Science.gov

Sample records for a-t base pairs

  1. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    PubMed

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  2. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    PubMed

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  3. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs

    PubMed Central

    De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude

    2017-01-01

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung−/−Pms2−/− mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. PMID:28283534

  4. Base pairing and base mis-pairing in nucleic acids

    NASA Technical Reports Server (NTRS)

    Wang, A. H. J.; Rich, A.

    1986-01-01

    In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

  5. Report on Pairing-based Cryptography.

    PubMed

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  6. Report on Pairing-based Cryptography

    PubMed Central

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST’s position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed. PMID:26958435

  7. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides

    PubMed Central

    Buchmueller, Karen L.; Staples, Andrew M.; Uthe, Peter B.; Howard, Cameron M.; Pacheco, Kimberly A. O.; Cox, Kari K.; Henry, James A.; Bailey, Suzanna L.; Horick, Sarah M.; Nguyen, Binh; Wilson, W. David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, –ImPy– and –PyPy–. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and ΔTM experiments. The f/Py pairing, when placed next to the –ImPy– or –PyPy– central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With –ImPy– central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson–Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the –PyPy– central pairings. PMID:15703305

  8. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  9. Molecular switching behavior in isosteric DNA base pairs.

    PubMed

    Jissy, A K; Konar, Sukanya; Datta, Ayan

    2013-04-15

    The structures and proton-coupled behavior of adenine-thymine (A-T) and a modified base pair containing a thymine isostere, adenine-difluorotoluene (A-F), are studied in different solvents by dispersion-corrected density functional theory. The stability of the canonical Watson-Crick base pair and the mismatched pair in various solvents with low and high dielectric constants is analyzed. It is demonstrated that A-F base pairing is favored in solvents with low dielectric constant. The stabilization and conformational changes induced by protonation are also analyzed for the natural as well as the mismatched base pair. DNA sequences capable of changing their sequence conformation on protonation are used in the construction of pH-based molecular switches. An acidic medium has a profound influence in stabilizing the isostere base pair. Such a large gain in stability on protonation leads to an interesting pH-controlled molecular switch, which can be incorporated in a natural DNA tract. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  11. Radical-pair based avian magnetoreception

    NASA Astrophysics Data System (ADS)

    Procopio, Maria; Ritz, Thorsten

    2014-03-01

    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  12. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  13. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    PubMed

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  14. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  15. Signature scheme based on bilinear pairs

    NASA Astrophysics Data System (ADS)

    Tong, Rui Y.; Geng, Yong J.

    2013-03-01

    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  16. Method for sequencing DNA base pairs

    DOEpatents

    Sessler, A.M.; Dawson, J.

    1993-12-14

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.

  17. Nonhomologous Pairing in Mice Heterozygous for a t Haplotype Can Produce Recombinant Chromosomes with Duplications and Deletions

    PubMed Central

    Sarvetnick, Nora; Fox, Howard S.; Mann, Elizabeth; Mains, Paul E.; Elliott, Rosemary W.; Silver, Lee M.

    1986-01-01

    We have investigated the structure and properties of a chromosomal product recovered from a rare recombination event between a t haplotype and a wild-type form of mouse chromosome 17. Our embryological and molecular studies indicate that this chromosome (twLub2 ) is characterized by both a deletion and duplication of adjacent genetic material. The deletion appears to be responsible for a dominant lethal maternal effect and a recessive embryonic lethality. The duplication provides an explanation for the twLub2 suppression of the dominant T locus phenotype. A reanalysis of previously described results with another chromosome 17 variant called TtOrl indicates a structure for this chromosome that is reciprocal to that observed for twLub2. We have postulated the existence of an inversion over the proximal portion of all complete t haplotypes in order to explain the generation of the partial t haplotypes t wLub2 and TtOrl. This proximal inversion and the previously described distal inversion are sufficient to account for all of the recombination properties that are characteristic of complete t haplotypes. The structures determined for twLub2 and TtOrl indicate that rare recombination can occur between nonequivalent genomic sequences within the inverted proximal t region when wild-type and t chromosomes are paired in a linear, nonhomologous configuration. PMID:3732789

  18. Nucleic acid duplexes incorporating a dissociable covalent base pair

    NASA Technical Reports Server (NTRS)

    Gao, K.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure.

  19. Nucleic acid duplexes incorporating a dissociable covalent base pair

    PubMed Central

    Gao, Kui; Orgel, Leslie E.

    1999-01-01

    We have used molecular modeling techniques to design a dissociable covalently bonded base pair that can replace a Watson-Crick base pair in a nucleic acid with minimal distortion of the structure of the double helix. We introduced this base pair into a potential precursor of a nucleic acid double helix by chemical synthesis and have demonstrated efficient nonenzymatic template-directed ligation of the free hydroxyl groups of the base pair with appropriate short oligonucleotides. The nonenzymatic ligation reactions, which are characteristic of base paired nucleic acid structures, are abolished when the covalent base pair is reduced and becomes noncoplanar. This suggests that the covalent base pair linking the two strands in the duplex is compatible with a minimally distorted nucleic acid double-helical structure. PMID:10611299

  20. Array-Based Discovery of Aptamer Pairs

    DTIC Science & Technology

    2014-12-11

    affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such constructs, because they can be linked via...standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult to generate, primarily because...conventional selection methods preferentially yield aptamers that recognize a dominant “hot spot” epitope. Our 1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND

  1. An ensemble of SVM classifiers based on gene pairs.

    PubMed

    Tong, Muchenxuan; Liu, Kun-Hong; Xu, Chungui; Ju, Wenbin

    2013-07-01

    In this paper, a genetic algorithm (GA) based ensemble support vector machine (SVM) classifier built on gene pairs (GA-ESP) is proposed. The SVMs (base classifiers of the ensemble system) are trained on different informative gene pairs. These gene pairs are selected by the top scoring pair (TSP) criterion. Each of these pairs projects the original microarray expression onto a 2-D space. Extensive permutation of gene pairs may reveal more useful information and potentially lead to an ensemble classifier with satisfactory accuracy and interpretability. GA is further applied to select an optimized combination of base classifiers. The effectiveness of the GA-ESP classifier is evaluated on both binary-class and multi-class datasets. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    PubMed

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    PubMed

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  4. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    NASA Technical Reports Server (NTRS)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  5. Layer-Based Approach for Image Pair Fusion.

    PubMed

    Son, Chang-Hwan; Zhang, Xiao-Ping

    2016-04-20

    Recently, image pairs, such as noisy and blurred images or infrared and noisy images, have been considered as a solution to provide high-quality photographs under low lighting conditions. In this paper, a new method for decomposing the image pairs into two layers, i.e., the base layer and the detail layer, is proposed for image pair fusion. In the case of infrared and noisy images, simple naive fusion leads to unsatisfactory results due to the discrepancies in brightness and image structures between the image pair. To address this problem, a local contrast-preserving conversion method is first proposed to create a new base layer of the infrared image, which can have visual appearance similar to another base layer such as the denoised noisy image. Then, a new way of designing three types of detail layers from the given noisy and infrared images is presented. To estimate the noise-free and unknown detail layer from the three designed detail layers, the optimization framework is modeled with residual-based sparsity and patch redundancy priors. To better suppress the noise, an iterative approach that updates the detail layer of the noisy image is adopted via a feedback loop. This proposed layer-based method can also be applied to fuse another noisy and blurred image pair. The experimental results show that the proposed method is effective for solving the image pair fusion problem.

