-DEP). The areas encircled with micropoles which fabricated from an electrical insulating photosensitive polymer were used as microwells. The width (14 μm) and depth (25 μm) of the individual microwells restricted the size to two vertically aligned cells. The DEP device for the manipulation of cells consisted of a microfluidic channel with an upper indium tin oxide (ITO) electrode and a lower microwell array electrode fabricated on an ITO substrate. Mouse myeloma cells stained in green were trapped within 1 s in the microwells by p-DEP by applying an alternating current voltage between the upper ITO and the lower microwell array electrode. The cells were retained inside the wells even after switching off the voltage and washing with a fluidic flow. Other myeloma cells stained in blue were then trapped in the microwells occupied by the cells stained in green to form the vertical cell pairing in the microwells. Cells stained in different colors were paired within only 1 min and a pairing efficiency of over 50% was achieved.

  3. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  4. Microwave and THz sensing using slab-pair-based metamaterials

    SciTech Connect

    Kenanakis, G.; Shen, Nianhai; Mavidis, Ch.; Katsarakis, N.; Kafesaki, M.; Soukoulis, Costas M.; Economou, E.N.

    2012-10-15

    In this work the sensing capability of an artificial magnetic metamaterial based on pairs of metal slabs is demonstrated, both theoretically and experimentally, in the microwave regime. The demonstration is based on transmission measurements and simulations monitoring the shift of the magnetic resonance frequency as one changes a thin dielectric layer placed between the slabs of the pairs. Strong dependence of the magnetic resonance frequency on both the permittivity and the thickness of the dielectric layer under detection was observed. The sensitivity to the dielectrics′ permittivity (ε) is larger for dielectrics of low ε values, which makes the approach suitable for sensing organic materials also in the THz regime. The capability of our approach for THz sensing is also demonstrated through simulations.

  5. Identity-Based Authenticated Key Agreement Protocols without Bilinear Pairings

    NASA Astrophysics Data System (ADS)

    Cao, Xuefei; Kou, Weidong; Yu, Yong; Sun, Rong

    This letter proposes an identity-based authenticated key agreement protocol. Different from available comparable ones, the new protocol realizes implicit authentication without bilinear pairings which makes it more efficient. The security of proposed protocol can be reduced to the standard Computational Diffie-Hellman problem. Two variants of the protocol are also given, with one achieving the security-efficiency trade-off and the other providing authenticated key agreement between users of different domains.

  6. Differential Role of Base Pairs on gal Promoters Strength

    PubMed Central

    Lewis, Dale E. A.; Le, Phuoc; Adhya, Sankar

    2015-01-01

    Sequence alignments of promoters in prokaryotes postulated that the frequency of occurrence of a base pair at a given position of promoter elements reflects its contribution to intrinsic promoter strength. We directly assessed the contribution of the four bp in each position in the intrinsic promoter strength by keeping the context constant in Escherichia coli cAMP-CRP regulated gal promoters by in vitro transcription assays. First, we show that bp frequency within known consensus elements correlates well with promoter strength. Second, we observe some substitutions upstream of the ex-10 TG-motif that are important for promoter function. Although the galP1 and P2 promoters overlap, only three positions were found where substitutions inactivated both promoters. We propose that RNA polymerase binds to the −12T bp as part of dsDNA while opening base pairs from −11A to +3 to form the single stranded transcription bubble DNA during isomerization. The cAMP-CRP complex rescued some deleterious substitutions in the promoter region. The base pair roles and their flexibilities reported here for E. coli gal promoters may help construction of synthetic promoters in gene circuitry experiments in which overlapping promoters with differential controls may be warranted. PMID:25543084

  7. Electrical current through DNA containing mismatched base pairs

    NASA Astrophysics Data System (ADS)

    Edirisinghe, Neranjan; Apalkov, Vadym; Berashevich, Julia; Chakraborty, Tapash

    2010-06-01

    Mismatched base pairs, such as different conformations of the G·A mispair, cause only minor structural changes in the host DNA molecule, thereby making mispair recognition an arduous task. Electron transport in DNA that depends strongly on the hopping transfer integrals between the nearest base pairs, which in turn are affected by the presence of a mispair, might be an attractive approach in this regard. We report here on our investigations, via the I-V characteristics, of the effect of a mispair on the electrical properties of homogeneous and generic DNA molecules. The I-V characteristics of DNA were studied numerically within the double-stranded tight-binding model. The parameters of the tight-binding model, such as the transfer integrals and on-site energies, are determined from first-principles calculations. The changes in electrical current through the DNA chain due to the presence of a mispair depend on the conformation of the G·A mispair and are appreciable for DNA consisting of up to 90 base pairs. For homogeneous DNA sequences the current through DNA is suppressed and the strongest suppression is realized for the G(anti)·A(syn) conformation of the G·A mispair. For inhomogeneous (generic) DNA molecules, the mispair result can be either a suppression or an enhancement of the current, depending on the type of mispairs and actual DNA sequence.

  8. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  9. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials.

  10. Attacking mechanism of hydroxyl radical to DNA base-pair: density functional study in vacuum and in water.

    PubMed

    Shimizu, Eisuke; Tokuyama, Yuki; Okutsu, Naoko; Nomura, Kazuya; Danilov, Victor I; Kurita, Noriyuki

    2015-01-01

    Recently, the influence of radiation on human body has been recognized as a serious problem. In particular, highly reactive hydroxyl radicals *OH produced by the radiation react with DNA, resulting in a great damage on its structure and electronic properties. It is thus important to investigate the reaction mechanism of *OH to DNA for elucidating the initial damage in DNA induced by the radiation. In the present study, we search for transition states (TS) of the reaction between G-C/A-T base-pair and [Formula: see text] in vacuum and in water, by the density functional theory (DFT) calculations. At first, we obtain the stable structures for the dehydrogenated G-C and A-T, in which the hydrogen atom of NH2 group of G or A base is abstracted by [Formula: see text]. From the structures of the dehydrogenated as well as the natural base-pairs, the TS between these structures is searched for and the activation free energy (AFE) is estimated for the reaction. In vacuum, AFEs for the G-C and A-T are almost the same each other, while the stabilization energy by the reaction for G-C is about 4.9 kcal/mol larger than that for A-T, indicating that the population of the dehydrogenated G-C is remarkably larger than that of the dehydrogenated A-T in vacuum. On the other hand, in water approximated by the continuum solvation model, the AFE for A-T is 2.6 kcal/mol smaller than that for G-C, indicating that the reaction dehydrogenated by [Formula: see text] occurs more frequently for the solvated A-T base-pair than G-C.

  11. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  12. Constructing optimal backbone segments for joining fixed DNA base pairs.

    PubMed Central

    Mazur, J; Jernigan, R L; Sarai, A

    1996-01-01

    A method is presented to link a sequence of space-fixed base pairs by the sugar-phosphate segments of single nucleotides and to evaluate the effects in the backbone caused by this positioning of the bases. The entire computational unit comprises several nucleotides that are energy-minimized, subject to constraints imposed by the sugar-phosphate backbone segments being anchored to space-fixed base pairs. The minimization schemes are based on two stages, a conjugate gradient method followed by a Newton-Raphson algorithm. Because our purpose is to examine the response, or relaxation, of an artificially stressed backbone, it is essential to be able to obtain, as closely as possible, a lowest minimum energy conformation of the backbone segment in conformational space. For this purpose, an algorithm is developed that leads to the generation of an assembly of many local energy minima. From these sets of local minima, one conformation corresponding to the one with the lowest minimum is then selected and designated to represent the backbone segment at its minimum. The effective electrostatic potential of mean force is expressed in terms of adjustable parameters that incorporate solvent screening action in the Coulombic interactions between charged backbone atoms; these parameters are adjusted to obtain the best fit of the nearest-neighbor phosphorous atoms in an x-ray structure. PMID:8874023

  13. Unusual Base-Pairing Interactions in Monomer–Template Complexes

    PubMed Central

    2016-01-01

    Many high-resolution crystal structures have contributed to our understanding of the reaction pathway for catalysis by DNA and RNA polymerases, but the structural basis of nonenzymatic template-directed RNA replication has not been studied in comparable detail. Here we present crystallographic studies of the binding of ribonucleotide monomers to RNA primer–template complexes, with the goal of improving our understanding of the mechanism of nonenzymatic RNA copying, and of catalysis by polymerases. To explore how activated ribonucleotides recognize and bind to RNA templates, we synthesized an unreactive phosphonate-linked pyrazole analogue of guanosine 5′-phosphoro-2-methylimidazolide (2-MeImpG), a highly activated nucleotide that has been used extensively to study nonenzymatic primer extension. We cocrystallized this analogue with structurally rigidified RNA primer–template complexes carrying single or multiple monomer binding sites, and obtained high-resolution X-ray structures of these complexes. In addition to Watson–Crick base pairing, we repeatedly observed noncanonical guanine:cytidine base pairs in our crystal structures. In most structures, the phosphate and leaving group moieties of the monomers were highly disordered, while in others the distance from O3′ of the primer to the phosphorus of the incoming monomer was too great to allow for reaction. We suggest that these effects significantly influence the rate and fidelity of nonenzymatic RNA replication, and that even primitive ribozyme polymerases could enhance RNA replication by enforcing Watson–Crick base pairing between monomers and primer–template complexes, and by bringing the reactive functional groups into closer proximity. PMID:28058281

  14. Synthesis and base pairing studies of geranylated 2-thiothymidine, a natural variant of thymidine.

    PubMed

    Wang, Rui; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Shen, Fusheng; Chen, Alan; Sheng, Jia

    2015-11-25

    The synthesis and base pairing of DNA duplexes containing the geranylated 2-thiothymidine have been investigated. This naturally existing hydrophobic modification could grant better base pairing stability to the T-G pair over normal T-A and other mismatched pairs in the duplex context. This study provides a potential explanation for the different codon recognition preferences of the geranylated tRNAs.

  15. DNA base pair stacks with high electric conductance: a systematic structural search.

    PubMed

    Berlin, Yuri A; Voityuk, Alexander A; Ratner, Mark A

    2012-09-25

    We report a computational search for DNA π-stack structures exhibiting high electric conductance in the hopping regime, based on the INDO/S calculations of electronic coupling and the method of data analysis called k-means clustering. Using homogeneous poly(G)-poly(C) and poly(A)-poly(T) stacks as the simplest structural models, we identify the configurations of neighboring G:C and A:T pairs that allow strong electronic coupling and, therefore, molecular electric conductance much larger than the values reported for the corresponding reference systems in the literature. A computational approach for modeling the impact of thermal fluctuations on the averaged dimer structure was also proposed and applied to the [(G:C),(G:C)] and [(A:T),(A:T)] duplexes. The results of this work may provide guidance for the construction of DNA devices and DNA-based elements of nanoscale molecular circuits. Several factors that cause changes of step parameters favorable to the formation of the predicted stack conformation with high electric conductance of DNA molecules are also discussed; favorable geometries may enhance the conductivity by factors as large as 15.

  16. Base-pairing mediated non-covalent polymers.

    PubMed

    Fathalla, Maher; Lawrence, Candace M; Zhang, Nan; Sessler, Jonathan L; Jayawickramarajah, Janarthanan

    2009-06-01

    The naturally occurring nucleic acid bases (nucleobases) adenine, thymine (uracil), guanine, and cytosine are widely appreciated for their ability to stabilize canonical Watson-Crick base-pairing motifs, as well as a number of other well-characterized arrangements, such as Hoogsteen and wobble heterodimers, and a variety of homodimers. In this tutorial review, the use of these kinds of interactions to form synthetic polymeric and oligomeric ensembles is summarized. Particular emphasis will be placed on synthetic analogues of guanine that stabilize the formation of well-defined higher order aggregates, as well as de novo polymeric systems whose properties are modulated by the presence of nucleobase derivatives incorporated within or attached to the chain-defining backbone. In both cases, nucleobase-nucleobase interactions serve to underlie the chemistry, establish the structural morphology, and enable the development of bioinspired, environmentally responsive materials.

  17. Color image encryption based on paired interpermuting planes

    NASA Astrophysics Data System (ADS)

    Zhang, Wei; Yu, Hai; Zhu, Zhi-liang

    2015-03-01

    A number of chaos-based image encryption algorithms have been proposed in recent years, and most of them employ confusion-diffusion architecture. This paper presents a new confusion scheme based on paired interpermuting planes. In the proposed new confusion operation, an "exchange and random access strategy" is employed to replace the traditional confusion operations. The efficiency of the proposed scheme was analyzed by evaluating its histogram distribution, its correlation coefficients, its ability to resist differential attacks, its ability to retain information (entropy analysis), its computational speed, and its ability to guarantee the security of its key scheme. Simulations have been carried out and the results confirmed the superior security and computing speed of our scheme compared to other comparable algorithms.

  18. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  19. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  20. Detection of base-pair mismatches in DNA using graphene-based nanopore device.

    PubMed

    Kundu, Sourav; Karmakar, S N

    2016-04-01

    We present a unique way to detect base-pair mismatches in DNA, leading to a different epigenetic disorder by the method of nanopore sequencing. Based on a tight-binding formulation of a graphene-based nanopore device, using the Green's function approach we study the changes in the electronic transport properties of the device as we translocate a double-stranded DNA through the nanopore embedded in a zigzag graphene nanoribbon. In the present work we are not only successful in detecting the usual AT and GC pairs but also a set of possible mismatches in the complementary base pairing.

  1. Detection of base-pair mismatches in DNA using graphene-based nanopore device

    NASA Astrophysics Data System (ADS)

    Kundu, Sourav; Karmakar, S. N.

    2016-04-01

    We present a unique way to detect base-pair mismatches in DNA, leading to a different epigenetic disorder by the method of nanopore sequencing. Based on a tight-binding formulation of a graphene-based nanopore device, using the Green’s function approach we study the changes in the electronic transport properties of the device as we translocate a double-stranded DNA through the nanopore embedded in a zigzag graphene nanoribbon. In the present work we are not only successful in detecting the usual AT and GC pairs but also a set of possible mismatches in the complementary base pairing.

  2. Electron correlated and density functional studies on hydrogen-bonded proton transfer in adenine thymine base pair of DNA

    NASA Astrophysics Data System (ADS)

    Shimizu, Naoto; Kawano, Satoyuki; Tachikawa, Masanori

    2005-02-01

    The potential energy surface along the hydrogen-bonded proton transfer between the Watson-Crick (WC) adenine-thymine (A-T) base pair of deoxyribonucleic acid (DNA) and its tautomeric structures is calculated with 6-31G(d,p) basis set in Hartree-Fock (HF), density functional theory with Becke's three-parameter hybrid Lee-Yang-Parr exchange-correlation functional (B3LYP), second order Møller-Plesset perturbation (MP2), and coupled cluster singles and doubles (CCSD) levels. The tautomeric structure, where both two hydrogen-bonded protons in the A-T base pair have transferred each other, is found at all level of calculations. Though the optimized structure in which only one hydrogen-bonded proton in adenine has migrated to thymine is found at HF level, we could not obtain such optimized structure at both MP2 and B3LYP levels. Including electron correlations, the energy differences between the canonical A-T and the two hydrogen-bonded protons transferred tautomeric structure become smaller. Aside from this, potential energy surface from the WC A-T to the Hoogsteen type A-T gives almost the same among each level of calculation.

  3. Base pair opening kinetics and dynamics in the DNA duplexes that specifically recognized by very short patch repair protein (Vsr).

    PubMed

    Cho, Sung Jae; Bang, Jongchul; Lee, Joon-Hwa; Choi, Byong-Seok

    2010-09-15

    In Escherichia coli, the very short patch (VSP) repair system is a major pathway for removal of T.G mismatches in Dcm target sequences. In the VSP repair pathway, the very short patch repair (Vsr) endonuclease selectively recognizes a T.G mismatch in Dcm target sequences and hydrolyzes the 5'-phosphate group of the mismatched thymine. The hydrogen exchange NMR studies here revealed that the T5.G18 mismatch in the Dcm target sequence significantly stabilizes own base pair but destabilizes the two neighboring G4.C19 and A6.T17 base pairs compare to other T.G mismatches. These unusual patterns of base pair stability in the Dcm target sequence can explain how the Vsr endonuclease specifically recognizes the mismatched Dcm target sequence and intercalates into the DNA. Copyright 2010 Elsevier Inc. All rights reserved.

  4. Molecular cloning of bovine thyroglobulin complementary DNA. Characterization of 2500-base-pair and 1900-base-pair fragments.

    PubMed

    Christophe, D; Brocas, H; Gannon, F; de Martynoff, G; Pays, E; Vassart, G

    1980-10-01

    Double-stranded thyroglobulin complementary DNA (cDNA) was synthesized from purified 33-S bovine thyroglobulin mRNA. This synthetic structural gene has previously been shown to contain three sites for the restriction endonuclease HindIII, yielding two internal fragments of 1900 and 2500 base pairs respectively. Recombinant molecules were prepared by ligating the HindIII-restricted cDNA to the plasmid pBR322 which had been linearized by the same enzyme. When Escherichia coli was transformed with this mixture, it yielded two kinds of colonies each harboring recombinant plasmids containing one of the two cDNA fragments. Both recombinant molecules hybridized specifically to translatable thyroglobulin mRNA. Sequence homology between the two cloned DNAs could not be detected by cross-hybridization experiments; this argues against the existence of internal structural repetition in thyroglobulin subunits. Together, the two cloned DNA fragments represent 55% of the 8000-base-pair double-stranded thyroglobulin DNA.

  5. Charge-transfer and spin dynamics in DNA hairpin conjugates with perylenediimide as a base-pair surrogate.

    PubMed

    Zeidan, Tarek A; Carmieli, Raanan; Kelley, Richard F; Wilson, Thea M; Lewis, Frederick D; Wasielewski, Michael R

    2008-10-22

    A perylenediimide chromophore (P) was incorporated into DNA hairpins as a base-pair surrogate to prevent the self-aggregation of P that is typical when it is used as the hairpin linker. The photoinduced charge-transfer and spin dynamics of these hairpins were studied using femtosecond transient absorption spectroscopy and time-resolved EPR spectroscopy (TREPR). P is a photooxidant that is sufficiently powerful to quantitatively inject holes into adjacent adenine (A) and guanine (G) nucleobases. The charge-transfer dynamics observed following hole injection from P into the A-tract of the DNA hairpins is consistent with formation of a polaron involving an estimated 3-4 A bases. Trapping of the (A 3-4) (+*) polaron by a G base at the opposite end of the A-tract from P is competitive with charge recombination of the polaron and P (-*) only at short P-G distances. In a hairpin having 3 A-T base pairs between P and G ( 4G), the radical ion pair that results from trapping of the hole by G is spin-correlated and displays TREPR spectra at 295 and 85 K that are consistent with its formation from (1*)P by the radical-pair intersystem crossing mechanism. Charge recombination is spin-selective and produces (3*)P, which at 85 K exhibits a spin-polarized TREPR spectrum that is diagnostic of its origin from the spin-correlated radical ion pair. Interestingly, in a hairpin having no G bases ( 0G), TREPR spectra at 85 K revealed a spin-correlated radical pair with a dipolar interaction identical to that of 4G, implying that the A-base in the fourth A-T base pair away from the P chromophore serves as a hole trap. Our data suggest that hole injection and transport in these hairpins is completely dominated by polaron generation and movement to a trap site rather than by superexchange. On the other hand, the barrier for charge injection from G (+*) back onto the A-T base pairs is strongly activated, so charge recombination from G (or even A trap sites at 85 K) most likely proceeds by a

  6. Unique magnetic signatures of mismatched base pairs in DNA

    NASA Astrophysics Data System (ADS)

    Apalkov, Vadim; Berashevich, Julia; Chakraborty, Tapash

    2010-02-01

    Magnetic properties of DNA containing mispairs, such as different conformations of the GṡA mispair, or a GṡT mispair inserted into the DNA chain, have been theoretically investigated. The essential ingredients for these studies, the charge transfer integrals, were evaluated from the DNA sequences containing the mispair and optimized in the solvent. We find that the magnetic susceptibilities of the host DNA chain containing a large number of Watson-Crick base pairs are significantly altered in the presence of the mispairs, and the effects depend on the choice of mispairs. In particular, insertion of even a single GṡA mispair changes the nature of magnetization (sign of the susceptibility) of the host DNA. We propose that measurement of the magnetic properties of DNA might provide a direct route to detection and identification of those mispairs.

  7. Design of laser pulses for selective vibrational excitation of the N6-H bond of adenine and adenine-thymine base pair using optimal control theory.

    PubMed

    Sharma, Sitansh; Sharma, Purshotam; Singh, Harjinder; Balint-Kurti, Gabriel G

    2009-06-01

    Time dependent quantum dynamics and optimal control theory are used for selective vibrational excitation of the N6-H (amino N-H) bond in free adenine and in the adenine-thymine (A-T) base pair. For the N6-H bond in free adenine we have used a one dimensional model while for the hydrogen bond, N6-H(A)...O4(T), present in the A-T base pair, a two mathematical dimensional model is employed. The conjugate gradient method is used for the optimization of the field dependent cost functional. Optimal laser fields are obtained for selective population transfer in both the model systems, which give virtually 100% excitation probability to preselected vibrational levels. The effect of the optimized laser field on the other hydrogen bond, N1(A)...H-N3(T), present in A-T base pair is also investigated.

  8. Pyrimidine-pyrimidine base pairs stabilized by silver(I) ions.

    PubMed

    Urata, Hidehito; Yamaguchi, Eriko; Nakamura, Yasunari; Wada, Shun-ichi

    2011-01-21

    In the presence of Ag(I) ions, the C-T and m(5)iC (5-methylisocytosine)-T base pairs showed comparable stability to the C-Ag(I)-C base pair, and the m(5)iC-C base pair was highly stabilized by the synergetic effect of Ag(I) coordination and possible hydrogen bonding.

  9. Region-based compression of remote sensing stereo image pairs

    NASA Astrophysics Data System (ADS)

    Yan, Ruomei; Li, Yunsong; Wu, Chengke; Wang, Keyan; Li, Shizhong

    2009-08-01

    According to the data characteristics of remote sensing stereo image pairs, a novel compression algorithm based on the combination of feature-based image matching (FBM), area-based image matching (ABM), and region-based disparity estimation is proposed. First, the Scale Invariant Feature Transform (SIFT) and the Sobel operator are carried out for texture classification. Second, an improved ABM is used in the area with flat terrain (flat area), while the disparity estimation, a combination of quadtree decomposition and FBM, is used in the area with alpine terrain (alpine area). Furthermore, the radiation compensation is applied in every area. Finally, the disparities, the residual image, and the reference image are compressed by JPEG2000 together. The new algorithm provides a reasonable prediction in different areas according to characteristics of image textures, which improves the precision of the sensed image. The experimental results show that the PSNR of the proposed algorithm can obtain up to about 3dB's gain compared with the traditional algorithm at low or medium bitrates, and the subjective quality is obviously enhanced.

  10. Using gap symmetry and structure to reveal the pairing mechanism in Fe-based superconductors

    NASA Astrophysics Data System (ADS)

    Hirschfeld, Peter J.

    2016-01-01

    I review theoretical ideas and implications of experiments for the gap structure and symmetry of the Fe-based superconductors. Unlike any other class of unconventional superconductors, one has in these systems the possibility to tune the interactions by small changes in pressure, doping or disorder. Thus, measurements of order parameter evolution with these parameters should enable a deeper understanding of the underlying interactions. I briefly review the ;standard paradigm; for s-wave pairing in these systems, and then focus on developments in the past several years which have challenged this picture. I further discuss the reasons for the apparent close competition between pairing in s- and d-wave channels, particularly in those systems where one type of Fermi surface pocket - hole or electron - is missing. Observation of a transition between s- and d-wave symmetry, possibly via a time reversal symmetry breaking ;s + id; state, would provide an important confirmation of these ideas. Several proposals for detecting these novel phases are discussed, including the appearance of order parameter collective modes in Raman and optical conductivities. Transitions between two different types of s-wave states, involving various combinations of signs on Fermi surface pockets, can also proceed through a T-breaking ;s + is; state. I discuss recent work that suggests pairing may take place away from the Fermi level over a surprisingly large energy range, as well as the effect of glide plane symmetry of the Fe-based systems on the superconductivity, including various exotic, time and translational invariance breaking pair states that have been proposed. Finally, I address disorder issues, and the various ways systematic introduction of disorder can (and cannot) be used to extract information on gap symmetry and structure.

  11. DNA duplex stability of the thio-iso-guanine•methyl-iso-Cytosine base pair.

    PubMed

    Lee, Dongkye; Switzer, Christopher

    2015-01-01

    We report the synthesis, incorporation into oligonucleotides, and base-pairing properties of the 2-thio-variant of iso-guanine. Iso-guanine is the purine component of a nonstandard base pair with 5-methyl-iso-cytosine. The 2-thio-iso-guanine • 5-methyl-iso-cytosine base pair is found to have similar stability to an adenine • thymine pair.

  12. Structure, stability, and dynamics of canonical and noncanonical base pairs: quantum chemical studies.

    PubMed

    Roy, Ashim; Panigrahi, Swati; Bhattacharyya, Malyasri; Bhattacharyya, Dhananjay

    2008-03-27

    The importance of non-Watson-Crick base pairs in the three-dimensional structure of RNA is now well established. The structure and stability of these noncanonical base pairs are, however, poorly understood. We have attempted to understand structural features of 33 frequently occurring base pairs using density functional theory. These are of three types, namely (i) those stabilized by two or more polar hydrogen bonds between the bases, (ii) those having one polar and another C-H...O/N type interactions, and (iii) those having one H-bond between the bases and another involving one of the sugars linked to the bases. We found that the base pairs having two polar H-bonds are very stable as compared to those having one C-H...O/N interaction. Our quantitatively analysis of structures of these optimized base pairs indicates that they possess a different amount of nonplanarity with large propeller or buckle values as also observed in the crystal structures. We further found that geometry optimization does not modify the hydrogen-bonding pattern, as values of shear and open angle of the base pairs remain conserved. The structures of initial crystal geometry and final optimized geometry of some base pairs having only one polar H-bond and a C-H...O/N interaction, however, are significantly different, indicating the weak nature of the nonpolar interaction. The base pair flexibility, as measured from normal-mode analysis, in terms of the intrinsic standard deviations of the base pair structural parameters are in conformity with those calculated from RNA crystal structures. We also noticed that deformation of a base pair along the stretch direction is impossible for all of the base pairs, and movements of the base pairs along shear and open are also quite restricted. The base pair opening mode through alteration of propeller or buckle is considerably less restricted for most of the base pairs.

  13. Effect of phenolic radicals on the geometry and electronic structure of DNA base pairs: computational study

    NASA Astrophysics Data System (ADS)

    Zarei, Mohammad; Seif, Abdolvahab; Azizi, Khaled; Zarei, Mohanna; Bahrami, Jamil

    2016-04-01

    In this paper, we show the reaction of a hydroxyl, phenyl and phenoxy radicals with DNA base pairs by the density functional theory (DFT) calculations. The influence of solvation on the mechanism is also presented by the same DFT calculations under the continuum solvation model. The results showed that hydroxyl, phenyl and phenoxy radicals increase the length of the nearest hydrogen bond of adjacent DNA base pair which is accompanied by decrease in the length of furthest hydrogen bond of DNA base pair. Also, hydroxyl, phenyl and phenoxy radicals influenced the dihedral angle between DNA base pairs. According to the results, hydrogen bond lengths between AT and GC base pairs in water solvent are longer than vacuum. All of presented radicals influenced the structure and geometry of AT and GC base pairs, but phenoxy radical showed more influence on geometry and electronic properties of DNA base pairs compared with the phenyl and hydroxyl radicals.

  14. The influence of arene-ring size on stacking interaction with canonical base pairs

    NASA Astrophysics Data System (ADS)

    Formánek, Martin; Burda, Jaroslav V.

    2014-04-01

    Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.

  15. Intriguing radical-radical interactions among double-electron oxidized adenine-thymine base pairs

    NASA Astrophysics Data System (ADS)

    Wang, Mei; Zhao, Jing; Zhang, Laibin; Su, Xiyu; Su, Hanlei; Bu, Yuxiang

    2015-01-01

    We present a theoretical investigation of the structural and electronic properties of double-electron oxidized adenine-thymine base pair as well as its deprotonated Watson-Crick derivatives. Double-electron oxidation can destabilize the AT unit, leading to a barrier-hindered metastable A+T+ state with a dissociation channel featuring negative dissociation energy. This unusual energetic phenomenon originates from the competition of electrostatic repulsion and attractively hydrogen-bonding interaction co-existing between Arad + and Trad +. The associated double-proton-transfer process is also explored, suggesting a possible two-step mechanism. Magnetic coupling interactions of various diradical structures are controlled by both intra- and inter-molecular interactions.

  16. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.

    PubMed

    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi

    2012-06-01

    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  17. Anharmonic Vibrational Signatures of DNA Bases and Watson-Crick Base Pairs

    NASA Astrophysics Data System (ADS)

    Wang, Gui-xiu; Ma, Xiao-yan; Wang, Jian-ping

    2009-12-01

    Changes of molecular structure and associated charge distributions, and changes of anharmonic vibrational parameters from DNA base monomers to the Watson-Crick base pairs, have been investigated at the density functional theory level. Through examination of the NH2, N-H, and C = O stretching vibrational modes that are involved in the multiple H-bonds in the base pairs, sensitivity of their diagonal and off-diagonal anharmonicities, as well as anharmonic vibrational couplings, to the structure change are predicted. Our results reveal the intrinsic connection between the anharmonic vibrational potentials, H-bonding, and electrostatic interactions in DNA bases.

  18. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs.

    PubMed

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5-50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with lp ∼ 50 nm.

  19. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    NASA Astrophysics Data System (ADS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5-50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ˜6 bps at each helix end. Correspondingly, the apparent persistence length lp of short DNAs increases gradually from ˜29 nm to ˜45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ˜6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with lp ˜ 50 nm.

  20. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    SciTech Connect

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-03-28

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l{sub p} of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l{sub p} ∼ 50 nm.

  1. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism.

    PubMed

    Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes.

  2. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  3. Plasmon switching effect based on graphene nanoribbon pair arrays

    NASA Astrophysics Data System (ADS)

    Liu, Dan; Wu, Lingxi; Liu, Qiong; Zhou, Renlong; Xie, Suxia; Chen, Jiangjiamin; Wu, Mengxiong; Zeng, Lisan

    2016-10-01

    We theoretically demonstrate the existence of plasmon switching effect in graphene nanostructure. By using finite-difference time-domain (FDTD) method, the plasmon resonance modes are studied in graphene nanoribbon pair arrays with the change of Fermi level, graphene width, and carrier mobility. It is found that the Fermi level and graphene width play an important role in changing the distribution of electric energy on different graphene nanoribbons, resulting in a significant plasmon switching effect. Moreover, we study the characteristic of resonance mode of one graphene ribbon by using glass rod with different shape. The effect of kerr material sandwiched between graphene nanoribbon pair is also considered.

  4. Inferring the conformation of RNA base pairs and triples from patterns of sequence variation.

    PubMed

    Gautheret, D; Gutell, R R

    1997-04-15

    The success of comparative analysis in resolving RNA secondary structure and numerous tertiary interactions relies on the presence of base covariations. Although the majority of base covariations in aligned sequences is associated to Watson-Crick base pairs, many involve non-canonical or restricted base pair exchanges (e.g. only G:C/A:U), reflecting more specific structural constraints. We have developed a computer program that determines potential base pairing conformations for a given set of paired nucleotides in a sequence alignment. This program (ISOPAIR) assumes that the base pair conformation is maintained through sequence variation without significantly affecting the path of the sugar-phosphate backbone. ISOPAIR identifies such 'isomorphic' structures for any set of input base pair or base triple sequences. The program was applied to base pairs and triples with known structures and sequence exchanges. In several instances, isomorphic structures were correctly identified with ISOPAIR. Thus, ISOPAIR is useful when assessing non-canonical base pair conformations in comparative analysis. ISOPAIR applications are limited to those cases where unusual base pair exchanges indeed reflect a non-canonical conformation.

  5. Raising the barrier for photoinduced DNA charge injection with a cyclohexyl artificial base pair.

    PubMed

    Singh, Arunoday P N; Harris, Michelle A; Young, Ryan M; Miller, Stephen A; Wasielewski, Michael R; Lewis, Frederick D

    2015-01-01

    The effects of an artificial cyclohexyl base pair on the quantum yields of fluorescence and dynamics of charge separation and charge recombination have been investigated for several synthetic DNA hairpins. The hairpins possess stilbenedicarboxamide, perylenediimide, or naphthalenediimide linkers and base-paired stems. In the absence of the artificial base pair hole injection into both adenine and guanine purine bases is exergonic and irreversible, except in the case of stilbene with adenine for which it is slightly endergonic and reversible. Insertion of the artificial base pair renders hole injection endergonic or isoergonic except in the case of the powerful naphthalene acceptor for which it remains exergonic. Both hole injection and charge recombination are slower for the naphthalene acceptor in the presence of the artificial base pair than in its absence. The effect of an artificial base pair on charge separation and charge recombination in hairpins possessing stilbene and naphthalene acceptor linkers and a stilbenediether donor capping group has also been investigated. In the case of the stilbene acceptor-stilbene donor capped hairpins photoinduced charge separation across six base pairs is efficient in the absence of the artificial base pair but does not occur in its presence. In the case of the naphthalene acceptor-stilbene donor capped hairpins the artificial base pair slows but does not stop charge separation and charge recombination, leading to the formation of long-lived charge separated states.

  6. Additional base-pair formation in DNA duplexes by a double-headed nucleotide.

    PubMed

    Madsen, Charlotte S; Witzke, Sarah; Kumar, Pawan; Negi, Kushuma; Sharma, Pawan K; Petersen, Michael; Nielsen, Poul

    2012-06-11

    We have designed and synthesised a double-headed nucleotide that presents two nucleobases in the interior of a dsDNA duplex. This nucleotide recognises and forms Watson-Crick base pairs with two complementary adenosines in a Watson-Crick framework. Furthermore, with judicious positioning in complementary strands, the nucleotide recognises itself through the formation of a T:T base pair. Thus, two novel nucleic acid motifs can be defined by using our double-headed nucleotide. Both motifs were characterised by UV melting experiments, CD and NMR spectroscopy and molecular dynamics simulations. Both motifs leave the thermostability of the native dsDNA duplex largely unaltered. Molecular dynamics calculations showed that the double-headed nucleotides are accommodated in the dsDNA by entirely local perturbations and that the modified duplexes retain an overall B-type geometry with the dsDNA unwound by around 25 or 60°, respectively, in each of the modified motifs. Both motifs can be accommodated twice in a dsDNA duplex without incurring any loss of stability and extrapolating from this observation and the results of modelling, it is conceivable that both can be multiplied several times within a dsDNA duplex. These new motifs extend the DNA recognition repertoire and may form the basis for a complete series of double-headed nucleotides based on all 16 base combinations of the four natural nucleobases. In addition, both motifs can be used in the design of nanoscale DNA structures in which a specific duplex twist is required.

  7. Ground-based observations of subionospheric pulse pairs

    NASA Astrophysics Data System (ADS)

    Smith, David A.; Holden, Daniel N.

    1996-05-01

    We have developed a unique multiple-channel subband system to detect and record broadband electromagnetic transient events in carrier-dominated radio environments. Between May and September of 1994 we used this system to detect and record over six thousand transient radio frequency events in the band from 3 to 30 MHz. Approximately 500 of the events have been characterized as paired bursts of radio noise with individual burst durations of 4 to 10 μs and separations between the bursts of 5 to 160 μs. The paired transients are typically 5 to 40 dB brighter than the background electromagnetic spectrum between carrier signals. We have termed these events subionospheric pulse pairs (SIPPs) and presently have no explanation as to their source. Our observations of SIPPs resemble observations of transionospheric pulse pairs (TIPPs) recorded by the Blackbeard instrument on the ALEXIS satellite; the source of TIPP events is also unknown. Most SIPPs do not exhibit dispersion, implying groundwave (line-of-sight) propagation; but seven of the pairs exhibit dispersion characteristic of ionospheric skywave propagation. For our experimental configuration the maximum line-of-sight observation range for radio propagation extends to 300 km for a source at an altitude of 5 km and 520 km for a source at 15 km. Refraction from the ionosphere may allow HF skywave radiation to propagate around the globe. Information about the times and locations of sources, in conjunction with regional weather maps and computer models of ionospheric propagation, suggests that some SIPP events originate in the vicinity of large-scale thunderstorm complexes.

  8. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    SciTech Connect

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J. )

    1989-05-01

    The bisintercalation complex present between the DNA octamer (d(ACGTACGT)){sub 2} and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C{center dot}G and A{center dot}T base pairs. At low temperatures, the A{center dot}T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A{center dot}T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45{degree}C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed.

  9. Interim Evaluation of the Project P.A.T.H.S.: Findings Based on Different Datasets

    PubMed Central

    Shek, Daniel T. L.; Yu, Lu

    2012-01-01

    Interim evaluation studies were carried out in order to examine the implementation details of the Tier 1 Program of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in Hong Kong. Quantitative results of the interim evaluation findings based on eight datasets collected from 2006 to 2009 are reported in this paper. Three hundred and seventy-eight schools were randomly selected to provide information on the implementation details of the program via face-to-face interviews, telephone interviews, and self-completed questionnaires. Results showed that a majority of the workers perceived that the students had positive responses to the program and the program was helpful to the students. In conjunction with other process evaluation findings, the present study suggests that the implementation quality of the Tier 1 Program of the Project P.A.T.H.S. is high. The present study also provides support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong. PMID:22666091

  10. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.

    PubMed

    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

    2014-06-09

    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  11. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  12. The mode of binding ACMA-DNA relies on the base-pair nature.

    PubMed

    Busto, Natalia; García, Begoña; Leal, José M; Secco, Fernando; Venturini, Marcella

    2012-04-07

    A thermodynamic and kinetic study on the mode of binding of 9-amino-6-chloro-2-methoxi-acridine (ACMA) to poly(dA-dT)·poly(dA-dT) and poly(dG-dC)·poly(dG-dC) has been undertaken at pH = 7.0 and I = 0.1 M. The spectrophotometric, kinetic (T-jump), circular dichroism, viscometric and calorimetric information gathered point to formation of a fully intercalated ACMA complex with poly(dA-dT)·poly(dA-dT) and another one only partially intercalated (7%) with poly(dG-dC)·poly(dG-dC). The ACMA affinity with the A-T bases was higher than with the G-C bases. The two polynucleotide sequences give rise to external complexes when the ACMA concentration is raised, namely, the electrostatic complex poly(dA-dT)·poly(dA-dT)-ACMA and the major groove binding complex poly(dG-dC)·poly(dG-dC)-ACMA. A considerable quenching effect of the ACMA fluorescence is observed with poly(dA-dT)·poly(dA-dT), ascribable to face-to-face location in the intercalated A-T-ACMA base-pairs. The even stronger effect observed in the presence of poly(dG-dC)·poly(dG-dC) is related to the guanine residue from on- and off-slot ACMA positions.

  13. Contiguous metal-mediated base pairs comprising two Ag(I) ions.

    PubMed

    Megger, Dominik A; Guerra, Célia Fonseca; Hoffmann, Jan; Brutschy, Bernhard; Bickelhaupt, F Matthias; Müller, Jens

    2011-05-27

    The incorporation of transition-metal ions into nucleic acids by using metal-mediated base pairs has proved to be a promising strategy for the site-specific functionalization of these biomolecules. We report herein the formation of Ag(+)-mediated Hoogsteen-type base pairs comprising 1,3-dideaza-2'-deoxyadenosine and thymidine. By defunctionalizing the Watson-Crick edge of adenine, the formation of regular base pairs is prohibited. The additional substitution of the N3 nitrogen atom of adenine by a methine moiety increases the basicity of the exocyclic amino group. Hence, 1,3-dideazaadenine and thymine are able to incorporate two Ag(+) ions into their Hoogsteen-type base pair (as compared with one Ag(+) ion in base pairs with 1-deazaadenine and thymine). We show by using a combination of experimental techniques (UV and circular dichroism (CD) spectroscopies, dynamic light scattering, and mass spectrometry) that this type of base pair is compatible with different sequence contexts and can be used contiguously in DNA double helices. The most stable duplexes were observed when using a sequence containing alternating purine and pyrimidine nucleosides. Dispersion-corrected density functional theory calculations have been performed to provide insight into the structure, formation and stabilization of the twofold metalated base pair. They revealed that the metal ions within a base pair are separated by an Ag···Ag distance of about 2.88 Å. The Ag-Ag interaction contributes some 16 kcal mol(-1) to the overall stability of the doubly metal-mediated base pair, with the dominant contribution to the Ag-Ag bonding resulting from a donor-acceptor interaction between silver 4d-type and 4s orbitals. These Hoogsteen-type base pairs enable a higher functionalization of nucleic acids with metal ions than previously reported metal-mediated base pairs, thereby increasing the potential of DNA-based nanotechnology.

  14. Alternative radical pairs for cryptochrome-based magnetoreception

    PubMed Central

    Lee, Alpha A.; Lau, Jason C. S.; Hogben, Hannah J.; Biskup, Till; Kattnig, Daniel R.; Hore, P. J.