  6. Terminal base pairs of oligodeoxynucleotides: imino proton exchange and fraying.

    PubMed

    Nonin, S; Leroy, J L; Guéron, M

    1995-08-22

    We have estimated the dissociation constant of the terminal base pairs of the B-DNA duplexes formed by 5'-d(CGCGATCGCG) and 5'-d(TAGCGCTA) by two methods, one based on the change in imino proton chemical shift with temperature and the other on the apparent pK shift of the imino proton, as monitored by the change in chemical shift of aromatic protons. These methods do not rely on imino proton exchange, whose rate was also measured. (1) The effect of ammonia on the imino proton exchange rate of the terminal pair of the 5'-d(CGCGATCGCG) duplex is 67 times less than on the isolated nucleoside. This provides an upper limit on the exchange rate from the closed pair. In fact, the effect is just as predicted from the dissociation constant, assuming that there is no exchange at all from the closed pair and that, as has been argued previously, external catalysts act on the open state as they do on the isolated nucleoside. The inhibition of catalyzed proton exchange in the closed pair, despite exposure of one face of the pair to solvent, is a new feature of the exchange process. It will allow determination of the dissociation constant of terminal pairs from the exchange rate. (2) Intrinsic catalysis of proton exchange is less efficient for the terminal pair than for an internal one. A possible explanation is that proton transfer across the water bridge responsible for intrinsic catalysis is slower, as expected if the open-state separation of the bases is larger in a terminal pair. This observation may lead to a direct method for the study of fraying. (3) At 0 degrees C, the dissociation constant of the second pair of the 5'-d(CGCGATCGCG) duplex is close to the square of the constant for the terminal pair, as predicted from a simple model of fraying. The enthalpy and entropy of opening of the terminal pairs may be compared with those of nearest neighbor interactions derived from calorimetry [Breslauer, K. J., et al. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750].

  7. The electrostatic characteristics of G·U wobble base pairs

    PubMed Central

    Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

    2007-01-01

    G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

  8. Understanding the kinetic mechanism of RNA single base pair formation

    PubMed Central

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-01

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466

  9. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    PubMed

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  10. Social Networks-Based Adaptive Pairing Strategy for Cooperative Learning

    ERIC Educational Resources Information Center

    Chuang, Po-Jen; Chiang, Ming-Chao; Yang, Chu-Sing; Tsai, Chun-Wei

    2012-01-01

    In this paper, we propose a grouping strategy to enhance the learning and testing results of students, called Pairing Strategy (PS). The proposed method stems from the need of interactivity and the desire of cooperation in cooperative learning. Based on the social networks of students, PS provides members of the groups to learn from or mimic…

  11. Configurations of base-pair complexes in solutions. [nucleotide chemistry

    NASA Technical Reports Server (NTRS)

    Egan, J. T.; Nir, S.; Rein, R.; Macelroy, R.

    1978-01-01

    A theoretical search for the most stable conformations (i.e., stacked or hydrogen bonded) of the base pairs A-U and G-C in water, CCl4, and CHCl3 solutions is presented. The calculations of free energies indicate a significant role of the solvent in determining the conformations of the base-pair complexes. The application of the continuum method yields preferred conformations in good agreement with experiment. Results of the calculations with this method emphasize the importance of both the electrostatic interactions between the two bases in a complex, and the dipolar interaction of the complex with the entire medium. In calculations with the solvation shell method, the last term, i.e., dipolar interaction of the complex with the entire medium, was added. With this modification the prediction of the solvation shell model agrees both with the continuum model and with experiment, i.e., in water the stacked conformation of the bases is preferred.

  12. Synthesis, base pairing and structure studies of geranylated RNA

    PubMed Central

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-01-01

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604

  13. Synthesis, base pairing and structure studies of geranylated RNA.

    PubMed

    Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia

    2016-07-27

    Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. A T Matrix Method Based upon Scalar Basis Functions

    NASA Technical Reports Server (NTRS)

    Mackowski, D.W.; Kahnert, F. M.; Mishchenko, Michael I.

    2013-01-01

    A surface integral formulation is developed for the T matrix of a homogenous and isotropic particle of arbitrary shape, which employs scalar basis functions represented by the translation matrix elements of the vector spherical wave functions. The formulation begins with the volume integral equation for scattering by the particle, which is transformed so that the vector and dyadic components in the equation are replaced with associated dipole and multipole level scalar harmonic wave functions. The approach leads to a volume integral formulation for the T matrix, which can be extended, by use of Green's identities, to the surface integral formulation. The result is shown to be equivalent to the traditional surface integral formulas based on the VSWF basis.

  15. Error simulation of paired-comparison-based scaling methods

    NASA Astrophysics Data System (ADS)

    Cui, Chengwu

    2000-12-01

    Subjective image quality measurement usually resorts to psycho physical scaling. However, it is difficult to evaluate the inherent precision of these scaling methods. Without knowing the potential errors of the measurement, subsequent use of the data can be misleading. In this paper, the errors on scaled values derived form paired comparison based scaling methods are simulated with randomly introduced proportion of choice errors that follow the binomial distribution. Simulation results are given for various combinations of the number of stimuli and the sampling size. The errors are presented in the form of average standard deviation of the scaled values and can be fitted reasonably well with an empirical equation that can be sued for scaling error estimation and measurement design. The simulation proves paired comparison based scaling methods can have large errors on the derived scaled values when the sampling size and the number of stimuli are small. Examples are also given to show the potential errors on actually scaled values of color image prints as measured by the method of paired comparison.

  16. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    PubMed

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  17. 1,8-Naphthyridine-2,7-diamine: A Potential Universal Reader of the Watson-Crick Base Pairs for DNA Sequencing by Electron Tunneling

    PubMed Central

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2013-01-01

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read the DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A:T and G:C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs. PMID:23038027

  18. Physics of base-pairing dynamics in DNA

    NASA Astrophysics Data System (ADS)

    Manghi, Manoel; Destainville, Nicolas

    2016-05-01

    As a key molecule of life, Deoxyribo-Nucleic Acid (DNA) is the focus of numbers of investigations with the help of biological, chemical and physical techniques. From a physical point of view, both experimental and theoretical works have brought quantitative insights into DNA base-pairing dynamics that we review in this Report, putting emphasis on theoretical developments. We discuss the dynamics at the base-pair scale and its pivotal coupling with the polymer one, with a polymerization index running from a few nucleotides to tens of kilo-bases. This includes opening and closure of short hairpins and oligomers as well as zipping and unwinding of long macromolecules. We review how different physical mechanisms are either used by Nature or utilized in biotechnological processes to separate the two intertwined DNA strands, by insisting on quantitative results. They go from thermally-assisted denaturation bubble nucleation to force- or torque-driven mechanisms. We show that the helical character of the molecule, possibly supercoiled, can play a key role in many denaturation and renaturation processes. We categorize the mechanisms according to the relative timescales associated with base-pairing and chain orientational degrees of freedom such as bending and torsional elastic ones. In some specific situations, these chain orientational degrees of freedom can be integrated out, and the quasi-static approximation is valid. The complex dynamics then reduces to the diffusion in a low-dimensional free-energy landscape. In contrast, some important cases of experimental interest necessarily appeal to far-from-equilibrium statistical mechanics and hydrodynamics.

  19. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  20. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    NASA Astrophysics Data System (ADS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, Liu Jian; Porrino, A.

    1985-07-01

    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v=0, v=1, and v=2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states.

  1. Design and Applications of Noncanonical DNA Base Pairs.

    PubMed

    Jissy, A K; Datta, Ayan

    2014-01-02

    While the Watson-Crick base pairs are known to stabilize the DNA double helix and play a vital role in storage/replication of genetic information, their replacement with non-Watson-Crick base pairs has recently been shown to have interesting practical applications. Nowadays, theoretical calculations are routinely performed on very complex systems to gain a better understanding of how molecules interact with each other. We not only bring together some of the basic concepts of how mispaired or unnatural nucleobases interact with each other but also look at how such an understanding influences the prediction of novel properties and development of new materials. We highlight the recent developments in this field of research. In this Perspective, we discuss the success of DFT methods, particularly, dispersion-corrected DFT, for applications such as pH-controlled molecular switching, electric-field-induced stacking of disk-like molecules with guanine quartets, and optical birefringence of alkali-metal-coordinated guanine quartets. The synergy between theoretical models and real applications is highlighted.

  2. Using Pair Programming to Teach CAD Based Engineering Graphics

    ERIC Educational Resources Information Center

    Leland, Robert P.

    2010-01-01

    Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…

  3. THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides

    NASA Astrophysics Data System (ADS)

    Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

    2018-07-01

    The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most Nsbnd H and Csbnd H bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study.

  4. THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides.

    PubMed

    Wang, Fang; Zhao, Dongbo; Dong, Hao; Jiang, Ling; Huang, Lin; Liu, Yunfei; Li, Shuhua

    2018-07-05

    The generalized energy-based fragmentation (GEBF) approach has been applied to study the THz spectra and vibrational modes of base pair cocrystals under periodic boundary conditions (denoted as PBC-GEBF). Results of vibrational mode reveal that hydrogen bonds play a pivotal role in the pairing process of base crystals, where most NH and CH bonds stretch to some extent. We also found that hydrogen bonds of a self-made A:T cocrystal completely break in a transition from liquid to the solid state, while self-made C:G cocrystal is different and easier to form a cocrystal, as confirmed by X-ray diffraction (XRD) and terahertz (THz) spectra. Furthermore, we have studied DNA polynucleotides (in both A and B forms) found that the vibrational modes changed a lot during the process of their forming double strand. Despite the key role played by hydrogen bonds, the key contribution originates from collective motions of the main skeleton. A comparative study of the spectra of some stranded fragments suggests that different sequences or forms have similar spectra in THz band. They distinguish from each other mainly in the low-frequency regions, especially below 1 THz. This study would make great contributions to the molecular dynamics model based DNA long-chain structure simulation in the future study. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. The influence of arene-ring size on stacking interaction with canonical base pairs

    NASA Astrophysics Data System (ADS)

    Formánek, Martin; Burda, Jaroslav V.

    2014-04-01

    Stacking interactions between aromatic molecules (benzene, p-cymene, biphenyl, and di- and tetra-hydrogen anthracene) and G.C and A.T canonical Watson-Crick (WC) base pairs are explored. Two functionals with dispersion corrections: ω-B97XD and B3LYP-D3 are used. For a comparison also the MP2 and B3LYP-D3/PCM methods were used for the most stable p-cymene…WC geometries. It was found that the stacking interaction increases with the size of π-conjugation system. Its extent is in agreement with experimental finding on anticancer activity of Ru(II) piano-stool complexes where intercalation of these aromatic molecules should play an important role. The explored structures are considered as ternary system so that decomposition of the interaction energy to pairwise and non-additivity contributions is also examined.

  6. Bifacial Base-Pairing Behaviors of 5-Hydroxyuracil DNA Bases through Hydrogen Bonding and Metal Coordination.

    PubMed

    Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko

    2015-10-12

    A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Mutagen Synergy: Hypermutability Generated by Specific Pairs of Base Analogs

    PubMed Central

    Ang, Jocelyn; Song, Lisa Yun; D'Souza, Sara; Hong, Irene L.; Luhar, Rohan; Yung, Madeline

    2016-01-01

    ABSTRACT We tested pairwise combinations of classical base analog mutagens in Escherichia coli to study possible mutagen synergies. We examined the cytidine analogs zebularine (ZEB) and 5-azacytidine (5AZ), the adenine analog 2-aminopurine (2AP), and the uridine/thymidine analog 5-bromodeoxyuridine (5BrdU). We detected a striking synergy with the 2AP plus ZEB combination, resulting in hypermutability, a 35-fold increase in mutation frequency (to 53,000 × 10−8) in the rpoB gene over that with either mutagen alone. A weak synergy was also detected with 2AP plus 5AZ and with 5BrdU plus ZEB. The pairing of 2AP and 5BrdU resulted in suppression, lowering the mutation frequency of 5BrdU alone by 6.5-fold. Sequencing the mutations from the 2AP plus ZEB combination showed the predominance of two new hot spots for A·T→G·C transitions that are not well represented in either single mutagen spectrum, and one of which is not found even in the spectrum of a mismatch repair-deficient strain. The strong synergy between 2AP and ZEB could be explained by changes in the dinucleoside triphosphate (dNTP) pools. IMPORTANCE Although mutagens have been widely studied, the mutagenic effects of combinations of mutagens have not been fully researched. Here, we show that certain pairwise combinations of base analog mutagens display synergy or suppression. In particular, the combination of 2-aminopurine and zebularine, analogs of adenine and cytidine, respectively, shows a 35-fold increased mutation frequency compared with that of either mutagen alone. Understanding the mechanism of synergy can lead to increased understanding of mutagenic processes. As combinations of base analogs are used in certain chemotherapy regimens, including those involving ZEB and 5AZ, these results indicate that testing the mutagenicity of all drug combinations is prudent. PMID:27457718

  8. Detection of figure and caption pairs based on disorder measurements

    NASA Astrophysics Data System (ADS)

    Faure, Claudie; Vincent, Nicole

    2010-01-01

    Figures inserted in documents mediate a kind of information for which the visual modality is more appropriate than the text. A complete understanding of a figure often necessitates the reading of its caption or to establish a relationship with the main text using a numbered figure identifier which is replicated in the caption and in the main text. A figure and its caption are closely related; they constitute single multimodal components (FC-pair) that Document Image Analysis cannot extract with text and graphics segmentation. We propose a method to go further than the graphics and text segmentation in order to extract FC-pairs without performing a full labelling of the page components. Horizontal and vertical text lines are detected in the pages. The graphics are associated with selected text lines to initiate the detector of FC-pairs. Spatial and visual disorders are introduced to define a layout model in terms of properties. It enables to cope with most of the numerous spatial arrangements of graphics and text lines. The detector of FC-pairs performs operations in order to eliminate the layout disorder and assigns a quality value to each FC-pair. The processed documents were collected in medic@, the digital historical collection of the BIUM (Bibliothèque InterUniversitaire Médicale). A first set of 98 pages constitutes the design set. Then 298 pages were collected to evaluate the system. The performances are the result of a full process, from the binarisation of the digital images to the detection of FC-pairs.