    2014-01-01

    There is growing evidence that the remarkable ability of animals, in particular birds, to sense the direction of the Earth's magnetic field relies on magnetically sensitive photochemical reactions of the protein cryptochrome. It is generally assumed that the magnetic field acts on the radical pair [FAD•− TrpH•+] formed by the transfer of an electron from a group of three tryptophan residues to the photo-excited flavin adenine dinucleotide cofactor within the protein. Here, we examine the suitability of an [FAD•− Z•] radical pair as a compass magnetoreceptor, where Z• is a radical in which the electron spin has no hyperfine interactions with magnetic nuclei, such as hydrogen and nitrogen. Quantum spin dynamics simulations of the reactivity of [FAD•− Z•] show that it is two orders of magnitude more sensitive to the direction of the geomagnetic field than is [FAD•− TrpH•+] under the same conditions (50 µT magnetic field, 1 µs radical lifetime). The favourable magnetic properties of [FAD•− Z•] arise from the asymmetric distribution of hyperfine interactions among the two radicals and the near-optimal magnetic properties of the flavin radical. We close by discussing the identity of Z• and possible routes for its formation as part of a spin-correlated radical pair with an FAD radical in cryptochrome. PMID:24671932

  15. Molecular Design of Ionization-Induced Proton Switching Element Based on Fluorinated DNA Base Pair.

    PubMed

    Tachikawa, Hiroto; Kawabata, Hiroshi

    2016-03-10

    To design theoretically the high-performance proton switching element based on DNA base pair, the effects of fluorine substitution on the rate of proton transfer (PT) in the DNA model base pair have been investigated by means of direct ab initio molecular dynamics (AIMD) method. The 2-aminopyridine dimer, (AP)2, was used as the model of the DNA base pair. One of the hydrogen atoms of the AP molecule in the dimer was substituted by a fluorine (F) atom, and the structures of the dimer, expressed by F-(AP)2, were fully optimized at the MP2/6-311++G(d,p) level. The direct AIMD calculations showed that the proton is transferred within the base pair after the vertical ionization. The rates of PT in F-(AP)2(+) were calculated and compared with that of (AP)2(+) without an F atom. It was found that PT rate is accelerated by the F-substitution. Also, the direction of PT between F-AP and AP molecules can be clearly controlled by the position of F-substitution (AP)2 in the dimer.

  16. Mutation analysis of the base-pair connecting two functional modules in the DSL ribozyme.

    PubMed

    Ishikawa, Junya; Furuta, Hiroyuki; Ikawa, Yoshiya

    2008-01-01

    The class DSL ribozyme is one of artificial RNA enzymes generated by module-based molecular design. In the structure of this ribozyme, two most important functional modules are connected by a U-A base-pair. We have examined the possible importance of this base-pair by site-directed mutation experiments using the DSL-1S ribozyme and its derivative possessing altered modular organization. The analysis indicated that the DSL-1S ribozyme preferred U-A pair at the positions whereas the derivative preferred A-U pair.

  17. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  18. Deficient nucleotide excision repair increases base-pair substitutions but decreases TGGC frameshifts induced by methylglyoxal in Escherichia coli.

    PubMed

    Murata-Kamiya, N; Kaji, H; Kasai, H

    1999-06-07

    To investigate the mutation spectrum of a well-known mutagen, methylglyoxal, and the influence of nucleotide excision repair (NER) on methylglyoxal-induced mutations, we treated wild-type and NER-deficient (uvrA or uvrC) Escherichia coli strains with methylglyoxal, and analyzed mutations in the chromosomal lacI gene. In the three strains, the cell death and the mutation frequency increased according to the dose of methylglyoxal added to the culture medium. The frequencies of methylglyoxal-induced base-pair substitutions were higher in the NER-deficient strains than in the wild-type strain, in the presence and absence of mucAB gene. Paradoxically, the frequency of methylglyoxal-induced TGGC frameshifts was higher in the wild-type strain than in the NER-deficient strains. When the methylglyoxal-induced mutation spectra in the presence and absence of mucAB gene are compared, the ratios of base-pair substitutions to frameshifts were increased by the effects of mucAB gene. In the three strains, more than 75% of the base-pair substitutions occurred at G:C sites, independent of the mucAB gene. When the mucAB gene was present, G:C-->T:A transversions were predominant, followed by G:C-->A:T transitions. When the mucAB gene was absent, the predominant mutations differed in the three strains: in the wild-type and uvrC strains, G:C-->A:T transitions were predominant, followed by G:C-->T:A transversions, while in the uvrA strains, G:C-->T:A transversions were predominant, followed by G:C-->A:T transitions. These results suggest that NER may be involved in both the repair and the fixation of methylglyoxal-induced mutations.

  19. Sequence dependence of base-pair stacking in right-handed DNA in solution: proton nuclear Overhauser effect NMR measurements.

    PubMed Central

    Patel, D J; Kozlowski, S A; Bhatt, R

    1983-01-01

    Single-crystal x-ray studies of d(C-G-C-G-A-A-T-T-C-G-C-G) exhibit base-pair propeller twisting [Dickerson, R. E. & Drew, H. R. (1981) J. Mol. Biol. 149, 761-786] that results in close contacts between adjacent purines in the minor groove in pyrimidine (3'-5')-purine steps and in the major groove in purine (3'-5')-pyrimidine steps [Calladine, C. R. (1982) J. Mol. Biol. 161, 343-362]. These observations require an approximately 3.4 A separation between the minor groove edges of adenosines on adjacent base pairs for the dA-dA step but predict a smaller separation for the dT-dA step and a larger separation for the dA-dT step in a D(A-T-T-A).d(T-A-A-T) fragment. We have confirmed these predictions from steady-state nuclear Overhauser effect measurements between assigned minor groove adenosine H-2 protons on adjacent base pairs in the proton NMR spectrum of the d(C1-G2-A3-T4-T5-A6-T6-A5-A4-T3-C2-G1) self-complementary dodecanucleotide duplex (henceforth called the Pribnow 12-mer) in solution. The measured cross-relaxation rates (product of steady-state nuclear Overhauser effect and selective spin- lattice relaxation rates) translate to interproton separations between adjacent adenosine H-2 protons of 4.22 A in the (dA3-dT4).(dA4-dT3) step, of 3.56 A in the (dT4-dT5).dA5-dA4) step, and of 3.17 A in the (dT5-dA6).(dT6-dA5) step for the Pribnow 12-mer duplex with an isotropic rotational correlation time of 9 ns at 5 degrees C. These proton NMR results show that the sequence-dependent base-pair stacking resulting from base-pair propeller twisting of defined handedness for right-handed DNA in the solid state is maintained in aqueous solution. PMID:6575384

  20. An innate twist between Crick's wobble and Watson-Crick base pairs.

    PubMed

    Ananth, Prakash; Goldsmith, Gunaseelan; Yathindra, Narayanarao

    2013-08-01

    Non-Watson-Crick pairs like the G·U wobble are frequent in RNA duplexes. Their geometric dissimilarity (nonisostericity) with the Watson-Crick base pairs and among themselves imparts structural variations decisive for biological functions. Through a novel circular representation of base pairs, a simple and general metric scheme for quantification of base-pair nonisostericity, in terms of residual twist and radial difference that can also envisage its mechanistic effect, is proposed. The scheme is exemplified by G·U and U·G wobble pairs, and their predicable local effects on helical twist angle are validated by MD simulations. New insights into a possible rationale for contextual occurrence of G·U and other non-WC pairs, as well as the influence of a G·U pair on other non-Watson-Crick pair neighborhood and RNA-protein interactions are obtained from analysis of crystal structure data. A few instances of RNA-protein interactions along the major groove are documented in addition to the well-recognized interaction of the G·U pair along the minor groove. The nonisostericity-mediated influence of wobble pairs for facilitating helical packing through long-range interactions in ribosomal RNAs is also reviewed.

  1. An innate twist between Crick’s wobble and Watson-Crick base pairs

    PubMed Central

    Ananth, Prakash; Goldsmith, Gunaseelan; Yathindra, Narayanarao

    2013-01-01

    Non-Watson-Crick pairs like the G·U wobble are frequent in RNA duplexes. Their geometric dissimilarity (nonisostericity) with the Watson-Crick base pairs and among themselves imparts structural variations decisive for biological functions. Through a novel circular representation of base pairs, a simple and general metric scheme for quantification of base-pair nonisostericity, in terms of residual twist and radial difference that can also envisage its mechanistic effect, is proposed. The scheme is exemplified by G·U and U·G wobble pairs, and their predicable local effects on helical twist angle are validated by MD simulations. New insights into a possible rationale for contextual occurrence of G·U and other non-WC pairs, as well as the influence of a G·U pair on other non-Watson-Crick pair neighborhood and RNA-protein interactions are obtained from analysis of crystal structure data. A few instances of RNA-protein interactions along the major groove are documented in addition to the well-recognized interaction of the G·U pair along the minor groove. The nonisostericity-mediated influence of wobble pairs for facilitating helical packing through long-range interactions in ribosomal RNAs is also reviewed. PMID:23861536

  2. DNA terminal base pairs have weaker hydrogen bonds especially for AT under low salt concentration

    NASA Astrophysics Data System (ADS)

    Ferreira, Izabela; Amarante, Tauanne D.; Weber, Gerald

    2015-11-01

    DNA base pairs are known to open more easily at the helix terminal, a process usually called end fraying, the details of which are still poorly understood. Here, we present a mesoscopic model calculation based on available experimental data where we consider separately the terminal base pairs of a DNA duplex. Our results show an important reduction of hydrogen bond strength for terminal cytosine-guanine (CG) base pairs which is uniform over the whole range of salt concentrations, while for AT base pairs, we obtain a nearly 1/3 reduction but only at low salt concentrations. At higher salt concentrations, terminal adenine-thymine (AT) pair has almost the same hydrogen bond strength than interior bases. The calculated terminal stacking interaction parameters display some peculiarly contrasting behavior. While there is mostly no perceptible difference to internal stacking, for some cases, we observe an unusually strong dependence with salt concentration which does not appear follow any pattern or trend.

  3. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  4. Development of artificial nucleic acid that recognizes a CG base pair in triplex DNA formation.

    PubMed

    Hari, Yoshiyuki

    2013-01-01

    An oligonucleotide that can form a triplex with double-stranded DNA is called a triplex-forming oligonucleotide (TFO). TFOs have gained considerable attention because of their potential as gene targeting tools. However, triplex DNA formation involves inherent problems for practical use. The most important problem is that natural nucleotides in TFO do not have sufficient affinity and base pair-selectivity to pyrimidine-purine base pair, like a CG or TA base pair, within dsDNA. This suggests that dsDNA region including a CG or TA base pair cannot be targeted. Therefore, artificial nucleotides, especially with non-natural nucleobases, capable of direct recognition of a CG or TA base pair via hydrogen bond formation have been developed; however, nucleotides with better selectivity and stronger affinity are necessary for implementing this dsDNA-targeting technology using TFOs. Under such a background, we considered that facile and efficient synthesis of various nucleobase derivatives in TFOs would be useful for finding an ideal nucleobase for recognition of a CG or TA base pair because detailed and rational exploration of nucleobase structures is facilitated. Recently, to develop a nucleobase recognizing a CG base pair, we have used post-elongation modification, i.e., modification after oligonucleotide synthesis, for the facile synthesis of nucleobase derivatives. This review mainly summarizes our recent findings on the development of artificial nucleobases and nucleotides for recognition of a CG base pair in triplexes formed between dsDNA and TFOs.

  5. Conducting Task-Based Interviews with Pairs of Children: Consensus, Conflict, Knowledge Construction and Turn Taking

    ERIC Educational Resources Information Center

    Houssart, Jenny; Evens, Hilary

    2011-01-01

    This article explores theoretical and methodological issues associated with task-based interviews conducted with pairs of children. We explore different approaches to interviews from sociological, psychological and subject-based perspectives. Our interviews, concerning mathematical questions and carried out with pairs of 10 and 11-year-olds, are…

  6. Base-pairing selectivity of a ureido-linked phenyl-2'-deoxycytidine derivative.

    PubMed

    Nakano, Shu-ichi; Oka, Hirohito; Yamaguchi, Daisuke; Fujii, Masayuki; Sugimoto, Naoki

    2012-12-28

    Incorporation of modified nucleotides into nucleic acid strands often produces conformational constraints and steric hindrances that may change the property of base pairing. In this study, we investigated a 2'-deoxycytidine derivative that tethers a phenyl moiety to the exocyclic amino group of cytosine linked through a ureido group. This derivative compound is structurally similar to the carbamoylated DNA base lesions produced in cells. The thermodynamic and structural studies showed that the modified dC formed the base pair with dG in the complementary strand, but the base-pairing selectivity toward dG was decreased under poly(ethylene glycol)-mediated osmotic stress. The phenyl group and the ureido linker attached to dC provided selectivity for the formation of base pairing exclusively with dG in a wide range of pH conditions, whereas unmodified dC stabilized the pairings with dA or dC in acidic solutions. Moreover, this modified base could not form self-pairing through intermolecular hydrogen bonds. We suggest that formation of weak pairing and protonation of the cytosine base are hindered due to the base modification. These data provide insights into the pairing selectivity of carbamoylated cytosine lesions produced in cells, and suggest applications of the 2'-deoxycytidine derivatives in medical technologies, molecular biology experiments, and synthesis of a supramolecular network of DNA strands.

  7. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  8. Conducting Task-Based Interviews with Pairs of Children: Consensus, Conflict, Knowledge Construction and Turn Taking

    ERIC Educational Resources Information Center

    Houssart, Jenny; Evens, Hilary

    2011-01-01

    This article explores theoretical and methodological issues associated with task-based interviews conducted with pairs of children. We explore different approaches to interviews from sociological, psychological and subject-based perspectives. Our interviews, concerning mathematical questions and carried out with pairs of 10 and 11-year-olds, are…

  9. Structural landscape of base pairs containing post-transcriptional modifications in RNA.

    PubMed

    Seelam, Preethi P; Sharma, Purshotam; Mitra, Abhijit

    2017-06-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. © 2017 Seelam et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

  11. Sequence dependency of canonical base pair opening in the DNA double helix.

    PubMed

    Lindahl, Viveca; Villa, Alessandra; Hess, Berk

    2017-04-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair.

  12. Theory of tunneling across hydrogen-bonded base pairs for DNA recognition and sequencing

    NASA Astrophysics Data System (ADS)

    Lee, Myeong H.; Sankey, Otto F.

    2009-05-01

    We present the results of first-principles calculations for the electron tunnel current through hydrogen-bonded DNA base pairs and for (deoxy)nucleoside-nucleobase pairs. Electron current signals either through a base pair or through a deoxynucleoside-nucleobase pair are a potential mechanism for recognition or identification of the DNA base on a single-stranded DNA polymer. Four hydrogen-bonded complexes are considered: guanine-cytosine, diaminoadenine-thymine, adenine-thymine, and guanine-thymine. First, the electron tunneling properties are examined through their complex band structure (CBS) and the metal contact’s Fermi-level alignment. For gold contacts, the metal Fermi level lies near the highest occupied molecular orbital for all DNA base pairs. The decay constant determined by the complex band structure at the gold Fermi level shows that tunnel current decays more slowly for base pairs with three hydrogen bonds (guanine-cytosine and diaminoadenine-thymine) than for base pairs with two hydrogen bonds (adenine-thymine and guanine-thymine). The decay length and its dependence on hydrogen-bond length are examined. Second, the conductance is computed using density functional theory Green’s-function scattering methods and these results agree with estimates made from the tunneling decay constant obtained from the CBS. Changing from a base pair to a deoxynucleoside-nucleobase complex shows a significant decrease in conductance. It also becomes difficult to distinguish the current signal by only the number of hydrogen bonds.

  13. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events.

  14. Theoretical and experimental study of charge transfer through DNA: impact of mercury mediated T-Hg-T base pair.

    PubMed

    Kratochvílová, Irena; Golan, Martin; Vala, Martin; Špérová, Miroslava; Weiter, Martin; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír; Tanaka, Yoshiyuki; Bickelhaupt, F Matthias

    2014-05-22

    DNA-Hg complexes may play an important role in sensing DNA defects or in detecting the presence of Hg in the environment. A fundamental way of characterizing DNA-Hg complexes is to study the way the electric charge is transferred through the molecular chain. The main goal of this contribution was to investigate the impact of a mercury metal cation that links two thymine bases in a DNA T-T mismatched base pair (T-Hg-T) on charge transfer through the DNA molecule. We compared the charge transfer efficiencies in standard DNA, DNA with mismatched T-T base pairs, and DNA with a T-Hg(II)-T base pair. For this purpose, we measured the temperature dependence of steady-state fluorescence and UV-vis of the DNA molecules. The experimental results were confronted with the results obtained employing theoretical DFT methods. Generally, the efficiency of charge transfer was driven by mercury changing the spatial overlap of bases.

  15. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  16. Structure of the 2-Aminopurine-Cytosine Base Pair Formed in the Polymerase Active Site of the RB69 Y567A-DNA Polymerase

    SciTech Connect

    Reha-Krantz, Linda J.; Hariharan, Chithra; Subuddhi, Usharani; Xia, Shuangluo; Zhao, Chao; Beckman, Jeff; Christian, Thomas; Konigsberg, William

    2011-11-21

    The adenine base analogue 2-aminopurine (2AP) is a potent base substitution mutagen in prokaryotes because of its enhanceed ability to form a mutagenic base pair with an incoming dCTP. Despite more than 50 years of research, the structure of the 2AP-C base pair remains unclear. We report the structure of the 2AP-dCTP base pair formed within the polymerase active site of the RB69 Y567A-DNA polymerase. A modified wobble 2AP-C base pair was detected with one H-bond between N1 of 2AP and a proton from the C4 amino group of cytosine and an apparent bifurcated H-bond between a proton on the 2-amino group of 2-aminopurine and the ring N3 and O2 atoms of cytosine. Interestingly, a primer-terminal region rich in AT base pairs, compared to GC base pairs, facilitated dCTP binding opposite template 2AP. We propose that the increased flexibility of the nucleotide binding pocket formed in the Y567A-DNA polymerase and increased 'breathing' at the primer-terminal junction of A+T-rich DNA facilitate dCTP binding opposite template 2AP. Thus, interactions between DNA polymerase residues with a dynamic primer-terminal junction play a role in determining base selectivity within the polymerase active site of RB69 DNA polymerase.

  17. Canonical Watson-Crick base pair interactions in π* type triplet states

    NASA Astrophysics Data System (ADS)

    Noguera, M.; Blancafort, L.; Sodupe, M.; Bertran, J.

    2006-03-01

    Ground state and triplet π → π* states of canonical Watson-Crick base pairs have been studied at the B3LYP level of theory. Excited states were found to be localized at either of the monomers forming the base pair (guanine, cytosine, adenine and thymine), geometry relaxation of the excited base pair being similar to that occurring in the isolated nucleobase. For thymine and cytosine, triplet π → π* excitation produces a significant elongation of the C5-C6 bond whereas for guanine and adenine there is a significant increase of the N3-C2 bond and pyramidalization of the NH2 group. Adenine-thymine energy pairing remains almost unaffected by triplet excitation. However, for guanine-cytosine, with excitation localized at the guanine moiety, base pairing energy decreases about 5 kcal/mol due to pyramidalization of the amino group of guanine.

  18. Theoretical Studies on the Intermolecular Interactions of Potentially Primordial Base-Pair Analogues

    SciTech Connect

    Leszczynski, Jerzy; Sponer, Judit; Sponer, Jiri; Sumpter, Bobby G; Fuentes-Cabrera, Miguel A; Vazquez-Mayagoitia, Alvaro

    2010-01-01

    Recent experimental studies on the Watson Crick type base pairing of triazine and aminopyrimidine derivatives suggest that acid/base properties of the constituent bases might be related to the duplex stabilities measured in solution. Herein we use high-level quantum chemical calculations and molecular dynamics simulations to evaluate the base pairing and stacking interactions of seven selected base pairs, which are common in that they are stabilized by two NH O hydrogen bonds separated by one NH N hydrogen bond. We show that neither the base pairing nor the base stacking interaction energies correlate with the reported pKa data of the bases and the melting points of the duplexes. This suggests that the experimentally observed correlation between the melting point data of the duplexes and the pKa values of the constituent bases is not rooted in the intrinsic base pairing and stacking properties. The physical chemistry origin of the observed experimental correlation thus remains unexplained and requires further investigations. In addition, since our calculations are carried out with extrapolation to the complete basis set of atomic orbitals and with inclusion of higher electron correlation effects, they provide reference data for stacking and base pairing energies of non-natural bases.

  19. Direct identification of base-paired RNA nucleotides by correlated chemical probing.

    PubMed

    Krokhotin, Andrey; Mustoe, Anthony M; Weeks, Kevin M; Dokholyan, Nikolay V

    2017-01-01

    Many RNA molecules fold into complex secondary and tertiary structures that play critical roles in biological function. Among the best-established methods for examining RNA structure are chemical probing experiments, which can report on local nucleotide structure in a concise and extensible manner. While probing data are highly useful for inferring overall RNA secondary structure, these data do not directly measure through-space base-pairing interactions. We recently introduced an approach for single-molecule correlated chemical probing with dimethyl sulfate (DMS) that measures RNA interaction groups by mutational profiling (RING-MaP). RING-MaP experiments reveal diverse through-space interactions corresponding to both secondary and tertiary structure. Here we develop a framework for using RING-MaP data to directly and robustly identify canonical base pairs in RNA. When applied to three representative RNAs, this framework identified 20%-50% of accepted base pairs with a <10% false discovery rate, allowing detection of 88% of duplexes containing four or more base pairs, including pseudoknotted pairs. We further show that base pairs determined from RING-MaP analysis significantly improve secondary structure modeling. RING-MaP-based correlated chemical probing represents a direct, experimentally concise, and accurate approach for detection of individual base pairs and helices and should greatly facilitate structure modeling for complex RNAs. © 2016 Krokhotin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  20. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  1. A threonine to alanine exchange at position 40 of Tet repressor alters the recognition of the sixth base pair of tet operator from GC to AT.

    PubMed Central

    Altschmied, L; Baumeister, R; Pfleiderer, K; Hillen, W

    1988-01-01

    The tet operators of two naturally evolved tetracycline resistance determinants differ by a G.C to A.T transition at the sixth base pair. This mutation prevents heterologous recognition of these tet operators by their respective two Tet repressor proteins. The amino acid side chains responsible for this sequence-specific distinction of operators were determined. For this purpose in vitro recombinants of the two tetR genes were constructed. Restriction sites were introduced by oligonucleotide-directed mutagenesis in both genes followed by the exchange of different coding segments between them. The encoded chimeric Tet repressor proteins were expressed and their operator recognition specificity was scored in vivo. Exchanging gradually smaller coding segments led finally to a single amino acid exchange in both genes at position 40 of the primary structures. Each Tet repressor containing Thr at this position recognizes the G.C operator while those with Ala recognize the A.T operator regardless of the rest of the sequences. This result demonstrates clearly that the amino acid 40 of Tet repressor contacts and recognizes base pair 6 of tet operator. Sterical interference of the large Thr side chain with the methyl group of A.T and a possible involvement of the hydroxyl in hydrogen bonding to the operator are discussed as the molecular basis of this differentiation between A.T and G.C base pairs. Images PMID:3208760

  2. Self-organised criticality in base-pair breathing in DNA with a defect

    NASA Astrophysics Data System (ADS)

    Duduială, Ciprian-Ionuţ; Wattis, Jonathan A. D.; Laughton, Charles A.

    2011-08-01

    We analyse base-pair breathing in a DNA sequence of 12 base-pairs with a defective base at its centre. We use both all-atom molecular dynamics (MD) simulations and a system of stochastic differential equations (SDEs). In both cases, Fourier analysis of the trajectories reveals self-organised critical behaviour in the breathing of base-pairs. The Fourier Transforms (FTs) of the inter-base distances show power-law behaviour with gradients close to -1. The scale-invariant behaviour we have found provides evidence for the view that base-pair breathing corresponds to the nucleation stage of large-scale DNA opening (or ‘melting’) and that this process is a (second-order) phase transition. Although the random forces in our SDE system were introduced as white noise, FTs of the displacements exhibit pink noise, as do the displacements in the AMBER/MD simulations.

  3. Centromeric Alpha-Satellite DNA Adopts Dimeric i-Motif Structures Capped by AT Hoogsteen Base Pairs.

    PubMed

    Garavís, Miguel; Escaja, Núria; Gabelica, Valérie; Villasante, Alfredo; González, Carlos

    2015-06-26

    Human centromeric alpha-satellite DNA is composed of tandem arrays of two types of 171 bp monomers; type A and type B. The differences between these types are concentrated in a 17 bp region of the monomer called the A/B box. Here, we have determined the solution structure of the C-rich strand of the two main variants of the human alpha-satellite A box. We show that, under acidic conditions, the C-rich strands of two A boxes self-recognize and form a head-to-tail dimeric i-motif stabilized by four intercalated hemi-protonated C:C(+) base pairs. Interestingly, the stack of C:C(+) base pairs is capped by T:T and Hoogsteen A:T base pairs. The two main variants of the A box adopt a similar three-dimensional structure, although the residues involved in the formation of the i-motif core are different in each case. Together with previous studies showing that the B box (known as the CENP-B box) also forms dimeric i-motif structures, our finding of this non-canonical structure in the A box shows that centromeric alpha satellites in all human chromosomes are able to form i-motifs, which consequently raises the possibility that these structures may play a role in the structural organization of the centromere. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Unprecedented dinuclear silver(I)-mediated base pair involving the DNA lesion 1,N(6)-ethenoadenine.

    PubMed

    Mandal, Soham; Hepp, Alexander; Müller, Jens

    2015-02-28

    The DNA lesion 1,N(6)-ethenoadenine (εA) has been investigated with respect to its metal-binding properties. A synthetic DNA duplex comprising an εA : εA mispair readily forms doubly silver(I)-mediated base pairs εA-Ag(I)2-εA, representing the first example for a dinuclear metal-mediated homo base pair of a purine derivative. It also constitutes the first example for a Hoogsteen-type metal-mediated homo base pair within a B-DNA duplex.

  5. A cohesin-based structural platform supporting homologous chromosome pairing in meiosis.

    PubMed

    Ding, Da-Qiao; Haraguchi, Tokuko; Hiraoka, Yasushi

    2016-08-01

    The pairing and recombination of homologous chromosomes during the meiotic prophase is necessary for the accurate segregation of chromosomes in meiosis. However, the mechanism by which homologous chromosomes achieve this pairing has remained an open question. Meiotic cohesins have been shown to affect chromatin compaction; however, the impact of meiotic cohesins on homologous pairing and the fine structures of cohesion-based chromatin remain to be determined. A recent report using live-cell imaging and super-resolution microscopy demonstrated that the lack of meiotic cohesins alters the chromosome axis structures and impairs the pairing of homologous chromosomes. These results suggest that meiotic cohesin-based chromosome axis structures are crucial for the pairing of homologous chromosomes.

  6. Orbital selective pairing and gap structures of iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; Kostin, A.; Davis, J. C. Séamus; Hirschfeld, P. J.

    2017-05-01

    We discuss the influence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation theory via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, as well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.

  7. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  8. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T8X9G10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmCmore » and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  9. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  10. Tolerance of base pair size and shape in postlesion DNA synthesis.

    PubMed

    Gahlon, Hailey L; Schweizer, W Bernd; Sturla, Shana J

    2013-05-01

    The influence of base pair size and shape on the fidelity of DNA polymerase-mediated extension past lesion-containing mispairs was examined. Primer extension analysis was performed with synthetic nucleosides paired opposite the pro-mutagenic DNA lesion O(6)-benzylguanine (O(6)-BnG). These data indicate that the error-prone DNA polymerase IV (Dpo4) inefficiently extended past the larger Peri:O(6)-BnG base pair, and in contrast, error-free extension was observed for the smaller BIM:O(6)-BnG base pair. Steady-state kinetic analysis revealed that Dpo4 catalytic efficiency was strongly influenced by the primer:template base pair. Compared to the C:G pair, a 1.9- and 79,000-fold reduction in Dpo4 efficiency was observed for terminal C:O(6)-BnG and BIM:G base pairs respectively. These results demonstrate the impact of geometrical size and shape on polymerase-mediated mispair extension.

  11. In vitro recognition of DNA base pairs by histones in histone-DNA complexes and reconstituted core particles: an ultraviolet resonance Raman study.

    PubMed Central

    Laigle, A; Chinsky, L; Turpin, P Y; Liquier, J; Taillandier, E

    1982-01-01

    Resonance Raman spectra of complexes between DNA and the four core histones, alone or associated, have been investigated in vitro using excitations at 300 and 257 nm, which give complementary informations about the DNA bases. H2A and H2B fractions recognize the G-C base pairs, while H3 and H4 (arginine rich fractions) recognize the A-T base pairs. The associated fractions form complexes with DNA which yield about the same DNA spectral modifications as the DNA-H4 complexes. This reveals the important role of the arginine rich fractions in the core particle formation and confirms the preferential in vitro assembly of nucleosome cores on A-T rich regions of DNA (25). PMID:7155896

  12. SURVEY AND SUMMARY: The non-Watson–Crick base pairs and their associated isostericity matrices

    PubMed Central

    Leontis, Neocles B.; Stombaugh, Jesse; Westhof, Eric

    2002-01-01

    RNA molecules exhibit complex structures in which a large fraction of the bases engage in non-Watson–Crick base pairing, forming motifs that mediate long-range RNA–RNA interactions and create binding sites for proteins and small molecule ligands. The rapidly growing number of three-dimensional RNA structures at atomic resolution requires that databases contain the annotation of such base pairs. An unambiguous and descriptive nomenclature was proposed recently in which RNA base pairs were classified by the base edges participating in the interaction (Watson–Crick, Hoogsteen/CH or sugar edge) and the orientation of the glycosidic bonds relative to the hydrogen bonds (cis or trans). Twelve basic geometric families were identified and all 12 have been observed in crystal structures. For each base pairing family, we present here the 4 × 4 ‘isostericity matrices’ summarizing the geometric relationships between the 16 pairwise combinations of the four standard bases, A, C, G and U. Whenever available, a representative example of each observed base pair from X-ray crystal structures (3.0 Å resolution or better) is provided or, otherwise, theoretically plausible models. This format makes apparent the recurrent geometric patterns that are observed and helps identify isosteric pairs that co-vary or interchange in sequences of homologous molecules while maintaining conserved three-dimensional motifs. PMID:12177293

  13. Dimension-controlled ion-pairing assemblies based on π-electronic charged species.

    PubMed

    Haketa, Yohei; Maeda, Hiromitsu

    2017-03-07

    This feature article summarizes the recent progress in the study of ion-pairing assemblies based on π-electronic ion pairs, including anion complexes of π-electronic molecules. Recently, ionic self-assembly (or ion-pairing assembly) has been widely investigated and utilized in the fabrication of various functional materials including soft materials, surface morphologies and organic-inorganic hybrid materials. It is significantly important to precisely design and synthesize charged π-electronic systems for obtaining highly organized assemblies, but the development of π-electronic ion pairs with an aim to fabricate soft materials has hardly been examined. This is because in many cases it is difficult to arrange the desired charged species due to their synthetic difficulties. In view of this scenario, tailor-made π-electronic ion pairs consisting of ion complexes of π-electronic molecules and their counterions can be used as the building blocks for ion-pairing assemblies. In particular, dimension-controlled ion-pairing assemblies can be formed based on π-electronic charged species, which have potential for use as functional nanostructured materials. In this feature article, we overview the basic synthetic strategies and recent examples of ion-pairing assemblies comprising π-electronic systems.

  14. Double proton transfer in the isolated and DNA-embedded guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Zoete, Vincent; Meuwly, Markus

    2004-09-01

    The energetics and dynamics of double proton transfer (DPT) is investigated theoretically for the Watson-Crick conformation of the guanine-cytosine (GC) base pair. Using semiempirical density functional theory the isolated and DNA-embedded GC pair is considered. Differences in the energetics and dynamics of DPT thus addresses the question of how relevant studies of isolated base pairs are for the understanding of processes occurring in DNA. Two-dimensional potential energy surfaces involving the transferring hydrogen atoms and the proton donors and acceptors are presented for both systems. The DPT reaction is accompanied by a contraction of the distance between the two bases with virtually identical energetic barriers being 18.8 and 18.7 kcal/mol for the isolated and DNA-embedded system, respectively. However, the transition state for DPT in the DNA-embedded GC pair is offset by 0.1 Å to larger N-H separation compared to the isolated GC pair. Using activated ab initio molecular dynamics, DPT is readily observed for the isolated base pair with a minimal amount of 21.4 kcal/mol of initial average kinetic energy along the DPT normal mode vector. On a time scale of ≈100 fs DPT has occurred and the excess energy is redistributed. For the DNA-embedded GC pair considerably more kinetic energy is required (30.0 kcal/mol) for DPT and the process is completed within one hydrogen vibration. The relevance of studies of isolated base pairs and base pair analogs in regard of reactions or properties involving DNA is discussed.

  15. An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules

    PubMed Central

    Kimoto, Michiko; Kawai, Rie; Mitsui, Tsuneo; Yokoyama, Shigeyuki; Hirao, Ichiro

    2009-01-01

    Toward the expansion of the genetic alphabet, we present an unnatural base pair system for efficient PCR amplification, enabling the site-specific incorporation of extra functional components into DNA. This system can be applied to conventional PCR protocols employing DNA templates containing unnatural bases, natural and unnatural base triphosphates, and a 3′→5′ exonuclease-proficient DNA polymerase. For highly faithful and efficient PCR amplification involving the unnatural base pairing, we identified the natural-base sequences surrounding the unnatural bases in DNA templates by an in vitro selection technique, using a DNA library containing the unnatural base. The system facilitates the site-specific incorporation of a variety of modified unnatural bases, linked with functional groups of interest, into amplified DNA. DNA fragments (0.15 amol) containing the unnatural base pair can be amplified 107-fold by 30 cycles of PCR, with <1% total mutation rate of the unnatural base pair site. Using the system, we demonstrated efficient PCR amplification and functionalization of DNA fragments for the extremely sensitive detection of zeptomol-scale target DNA molecules from mixtures with excess amounts (pmol scale) of foreign DNA species. This unnatural base pair system will be applicable to a wide range of DNA/RNA-based technologies. PMID:19073696

  16. Structure of 2,4-diaminopyrimidine-theobromine alternate base pairs.

    PubMed

    Gengeliczki, Zsolt; Callahan, Michael P; Kabeláč, Martin; Rijs, Anouk M; de Vries, Mattanjah S

    2011-10-20

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  17. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies.

    PubMed

    Chawla, Mohit; Oliva, Romina; Bujnicki, Janusz M; Cavallo, Luigi

    2015-08-18

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. 'modified base pairs'. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson-Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  18. Selective recognition of unnatural imidazopyridopyrimidine:naphthyridine base pairs consisting of four hydrogen bonds by the Klenow fragment.

    PubMed

    Minakawa, Noriaki; Ogata, Shintaro; Takahashi, Mayumi; Matsuda, Akira

    2009-02-11

    In this work, we investigated how thermally stable ImO(N):NaN(O) and ImN(O):NaO(N) pairs are recognized by the Klenow fragment (KF). As a result, these complementary base pairs, especially the ImN(O):NaO(N) pair, were recognized selectively due to the four hydrogen bonds between the nucleobases and the shape complementarity of the Im:Na pair similar to the purine:pyrimidine base pair.

  19. Theory of nodal s ± -wave pairing symmetry in the Pu-based 115 superconductor family.

    PubMed

    Das, Tanmoy; Zhu, Jian-Xin; Graf, Matthias J

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-Tc superconductors and predict the presence of a nodal s(±) wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface "hot-spots" in the inter-band scattering channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s(±) wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.

  20. Effect of Base-Pairing Partner on the Thermodynamic Stability of the Diastereomeric Spiroiminodihydantoin Lesion.

    PubMed

    Gruessner, Brian; Dwarakanath, Megana; Stewart, Elizabeth; Bae, Yoon; Jamieson, Elizabeth R

    2016-03-21

    Oxidation of guanine by reactive oxygen species and high valent metals produces damaging DNA base lesions like 8-oxo-7,8-dihydroguanine (8-oxoG). 8-oxoG can be further oxidized to form the spiroiminodihydantoin (Sp) lesion, which is even more mutagenic. DNA polymerases preferentially incorporate purines opposite the Sp lesion, and DNA glycosylases excise the Sp lesion from the duplex, although the rate of repair is different for the two Sp diastereomers. To further understand the biological processing of the Sp lesion, differential scanning calorimetry studies were performed on a series of 15-mer DNA duplexes. The thermal and thermodynamic stabilities of each of the Sp diastereomers paired to the four standard DNA bases were investigated. It was found that, regardless of the base-pairing partner, the Sp lesion was always highly destabilizing in terms of DNA melting temperature, enthalpic stability, and overall duplex free energy. We found no significant differences between the two Sp diastereomers, but changing the base-pairing partner of the Sp lesion produced slight differences in stability. Specifically, duplexes with Sp:C pairings were always the most destabilized, whereas pairing the Sp lesion with a purine base modestly increased stability. Overall, these results suggest that, although the stability of the Sp diastereomers cannot explain the differences in the rates of repair by DNA glycosylases, the most stable base-pairing partners do correspond with the nucleotide preference of DNA polymerases.

  1. Cytostatic evaluations of nucleoside analogs related to unnatural base pairs for a genetic expansion system.

    PubMed

    Kimoto, Michiko; Moriyama, Kei; Yokoyama, Shigeyuki; Hirao, Ichiro

    2007-10-15

    The introduction of an unnatural base pair into DNA enables the expansion of genetic information. To apply unnatural base pairs to in vivo systems, we evaluated the cytostatic toxicity of several nucleoside analogs by an MTT assay. Several nucleoside analogs based on two types of unnatural base pairs were tested. One is a hydrogen-bonded base pair between 2-amino-6-(2-thienyl)purine (s) and pyridin-2-one (y), and the other is a hydrophobic base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and pyrrole-2-carbaldehyde (Pa). Among the nucleoside analogs, the ribonucleoside of 6-(2-thienyl)purine possessed the highest cytostatic activity against CCRF-CEM and especially HT-1080, as well as the normal fibroblast cell line, WI-38. The other analogs, including its 2'-deoxy, 2-amino, and 1-deazapurine nucleoside derivatives, were less active against CCRF-CEM and HT-1080, and the toxicity of these nucleosides toward WI-38 was low. The nucleosides of y and Pa were inactive against CCRF-CEM, HT-1080, and WI-38. In addition, no cytostatic synergism was observed with the combination of the pairing nucleosides of s and y or Ds and Pa.

  2. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  3. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  4. Base pair opening in a deoxynucleotide duplex containing a cis-syn thymine cyclobutane dimer lesion.

    PubMed

    Wenke, Belinda B; Huiting, Leah N; Frankel, Elisa B; Lane, Benjamin F; Núñez, Megan E

    2013-12-23

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair K(op). In the normal duplex K(op) decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a K(op) of 8 × 10⁻⁷. In contrast, base pair opening at the 5'T of the thymine dimer is facile. The 5'T of the dimer has the largest equilibrium constant (K(op) = 3 × 10⁻⁴) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3'T of the dimer is much more stable than by the 5'T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5' side more than on the 3' side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions.

  5. Fluorescent Protein Based FRET Pairs with Improved Dynamic Range for Fluorescence Lifetime Measurements

    PubMed Central

    George Abraham, Bobin; Sarkisyan, Karen S.; Mishin, Alexander S.; Santala, Ville; Tkachenko, Nikolai V.; Karp, Matti

    2015-01-01

    Fluorescence Resonance Energy Transfer (FRET) using fluorescent protein variants is widely used to study biochemical processes in living cells. FRET detection by fluorescence lifetime measurements is the most direct and robust method to measure FRET. The traditional cyan-yellow fluorescent protein based FRET pairs are getting replaced by green-red fluorescent protein variants. The green-red pair enables excitation at a longer wavelength which reduces cellular autofluorescence and phototoxicity while monitoring FRET. Despite the advances in FRET based sensors, the low FRET efficiency and dynamic range still complicates their use in cell biology and high throughput screening. In this paper, we utilized the higher lifetime of NowGFP and screened red fluorescent protein variants to develop FRET pairs with high dynamic range and FRET efficiency. The FRET variations were analyzed by proteolytic activity and detected by steady-state and time-resolved measurements. Based on the results, NowGFP-tdTomato and NowGFP-mRuby2 have shown high potentials as FRET pairs with large fluorescence lifetime dynamic range. The in vitro measurements revealed that the NowGFP-tdTomato has the highest Förster radius for any fluorescent protein based FRET pairs yet used in biological studies. The developed FRET pairs will be useful for designing FRET based sensors and studies employing Fluorescence Lifetime Imaging Microscopy (FLIM). PMID:26237400

  6. The essential role of stacking adenines in a two-base-pair RNA kissing complex.

    PubMed

    Stephenson, William; Asare-Okai, Papa Nii; Chen, Alan A; Keller, Sean; Santiago, Rachel; Tenenbaum, Scott A; Garcia, Angel E; Fabris, Daniele; Li, Pan T X

    2013-04-17

    In minimal RNA kissing complexes formed between hairpins with cognate GACG tetraloops, the two tertiary GC pairs are likely stabilized by the stacking of 5'-unpaired adenines at each end of the short helix. To test this hypothesis, we mutated the flanking adenines to various nucleosides and examined their effects on the kissing interaction. Electrospray ionization mass spectrometry was used to detect kissing dimers in a multiequilibria mixture, whereas optical tweezers were applied to monitor the (un)folding trajectories of single RNA molecules. The experimental findings were rationalized by molecular dynamics simulations. Together, the results showed that the stacked adenines are indispensable for the tertiary interaction. By shielding the tertiary base pairs from solvent and reducing their fraying, the stacked adenines made terminal pairs act more like interior base pairs. The purine double-ring of adenine was essential for effective stacking, whereas additional functional groups modulated the stabilizing effects through varying hydrophobic and electrostatic forces. Furthermore, formation of the kissing complex was dominated by base pairing, whereas its dissociation was significantly influenced by the flanking bases. Together, these findings indicate that unpaired flanking nucleotides play essential roles in the formation of otherwise unstable two-base-pair RNA tertiary interactions.