  9. Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

    PubMed Central

    Yusupov, Marat; Yusupova, Gulnara

    2014-01-01

    The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

  10. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    PubMed Central

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  11. Reversed-phase ion-pair liquid chromatography method for purification of duplex DNA with single base pair resolution

    PubMed Central

    Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.

    2013-01-01

    Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567

  12. Developing Topological Insulator Fiber Based Photon Pairs Source for Ultrafast Optoelectronic Applications

    DTIC Science & Technology

    2016-04-01

    DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED PHOTON PAIRS SOURCE FOR ULTRAFAST OPTOELECTRONIC APPLICATIONS NORTHWESTERN UNIVERSITY...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) APRIL 2015 – DEC 2015 4. TITLE AND SUBTITLE DEVELOPING TOPOLOGICAL INSULATOR FIBER BASED...in developing a new source for the production of correlated/entangled photon pairs based on the unique nanolayer properties of topological insulator

  13. Database of non-canonical base pairs found in known RNA structures

    NASA Technical Reports Server (NTRS)

    Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.

    2000-01-01

    Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.

  14. Lewis pair polymerization by classical and frustrated Lewis pairs: acid, base and monomer scope and polymerization mechanism.

    PubMed

    Zhang, Yuetao; Miyake, Garret M; John, Mallory G; Falivene, Laura; Caporaso, Lucia; Cavallo, Luigi; Chen, Eugene Y-X

    2012-08-14

    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C(6)F(5))(3) with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl-α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C(6)F(5))(3)-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C(6)F(5))(3), can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P(t)Bu(3)), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P(4)-(t)Bu). The P(4)-(t)Bu/Al(C(6)F(5))(3) pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10(4) h(-1) (0.125 mol% catalyst, 100% MMA conversion in 30 s, M(n) = 2.12 × 10(5) g mol(-1), PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P(γ)MMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C(6)F(5))(3) adduct with P(t)Bu(3) and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the (t)Bu(3)P/Al(C(6)F(5))(3) pair is zero-order in monomer concentration after an initial

  15. The Impact of a Peer-Learning Agent Based on Pair Programming in a Programming Course

    ERIC Educational Resources Information Center

    Han, Keun-Woo; Lee, EunKyoung; Lee, YoungJun

    2010-01-01

    This paper analyzes the educational effects of a peer-learning agent based on pair programming in programming courses. A peer-learning agent system was developed to facilitate the learning of a programming language through the use of pair programming strategies. This system is based on the role of a peer-learning agent from pedagogical and…

  16. Structural landscape of base pairs containing post-transcriptional modifications in RNA

    PubMed Central

    Seelam, Preethi P.; Sharma, Purshotam

    2017-01-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. PMID:28341704

  17. Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.

    PubMed

    Nakano, Shu-ichi; Sugimoto, Naoki

    2014-08-05

    The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  18. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  19. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    PubMed

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Molecular mechanical studies of DNA flexibility: Coupled backbone torsion angles and base-pair openings

    PubMed Central

    Keepers, Joe W.; Kollman, Peter A.; Weiner, Paul K.; James, Thomas L.

    1982-01-01

    Molecular mechanics studies have been carried out on “B-DNA-like” structures of [d(C-G-C-G-A-A-T-T-C-G-C-G)]2 and [d(A)]12·[d(T)]12. Each of the backbone torsion angles (ψ, φ, ω, ω′, φ′) has been “forced” to alternative values from the normal B-DNA values (g+, t, g-, g-, t conformations). Compensating torsion angle changes preserve most of the base stacking energy in the double helix. In a second part of the study, one purine N3-pyrimidine N1 distance at a time has been forced to a value of 6 Å in an attempt to simulate the base opening motions required to rationalize proton exchange data for DNA. When the 6-Å constraint is removed, many of the structures revert to the normal Watson-Crick hydrogen-bonded structure, but a number are trapped in structures ≈5 kcal/mol higher in energy than the starting B-DNA structure. The relative energy of these structures, some of which involve a non-Watson-Crick thymine C2(carbonyl)[unk]adenine 6NH2 hydrogen bond, are qualitatively consistent with the ΔH for a “base pair-open state” suggested by Mandal et al. of 4-6 kcal/mol [Mandal, C., Kallenbach, N. R. & Englander, S. W. (1979) J. Mol. Biol. 135, 391-411]. The picture of DNA flexibility emerging from this study depicts the backbone as undergoing rapid motion between local torsional minima on a nanosecond time scale. Backbone motion is mainly localized within a dinucleoside segment and generally not conformationally coupled along the chain or across the base pairs. Base motions are much smaller in magnitude than backbone motions. Base sliding allows imino N—H exchange, but it is localized, and only a small fraction of the N—H groups is exposed at any one time. Stacking and hydrogen bonding cause a rigid core of bases in the center of the molecule accounting for the hydrodynamic properties of DNA. PMID:6957879

  1. Comparison of the conformation of an oligonucleotide containing a central G-T base pair with the non-mismatch sequence by proton NMR.

    PubMed Central

    Quignard, E; Fazakerley, G V; van der Marel, G; van Boom, J H; Guschlbauer, W

    1987-01-01

    We have recorded NOESY spectra of two non-selfcomplementary undecanucleotide duplexes. From the observed NOEs we do not detect any significant distortion of the helix when a G-C pair is replaced by a G-T pair and the normal interresidue connectivities can be followed through the mismatch site. We conclude that the 2D spectra of the non-exchangeable protons do not allow differentiation between a wobble or rare tautomer form for the mismatch. NOE measurements in H2O, however, clearly show that the mismatch adopts a wobble structure and give information on the hydration in the minor groove for the G-T base pair which is embedded between two A-T base pairs in the sequence. PMID:3033602

  2. N-H Stretching Excitations in Adenosine-Thymidine Base Pairs in Solution: Base Pair Geometries, Infrared Line Shapes and Ultrafast Vibrational Dynamics

    PubMed Central

    Greve, Christian; Preketes, Nicholas K.; Fidder, Henk; Costard, Rene; Koeppe, Benjamin; Heisler, Ismael A.; Mukamel, Shaul; Temps, Friedrich; Nibbering, Erik T. J.; Elsaesser, Thomas

    2013-01-01

    We explore the N-H stretching vibrations of adenosine-thymidine base pairs in chloroform solution with linear and nonlinear infrared spectroscopy. Based on estimates from NMR measurements and ab initio calculations, we conclude that adenosine and thymidine form hydrogen bonded base pairs in Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen configurations with similar probability. Steady-state concentration- and temperature dependent linear FT-IR studies, including H/D exchange experiments, reveal that these hydrogen-bonded base pairs have complex N-H/N-D stretching spectra with a multitude of spectral components. Nonlinear 2D-IR spectroscopic results, together with IR-pump-IR-probe measurements, as also corroborated by ab initio calculations, reveal that the number of N-H stretching transitions is larger than the total number of N-H stretching modes. This is explained by couplings to other modes, such as an underdamped low-frequency hydrogen-bond mode, and a Fermi resonance with NH2 bending overtone levels of the adenosine amino-group. Our results demonstrate that modeling based on local N-H stretching vibrations only is not sufficient and call for further refinement of the description of the N-H stretching manifolds of nucleic acid base pairs of adenosine and thymidine, incorporating a multitude of couplings with fingerprint and low-frequency modes. PMID:23234439

  3. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  4. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    PubMed Central

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  5. Structural features of the DNA hairpin d(ATCCTA-GTTA-TAGGAT): formation of a G-A base pair in the loop.