  7. The Essential Role of stacking adenines in a Two-Base-Pair RNA Kissing Complex

    PubMed Central

    Stephenson, William; Asare-Okai, Papa Nii; Chen, Alan A.; Keller, Sean; Santiago, Rachel; Tenenbaum, Scott; Garcia, Angel E.; Fabris, Daniele; Li, Pan T.X.

    2013-01-01

    In minimal RNA kissing complexes formed between hairpins with cognate GACG tetraloops, the two tertiary GC pairs are likely stabilized by the stacking of 5’-unpaired adenines at each end of the short helix. To test this hypothesis, we mutated the flanking adenines to various nucleosides and examined their effects on the kissing interaction. Electrospray ionization mass spectrometry was used to detect kissing dimers in a multi-equilibria mixture, whereas optical tweezers were applied to monitor the (un)folding trajectories of single RNA molecules. The experimental findings were rationalized by molecular dynamics simulations. Together, the results showed that the stacked adenines are indispensable for the tertiary interaction. By shielding the tertiary base pairs from solvent and reducing their fraying, the stacked adenines made terminal pairs act more like interior base pairs. The purine double-ring of adenine was essential for effective stacking, whereas additional functional groups modulated the stabilizing effects through varying hydrophobic and electrostatic forces. Furthermore, formation of the kissing complex was dominated by base pairing, whereas its dissociation was significantly influenced by the flanking bases. Together, these findings indicate that unpaired flanking nucleotides play essential roles in the formation of otherwise unstable two-base-pair RNA tertiary interactions. PMID:23517345

  8. Strong Versus Weak Coupling Pairing in Iron-Based Superconductors

    NASA Astrophysics Data System (ADS)

    Bernevig, B. Andrei

    2012-02-01

    We use the functional renormalization group as well as strong-coupling methods to analyze the phase diagram of several of the iron-based superconductors. As in the previous studies by F. Wang, D.H. Lee et. al., we observe a nodeless sign-changing order parameter to be favored over a sizable part of the parameter space, but the physics quickly develops peculiarities depending on the doping, shape, size and orbital content of the Fermi surfaces in the different superconducting compounds. Using several new one-body models available in the literature (due to Kuroki, Graser and Raghu), we analyze the orbital content of the superconducting gap, which should be observable in spin-polarized ARPES experiments. We find that the effective theory of the Iron-based superconductors is a J1-J2 model in orbital space with J2> |J1| and antiferromagnetic, and analyze the behavior of the physical properties such as superconducting gap for systems ranging from electron overdoped (K, Cs)Fe2?xSex to hole-doped KxBa1-xFe2As2.

  9. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    NASA Astrophysics Data System (ADS)

    Chang, Shuai; He, Jin; Lin, Lisha; Zhang, Peiming; Liang, Feng; Young, Michael; Huang, Shuo; Lindsay, Stuart

    2009-05-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  10. Tunnel Conductance of Watson-Crick Nucleoside-Base Pairs from Telegraph Noise

    PubMed Central

    Chang, Shuai; He, Jin; Lin, Lisha; Zhang, Peiming; Liang, Feng; Young, Michael; Huang, Shuo; Lindsay, Stuart

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base-pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break. PMID:19420603

  11. Entanglement and sources of magnetic anisotropy in radical pair-based avian magnetoreceptors.

    PubMed

    Hogben, Hannah J; Biskup, Till; Hore, P J

    2012-11-30

    One of the principal models of magnetic sensing in migratory birds rests on the quantum spin dynamics of transient radical pairs created photochemically in ocular cryptochrome proteins. We consider here the role of electron spin entanglement and coherence in determining the sensitivity of a radical pair-based geomagnetic compass and the origins of the directional response. It emerges that the anisotropy of radical pairs formed from spin-polarized molecular triplets could form the basis of a more sensitive compass sensor than one founded on the conventional hyperfine-anisotropy model. This property offers new and more flexible opportunities for the design of biologically inspired magnetic compass sensors.

  12. Entanglement and Sources of Magnetic Anisotropy in Radical Pair-Based Avian Magnetoreceptors

    NASA Astrophysics Data System (ADS)

    Hogben, Hannah J.; Biskup, Till; Hore, P. J.

    2012-11-01

    One of the principal models of magnetic sensing in migratory birds rests on the quantum spin dynamics of transient radical pairs created photochemically in ocular cryptochrome proteins. We consider here the role of electron spin entanglement and coherence in determining the sensitivity of a radical pair-based geomagnetic compass and the origins of the directional response. It emerges that the anisotropy of radical pairs formed from spin-polarized molecular triplets could form the basis of a more sensitive compass sensor than one founded on the conventional hyperfine-anisotropy model. This property offers new and more flexible opportunities for the design of biologically inspired magnetic compass sensors.

  13. Protein-protein interaction interface residue pair prediction based on deep learning architecture.

    PubMed

    Zhao, Zhenni; Gong, Xinqi

    2017-05-19

    Proteins usually fulfill their biological functions by interacting with other proteins. Although some methods have been developed to predict the binding sites of a monomer protein, these are not sufficient for prediction of the interaction between two monomer proteins. The correct prediction of interface residue pairs from two monomer proteins is still an open question and has great significance for practical experimental applications in the life sciences. We hope to build a method for the prediction of interface residue pairs that is suitable for those applications. Here, we developed a novel deep network architecture called the multi-layered Long-Short Term Memory networks (LSTMs) approach for the prediction of protein interface residue pairs. Firstly, we created three new descriptions and used other six worked characterizations to describe an amino acid, then we employed these features to discriminate between interface residue pairs and non-interface residue pairs. Secondly, we used two thresholds to select residue pairs that are more likely to be interface residue pairs. Furthermore, this step increases the proportion of interface residue pairs and reduces the influence of imbalanced data. Thirdly, we built deep network architectures based on Long-Short Term Memory networks algorithm to organize and refine the prediction of interface residue pairs by employing features mentioned above. We trained the deep networks on dimers in the unbound state in the international Protein-protein Docking Benchmark version 3.0. The updated data sets in the versions 4.0 and 5.0 were used as the validation set and test set respectively. For our best model, the accuracy rate was over 62% when we chose the top 0.2% pairs of every dimer in the test set as predictions, which will be very helpful for the understanding of protein-protein interaction mechanisms and for guidance in biological experiments.

  14. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  15. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.

  16. Pairing of isolated nucleic-acid bases in the absence of the DNA backbone

    NASA Astrophysics Data System (ADS)

    Nir, Eyal; Kleinermanns, Karl; de Vries, Mattanjah S.

    2000-12-01

    The two intertwined strands of DNA are held together through base pairing-the formation of hydrogen bonds between bases located opposite each other on the two strands. DNA replication and transcription involve the breaking and re-forming of these hydrogen bonds, but it is difficult to probe these processes directly. For example, conventional DNA spectroscopy is dominated by solvent interactions, crystal modes and collective modes of the DNA backbone; gas-phase studies, in contrast, can in principle measure interactions between individual molecules in the absence of external effects, but require the vaporization of the interacting species without thermal degradation. Here we report the generation of gas-phase complexes comprising paired bases, and the spectroscopic characterization of the hydrogen bonding in isolated guanine-cytosine (G-C) and guanine-guanine (G-G) base pairs. We find that the gas-phase G-C base pair adopts a single configuration, which may be Watson-Crick, whereas G-G exists in two different configurations, and we see evidence for proton transfer in the G-C pair, an important step in radiation-induced DNA damage pathways. Interactions between different bases and between bases and water molecules can also be characterized by our approach, providing stringent tests for high-level ab initio computations that aim to elucidate the fundamental aspects of nucleotide interactions.

  17. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    PubMed Central

    Chawla, Mohit; Oliva, Romina; Bujnicki, Janusz M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in. PMID:26117545

  18. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry

    PubMed Central

    Betz, Karin; Malyshev, Denis A.; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J.; Ordoukhanian, Phillip; Romesberg, Floyd E.; Marx, Andreas

    2013-01-01

    Many candidate unnatural DNA base pairs have been developed, but surprisingly, some of the best replicated adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replicating one of the more promising pairs, dNaM-d5SICS, and show that efficient replication results from the polymerase itself inducing the required natural-like structure. PMID:22660438

  19. Design and reactions of a carbon Lewis base/boron Lewis acid frustrated Lewis pair.

    PubMed

    Möricke, Jennifer; Wibbeling, Birgit; Daniliuc, Constantin G; Kehr, Gerald; Erker, Gerhard

    2017-08-28

    The conjugated dienamine 4 selectively adds Piers' borane [HB(C6F5)2] to give the enamine/borane system 5, which features a boratirane structure by internal enamine carbon Lewis base to boron Lewis acid interaction. Compound 5 behaves as a C/B frustrated Lewis pair and undergoes typical addition reactions to benzaldehyde, several nitriles and to sulfur dioxide.This article is part of the themed issue 'Frustrated Lewis pair chemistry'. © 2017 The Author(s).

  20. O⁶-carboxymethylguanine in DNA forms a sequence context-dependent wobble base-pair structure with thymine.

    PubMed

    Zhang, Fang; Tsunoda, Masaru; Kikuchi, Yuji; Wilkinson, Oliver; Millington, Christopher L; Margison, Geoffrey P; Williams, David M; Takénaka, Akio

    2014-06-01

    N-Nitrosation of glycine and its derivatives generates potent alkylating agents that can lead to the formation of O(6)-carboxymethylguanine (O(6)-CMG) in DNA. O(6)-CMG has been identified in DNA derived from human colon tissue and its occurrence has been linked to diets high in red and processed meats, implying an association with the induction of colorectal cancer. By analogy to O(6)-methylguanine, O(6)-CMG is expected to be mutagenic, inducing G-to-A mutations that may be the molecular basis of increased cancer risk. Previously, the crystal structure of the DNA dodecamer d(CGCG[O(6)-CMG]ATTCGCG) has been reported, in which O(6)-CMG forms a Watson-Crick-type pair with thymine similar to the canonical A:T pair. In order to further investigate the versatility of O(6)-CMG in base-pair formation, the structure of the DNA dodecamer d(CGC[O(6)-CMG]AATTTGCG) containing O(6)-CMG at a different position has been determined by X-ray crystallography using four crystal forms obtained under conditions containing different solvent ions (Sr(2+), Ba(2+), Mg(2+), K(+) or Na(+)) with and without Hoechst 33258. The most striking finding is that the pairing modes of O(6)-CMG with T are quite different from those previously reported. In the present dodecamer, the T bases are displaced (wobbled) into the major groove to form a hydrogen bond between the thymine N(3) N-H and the carboxyl group of O(6)-CMG. In addition, a water molecule is bridged through two hydrogen bonds between the thymine O(2) atom and the 2-amino group of O(6)-CMG to stabilize the pairing. These interaction modes commonly occur in the four crystal forms, regardless of the differences in crystallization conditions. The previous and the present results show that O(6)-CMG can form a base pair with T in two alternative modes: the Watson-Crick type and a high-wobble type, the nature of which may depend on the DNA-sequence context.

  1. Theoretical investigation on DNA/RNA base pairs mediated by copper, silver, and gold cations.

    PubMed

    Marino, Tiziana; Russo, Nino; Toscano, Marirosa; Pavelka, Matej

    2012-02-14

    B3LYP density functional based computations were performed in order to characterize the interactions present in some Cu(+), Ag(+), and Au(+) metal ion-mediated DNA and RNA base pairs from both structural and electronic points of view. Examined systems involve as ligands canonical Watson-Crick, Hoogsteen and Wobble base pairs. Two artificial Hoogsteen base pairs were also taken into account. Binding energy values indicate that complexes involving silver cations are less stable than those in which copper or gold are present, and propose a similar behaviour for these two latter ions. The nature of the bond linking metal ions and bases was described by the NBO analysis that suggests metal coordinative interactions to be covalent. An evaluation of the dispersion contributions for the investigated systems was performed with the B3LYP-D3 functional.

  2. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey

    PubMed Central

    Zhou, Huiqing; Hintze, Bradley J.; Kimsey, Isaac J.; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson–Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1′–C1′ distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1′–C1′ distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5′-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. PMID:25813047

  3. Solution structure, mechanism of replication, and optimization of an unnatural base pair.

    PubMed

    Malyshev, Denis A; Pfaff, Danielle A; Ippoliti, Shannon I; Hwang, Gil Tae; Dwyer, Tammy J; Romesberg, Floyd E

    2010-11-08

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventual in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs and evaluated their replication in DNA. Collectively, the results have led us to propose that these base pairs, which lack stabilizing edge-on interactions, are replicated by means of a unique intercalative mechanism. Here, we report the synthesis and characterization of three novel derivatives of the nucleotide analogue dMMO2, which forms an unnatural base pair with the nucleotide analogue d5SICS. Replacing the para-methyl substituent of dMMO2 with an annulated furan ring (yielding dFMO) has a dramatically negative effect on replication, while replacing it with a methoxy (dDMO) or with a thiomethyl group (dTMO) improves replication in both steady-state assays and during PCR amplification. Thus, dTMO-d5SICS, and especially dDMO-d5SICS, represent significant progress toward the expansion of the genetic alphabet. To elucidate the structure-activity relationships governing unnatural base pair replication, we determined the solution structure of duplex DNA containing the parental dMMO2-d5SICS pair, and also used this structure to generate models of the derivative base pairs. The results strongly support the intercalative mechanism of replication, reveal a surprisingly high level of specificity that may be achieved by optimizing packing interactions, and should prove invaluable for the further optimization of the unnatural base pair.

  4. 2-Methoxypyridine as Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-08-31

    Development of nucleic acid base pair analogues that use new modes of molecular recognition is important for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme could enhance the thermal stability of DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability by ~10 ºC in DNA-DNA duplexes and ~20 ºC in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The consequences of base pair composition biases for regulatory network organization in prokaryotes.

    PubMed

    Cordero, Otto X; Hogeweg, Paulien

    2009-10-01

    Given the dramatic variation in guanine-cytosine (GC) content observed in prokaryotes, from approximately 20% to approximately 75% GC, one wonders if these extreme biases in base pair composition affect the evolution of transcription factor-binding sites (BS). This letter shows that, along the wide range of GC content variation in bacteria, bacterial BS keep a high frequency of AT bases, roughly independently of the background (BG) base pair composition of intergenic regions. As a result, the equilibrium base pair frequencies of BS depart the most from those of BS DNA in GC-rich genomes. This not only implies a higher specificity but also a higher coding barrier for BS in GC-rich genomes. In accordance, we observe that the average percentage of divergently transcribed regions increases with the GC content of the genome, suggesting the use of a more efficient coding strategy.

  6. Influence of the absolute configuration of npe-caged cytosine on DNA single base pair stability.

    PubMed

    Steinert, Hannah S; Schäfer, Florian; Jonker, Hendrik R A; Heckel, Alexander; Schwalbe, Harald

    2014-01-20

    Photolabile protecting groups are a versatile tool to trigger reactions by light irradiation. In this study, we have investigated the influence of the absolute configuration of the 1-(2-nitrophenyl)ethyl (NPE) cage group on a 15-base-pair duplex DNA. Using UV melting, we determined the global stability of the unmodified and the selectively (S)- and (R)-NPE-modified DNA sequences, respectively. We observe a differently destabilizing effect for the two NPE stereoisomers on the global stability. Analysis of the temperature dependence of imino proton exchange rates measured by NMR spectroscopy reveals that this effect can be attributed to decreased base pair stabilities of the caged and the 3'-neighbouring base pair, respectively. Furthermore, our NMR based structural models of the modified duplexes provide a structural basis for the distinct effect of the (S)- and the (R)-NPE group. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Subtelomeric regions of yeast chromosomes contain a 36 base-pair tandemly repeated sequence.

    PubMed Central

    Horowitz, H; Haber, J E

    1984-01-01

    We have determined the nucleotide sequence of a region of DNA derived from the end of one chromosome of the yeast, Saccharomyces cerevisiae. Inspection of the sequence reveals the presence of 12 tandem direct repeats, each 36 nucleotides long and having nearly identical sequence. Each 36 base-pair repeat can be further subdivided into three tandem sub-repeats of a similar 12 base-pair sequence. Analysis of total genomic yeast DNA from several strains by Southern hybridization suggests that the number of tandem 36 base-pair repeat units may vary from approximately 8 to 25 among different telomeric regions. Differences in the number of repeats may have arisen by unequal crossing over between them. Furthermore, the finding that the pattern of bases at multiple variable positions within the repeat unit is not random suggests that these regions may undergo gene conversion events that render them homogeneous. Images PMID:6091055

  8. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  9. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  10. Power and sample size calculation for paired recurrent events data based on robust nonparametric tests.

    PubMed

    Su, Pei-Fang; Chung, Chia-Hua; Wang, Yu-Wen; Chi, Yunchan; Chang, Ying-Ju

    2017-05-20

    The purpose of this paper is to develop a formula for calculating the required sample size for paired recurrent events data. The developed formula is based on robust non-parametric tests for comparing the marginal mean function of events between paired samples. This calculation can accommodate the associations among a sequence of paired recurrent event times with a specification of correlated gamma frailty variables for a proportional intensity model. We evaluate the performance of the proposed method with comprehensive simulations including the impacts of paired correlations, homogeneous or nonhomogeneous processes, marginal hazard rates, censoring rate, accrual and follow-up times, as well as the sensitivity analysis for the assumption of the frailty distribution. The use of the formula is also demonstrated using a premature infant study from the neonatal intensive care unit of a tertiary center in southern Taiwan. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Ferrocene-linked thymine/uracil conjugates: base pairing directed self-assembly and supramolecular packing.

    PubMed

    Patwa, Amit N; Gupta, Susmita; Gonnade, Rajesh G; Kumar, Vaijayanti A; Bhadbhade, Mohan M; Ganesh, Krishna N

    2008-02-15

    Ferrocene-linked bis(nucleobase) (1a-c) and chimeric nucleobase (1d) conjugates have been synthesized from mono- and bis(hydroxybutyl)ferrocene 6 via Mitsunobu reaction as the key step. X-ray crystallographic studies of ferrocene bis(nucleobase) conjugates reveal two-dimensional supramolecular organizations of backbones through self-assembled Watson-Crick and reverse Watson-Crick type pairs. Ferrocene-bis(thymine) conjugate self-assembles by reverse Watson-Crick pairing, while the corresponding bis(uracil) conjugate self-assembles by alternating WC and reverse WC type pairing. Such continuous assemblies are not seen in monosubstituted ferrocene nucleobase conjugates which form only planar sheets. The results are interesting from the point of understanding and engineering supramolecular assemblies through rational design of base pairing patterns.

  12. Molecular recognition of T:G mismatched base pairs in DNA as studied by electrospray ionization mass spectrometry.

    PubMed

    Riccardi Sirtori, Federico; Aldini, Giancarlo; Colombo, Maristella; Colombo, Nicoletta; Malyszko, Jan; Vistoli, Giulio; D'Alessio, Roberto

    2012-06-01

    Postreplicative mismatch repair (MMR) is a cellular system involved in the recognition and correction of DNA polymerase errors that escape detection in proofreading. Of the various mismatched bases, T:G pairing in DNA is one of the more common mutations leading to the formation of tumors in humans. In addition, the absence of the MMR system can generate resistance to several chemotherapeutic agents, particularly DNA-damaging substances. The main purpose of this study was the setup and validation of an electrospray ionization (ESI) mass spectrometry method for the identification of small molecules that are able to recognize T:G mismatches in DNA targets. These findings could be useful for the discovery of new antitumor drugs. The analytical method is based on the ability of electrospray to preserve the noncovalent adducts present in solution and transfer them to the gas phase. Lexitropsin derivatives (polyimidazole compounds) have been previously described as selective for T:G mismatch binding by NMR and ITC studies. We synthesized and tested various polyimidazole derivatives, one of which in particular (NMS-057) showed a higher affinity for an oligonucleotide DNA sequence containing a T:G mismatched base pair. To rationalize these findings, molecular docking studies were performed using available NMR structures. Moreover, ESI-MS experiments, performed on an orbitrap mass spectrometer, highlighted the formation of heterodimeric complexes between DNA sequences, distamycin A, and polyimidazole compounds. Our results confirm that this ESI method could be a valuable tool for the identification of new molecules able to specifically recognize T:G mismatched base pairs.

  13. VAMMPIRE: a matched molecular pairs database for structure-based drug design and optimization.

    PubMed

    Weber, Julia; Achenbach, Janosch; Moser, Daniel; Proschak, Ewgenij

    2013-06-27

    Structure-based optimization to improve the affinity of a lead compound is an established approach in drug discovery. Knowledge-based databases holding molecular replacements can be supportive in the optimization process. We introduce a strategy to relate the substitution effect within matched molecular pairs (MMPs) to the atom environment within the cocrystallized protein-ligand complex. Virtually Aligned Matched Molecular Pairs Including Receptor Environment (VAMMPIRE) database and the supplementary web interface ( http://vammpire.pharmchem.uni-frankfurt.de ) provide valuable information for structure-based lead optimization.

  14. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  15. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  16. Base pairing small RNAs and their roles in global regulatory networks

    PubMed Central

    Beisel, Chase L.; Storz, Gisela

    2010-01-01

    Bacteria employ a range of RNA regulators collectively termed small RNAs (sRNAs) to help respond to changes in the environment. Many sRNAs regulate their target mRNAs through limited base pairing interactions. Ongoing characterization of base pairing sRNAs in bacteria has started to reveal how these sRNAs participate in global regulatory networks. These networks can be broken down into smaller regulatory circuits that have characteristic behaviors and functions. In this review, we describe the specific regulatory circuits that incorporate base pairing sRNAs and the importance of each circuit in global regulation. Since most of these circuits were originally identified as network motifs in transcriptional networks, we also discuss why sRNAs may be employed over protein transcription factors to help transduce environmental signals. PMID:20662934

  17. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  18. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  19. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    PubMed

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  20. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  1. Solvent effect on the anharmonic vibrational frequencies in guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Bende, A.; Muntean, C. M.

    2012-02-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by considering the DFT method together with the Polarizable Continuum Model (PCM) using PBE and B3PW91 exchange-correlation functionals and triple-ζ valence basis set. We investigate the importance of anharmonic corrections for the vibrational modes taking into account the solvent effect of the water environment. In particular, the unusual anharmonic effect of the H+ vibration in the case of the Hoogsteen base pair configuration is discussed.

  2. Targeting DNA base pair mismatch with artificial nucleobases. Advances and perspectives in triple helix strategy.

    PubMed

    Malnuit, Vincent; Duca, Maria; Benhida, Rachid

    2011-01-21

    This review, divided into three sections, describes the contribution of the chemists' community to the development and application of triple helix strategy by using artificial nucleic acids, particularly for the recognition of DNA sequences incorporating base pair inversions. Firstly, the development of nucleobases that recognise CG inversion is surveyed followed secondly by specific recognition of TA inverted base pair. Finally, we point out in the last section recent perspectives and applications, driven from knowledge in nucleic acids interactions, in the growing field of nanotechnology and supramolecular chemistry at the border area of physics, chemistry and molecular biology.

  3. Class-paired Fuzzy SubNETs: A paired variant of the rank-based network analysis family for feature selection based on protein complexes.

    PubMed

    Goh, Wilson Wen Bin; Wong, Limsoon

    2017-04-08

    Identifying reproducible yet relevant protein features in proteomics data is a major challenge. Analysis at the level of protein complexes can resolve this issue and we have developed a suite of feature-selection methods collectively referred to as Rank-Based Network Analysis (RBNA). RBNAs differ in their individual statistical test setup but are similar in the sense that they deploy rank-defined weights amongst proteins per sample. This procedure is known as gene fuzzy scoring. Currently, no RBNA exists for paired-sample scenarios where both control and test tissues originate from the same source (e.g. same patient). It is expected that paired tests, when used appropriately, are more powerful than approaches intended for unpaired samples. We report that the class-paired RBNA, PPFSNET, dominates in both simulated and real data scenarios. Moreover, for the first time, we explicitly incorporate batch-effect resistance as an additional evaluation criterion for feature-selection approaches. Batch effects are class irrelevant variations arising from different handlers or processing times, and can obfuscate analysis. We demonstrate that PPFSNET and PFSNET, are particularly resistant against batch effects, and only select features strongly correlated with class but not batch. This article is protected by copyright. All rights reserved.

  4. Discrimination of environmental background noise in presence of speech using sample-pairs statistics based features

    NASA Astrophysics Data System (ADS)

    Jhanwar, D.; Sharma, Kamlesh K.; Modani, S. G.

    2015-09-01

    A methodology to discriminate the different classes of background noise using new features based on samples of the signal is presented here. Two consecutive samples of different amplitude of the discretetime signals are termed as sample-pair and 14 types of sample-pairs are considered here as fundamental features. Results of simulation work proves that count of some of such type of sample-pairs as well as count of few combinations of two, three and four such sample-pairs are useful to detect and discriminate the different acoustic noise mixed with speech signals. On the basis of simulation results, the performance of proposed features have proved better than other spectral features like Mel Frequency Cepstral Coefficients (MFCC), Spectral Centroid, Spectral Flux and Spectral Roll-off regarding discrimination capabilities, simplicity of extraction process and lesser dependency over speech utterances mixed with noise. These sample-pairs based features having advantage of not requiring frame-decomposition and silence period removal. Their discrimination capabilities are shown by Fisher's F-ratio as performance index. The multiclass Support Vector Machine (SVM) is used as a classifier.

  5. Single-molecule derivation of salt dependent base-pair free energies in DNA

    PubMed Central

    Huguet, Josep M.; Bizarro, Cristiano V.; Forns, Núria; Smith, Steven B.; Bustamante, Carlos; Ritort, Felix

    2010-01-01

    Accurate knowledge of the thermodynamic properties of nucleic acids is crucial to predicting their structure and stability. To date most measurements of base-pair free energies in DNA are obtained in thermal denaturation experiments, which depend on several assumptions. Here we report measurements of the DNA base-pair free energies based on a simplified system, the mechanical unzipping of single DNA molecules. By combining experimental data with a physical model and an optimization algorithm for analysis, we measure the 10 unique nearest-neighbor base-pair free energies with 0.1 kcal mol-1 precision over two orders of magnitude of monovalent salt concentration. We find an improved set of standard energy values compared with Unified Oligonucleotide energies and a unique set of 10 base-pair-specific salt-correction values. The latter are found to be strongest for AA/TT and weakest for CC/GG. Our unique energy values and salt corrections improve predictions of DNA unzipping forces and are fully compatible with melting temperatures for oligos. The method should make it possible to obtain free energies, enthalpies, and entropies in conditions not accessible by bulk methodologies. PMID:20716688

  6. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  7. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    PubMed

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  8. A Bayesian-based Method for Particle Track Identification in Low-energy Pair-creation Telescopes

    SciTech Connect

    Zoglauer, Andreas; Andritschke, Robert; Kanbach, Gottfried; Boggs, Steven E.

    2007-07-12

    A critical step during the data analysis of pair creation telescopes is the correct identification of the electron and positron tracks. For MEGA, an electron-tracking Compton and pair telescope optimized for energies up to 50 MeV, we describe a low-energy pair event reconstruction approach partly based on Bayesian statistics.

  9. Unique base-pair breathing dynamics in PNA-DNA hybrids.

    PubMed

    Leijon, M; Sehlstedt, U; Nielsen, P E; Gräslund, A

    1997-08-22

    Kinetic and thermodynamic parameters, derived from 1H-NMR measurements of the imino proton exchange rates upon titration with the exchange catalyst ammonia, are reported for two mixed-sequence peptide nucleic acid (PNA)-DNA hybrids and their counterpart DNA duplex. The exchange times of the imino protons in the PNA strands extrapolate to very short base-pair lifetimes in the limit of infinite exchange catalyst concentration. This is not due to generally less stable base-pairs in PNA-DNA hybrids, since the lifetimes, apparent dissociation constants and thermodynamic stability (DeltaG degrees ) of the innermost DNA guanine imino protons are similar in the hybrid duplexes and in the DNA duplex. In addition, the apparent dissociation constants determined for PNA bases of the hybrids are of the same order as those of the corresponding bases in the DNA duplex. An exchange process from the closed state was found to be inconsistent with the experimental data. From these results, we conclude that opening and closing rates of the PNA guanine and thymine bases are at least two orders of magnitude higher than those of the corresponding bases in the DNA duplex. Unusual kinetics in the hybrids is also evident from the destabilization of the complementary DNA strand thymine bases, which exhibit base-pair dissociation constants increased by approximately two orders of magnitude compared to what is observed in the DNA duplex, while the DNA strand guanine bases are largely unaffected. The general pattern of the base-pair dynamics in the hybrids obtained when using trimethylamine as an exchange catalyst is the same as when using ammonia. However, the long base-pair lifetimes i. e. those of the DNA duplex and the guanine bases of the DNA strands in the hybrids, are approximately three to five times longer than when using ammonia. Thus, all opening events sensed by ammonia are not accessible to trimethylamine. These observations are discussed in regard to the mechanism of base-pair

  10. Synthesis and triplex-forming properties of oligonucleotides capable of recognizing corresponding DNA duplexes containing four base pairs.

    PubMed

    Ohkubo, Akihiro; Yamada, Kenji; Ito, Yu; Yoshimura, Kiichi; Miyauchi, Koichiro; Kanamori, Takashi; Masaki, Yoshiaki; Seio, Kohji; Yuasa, Hideya; Sekine, Mitsuo

    2015-07-13

    A triplex-forming oligonucleotide (TFO) could be a useful molecular tool for gene therapy and specific gene modification. However, unmodified TFOs have two serious drawbacks: low binding affinities and high sequence-dependencies. In this paper, we propose a new strategy that uses a new set of modified nucleobases for four-base recognition of TFOs, and thereby overcome these two drawbacks. TFOs containing a 2'-deoxy-4N-(2-guanidoethyl)-5-methylcytidine (d(g)C) residue for a C-G base pair have higher binding and base recognition abilities than those containing 2'-OMe-4N-(2-guanidoethyl)-5-methylcytidine (2'-OMe (g)C), 2'-OMe-4N-(2-guanidoethyl)-5-methyl-2-thiocytidine (2'-OMe (g)Cs), d(g)C and 4S-(2-guanidoethyl)-4-thiothymidine ((gs)T). Further, we observed that N-acetyl-2,7-diamino-1,8-naphtyridine ((DA)Nac) has a higher binding and base recognition abilities for a T-A base pair compared with that of dG and the other DNA derivatives. On the basis of this knowledge, we successfully synthesized a fully modified TFO containing (DA)Nac, d(g)C, 2'-OMe-2-thiothymidine (2'-OMe (s)T) and 2'-OMe-8-thioxoadenosine (2'-OMe (s)A) with high binding and base recognition abilities. To the best of our knowledge, this is the first report in which a fully modified TFO accurately recognizes a complementary DNA duplex having a mixed sequence under neutral conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    PubMed

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  12. Concealed d-wave pairs in the s± condensate of iron-based superconductors

    PubMed Central

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-01-01

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of s± state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I=2 of the iron orbitals to make a singlet (J=L+I=0), an s± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1−x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J=L+I=4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy. PMID:27140626

  13. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE PAGES

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-02

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s± state containing amore » condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1$-$xKXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  14. Crystal structure studies of RNA duplexes containing s(2)U:A and s(2)U:U base pairs.

    PubMed

    Sheng, Jia; Larsen, Aaron; Heuberger, Benjamin D; Blain, J Craig; Szostak, Jack W

    2014-10-01

    Structural studies of modified nucleobases in RNA duplexes are critical for developing a full understanding of the stability and specificity of RNA base pairing. 2-Thio-uridine (s(2)U) is a modified nucleobase found in certain tRNAs. Thermodynamic studies have evaluated the effects of s(2)U on base pairing in RNA, where it has been shown to stabilize U:A pairs and destabilize U:G wobble pairs. Surprisingly, no high-resolution crystal structures of s(2)U-containing RNA duplexes have yet been reported. We present here two high-resolution crystal structures of heptamer RNA duplexes (5'-uagcs(2)Ucc-3' paired with 3'-aucgAgg-5' and with 3'-aucgUgg-5') containing s(2)U:A and s(2)U:U pairs, respectively. For comparison, we also present the structures of their native counterparts solved under identical conditions. We found that replacing O2 with S2 stabilizes the U:A base pair without any detectable structural perturbation. In contrast, an s(2)U:U base pair is strongly stabilized in one specific U:U pairing conformation out of four observed for the native U:U base pair. This s(2)U:U stabilization appears to be due at least in part to an unexpected sulfur-mediated hydrogen bond. This work provides additional insights into the effects of 2-thio-uridine on RNA base pairing.

  15. Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

    PubMed

    Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

    1999-07-30

    A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

  16. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  17. 6-Pyrazolylpurine as an Artificial Nucleobase for Metal-Mediated Base Pairing in DNA Duplexes

    PubMed Central

    Léon, J. Christian; Sinha, Indranil; Müller, Jens

    2016-01-01

    The artificial nucleobase 6-pyrazol-1-yl-purine (6PP) has been investigated with respect to its usability in metal-mediated base pairing. As was shown by temperature-dependent UV spectroscopy, 6PP may form weakly stabilizing 6PP–Ag(I)–6PP homo base pairs. Interestingly, 6PP can be used to selectively recognize a complementary pyrimidine nucleobase. The addition of Ag(I) to a DNA duplex comprising a central 6PP:C mispair (C = cytosine) leads to a slight destabilization of the duplex. In contrast, a stabilizing 6PP–Ag(I)–T base pair is formed with a complementary thymine (T) residue. It is interesting to note that 6PP is capable of differentiating between the pyrimidine moieties despite the fact that it is not as sterically crowded as 6-(3,5-dimethylpyrazol-1-yl)purine, an artificial nucleobase that had previously been suggested for the recognition of nucleic acid sequences via the formation of a metal-mediated base pair. Hence, the additional methyl groups of 6-(3,5-dimethylpyrazol-1-yl)purine may not be required for the specific recognition of the complementary nucleobase. PMID:27089326

  18. Sequence-specific base pair mimics are efficient topoisomerase IB inhibitors.

    PubMed

    Vekhoff, Pierre; Duca, Maria; Guianvarc'h, Dominique; Benhida, Rachid; Arimondo, Paola B

    2012-01-10

    Topoisomerase IB controls DNA topology by cleaving DNA transiently. This property is used by inhibitors, such as camptothecin, that stabilize, by inhibiting the religation step, the cleavage complex, in which the enzyme is covalently attached to the 3'-phosphate of the cleaved DNA strand. These drugs are used in clinics as antitumor agents. Because three-dimensional structural studies have shown that camptothecin derivatives act as base pair mimics and intercalate between two base pairs in the ternary DNA-topoisomerase-inhibitor complex, we hypothesized that base pairs mimics could act like campthotecin and inhibit the religation reaction after the formation of the topoisomerase I-DNA cleavage complex. We show here that three base pair mimics, nucleobases analogues of the aminophenyl-thiazole family, once targeted specifically to a DNA sequence were potent topoisomerase IB inhibitors. The targeting was achieved through covalent linkage to a sequence-specific DNA ligand, a triplex-forming oligonucleotide, and was necessary to position and keep the nucleobase analogue in the cleavage complex. In the absence of triplex formation, only a weak binding to the DNA and topoisomerase I-mediated DNA cleavage was observed. The three compounds were equally active once conjugated, implying that the intercalation of the nucleobase upon triplex formation is the essential feature for the inhibition activity.

  19. Contextual Resources in Meaning Negotiations of a Student Pair in a Web-Based History Project

    ERIC Educational Resources Information Center

    Arvaja, Maarit

    2007-01-01

    This study examines how one student pair working face-to-face at a computer and engaged in a web-based discussion environment negotiated meanings for their activity and what contextual resources they used in this negotiation process. The aim was also to study how the students themselves interpreted the learning activity. The subjects were two…

  20. Free energy analysis and mechanism of base pair stacking in nicked DNA

    PubMed Central

    Häse, Florian; Zacharias, Martin

    2016-01-01

    The equilibrium of stacked and unstacked base pairs is of central importance for all nucleic acid structure formation processes. The stacking equilibrium is influenced by intramolecular interactions between nucleosides but also by interactions with the solvent. Realistic simulations on nucleic acid structure formation and flexibility require an accurate description of the stacking geometry and stability and its sequence dependence. Free energy simulations have been conducted on a series of double stranded DNA molecules with a central strand break (nick) in one strand. The change in free energy upon unstacking was calculated for all ten possible base pair steps using umbrella sampling along a center-of-mass separation coordinate and including a comparison of different water models. Comparison to experimental studies indicates qualitative agreement of the stability order but a general overestimation of base pair stacking interactions in the simulations. A significant dependence of calculated nucleobase stacking free energies on the employed water model was observed with the tendency of stacking free energies being more accurately reproduced by more complex water models. The simulation studies also suggest a mechanism of stacking/unstacking that involves significant motions perpendicular to the reaction coordinate and indicate that the equilibrium nicked base pair step may slightly differ from regular B-DNA geometry in a sequence-dependent manner. PMID:27407106

  1. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  2. Free energy analysis and mechanism of base pair stacking in nicked DNA.

    PubMed

    Häse, Florian; Zacharias, Martin

    2016-09-06

    The equilibrium of stacked and unstacked base pairs is of central importance for all nucleic acid structure formation processes. The stacking equilibrium is influenced by intramolecular interactions between nucleosides but also by interactions with the solvent. Realistic simulations on nucleic acid structure formation and flexibility require an accurate description of the stacking geometry and stability and its sequence dependence. Free energy simulations have been conducted on a series of double stranded DNA molecules with a central strand break (nick) in one strand. The change in free energy upon unstacking was calculated for all ten possible base pair steps using umbrella sampling along a center-of-mass separation coordinate and including a comparison of different water models. Comparison to experimental studies indicates qualitative agreement of the stability order but a general overestimation of base pair stacking interactions in the simulations. A significant dependence of calculated nucleobase stacking free energies on the employed water model was observed with the tendency of stacking free energies being more accurately reproduced by more complex water models. The simulation studies also suggest a mechanism of stacking/unstacking that involves significant motions perpendicular to the reaction coordinate and indicate that the equilibrium nicked base pair step may slightly differ from regular B-DNA geometry in a sequence-dependent manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Genome filtering using methylation-sensitive restriction enzymes with six-base pair recognition sites

    USDA-ARS?s Scientific Manuscript database

    The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl sensitive restriction enzymes with six base pair recognition sites...

  4. Contextual Resources in Meaning Negotiations of a Student Pair in a Web-Based History Project

    ERIC Educational Resources Information Center

    Arvaja, Maarit

    2007-01-01

    This study examines how one student pair working face-to-face at a computer and engaged in a web-based discussion environment negotiated meanings for their activity and what contextual resources they used in this negotiation process. The aim was also to study how the students themselves interpreted the learning activity. The subjects were two…

  5. Confidence interval construction for proportion ratio in paired studies based on hybrid method.

    PubMed

    Tang, Man-Lai; Li, Hui-Qiong; Tang, Nian-Sheng

    2012-08-01

    In this article, we consider confidence interval construction for proportion ratio in paired samples. Previous studies usually reported that score-based confidence intervals consistently outperformed other asymptotic confidence intervals for correlated proportion difference and ratio. However, score-based confidence intervals may not possess closed-form solutions and iterative procedures are therefore required. This article investigates the problem of confidence interval construction for ratio of two correlated proportions based on a hybrid method. Briefly, the hybrid method simply combines two separate confidence intervals for two individual proportions to produce a hybrid confidence interval for the ratio of the two individual proportions in paired studies. Most importantly, confidence intervals based on this hybrid method possess explicit solutions. Our simulation studies indicate that hybrid Wilson score confidence intervals based on Fieller's theorem performs well. The proposed confidence intervals will be illustrated with three real examples.

  6. Nearest-neighbor parameters for 7-deaza-adenosine·uridine base pairs in RNA duplexes.

    PubMed

    Richardson, Katherine E; Znosko, Brent M

    2016-06-01

    One of the major limitations in RNA structure prediction is the lack of information about the effect of nonstandard nucleotides on stability. The nonstandard nucleotide 7-deaza-adenosine (7DA) is a naturally occurring analog of adenosine that has been studied for medicinal purposes and is commonly referred to as tubercidin. In 7DA, the nitrogen in the 7 position of adenosine is replaced by a carbon. Differences in RNA duplex stability due to the removal of this nitrogen can be attributed to a possible change in hydration and a difference in base stacking interactions resulting from changes in the electrostatics of the ring. In order to determine how 7DA affects the stability of RNA, optical melting experiments were conducted on RNA duplexes that contain either internal or terminal 7DA·U pairs with all possible nearest-neighbor combinations. On average, duplexes containing 7DA·U pairs are 0.43 and 0.07 kcal/mol less stable than what is predicted for the same duplex containing internal and terminal A-U pairs, respectively. Thermodynamic parameters for all nearest-neighbor combinations of 7DA·U pairs were derived from the data. These parameters can be used to more accurately predict the secondary structure and stability of RNA duplexes containing 7DA·U pairs. © 2016 Richardson and Znosko; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. The characteristics of gamma-prime dislocation pairs in a nickel-base superalloy

    NASA Technical Reports Server (NTRS)

    Gabb, T. P.; Miner, R. V.; Welsch, G.

    1987-01-01

    The gamma-prime dislocation pairs of a single crystal nickel-base superalloy, PWA 1480, after tensile and fatigue loading at 650 C are analyzed. The existence and extent of cube cross slip in octahedral slip, and the nature of gamma-prime dislocation pairs in primary cube slip are investigated. It is observed that the PWA 1480 specimens oriented near (001) and (-3 6 10) line directions deform by octahedral slip and specimens oriented near (-1 1 1) and (-2 3 4) lines deform by primary cube slip. It is determined that the overall dislocation distributions are more homogeneous in low cycle fatigue (LCF) loading than in monotonic tensile loading; however, the gamma-prime dislocation pair characteristics are similar for tensile and LCF test specimens. The data reveal that the gamma-prime dislocation pairs of octahedral slip specimens are near-screw and on the cube cross slip plane and for the cube slip specimens, the dislocation pairs are of various characters and on the primary cube slip plane.