    PubMed Central

    van Dongen, M J; Mooren, M M; Willems, E F; van der Marel, G A; van Boom, J H; Wijmenga, S S; Hilbers, C W

    1997-01-01

    The three-dimensional structure of the hairpin formed by d(ATCCTA-GTTA-TAGGAT) has been determined by means of two-dimensional NMR studies, distance geometry and molecular dynamics calculations. The first and the last residues of the tetraloop of this hairpin form a sheared G-A base pair on top of the six Watson-Crick base pairs in the stem. The glycosidic torsion angles of the guanine and adenine residues in the G-A base pair reside in the anti and high- anti domain ( approximately -60 degrees ) respectively. Several dihedral angles in the loop adopt non-standard values to accommodate this base pair. The first and second residue in the loop are stacked in a more or less normal helical fashion; the fourth loop residue also stacks upon the stem, while the third residue is directed away from the loop region. The loop structure can be classified as a so-called type-I loop, in which the bases at the 5'-end of the loop stack in a continuous fashion. In this situation, loop stability is unlikely to depend heavily on the nature of the unpaired bases in the loop. Moreover, the present study indicates that the influence of the polarity of a closing A.T pair is much less significant than that of a closing C.G base pair. PMID:9092659

  6. Orbital selective pairing and gap structures of iron-based superconductors

    SciTech Connect

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  7. Orbital selective pairing and gap structures of iron-based superconductors

    DOE PAGES

    Kreisel, Andreas; Andersen, Brian M.; Sprau, P. O.; ...

    2017-05-08

    We discuss the in uence on spin-fluctuation pairing theory of orbital selective strong correlation effects in Fe-based superconductors, particularly Fe chalcogenide systems. We propose that a key ingredient for an improved itinerant pairing theory is orbital selectivity, i.e., incorporating the reduced coherence of quasiparticles occupying specific orbital states. This modifies the usual spin-fluctuation via suppression of pair scattering processes involving those less coherent states and results in orbital selective Cooper pairing of electrons in the remaining states. We show that this paradigm yields remarkably good agreement with the experimentally observed anisotropic gap structures in both bulk and monolayer FeSe, asmore » well as LiFeAs, indicating that orbital selective Cooper pairing plays a key role in the more strongly correlated iron-based superconductors.« less

  8. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    PubMed

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  9. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    PubMed Central

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  10. Differential stabilities and sequence-dependent base pair opening dynamics of Watson–Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine

    DOE PAGES

    Szulik, Marta W.; Pallan, Pradeep S.; Nocek, Boguslaw; ...

    2015-01-29

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T 8X 9G 10-3' sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC didmore » not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A 5:T 8, whereas 5caC did not. At the oxidized base pair G 4:X 9, 5fC exhibited an increase in the imino proton exchange rate and the calculated k op. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C 3:G 10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G 4:X 9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N 4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. Furthermore, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.« less

  11. Determinants of Base-Pair Substitution Patterns Revealed by Whole-Genome Sequencing of DNA Mismatch Repair Defective Escherichia coli.

    PubMed

    Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu

    2018-06-15

    Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.

  12. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

    PubMed

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

    2015-01-01

    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  13. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

    PubMed Central

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

    2015-01-01

    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  14. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  15. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  16. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    PubMed Central

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  17. Sequence dependency of canonical base pair opening in the DNA double helix

    PubMed Central

    Villa, Alessandra

    2017-01-01

    The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

  18. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  19. From ecology to base pairs: nursing and genetic science.

    PubMed

    Williams, J K; Tripp-Reimer, T

    2001-07-01

    With the mapping of the human genome has come the opportunity for nursing research to explore topics of concern to the maintenance, restoration, and attainment of genetic-related health. Initially, nursing research on genetic topics originated primarily from physical anthropology and from a clinical, disease-focused perspective. Nursing research subsequently focused on psychosocial aspects of genetic conditions for individuals and their family members. As findings emerge from current human genome discovery, new programs of genetic nursing research are originating from a biobehavioral interface, ranging from the investigations of the influence of specific molecular changes on gene function to social/ethical issues of human health and disease. These initiatives reflect nursing's response to discoveries of gene mutations related to phenotypic expression in both clinical and community-based populations. Genetic research programs are needed that integrate or adapt theoretical and methodological advances in epidemiology, family systems, anthropology, and ethics with those from nursing. Research programs must address not only populations with a specific disease but also community-based genetic health care issues. As genetic health care practice evolves, so will opportunities for research by nurses who can apply genetic concepts and interventions to improve the health of the public. This article presents an analysis of the evolution of genetic nursing research and challengesfor the future.

  20. Base pair mismatch recognition using plasmon resonant particle labels.

    PubMed

    Oldenburg, Steven J; Genick, Christine C; Clark, Keith A; Schultz, David A

    2002-10-01

    We demonstrate the use of silver plasmon resonant particles (PRPs), as reporter labels, in a microarray-based DNA hybridization assay in which we screen for a known polymorphic site in the breast cancer gene BRCA1. PRPs (40-100 nm in diameter) image as diffraction-limited points of colored light in a standard microscope equipped with dark-field illumination, and can be individually identified and discriminated against background scatter. Rather than overall intensity, the number of PRPs counted in a CCD image by a software algorithm serves as the signal in these assays. In a typical PRP hybridization assay, we achieve a detection sensitivity that is approximately 60 x greater than that achieved by using fluorescent labels. We conclude that single particle counting is robust, generally applicable to a wide variety of assay platforms, and can be integrated into low-cost and quantitative detection systems for single nucleotide polymorphism analysis.

  1. Multi-hop teleportation based on W state and EPR pairs

    NASA Astrophysics Data System (ADS)

    Hai-Tao, Zhan; Xu-Tao, Yu; Pei-Ying, Xiong; Zai-Chen, Zhang

    2016-05-01

    Multi-hop teleportation has significant value due to long-distance delivery of quantum information. Many studies about multi-hop teleportation are based on Bell pairs, partially entangled pairs or W state. The possibility of multi-hop teleportation constituted by partially entangled pairs relates to the number of nodes. The possibility of multi-hop teleportation constituted by double W states is after n-hop teleportation. In this paper, a multi-hop teleportation scheme based on W state and EPR pairs is presented and proved. The successful possibility of quantum information transmitted hop by hop through intermediate nodes is deduced. The possibility of successful transmission is after n-hop teleportation. Project supported by the National Natural Science Foundation of China (Grant No. 61571105), the Prospective Future Network Project of Jiangsu Province, China (Grant No. BY2013095-1-18), and the Independent Project of State Key Laboratory of Millimeter Waves, China (Grant No. Z201504).