  8. Design and development of three-dimensional DNA crystals utilizing CGAA parallel base paired motifs

    NASA Astrophysics Data System (ADS)

    Muser, Stephanie Elizabeth

    Three-dimensional (3D) DNA crystals hold great potential for various applications such as the development of molecular scaffolds for use in protein structure determination by x-ray crystallography. The programmability and predictability of DNA make it a powerful tool for self-assembly but it is hindered by the linearity of the duplex structure. Predictable noncanonical base pairs and motifs have the potential to connect linear double-helical DNA segments into complex 3D structures. The sequence d(GCGAAAGCT) has been observed to form 3D crystals containing both noncanonical parallel pairs and canonical Watson-Crick pairs. This provided a template structure that we used in expanding the design and development of 3D DNA crystals along with exploring the use of predictable noncanonical motifs. The structures we determined contained all but one or two of the designed secondary structure interactions, depending on pH.

  9. Triplet pairing and possible weak topological superconductivity in BiS2-based superconductors

    NASA Astrophysics Data System (ADS)

    Yang, Yang; Wang, Wan-Sheng; Xiang, Yuan-Yuan; Li, Zheng-Zao; Wang, Qiang-Hua

    2013-09-01

    We show that the newly discovered BiS2-based superconductors may have a dominant triplet pairing component in addition to a subdominant singlet component arising from the spin-orbital coupling. The pairing respects time-reversal symmetry. The dominant triplet gap causes gap sign changes between the spin-split Fermi pockets. Within a pocket, the gap function respects dx2-y2*-wave symmetry where the asterisk indicates joint spin-lattice rotations. Below the Lifshitz filling level, the gap is nodeless, and the superconducting state is weak topological. Above the Lifshitz points, the gap becomes nodal. The superconducting pairing and the time-reversal symmetry result from the strong spin-orbital coupling and the ferromagneticlike spin fluctuations. The dx2-y2*-wave gap structure follows from the coexisting antiferromagnetic spin fluctuations. The relevance to experiments is discussed.

  10. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m(5)dCyd: Implications for the Stability of DNA i-Motif Conformations.

    PubMed

    Yang, Bo; Rodgers, M T

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m(5)dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m(5)dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m(5)dCyd)H(+)(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  11. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  12. Participants' evaluation of the project P.A.T.H.S.: are findings based on different datasets consistent?

    PubMed

    Shek, Daniel T L; Sun, Rachel C F

    2012-01-01

    Subjective outcome evaluation findings based on the perspective of the participants of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in nine datasets collected from 2005 to 2009 (n = 206, 313 program participants) were examined in this paper. Based on the consolidated data with schools as units, results showed that the participants generally had positive perceptions of the program, implementers, and benefits of the program. More than four-fifths of the participants regarded the program as beneficial to their holistic development. Multiple regression analysis revealed that the perceived qualities of the program and the program implementers predicted perceived effectiveness of the program. Based on the subjective outcome evaluation findings, the present study provides support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong.

  13. Theory of phase segregation in DNA assemblies containing two different base-pair sequence types

    NASA Astrophysics Data System (ADS)

    (O’ Lee, Dominic J.; Wynveen, Aaron; Kornyshev, Alexei A.

    2017-01-01

    Spontaneous pairing of homologous DNA sequences—a challenging subject in molecular biophysics, often referred to as ‘homology recognition’—has been observed in vitro for several DNA systems. One of these experiments involved liquid crystalline quasi-columnar phases formed by a mixture of two kinds of double stranded DNA oligomer. Both oligomer types were of the same length and identical stoichiometric base-pair composition, but the base-pairs followed a different order. Phase segregation of the two DNA types was observed in the experiments, with the formation of boundaries between domains rich in molecules of one type (order) of base pair sequence. We formulate here a modified ‘X–Y model’ for phase segregation in such assemblies, obtain approximate solutions of the model, compare analytical results to Monte Carlo simulations, and rationalise past experimental observations. This study, furthermore, reveals the factors that affect the degree of segregation. Such information could be used in planning new versions of similar segregation experiments, needed for deepening our understanding of forces that might be involved, e.g., in gene–gene recognition.

  14. Feasibility of occurrence of different types of protonated base pairs in RNA: a quantum chemical study.

    PubMed

    Halder, Antarip; Halder, Sukanya; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2014-09-14

    Protonated nucleobases have significant roles in facilitating catalytic functions of RNA, and in stabilizing different structural motifs. Reported pKa values of nucleobase protonation suggest that the population of neutral nucleobases is 10(3)-10(4) times higher than that of protonated nucleobases under physiological conditions (pH ∼ 7.4). Therefore, a molecular level understanding of various putative roles of protonated nucleobases cannot be achieved without addressing the question of how their occurrence propensities and stabilities are related to the free energy costs associated with the process of protonation under physiological conditions. With water as the proton donor, we use advanced QM methods to evaluate the site specific protonation propensities of nucleobases in terms of their associated free energy changes (ΔGprot). Quantitative follow up on the energetics of base pair formation and database search for evaluating their occurrence frequencies, reveal a lack of correlation between base pair stability and occurrence propensities on the one hand, and ease of protonation on the other. For example, although N7 protonated adenine (ΔGprot = 40.0 kcal mol(-1)) is found to participate in stable base pairing, base pairs involving N7 protonated guanine (ΔGprot = 36.8 kcal mol(-1)), on geometry optimization, converge to a minima where guanine transfers its extra proton to its partner base. Such observations, along with examples of weak base pairs involving N3 protonation of cytosine (ΔGprot = 37.0 kcal mol(-1)) are rationalized by analysing the protonation induced charge redistributions which are found to significantly influence, both positively and negatively, the hydrogen bonding potentials of different functional sites of individual nucleobases. Protonation induced charge redistribution is also found to strongly influence (i) the aromatic character of the rings of the participating bases and (ii) hydrogen bonding potential of the free edges of the

  15. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    PubMed

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions.

  16. Anharmonic and harmonic intermolecular vibrational modes of the DNA base pairs

    NASA Astrophysics Data System (ADS)

    Špirko, Vladimír; Šponer, Jiří; Hobza, Pavel

    1997-01-01

    Intermolecular vibrational modes of the H-bonded adenine…thymine Watson-Crick (AT) base pair were studied for the first time using multidimensional nonharmonic treatment. Relying on a Born-Oppenheimer-like separation of the fast and slow vibrational motions, the complete multidimensional vibrational problem is reduced to a six-dimensional subproblem in which all rearrangements between the pair fragments (i.e., adenine and thymine) can be described. Following the Hougen-Bunker-Johns approach and using appropriate vibrational coordinates, a nonrigid reference is defined which covers all motions on the low-lying part of the intermolecular potential surface and which facilitates the derivation of a suitable model Hamiltonian. The potential energy surface is determined at the ab initio Hartree-Fock level with minimal basis set (HF/MINI-1) and an analytic potential energy function is obtained by fitting to the ab initio data. This function is used to calculate vibrational energy levels and effective geometries within the framework of the model Hamiltonian, disregarding the role of the kinematic and potential (in-plane)-(out-of-plane) interactions. The calculations are in reasonable agreement with the normal coordinate analysis (harmonic treatment) thus indicating physical correctness of this standard approach for an approximate description of the lowest vibrational states of the AT base pair. In addition, to get a deeper insight, harmonic vibrational frequencies of the AT pair and 28 other base pairs are evaluated at the same and higher levels of theory [ab initio Hartree-Fock level with split-valence basis set (HF/6-31G**)]. The HF/MINI-1 and HF/6-31G** intermolecular harmonic vibrational frequencies differ by less than 30%. For all the base pairs, the buckle and propeller vibrational modes [for definition and nomenclature see R. E. Dickerson et al., EMBO J. 8, 1 (1989)] are the lowest ones, all being in the narrow interval (from 4 to 30 cm-1 in the harmonic

  17. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.

    PubMed

    Seclaman, E; Kurunczi, L; Simon, Z

    2007-03-01

    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  18. Evidence of competing s and d-wave pairing channels in iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Kretzschmar, Florian; Muschler, Bernhard; Böhm, Thomas; Baum, Andreas; Hackl, Rudi; Wen, Hai-Hu; Tsurkan, Vladimir; Deisenhofer, Joachim; Loidl, Alois

    2013-03-01

    Superconductivity is determined by the interactions that drive Cooper pairing. However, experimental access to the pairing potential Vk ,k' becomes increasingly complicated upon going from conventional metals to complex systems such as the cuprates, some heavy fermion compounds or the iron-based superconductors. We show that electronic Raman scattering affords a window into the essential properties of Vk ,k' of iron-based superconductors. In Ba0 . 6K0 . 4Fe2As2 we observe band dependent energy gaps along with excitonic Bardasis-Schrieffer modes characterizing, respectively, the dominant and subdominant pairing channel. The dx2 -y2 symmetry of all excitons allows us to identify the subdominant channel to originate from the interaction between the electron bands. Consequently, the dominant channel driving superconductivity results from the interaction between the electron and hole bands and has the full lattice symmetry. The results in Rb0 . 8Fe1 . 6Se2 along with earlier ones in Ba(Fe0.939Co0 . 061) 2As2 highlight the influence of the Fermi surface topology on the pairing interactions.

  19. Evaluation of Project P.A.T.H.S. by the program implementers: findings based on the extension phase.

    PubMed

    Shek, Daniel T L; Sun, Rachel C F

    2013-01-01

    A total of 236 schools participated in the Project P.A.T.H.S. in the 2010/2011 school year. After completion of the Tier 1 Program, subjective outcome evaluation data were collected from 3275 program implementers. Based on the consolidated findings based on schools as units, results showed that participants had positive perceptions of the program, implementers, and benefits of the program. More than four-fifths of the implementers regarded the program as helpful to the program participants. Multiple regression analysis revealed that perceived qualities of the program and the program implementers predicted perceived effectiveness of the program. Grade differences were not significant. The present study provides additional support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong.

  20. Pairing symmetry and Antiferromagnetic Exchange Coupling in Fe-Based Superconductors

    NASA Astrophysics Data System (ADS)

    Hu, Jiangping

    2009-03-01

    I discuss the existence of strikingly identical paradigms applicable to both cuprates and iron-based superconductors in understanding magnetism, superconductivity and the interplay between the two. The magnetic states and transitions in iron- based superconductors are well described by a J1-J2-Jz magnetic exchange model where J1, J2 and Jz are nearest neighbour, next nearest neighbour and inter-layer couplings respectively. Differing from the t-J model for cuprates where d-wave pairing symmetry is favored, the magnetic exchange in the iron based supercondunctors predicts an unconventional s-wave coskxcosky pairing. I will show that the predicted pairing symmetry is supported by many experimental results, and also discuss new predictions associated with the pairing symmetry. [4pt] References: [0pt] [1]: Chen Fang, Hong Yao, Wei-Feng Tai, Jiangping Hu and S. Kivelson ``Theory of Electron Nematic Order in LaOFeAs''; Phys. Rev. B 77 224509 (2008).[0pt] [2]: Kangjun Seo, A. B. Bernevig and JiangPing Hu, ``Pairing Symmetry in a Two-Orbital Exchange Coupling Model of Oxypnictides''; PRL 101, 206404 (2008) ArXiv: 0805.2958.[0pt] [3]: Meera M. Parish, Jiangping Hu and B. Andrei Bernevig ``Experimental Consequences of the S-wave cos(kx)cos (ky) Superconductivity in the Iron-Pnictides'', Phys. Rev. B 78, 144514 (2008) ArXiv:0807.4572.[0pt] [4]: Chen Fang, B. Andrei Bernevig, Jiangping Hu,``Theory of Magnetic Order in Fe1+yTe1-xSex'', arXiv:0811.1294 (2008).

  1. Thermodynamic contribution and nearest-neighbor parameters of pseudouridine-adenosine base pairs in oligoribonucleotides

    PubMed Central

    Hudson, Graham A.; Bloomingdale, Richard J.; Znosko, Brent M.

    2013-01-01

    Pseudouridine (Ψ) is the most common noncanonical nucleotide present in naturally occurring RNA and serves a variety of roles in the cell, typically appearing where structural stability is crucial to function. Ψ residues are isomerized from native uridine residues by a class of highly conserved enzymes known as pseudouridine synthases. In order to quantify the thermodynamic impact of pseudouridylation on U-A base pairs, 24 oligoribonucleotides, 16 internal and eight terminal Ψ-A oligoribonucleotides, were thermodynamically characterized via optical melting experiments. The thermodynamic parameters derived from two-state fits were used to generate linearly independent parameters for use in secondary structure prediction algorithms using the nearest-neighbor model. On average, internally pseudouridylated duplexes were 1.7 kcal/mol more stable than their U-A counterparts, and terminally pseudouridylated duplexes were 1.0 kcal/mol more stable than their U-A equivalents. Due to the fact that Ψ-A pairs maintain the same Watson-Crick hydrogen bonding capabilities as the parent U-A pair in A-form RNA, the difference in stability due to pseudouridylation was attributed to two possible sources: the novel hydrogen bonding capabilities of the newly relocated imino group as well as the novel stacking interactions afforded by the electronic configuration of the Ψ residue. The newly derived nearest-neighbor parameters for Ψ-A base pairs may be used in conjunction with other nearest-neighbor parameters for accurately predicting the most likely secondary structure of A-form RNA containing Ψ-A base pairs. PMID:24062573

  2. Base-pairing behavior of a carbocyclic Janus-AT nucleoside analogue capable of recognizing A and T within a DNA duplex.

    PubMed

    Largy, Eric; Liu, Wenbo; Hasan, Abid; Perrin, David M

    2013-11-04

    Janus-type nucleosides are heterocycles with two faces, each of which is designed to complement the H-bonding interactions of natural nucleosides comprising a canonical Watson-Crick base pair. By intercepting all of the hydrogen bonds contained within the base pair, oligomeric Janus nucleosides are expected to achieve sequence-specific DNA recognition through the formation of J-loops that will be more stable than D-loops, which simply replaces one base-pair with another. Herein, we report the synthesis of a novel Janus-AT nucleoside analogue, JAT , affixed on a carbocyclic analogue of deoxyribose that was converted to the corresponding phosphoramidite. A single JAT was successfully incorporated into a DNA strand by solid phase for targeting both A and T bases, and characterized through biophysical and computational methods. Experimental UV-melting and circular dichroism data demonstrated that within the context of a standard duplex, JAT associates preferentially with T over A, and much more poorly with C and G. Density functional theory calculations confirm that the JAT structure is well suited to associate only with A and T thereby highlighting the importance of the electronic structure in terms of H-bonding. Finally, molecular dynamics simulations validated the observation that JAT can substitute more effectively as an A-analogue than as a T-analogue without substantial distortion of the B-helix. Overall, this new Janus nucleotide is a promising tool for the targeting of A-T base pairs in DNA, and will lead to the development of oligo-Janus-nucleotide strands for sequence-specific DNA recognition.

  3. PRISM: pair-read informed split-read mapping for base-pair level detection of insertion, deletion and structural variants.

    PubMed

    Jiang, Yue; Wang, Yadong; Brudno, Michael

    2012-10-15

    The development of high-throughput sequencing technologies has enabled novel methods for detecting structural variants (SVs). Current methods are typically based on depth of coverage or pair-end mapping clusters. However, most of these only report an approximate location for each SV, rather than exact breakpoints. We have developed pair-read informed split mapping (PRISM), a method that identifies SVs and their precise breakpoints from whole-genome resequencing data. PRISM uses a split-alignment approach informed by the mapping of paired-end reads, hence enabling breakpoint identification of multiple SV types, including arbitrary-sized inversions, deletions and tandem duplications. Comparisons to previous datasets and simulation experiments illustrate PRISM's high sensitivity, while PCR validations of PRISM results, including previously uncharacterized variants, indicate an overall precision of ~90%. PRISM is freely available at http://compbio.cs.toronto.edu/prism.

  4. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    NASA Astrophysics Data System (ADS)

    Shukla, P. K.; Ganapathy, Vinay; Mishra, P. C.

    2011-09-01

    Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Møller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  5. Aviram-Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    NASA Astrophysics Data System (ADS)

    Agapito, Luis A.; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-04-01

    We demonstrate that biological molecules such as Watson-Crick DNA base pairs can behave as biological Aviram-Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current-voltage response for the cytosine-guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine-adenine case. We propose applying the asymmetry of the current-voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps.

  6. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states.

  7. Protein−DNA binding in the absence of specific base-pair recognition

    PubMed Central

    Afek, Ariel; Schipper, Joshua L.; Horton, John; Gordân, Raluca; Lukatsky, David B.

    2014-01-01

    Until now, it has been reasonably assumed that specific base-pair recognition is the only mechanism controlling the specificity of transcription factor (TF)−DNA binding. Contrary to this assumption, here we show that nonspecific DNA sequences possessing certain repeat symmetries, when present outside of specific TF binding sites (TFBSs), statistically control TF−DNA binding preferences. We used high-throughput protein−DNA binding assays to measure the binding levels and free energies of binding for several human TFs to tens of thousands of short DNA sequences with varying repeat symmetries. Based on statistical mechanics modeling, we identify a new protein−DNA binding mechanism induced by DNA sequence symmetry in the absence of specific base-pair recognition, and experimentally demonstrate that this mechanism indeed governs protein−DNA binding preferences. PMID:25313048

  8. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  9. An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA.

    PubMed

    Hirao, Ichiro; Kimoto, Michiko; Mitsui, Tsuneo; Fujiwara, Tsuyoshi; Kawai, Rie; Sato, Akira; Harada, Yoko; Yokoyama, Shigeyuki

    2006-09-01

    Methods for the site-specific incorporation of extra components into nucleic acids can be powerful tools for creating DNA and RNA molecules with increased functionality. We present an unnatural base pair system in which DNA containing an unnatural base pair can be amplified and function as a template for the site-specific incorporation of base analog substrates into RNA via transcription. The unnatural base pair is formed by specific hydrophobic shape complementation between the bases, but lacks hydrogen bonding interactions. In replication, this unnatural base pair exhibits high selectivity in combination with the usual triphosphates and modified triphosphates, gamma-amidotriphosphates, as substrates of 3' to 5' exonuclease-proficient DNA polymerases, allowing PCR amplification. In transcription, the unnatural base pair complementarity mediates the incorporation of these base substrates and their analogs, such as a biotinylated substrate, into RNA by T7 RNA polymerase (RNAP). With this system, functional components can be site-specifically incorporated into a large RNA molecule.

  10. Protonation of base pairs in RNA: context analysis and quantum chemical investigations of their geometries and stabilities.

    PubMed

    Chawla, Mohit; Sharma, Purshotam; Halder, Sukanya; Bhattacharyya, Dhananjay; Mitra, Abhijit

    2011-02-17

    Base pairs involving protonated nucleobases play important roles in mediating global macromolecular conformational changes and in facilitation of catalysis in a variety of functional RNA molecules. Here we present our attempts at understanding the role of such base pairs by detecting possible protonated base pairs in the available RNA crystal structures using BPFind software, in their specific structural contexts, and by the characterization of their geometries, interaction energies, and stabilities using advanced quantum chemical computations. We report occurrences of 18 distinct protonated base pair combinations from a representative data set of RNA crystal structures and propose a theoretical model for one putative base pair combination. Optimization of base pair geometries was carried out at the B3LYP/cc-pVTZ level, and the BSSE corrected interaction energies were calculated at the MP2/aug-cc-pVDZ level of theory. The geometries for each of the base pairs were characterized in terms of H-bonding patterns observed, rmsd values observed on optimization, and base pair geometrical parameters. In addition, the intermolecular interaction in these complexes was also analyzed using Morokuma energy decomposition. The gas phase interaction energies of the base pairs range from -24 to -49 kcal/mol and reveal the dominance of Hartree-Fock component of interaction energy constituting 73% to 98% of the total interaction energy values. On the basis of our combined bioinformatics and quantum chemical analysis of different protonated base pairs, we suggest resolution of structural ambiguities and correlate their geometric and energetic features with their structural and functional roles. In addition, we also examine the suitability of specific base pairs as key elements in molecular switches and as nucleators for higher order structures such as base triplets and quartets.

  11. DNA separation and fluorescent detection in an optofluidic chip with sub-base-pair resolution

    NASA Astrophysics Data System (ADS)

    Pollnau, Markus; Hammer, Manfred; Dongre, Chaitanya; Hoekstra, Hugo J.

    2015-03-01

    DNA sequencing in a lab-on-a-chip aims at providing cheap, high-speed analysis of low reagent volumes to, e.g., identify genomic deletions or insertions associated with genetic illnesses. Detecting single base-pair insertions/deletions from DNA fragments in the diagnostically relevant range of 150-1000 base-pairs requires a sizing accuracy of S < 10-3. Here we demonstrate S = 4×10-4. A microfluidic chip was post-processed by femtosecond-laser writing of an optical waveguide. 12 blue-labeled and 23 red-labeled DNA fragments were separated in size by capillary electrophoresis, each set excited by either of two lasers power-modulated at different frequencies, their fluorescence detected by a photomultiplier, and blue/red signals distinguished by Fourier analysis. Different calibration strategies were tested: a) use either set of DNA molecules as reference to calibrate the set-up and identify the base-pair sizes of the other set in the same flow experiment, thereby eliminating variations in temperature, wall-coating and sieving-gel conditions, and actuation voltages; b) use the same molecular set as reference and sample with the same fluorescence label, flown in consecutive experiments; c) perform cross-experiments based on different molecular sets with different labels, flown in consecutive experiments. From the results we conclude: Applying quadratic instead of linear fit functions improves the calibration accuracy. Blue-labeled molecules are separated with higher accuracy. The influence of dye label is higher than fluctuations between two experiments. Choosing a single, suitable dye label combined with reference calibration and sample investigation in consecutive experiments results in S = 4×10-4, enabling detection of single base-pair insertion/deletion in a lab-on-a-chip.

  12. Comparison of NIR FRET pairs for quantitative transferrin-based assay

    NASA Astrophysics Data System (ADS)

    Sinsuebphon, Nattawut; Bevington, Travis; Zhao, Lingling; Ken, Abe; Barroso, Margarida; Intes, Xavier

    2014-02-01

    Transferrin (Tfn) is commonly used as a drug delivery carrier for cancer treatment. Tfn cellular internalization can be observed by Förster resonance energy transfer (FRET), which occurs when two fluorophores - donor and acceptor - are a few nanometers apart. Donor fluorescence lifetime can be used to sense and quantify FRET occurrence. In FRET state, the donor is quenched leading to a significant reduction in its lifetime. In this study, donor and acceptor near-infrared (NIR) fluorophore-labeled Tfn were used to quantify cellular internalization in breast cancer cell line (T47D). Based on donor lifetime, quantum yield and spectral data, seven NIR FRET pairs were chosen for this comparison. Performance of the different NIR FRET pairs was evaluated in vitro in multiwell plate settings and by analyzing the relationship between quenched donor fraction and acceptor:donor ratio. Additionally, we performed brightness comparison between each pairs. Several parameters, such as brightness, lifetime, R0 and FRET donor population values are used to identify the most suitable NIR FRET pair for in vivo studies in preclinical settings.

  13. Unnatural imidazopyridopyrimidine:naphthyridine base pairs: selective incorporation and extension reaction by Deep Vent (exo- ) DNA polymerase.

    PubMed

    Ogata, Shintaro; Takahashi, Mayumi; Minakawa, Noriaki; Matsuda, Akira

    2009-09-01

    In our previous communication we reported the enzymatic recognition of unnatural imidazopyridopyrimidine:naphthyridine (Im:Na) base pairs, i.e. ImO(N):NaN(O) and ImN(O):NaO(N), using the Klenow fragment exo(-) [KF (exo(-))]. We describe herein the successful results of (i) improved enzymatic recognition for ImN(O):NaO(N) base pairs and (ii) further primer extension reactions after the Im:Na base pairs by Deep Vent DNA polymerase exo(-) [Deep Vent (exo(-))]. Since KF (exo(-)) did not catalyze primer extension reactions after the Im:Na base pair, we carried out a screening of DNA polymerases to promote the primer extension reaction as well as to improve the selectivity of base pair recognition. As a result, a family B DNA polymerase, especially Deep Vent (exo(-)), seemed most promising for this purpose. In the ImO(N):NaN(O) base pair, incorporation of NaN(O)TP against ImO(N) in the template was preferable to that of the natural dNTPs, while incorporation of dATP as well as dGTP competed with that of ImO(N)TP when NaN(O) was placed in the template. Thus, the selectivity of base pair recognition by Deep Vent (exo(-)) was less than that by KF (exo(-)) in the case of the ImO(N):NaN(O) base pair. On the other hand, incorporation of NaO(N)TP against ImN(O) in the template and that of ImN(O)TP against NaO(N) were both quite selective. Thus, the selectivity of base pair recognition was improved by Deep Vent (exo(-)) in the ImN(O):NaO(N) base pair. Moreover, this enzyme catalyzed further primer extension reactions after the ImN(O):NaO(N) base pair to afford a faithful replicate, which was confirmed by MALDI-TOF mass spectrometry as well as the kinetics data for extension fidelity next to the ImN(O):NaO(N) base pair. The results presented in this paper revealed that the ImN(O):NaO(N) base pair might be a third base pair beyond the Watson-Crick base pairs.

  14. Hoogsteen base-pairing revisited: Resolving a role in normal biological processes and human diseases

    SciTech Connect

    Ghosal, Gargi; Muniyappa, K. . E-mail: kmbc@biochem.iisc.ernet.in

    2006-04-28

    For a long time since the discovery of an alternative type of hydrogen bonding between adenine and thymidine, termed Hoogsteen base-pairing, its biological role remained elusive. Recent experiments provide compelling evidence that Hoogsteen base pairs manifest in a gamut of nuclear processes encompassing gene expression, replication, recombination, and telomere length maintenance. An increasing number of proteins that have been shown to bind, unwind or cleave G-quadruplexes or triplexes with high specificity underscore their biological significance. In humans, the absence of these cellular factors or their dysfunction leads to a wide spectrum of genetic diseases including cancer, neurodegenerative syndromes, and a myriad of other disorders. Thus, development of clinically useful compounds that target G-quadruplexes or triplexes, and interfere with specific cellular processes, provides considerable promise for successful and improved treatment of human diseases.

  15. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water

    PubMed Central

    Cafferty, Brian J.; Fialho, David M.; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V.

    2016-01-01

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life. PMID:27108699

  16. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    PubMed

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  17. Fiber-based frequency-degenerate polarization-entanglement photon pair sources for information encoding

    NASA Astrophysics Data System (ADS)

    Zhu, Feng; Zhang, Wei; Huang, Yidong

    2016-11-01

    We propose and experimentally demonstrate a generation scheme of telecom-band fiber-based frequency-degenerate polarization-entanglement photon pair source. Basing on the vector spontaneous four wave mixing process in a Sagnac fiber loop along the clockwise and counter-clockwise directions, two frequency-degenerate and polarization orthogonal biphoton states generate and then lead to the polarization entanglement states by the interference at the beamsplitter. The raw fringe visibilities of the two-photon interferences are 97% and 92%, respectively. Information can be encoded on the generated photon pairs using the polarization entangled Bell states. It is demonstrated by a simplified Bell state measurement with a fringe visibility of 83%.

  18. Metal-free electrocatalytic hydrogen oxidation using frustrated Lewis pairs and carbon-based Lewis acids.

    PubMed

    Lawrence, Elliot J; Clark, Ewan R; Curless, Liam D; Courtney, James M; Blagg, Robin J; Ingleson, Michael J; Wildgoose, Gregory G

    2016-04-21

    Whilst hydrogen is a potentially clean fuel for energy storage and utilisation technologies, its conversion to electricity comes at a high energetic cost. This demands the use of rare and expensive precious metal electrocatalysts. Electrochemical-frustrated Lewis pairs offer a metal-free, CO tolerant pathway to the electrocatalysis of hydrogen oxidation. They function by combining the hydrogen-activating ability of frustrated Lewis pairs (FLPs) with electrochemical oxidation of the resultant hydride. Here we present an electrochemical-FLP approach that utilises two different Lewis acids - a carbon-based N-methylacridinium cation that possesses excellent electrochemical attributes, and a borane that exhibits fast hydrogen cleavage kinetics and functions as a "hydride shuttle". This synergistic interaction provides a system that is electrocatalytic with respect to the carbon-based Lewis acid, decreases the required potential for hydrogen oxidation by 1 V, and can be recycled multiple times.

  19. Hydrogen bonding: a channel for protons to transfer through acid-base pairs.

    PubMed

    Wu, Liang; Huang, Chuanhui; Woo, Jung-Je; Wu, Dan; Yun, Sung-Hyun; Seo, Seok-Jun; Xu, Tongwen; Moon, Seung-Hyeon

    2009-09-10

    Different from H(3)O(+) transport as in the vehicle mechanism, protons find another channel to transfer through the poorly hydrophilic interlayers in a hydrated multiphase membrane. This membrane was prepared from poly(phthalazinone ether sulfone kentone) (SPPESK) and H(+)-form perfluorosulfonic resin (FSP), and poorly hydrophilic electrostatically interacted acid-base pairs constitute the interlayer between two hydrophilic phases (FSP and SPPESK). By hydrogen bonds forming and breaking between acid-base pairs and water molecules, protons transport directly through these poorly hydrophilic zones. The multiphase membrane, due to this unique transfer mechanism, exhibits better electrochemical performances during fuel cell tests than those of pure FSP and Nafion-112 membranes: 0.09-0.12 S cm(-1) of proton conductivity at 25 degrees C and 990 mW cm(-2) of the maximum power density at a current density of 2600 mA cm(-2) and a cell voltage of 0.38 V.

  20. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    PubMed

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences.

  1. Qualitative Evaluation of the Project P.A.T.H.S.: An Integration of Findings Based on Program Implementers

    PubMed Central

    Shek, Daniel T. L.

    2012-01-01

    An integration of the qualitative evaluation findings collected from program implementers conducting the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in different years (n = 177 participants in 36 focus groups) was carried out. General qualitative data analyses utilizing intra and interrater reliability techniques were performed. Results showed that the descriptors used to describe the program and the metaphors named by the informants that could stand for the program were generally positive in nature. Program participants also perceived the program to be beneficial to the development of the students in different psychosocial domains. The present study further supports the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong based on the perspective of the program implementers. PMID:22666139

  2. Subjective outcome evaluation of the Project P.A.T.H.S.: findings based on different datasets.

    PubMed

    Shek, Daniel T L; Ma, Cecilia; Tang, Christina Y P

    2011-01-01

    A total of 216 schools participated in the Project P.A.T.H.S. in the 2008/2009 school year. After completion of the Tier 1 Program, subjective outcome evaluation data were collected from 3274 program implementers. Based on the consolidated data with schools as units, results showed that participants had positive perceptions of the program, implementers and benefits of the program. More than four-fifths of the implementers regarded the program as helpful to the program participants. Multiple regression analysis revealed that perceived qualities of the program and the program implementers predicted perceived effectiveness of the program. Grade differences were not significant, except in the perception of the program for the Secondary 1 and Secondary 3 programs. The present study provides additional support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong.

  3. Qualitative evaluation of the project P.A.T.H.S. based on the perceptions of the program participants.

    PubMed

    Shek, Daniel T L; Lee, Tak Yan; Siu, Andrew; Lam, Ching Man

    2006-11-16

    Qualitative evaluation was carried out to understand the perceptions of the students participating in the Tier 1 Program of the P.A.T.H.S. Project. Five focus groups based on 43 students recruited from four schools were conducted to generate qualitative data to evaluate the program. With specific focus on how the informants described the program, results showed that the descriptors used were mainly positive in nature. When the informants were invited to name three metaphors that could stand for the program, the related metaphors were basically positive in nature. Finally, the program participants perceived many beneficial effects of the program in different psychosocial domains. Intra- and inter-rater reliability analyses revealed that the coding of the positive or negative nature of the responses was reliable. The present study provides qualitative support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in promoting holistic development in Chinese adolescents in Hong Kong.

  4. Thermodynamic properties of the specific binding between Ag+ ions and C:C mismatched base pairs in duplex DNA.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2011-02-01

    Metal-mediated base pairs formed by the interaction between metal ions and artificial bases in oligonucleotides have been developed for potential applications in nanotechnology. We recently found that a natural C:C mismatched base pair bound to an Ag(+) ion to generate a novel metal-mediated base pair in duplex DNA. Preparation of the novel C-Ag-C base pair involving natural bases is more convenient than that of metal-mediated base pairs involving artificial bases because time-consuming base synthesis is not required. Here, we examined the thermodynamic properties of the binding between the Ag(+) ion and each of single and double C:C mismatched base pair in duplex DNA by isothermal titration calorimetry. The Ag(+) ion specifically bound to the C:C mismatched base pair at a 1:1 molar ratio with 10(6) M(-1) binding constant, which was significantly larger than those for nonspecific metal ion-DNA interactions. The specific binding between the Ag(+) ion and the single C:C mismatched base pair was mainly driven by the positive dehydration entropy change and the negative binding enthalpy change. In the interaction between the Ag(+) ion and each of the consecutive and interrupted double C:C mismatched base pairs, stoichiometric binding at a 1:1 molar ratio was achieved in each step of the first and second Ag(+) binding. The binding affinity for the second Ag(+) binding was similar to that for the first Ag(+) binding. Stoichiometric binding without interference and negative cooperativity may be favorable for aligning multiple Ag(+) ions in duplex DNA for applications of the metal-mediated base pairs in nanotechnology.

  5. Reverse Watson-Crick G-G base pair in G-quadruplex formation.

    PubMed

    Mondal, Soma; Bhat, Jyotsna; Jana, Jagannath; Mukherjee, Meghomukta; Chatterjee, Subhrangsu

    2016-01-01

    A stable intermediate dimeric G-rich form as a precursor of tetrameric G-quadruplex structures has been detected via MALDI-TOF spectrometry. Molecular dynamics simulation offered detailed insights at the atomic level, assigning reverse Watson-Crick G-G base pairing (not Hoogsteen) in the G-rich dimer. In support of this, cisplatin formed a stable adduct by binding to the dimeric G-rich structure, eliminating the possibility of G-G Hoogsteen hydrogen bond formation.

  6. Optimized distance-dependent atom-pair-based potential DOOP for protein structure prediction.

    PubMed

    Chae, Myong-Ho; Krull, Florian; Knapp, Ernst-Walter

    2015-05-01

    The DOcking decoy-based Optimized Potential (DOOP) energy function for protein structure prediction is based on empirical distance-dependent atom-pair interactions. To optimize the atom-pair interactions, native protein structures are decomposed into polypeptide chain segments that correspond to structural motives involving complete secondary structure elements. They constitute near native ligand-receptor systems (or just pairs). Thus, a total of 8609 ligand-receptor systems were prepared from 954 selected proteins. For each of these hypothetical ligand-receptor systems, 1000 evenly sampled docking decoys with 0-10 Å interface root-mean-square-deviation (iRMSD) were generated with a method used before for protein-protein docking. A neural network-based optimization method was applied to derive the optimized energy parameters using these decoys so that the energy function mimics the funnel-like energy landscape for the interaction between these hypothetical ligand-receptor systems. Thus, our method hierarchically models the overall funnel-like energy landscape of native protein structures. The resulting energy function was tested on several commonly used decoy sets for native protein structure recognition and compared with other statistical potentials. In combination with a torsion potential term which describes the local conformational preference, the atom-pair-based potential outperforms other reported statistical energy functions in correct ranking of native protein structures for a variety of decoy sets. This is especially the case for the most challenging ROSETTA decoy set, although it does not take into account side chain orientation-dependence explicitly. The DOOP energy function for protein structure prediction, the underlying database of protein structures with hypothetical ligand-receptor systems and their decoys are freely available at http://agknapp.chemie.fu-berlin.de/doop/. © 2015 Wiley Periodicals, Inc.

  7. Bright Phase-Stable Broadband Fiber-Based Source of Polarization-Entangled Photon Pairs

    DTIC Science & Technology

    2007-10-24

    distribution 2, and quantum - state teleportation 3. For example, it is now well known that two parties, each sharing half of an entangled photon pair...FUNDING NUMBERS Bright Phase-Stable Broadband Fiber-Based Source of MURI Center for Photonic Quantum Information Systems: ARO/ARDA Program Polarization...wide range of quantum -information applications. 14. SUBJECT TERMS 15. NUMBER OF PAGES single photon source, microstructure fiber, photon correlation

  8. A chemical approach to mapping nucleosomes at base pair resolution in yeast.

    PubMed

    Brogaard, Kristin R; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-01-01

    Most eukaryotic DNA exists in DNA-protein complexes known as nucleosomes. The exact locations of nucleosomes along the genome play a critical role in chromosome functions and gene regulation. However, the current methods for nucleosome mapping do not provide the necessary accuracy to identify the precise nucleosome locations. Here we describe a new experimental approach that directly maps nucleosome center locations in vivo genome-wide at single base pair resolution.

  9. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  10. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  11. Molecular dynamics simulation of DNA base-pair opening by sharp bending

    NASA Astrophysics Data System (ADS)

    Cong, Peiwen; Dai, Liang; van der Maarel, Johan R. C.; Yan, Jie

    2013-03-01

    Many biological processes require sharp bending of DNA. According to worm-like chain model, the bending energy dominates the free energy cost of those processes containing DNA loops shorter than 40 nm, such as DNA wrapping around histones, Lac repressor looping and virus DNA packaging. However, several recent experimental observations suggest that the WLC model s not applicable under tight bending conditions. In full atom molecular dynamics simulations, a double stranded, 20 base-pairs DNA fragment is forced to bend by an external spring. It is found that one or two AT-rich regions are disrupted for sufficiently small end-to-end distance. The disrupted DNA base-pairs separate and usually stack with the neighbouring base-pairs to form a defect. It is shown that these defects are more bendable than the bending rigidity of the duplex in the regular B-form. The simulation suggests a curvature dependent, non-harmonic bending elasticity of the DNA backbone is necessary to describe the DNA conformation under tight bending conditions.

  12. Combined microfluidic-optical DNA analysis with single-base-pair sizing capability

    PubMed Central

    Pollnau, Markus; Hammer, Manfred; Dongre, Chaitanya; Hoekstra, Hugo J. W. M.

    2016-01-01

    DNA sequencing by microchip capillary electrophoresis (CE) enables cheap, high-speed analysis of low reagent volumes. One of its potential applications is the identification of genomic deletions or insertions associated with genetic illnesses. Detecting single base-pair insertions or deletions from DNA fragments in the diagnostically relevant size range of 150−1000 base-pairs requires a variance of σ2 < 10−3. In a microfluidic chip post-processed by femtosecond-laser writing of an optical waveguide we CE-separated 12 blue-labeled and 23 red-labeled DNA fragments in size. Each set was excited by either of two lasers power-modulated at different frequencies, their fluorescence detected by a photomultiplier, and blue and red signals distinguished by Fourier analysis. We tested different calibration strategies. Choice of the fluorescent label as well as the applied fit function strongly influence the obtained variance, whereas fluctuations between two consecutive experiments are less detrimental in a laboratory environment. We demonstrate a variance of σ2 ≈4 × 10−4, lower than required for the detection of single base-pair insertion or deletion in an optofluidic chip. PMID:28018736

  13. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    SciTech Connect

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-12-31

    For a number of years, the authors` group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH{sub 2}) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions.

  14. B-DNA structure is intrinsically polymorphic: even at the level of base pair positions

    SciTech Connect

    Maehigashi, Tatsuya; Hsiao, Chiaolong; Woods, Kristen Kruger; Moulaei, Tinoush; Hud, Nicholas V.; Williams, Loren Dean

    2012-10-23

    Increasingly exact measurement of single crystal X-ray diffraction data offers detailed characterization of DNA conformation, hydration and electrostatics. However, instead of providing a more clear and unambiguous image of DNA, highly accurate diffraction data reveal polymorphism of the DNA atomic positions and conformation and hydration. Here we describe an accurate X-ray structure of B-DNA, painstakingly fit to a multistate model that contains multiple competing positions of most of the backbone and of entire base pairs. Two of ten base-pairs of CCAGGCCTGG are in multiple states distinguished primarily by differences in slide. Similarly, all the surrounding ions are seen to fractionally occupy discrete competing and overlapping sites. And finally, the vast majority of water molecules show strong evidence of multiple competing sites. Conventional resolution appears to give a false sense of homogeneity in conformation and interactions of DNA. In addition, conventional resolution yields an average structure that is not accurate, in that it is different from any of the multiple discrete structures observed at high resolution. Because base pair positional heterogeneity has not always been incorporated into model-building, even some high and ultrahigh-resolution structures of DNA do not indicate the full extent of conformational polymorphism.

  15. Reversible bond formation enables the replication and amplification of a crosslinking salen complex as an orthogonal base pair

    NASA Astrophysics Data System (ADS)

    Kaul, Corinna; Müller, Markus; Wagner, Mirko; Schneider, Sabine; Carell, Thomas

    2011-10-01

    The universal genetic code relies on two hydrogen-bonded Watson-Crick base pairs that can form 64 triplet codons. This places a limit on the number of amino acids that can be encoded, which has motivated efforts to create synthetic base pairs that are orthogonal to the natural ones. An additional base pair would result in another 61 triplet codons. Artificial organic base pairs have been described in enzymatic incorporation studies, and inorganic T-Hg-T and C-Ag-C base pairs have been reported to form in primer extension studies. Here, we demonstrate a metal base pair that is fully orthogonal and can be replicated, and can even be amplified by polymerase chain reaction in the presence of the canonical pairs dA:dT and dG:dC. Crystal structures of a dS-Cu-dS base pair inside a polymerase show that reversible chemistry is possible directly inside the polymerase, which enables the efficient copying of the inorganic crosslink. The results open up the possibility of replicating and amplifying artificial inorganic DNA nanostructures by extending the genetic alphabet.