  2. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    NASA Astrophysics Data System (ADS)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  3. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

    DTIC Science & Technology

    2014-12-11

    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein,†,‡ Peter J...bidentate” target recognition, with affinities greatly exceeding either monovalent component. DNA aptamers are especially well-suited for such...constructs, because they can be linked via standard synthesis techniques without requiring chemical conjugation. Unfortunately, aptamer pairs are difficult

  4. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    PubMed

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    PubMed

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  6. Relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian: Relativistic pair correlation energies of the Xe atom

    SciTech Connect

    Eliav, E.; Kaldor, U.; Ishikawa, Y.

    1994-12-31

    Relativistic pair correlation energies of Xe were computed by employing a recently developed relativistic coupled cluster theory based on the no-pair Dirac-Coulomb-Breit Hamiltonian. The matrix Dirac-Fock-Breit SCF and relativistic coupled cluster calculations were performed by means of expansion in basis sets of well-tempered Gaussian spinors. A detailed study of the pair correlation energies in Xe is performed, in order to investigate the effects of the low-frequency Breit interaction on the correlation energies of Xe. Nonadditivity of correlation and relativistic (particularly Breit) effects is discussed.

  7. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

    PubMed

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

    2016-02-22

    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  8. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    PubMed

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  9. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    PubMed Central

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  10. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    NASA Astrophysics Data System (ADS)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  11. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    PubMed

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. PAIRS, The GIS-Based Incident Response System for Pennsylvania, and NASA

    NASA Technical Reports Server (NTRS)

    Conrad, Eric; Arbegast, Daniel; Maynard, Nancy; Vicente, Gilberto

    2003-01-01

    Over the past several years the Pennsylvania Departments of Environmental Protection (DEP), Health (DOH), and Agriculture (PDA) built the GIs-based Pennsylvania West Nile Surveillance System. That system has become a model for collecting data that has a field component, laboratory component, reporting and mapping component, and a public information component. Given the success of the West Nile Virus System and the events of September 11, 2001, DEP then embarked on the development of the Pennsylvania Incident Response System, or PAIRS. PAIRS is an effective GIs-based approach to providing a system for response to incidents of any kind, including terrorism because it is building upon the existing experience, infrastructure and databases that were successfully developed to respond to the West Nile Virus by DEP, DOH, and PDA. The proposed system can be described as one that supports data acquisition, laboratory forensics, decision making/response, and communications. Decision makers will have tools to view and analyze data from various sources and, at the same time, to communicate with the large numbers of people responding to the same incident. Recent collaborations with NASA partners are creating mechanisms for the PAIRS system to incorporate space-based and other remote sensing geophysical parameters relevant to public health assessment and management, such as surface temperatures, precipitation, land cover/land use change, and humidity. This presentation will describe the PAIRS system and outline the Pennsylvania-NASA collaboration for integration of space-based data into the PAIRS system.

  13. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    NASA Technical Reports Server (NTRS)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  14. Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

    PubMed

    Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

    2011-12-01

    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

  15. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  16. Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs

    PubMed Central

    Lee, Alex H. F.; Kool, Eric T.

    2008-01-01

    A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396

  17. Triple helical DNA in a duplex context and base pair opening

    PubMed Central

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  18. [Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

    PubMed

    Petrenko, Y M

    2015-01-01

    Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

  19. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    SciTech Connect

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  20. Concealed d-wave pairs in the s± condensate of iron-based superconductors.

    PubMed

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-17

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  1. Concealed d -wave pairs in the s ± condensate of iron-based superconductors

    DOE PAGES

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg

    2016-05-02

    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave (s ±) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. In this paper, we propose a new class of s ± statemore » containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave (L=2) motion of the pairs with the internal angular momenta I =2 of the iron orbitals to make a singlet (J =L+I =0), an s ± superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba 1$-$xK XFe 2As 2 as a reconfiguration of the orbital and internal angular momentum into a high spin (J =L+I =4) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. Finally, the formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.« less

  2. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  3. Base-Pairing Systems Related to TNA: alpha-Threofuranosyl Oligonucleotides Containing Phosphoramidate Linkages

    NASA Technical Reports Server (NTRS)

    Meyer, Michael (Technical Monitor); Wu, Xiaolin; Guntha, Sreenivasulu; Ferenclc, Mathias; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert

    2002-01-01

    (3'NH)- and (2'NH)-TNA, two isomeric phosphoramidate analogues of TNA (alpha-threofuranosyl-(3'-2') oligonucleotides), are shown to be efficient Watson-Crick base-pairing systems and to undergo intersystem crosspairing with TNA, RNA, and DNA.

  4. Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

    PubMed

    Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

    1999-07-30

    A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

  5. Time series regression-based pairs trading in the Korean equities market

    NASA Astrophysics Data System (ADS)

    Kim, Saejoon; Heo, Jun

    2017-07-01

    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  6. Base-Pairing Energies of Protonated Nucleoside Base Pairs of dCyd and m5dCyd: Implications for the Stability of DNA i-Motif Conformations

    NASA Astrophysics Data System (ADS)

    Yang, Bo; Rodgers, M. T.

    2015-08-01

    Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.

  7. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    PubMed

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  8. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  9. Watson-Crick base pairing controls excited-state decay in natural DNA.

    PubMed

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Supramolecular latching system based on ultrastable synthetic binding pairs as versatile tools for protein imaging.

    PubMed

    Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon

    2018-04-27

    Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.

  11. Coexistence of Multiple Attractors in an Active Diode Pair Based Chua’s Circuit

    NASA Astrophysics Data System (ADS)

    Bao, Bocheng; Wu, Huagan; Xu, Li; Chen, Mo; Hu, Wen

    This paper focuses on the coexistence of multiple attractors in an active diode pair based Chua’s circuit with smooth nonlinearity. With dimensionless equations, dynamical properties, including boundness of system orbits and stability distributions of two nonzero equilibrium points, are investigated, and complex coexisting behaviors of multiple kinds of disconnected attractors of stable point attractors, limit cycles and chaotic attractors are numerically revealed. The results show that unlike the classical Chua’s circuit, the proposed circuit has two stable nonzero node-foci for the specified circuit parameters, thereby resulting in the emergence of multistability phenomenon. Based on two general impedance converters, the active diode pair based Chua’s circuit with an adjustable inductor and an adjustable capacitor is made in hardware, from which coexisting multiple attractors are conveniently captured.

  12. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    PubMed

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  13. Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

    PubMed

    Calvet, J P; Meyer, L M; Pederson, T

    1982-07-30

    Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

  14. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    PubMed

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    PubMed

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  16. Identification of a t(3;4)(p1.3;q1.5) translocation breakpoint in pigs using somatic cell hybrid mapping and high-resolution mate-pair sequencing

    PubMed Central

    Fève, Katia; Foissac, Sylvain; Pinton, Alain; Mompart, Florence; Esquerré, Diane; Faraut, Thomas; Yerle, Martine

    2017-01-01

    Reciprocal translocations are the most frequently occurring constitutional structural rearrangements in mammalian genomes. In phenotypically normal pigs, an incidence of 1/200 is estimated for such rearrangements. Even if constitutional translocations do not necessarily induce defects and diseases, they are responsible for significant economic losses in domestic animals due to reproduction failures. Over the last 30 years, advances in molecular and cytogenetic technologies have led to major improvements in the resolution of the characterization of translocation events. Characterization of translocation breakpoints helps to decipher the mechanisms that lead to such rearrangements and the functions of the genes that are involved in the translocation. Here, we describe the fine characterization of a reciprocal translocation t(3;4) (p1.3;q1.5) detected in a pig line. The breakpoint was identified at the base-pair level using a positional cloning and chromosome walking strategy in somatic cell hybrids that were generated from an animal that carries this translocation. We show that this translocation occurs within the ADAMTSL4 gene and results in a loss of expression in homozygous carriers. In addition, by taking this translocation as a model, we used a whole-genome next-generation mate-pair sequencing approach on pooled individuals to evaluate this strategy for high-throughput screening of structural rearrangements. PMID:29121641

  17. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  18. An inversion of 25 base pairs causes feline GM2 gangliosidosis variant.

    PubMed

    Martin, Douglas R; Krum, Barbara K; Varadarajan, G S; Hathcock, Terri L; Smith, Bruce F; Baker, Henry J

    2004-05-01

    In G(M2) gangliosidosis variant 0, a defect in the beta-subunit of lysosomal beta-N-acetylhexosaminidase (EC 3.2.1.52) causes abnormal accumulation of G(M2) ganglioside and severe neurodegeneration. Distinct feline models of G(M2) gangliosidosis variant 0 have been described in both domestic shorthair and Korat cats. In this study, we determined that the causative mutation of G(M2) gangliosidosis in the domestic shorthair cat is a 25-base-pair inversion at the extreme 3' end of the beta-subunit (HEXB) coding sequence, which introduces three amino acid substitutions at the carboxyl terminus of the protein and a translational stop that is eight amino acids premature. Cats homozygous for the 25-base-pair inversion express levels of beta-subunit mRNA approximately 190% of normal and protein levels only 10-20% of normal. Because the 25-base-pair inversion is similar to mutations in the terminal exon of human HEXB, the domestic shorthair cat should serve as an appropriate model to study the molecular pathogenesis of human G(M2) gangliosidosis variant 0 (Sandhoff disease).

  19. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  20. High quality image-pair-based deblurring method using edge mask and improved residual deconvolution

    NASA Astrophysics Data System (ADS)

    Cui, Guangmang; Zhao, Jufeng; Gao, Xiumin; Feng, Huajun; Chen, Yueting

    2017-04-01

    Image deconvolution problem is a challenging task in the field of image process. Using image pairs could be helpful to provide a better restored image compared with the deblurring method from a single blurred image. In this paper, a high quality image-pair-based deblurring method is presented using the improved RL algorithm and the gain-controlled residual deconvolution technique. The input image pair includes a non-blurred noisy image and a blurred image captured for the same scene. With the estimated blur kernel, an improved RL deblurring method based on edge mask is introduced to obtain the preliminary deblurring result with effective ringing suppression and detail preservation. Then the preliminary deblurring result is served as the basic latent image and the gain-controlled residual deconvolution is utilized to recover the residual image. A saliency weight map is computed as the gain map to further control the ringing effects around the edge areas in the residual deconvolution process. The final deblurring result is obtained by adding the preliminary deblurring result with the recovered residual image. An optical experimental vibration platform is set up to verify the applicability and performance of the proposed algorithm. Experimental results demonstrate that the proposed deblurring framework obtains a superior performance in both subjective and objective assessments and has a wide application in many image deblurring fields.

  1. A novel hazard assessment method for biomass gasification stations based on extended set pair analysis

    PubMed Central

    Yan, Fang; Xu, Kaili; Li, Deshun; Cui, Zhikai

    2017-01-01

    Biomass gasification stations are facing many hazard factors, therefore, it is necessary to make hazard assessment for them. In this study, a novel hazard assessment method called extended set pair analysis (ESPA) is proposed based on set pair analysis (SPA). However, the calculation of the connection degree (CD) requires the classification of hazard grades and their corresponding thresholds using SPA for the hazard assessment. In regard to the hazard assessment using ESPA, a novel calculation algorithm of the CD is worked out when hazard grades and their corresponding thresholds are unknown. Then the CD can be converted into Euclidean distance (ED) by a simple and concise calculation, and the hazard of each sample will be ranked based on the value of ED. In this paper, six biomass gasification stations are introduced to make hazard assessment using ESPA and general set pair analysis (GSPA), respectively. By the comparison of hazard assessment results obtained from ESPA and GSPA, the availability and validity of ESPA can be proved in the hazard assessment for biomass gasification stations. Meanwhile, the reasonability of ESPA is also justified by the sensitivity analysis of hazard assessment results obtained by ESPA and GSPA. PMID:28938011

  2. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    PubMed Central

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  3. Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept

    NASA Technical Reports Server (NTRS)

    Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.

    2010-01-01

    The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.

  4. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  5. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Gajewski, Andrzej; Kolenderski, Piotr L.

    2016-10-01

    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  6. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    PubMed

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  7. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    PubMed Central

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C.-W.

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions. PMID:25207333

  8. Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

    PubMed

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

    2014-01-01

    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  9. The solvability of quantum k-pair network in a measurement-based way.

    PubMed

    Li, Jing; Xu, Gang; Chen, Xiu-Bo; Qu, Zhiguo; Niu, Xin-Xin; Yang, Yi-Xian

    2017-12-01

    Network coding is an effective means to enhance the communication efficiency. The characterization of network solvability is one of the most important topic in this field. However, for general network, the solvability conditions are still a challenge. In this paper, we consider the solvability of general quantum k-pair network in measurement-based framework. For the first time, a detailed account of measurement-based quantum network coding(MB-QNC) is specified systematically. Differing from existing coding schemes, single qubit measurements on a pre-shared graph state are the only allowed coding operations. Since no control operations are concluded, it makes MB-QNC schemes more feasible. Further, the sufficient conditions formulating by eigenvalue equations and stabilizer matrix are presented, which build an unambiguous relation among the solvability and the general network. And this result can also analyze the feasibility of sharing k EPR pairs task in large-scale networks. Finally, in the presence of noise, we analyze the advantage of MB-QNC in contrast to gate-based way. By an instance network [Formula: see text], we show that MB-QNC allows higher error thresholds. Specially, for X error, the error threshold is about 30% higher than 10% in gate-based way. In addition, the specific expressions of fidelity subject to some constraint conditions are given.