  16. High quality image-pair-based deblurring method using edge mask and improved residual deconvolution

    NASA Astrophysics Data System (ADS)

    Cui, Guangmang; Zhao, Jufeng; Gao, Xiumin; Feng, Huajun; Chen, Yueting

    2017-04-01

    Image deconvolution problem is a challenging task in the field of image process. Using image pairs could be helpful to provide a better restored image compared with the deblurring method from a single blurred image. In this paper, a high quality image-pair-based deblurring method is presented using the improved RL algorithm and the gain-controlled residual deconvolution technique. The input image pair includes a non-blurred noisy image and a blurred image captured for the same scene. With the estimated blur kernel, an improved RL deblurring method based on edge mask is introduced to obtain the preliminary deblurring result with effective ringing suppression and detail preservation. Then the preliminary deblurring result is served as the basic latent image and the gain-controlled residual deconvolution is utilized to recover the residual image. A saliency weight map is computed as the gain map to further control the ringing effects around the edge areas in the residual deconvolution process. The final deblurring result is obtained by adding the preliminary deblurring result with the recovered residual image. An optical experimental vibration platform is set up to verify the applicability and performance of the proposed algorithm. Experimental results demonstrate that the proposed deblurring framework obtains a superior performance in both subjective and objective assessments and has a wide application in many image deblurring fields.

  17. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis.

    PubMed

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA.

  18. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis

    PubMed Central

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA. PMID:28938011

  19. High quality image-pair-based deblurring method using edge mask and improved residual deconvolution

    NASA Astrophysics Data System (ADS)

    Cui, Guangmang; Zhao, Jufeng; Gao, Xiumin; Feng, Huajun; Chen, Yueting

    2017-02-01

    Image deconvolution problem is a challenging task in the field of image process. Using image pairs could be helpful to provide a better restored image compared with the deblurring method from a single blurred image. In this paper, a high quality image-pair-based deblurring method is presented using the improved RL algorithm and the gain-controlled residual deconvolution technique. The input image pair includes a non-blurred noisy image and a blurred image captured for the same scene. With the estimated blur kernel, an improved RL deblurring method based on edge mask is introduced to obtain the preliminary deblurring result with effective ringing suppression and detail preservation. Then the preliminary deblurring result is served as the basic latent image and the gain-controlled residual deconvolution is utilized to recover the residual image. A saliency weight map is computed as the gain map to further control the ringing effects around the edge areas in the residual deconvolution process. The final deblurring result is obtained by adding the preliminary deblurring result with the recovered residual image. An optical experimental vibration platform is set up to verify the applicability and performance of the proposed algorithm. Experimental results demonstrate that the proposed deblurring framework obtains a superior performance in both subjective and objective assessments and has a wide application in many image deblurring fields.

  20. Intramolecular Lewis pairs with two acid sites - reactivity differences between P- and N-based systems.

    PubMed

    Körte, Leif A; Blomeyer, Sebastian; Heidemeyer, Shari; Nissen, Jan Hendrick; Mix, Andreas; Neumann, Beate; Stammler, Hans-Georg; Mitzel, Norbert W

    2016-11-01

    The doubly acid-functionalised aniline PhN[(CH2)3B(C6F5)2]2 shows rapidly exchanging boron acid groups at the central base function and is an active frustrated Lewis pair due to cooperative hydride binding by both Lewis acids. Here we report investigations on the effect of different substituents at the central nitrogen atom and on the effect of exchanging nitrogen by phosphorus. Treatment of diallyl-tert-butylaniline with one equivalent of HB(C6F5)2 led to formation of a seven-membered iminium hydridoborate ring; after mono-hydroboration the intermediately formed frustrated Lewis pair reacts with the second allylamine function under ring closure. Phosphorus based Lewis pairs with two acid sites were prepared by hydroboration of diallylphenylphosphane and diallyl-tert-butylphosphane. Unlike the aniline PhN[(CH2)3B(C6F5)2]2 the doubly hydroborated species ((t)Bu/Ph)P[(CH2)3B(C6F5)2]2 show no dynamic exchange of the boron Lewis acid functions in solution and are not catalytically active in terms of H/D-scrambling as well as hydrogenation reactions. Quantum-chemical investigations revealed the B-P bond dissociation Gibbs free energy to be much larger than those of the nitrogen analogue. The absence of an active open form in solution prevents an activity in heterolytic hydrogen splitting.

  1. High efficient key-insulated attribute based encryption scheme without bilinear pairing operations.

    PubMed

    Hong, Hanshu; Sun, Zhixin

    2016-01-01

    Attribute based encryption (ABE) has been widely applied for secure data protection in various data sharing systems. However, the efficiency of existing ABE schemes is not high enough since running encrypt and decrypt algorithms need frequent bilinear pairing operations, which may occupy too much computing resources on terminal devices. What's more, since different users may share the same attributes in the system, a single user's private key exposure will threaten the security and confidentiality of the whole system. Therefore, to further decrease the computation cost in attribute based cryptosystem as well as provide secure protection when key exposure happens, in this paper, we firstly propose a high efficient key-insulated ABE algorithm without pairings. The key-insulated mechanism guarantees both forward security and backward security when key exposure or user revocation happens. Besides, during the running of algorithms in our scheme, users and attribute authority needn't run any bilinear pairing operations, which will increase the efficiency to a large extent. The high efficiency and security analysis indicate that our scheme is more appropriate for secure protection in data sharing systems.

  2. Detecting pairing symmetry in Fe-based superconductors: Solitons and proximity patch

    NASA Astrophysics Data System (ADS)

    Vakaryuk, Victor; Stanev, Valentin; Lee, Wei-Cheng; Levchenko, Alex

    2013-03-01

    We suggest a mechanism which promotes the existence of a phase soliton - topological defect formed in the relative phase of superconducting gaps of a two-band superconductor with s+ - type of pairing. This mechanism exploits the proximity effect with a conventional s-wave superconductor which favors the alignment of the phases of the two-band superconductor which, in the case of s+ - pairing, are π-shifted in the absence of proximity. In the case of a strong proximity such effect can be used to reduce soliton's energy below the energy of a soliton-free state thus making the soliton thermodynamically stable. Based on this observation we consider an experimental setup, applicable both for stable and metastable solitons, which can be used to distinguish between s+ - and s+ + types of pairing in the iron-based multiband superconductors. The financial support was provided by the Center of Emergent Superconductivity funded by the U.S. DOE, Award No. DE-AC0298CH1088. W.C.L. acknowledges Roving Postdoc Program sponsored by CES. AL acknowledges support from Michigan State University.

  3. Role of a tRNA base modification and its precursors in frameshifting in eukaryotes.

    PubMed

    Waas, William F; Druzina, Zhanna; Hanan, Melanie; Schimmel, Paul

    2007-09-07

    Little is known about the role of specific base modifications of transfer RNAs. Wyosine bases are tRNA(Phe)-specific modifications that are distinguished by differentiated, lateral side chains and base methylations appended to the core ring structure of a universally conserved G37, adjacent to the anticodon of Phe tRNAs. Based on previous data, we hypothesized that this modification was needed for -1 frameshifting. Using a reporter system incorporating a SCV-LA yeast virus slippery site for detecting -1 frameshifts in vivo, yeast strains were created that enabled chemical-genetic dissection of the role of different functional groups of wyebutosine that are added in a three-step post-transcriptional set of reactions. With this system, hypomodification increased Phe-specific frameshifting, with incremental changes in frameshift efficiency after specific intermediates in the progression of wyebutosine synthesis. These data combined with investigations of wild-type and hypomodified tRNA binding to ribosomes suggest that frameshift efficiency is kinetically and not thermodynamically controlled. The progressive nature of frameshift efficiency with the stage of modification is consistent with a stepwise evolution and tuning of frameshift potential. The stepwise tuning of frameshift efficiency could explain why tRNA(Phe) in some eukaryotes is not fully modified but, rather, hypomodified to capture a specific frameshift potential.

  4. Activation of Carbon Dioxide by Silyl Triflate-Based Frustrated Lewis Pairs.

    PubMed

    Weicker, Sarah A; Stephan, Douglas W

    2015-09-07

    Silyl triflates of the form R4-n Si(OTf)n (n=1, 2; OTf=OSO3 CF3 ) are shown to activate carbon dioxide when paired with bulky alkyl-substituted Group 15 bases. Combinations of silyl triflates and 2,2,6,6-tetramethylpiperidine react with CO2 to afford silyl carbamates via a frustrated Lewis pair-type mechanism. With trialkylphosphines, the silyl triflates R3 Si(OTf) reversibly bind CO2 affording [R'3 P(CO2 )SiR3 ][OTf] whereas when Ph2 Si(OTf)2 is used one or two molecules of CO2 can be sequestered. The latter bis-CO2 product is favoured at low temperatures and by excess phosphine.

  5. Vehicle detection algorithm based on light pairing and tracking at nighttime

    NASA Astrophysics Data System (ADS)

    Wan, Weibing; Fang, Tao; Li, Shuguang

    2011-10-01

    Detecting a vehicle to obtain traffic information at nighttime is difficult. This study proposes a vehicle detection algorithm, called the headlight extraction, pairing, and tracking (HLEPT) algorithm, which can acquire traffic information in the rain at nighttime by identifying vehicles through the location of their headlights and other indicative lights. A knowledge-based connected-component procedure, in which vehicles are located by grouping their lights and estimating their features, is proposed. The features of a complex nighttime traffic scene were also analyzed. The HLEPT algorithm includes a headlight extraction algorithm, as well as regulations for the pairing and grouping of lights and light tracking using a Kanade-Lucas-Tomasi tracker to measure traffic flow and velocity. Experimental results demonstrate the feasibility and effectiveness of the proposed approach on vehicle detection in the rain at nighttime.

  6. Stability and proton transfer in DNA base pairs of AMD473-DNA adduct

    NASA Astrophysics Data System (ADS)

    Sarmah, Pubalee; Deka, Ramesh C.

    2011-05-01

    We investigate the energetics of four different adducts of cisplatin analogue cis-[PtCl 2(NH 3)(2-picoline)] (AMD473) with a duplex DNA using DFT/ONIOM methods to probe their stabilities. Further, we study the possibilities of proton transfer between DNA base pairs of the most stable drug-DNA adduct. The adduct b(2-picoline trans to 3'-G and 2-methyl group directs to the DNA major groove) is found to be the most stable configuration among all the possible adducts. From the proton transfer analysis we found that the single proton transfer between N1 position of guanine (G) and N3 position of cytosine (C) of each GC pair gives a structure energetically as stable as the original one.

  7. Orbital-Parity Selective Superconducting Pairing Structures of Fe-based Superconductors under Glide Symmetry

    NASA Astrophysics Data System (ADS)

    Lin, Chiahui; Chou, Chung-Pin; Yin, Wei-Guo; Ku, Wei

    2014-03-01

    We show that the superconductivity in Fe-based superconductors consists of zero and finite momentum (π , π , 0) Cooper pairs with the same and different parities of the Fe 3 d orbitals respectively. The former develops the distinct gap structures for each orbital parity, and the latter is characteristic of spin singlet, spacial oddness and time reversal symmetry breaking. This originates from the unit cell containing two Fe atoms and two anions of staggered positioning with respect to the Fe square lattice. The in-plane translation is turned into glide translation, which dictates orbital-parity selective quasiparticles. Such novel pairing structures explain the unusual gap angular modulation on the hole pockets in recent ARPES and STS experiments. Work supported by DOE DE-AC02-98CH10886 and Chinese Academy of Engineering Physics and Ministry of Science and Technology.

  8. Initial test of a T9-like P300-based speller by an ALS patient

    NASA Astrophysics Data System (ADS)

    Ron-Angevin, R.; Varona-Moya, S.; da Silva-Sauer, L.

    2015-08-01

    Objective. Visual P300-based brain-computer interface spellers offer a useful communication channel for locked-in patients, who are completely dependent in their daily lives. One of the research goals for these systems is to achieve greater communication rates by means of modifying some features of their interfaces, e.g., reducing the matrix size. However, such modifications may not work well with disabled end-users, such as patients of amyotrophic lateral sclerosis (ALS), due to a supposed reduction of their cognitive resources. The purpose of the present study was to provide a proof of concept that ALS patients could efficiently use a P300-based speller with a 4 × 3 symbol matrix based on the T9 interface developed for mobile phones. Approach. We conducted an experiment with a sample of 11 able-bodied participants and one locked-in patient with ALS. All participants tested our T9-like visual P300-based speller and also two different 7 × 6 matrix spellers based on Farwell and Donchin’s classic proposal—one of them included a word predictor system like the T9-like speller did. Main results. The performance analyses indicated that the locked-in patient benefited from using a reduced matrix size as much as healthy users did, spelling words almost 1.6 times faster and equally accurately when using the T9-like speller than when using the alternative spellers. Significance. Due to counting on only one locked-in patient, the current work constitutes a feasibility study. The actual usability of systems such as the one proposed in this paper should be determined by means of studies with a greater number of end-users in real-life conditions.

  9. Kinetic Analysis of Base Pairing Preference for Nucleotide Incorporation Opposite Template Pyrimidines by Human DNA Polymerase ι

    PubMed Central

    Choi, Jeong-Yun; Lim, Seonhee; Eoff, Robert L.; Guengerich, F. Peter

    2009-01-01

    SUMMARY DNA polymerase (pol) ι, a member of the mammalian Y-family of DNA polymerases involved in translesion DNA synthesis, has been previously suggested to peculiarly utilize Hoogsteen base pairing for DNA synthesis opposite template purines, unlike pols η and κ which utilize Watson-Crick base pairing. To investigate the possible roles of Hoogsteen, Watson-Crick, and wobble base pairing modes in the selection of nucleotides opposite template pyrimidines by human pol ι, we carried out kinetic analyses of incorporation of modified purine nucleoside triphosphates including 7-deazapurines, inosine, 2-aminopurine, 2,6-diaminopurine, and 6-chloropurine, which affect H-bonding in base pair formation opposite template pyrimidines. Carbon substitution at the N7 atom of purine nucleoside triphosphates, which disrupts Hoogsteen base pairing, only slightly inhibited DNA synthesis opposite template pyrimidines by pol ι, which was not substantially different from human pols η and κ. Opposite template T, only the relative wobble stabilities (inferred from the potential numbers of H-bonds, steric, and electrostatic interactions but not measured) of base pairs were positively correlated to the relative efficiencies of nucleotide incorporation by pol ι but not the relative Watson-Crick or Hoogsteen stabilities, unlike pols η and κ. In contrast, opposite C only the relative Watson-Crick stabilities of base pairs were positively correlated to the relative efficiencies of nucleotide incorporation by pol ι, as with pols η and κ. These results suggest that pol ι might not indispensably require Hoogsteen base pairing for DNA synthesis opposite pyrimidines but rather might prefer wobble base pairing in the selection of nucleotides opposite T and Watson-Crick base pairing opposite C. PMID:19376129

  10. Benchmarking of a T-wave alternans detection method based on empirical mode decomposition.

    PubMed

    Blanco-Velasco, Manuel; Goya-Esteban, Rebeca; Cruz-Roldán, Fernando; García-Alberola, Arcadi; Rojo-Álvarez, José Luis

    2017-07-01

    T-wave alternans (TWA) is a fluctuation of the ST-T complex occurring on an every-other-beat basis of the surface electrocardiogram (ECG). It has been shown to be an informative risk stratifier for sudden cardiac death, though the lack of gold standard to benchmark detection methods has promoted the use of synthetic signals. This work proposes a novel signal model to study the performance of a TWA detection. Additionally, the methodological validation of a denoising technique based on empirical mode decomposition (EMD), which is used here along with the spectral method, is also tackled. The proposed test bed system is based on the following guidelines: (1) use of open source databases to enable experimental replication; (2) use of real ECG signals and physiological noise; (3) inclusion of randomized TWA episodes. Both sensitivity (Se) and specificity (Sp) are separately analyzed. Also a nonparametric hypothesis test, based on Bootstrap resampling, is used to determine whether the presence of the EMD block actually improves the performance. The results show an outstanding specificity when the EMD block is used, even in very noisy conditions (0.96 compared to 0.72 for SNR = 8 dB), being always superior than that of the conventional SM alone. Regarding the sensitivity, using the EMD method also outperforms in noisy conditions (0.57 compared to 0.46 for SNR=8 dB), while it decreases in noiseless conditions. The proposed test setting designed to analyze the performance guarantees that the actual physiological variability of the cardiac system is reproduced. The use of the EMD-based block in noisy environment enables the identification of most patients with fatal arrhythmias. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Understanding the Role of Dispersion in Frustrated Lewis Pairs and Classical Lewis Adducts: A Domain-Based Local Pair Natural Orbital Coupled Cluster Study.

    PubMed

    Bistoni, Giovanni; Auer, Alexander A; Neese, Frank

    2017-01-18

    The interaction of Lewis acids and bases in both classical Lewis adducts and frustrated Lewis pairs (FLPs) is investigated to elucidate the role that London dispersion plays in different situations. The analysis comprises 14 different adducts between tris(pentafluorophenyl)borane and a series of phosphines, carbenes, and amines with various substituents, differing in both steric and electronic properties. The domain-based local pair natural orbital coupled-cluster (DLPNO-CCSD(T)) method is used in conjunction with the recently introduced local energy decomposition (LED) analysis to obtain state-of-the-art dissociation energies and, at the same time, a clear-cut definition of the London dispersion component of the interaction, with the ultimate goal of aiding in the development of designing principles for acid/base pairs with well-defined bonding features and reactivity. In agreement with previous DFT investigations, it is found that the London dispersion dominates the interaction energy in FLPs, and is also remarkably strong in Lewis adducts. In these latter systems, its magnitude can be easily modulated by modifying the polarizability of the substituents on the basic center, which is consistent with the recently introduced concept of dispersion energy donors. By counteracting the destabilizing energy contribution associated with the deformation of the monomers, the London dispersion drives the stability of many Lewis adducts.

  12. Interactions of the Watson-Crick nucleic acid base pairs with carbon nanotubes and graphene: DFT and MP2 study

    NASA Astrophysics Data System (ADS)

    Stepanian, S. G.; Karachevtsev, M. V.; Karachevtsev, V. A.; Adamowicz, L.

    2014-08-01

    Structures and interaction energies of complexes formed by Watson-Crick base pairs and carbon surfaces (nanotubes and graphene) are investigated using the DFT M05-2X and MP2 quantum chemical computational methods. High structural flexibility of the complexes is demonstrated. Structures with approximately parallel and perpendicular orientations of the base pairs and the nanotube main axis are revealed. The complexes formed by the GC base pair and large-diameter zigzag nanotubes with the perpendicular orientation of the two systems are found to be the lowest energy configurations. Decomposition of the interaction energies into two-body contributions is applied to explain the nature of the interaction. The question of how the interaction between a base pair and a carbon surface affects the H-bonding between the nucleobases in the pair is elucidated.

  13. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs.

    PubMed

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch.

  14. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  15. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  16. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    USGS Publications Warehouse

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  17. Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept

    NASA Technical Reports Server (NTRS)

    Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.

    2010-01-01

    The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.

  18. A dual-wavelength erbium-doped fiber laser based on fiber grating pair

    NASA Astrophysics Data System (ADS)

    Sun, Hongwei; Wang, Tianshu; Jia, Qingsong; Zhang, Peng; Jiang, Huilin

    2014-12-01

    A dual-wavelength linear cavity erbium-doped fiber (EDF) laser based on a fiber grating pair is demonstrated experimentally. A circulator, a 980nm/1550nm wavelength division multiplexing (WDM) coupler, a 1×2 coupler, a polarization controller, a 6m long erbium-doped fiber and a fiber grating pair for wavelength interval of 0.3nm are included in the structure. A circulator connected at two ports as reflecting mirror structure. A 980nm pump source pump an erbium-doped fiber with a length of 6m consist of an erbium doped fiber amplifier. Through adjusting the state of the polarization controller, the transmission characteristic of cavity is changed. In both polarization and wavelength, the feedback from the fiber grating pair results in the laser operating on two longitudinal modes that are separated. The birefringence induced by the fiber grating pair is beneficial to diversify the polarization states of different wavelength in the erbium-doped fiber. So it is enhanced the polarization hole burning effect. This polarization hole burning effect greatly reduced the wavelength competition. Then, it was possible to achieve stable dual-wavelength. It turns out the structure generated the stable dual-wavelength with the 0.3nm wavelength interval and the output power is 0.13dBm in the end. The whole system have a simple and compact structure, it can work stably and laid a foundation for microwave/millimeter wave generator. It has a good application performance in the future for scientific research and daily life.

  19. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  20. A novel sequence-based approach to localize translocation breakpoints identifies the molecular basis of a t(4;22).

    PubMed

    Nimmakayalu, Manjunath A; Gotter, Anthony L; Shaikh, Tamim H; Emanuel, Beverly S

    2003-11-01

    Low copy repeats (LCRs) located in 22q11.2, especially LCR-B, are susceptible to rearrangements associated with several relatively common constitutional disorders. These include DiGeorge syndrome, Velocardiofacial syndrome, Cat-eye syndrome and recurrent translocations of 22q11 including the constitutional t(11;22) and t(17;22). The presence of palindromic AT-rich repeats (PATRRs) within LCR-B of 22q11.2, as well as within the 11q23 and 17q11 regions, has suggested a palindrome-mediated, stem-loop mechanism for the generation of such recurring constitutional 22q11.2 translocations. The mechanism responsible for non-recurrent 22q11.2 rearrangements is presently unknown due to the extensive effort required for breakpoint cloning. Thus, we have developed a novel fluorescence in-situ hybridization and primed in-situ hybridization (PRINS) approach and rapidly localized the breakpoint of a non-recurrent 22q11.2 translocation, a t(4;22). Multiple primer pairs were designed from the sequence of a 200 kb, chromosome 4, breakpoint-spanning BAC to generate PRINS probes. Amplification of adjacent primer pairs, labeled in two colors, allowed us to narrow the 4q35.1 breakpoint to a 6.7 kb clonable region. Application of our improved PRINS protocol facilitated fine-mapping the translocation breakpoints within 4q35.1 and 22q11.2, and permitted rapid cloning and analysis of translocation junction fragments. To confirm the PRINS localization results, PCR mapping of t(4;22) somatic cell hybrid DNA was employed. Analysis of the breakpoints demonstrates the presence of a 554 bp palindromic sequence at the chromosome 4 breakpoint and a 22q11.2 location within the same PATRR as the recurrent t(11;22) and t(17;22). The sequence of this breakpoint further suggests that a stem-loop secondary structure mechanism is responsible for the formation of other, non-recurrent translocations involving LCR-B of 22q11.2.

  1. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    PubMed Central

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

  2. TABASCO: A single molecule, base-pair resolved gene expression simulator

    PubMed Central

    Kosuri, Sriram; Kelly, Jason R; Endy, Drew

    2007-01-01

    Background Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene expression, and the goals of biotechnology research, both scientists and engineers would benefit from detailed simulators that can explicitly compute genome-wide expression levels as a function of individual molecular events, including the activities and interactions of molecules on DNA at single base pair resolution. However, for practical reasons including computational tractability, available simulators have not been able to represent genome-scale models of gene expression at this level of detail. Results Here we develop a simulator, TABASCO , which enables the precise representation of individual molecules and events in gene expression for genome-scale systems. We use a single molecule computational engine to track individual molecules interacting with and along nucleic acid polymers at single base resolution. Tabasco uses logical rules to automatically update and delimit the set of species and reactions that comprise a system during simulation, thereby avoiding the need for a priori specification of all possible combinations of molecules and reaction events. We confirm that single molecule, base-pair resolved simulation using TABASCO (Tabasco) can accurately compute gene expression dynamics and, moving beyond previous simulators, provide for the direct representation of intermolecular events such as polymerase collisions and promoter occlusion. We demonstrate the computational capacity of Tabasco by simulating the entirety of gene expression during bacteriophage T7 infection; for reference, the 39,937 base pair T7 genome encodes 56 genes that are transcribed by two types of RNA polymerases active across 22 promoters. Conclusion Tabasco enables genome-scale simulation of transcription and translation at individual molecule and single base-pair

  3. TABASCO: A single molecule, base-pair resolved gene expression simulator.

    PubMed

    Kosuri, Sriram; Kelly, Jason R; Endy, Drew

    2007-12-19

    Experimental studies of gene expression have identified some of the individual molecular components and elementary reactions that comprise and control cellular behavior. Given our current understanding of gene expression, and the goals of biotechnology research, both scientists and engineers would benefit from detailed simulators that can explicitly compute genome-wide expression levels as a function of individual molecular events, including the activities and interactions of molecules on DNA at single base pair resolution. However, for practical reasons including computational tractability, available simulators have not been able to represent genome-scale models of gene expression at this level of detail. Here we develop a simulator, TABASCO http://openwetware.org/wiki/TABASCO, which enables the precise representation of individual molecules and events in gene expression for genome-scale systems. We use a single molecule computational engine to track individual molecules interacting with and along nucleic acid polymers at single base resolution. Tabasco uses logical rules to automatically update and delimit the set of species and reactions that comprise a system during simulation, thereby avoiding the need for a priori specification of all possible combinations of molecules and reaction events. We confirm that single molecule, base-pair resolved simulation using TABASCO (Tabasco) can accurately compute gene expression dynamics and, moving beyond previous simulators, provide for the direct representation of intermolecular events such as polymerase collisions and promoter occlusion. We demonstrate the computational capacity of Tabasco by simulating the entirety of gene expression during bacteriophage T7 infection; for reference, the 39,937 base pair T7 genome encodes 56 genes that are transcribed by two types of RNA polymerases active across 22 promoters. Tabasco enables genome-scale simulation of transcription and translation at individual molecule and single base-pair

  4. Ferrocene-bis(thymine/uracil) conjugates: base pairing directed, spacer dependent self-assembly and supramolecular packing.

    PubMed

    Patwa, Amit N; Gonnade, Rajesh G; Kumar, Vaijayanti A; Bhadbhade, Mohan M; Ganesh, Krishna N

    2010-12-17

    X-ray crystallographic studies of methylene linked Ferrocene-bis(thymine/uracil) conjugates Fc(T:T)(M) and Fc(U:U)(M) reveal base dependent 2-D supramolecular assemblies generated via wobble self-pairing for bis-thymine and reverse wobble self-pairing for bis-uracil conjugates, differing in architecture from the corresponding butylene spacer linked conjugates.

  5. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    PubMed

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  6. Evaluation of the Project P.A.T.H.S. Based on Students' Weekly Diaries: Findings from Eight Datasets

    PubMed Central

    Shek, Daniel T. L.; Sun, Rachel C. F.

    2012-01-01

    This paper aims to investigate the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. (positive adolescent training through holistic social programmes) based on eight datasets collected between 2005 and 2009. A total of 1,138 students who participated in the program were randomly invited (from the whole grade or in some classes) to write a piece of journal in the form of a weekly diary in order to reveal their perceptions and feelings regarding the program and the perceived benefits of the program. Based on an integration of findings from different databases, results showed that the respondents generally (1) had positive views on the program, (2) had positive views on the instructors, and (3) perceived that they had acquired competencies at the societal, school, familial, interpersonal, and personal levels after joining the program. Acknowledging the limitations of diaries, the present qualitative findings provide support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong. PMID:22593676

  7. Evaluation of the project P.A.T.H.S. based on students' weekly diaries: findings from eight datasets.

    PubMed

    Shek, Daniel T L; Sun, Rachel C F

    2012-01-01

    This paper aims to investigate the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. (positive adolescent training through holistic social programmes) based on eight datasets collected between 2005 and 2009. A total of 1,138 students who participated in the program were randomly invited (from the whole grade or in some classes) to write a piece of journal in the form of a weekly diary in order to reveal their perceptions and feelings regarding the program and the perceived benefits of the program. Based on an integration of findings from different databases, results showed that the respondents generally (1) had positive views on the program, (2) had positive views on the instructors, and (3) perceived that they had acquired competencies at the societal, school, familial, interpersonal, and personal levels after joining the program. Acknowledging the limitations of diaries, the present qualitative findings provide support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong.

  8. Subjective outcome evaluation based on secondary data analyses: the project P.A.T.H.S. in Hong Kong.

    PubMed

    Shek, Daniel T L; Sun, Rachel C F

    2010-02-12

    The intent of this study was to evaluate the program effectiveness of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) (Secondary 1 Curriculum) by analyzing 207 school-based program reports, in which program implementers were invited to write down five conclusions based on an integration of the subjective outcome evaluation data collected from the program participants and program implementers. Secondary data analyses were conducted and 1,855 meaningful units were extracted from 1,035 "aggregated" conclusions. Among them, about 27 and 18% were related to perceptions of the program and implementers, respectively, and most of them were positive in nature. About one-third was related to perceived effectiveness of the program, and most of them referred to enhancement of students' development in societal, familial, interpersonal, and personal aspects. However, difficulties encountered during program implementation (3.34%) and recommendations for improvement (18.11%) were also reported. The present study replicated the findings reported in previous studies and suggests that the Tier 1 Program of the Project P.A.T.H.S. is beneficial to the development of the program participants.

  9. Expanding the scope of replicable unnatural DNA: stepwise optimization of a predominantly hydrophobic base pair.

    PubMed

    Lavergne, Thomas; Degardin, Mélissa; Malyshev, Denis A; Quach, Henry T; Dhami, Kirandeep; Ordoukhanian, Phillip; Romesberg, Floyd E

    2013-04-10

    As part of an ongoing effort to expand the genetic alphabet for in vitro and eventually in vivo applications, we have synthesized a wide variety of predominantly hydrophobic unnatural base pairs exemplified by d5SICS-dMMO2 and d5SICS-dNaM. When incorporated into DNA, the latter is replicated and transcribed with greater efficiency and fidelity than the former; however, previous optimization efforts identified the para and methoxy-distal meta positions of dMMO2 as particularly promising for further optimization. Here, we report the stepwise optimization of dMMO2 via the synthesis and evaluation of 18 novel para-derivatized analogs of dMMO2, followed by further derivatization and evaluation of the most promising analogs with meta substituents. Subject to size constraints, we find that para substituents can optimize replication via both steric and electronic effects and that meta methoxy groups are unfavorable, while fluoro substituents can be beneficial or deleterious depending on the para substituent. In addition, we find that improvements in the efficiency of unnatural triphosphate insertion translate most directly into higher fidelity replication. Importantly, we identify multiple, unique base pair derivatives that when incorporated into DNA are well replicated. The most promising, d5SICS-dFEMO, is replicated under some conditions with greater efficiency and fidelity than d5SICS-dNaM. These results clearly demonstrate the generality of hydrophobic forces for the control of base pairing within DNA, provide a wealth of new SAR data, and importantly identify multiple new candidates for eventual in vivo evaluation.

  10. From rigid base pairs to semiflexible polymers: coarse-graining DNA.

    PubMed

    Becker, Nils B; Everaers, Ralf

    2007-08-01

    The elasticity of double-helical DNA on a nm length scale is captured in detail by the rigid base-pair model, whose conformation variables are the relative positions and orientations of adjacent base pairs. Corresponding sequence-dependent elastic potentials have been obtained from all-atom MD simulation and from high-resolution structural data. On the scale of 100 nm, DNA is successfully described by a continuous wormlike chain model with homogeneous elastic properties, characterized by a set of four elastic constants which have been measured in single-molecule experiments. We present here a theory that links these experiments on different scales, by systematically coarse-graining the rigid base-pair model to an effective wormlike chain description. The average helical geometry of the molecule is accounted for exactly, and repetitive as well as random sequences are considered. Structural disorder is shown to produce a small, additive and short-range correction to thermal conformation fluctuations as well as to entropic elasticity. We also discuss the limits of applicability of the homogeneous wormlike chain on short scales, quantifying the anisotropy of bending stiffness, the non-Gaussian bend angle distribution and the variability of stiffness, all of which are noticeable below a helical turn. The coarse-grained elastic parameters show remarkable overall agreement with experimental wormlike chain stiffness. For the best-matching potential, bending persistence lengths of dinucleotide repeats span a range of 37-53 nm, with a random DNA value of 43 nm. While twist stiffness is somewhat underestimated and stretch stiffness is overestimated, the counterintuitive negative sign and the magnitude of the twist-stretch coupling agree with recent experimental findings.

  11. Adaptive total variation minimization-based image enhancement from flash and no-flash pairs.

    PubMed

    Yoon, Sang Min; Lee, Yeon Ju; Yoon, Gang-Joon; Yoon, Jungho

    2014-01-01

    We present a novel approach for enhancing the quality of an image captured from a pair of flash and no-flash images. The main idea for image enhancement is to generate a new image by combining the ambient light of the no-flash image and the details of the flash image. In this approach, we propose a method based on Adaptive Total Variation Minimization (ATVM) so that it has an efficient image denoising effect by preserving strong gradients of the flash image. Some numerical results are presented to demonstrate the effectiveness of the proposed scheme.

  12. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    PubMed

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  13. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    PubMed

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  14. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.

    2009-01-01

    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  15. Ion Pair in Extreme Aqueous Environments, Molecular-Based and Electric Conductance Approaches

    SciTech Connect

    Chialvo, Ariel A; Gruszkiewicz, Miroslaw {Mirek} S; Simonson, J Michael {Mike}; Palmer, Donald; Cole, David R

    2009-01-01

    We determine by molecular-based simulation the density profiles of the Na+!Cl! ion-pair association constant in steam environments along three supercritical isotherms to interrogate the behavior of ion speciation in dilute aqueous solutions at extreme conditions. Moreover, we describe a new ultra-sensitive flow-through electric conductance apparatus designed to bridge the gap between the currently lowest steam-density conditions at which we are experimentally able to attain electric conductance measurements and the theoretically-reachable zero-density limit. Finally, we highlight important modeling challenges encountered near the zero-density limit and discuss ways to overcome them.

  16. Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system

    NASA Astrophysics Data System (ADS)

    Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di

    2011-10-01

    Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.

  17. Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system.

    PubMed

    Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di

    2011-10-31

    Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.

  18. Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system

    PubMed Central

    2011-01-01

    Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip. PMID:22039926

  19. A Multiparty Controlled Bidirectional Quantum Secure Direct Communication and Authentication Protocol Based on EPR Pairs

    NASA Astrophysics Data System (ADS)

    Chang, Yan; Zhang, Shi-Bin; Yan, Li-Li; Sheng, Zhi-Wei

    2013-06-01

    A multiparty controlled bidirectional quantum secure direct communication and authentication protocol is proposed based on EPR pair and entanglement swapping. The legitimate identities of communicating parties are encoded to Bell states which act as a detection sequence. Secret messages are transmitted by using the classical XOR operation, which serves as a one-time-pad. No photon with secret information transmits in the quantum channel. Compared with the protocols proposed by Wang et al. [Acta Phys. Sin. 56 (2007) 673; Opt. Commun. 266 (2006) 732], the protocol in this study implements bidirectional communication and authentication, which defends most attacks including the ‘man-in-the-middle’ attack efficiently.

  20. Thermodynamics and kinetics for base pair opening in the DNA decamer duplexes containing cyclobutane pyrimidine dimer.

    PubMed

    Bang, Jongchul; Kang, Young-Min; Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2009-06-18

    The cyclobutane pyrimidine dimer (CPD) is one of the major classes of cytotoxic and carcinogenic DNA photoproducts induced by UV light. Hydrogen exchange rates of the imino protons were measured for various CPD-containing DNA duplexes to better understand the mechanism for CPD recognition by XPC-hHR23B. The results here revealed that double T.G mismatches in a CPD lesion significantly destabilized six consecutive base pairs compared to other DNA duplexes. This flexibility in a DNA duplex caused at the CPD lesions with double T.G mismatches might be the key factor for damage recognition by XPC-hHR23B.

  1. Robust EPR-pairs-based quantum secure communication with authentication resisting collective noise

    NASA Astrophysics Data System (ADS)

    Chang, Yan; Zhang, ShiBin; Li, Jian; Yan, LiLi

    2014-10-01

    This work presents two robust quantum secure communication schemes with authentication based on Einstein-Podolsky-Rosen (EPR) pairs, which can withstand collective noises. Two users previously share an identity string representing their identities. The identity string is encoded as decoherence-free states (termed logical qubits), respectively, over the two collective noisy channels, which are used as decoy photons. By using the decoy photons, both the authentication of two users and the detection of eavesdropping were implemented. The use of logical qubits not only guaranteed the high fidelity of exchanged secret message, but also prevented the eavesdroppers to eavesdrop beneath a mask of noise.

  2. A map of nucleosome positions in yeast at base-pair resolution.

    PubMed

    Brogaard, Kristin; Xi, Liqun; Wang, Ji-Ping; Widom, Jonathan

    2012-06-28

    The exact positions of nucleosomes along genomic DNA can influence many aspects of chromosome function. However, existing methods for mapping nucleosomes do not provide the necessary single-base-pair accuracy to determine these positions. Here we develop and apply a new approach for direct mapping of nucleosome centres on the basis of chemical modification of engineered histones. The resulting map locates nucleosome positions genome-wide in unprecedented detail and accuracy. It shows new aspects of the in vivo nucleosome organization that are linked to transcription factor binding, RNA polymerase pausing and the higher-order structure of the chromatin fibre.

  3. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  4. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?

    PubMed

    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro

    2015-06-25

    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  5. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  6. Program Implementers' Evaluation of the Project P.A.T.H.S.: Findings Based on Different Datasets over Time

    PubMed Central

    Shek, Daniel T. L.; Ma, Cecilia M. S.

    2012-01-01

    This paper integrates the evaluation findings based on program implementers in nine datasets collected from 2005 to 2009 (244 schools and 7,926 implementers). Using consolidated data with schools as the unit of analysis, results showed that program implementers generally had positive perceptions of the program, themselves, and benefits of the program, with more than four-fifths of the implementers regarding the program as beneficial to the program participants. The subjective outcome evaluation instrument was found to be internally consistent. Multiple regression analyses revealed that perceived qualities of the program and program implementers predicted perceived effectiveness of the program. In conjunction with evaluation findings based on other sources, the present study provides support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in Hong Kong. PMID:22629224

  7. Program implementers' evaluation of the project P.A.T.H.S.: findings based on different datasets over time.

    PubMed

    Shek, Daniel T L; Ma, Cecilia M S

    2012-01-01

    This paper integrates the evaluation findings based on program implementers in nine datasets collected from 2005 to 2009 (244 schools and 7,926 implementers). Using consolidated data with schools as the unit of analysis, results showed that program implementers generally had positive perceptions of the program, themselves, and benefits of the program, with more than four-fifths of the implementers regarding the program as beneficial to the program participants. The subjective outcome evaluation instrument was found to be internally consistent. Multiple regression analyses revealed that perceived qualities of the program and program implementers predicted perceived effectiveness of the program. In conjunction with evaluation findings based on other sources, the present study provides support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in Hong Kong.

  8. Matched molecular pair-based data sets for computer-aided medicinal chemistry.

    PubMed

    Hu, Ye; de la Vega de León, Antonio; Zhang, Bijun; Bajorath, Jürgen

    2014-01-01

    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community.

  9. Aromatic N versus aromatic F: bioisosterism discovered in RNA base pairing interactions leads to a novel class of universal base analogs.

    PubMed

    Koller, Alrun N; Bozilovic, Jelena; Engels, Joachim W; Gohlke, Holger

    2010-05-01

    The thermodynamics of base pairing is of fundamental importance. Fluorinated base analogs are valuable tools for investigating pairing interactions. To understand the influence of direct base-base interactions in relation to the role of water, pairing free energies between natural nucleobases and fluorinated analogs are estimated by potential of mean force calculations. Compared to pairing of AU and GC, pairing involving fluorinated analogs is unfavorable by 0.5-1.0 kcal mol(-1). Decomposing the pairing free energies into enthalpic and entropic contributions reveals fundamental differences for Watson-Crick pairs compared to pairs involving fluorinated analogs. These differences originate from direct base-base interactions and contributions of water. Pairing free energies of fluorinated base analogs with natural bases are less unfavorable by 0.5-1.0 kcal mol(-1) compared to non-fluorinated analogs. This is attributed to stabilizing C-F(...)H-N dipolar interactions and stronger N(...)H-C hydrogen bonds, demonstrating direct and indirect influences of fluorine. 7-methyl-7H-purine and its 9-deaza analog (Z) have been suggested as members of a new class of non-fluorinated base analogs. Z is found to be the least destabilizing universal base in the context of RNA known to date. This is the first experimental evidence for nitrogen-containing heterocylces as bioisosteres of aromatic rings bearing fluorine atoms.

  10. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  11. Synthesis and base pairing properties of DNA-RNA heteroduplex containing 5-hydroxyuridine.

    PubMed

    Cui, Song; Kim, Yong-Hoon; Jin, Cheng-Hao; Kim, Sang Kook; Rhee, Man-Hee; Kwon, Oh-Shin; Moon, Byung Jo

    2009-06-30

    5-Hydroxyuridine (5-OHU) is a major lesion of uridine and cytosine produced in RNA by various chemical oxidants. To elucidate its biochemical and biophysical effects on RNA replication, the site-specifically modified oligoribonucleotides containing 5-OHU were synthesized with C5-hydroxy-5'-O-DMTr-2'-TBDMS-uridine phosphoramidite using automated solid phase synthesis. The base-pairing properties of nucleotides opposite 5-OHU in 24 mer oligoribonulcleotides with dNTP were studied using three reverse transcriptases (Super-Script(TM)II-, AMV-, MMLV-RT) in cDNA synthesis. Adenine as well as guanine was incorporated preferentially by all reverse transcriptases. In the UV-melting temperature experiment, the results from the relative stabilities of the base pairs were A : 5-OHU > G : 5-OHU > T : 5-OHU approximately C : 5-OHU. Circular Dichroism (CD) studies showed that DNA-RNA containing 5-OHU heteroduplexes exhibit a similar conformation between the A-type RNA and B-type DNA. These results suggest that 5-OHU from oxidative damage was mainly influenced by adenine mismatch.

  12. A computational approach to map nucleosome positions and alternative chromatin states with base pair resolution

    PubMed Central

    Zhou, Xu; Blocker, Alexander W; Airoldi, Edoardo M; O'Shea, Erin K

    2016-01-01

    Understanding chromatin function requires knowing the precise location of nucleosomes. MNase-seq methods have been widely applied to characterize nucleosome organization in vivo, but generally lack the accuracy to determine the precise nucleosome positions. Here we develop a computational approach leveraging digestion variability to determine nucleosome positions at a base-pair resolution from MNase-seq data. We generate a variability template as a simple error model for how MNase digestion affects the mapping of individual nucleosomes. Applied to both yeast and human cells, this analysis reveals that alternatively positioned nucleosomes are prevalent and create significant heterogeneity in a cell population. We show that the periodic occurrences of dinucleotide sequences relative to nucleosome dyads can be directly determined from genome-wide nucleosome positions from MNase-seq. Alternatively positioned nucleosomes near transcription start sites likely represent different states of promoter nucleosomes during transcription initiation. Our method can be applied to map nucleosome positions in diverse organisms at base-pair resolution. DOI: http://dx.doi.org/10.7554/eLife.16970.001 PMID:27623011

  13. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  14. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  15. Yeast Pif1 helicase exhibits a one-base-pair stepping mechanism for unwinding duplex DNA.

    PubMed

    Ramanagoudr-Bhojappa, Ramanagouda; Chib, Shubeena; Byrd, Alicia K; Aarattuthodiyil, Suja; Pandey, Manjula; Patel, Smita S; Raney, Kevin D

    2013-05-31

    Kinetic analysis of the DNA unwinding and translocation activities of helicases is necessary for characterization of the biochemical mechanism(s) for this class of enzymes. Saccharomyces cerevisiae Pif1 helicase was characterized using presteady state kinetics to determine rates of DNA unwinding, displacement of streptavidin from biotinylated DNA, translocation on single-stranded DNA (ssDNA), and ATP hydrolysis activities. Unwinding of substrates containing varying duplex lengths was fit globally to a model for stepwise unwinding and resulted in an unwinding rate of ∼75 bp/s and a kinetic step size of 1 base pair. Pif1 is capable of displacing streptavidin from biotinylated oligonucleotides with a linear increase in the rates as the length of the oligonucleotides increased. The rate of translocation on ssDNA was determined by measuring dissociation from varying lengths of ssDNA and is essentially the same as the rate of unwinding of dsDNA, making Pif1 an active helicase. The ATPase activity of Pif1 on ssDNA was determined using fluorescently labeled phosphate-binding protein to measure the rate of phosphate release. The quantity of phosphate released corresponds to a chemical efficiency of 0.84 ATP/nucleotides translocated. Hence, when all of the kinetic data are considered, Pif1 appears to move along DNA in single nucleotide or base pair steps, powered by hydrolysis of 1 molecule of ATP.

  16. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  17. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  18. Excited states of DNA base pairs using long-range corrected time-dependent density functional theory.

    PubMed

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work, we present a study of the excitation energies of adenine, cytosine, guanine, thymine, and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC functionals, BNL, CAM-B3LYP, and LC-PBE0, with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement, a smaller attenuation parameter is needed, which leads to nonoptimum performance for ground-state properties. B3LYP, on the other hand, severely underestimates the charge-transfer (CT) transitions in the base pairs. Surprisingly, we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance is obtained with the LC-PBE0 functional, which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange. Thus, this work highlights the difficulties in obtained LC functionals, which provides a good description of both ground- and excited-state properties.

  19. Excited States of DNA Base Pairs Using Long-Range Corrected Time-Dependent Density Functional Theory

    SciTech Connect

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work we present a study of the excitation energies of adenine, cytosine, guanine, thymine and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC-functionals, BNL, CAM-B3LYP and LC-PBE0 with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement a smaller attenuation parameter was needed which leads to non-optimum performance for ground state properties. B3LYP, on the other hand, severely underestimates the charge transfer (CT) transitions in the base pairs. Surprisingly we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair, but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance was obtained with the LC-PBE0 functional which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange.

  20. Excited States of DNA Base Pairs Using Long-Range Corrected Time-Dependent Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Jensen, Lasse; Govind, Niranjan

    2009-08-01

    In this work, we present a study of the excitation energies of adenine, cytosine, guanine, thymine, and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC functionals, BNL, CAM-B3LYP, and LC-PBE0, with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement, a smaller attenuation parameter is needed, which leads to nonoptimum performance for ground-state properties. B3LYP, on the other hand, severely underestimates the charge-transfer (CT) transitions in the base pairs. Surprisingly, we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance is obtained with the LC-PBE0 functional, which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange. Thus, this work highlights the difficulties in obtained LC functionals, which provides a good description of both ground- and excited-state properties.

  1. Toward a designed genetic system with biochemical function: polymerase synthesis of single and multiple size-expanded DNA base pairs.

    PubMed

    Lu, Haige; Krueger, Andrew T; Gao, Jianmin; Liu, Haibo; Kool, Eric T

    2010-06-21

    The development of alternative architectures for genetic information-encoding systems offers the possibility of new biotechnological tools as well as basic insights into the function of the natural system. In order to examine the potential of benzo-expanded DNA (xDNA) to encode and transfer biochemical information, we carried out a study of the processing of single xDNA pairs by DNA Polymerase I Klenow fragment (Kf, an A-family sterically rigid enzyme) and by the Sulfolobus solfataricus polymerase Dpo4 (a flexible Y-family polymerase). Steady-state kinetics were measured and compared for enzymatic synthesis of the four correct xDNA pairs and twelve mismatched pairs, by incorporation of dNTPs opposite single xDNA bases. Results showed that, like Kf, Dpo4 in most cases selected the correctly paired partner for each xDNA base, but with efficiency lowered by the enlarged pair size. We also evaluated kinetics for extension by these polymerases beyond xDNA pairs and mismatches, and for exonuclease editing by the Klenow exo+ polymerase. Interestingly, the two enzymes were markedly different: Dpo4 extended pairs with relatively high efficiencies (within 18-200-fold of natural DNA), whereas Kf essentially failed at extension. The favorable extension by Dpo4 was tested further by stepwise synthesis of up to four successive xDNA pairs on an xDNA template.

  2. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-10-02

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures. © 2017 IOP Publishing Ltd.

  3. An efficient and near linear scaling pair natural orbital based local coupled cluster method

    NASA Astrophysics Data System (ADS)

    Riplinger, Christoph; Neese, Frank

    2013-01-01

    In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009), 10.1063/1.3173827]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 105-106 relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation

  4. Molecular dynamics simulation reveals conformational switching of water-mediated uracil-cytosine base-pairs in an RNA duplex.

    PubMed

    Schneider, C; Brandl, M; Sühnel, J

    2001-01-26

    A 4 ns molecular dynamics simulation of an RNA duplex (r-GGACUUCGGUCC)(2 )in solution with Na+ and Cl- as counterions was performed. The X-ray structure of this duplex includes two water-mediated uracil-cytosine pairs. In contrast to the other base-pairs in the duplex the water-mediated pairs switch between different conformations. One conformation corresponds to the geometry of the water-mediated UC pairs in the duplex X-ray structure with water acting both as hydrogen-bond donor and acceptor. Another conformation is close to that of a water-mediated UC base-pair found in the X-ray structure of the 23 S rRNA sarcin/ricin domain. In this case the oxygen of the water molecule is linked to two-base donor sites. For a very short time also a direct UC base-pair and a further conformation that is similar to the one found in the RNA duplex structure but exhibits an increased H3(U)...N3(C) distance is observed. Water molecules with unusually long residence times are involved in the water-mediated conformations. These results indicate that the dynamic behaviour of the water-mediated UC base-pairs differs from that of the duplex Watson-Crick and non-canonical guanine-uracil pairs with two or three direct hydrogen bonds. The conformational variability and increased flexibility has to be taken into account when considering these base-pairs as RNA building blocks and as recognition motifs. Copyright 2001 Academic Press.

  5. Isosteric and fluorescent DNA base pair formed by 4-amino-phthalimide and 2,4-diaminopyrimidine: melting, structure, and THz polar solvation dynamics.

    PubMed

    Dehmel, L; Berndt, F; Weinberger, M; Sajadi, M; Ioffe, I; Wagenknecht, H-A; Ernsting, N P

    2016-03-07

    An artificial base pair in the center of a duplex DNA oligomer, formed by 2,4-diaminopyrimidine and fluorescent 4-aminophthalimide C-nucleosides, is characterized spectroscopically, with a view towards its use in femtosecond solvation dynamics. Quantum-chemical calculations predict H-bonding energy equivalent to A:T. UV-vis absorption spectra provide insight into local melting at the 4-aminophthalimide modification site. Increase of temperature to nearly the melting temperature of the duplex leads to better hybridisation of the fluorescent nucleoside, contrary to native base pairs. This unusual observation is explained by the NMR solution structure of the duplex. Two conformations are adopted by the artificial pair due to backbone constraints, having either two or one interbase hydrogen bonds. In the latter, hydrogen bonding sites remain accessible for water solvation. The time-resolved dynamic Stokes' shift of 4-aminophthalimide fluorescence is consistent with that of a mixture of a slow and fast species. From the observations, the optimal linkage between 4-aminophthalimide and 2-deoxyribose for fitting into the duplex B-DNA structure is deduced.

  6. Evaluating changes in matrix based, recovery-adjusted concentrations in paired data for pesticides in groundwater

    USGS Publications Warehouse

    Zimmerman, Tammy M.; Breen, Kevin J.

    2012-01-01

    Pesticide concentration data for waters from selected carbonate-rock aquifers in agricultural areas of Pennsylvania were collected in 1993–2009 for occurrence and distribution assessments. A set of 30 wells was visited once in 1993–1995 and again in 2008–2009 to assess concentration changes. The data include censored matched pairs (nondetections of a compound in one or both samples of a pair). A potentially improved approach for assessing concentration changes is presented where (i) concentrations are adjusted with models of matrix-spike recovery and (ii) area-wide temporal change is tested by use of the paired Prentice-Wilcoxon (PPW) statistical test. The PPW results for atrazine, simazine, metolachlor, prometon, and an atrazine degradate, deethylatrazine (DEA), are compared using recovery-adjusted and unadjusted concentrations. Results for adjusted compared with unadjusted concentrations in 2008–2009 compared with 1993–1995 were similar for atrazine and simazine (significant decrease; 95% confidence level) and metolachlor (no change) but differed for DEA (adjusted, decrease; unadjusted, increase) and prometon (adjusted, decrease; unadjusted, no change). The PPW results were different on recovery-adjusted compared with unadjusted concentrations. Not accounting for variability in recovery can mask a true change, misidentify a change when no true change exists, or assign a direction opposite of the true change in concentration that resulted from matrix influences on extraction and laboratory method performance. However, matrix-based models of recovery derived from a laboratory performance dataset from multiple studies for national assessment, as used herein, rather than time- and study-specific recoveries may introduce uncertainty in recovery adjustments for individual samples that should be considered in assessing change.

  7. Simulation Based on Negative ion pair Techniques of Electric propulsion In Satellite Mission Using Chlorine Gas

    NASA Astrophysics Data System (ADS)

    Bakkiyaraj, R.

    R.Bakkiyaraj,Assistant professor,Government college of Engineering ,Bargur,Tamilnadu. *C.Sathiyavel, PG Student and Department of Aeronautical Engineering/Branch of Avionics, PSN college of Engineering and Technology,Tirunelveli,India. Abstract: Ion propulsion rocket system is expected to become popular with the development of ion-ion pair techniques because of their stimulated of low propellant, Design of repulsive between negative ions with low electric power and high efficiency. A Negative ion pair of ion propulsion rocket system is proposed in this work .Negative Ion Based Rocket system consists of three parts 1.ionization chamber 2. Repulsion force and ion accelerator 3. Exhaust of Nozzle. The Negative ions from electro negatively gas are produced by attachment of the gas ,such as chlorine with electron emitted from a Electron gun ionization chamber. The formulate of large stable negative ion is achievable in chlorine gas with respect to electron affinity (∆E). When a neutral chlorine atom in the gaseous form picks up an electron to form a cl- ion, it releases energy of 349 kJ/mol or 3.6 eV/atom. It is said to have an electron affinity of -349 kJ/mol ,the negative sign indicating that energy is released during this process .The distance between negative ions pair is important for the evaluation of the rocket thrust and is also determined by the exhaust velocity of the propellant. The mass flow rate of ions is related to the ion beam current. Accelerate the Negative ions to a high velocity in the thrust vector direction with a significantly intense grids and the exhaust of negative ions through Nozzle. The simulation of the ion propulsion system has been carried out by MATLAB. By comparing the simulation results with the theoretical and previous results, we have found that the proposed method is achieved of thrust value with low electric power for simulating the ion propulsion rocket system

  8. Nature of base stacking: reference quantum-chemical stacking energies in ten unique B-DNA base-pair steps.

    PubMed

    Sponer, Jirí; Jurecka, Petr; Marchan, Ivan; Luque, F Javier; Orozco, Modesto; Hobza, Pavel

    2006-03-20

    Base-stacking energies in ten unique B-DNA base-pair steps and some other arrangements were evaluated by the second-order Møller-Plesset (MP2) method, complete basis set (CBS) extrapolation, and correction for triple (T) electron-correlation contributions. The CBS(T) calculations were compared with decade-old MP2/6-31G*(0.25) reference data and AMBER force field. The new calculations show modest increases in stacking stabilization compared to the MP2/6-31G*(0.25) data and surprisingly large sequence-dependent variation of stacking energies. The absolute force-field values are in better agreement with the new reference data, while relative discrepancies between quantum-chemical (QM) and force-field values increase modestly. Nevertheless, the force field provides good qualitative description of stacking, and there is no need to introduce additional pair-additive electrostatic terms, such as distributed multipoles or out-of-plane charges. There is a rather surprising difference of about 0.1 A between the vertical separation of base pairs predicted by quantum chemistry and derived from crystal structures. Evaluations of different local arrangements of the 5'-CG-3' step indicate a sensitivity of the relative stacking energies to the level of calculation. Thus, describing quantitative relations between local DNA geometrical variations and stacking may be more complicated than usually assumed. The reference calculations are complemented by continuum-solvent assessment of solvent-screening effects.

  9. Pair breaking due to orbital magnetism in iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Hoyer, M.; Scheurer, M. S.; Syzranov, S. V.; Schmalian, J.

    2015-02-01

    We consider superconductivity in the presence of impurities in a two-band model suited for the description of iron-based superconductors. We analyze the effect of interband scattering processes on superconductivity, allowing for orbital, i.e., nonspin-magnetic but time-reversal symmetry-breaking impurities. Pair breaking in such systems is described by a nontrivial phase in an interband-scattering matrix element. We find that the transition temperature of conventional superconductors can be suppressed due to interband scattering, whereas unconventional superconductors may be unaffected. We also discuss the stability of density wave phases in the presence of impurities. As an example, we consider impurities associated with imaginary charge density waves that are of interest for iron-based superconductors.

  10. The Mutate-and-Map Protocol for Inferring Base Pairs in Structured RNA

    PubMed Central

    VanLang, Christopher C.; Das, Rhiju

    2014-01-01

    Chemical mapping is a widespread technique for structural analysis of nucleic acids in which a molecule’s reactivity to different probes is quantified at single nucleotide resolution and used to constrain structural modeling. This experimental framework has been extensively revisited in the past decade with new strategies for high-throughput readouts, chemical modification, and rapid data analysis. Recently, we have coupled the technique to high-throughput mutagenesis. Point mutations of a base paired nucleotide can lead to exposure of not only that nucleotide but also its interaction partner. Systematically carrying out the mutation and mapping for the entire system gives an experimental approximation of the molecule’s “contact map.” Here, we give our in-house protocol for this “mutate-and-map” (M2) strategy, based on 96-well capillary electrophoresis, and we provide practical tips on interpreting the data to infer nucleic acid structure. PMID:24136598

  11. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing.

    PubMed

    Riedl, Jan; Ding, Yun; Fleming, Aaron M; Burrows, Cynthia J

    2015-11-06

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand.

  12. The mutate-and-map protocol for inferring base pairs in structured RNA.

    PubMed

    Cordero, Pablo; Kladwang, Wipapat; VanLang, Christopher C; Das, Rhiju

    2014-01-01

    Chemical mapping is a widespread technique for structural analysis of nucleic acids in which a molecule's reactivity to different probes is quantified at single nucleotide resolution and used to constrain structural modeling. This experimental framework has been extensively revisited in the past decade with new strategies for high-throughput readouts, chemical modification, and rapid data analysis. Recently, we have coupled the technique to high-throughput mutagenesis. Point mutations of a base paired nucleotide can lead to exposure of not only that nucleotide but also its interaction partner. Systematically carrying out the mutation and mapping for the entire system gives an experimental approximation of the molecule's "contact map." Here, we give our in-house protocol for this "mutate-and-map" (M2) strategy, based on 96-well capillary electrophoresis, and we provide practical tips on interpreting the data to infer nucleic acid structure.

  13. Highly efficient nanofocusing based on a T-shape micro-slit surrounded with multi-slits.

    PubMed

    Chen, Jianjun; Wang, Chen; Lu, Guowei; Li, Wenqiang; Xiao, Jinghua; Gong, Qihuang

    2012-07-30

    Highly efficient plasmonic nanofocusing is proposed and demonstrated in a T-shape micro-slit surrounded by multi-slits. The nanofocusing phenomenon is achieved based on the multimode interference in the micro-slit, the constructive interference in the T-shape slit, and also the multiple-beam interference of the light radiated from the multi-slits and the transmitted light from the T-shape micro-slit. Because of the large illumination areas of the incident light on the wide slit aperture in the proposed structure, a large amount of light can pass through the wide slit. This leads to a highly efficient nanofocusing. Meanwhile, the wide slit means easy fabrication. In the experiment, the focusing phenomenon in the proposed structure was successfully demonstrated with a scanning near-field optical microscopy (SNOM) technology.

  14. Program implementers' evaluation of Project P.A.T.H.S. in Hong Kong: a study based on different cohorts.

    PubMed

    Shek, Daniel T L; Tsui, Pik Fong

    2012-09-07

    A total of 216 schools participated in the Tier 1 Program (Secondary 1, 2 and 3 levels) of Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in the 2008/09 school year. Based on the subjective outcome evaluation findings collected from students and instructors in each grade, the program implementers wrote down five conclusions in their reports. Utilizing secondary data analysis, the conclusions in the reports were further analyzed. Results showed that most of the conclusions concerning perceptions of the program, instructors and effectiveness of the program were positive in nature. There were also conclusions indicating difficulties encountered and recommendations for improvement. The result of the present study is consistent with previous studies using the same method as well as using other evaluation means for the same grades. The findings suggest that the Tier 1 Program is well received by the stakeholders and the program is effective in promoting the holistic development of adolescents.

  15. Cloud Base Height Measurements at Manila Observatory: Initial Results from Constructed Paired Sky Imaging Cameras

    NASA Astrophysics Data System (ADS)

    Lagrosas, N.; Tan, F.; Antioquia, C. T.

    2014-12-01

    Fabricated all sky imagers are efficient and cost effective instruments for cloud detection and classification. Continuous operation of this instrument can result in the determination of cloud occurrence and cloud base heights for the paired system. In this study, a fabricated paired sky imaging system - consisting two commercial digital cameras (Canon Powershot A2300) enclosed in weatherproof containers - is developed in Manila Observatory for the purpose of determining cloud base heights at the Manila Observatory area. One of the cameras is placed on the rooftop of Manila Observatory and the other is placed on the rooftop of the university dormitory, 489m from the first camera. The cameras are programmed to simultaneously gather pictures every 5 min. Continuous operation of these cameras were implemented since the end of May of 2014 but data collection started end of October 2013. The data were processed following the algorithm proposed by Kassianov et al (2005). The processing involves the calculation of the merit function that determines the area of overlap of the two pictures. When two pictures are overlapped, the minimum of the merit function corresponds to the pixel column positions where the pictures have the best overlap. In this study, pictures of overcast sky prove to be difficult to process for cloud base height and were excluded from processing. The figure below shows the initial results of the hourly average of cloud base heights from data collected from November 2013 to July 2014. Measured cloud base heights ranged from 250m to 1.5km. These are the heights of cumulus and nimbus clouds that are dominant in this part of the world. Cloud base heights are low in the early hours of the day indicating low convection process during these times. However, the increase in the convection process in the atmosphere can be deduced from higher cloud base heights in the afternoon. The decrease of cloud base heights after 15:00 follows the trend of decreasing solar

  16. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  17. Mode expansion and Bragg filtering for a high-fidelity fiber-based photon-pair Source.

    PubMed

    Ling, Alexander; Chen, Jun; Fan, Jingyun; Migdall, Alan

    2009-11-09

    We report the development of a fiber-based single spatial-mode source of photon-pairs where the efficiency of extracting photon-pairs is increased through the use of fiber-end expansion and Bragg filters. This improvement in efficiency enabled a spectrally bright and pure photon-pair source having a small second-order correlation function (0.03) and a raw spectral brightness of 44,700 pairs s(-1)nm(-1)mW(-1). The source can be configured to generate entangled photon-pairs, characterized via optimal and minimal quantum state tomography, to have a fidelity of 97% and tangle of 92%, without subtracting any background.

  18. Exploiting bounded signal flow for graph orientation based on cause-effect pairs.

    PubMed

    Dorn, Britta; Hüffner, Falk; Krüger, Dominikus; Niedermeier, Rolf; Uhlmann, Johannes

    2011-08-25

    We consider the following problem: Given an undirected network and a set of sender-receiver pairs, direct all edges such that the maximum number of "signal flows" defined by the pairs can be routed respecting edge directions. This problem has applications in understanding protein interaction based cell regulation mechanisms. Since this problem is NP-hard, research so far concentrated on polynomial-time approximation algorithms and tractable special cases. We take the viewpoint of parameterized algorithmics and examine several parameters related to the maximum signal flow over vertices or edges. We provide several fixed-parameter tractability results, and in one case a sharp complexity dichotomy between a linear-time solvable case and a slightly more general NP-hard case. We examine the value of these parameters for several real-world network instances. Several biologically relevant special cases of the NP-hard problem can be solved to optimality. In this way, parameterized analysis yields both deeper insight into the computational complexity and practical solving strategies.

  19. Current cross-correlations in double quantum dot based Cooper pair splitters with ferromagnetic leads

    NASA Astrophysics Data System (ADS)

    Wrześniewski, Kacper; Trocha, Piotr; Weymann, Ireneusz

    2017-05-01

    We investigate the current cross-correlations in a double quantum dot based Cooper pair splitter coupled to one superconducting and two ferromagnetic electrodes. The analysis is performed by assuming a weak coupling between the double dot and ferromagnetic leads, while the coupling to the superconductor is arbitrary. Employing the perturbative real-time diagrammatic technique, we study the Andreev transport properties of the device, focusing on the Andreev current cross-correlations, for various parameters of the model, both in the linear and nonlinear response regimes. Depending on parameters and transport regime, we find both positive and negative current cross-correlations. Enhancement of the former type of cross-correlations indicates transport regimes, in which the device works with high Cooper pair splitting efficiency, contrary to the latter type of correlations, which imply negative influence on the splitting. The processes and mechanisms leading to both types of current cross-correlations are thoroughly examined and discussed, giving a detailed insight into the Andreev transport properties of the considered device.

  20. Current cross-correlations in double quantum dot based Cooper pair splitters with ferromagnetic leads.

    PubMed

    Wrześniewski, Kacper; Trocha, Piotr; Weymann, Ireneusz

    2017-05-17

    We investigate the current cross-correlations in a double quantum dot based Cooper pair splitter coupled to one superconducting and two ferromagnetic electrodes. The analysis is performed by assuming a weak coupling between the double dot and ferromagnetic leads, while the coupling to the superconductor is arbitrary. Employing the perturbative real-time diagrammatic technique, we study the Andreev transport properties of the device, focusing on the Andreev current cross-correlations, for various parameters of the model, both in the linear and nonlinear response regimes. Depending on parameters and transport regime, we find both positive and negative current cross-correlations. Enhancement of the former type of cross-correlations indicates transport regimes, in which the device works with high Cooper pair splitting efficiency, contrary to the latter type of correlations, which imply negative influence on the splitting. The processes and mechanisms leading to both types of current cross-correlations are thoroughly examined and discussed, giving a detailed insight into the Andreev transport properties of the considered device.

  1. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    NASA Astrophysics Data System (ADS)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  2. STRAL: progressive alignment of non-coding RNA using base pairing probability vectors in quadratic time.

    PubMed

    Dalli, Deniz; Wilm, Andreas; Mainz, Indra; Steger, Gerhard

    2006-07-01

    Alignment of RNA has a wide range of applications, for example in phylogeny inference, consensus structure prediction and homology searches. Yet aligning structural or non-coding RNAs (ncRNAs) correctly is notoriously difficult as these RNA sequences may evolve by compensatory mutations, which maintain base pairing but destroy sequence homology. Ideally, alignment programs would take RNA structure into account. The Sankoff algorithm for the simultaneous solution of RNA structure prediction and RNA sequence alignment was proposed 20 years ago but suffers from its exponential complexity. A number of programs implement lightweight versions of the Sankoff algorithm by restricting its application to a limited type of structure and/or only pairwise alignment. Thus, despite recent advances, the proper alignment of multiple structural RNA sequences remains a problem. Here we present StrAl, a heuristic method for alignment of ncRNA that reduces sequence-structure alignment to a two-dimensional problem similar to standard multiple sequence alignment. The scoring function takes into account sequence similarity as well as up- and downstream pairing probability. To test the robustness of the algorithm and the performance of the program, we scored alignments produced by StrAl against a large set of published reference alignments. The quality of alignments predicted by StrAl is far better than that obtained by standard sequence alignment programs, especially when sequence homologies drop below approximately 65%; nevertheless StrAl's runtime is comparable to that of ClustalW.

  3. The selective tRNA aminoacylation mechanism based on a single G•U pair.

    PubMed

    Naganuma, Masahiro; Sekine, Shun-ichi; Chong, Yeeting Esther; Guo, Min; Yang, Xiang-Lei; Gamper, Howard; Hou, Ya-Ming; Schimmel, Paul; Yokoyama, Shigeyuki

    2014-06-26

    Ligation of tRNAs with their cognate amino acids, by aminoacyl-tRNA synthetases, establishes the genetic code. Throughout evolution, tRNA(Ala) selection by alanyl-tRNA synthetase (AlaRS) has depended predominantly on a single wobble base pair in the acceptor stem, G3•U70, mainly on the kcat level. Here we report the crystal structures of an archaeal AlaRS in complex with tRNA(Ala) with G3•U70 and its A3•U70 variant. AlaRS interacts with both the minor- and the major-groove sides of G3•U70, widening the major groove. The geometry difference between G3•U70 and A3•U70 is transmitted along the acceptor stem to the 3'-CCA region. Thus, the 3'-CCA region of tRNA(Ala) with G3•U70 is oriented to the reactive route that reaches the active site, whereas that of the A3•U70 variant is folded back into the non-reactive route. This novel mechanism enables the single wobble pair to dominantly determine the specificity of tRNA selection, by an approximate 100-fold difference in kcat.

  4. The selective tRNA aminoacylation mechanism based on a single G•U pair

    PubMed Central

    Naganuma, Masahiro; Sekine, Shun-ichi; Chong, Yeeting Esther; Guo, Min; Yang, Xiang-Lei; Gamper, Howard; Hou, Ya-Ming; Schimmel, Paul; Yokoyama, Shigeyuki

    2015-01-01

    Ligation of tRNAs with their cognate amino acids, by aminoacyl-tRNA synthetases, establishes the genetic code. Throughout evolution, tRNAAla selection by alanyl-tRNA synthetase (AlaRS) has depended predominantly on a single wobble base pair in the acceptor stem, G3•U70, mainly on the kcat level. Here we report the crystal structures of an archaeal AlaRS in complex with tRNAAla with G3•U70 and its A3•U70 variant. AlaRS interacts with both the minor- and major-groove sides of G3•U70, widening the major groove. The geometry difference between G3•U70 and A3•U70 is transmitted along the acceptor stem to the 3′-CCA region. Thus, the 3′-CCA region of tRNAAla with G3•U70 is oriented to the reactive route that reaches the active site, whereas that of the A3•U70 variant is folded back into the “non-reactive route”. This novel mechanism enables the single wobble pair to dominantly determine the specificity of tRNA selection, by an approximate 100-fold difference in kcat. PMID:24919148

  5. Theory of nodal s±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-Tc superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scattering channel,more » which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  6. Theory of nodal s±-wave pairing symmetry in the Pu-based 115 superconductor family

    PubMed Central

    Das, Tanmoy; Zhu, Jian-Xin; Graf, Matthias J.

    2015-01-01

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-Tc superconductors and predict the presence of a nodal s+− wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scattering channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s+− wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry. PMID:25721375

  7. Theory of nodal s±-wave pairing symmetry in the Pu-based 115 superconductor family

    SciTech Connect

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-Tc superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scattering channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.

  8. A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA

    PubMed Central

    Kladwang, Wipapat; Cordero, Pablo; Das, Rhiju

    2011-01-01

    We present a rapid experimental strategy for inferring base pairs in structured RNAs via an information-rich extension of classic chemical mapping approaches. The mutate-and-map method, previously applied to a DNA/RNA helix, systematically searches for single mutations that enhance the chemical accessibility of base-pairing partners distant in sequence. To test this strategy for structured RNAs, we have carried out mutate-and-map measurements for a 35-nt hairpin, called the MedLoop RNA, embedded within an 80-nt sequence. We demonstrate the synthesis of all 105 single mutants of the MedLoop RNA sequence and present high-throughput DMS, CMCT, and SHAPE modification measurements for this library at single-nucleotide resolution. The resulting two-dimensional data reveal visually clear, punctate features corresponding to RNA base pair interactions as well as more complex features; these signals can be qualitatively rationalized by comparison to secondary structure predictions. Finally, we present an automated, sequence-blind analysis that permits the confident identification of nine of the 10 MedLoop RNA base pairs at single-nucleotide resolution, while discriminating against all 1460 false-positive base pairs. These results establish the accuracy and information content of the mutate-and-map strategy and support its feasibility for rapidly characterizing the base-pairing patterns of larger and more complex RNA systems. PMID:21239468

  9. Role of the Closing Base Pair for d(GCA) Hairpin Stability: Free Energy Analysis and Folding Simulations

    SciTech Connect

    Kannan, Srinivasaraghavan; Zacharias, Martin W.

    2011-06-30

    Hairpin loops belong to the most important structural motifs in folded nucleic acids. The d(GNA) sequence in DNA can form very stable trinucleotide hairpin loops depending, however, strongly on the closing base pair. Replica-exchange molecular dynamics (REMD) were employed to study hairpin folding of two DNA sequences, d(gcGCAgc) and d(cgGCAcg), with the same central loop motif but different closing base pairs starting from singlestranded structures. In both cases, conformations of the most populated conformational cluster at the lowest temperature showed close agreement with available experimental structures. For the loop sequence with the less stable G:C closing base pair, an alternative loop topology accumulated as second most populated conformational state indicating a possible loop structural heterogeneity. Comparative-free energy simulations on induced loop unfolding indicated higher stability of the loop with a C:G closing base pair by 3 kcal mol1 (compared to a G:C closing base pair) in very good agreement with experiment. The comparative energetic analysis of sampled unfolded, intermediate and folded conformational states identified electrostatic and packing interactions as the main contributions to the closing base pair dependence of the d(GCA) loop stability.

  10. Quantum chemical studies of structures and binding in noncanonical RNA base pairs: the trans Watson-Crick:Watson-Crick family.

    PubMed

    Sharma, Purshotam; Mitra, Abhijit; Sharma, Sitansh; Singh, Harjinder; Bhattacharyya, Dhananjay

    2008-06-01

    The trans Watson-Crick/Watson-Crick family of base pairs represent a geometric class that play important structural and possible functional roles in the ribosome, tRNA, and other functional RNA molecules. They nucleate base triplets and quartets, participate as loop closing terminal base pairs in hair pin motifs and are also responsible for several tertiary interactions that enable sequentially distant regions to interact with each other in RNA molecules. Eleven representative examples spanning nine systems belonging to this geometric family of RNA base pairs, having widely different occurrence statistics in the PDB database, were studied at the HF/6-31G (d, p) level using Morokuma decomposition, Atoms in Molecules as well as Natural Bond Orbital methods in the optimized gas phase geometries and in their crystal structure geometries, respectively. The BSSE and deformation energy corrected interaction energy values for the optimized geometries are compared with the corresponding values in the crystal geometries of the base pairs. For non protonated base pairs in their optimized geometry, these values ranged from -8.19 kcal/mol to -21.84 kcal/mol and compared favorably with those of canonical base pairs. The interaction energies of these base pairs, in their respective crystal geometries, were, however, lesser to varying extents and in one case, that of A:A W:W trans, it was actually found to be positive. The variation in RMSD between the two geometries was also large and ranged from 0.32-2.19 A. Our analysis shows that the hydrogen bonding characteristics and interaction energies obtained, correlated with the nature and type of hydrogen bonds between base pairs; but the occurrence frequencies, interaction energies, and geometric variabilities were conspicuous by the absence of any apparent correlation. Instead, the nature of local interaction energy hyperspace of different base pairs as inferred from the degree of their respective geometric variability could be

  11. Fingerprint identification using SIFT-based minutia descriptors and improved all descriptor-pair matching.

    PubMed

    Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

    2013-03-06

    The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  12. Active destabilization of base pairs by a DNA glycosylase wedge initiates damage recognition.

    PubMed

    Kuznetsov, Nikita A; Bergonzo, Christina; Campbell, Arthur J; Li, Haoquan; Mechetin, Grigory V; de los Santos, Carlos; Grollman, Arthur P; Fedorova, Olga S; Zharkov, Dmitry O; Simmerling, Carlos

    2015-01-01

    Formamidopyrimidine-DNA glycosylase (Fpg) excises 8-oxoguanine (oxoG) from DNA but ignores normal guanine. We combined molecular dynamics simulation and stopped-flow kinetics with fluorescence detection to track the events in the recognition of oxoG by Fpg and its mutants with a key phenylalanine residue, which intercalates next to the damaged base, changed to either alanine (F110A) or fluorescent reporter tryptophan (F110W). Guanine was sampled by Fpg, as evident from the F110W stopped-flow traces, but less extensively than oxoG. The wedgeless F110A enzyme could bend DNA but failed to proceed further in oxoG recognition. Modeling of the base eversion with energy decomposition suggested that the wedge destabilizes the intrahelical base primarily through buckling both surrounding base pairs. Replacement of oxoG with abasic (AP) site rescued the activity, and calculations suggested that wedge insertion is not required for AP site destabilization and eversion. Our results suggest that Fpg, and possibly other DNA glycosylases, convert part of the binding energy into active destabilization of their substrates, using the energy differences between normal and damaged bases for fast substrate discrimination.

  13. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    PubMed Central

    Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

    2013-01-01

    The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements. PMID:23467056

  14. The Effect of Unitizing Word Pairs on Recollection Versus Familiarity-Based Retrieval— Further Evidence From ERPs

    PubMed Central

    Kamp, Siri-Maria; Bader, Regine; Mecklinger, Axel

    2016-01-01

    We investigated the contribution of familiarity and recollection to associative retrieval of word pairs depending on the extent to which the pairs have been unitized through task instructions in the encoding phase. Participants in the unitization condition encoded word pairs in the context of a definition that tied them together such that they were treated as a coherent new item, while in the control condition word pairs were inserted into a sentence frame in which each word remained an individual unit. Contrasting event-related potentials (ERERPs) elicited in a subsequent recognition test by old (intact) and recombined (a new combination of two words from different study pairs) word pairs, an early frontal effect, the putative ER P correlate of familiarity-based retrieval, was apparent in the unitization condition. The left parietal old/new effect, reflecting recollection-based retrieval, was elicited only in the control condition. This suggests that in the unitization condition only, familiarity was sufficiently diagnostic to distinguish old from recombined pairs, while in the control condition, recollection contributed to associative recognition. Our findings add to a body of literature suggesting that unitization of associations increases the relative contribution of familiarity to subsequent associative retrieval. PMID:28154613

  15. Integer Variable χ-Based Cross Twisted Ate Pairing and Its Optimization for Barreto-Naehrig Curve

    NASA Astrophysics Data System (ADS)

    Nogami, Yasuyuki; Sakemi, Yumi; Kato, Hidehiro; Akane, Masataka; Morikawa, Yoshitaka

    It is said that the lower bound of the number of iterations of Miller's algorithm for pairing calculation is log2 r/φ(k), where φ(·) is the Euler's function, r is the group order, and k is the embedding degree. Ate pairing reduced the number of the loops of Miller's algorithm of Tate pairing from ⌊log2 r⌋ to ⌊ log2(t-1)⌋, where t is the Frobenius trace. Recently, it is known to systematically prepare a pairing-friendly elliptic curve whose parameters are given by a polynomial of integer variable “χ.” For such a curve, this paper gives integer variable χ-based Ate (Xate) pairing that achieves the lower bound. In the case of the well-known Barreto-Naehrig pairing-friendly curve, it reduces the number of loops to ⌊log2χ⌋. Then, this paper optimizes Xate pairing for Barreto-Naehrig curve and shows its efficiency based on some simulation results.

  16. Semiclassical dynamics of electron attachment to guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Honda, Tomohiro; Minoshima, Yusuke; Yokoi, Yuki; Takayanagi, Toshiyuki; Shiga, Motoyuki

    2015-04-01

    Electron attachment dynamics to the guanine-cytosine (G-C) base pair in the gas phase is studied using DFT and molecular dynamics. The potential energy surface of the G-C anion is constructed with the empirical-valence-bond method using force-field information obtained from long-range corrected DFT calculations. Ring-polymer molecular dynamics simulations predict that the initial dipole-bound anion readily converts into the valence-bound anion within 0.1 ps and proton-transfer occurs subsequently within 10 ps. The same process was found in classical simulations, but on a much slower time scale. This result suggests that nuclear quantum effects are important in understanding DNA damage by low-energy electrons.

  17. High-speed True Random Number Generation Based on Paired Memristors for Security Electronics.

    PubMed

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-09-08

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and Internet of Things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaOx/Ta memristors fabricated in this work have fast programming/erasing speeds of ~30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation. © 2017 IOP Publishing Ltd.

  18. Confidence interval estimation of the difference between paired AUCs based on combined biomarkers.

    PubMed

    Tian, Lili; Vexler, Albert; Yan, Li; Schisterman, Enrique F

    2009-01-01

    In many diagnostic studies, multiple diagnostic tests are performed on each subject or multiple disease markers are available. Commonly, the information should be combined to improve the diagnostic accuracy. We consider the problem of comparing the discriminatory abilities between two groups of biomarkers. Specifically, this article focuses on confidence interval estimation of the difference between paired AUCs based on optimally combined markers under the assumption of multivariate normality. Simulation studies demonstrate that the proposed generalized variable approach provides confidence intervals with satisfying coverage probabilities at finite sample sizes. The proposed method can also easily provide P-values for hypothesis testing. Application to analysis of a subset of data from a study on coronary heart disease illustrates the utility of the method in practice.

  19. Pair normalized channel feature and statistics-based learning for high-performance pedestrian detection

    NASA Astrophysics Data System (ADS)

    Zeng, Bobo; Wang, Guijin; Ruan, Zhiwei; Lin, Xinggang; Meng, Long

    2012-07-01

    High-performance pedestrian detection with good accuracy and fast speed is an important yet challenging task in computer vision. We design a novel feature named pair normalized channel feature (PNCF), which simultaneously combines and normalizes two channel features in image channels, achieving a highly discriminative power and computational efficiency. PNCF applies to both gradient channels and color channels so that shape and appearance information are described and integrated in the same feature. To efficiently explore the formidably large PNCF feature space, we propose a statistics-based feature learning method to select a small number of potentially discriminative candidate features, which are fed into the boosting algorithm. In addition, channel compression and a hybrid pyramid are employed to speed up the multiscale detection. Experiments illustrate the effectiveness of PNCF and its learning method. Our proposed detector outperforms the state-of-the-art on several benchmark datasets in both detection accuracy and efficiency.

  20. A bilinear pairing based anonymous authentication scheme in wireless body area networks for mHealth.

    PubMed

    Jiang, Qi; Lian, Xinxin; Yang, Chao; Ma, Jianfeng; Tian, Youliang; Yang, Yuanyuan

    2016-11-01

    Wireless body area networks (WBANs) have become one of the key components of mobile health (mHealth) which provides 24/7 health monitoring service and greatly improves the quality and efficiency of healthcare. However, users' concern about the security and privacy of their health information has become one of the major obstacles that impede the wide adoption of WBANs. Anonymous and unlinkable authentication is critical to protect the security and privacy of sensitive physiological information in transit from the client to the application provider. We first show that the anonymous authentication scheme of Wang and Zhang based on bilinear pairing is prone to client impersonation attack. Then, we propose an enhanced anonymous authentication scheme to remedy the flaw in Wang and Zhang's scheme. We give the security analysis to demonstrate that the enhanced scheme achieves the desired security features and withstands various known attacks.

  1. Prediction of multidimensional drug dose responses based on measurements of drug pairs

    PubMed Central

    Zimmer, Anat; Katzir, Itay; Dekel, Erez; Alon, Uri

    2016-01-01

    Finding potent multidrug combinations against cancer and infections is a pressing therapeutic challenge; however, screening all combinations is difficult because the number of experiments grows exponentially with the number of drugs and doses. To address this, we present a mathematical model that predicts the effects of three or more antibiotics or anticancer drugs at all doses based only on measurements of drug pairs at a few doses, without need for mechanistic information. The model provides accurate predictions on available data for antibiotic combinations, and on experiments presented here on the response matrix of three cancer drugs at eight doses per drug. This approach offers a way to search for effective multidrug combinations using a small number of experiments. PMID:27562164

  2. Prediction of multidimensional drug dose responses based on measurements of drug pairs.

    PubMed

    Zimmer, Anat; Katzir, Itay; Dekel, Erez; Mayo, Avraham E; Alon, Uri

    2016-09-13

    Finding potent multidrug combinations against cancer and infections is a pressing therapeutic challenge; however, screening all combinations is difficult because the number of experiments grows exponentially with the number of drugs and doses. To address this, we present a mathematical model that predicts the effects of three or more antibiotics or anticancer drugs at all doses based only on measurements of drug pairs at a few doses, without need for mechanistic information. The model provides accurate predictions on available data for antibiotic combinations, and on experiments presented here on the response matrix of three cancer drugs at eight doses per drug. This approach offers a way to search for effective multidrug combinations using a small number of experiments.

  3. Efficient Deactivation of a Model Base Pair via Excited-State Hydrogen Transfer

    NASA Astrophysics Data System (ADS)

    Schultz, Thomas; Samoylova, Elena; Radloff, Wolfgang; Hertel, Ingolf V.; Sobolewski, Andrzej L.; Domcke, Wolfgang

    2004-12-01

    We present experimental and theoretical evidence for an excited-state deactivation mechanism specific to hydrogen-bonded aromatic dimers, which may account, in part, for the photostability of the Watson-Crick base pairs in DNA. Femtosecond time-resolved mass spectroscopy of 2-aminopyridine clusters reveals an excited-state lifetime of 65 +/- 10 picoseconds for the near-planar hydrogen-bonded dimer, which is significantly shorter than the lifetime of either the monomer or the 3- and 4-membered nonplanar clusters. Ab initio calculations of reaction pathways and potential-energy profiles identify the mechanism of the enhanced excited-state decay of the dimer: Conical intersections connect the locally excited 1ππ* state and the electronic ground state with a 1ππ* charge-transfer state that is strongly stabilized by the transfer of a proton.

  4. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

    PubMed Central

    2016-01-01

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

  5. Wavelet transform based on the optimal wavelet pairs for tunable diode laser absorption spectroscopy signal processing.

    PubMed

    Li, Jingsong; Yu, Benli; Fischer, Horst

    2015-04-01

    This paper presents a novel methodology-based discrete wavelet transform (DWT) and the choice of the optimal wavelet pairs to adaptively process tunable diode laser absorption spectroscopy (TDLAS) spectra for quantitative analysis, such as molecular spectroscopy and trace gas detection. The proposed methodology aims to construct an optimal calibration model for a TDLAS spectrum, regardless of its background structural characteristics, thus facilitating the application of TDLAS as a powerful tool for analytical chemistry. The performance of the proposed method is verified using analysis of both synthetic and observed signals, characterized with different noise levels and baseline drift. In terms of fitting precision and signal-to-noise ratio, both have been improved significantly using the proposed method.

  6. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs.

    PubMed

    Fang, Wei; Chen, Ji; Rossi, Mariana; Feng, Yexin; Li, Xin-Zheng; Michaelides, Angelos

    2016-06-02

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general.

  7. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed Central

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-01-01

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure. PMID:7519767

  8. Formation of sheared G:A base pairs in an RNA duplex modelled after ribozymes, as revealed by NMR.

    PubMed

    Katahira, M; Kanagawa, M; Sato, H; Uesugi, S; Fujii, S; Kohno, T; Maeda, T

    1994-07-25

    The thermal stability and structure of an RNA duplex, r(GGACGAGUCC)2, the base sequence of which was modelled after both a hammerhead ribozyme and a lead ribozyme, were studied by CD and NMR. We previously demonstrated that the corresponding DNA duplex, d(GGACGAGTCC)2, formed unique 'sheared' G:A base pairs, where an amino proton, instead of an imino proton, of G is involved in the hydrogen bonding, and G and A bases are arranged 'side by side' instead of 'head to head' (Nucleic Acids Res. (1993) 21, 5418-5424). CD melting profiles showed that the RNA duplex is thermally more stable than the corresponding DNA duplex. NMR studies revealed that sheared G:A base pairs are formed in the RNA duplex, too, although the overall structure of the RNA is the A form, which differs from the B form taken on by the corresponding DNA. A model building study confirmed that sheared G:A base pairs can be accommodated in the double helical structure of the A form. A difference between the RNA and DNA duplexes in the stacking interaction involving G:A mismatch bases is also suggested. The demonstration that sheared G:A base pairs can be formed not only in DNA but also in RNA suggests that this base pairing plays an important role regarding the RNA structure.

  9. DNA . RNA heteroduplex containing 8-oxo-7,8-dihydroguanosine: base pairing, structures, and thermodynamic stability.

    PubMed

    Kim, Sang Kook; Lee, Sung Hwa; Kwon, Oh-Shin; Moon, Byung Jo

    2004-11-30

    Oligoribonucleotides containing 8-oxo-7,8-dihydroguanosine (8-oxoG) and 8-oxo-7,8-dihydro-2'-O-methylguanosine (8-oxoG-Me) were synthesized. The base pairing properties of 8-oxoG and 8-oxoG-Me in oligoribonucleotide in cDNA synthesis by reverse transcriptases were studied. dCMP was preferentially incorporated into the site opposite 8-oxoG or 8-oxoG-Me than into other dNMPs. TMP and dCMP were inserted preferentially into sites opposite 8-oxoG or 8-oxoG by reverse transcriptases. HIV-RT did not incorporate TMP, but RAV2-RT incorporated 50% more TMP than dCMP into the site opposite 8-oxoG. In the site opposite 8-oxoG-Me TMP was substantially incorporated by HIV-RT or RAV2-RT. Thermodynamic analysis of the DNA.RNA heteroduplex containing 8-oxoG revealed that 8-oxoG and 8-oxoG-Me formed base pairs with cytidine and thymidine with similar stability. The thermodynamic parameter (DeltaG degrees ) demonstrated that the formation of duplexes between 8-oxoG or 8-oxoG-Me and cytidine or thymidine is more thermodynamically favorable than with adenosine and guanosine. However, differences in the melting temperature and DeltaG degrees 's of 8-oxoG/dC and 8-oxoG/T were much smaller than between G/dC and G/T. CD spectra showed that DNA . RNA containing 8-oxoG or 8-oxoG-Me duplexes showed similarities between the A-type RNA and B-type DNA conformations.

  10. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  11. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  12. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    PubMed

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  13. A population-based study of shared genetic variation between premorbid IQ and psychosis among male twin pairs and sibling pairs from Sweden.

    PubMed

    Fowler, Tom; Zammit, Stanley; Owen, Michael J; Rasmussen, Finn

    2012-05-01

    The strong association between lower IQ and risk for psychosis has led to the suggestion that the search for genes influencing cognition may provide a useful strategy for examining the genetic origins of psychosis. However, research in this area has generally used designs in which twin pairs are selected by case status and with assessment of IQ after the onset of psychosis rather than longitudinal population-based samples. To examine the relationship and shared genetic origin between premorbid IQ and psychotic disorders in a longitudinal population-based cohort. Genetically informative longitudinal study. Population-based cohort in Sweden. Individuals were identified from the population-based Swedish Multi-Generation Register and consisted of male sibling (n = 369 960), monozygotic twin (n = 1986), and dizygotic twin (n = 2253) pairs born between January 1951 and December 1976. Their IQs were measured during compulsory military conscription. Individuals having a subsequent diagnosis of psychosis were identified via the Swedish National Hospital Discharge Register. Heritability estimates for IQ and psychosis were similar to previous estimates, approximately 69% and 56%, respectively. However, the phenotypic correlation between IQ and psychosis was only -0.11, of which 91% was due to shared genetic influences. The proportion of genetic variance for psychosis shared with that for IQ was approximately 7%. Using IQ as a phenotype to identify genes that have an important role in the genetic origin of schizophrenia is unlikely to be a successful strategy. The low correlation seen in this study between premorbid IQ and psychosis vs the higher correlations reported in the literature with postmorbid IQ suggests the correlation between these phenotypes has more to do with the influence that the onset of psychosis has on cognitive functioning than with shared genetic origin.

  14. Quantifying Magnetic Sensitivity of Radical Pair Based Compass by Quantum Fisher Information.

    PubMed

    Guo, Li-Sha; Xu, Bao-Ming; Zou, Jian; Shao, Bin

    2017-07-19

    The radical pair (RP) based compass is considered as one of the principal models of avian magnetoreception. Different from the conventional approach where the sensitivity of RP based compass is described by the singlet yield, we introduce the quantum Fisher information (QFI), which represents the maximum information about the magnetic field's direction extracted from the RP state, to quantify the sensitivity of RP based compass. The consistency between our results and experimental observations suggests that the QFI may serve as a measure to describe the sensitivity of RP based compass. Besides, within the framework of quantum metrology, we give two specific possible measurement schemes and find that the conventional singlet yield is corresponding to the measurement of total angular momentum. Moreover, we show that the measurement of fluctuation of the total magnetic moment is much more accurate than the singlet yield measurement, and is close to the optimal measurement scheme. Finally, the effects of entanglement and decoherence are also discussed in the spirit of our approach.

  15. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  16. Characterization of the trans Watson-Crick GU base pair located in the catalytic core of the antigenomic HDV ribozyme.

    PubMed

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme's folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U(23) and G(28) nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U(23) and G(28) can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction.

  17. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  18. Cell pairing using a dielectrophoresis-based device with interdigitated array electrodes.

    PubMed

    Şen, Mustafa; Ino, Kosuke; Ramón-Azcón, Javier; Shiku, Hitoshi; Matsue, Tomokazu

    2013-09-21

    We present a chip device with an array of 900 gourd-shaped microwells designed to pair single cells of different types. The device consists of interdigitated array (IDA) electrodes and uses positive dielectrophoresis to trap cells within the microwells. Each side of a microwell is on a different comb of the IDA, so that cells of different types are trapped on opposite sides of the microwells, leading to close cell pairing. Using this device, a large number of cell pairs can be formed easily and rapidly, making it a highly attractive tool for controllable cell pairing in a range of biological applications.

  19. Structures, physicochemical properties, and applications of T-Hg(II)-T, C-Ag(I)-C, and other metallo-base-pairs.

    PubMed

    Tanaka, Yoshiyuki; Kondo, Jiro; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, Takenori; Saneyoshi, Hisao; Urata, Hidehito; Torigoe, Hidetaka; Ono, Akira

    2015-12-21

    Recently, metal-mediated base-pairs (metallo-base-pairs) have been studied extensively with the aim of exploring novel base-pairs; their structures, physicochemical properties, and applications have been studied. This trend has become more evident after the discovery of Hg(II)-mediated thymine-thymine (T-Hg(II)-T) and Ag(I)-mediated cytosine-cytosine (C-Ag(I)-C) base-pairs. In this article, we focus on the basic science and applications of these metallo-base-pairs, which are composed of natural bases.

  20. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    PubMed

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  1. biobambam: tools for read pair collation based algorithms on BAM files

    PubMed Central

    2014-01-01

    Background Sequence alignment data is often ordered by coordinate (id of the reference sequence plus position on the sequence where the fragment was mapped) when stored in BAM files, as this simplifies the extraction of variants between the mapped data and the reference or of variants within the mapped data. In this order paired reads are usually separated in the file, which complicates some other applications like duplicate marking or conversion to the FastQ format which require to access the full information of the pairs. Results In this paper we introduce biobambam, a set of tools based on the efficient collation of alignments in BAM files by read name. The employed collation algorithm avoids time and space consuming sorting of alignments by read name where this is possible without using more than a specified amount of main memory. Using this algorithm tasks like duplicate marking in BAM files and conversion of BAM files to the FastQ format can be performed very efficiently with limited resources. We also make the collation algorithm available in the form of an API for other projects. This API is part of the libmaus package. Conclusions In comparison with previous approaches to problems involving the collation of alignments by read name like the BAM to FastQ or duplication marking utilities our approach can often perform an equivalent task more efficiently in terms of the required main memory and run-time. Our BAM to FastQ conversion is faster than all widely known alternatives including Picard and bamUtil. Our duplicate marking is about as fast as the closest competitor bamUtil for small data sets and faster than all known alternatives on large and complex data sets.

  2. Inter-strand coupling and base pairing sequences in DNA charge transport.

    NASA Astrophysics Data System (ADS)

    Yudiarsah, Efta; Ulloa, Sergio

    2006-03-01

    The electronic transport properties of double-stranded DNA are studied using a tight-binding Hamiltonian. Transfer and scattering matrix methods for double strands are employed simultaneously in the calculation, guaranteeing numerical stability. Realistic on-site energies [1] and hopping constants are used in the model [2]. The role of inter-strand coupling is shown to be extremely important for random sequences typical of genetic DNA. In contrast, inter-strand coupling only changes slightly the charge transport properties for more periodic sequences. The effect of base-pairing across strands and details of the sequences were investigated. Our model shows that the resistance of DNA depends on the sequences and the ratio of the bases. This agrees with previous results by Roche [3]. The resistance is also shown to increase with the concentration of different bases in a homogenous strand, and we find that for certain sequences only short-range electronic transport is possible.[1] H. Sugiyama and I. Saito, J. Am. Chem. Soc. 118, 7063 (1996).[2] A. A. Voityuk, J. Jortner, M. Bixon, and N. Rosch, J. Chem. Phys. 114, 5614 (2001).[3] S. Roche, Phys. Rev. Lett. 91, 108101 (2003).

  3. Enhanced reduced representation bisulfite sequencing for assessment of DNA methylation at base pair resolution.

    PubMed

    Garrett-Bakelman, Francine E; Sheridan, Caroline K; Kacmarczyk, Thadeous J; Ishii, Jennifer; Betel, Doron; Alonso, Alicia; Mason, Christopher E; Figueroa, Maria E; Melnick, Ari M

    2015-02-24

    DNA methylation pattern mapping is heavily studied in normal and diseased tissues. A variety of methods have been established to interrogate the cytosine methylation patterns in cells. Reduced representation of whole genome bisulfite sequencing was developed to detect quantitative base pair resolution cytosine methylation patterns at GC-rich genomic loci. This is accomplished by combining the use of a restriction enzyme followed by bisulfite conversion. Enhanced Reduced Representation Bisulfite Sequencing (ERRBS) increases the biologically relevant genomic loci covered and has been used to profile cytosine methylation in DNA from human, mouse and other organisms. ERRBS initiates with restriction enzyme digestion of DNA to generate low molecular weight fragments for use in library preparation. These fragments are subjected to standard library construction for next generation sequencing. Bisulfite conversion of unmethylated cytosines prior to the final amplification step allows for quantitative base resolution of cytosine methylation levels in covered genomic loci. The protocol can be completed within four days. Despite low complexity in the first three bases sequenced, ERRBS libraries yield high quality data when using a designated sequencing control lane. Mapping and bioinformatics analysis is then performed and yields data that can be easily integrated with a variety of genome-wide platforms. ERRBS can utilize small input material quantities making it feasible to process human clinical samples and applicable in a range of research applications. The video produced demonstrates critical steps of the ERRBS protocol.

  4. Novel H⁺-Ion Sensor Based on a Gated Lateral BJT Pair.

    PubMed

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-12-23

    An H⁺-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H⁺-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology.

  5. The computation of cloud base height from paired whole-sky imaging cameras

    SciTech Connect

    Allmen, M.C.; Kegelmeyer, W.P. Jr.

    1994-03-01

    A major goal for global change studies is to improve the accuracy of general circulation models (GCMs) capable of predicting the timing and magnitude of greenhouse gas-induced global warming. Research has shown that cloud radiative feedback is the single most important effect determining the magnitude of possible climate responses to human activity. Of particular value to reducing the uncertainties associated with cloud-radiation interactions is the measurement of cloud base height (CBH), both because it is a dominant factor in determining the infrared radiative properties of clouds with respect to the earth`s surface and lower atmosphere and because CBHs are essential to measuring cloud cover fraction. We have developed a novel approach to the extraction of cloud base height from pairs of whole sky imaging (WSI) cameras. The core problem is to spatially register cloud fields from widely separated WSI cameras; this complete, triangulation provides the CBH measurements. The wide camera separation (necessary to cover the desired observation area) and the self-similarity of clouds defeats all standard matching algorithms when applied to static views of the sky. To address this, our approach is based on optical flow methods that exploit the fact that modern WSIs provide sequences of images. We will describe the algorithm and present its performance as evaluated both on real data validated by ceilometer measurements and on a variety of simulated cases.

  6. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    PubMed Central

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-01-01

    An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

  7. NMR and molecular modeling evidence for a Gter dot A mismatch base pair in a purine-rich DNA duplex

    SciTech Connect

    Li, Ying; Wilson, W.D. ); Zon, G. )

    1991-01-01

    {sup 1}H NMR experiments indicate that the oligomer 5{prime}-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G{center dot}A base pairs and a 3{prime} unpaired adenosine. NMR results indicate that guanoxine imino protons of the F{center dot}A mismatches are not hydrogen bonded but are stacked in the helix. A G{r arrow} I substitution in either G{center dot}A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1{prime} of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G{center dot}A base pairs containing A-NH{sub 2} to GN3 and G-NH{sub 2} to AN7 hydrogen bonds and B-form base pairs on both sides of the G{center dot}A pairs (5{prime}-d(ATGAGC)). The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH{sub 2} of the mismatch to a phosphate oxygen is predicted.

  8. Sensitive detection for coralyne and mercury ions based on homo-A/T DNA by exonuclease signal amplification.

    PubMed

    Huang, Hailiang; Shi, Shuo; Zheng, Xuyue; Yao, Tianming

    2015-09-15

    Based on specific homo-A/T DNA binding properties, a strategy for coralyne and mercury ions detection was realised by exonuclease-aided signal amplification. Coralyne could specifically bind homo-A DNA and protect it from the hydrolysis of exonuclease I. The coralyne-protected DNA was subsequently used as a trigger strand to hydrolyze DNA2 in exonuclease-aided signal amplification process. Thiazole orange was used to quantify the remainder DNA2. Under the optimal condition, the fluorescence intensity was linearly proportional to the concentration of coralyne in the range of 0.2-100 nM with a limit of detection (LOD) of 0.31 nM, which presented the lowest LOD for coralyne among all reported. With homo-T and Hg(2+) taking the place of homo-A DNA and coralyne, respectively, the system could also be used for Hg(2+) detection. The experiments in real samples also showed good results. This method was label-free, low-cost, easy-operating and highly repeatable for the detection of coralyne and mercury ions. It could also be extended to detect various analytes, such as other metal ions, proteins and small molecules by using appropriate aptamers. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The tolerance to exchanges of the Watson Crick base pair in the hammerhead ribozyme core is determined by surrounding elements.

    PubMed

    Przybilski, Rita; Hammann, Christian

    2007-10-01

    Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson-Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson-Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3-R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem-loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson-Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes.

  10. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  11. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs

    NASA Astrophysics Data System (ADS)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  12. Cloud-Base-Height Estimation from Paired Ground-Based Hemispherical Observations

    SciTech Connect

    Kassianov, Evgueni I.; Long, Charles N.; Christy, Jason E.

    2005-08-01

    The Total Sky Imager (TSI) and Hemispheric Sky Imager (HSI) each have a hemispherical field-of-view (FOV) and many TSIs are now deployed. Currently, these instruments have been used routinely to provide a time series of the fractional sky cover only. In this study, we examine the possible retrieval of cloud base height (CBH) from TSI surface observations. This paper presents a validation analysis of a new retrieval using both a model-output inverse problem and independent, ground-based Micropulse Lidar data. The obtained results suggest that, at least for single layer cloud fields, moderately accurate (within ~0.35 km) CBH retrieval is possible.

  13. Research on pairing method of chromosome of endangered amphioxus based on digital image processing technology

    NASA Astrophysics Data System (ADS)

    Li, Jinping; Jia, Hongwei; Mu, Hongshan; Tan, Hai

    2010-07-01

    This paper studies a new method for chromosome pairing of amphioxus using digital image processing technology, selects chromosome banding image of amphioxus Branchiostoma belcheri tsingtauense as experimental material, compares and analyzes objective data such as perimeter, long axis and short axis of the chromosome, and realizes chromosome pairing of amphioxus with Reference to band feature of Laplace and Sobel edge detection as pairing supplement. According to objective data obtained from the program, this method improves the subjective pairing method which uses image processing software to measure long arm and short arm of the chromosome. The results show that the pairing method is effective, accurate and practical. This study has important theoretical and practical significance for further study of chromosome gene mapping and cell genetics of amphioxus.

  14. Density functional theory studies of interactions of ruthenium-arene complexes with base pair steps.

    PubMed

    Mutter, Shaun T; Platts, James A

    2011-10-20

    Density functional theory (DFT) calculations have been performed to determine the strength and geometry of intermolecular interactions of "piano-stool" ruthenium arene complexes, which show potential as anticancer treatments. Model complexes with methane and benzene indicate that the coordinated arene has C-H···π acceptor ability similar to that of free benzene, whereas this arene acts as a much stronger C-H donor or partner in π-stacking than free benzene. The source of these enhanced interactions is identified as a combination of electrostatic and dispersion effects. Complexes of Ru-arene complexes with base-pair step fragments of DNA, in which the arene has the potential to act as an intercalator, have also been investigated. Binding energies are found to be sensitive to the size and nature of the arene, with larger and more flexible arenes having stronger binding. π-stacking and C-H···π interactions between arene and DNA bases and hydrogen bonds from coordinated N-H to DNA oxygen atoms, as well as covalent Ru-N bonding, contribute to the overall binding. The effect of complexation on DNA structure is also examined, with larger rise and more negative slide values than canonical B-DNA observed in all cases.

  15. A Bayesian Target Predictor Method based on Molecular Pairing Energies estimation

    PubMed Central

    Oliver, Antoni; Canals, Vincent; Rosselló, Josep L.

    2017-01-01

    Virtual screening (VS) is applied in the early drug discovery phases for the quick inspection of huge molecular databases to identify those compounds that most likely bind to a given drug target. In this context, there is the necessity of the use of compact molecular models for database screening and precise target prediction in reasonable times. In this work we present a new compact energy-based model that is tested for its application to Virtual Screening and target prediction. The model can be used to quickly identify active compounds in huge databases based on the estimation of the molecule’s pairing energies. The greatest molecular polar regions along with its geometrical distribution are considered by using a short set of smart energy vectors. The model is tested using similarity searches within the Directory of Useful Decoys (DUD) database. The results obtained are considerably better than previously published models. As a Target prediction methodology we propose the use of a Bayesian Classifier that uses a combination of different active compounds to build an energy-dependent probability distribution function for each target. PMID:28263323

  16. A Bayesian Target Predictor Method based on Molecular Pairing Energies estimation

    NASA Astrophysics Data System (ADS)

    Oliver, Antoni; Canals, Vincent; Rosselló, Josep L.

    2017-03-01

    Virtual screening (VS) is applied in the early drug discovery phases for the quick inspection of huge molecular databases to identify those compounds that most likely bind to a given drug target. In this context, there is the necessity of the use of compact molecular models for database screening and precise target prediction in reasonable times. In this work we present a new compact energy-based model that is tested for its application to Virtual Screening and target prediction. The model can be used to quickly identify active compounds in huge databases based on the estimation of the molecule’s pairing energies. The greatest molecular polar regions along with its geometrical distribution are considered by using a short set of smart energy vectors. The model is tested using similarity searches within the Directory of Useful Decoys (DUD) database. The results obtained are considerably better than previously published models. As a Target prediction methodology we propose the use of a Bayesian Classifier that uses a combination of different active compounds to build an energy-dependent probability distribution function for each target.

  17. Interaction Energies and Dynamics of Acid–Base Pairs Isolated in Cavitands

    PubMed Central

    Purse, Byron W.; Butterfield, Sara M.; Ballester, Pablo; Shivanyuk, Alexander; Rebek, Julius

    2009-01-01

    The use of capsules and cavitands in physical organic chemistry is briefly reviewed, and their application to the study of salt bridges is introduced. Carboxylate/ammonium ion pairs are generated within an environment that more or less surrounds the functional groups within a synthetic fixed introverted solvent sphere. This is provided by cavitands that fold around amines and present them with a carboxylic acid function. Both organic and water-soluble versions were prepared, and their equilibrium affinities with quinuclidine bases were determined by NMR methods. The association constants range from approximately 103 M−1 in water to more than 105 M−1 in organic solvents. Studies of nitrogen inversion and tumbling of [2.2.2]-diazabicyclooctane within the introverted acids also illustrate the strength of the acid–base interactions. The barriers to in–out exchange of several amine guests were determined to be in the range from 15 to 24 kcal mol−1. Some parallels with enzymes are drawn: the receptor folds around the guest species; presents them with inwardly directed functionality; and provides a generally hydrophobic environment and a periphery of secondary amide bonds. PMID:18672933

  18. Ion pair dissociation effects of aza-based anion receptors on lithium salts in polymer electrolytes

    SciTech Connect

    Yang, X.Q.; Lee, H.S.; Xiang, C.; McBreen, J.; Choi, L.S.; Okamoto, Y.

    1996-12-31

    The addition of aza-based anion receptors greatly increases the conductivity of polymer electrolytes based on LiCl and KI complexes with poly(ethylene oxide) (PEO). In some cases the conductivity increase is more than two orders of magnitude. Also the addition of the anion acceptors imparts a rubber like consistency to the normally stiff PEO salt films. Ion-ion, ion-polymer and anion-complex interactions were studied using Near Edge X-ray Absorption Fine Structure (NEXAFS) spectroscopy at the K and Cl K edges and at the I L{sub I} edge. The NEXAFS results show that Cl{sup {minus}} and I{sup {minus}} anions are complexed with the nitrogen groups of the anion receptors. The degree of complexation is related the chain length of the complexing agent and the number of R{double_bond}CF{sub 3}SO{sub 2} groups that are used to substitute for the amine hydrogen atoms in these aza-ether compounds. NEXAFS spectra at potassium K edge provide supplemental evidence for the ion pair dissociation effects of the anion receptors. The results show that dissociated K{sup +} cations are complexed with oxygen atoms of the PEO chains.

  19. Electronic coupling between base pair dimers of LNA:DNA oligomers.

    PubMed

    Ivanova, Anela; Jezierski, Grzegorz; Rösch, Notker

    2008-01-21

    We calculated ab initio electronic coupling elements between neighboring base-pair dimers in a set of LNA:DNA oligomers with different numbers of locked nucleotides and compared them by averaging the values over ensembles of snapshots from molecular dynamics trajectories. Averaging was based on coupling elements for various ensembles comprising of 33,000 structures. The known pronounced variations of coupling elements on the nanosecond timescale due to thermal fluctuations of the DNA structure were confirmed. We found significant differences in electronic coupling at the dimer level between a non-modified DNA:DNA duplex and the corresponding duplex containing one fully LNA-substituted strand. We rationalized these differences by very dissimilar overlap in the pi-stack as a consequence of the LNA-modified system approximating an A-DNA-type helix. The calculated coupling elements for the non-modified reference duplex were similar to those of standard B-DNA and those for the fully modified oligomer resembled the matrix elements estimated for standard A-DNA.

  20. A Bayesian Target Predictor Method based on Molecular Pairing Energies estimation.

    PubMed

    Oliver, Antoni; Canals, Vincent; Rosselló, Josep L

    2017-03-06

    Virtual screening (VS) is applied in the early drug discovery phases for the quick inspection of huge molecular databases to identify those compounds that most likely bind to a given drug target. In this context, there is the necessity of the use of compact molecular models for database screening and precise target prediction in reasonable times. In this work we present a new compact energy-based model that is tested for its application to Virtual Screening and target prediction. The model can be used to quickly identify active compounds in huge databases based on the estimation of the molecule's pairing energies. The greatest molecular polar regions along with its geometrical distribution are considered by using a short set of smart energy vectors. The model is tested using similarity searches within the Directory of Useful Decoys (DUD) database. The results obtained are considerably better than previously published models. As a Target prediction methodology we propose the use of a Bayesian Classifier that uses a combination of different active compounds to build an energy-dependent probability distribution function for each target.

  1. High levels of transcription stimulate transversions at GC base pairs in yeast.

    PubMed

    Alexander, Matthew P; Begins, Kaitlyn J; Crall, William C; Holmes, Margaret P; Lippert, Malcolm J

    2013-01-01

    High-levels of transcription through a gene stimulate spontaneous mutation rate, a phenomenon termed transcription-associated mutation (TAM). While transcriptional effects on specific mutation classes have been identified using forward mutation and frameshift-reversion assays, little is yet known about transcription-associated base substitutions in yeast. To address this issue, we developed a new base substitution reversion assay (the lys2-TAG allele). We report a 22-fold increase in overall reversion rate in the high- relative to the low-transcription strain (from 2.1- to 47- × 10(-9) ). While all detectable base substitution types increased in the high-transcription strain, G→T and G→C transversions increased disproportionately by 58- and 52-fold, respectively. To assess a potential role of DNA damage in the TAM events, we measured mutation rates and spectra in individual strains defective in the repair of specific DNA lesions or null for the error-prone translesion DNA polymerase zeta (Pol zeta). Results exclude a role of 8-oxoGuanine, general oxidative damage, or apurinic/apyrimidinic sites in the generation of TAM G→T and G→C transversions. In contrast, the TAM transversions at GC base pairs depend on Pol zeta for occurrence implicating DNA damage, other than oxidative lesions or AP sites, in the TAM mechanism. Results further indicate that transcription-dependent G→T transversions in yeast differ mechanistically from equivalent events in E. coli reported by others. Given their occurrences in repair-proficient cells, transcription-associated G→T and G→C events represent a novel type of transcription-associated mutagenesis in normal cells with potentially important implications for evolution and genetic disease.

  2. Mismatch base pairing of the mutagen 8-oxoguanine and its derivatives with adenine: A theoretical search for possible antimutagenic agents

    NASA Astrophysics Data System (ADS)

    Singh, A. K.; Mishra, P. C.

    Molecular geometries of 8-oxoguanine (8OG), those of its substituted derivatives with the substitutions CH2, CF2, CO, CNH, O, and S in place of the N7H7 group, adenine (A), and the base pairs of 8OG and its substituted derivatives with adenine were optimized using the RHF/6-31+G* and B3LYP/6-31+G* methods in gas phase. All the molecules and their hydrogen-bonded complexes were solvated in aqueous media employing the polarized continuum model (PCM) of the self-consistent reaction field (SCRF) theory using the RHF/6-31+G* and B3LYP/6-31+G* methods. The optimized geometrical parameters of the 8OG-A base pair at the RHF/6-31+G* and B3LYP/6-31+G* levels of theory agree satisfactorily with those of an oligonucleotide containing the base pair found from X-ray crystallography. The pattern of hydrogen bonding in the CF2- and O-substituted 8OG-A base pair is of Watson-Crick type and that in the unsubstituted and CH2-, CNH-, and S-substituted base pairs is of Hoogsteen type. In the CO-substituted base pair, the hydrogen bonding pattern is of neither Watson-Crick nor Hoogsteen type. The CF2-substitution appears to introduce steric hindrance for stacking of DNA bases. On the basis of these results, it appears that among all the substituted 8OG molecules considered here, the O-substituted derivative may be useful as an antimutagenic drug. It is, however, subject to experimental verification. Content:text/plain; charset="UTF-8"

  3. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    SciTech Connect

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-08-14

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized {sup 1}{pi}{pi}* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  4. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    NASA Astrophysics Data System (ADS)

    Ai, Yue-Jie; Zhang, Feng; Cui, Gang-Long; Luo, Yi; Fang, Wei-Hai

    2010-08-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized π1π∗ excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  5. Nucleon-pair states of even-even Sn isotopes based on realistic effective interactions

    NASA Astrophysics Data System (ADS)

    Cheng, Y. Y.; Qi, C.; Zhao, Y. M.; Arima, A.

    2016-08-01

    In this paper we study yrast states of 128,126,124Sn and 104,106,108Sn by using the monopole-optimized realistic interactions in terms of both the shell model (SM) and the nucleon-pair approximation (NPA). For yrast states of 128,126Sn and 104,106Sn, we calculate the overlaps between the wave functions obtained in the full SM space and those obtained in the truncated NPA space, and find that most of these overlaps are very close to 1. Very interestingly, for most of these states with positive parity and even spin or with negative parity and odd spin, the SM wave function is found to be well represented by one nucleon-pair basis state, viz., a simple picture of "nucleon-pair states" (nucleon-pair configuration without mixings) emerges. In 128,126Sn, the positive-parity (or negative-parity) yrast states with spin J >10 (or J >7 ) are found to be well described by breaking one or two S pairs in the 101+ (or 71-) state, i.e., the yrast state of seniority-two, spin-maximum, and positive-parity (or negative-parity), into non-S pair(s). Similar regularity is also pointed out for 104,106Sn. The evolution of E 2 transition rates between low-lying states in 128,126,124Sn is discussed in terms of the seniority scheme.

  6. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn Hess pair potential

    NASA Astrophysics Data System (ADS)

    Zhang, Zhi-Dong; Zhang, Yan-Jun

    2008-01-01

    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn Hess model, which is relative to the splay-bend elastic constant K. Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk.

  7. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    DOE PAGES

    Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; ...

    2016-08-22

    Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibitmore » stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.« less

  8. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    PubMed Central

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning. PMID:27445958

  9. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    NASA Astrophysics Data System (ADS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.

    2009-03-01

    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (˜4-40 g/cm2, or ˜0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy' (AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  10. The Common Prescription Patterns Based on the Hierarchical Clustering of Herb-Pairs Efficacies

    PubMed Central

    2016-01-01

    Prescription patterns are rules or regularities used to generate, recognize, or judge a prescription. Most of existing studies focused on the specific prescription patterns for diverse diseases or syndromes, while little attention was paid to the common patterns, which reflect the global view of the regularities of prescriptions. In this paper, we designed a method CPPM to find the common prescription patterns. The CPPM is based on the hierarchical clustering of herb-pair efficacies (HPEs). Firstly, HPEs were hierarchically clustered; secondly, the individual herbs are labeled by the HPEC (the clusters of HPEs); and then the prescription patterns were extracted from the combinations of HPEC; finally the common patterns are recognized statistically. The results showed that HPEs have hierarchical clustering structure. When the clustering level is 2 and the HPEs were classified into two clusters, the common prescription patterns are obvious. Among 332 candidate prescriptions, 319 prescriptions follow the common patterns. The description of the patterns is that if a prescription contains the herbs of the cluster (C 1), it is very likely to have other herbs of another cluster (C 2); while a prescription has the herbs of C 2, it may have no herbs of C 1. Finally, we discussed that the common patterns are mathematically coincident with the Blood-Qi theory. PMID:27190534

  11. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    SciTech Connect

    Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; Fujimoto, Cy; Kim, Yu Seung

    2016-08-22

    Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.

  12. The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

    NASA Technical Reports Server (NTRS)

    Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

    2013-01-01

    This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

  13. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    SciTech Connect

    Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; Fujimoto, Cy; Kim, Yu Seung

    2016-08-22

    Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.

  14. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    NASA Astrophysics Data System (ADS)

    Lee, Kwan-Soo; Spendelow, Jacob S.; Choe, Yoong-Kee; Fujimoto, Cy; Kim, Yu Seung

    2016-09-01

    Fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100 ∘C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180 ∘C however, these devices degrade when exposed to water below 140 ∘C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80-160 ∘C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.

  15. Simplified Aircraft-Based Paired Approach: Concept Definition and Initial Analysis

    NASA Technical Reports Server (NTRS)

    Johnson, Sally C.; Lohr, Gary W.; McKissick, Burnell T.; Abbott, Terence S.; Geurreiro, Nelson M.; Volk, Paul

    2013-01-01

    Simplified Aircraft-based Parallel Approach (SAPA) is an advanced concept proposed by the Federal Aviation Administration (FAA) to support dependent parallel approach operations to runways with lateral spacing closer than 2500 ft. At the request of the FAA, NASA performed an initial assessment of the potential performance and feasibility of the SAPA concept, including developing and assessing an operational implementation of the concept and conducting a Monte Carlo wake simulation study to examine the longitudinal spacing requirements. The SAPA concept was shown to have significant operational advantages in supporting the pairing of aircraft with dissimilar final approach speeds. The wake simulation study showed that support for dissimilar final approach speeds could be significantly enhanced through the use of a two-phased altitudebased longitudinal positioning requirement, with larger longitudinal positioning allowed for higher altitudes out of ground effect and tighter longitudinal positioning defined for altitudes near and in ground effect. While this assessment is preliminary and there are a number of operational issues still to be examined, it has shown the basic SAPA concept to be technically and operationally feasible.

  16. Decentralized supervisory based switching control for uncertain multivariable plants with variable input-output pairing.

    PubMed

    Namaki-Shoushtari, Omid; Khaki-Sedigh, Ali

    2012-01-01

    In this paper, the design of decentralized switching control for uncertain multivariable plants is considered. In the proposed strategy, the uncertainty region is divided into smaller regions with a nominal model and specific control structure. The underlying design is based on the quantitative feedback theory (QFT). It is assumed that a MIMO-QFT controller exists for robust stability and performance of the individual uncertain sets. The proposed control structure is made up by these local decentralized controllers, which commute among themselves in accordance with the decision of a high level decision maker called the supervisor. The supervisor makes the decision by comparing the local models' behaviors with the one of the plant and selects the controller corresponding to the best fitted model. A hysteresis switching logic is used to slow down the switching to guarantee the overall closed loop stability. It is shown that this strategy provides a stable and robust adaptive controller to deal with complex multivariable plants with input-output pairing changes during the plant operation, which can facilitate the development of a reconfigurable decentralized control. Also, the multirealization technique is used to implement a family of controllers to achieve bumpless transfer. Simulation results are employed to show the effectiveness of the proposed method. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

  17. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae).

    PubMed

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-10-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  18. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  19. CanScript, an 18-Base pair DNA sequence, boosts tumor cell-specific promoter activity

    PubMed Central

    Huang, Yu-Hung; Cozzitorto, Joseph A; Richards, Nathan G; Eltoukhy, Ahmed A; Yeo, Charles J; Langer, Robert; Anderson, Daniel G; Brody, Jonathan R

    2010-01-01

    Gene therapy protocols for the treatment of cancer often employ gene promoter sequences that are known to be overexpressed in specific tumor cell types relative to normal cells. These promoters, while specific, are often weakly active. It would be desirable to increase the activity of such promoters, while at the same time retain specificity, so that the therapeutic gene is more robustly expressed. Using a luciferase reporter DNA construct in both in vitro cell transfection assays and in vivo mouse tumor models, we have determined that in the absence of any other DNA sequence, a previously identified 18-base pair enhancer sequence called CanScript, lying upstream of the MSLN gene, has ∼25% of the promoter activity of CAG, a very strong non-specific promoter/enhancer, in tumor cells in which MSLN is highly expressed. Furthermore, tandem repeat copies of CanScript enhance transcription in a dose-dependent manner and, when coupled with promoter sequences that are active in tumor cells, increase promoter activity. These findings suggest that the incorporation of CanScript into gene constructs may have application in enhancing activity of promoters used in cancer-targeting gene therapy strategies, thereby improving therapeutic efficacy. PMID:20798601

  20. Joint CD and PMD monitoring based on a pair of low-bandwidth coherent receivers.

    PubMed

    Chen, Yuli; Sui, Qi; Li, Zhaohui; Liang, Zihao; Liu, Weiping

    2016-11-14

    A joint chromatic dispersion (CD) and 1st order polarization mode dispersion (PMD) monitoring technique for both a coherent and a non-coherent single carrier system based on a pair of cost effective low-bandwidth coherent receivers is proposed and experimentally demonstrated. By jointly detecting the narrow band around ± 1/2 baud rate, the CD and PMD can be estimated simultaneously by time domain correlation and Stokes space rotational angle recovery, respectively. The CD estimation range is theoretically infinite and the PMD estimation range is limited to the maximum of 1/2 symbol period. Simulation results show that for a 28 G baud dual-polarization (DP)-16QAM transmission system, with dual 1 GHz coherent receivers, the monitoring error for CD and differential group delay (DGD) is 30 ps/nm and 0.5 ps, respectively. We also experimentally verified it for a 12 GBit/s NRZ-OOK transmission system with a full-bandwidth coherent receiver and two 1 GHz digital filters to simulate dual 1 GHz coherent receivers. The monitoring error for CD and DGD is 60 ps/nm and 1.5 ps, respectively.

  1. Theoretical investigation of hydrogen transfer mechanism in the guanine cytosine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni

    2006-05-01

    We have studied the quantum-dynamics of the hydrogen bonds in the guanine-cytosine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick G-C, the imino-enol G*-C*, the imino-enol-imino-enol G #-C # and some zwitterionic structures. The common idea in the literature is that only the G-C and the G*-C* tautomers are stable with an estimate of G-C → G*-C* transition probability of 10 -6-10 -9 by the help of Boltzmann statistics. Here we show a detailed quantum theoretical study that suggests the following conclusion: G-C is the stablest tautomer, some partially charged systems (due to the movement of only one hydrogen atom) are important and a large amount of the imino-enol G*-C* (and less of the imino-enol-imino-enol G #-C # structure) tautomer is present at any time. The corresponding transition probabilities from different tautomers are not due to thermal passage, but they are a pure quantum phenomenon. These large probabilities definitively disprove the idea of these tautomers as mutation points. The mechanisms of passage from the G-C tautomer to the others have also been investigated.

  2. Tertiary base pair interactions in slipped loop-DNA: an NMR and model building study.

    PubMed Central

    Ulyanov, N B; Bishop, K D; Ivanov, V I; James, T L

    1994-01-01

    Short direct repeat sequences are often found in regulatory regions of various genes; in some cases they display hypersensitivity to S1 nuclease cleavage in supercoiled plasmids. A non-standard DNA structure (Slipped Loop Structure, or SLS) has been proposed for these regions in order to explain the S1 cleavage data; the formation of this structure may be involved in the regulation of transcription. The structure can be generally classified as a particular type of pseudoknot. To date, no detailed stereochemical model has been developed. We have applied one-dimensional 1H NMR spectroscopy to study a synthetic DNA, 55 nucleotides in length, which cannot fold as a standard hairpin but which may favor the SLS formation. AT base pairs were identified, consistent only with the formation of an additional, tertiary miniduplex in the SLS. An all-atom stereochemically sound model has been developed for the SLS with the use of conformational calculations. The model building studies have demonstrated that the tertiary miniduplex can be formed for one of the plausible SLS isomers, but not for the other. Images PMID:7937152

  3. Tertiary base pair interactions in slipped loop-DNA: an NMR and model building study.

    PubMed

    Ulyanov, N B; Bishop, K D; Ivanov, V I; James, T L

    1994-10-11

    Short direct repeat sequences are often found in regulatory regions of various genes; in some cases they display hypersensitivity to S1 nuclease cleavage in supercoiled plasmids. A non-standard DNA structure (Slipped Loop Structure, or SLS) has been proposed for these regions in order to explain the S1 cleavage data; the formation of this structure may be involved in the regulation of transcription. The structure can be generally classified as a particular type of pseudoknot. To date, no detailed stereochemical model has been developed. We have applied one-dimensional 1H NMR spectroscopy to study a synthetic DNA, 55 nucleotides in length, which cannot fold as a standard hairpin but which may favor the SLS formation. AT base pairs were identified, consistent only with the formation of an additional, tertiary miniduplex in the SLS. An all-atom stereochemically sound model has been developed for the SLS with the use of conformational calculations. The model building studies have demonstrated that the tertiary miniduplex can be formed for one of the plausible SLS isomers, but not for the other.

  4. DNA Base Pair Resolution Measurements Using Resonance Energy Transfer Efficiency in Lanthanide Doped Nanoparticles

    PubMed Central

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5’ amine modified-ssDNA. Hybridization with the 5’ fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale. PMID:25748446

  5. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae)

    PubMed Central

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-01-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae. PMID:27759763

  6. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  7. X-ray Pair Distribution Function Analysis of Potassium Based Geopolymer

    SciTech Connect

    Bell, J.; Sarin, P; Driemeyer, P; Haggerty, R; Chupas, P; Kriven, W

    2008-01-01

    The atomic structure of geopolymers is often described as amorphous with a local structure that is equivalent to that of crystalline zeolites. However, this structural relationship has never been quantified beyond a first-nearest-neighbor bonding environment. In this study, the short to medium range (1 nm) structural order of metakaolin-based KAlSi{sub 2}O{sub 6}{center_dot}5.5H{sub 2}O geopolymer was quantified and compared to zeolitic tetragonal leucite (KAlSi2O6) using the X-ray atomic pair distribution function technique. Unheated KAlSi{sub 2}O{sub 6}{center_dot}5.5H{sub 2}O was found to be structurally similar to leucite out to a length of 8 {angstrom}, but had increased medium range disorder over the 4.5 {angstrom} < r < 8 {angstrom} range. On heating to >300 C, changes in the short to medium range structure were observed due to dehydration and removal of chemically bound water. Crystallization of leucite occurred in samples heated beyond 1050 C. Refinements of a leucite model against the PDF data for geopolymer heated to 1100 C for 24 h yielded a good fit.

  8. Role of human leukocyte antigen-G 14-base pair polymorphism in kidney transplantation outcomes.

    PubMed

    Littera, Roberto; Piredda, Gianbenedetto; Pani, Antonello; Frongia, Mauro; Onano, Bruno; Michittu, Maria Benigna; Murgia, Maria Gavina; Lai, Sara; Alba, Francesco; Valentini, Maria Donatella; Loi, Valentina; Caocci, Giovanni; Orrù, Sandro; La Nasa, Giorgio; Carcassi, Carlo

    2013-01-01

    Both the membrane-bound and soluble forms of human leukocyte antigen-G (HLA-G) molecules exhibit a multitude of immunomodulatory properties that can potentially obviate or delay graft rejection. The 14-base pair (14-bp) polymorphism in the 3'-untranslated region of the HLA-G gene is thought to have a role in soluble HLA-G (sHLA-G) expression. In this study, we retrospectively investigated a large cohort of 418 kidney transplant recipients with the aim of establishing whether the HLA-G 14-bp insertion/deletion polymorphism could serve as an effective genetic risk marker for acute and/or chronic deterioration of transplanted kidney function. A statistically significant higher incidence of chronic kidney dysfunction leading to allograft loss was observed in transplant recipients homozygous for the HLA-G 14-bp deletion polymorphism. This difference increased over time and was confirmed by progressive decline in the glomerular filtration rate. These results suggest that alongside other factors previously consolidated in clinical practice, recipient HLA-G 14-bp genotype may serve as an adjuvant independent predictor of long-term outcome of kidney transplantation.

  9. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    PubMed

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  10. Base pairing enhances fluorescence and favors cyclobutane dimer formation induced upon absorption of UVA radiation by DNA.

    PubMed

    Banyasz, Akos; Vayá, Ignacio; Changenet-Barret, Pascale; Gustavsson, Thomas; Douki, Thierry; Markovitsi, Dimitra

    2011-04-13

    The photochemical properties of the DNA duplex (dA)(20)·(dT)(20) are compared with those of the parent single strands. It is shown that base pairing increases the probability of absorbing UVA photons, probably due to the formation of charge-transfer states. UVA excitation induces fluorescence peaking at ∼420 nm and decaying on the nanosecond time scale. The fluorescence quantum yield, the fluorescence lifetime, and the quantum yield for cyclobutane dimer formation increase upon base pairing. Such behavior contrasts with that of the UVC-induced processes.

  11. Double proton transfer mechanism in the adenine-uracil base pair and spontaneous mutation in RNA duplex

    NASA Astrophysics Data System (ADS)

    Cerón-Carrasco, José P.; Requena, Alberto; Perpète, Eric A.; Michaux, Catherine; Jacquemin, Denis

    2009-12-01

    We study the mechanism of double proton transfer (DPT) in the adenine-uracil (AU) base pair, both in gas phase and under the influence of surrounding water molecules. According to our ab initio calculations, no stable proton transfer product exists in gas phase, while in solution, the DPT process may occur only through the catalysis of water molecules. Nevertheless, a thermodynamic analysis confirms that AU does not contribute to spontaneous mutation in RNA duplex, and thus guanine-cytosine (GC) would be the only base pair contributing to spontaneous mutation.

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. Simulation Based on Ion Propulsion Rocket System with Using Negative ion - Negative Ion Pair Techniques

    NASA Astrophysics Data System (ADS)

    Sathiyavel, C.

    2016-07-01

    Ion propulsion rocket system is expected to become popular with the development of ion-ion pair techniques because of their stimulated of low propellant, Design of Thrust range is 1N with low electric power and high efficiency. A Negative ion-Negative ion pair of ion propulsion rocket system is proposed in this work .Negative Ion Based Rocket system consists of three parts 1.ionization chamber 2. Repulsion force and ion accelerator 3. Exhaust of Nozzle. The Negative ions from electro negatively gas are produced by attachment of the gas ,such as chlorine with electron emitted from a Electron gun ionization chamber. The formulate of large stable negative ion is achievable in chlorine gas with respect to electron affinity (∆E). The electron affinity is a measure of the energy change when an electron is added to a neutral atom to form a negative ion. When a neutral chlorine atom in the gaseous form picks up an electron to form a Cl- ion, it releases energy of 349 kJ/mol or 3.6 ev/atom. It is said to have an electron affinity of -349 kJ/mol ,the negative sign indicating that energy is released during this process .The mechanisms of attachment involve the formation of intermediate states. In that reason for , the highly repulsive force created between the same negative ions. The distance between same negative ions is important for the evaluate of the rocket thrust and is also determined by the exhaust velocity of the propellant. The mass flow rate of propellant is achieved by the ratio of total mass of the propellant (Kg) needed for operation to time period(s). Accelerate the Negative ions to a high velocity in the thrust vector direction with a significantly intense Magnetic field and the exhaust of negative ions through Nozzle. The simulation of the ion propulsion system has been carried out by MATLAB. By comparing the simulation results with the theoretical and previous results, we have found that the proposed method is achieved of thrust value with estimated

  14. Stereo image pair's construction and accuracy analysis based on MMT soft-baseline

    NASA Astrophysics Data System (ADS)

    Ou, Jianliang; Zhang, Jinhua; Cao, Bin; Bao, Feng; Wang, Weian

    2009-10-01

    Land based mobile mapping technology (MMT) can collect spatial and attribute data in high efficiency and the data can meet the requirement of 1:2000 scale or even higher accuracy topographic mapping without ground control point. In mobile mapping, direct georeferencing by the integration of GPS and INS/DR provides the mobile platform's continuous position and pose to mapping sensor in field survey, then image stereo of the certain target is used to calculate its 3d global coordinates. But in general, current MMT image stereo is defined as the solid baseline between the different CCD cameras' relative position deviation which is rigid connected to each other and calibrated by high precise control field, and baseline length is quite short (less than 2 meters). This brings some troubles on the far distance target or big size building observation from different viewpoints, and also limits the use of huge amount of MMT measurable images. This paper presented the image stereo pair construction in soft-baseline condition, which is organized through the different imaging time and platform field place but overlapped to the certain target, thus the baseline's accuracy would be some obvious lower than the solid one. We made a brief introduction about Tongji Geo-Informatics MMT firstly, analyzed the image stereo pair from the solid-baseline, and then constructed MMT measurable image into soft-baseline stereo and due mathematical model is expressed. In the paper's experiment part, we analyzed the concrete target 3d solution with the total station, MMT image's solid-baseline stereo and the soft-baseline surveying. The calculation shows that the target 3d coordinates solution in soft-baseline has the same precision as the solid one, also meets the topographic mapping requirement of scale 1:2000. Last, the paper discussed some important influence from the change of angle of two observing bundles in photogrammetric forward intersection and the change sub-deviations of survey error

  15. Preliminary Assessment of the Efficacy of a T-Cell–Based Influenza Vaccine, MVA-NP+M1, in Humans

    PubMed Central

    Lillie, Patrick J.; Berthoud, Tamara K.; Powell, Timothy J.; Lambe, Teresa; Mullarkey, Caitlin; Spencer, Alexandra J.; Hamill, Matthew; Peng, Yanchun; Blais, Marie-Eve; Duncan, Christopher J. A.; Sheehy, Susanne H.; Havelock, Tom; Faust, Saul N.; Williams, Rob Lambkin; Gilbert, Anthony; Oxford, John; Dong, Tao; Hill, Adrian V. S.; Gilbert, Sarah C.

    2012-01-01

    Background. The novel influenza vaccine MVA-NP+M1 is designed to boost cross-reactive T-cell responses to internal antigens of the influenza A virus that are conserved across all subtypes, providing protection against both influenza disease and virus shedding against all influenza A viruses. Following a phase 1 clinical study that demonstrated vaccine safety and immunogenicity, a phase 2a vaccination and influenza challenge study has been conducted in healthy adult volunteers. Methods. Volunteers with no measurable serum antibodies to influenza A/Wisconsin/67/2005 received either a single vaccination with MVA-NP+M1 or no vaccination. T-cell responses to the vaccine antigens were measured at enrollment and again prior to virus challenge. All volunteers underwent intranasal administration of influenza A/Wisconsin/67/2005 while in a quarantine unit and were monitored for symptoms of influenza disease and virus shedding. Results. Volunteers had a significantly increased T-cell response to the vaccine antigens following a single dose of the vaccine, with an increase in cytolytic effector molecules. Intranasal influenza challenge was undertaken without safety issues. Two of 11 vaccinees and 5 of 11 control subjects developed laboratory-confirmed influenza (symptoms plus virus shedding). Symptoms of influenza were less pronounced in the vaccinees and there was a significant reduction in the number of days of virus shedding in those vaccinees who developed influenza (mean, 1.09 days in controls, 0.45 days in vaccinees, P = .036). Conclusions. This study provides the first demonstration of clinical efficacy of a T-cell–based influenza vaccine and indicates that further clinical development should be undertaken. Clinical Trials Registration. NCT00993083. PMID:22441650

  16. Universal quantum gates for Single Cooper Pair Box based quantum computing

    NASA Technical Reports Server (NTRS)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  17. Universal quantum gates for Single Cooper Pair Box based quantum computing

    NASA Technical Reports Server (NTRS)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  18. Supramolecular architectures based on As(lone pair)···π(aryl) interactions.

    PubMed

    Zukerman-Schpector, Julio; Otero-de-la-Roza, Alberto; Luaña, Víctor; Tiekink, Edward R T

    2011-07-21

    As(lone pair)···π interactions provide stability to their crystal structures often leading to supramolecular chains and prevailing over As···X secondary contacts. The interaction (ca 8 kJ mol(-1)) arises from polarisation induced in the aryl ring by the As-lone pair plus the weak sharing of these electrons with the ring-C atoms.

  19. Metal-semiconductor pair nanoparticles by a physical route based on bipolar mixing

    NASA Astrophysics Data System (ADS)

    Kala, Shubhra; Theissmann, Ralf; Rouenhoff, Marcel; Kruis, Frank Einar

    2016-03-01

    In this report a methodology is described and demonstrated for preparing Au-Ge pair nanoparticles with known compositions by extending and modifying the basic steps normally used to synthesize nanoparticles in carrier gas. For the formation of pair nanoparticles by bipolar mixing, two oppositely charged aerosols of nanoparticles having the desired size are produced with the help of two differential mobility analyzers. Then both are allowed to pass through a tube, which provides sufficient residence time to result in nanoparticle pair formation due to Brownian collisions influenced by Coulomb forces. The effect of residence time on the formation of nanoparticle pairs as well as the influence of diffusion and discharging is described. Subsequently, necessary modifications to the experimental setup are demonstrated systematically. The kinetics of nanoparticles pair formation in a carrier gas is also calculated and compared with measurements made with the help of an online aerosol size analysis technique. This synthesis of nanoparticle pairs can be seen as a possible route towards Janus-type nanoparticles.

  20. Metal-semiconductor pair nanoparticles by a physical route based on bipolar mixing.

    PubMed

    Kala, Shubhra; Theissmann, Ralf; Rouenhoff, Marcel; Kruis, Frank Einar

    2016-03-29

    In this report a methodology is described and demonstrated for preparing Au-Ge pair nanoparticles with known compositions by extending and modifying the basic steps normally used to synthesize nanoparticles in carrier gas. For the formation of pair nanoparticles by bipolar mixing, two oppositely charged aerosols of nanoparticles having the desired size are produced with the help of two differential mobility analyzers. Then both are allowed to pass through a tube, which provides sufficient residence time to result in nanoparticle pair formation due to Brownian collisions influenced by Coulomb forces. The effect of residence time on the formation of nanoparticle pairs as well as the influence of diffusion and discharging is described. Subsequently, necessary modifications to the experimental setup are demonstrated systematically. The kinetics of nanoparticles pair formation in a carrier gas is also calculated and compared with measurements made with the help of an online aerosol size analysis technique. This synthesis of nanoparticle pairs can be seen as a possible route towards Janus-type nanoparticles.

  1. Theoretical studies of hydrogen bonding in water cyanides and in the base pair Gu Cy

    NASA Astrophysics Data System (ADS)

    Rivelino, Roberto; Ludwig, Valdemir; Rissi, Eduardo; Canuto, Sylvio

    2002-09-01

    Density-functional (DFT) and many-body-perturbation theories (MBPT/CC) are used to study the hydrogen bonding in the water-cyanide complexes H-CN⋯H 2O, H 3C-CN⋯H 2O and (CH 3) 3C-CN⋯H 2O. Structures, binding energies and changes in vibrational frequencies are analyzed. The calculated CN stretching frequency is found to shift to the blue upon complexation in H-CN⋯H 2O and H 3C-CN⋯H 2O. To investigate electron correlation effects on the binding energies of these complexes, single-point calculations are performed at the MBPT/CC (MP2, MP3, MP4, CCSD and CCSD(T)) levels using the optimized MP2 geometries. Binding energies are also obtained at different levels of DFT (B3LYP and PW91) and compared with the MBPT/CC results. All calculations include corrections for basis set superposition error (BSSE) and zero-point vibrational energies. Additionally, the triple hydrogen-bonded guanine-cytosine (Gu-Cy) base pair is analyzed. The binding energy of the Watson-Crick model for Gu-Cy is calculated using the Hartree-Fock calculations and DFT (B3LYP and BP86) methods. The results for the hydrogen bonding distances and binding energies are in good agreement with experimental and recent theoretical values. The calculated dipole moment of the Gu-Cy complex is compared with the direct vector sum of the isolated bases. After taking into account the BSSE effects we find that the electron polarization due to the hydrogen binding leads to an increase of ˜20% of the calculated dipole moment of the complex.

  2. Raman spectroscopic detection of the T-Hg II-T base pair and the ionic characteristics of mercury.

    PubMed

    Uchiyama, Tomomi; Miura, Takashi; Takeuchi, Hideo; Dairaku, Takenori; Komuro, Tomoyuki; Kawamura, Takuya; Kondo, Yoshinori; Benda, Ladislav; Sychrovsky, Vladimír; Bour, Petr; Okamoto, Itaru; Ono, Akira; Tanaka, Yoshiyuki

    2012-07-01

    Developing applications for metal-mediated base pairs (metallo-base-pair) has recently become a high-priority area in nucleic acid research, and physicochemical analyses are important for designing and fine-tuning molecular devices using metallo-base-pairs. In this study, we characterized the Hg(II)-mediated T-T (T-Hg(II)-T) base pair by Raman spectroscopy, which revealed the unique physical and chemical properties of Hg(II). A characteristic Raman marker band at 1586 cm(-1) was observed and assigned to the C4=O4 stretching mode. We confirmed the assignment by the isotopic shift ((18)O-labeling at O4) and density functional theory (DFT) calculations. The unusually low wavenumber of the C4=O4 stretching suggested that the bond order of the C4=O4 bond reduced from its canonical value. This reduction of the bond order can be explained if the enolate-like structure (N3=C4-O4(-)) is involved as a resonance contributor in the thymine ring of the T-Hg(II)-T pair. This resonance includes the N-Hg(II)-bonded state (Hg(II)-N3-C4=O4) and the N-Hg(II)-dissociated state (Hg(II+) N3=C4-O4(-)), and the latter contributor reduced the bond order of N-Hg(II). Consequently, the Hg(II) nucleus in the T-Hg(II)-T pair exhibited a cationic character. Natural bond orbital (NBO) analysis supports the interpretations of the Raman experiments.

  3. Structure, stability and function of 5-chlorouracil modified A:U and G:U base pairs

    SciTech Connect

    Patra, Amritraj; Harp, Joel; Pallan, Pradeep S.; Zhao, Linlin; Abramov, Mikhail; Herdewijn, Piet; Egli, Martin

    2012-12-28

    The thymine analog 5-chlorouridine, first reported in the 1950s as anti-tumor agent, is known as an effective mutagen, clastogen and toxicant as well as an effective inducer of sister-chromatid exchange. Recently, the first microorganism with a chemically different genome was reported; the selected Escherichia coli strain relies on the four building blocks 5-chloro-2'-deoxyuridine (ClU), A, C and G instead of the standard T, A, C, G alphabet [Marlière,P., Patrouix,J., Döring,V., Herdewijn,P., Tricot,S., Cruveiller,S., Bouzon,M. and Mutzel,R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem. Int. Ed., 50, 7109–7114]. The residual fraction of T in the DNA of adapted bacteria was <2% and the switch from T to ClU was accompanied by a massive number of mutations, including >1500 A to G or G to A transitions in a culture. The former is most likely due to wobble base pairing between ClU and G, which may be more common for ClU than T. To identify potential changes in the geometries of base pairs and duplexes as a result of replacement of T by ClU, we determined four crystal structures of a B-form DNA dodecamer duplex containing ClU:A or ClU:G base pairs. The structures reveal nearly identical geometries of these pairs compared with T:A or T:G, respectively, and no consequences for stability and cleavage by an endonuclease (EcoRI). The lack of significant changes in the geometry of ClU:A and ClU:G base pairs relative to the corresponding native pairs is consistent with the sustained unlimited self-reproduction of E. coli strains with virtually complete T→ClU genome substitution.

  4. Breaking pseudo-twofold symmetry in the poliovirus 3'-UTR Y-stem by restoring Watson-Crick base pairs.

    PubMed

    Zoll, Jan; Tessari, Marco; Van Kuppeveld, Frank J M; Melchers, Willem J G; Heus, Hans A

    2007-05-01

    The previously described NMR structure of a 5'-CU-3'/5'-UU-3' motif, which is highly conserved within the 3'-UTR Y-stem of poliovirus-like enteroviruses, revealed striking regularities of the local helix geometry, thus retaining the pseudo-twofold symmetry of the RNA helix. A mutant virus with both pyrimidine base pairs changed into Watson-Crick replicated as wild type, indicating the functional importance of this symmetry relation in viral RNA replication. Here we investigated the effect of changing only one of the two pyrimidine base pairs to Watson-Crick. We determined the NMR structures of two Y-stem variants: one containing the 5'-CU-3'/5'-AU-3' motif, which has been found in wild-type virus isolates as well, and the other containing a 5'-CU-3'/5'-UG-3' motif, which is not present in any enterovirus sequenced to date. Both structures show single pyrimidine mismatches with intercalated bases. In the 5'-CU-3'/5'-AU-3' motif a C-U Watson-Crick-type base pair is formed that retains the pseudo-twofold symmetry, while in the 5'-CU-3'/5'-UG-3' motif a single asymmetric U-U mismatch breaks the twofold symmetry. Surprisingly, for the nonnatural variant no effect of the single base-pair replacement was observed on polioviral RNA replication using an in vitro replicon assay.

  5. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs.

    PubMed

    van Beest, M; Dooijes, D; van De Wetering, M; Kjaerulff, S; Bonvin, A; Nielsen, O; Clevers, H

    2000-09-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment of promoter elements controlled by the yeast genes ste11 and Rox1 has indicated strict conservation of a larger DNA motif. By site selection, we identify a highly specific 12-base pair motif for Ste11, AGAACAAAGAAA. Similarly, we show that Tcf1, MatMc, and Sox4 bind unique, highly specific DNA motifs of 12, 12, and 10 base pairs, respectively. Footprinting with a deletion mutant of Ste11 reveals a novel interaction between the 3' base pairs of the extended DNA motif and amino acids C-terminal to the HMG domain. The sequence-specific interaction of Ste11 with these 3' base pairs contributes significantly to binding and bending of the DNA motif.

  6. Nucleic acid unwinding by hepatitis C virus and bacteriophage t7 helicases is sensitive to base pair stability.

    PubMed

    Donmez, Ilker; Rajagopal, Vaishnavi; Jeong, Yong-Joo; Patel, Smita S

    2007-07-20

    Helicases are motor enzymes that convert the chemical energy of NTP hydrolysis into mechanical force for motion and nucleic acid strand separation. Within the cell, helicases process a range of nucleic acid sequences. It is not known whether this composite rate of moving and opening the strands of nucleic acids depends on the base sequence. Our presteady state kinetic studies of helicases from two classes, the ring-shaped T7 helicase and two forms of non-ring-shaped hepatitis C virus (HCV) helicase, show that both the unwinding rate and processivity depend on the sequence and decrease as the nucleic acid stability increases. The DNA unwinding activity of T7 helicase and the RNA unwinding activity of HCV helicases decrease steeply with increasing base pair stability. On the other hand, the DNA unwinding activity of HCV helicases is less sensitive to base pair stability. These results predict that helicases will fall into a spectrum of modest to high sensitivity to base pair stability depending on their biological role in the cell. Modeling of the dependence provided the degree of the active involvement of helicase in base pair destabilization during the unwinding process and distinguished between passive and active mechanisms of unwinding.

  7. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices.

  8. Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods

    SciTech Connect

    Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

    2013-03-26

    Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

  9. ReLiance: a machine learning and literature-based prioritization of receptor--ligand pairings.

    PubMed

    Iacucci, Ernesto; Tranchevent, Léon-Charles; Popovic, Dusan; Pavlopoulos, Georgios A; De Moor, Bart; Schneider, Reinhard; Moreau, Yves

    2012-09-15

    The prediction of receptor-ligand pairings is an important area of research as intercellular communications are mediated by the successful interaction of these key proteins. As the exhaustive assaying of receptor-ligand pairs is impractical, a computational approach to predict pairings is necessary. We propose a workflow to carry out this interaction prediction task, using a text mining approach in conjunction with a state of the art prediction method, as well as a widely accessible and comprehensive dataset. Among several modern classifiers, random forests have been found to be the best at this prediction task. The training of this classifier was carried out using an experimentally validated dataset of Database of Ligand-Receptor Partners (DLRP) receptor-ligand pairs. New examples, co-cited with the training receptors and ligands, are then classified using the trained classifier. After applying our method, we find that we are able to successfully predict receptor-ligand pairs within the GPCR family with a balanced accuracy of 0.96. Upon further inspection, we find several supported interactions that were not present in the Database of Interacting Proteins (DIPdatabase). We have measured the balanced accuracy of our method resulting in high quality predictions stored in the available database ReLiance. http://homes.esat.kuleuven.be/~bioiuser/ReLianceDB/index.php yves.moreau@esat.kuleuven.be; ernesto.iacucci@gmail.com Supplementary data are available at Bioinformatics online.

  10. Computer simulation of acetonitrile and methanol with ab initio-based pair potentials

    NASA Astrophysics Data System (ADS)

    Hloucha, M.; Sum, A. K.; Sandler, S. I.

    2000-10-01

    This study address the adequacy of ab initio pair interaction energy potentials for the prediction of macroscopic properties. Recently, Bukowski et al. [J. Phys. Chem. A 103, 7322 (1999)] performed a comprehensive study of the potential energy surfaces for several pairs of molecules using symmetry-adapted perturbation theory. These ab initio energies were then fit to an appropriate site-site potential form. In an attempt to bridge the gap between ab initio interaction energy information and macroscopic properties prediction, we performed Gibbs ensemble Monte Carlo (GEMC) simulations using their developed pair potentials for acetonitrile and methanol. The simulations results show that the phase behavior of acetonitrile is well described by just the pair interaction potential. For methanol, on the other hand, pair interactions are insufficient to properly predict its vapor-liquid phase behavior, and its saturated liquid density. We also explored simplified forms for representing the ab initio interaction energies by refitting a selected range of the data to a site-site Lennard-Jones and to a modified Buckingham (exponential-6) potentials plus Coulombic interactions. These were also used in GEMC simulations in order to evaluate the quality and computational efficiency of these different potential forms. It was found that the phase behavior prediction for acetonitrile and methanol are highly dependent on the details of the interaction potentials developed.

  11. Transitions between Short-Term and Long-Term Memory in Learning Meaningful Unrelated Paired Associates Using Computer Based Drills.

    ERIC Educational Resources Information Center

    Goldenberg, Tzvika Y.; Turnure, James E.

    1989-01-01

    Discussion of short-term and long-term memory in learning paired associates focuses on two microcomputer-based instructional design experiments with eleventh and twelfth graders that were modeled after traditional drill and practice routines. Research questions are presented, treatment conditions are explained, and additional research is…

  12. Relationship between the 19 base pair deletion polymorphism in DHFR and unmetabolized folic and in plasma and RBC folate

    USDA-ARS?s Scientific Manuscript database

    Background: A 19 base pair (bp) deletion allele of dihydrofolate reductase (DHFR), an enzyme that makes folic acid metabolically active and reduces dihydrofolate to tetrahydrofolate to stimulate folate turnover, has been implicated in folate related health outcomes. Objective: Examine the effect ...

  13. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes.

    PubMed

    Sochacka, Elzbieta; Szczepanowski, Roman H; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-03-11

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon-anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3'-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif.

  14. A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

    ERIC Educational Resources Information Center

    Ilhan, Mustafa

    2016-01-01

    The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

  15. Multichannel HSO4- recognition promoted by a bound cation within a ferrocene-based ion pair receptor.

    PubMed

    Alfonso, María; Espinosa, Arturo; Tárraga, Alberto; Molina, Pedro

    2012-07-11

    A ferrocene-based ion pair receptor is shown only to recognise HSO(4)(-) anions in the presence of a cobound Pb(2+) or Zn(2+) cation guest species through a perturbation of the redox potential of the ferrocene unit and a remarkable enhancement of the fluorescence.

  16. Transitions between Short-Term and Long-Term Memory in Learning Meaningful Unrelated Paired Associates Using Computer Based Drills.

    ERIC Educational Resources Information Center

    Goldenberg, Tzvika Y.; Turnure, James E.

    1989-01-01

    Discussion of short-term and long-term memory in learning paired associates focuses on two microcomputer-based instructional design experiments with eleventh and twelfth graders that were modeled after traditional drill and practice routines. Research questions are presented, treatment conditions are explained, and additional research is…

  17. Mitochondrial DNA 4977-base pair common deletion in blood leukocytes and melanoma risk.

    PubMed

    Shen, Jie; Wan, Jie; Huff, Chad; Fang, Shenying; Lee, Jeffrey E; Zhao, Hua

    2016-05-01

    The 4977-base pair common deletion DmtDNA4977 is the most frequently observed mitochondrial DNA mutation in human tissues. Because mitochondrial DNA mutations are mainly caused by reactive oxygen species (ROS), and given that oxidative stress plays an important role in melanoma carcinogenesis, the investigation of DmtDNA4977 may be particularly relevant to the development of melanoma. In this study, we compared DmtDNA4977 levels in blood leukocytes from 206 melanoma patients and 219 healthy controls. Overall, melanoma cases had significantly higher levels of DmtDNA4977 than healthy controls (median: 0.60 vs 0.20, P = 0.008). The difference was evident among individuals who were older than 47 yrs, women, and had pigmentation risk factors (e.g., blond or red hair, blue eye, fair skin, light, or none tanning ability after prolonged sun exposure, and freckling in the sun as a child). The difference was also evident among those who had at least one lifetime sunburn with blistering and had no reported use of a sunlamp. Interestingly, among controls, DmtDNA4977 levels differed by phenotypic index and reported use of a sunlamp. In the risk assessment, increased levels of DmtDNA4977 were associated with a 1.23-fold increased risk of melanoma (odds ratio (OR): 1.23, 95% confidence interval (90% CI): 1.01, 1.50). A significant dose-response relationship was observed in quartile analysis (P = 0.001). In summary, our study suggests that high levels of DmtDNA4977 in blood leukocytes are associated with increased risk of melanoma and that association is affected by both pigmentation and personal history of sun exposure.

  18. Mitochondrial DNA 4977-base pair common deletion in blood leucocytes and melanoma risk

    PubMed Central

    Shen, Jie; Wan, Jie; Huff, Chad; Fang, Shenying; Lee, Jeffrey E.; Zhao, Hua

    2017-01-01

    The 4977-base pair common deletion DmtDNA4977 is the most frequently observed mitochondrial DNA mutation in human tissues. Because mitochondrial DNA mutations are mainly caused by reactive oxygen species (ROS), and given that oxidative stress plays an important role in melanoma carcinogenesis, the investigation of DmtDNA4977 may be particularly relevant to the development of melanoma. In the current study, we compared DmtDNA4977 levels in blood leucocytes from 206 melanoma patients and 219 healthy controls. Overall, melanoma cases had significantly higher levels of DmtDNA4977 than healthy controls (median: 0.60 vs 0.20, P=0.008). The difference was evident among individuals who were older than 47 years old, women, and had pigmentation risk factors (e.g. blond or red hair, blue eye, fair skin, light or none tanning ability after prolonged sun exposure, and freckling in the sun as a child). The difference was also evident among those who had at least one lifetime sunburn with blistering and had no reported use of a sunlamp. Interestingly, among controls, DmtDNA4977 levels differed by phenotypic index and reported use of a sunlamp. In the risk assessment, increased levels of DmtDNA4977 were associated with a 1.23-fold increased risk of melanoma (Odds ratio (OR): 1.23, 95% Confidence Interval (90% CI): 1.01, 1.50). A significant dose-response relationship was observed in quartile analysis (P=0.001). In summary, our study suggests that high levels of DmtDNA4977 in blood leucocytes are associated with increased risk of melanoma, and that association is affected by both pigmentation and personal history of sun exposure. PMID:26988264

  19. Josephson effect studies of pairing symmetry in Fe-based superconductors

    NASA Astrophysics Data System (ADS)

    Zhang, Xiaohang

    2010-03-01

    To investigate the pairing symmetry in the recently discovered Fe-based superconductors, Josephson effect studies have been performed on two types of c-axis junctions incorporating 122-type iron pnictide superconductors: junctions between s-wave superconductors and iron pnictide superconductors [1] and junctions between electron-doped and hole-doped iron pnictide superconductors [2]. The ac Josephson effect was observed in the I-V characteristics for both types of junctions under microwave irradiation. By applying external magnetic fields parallel to the junction interfaces, Fraunhofer-like patterns were obtained. Analysis based on the obtained modulation patterns suggests that the Josephson current is flowing along the c-axis direction within a typical area of 10 x 10 (μm)^2. The presence of Josephson coupling between an s-wave superconductor and a 122-type iron pnictide superconductor along the c-axis strongly supports an s-wave symmetry in the iron pnictide superconductor. Moreover, our observed Josephson effect in the bicrystal junctions indicates that phase coherence can be established between electron-doped and hole-doped iron pnictide superconductors. Such a phase-coherent p-n structure is an important component [3] for performing definitive phase-sensitive tests for the proposed s± symmetry in Fe-based superconductors. Progress in carrying out such tests will be discussed. Recent results on systematic measurements of the energy gap using Andreev reflection spectroscopy with highly transparent contacts will also be presented. This work is supported by the NSF (DMR-0653535) and performed in collaboration with S. R. Saha, N. P. Butch, K. Kirshenbaum, J. Paglione, R. L. Greene, I. Takeuchi at UMD, and Y. S. Oh, Y. Liu, L. Q. Yan, K. H. Kim at SNU. [4pt] [1] X. H. Zhang et al., Phys. Rev. Lett. 102, 147002 (2009).[0pt] [2] X. H. Zhang et al., Appl. Phy. Lett. 95, 062510 (2009).[0pt] [3] D. Parker and I. I. Mazin, Phys. Rev. Lett. 102, 227007 (2009).

  20. NMR Structural Studies on a Nonnatural Deoxyribonucleoside Mediated Recognition of GC Base Pairs in Pyrimidine-Purine-Pyrimidine Triplexes

    DTIC Science & Technology

    1993-06-01

    A) NOE cross peaks correlating the imino protons (12.3 to 14.7 ppm) and the amino and base protons (6.4 to 9.2 ppm) in the Watson - Crick pairs in...T19(NH3)- A12(NH2 -wc); k: PI(NHI)-G11(H8); 1 PI(NHI)-(NI-1 2). In adenines, amino protons involved in Watson - Crick and Hoogsteen pairing are denoted...Science 254, 1639-1642. Watson , J. D., & Crick , F. H. C. (1953) Nature 171, 737-738.

  1. Statistics for critical clinical decision making based on readings of pairs of implanted sensors.

    PubMed

    Schmidtke, D W; Pishko, M V; Quinn, C P; Heller, A

    1996-09-01

    Low error rates are essential if lives of patients are to depend on readings of implanted sensors, such as glucose sensors in insulin-dependent diabetic patients. To verify the operation and to calibrate on demand an implanted sensor, it is necessary that calibration through a single, independent measurement involving withdrawal of only one sample of blood and its independent analysis be feasible. Such a one-point calibration must be accurate. Borrowing from nuclear reactor safety assurance, where a likelihood ratio test is applied to readings of pairs of pressure sensors for shutdown/no shutdown decisions, we apply a similar test to sensor pairs implanted in rats. We show, for five sets of glucose sensor pairs, calibrated in vivo by withdrawal of a single sample of blood, that application of the likelihood ratio test increases the fraction of the clinically correct readings from 92.4% for their averaged readings to 98.8%.

  2. Cooper pairing in the insulating valence band in iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Hu, Lun-Hui; Chen, Wei-Qiang; Zhang, Fu-Chun

    2015-04-01

    Conventional Cooper pairing arises from attractive interaction of electrons in the metallic bands. A recent experiment on Co-doped LiFeAs shows superconductivity in the insulating valence band, which is evolved from a metallic hole band upon doping. Here we examine this phenomenon by studying superconductivity in a three-orbital Hamiltonian relevant to the doped LiFeAs. We show explicitly that Cooper pairing of the insulating hole band requires a finite pairing interaction strength. For strong coupling, the superconductivity in the hole band is robust against the sink of the hole band below the Fermi level. Our theory predicts a substantial upward shift of the chemical potential in the superconducting transition for Co-doped LiFeAs.

  3. Base pair sensitivity and enhanced ON/OFF ratios of DNA-binding: donor-acceptor-donor fluorophores.

    PubMed

    Wilson, James N; Wigenius, Jens; Pitter, Demar R G; Qiu, Yanhua; Abrahamsson, Maria; Westerlund, Fredrik

    2013-10-10

    The photophysical properties of two recently reported live cell compatible, DNA-binding dyes, 4,6-bis(4-(4-methylpiperazin-1-yl)phenyl)pyrimidin-2-ol, 1, and [1,3-bis[4-(4-methylpiperazin-1-yl)phenyl]-1,3-propandioato-κO, κO']difluoroboron, 2, are characterized. Both dyes are quenched in aqueous solutions, while binding to sequences containing only AT pairs enhances the emission. Binding of the dyes to sequences containing only GC pairs does not produce a significant emission enhancement, and for sequences containing both AT and GC base pairs, emission is dependent on the length of the AT pair tracts. Through emission lifetime measurements and analysis of the dye redox potentials, photoinduced electron transfer with GC pairs is implicated as a quenching mechanism. Binding of the dyes to AT-rich regions is accompanied by bathochromic shifts of 26 and 30 nm, respectively. Excitation at longer wavelengths thus increases the ON/OFF ratio of the bound probes significantly and provides improved contrast ratios in solution as well as in fluorescence microscopy of living cells.

  4. Hole states based on the {11}/{2}-[505] neutron orbital within the pairing gap

    NASA Astrophysics Data System (ADS)

    Peterson, R. J.; Garrett, J. D.

    1984-02-01

    Coupled-channel calculations have been performed for (d, p) and (d, t) reactions on the stable doubly even isotopes of Gd, Dy and Er for {11}/{2}- neutron transfer to the [505] band heads. Comparison to published data permitted reliable extraction of the occupation numbers for this orbital. The occupation numbers V2 were found to be much greater than the emptiness numbers U2, even for very low-lying excitations. These results can only be obtained for a very small pairing parameter, Δ, consistent with other less direct determinations. These results are as expected for a diminution of the pairing interaction for this oblate [505] orbital.

  5. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs.

    PubMed

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-29

    Two identical 5'GACG3' tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5' end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5'GACG3') forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5'A·U3' for H3, 5'U·A3' for H2) to 5'G·C3'/5'C·G3' has significant effect on the stability of the kissing complexes: the substitution to 5'C·G3' significantly decreases both thermal and mechanical stability, while switching to the 5'G·C3' significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5'A·U3' for H3 and 5'U·A3' for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Mechanistic insights into temperature-dependent regulation of the simple cyanobacterial hsp17 RNA thermometer at base-pair resolution

    PubMed Central

    Wagner, Dominic; Rinnenthal, Jörg; Narberhaus, Franz; Schwalbe, Harald

    2015-01-01

    The cyanobacterial hsp17 ribonucleicacid thermometer (RNAT) is one of the smallest naturally occurring RNAT. It forms a single hairpin with an internal 1×3-bulge separating the start codon in stem I from the ribosome binding site (RBS) in stem II. We investigated the temperature-dependent regulation of hsp17 by mapping individual base-pair stabilities from solvent exchange nuclear magnetic resonance (NMR) spectroscopy. The wild-type RNAT was found to be stabilized by two critical CG base pairs (C14-G27 and C13-G28). Replacing the internal 1×3 bulge by a stable CG base pair in hsp17rep significantly increased the global stability and unfolding cooperativity as evidenced by circular dichroism spectroscopy. From the NMR analysis, remote stabilization and non-nearest neighbour effects exist at the base-pair level, in particular for nucleotide G28 (five nucleotides apart from the side of mutation). Individual base-pair stabilities are coupled to the stability of the entire thermometer within both the natural and the stabilized RNATs by enthalpy–entropy compensation presumably mediated by the hydration shell. At the melting point the Gibbs energies of the individual nucleobases are equalized suggesting a consecutive zipper-type unfolding mechanism of the RBS leading to a dimmer-like function of hsp17 and switch-like regulation behaviour of hsp17rep. The data show how minor changes in the nucleotide sequence not only offset the melting temperature but also alter the mode of temperature sensing. The cyanobacterial thermosensor demonstrates the remarkable adjustment of natural RNATs to execute precise temperature control. PMID:25940621

  7. Mechanistic insights into temperature-dependent regulation of the simple cyanobacterial hsp17 RNA thermometer at base-pair resolution.

    PubMed

    Wagner, Dominic; Rinnenthal, Jörg; Narberhaus, Franz; Schwalbe, Harald

    2015-06-23

    The cyanobacterial hsp17 ribonucleicacid thermometer (RNAT) is one of the smallest naturally occurring RNAT. It forms a single hairpin with an internal 1×3-bulge separating the start codon in stem I from the ribosome binding site (RBS) in stem II. We investigated the temperature-dependent regulation of hsp17 by mapping individual base-pair stabilities from solvent exchange nuclear magnetic resonance (NMR) spectroscopy. The wild-type