  10. Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

    PubMed

    Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

    2007-02-15

    Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

  11. Initial test of a T9-like P300-based speller by an ALS patient

    NASA Astrophysics Data System (ADS)

    Ron-Angevin, R.; Varona-Moya, S.; da Silva-Sauer, L.

    2015-08-01

    Objective. Visual P300-based brain-computer interface spellers offer a useful communication channel for locked-in patients, who are completely dependent in their daily lives. One of the research goals for these systems is to achieve greater communication rates by means of modifying some features of their interfaces, e.g., reducing the matrix size. However, such modifications may not work well with disabled end-users, such as patients of amyotrophic lateral sclerosis (ALS), due to a supposed reduction of their cognitive resources. The purpose of the present study was to provide a proof of concept that ALS patients could efficiently use a P300-based speller with a 4 × 3 symbol matrix based on the T9 interface developed for mobile phones. Approach. We conducted an experiment with a sample of 11 able-bodied participants and one locked-in patient with ALS. All participants tested our T9-like visual P300-based speller and also two different 7 × 6 matrix spellers based on Farwell and Donchin’s classic proposal—one of them included a word predictor system like the T9-like speller did. Main results. The performance analyses indicated that the locked-in patient benefited from using a reduced matrix size as much as healthy users did, spelling words almost 1.6 times faster and equally accurately when using the T9-like speller than when using the alternative spellers. Significance. Due to counting on only one locked-in patient, the current work constitutes a feasibility study. The actual usability of systems such as the one proposed in this paper should be determined by means of studies with a greater number of end-users in real-life conditions.

  12. Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

    PubMed

    Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

  13. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    PubMed

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  14. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    PubMed

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  15. Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system

    NASA Astrophysics Data System (ADS)

    Jiang, Cheng; Chen, Bin; Li, Jin-Jin; Zhu, Ka-Di

    2011-10-01

    Nanomechanical resonators (NRs) with very high frequency have a great potential for mass sensing with unprecedented sensitivity. In this study, we propose a scheme for mass sensing based on the NR capacitively coupled to a Cooper-pair box (CPB) driven by two microwave currents. The accreted mass landing on the resonator can be measured conveniently by tracking the resonance frequency shifts because of mass changes in the signal absorption spectrum. We demonstrate that frequency shifts induced by adsorption of ten 1587 bp DNA molecules can be well resolved in the absorption spectrum. Integration with the CPB enables capacitive readout of the mechanical resonance directly on the chip.

  16. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  17. Benchmarking of a T-wave alternans detection method based on empirical mode decomposition.

    PubMed

    Blanco-Velasco, Manuel; Goya-Esteban, Rebeca; Cruz-Roldán, Fernando; García-Alberola, Arcadi; Rojo-Álvarez, José Luis

    2017-07-01

    T-wave alternans (TWA) is a fluctuation of the ST-T complex occurring on an every-other-beat basis of the surface electrocardiogram (ECG). It has been shown to be an informative risk stratifier for sudden cardiac death, though the lack of gold standard to benchmark detection methods has promoted the use of synthetic signals. This work proposes a novel signal model to study the performance of a TWA detection. Additionally, the methodological validation of a denoising technique based on empirical mode decomposition (EMD), which is used here along with the spectral method, is also tackled. The proposed test bed system is based on the following guidelines: (1) use of open source databases to enable experimental replication; (2) use of real ECG signals and physiological noise; (3) inclusion of randomized TWA episodes. Both sensitivity (Se) and specificity (Sp) are separately analyzed. Also a nonparametric hypothesis test, based on Bootstrap resampling, is used to determine whether the presence of the EMD block actually improves the performance. The results show an outstanding specificity when the EMD block is used, even in very noisy conditions (0.96 compared to 0.72 for SNR = 8 dB), being always superior than that of the conventional SM alone. Regarding the sensitivity, using the EMD method also outperforms in noisy conditions (0.57 compared to 0.46 for SNR=8 dB), while it decreases in noiseless conditions. The proposed test setting designed to analyze the performance guarantees that the actual physiological variability of the cardiac system is reproduced. The use of the EMD-based block in noisy environment enables the identification of most patients with fatal arrhythmias. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    PubMed

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  19. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    USGS Publications Warehouse

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  20. Selective and sensitive Escherichia coli detection based on a T4 bacteriophage-immobilized multimode microfiber.

    PubMed

    Li, Yanpeng; Ma, Hui; Gan, Lin; Gong, Andong; Zhang, Haibin; Liu, Deming; Sun, Qizhen

    2018-04-17

    Escherichia coli bacteria have been found to be responsible for various health outbreaks caused by contaminated food and water. Accurate and rapid test of E. coli is thus crucial for protecting the public health. A fast-response, label-free bacteriophage-based detection of E. coli using multimode microfiber probe is proposed and demonstrated in this article. Due to the abrupt taper and subwavelength diameter, different modes are excited and guided in the microfiber as evanescent field that can interact with surrounding E. coli directly. The change of E. coli concentration and corresponding binding of E. coli bacteria on microfiber surface will lead to the shift of optical spectrum, which can be exploited for the application of biosensing. The proposed method is capable of reliable detection of E. coli concentration as low as 10 3 cfu/mL within the range of 10 3 to 10 7  cfu/mL. Owing to the advantages of high sensitivity and fast response, the microfiber probe has great potential application in the fields of environment monitoring and food safety. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.

  2. A New Scheme for the Design of Hilbert Transform Pairs of Biorthogonal Wavelet Bases

    NASA Astrophysics Data System (ADS)

    Shi, Hongli; Luo, Shuqian

    2010-12-01

    In designing the Hilbert transform pairs of biorthogonal wavelet bases, it has been shown that the requirements of the equal-magnitude responses and the half-sample phase offset on the lowpass filters are the necessary and sufficient condition. In this paper, the relationship between the phase offset and the vanishing moment difference of biorthogonal scaling filters is derived, which implies a simple way to choose the vanishing moments so that the phase response requirement can be satisfied structurally. The magnitude response requirement is approximately achieved by a constrained optimization procedure, where the objective function and constraints are all expressed in terms of the auxiliary filters of scaling filters rather than the scaling filters directly. Generally, the calculation burden in the design implementation will be less than that of the current schemes. The integral of magnitude response difference between the primal and dual scaling filters has been chosen as the objective function, which expresses the magnitude response requirements in the whole frequency range. Two design examples illustrate that the biorthogonal wavelet bases designed by the proposed scheme are very close to Hilbert transform pairs.

  3. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

    PubMed

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  4. Damage mechanism of hydroxyl radicals toward adenine—thymine base pair

    NASA Astrophysics Data System (ADS)

    Tan, Rong-Ri; Wang, Dong-Qi; Zhang, Feng-Shou

    2014-02-01

    The adenine—thymine base pair was studied in the presence of hydroxyl radicals in order to probe the hydrogen bond effect. The results show that the hydrogen bonds have little effect on the hydroxylation and dehydrogenation happened at the sites, which are not involved in a hydrogen bond, while at the sites involved in hydrogen bond formation in the base pair, the reaction becomes more difficult, both in view of the free energy barrier and the exothermicity. With a 6-311++G(d,p) level of description, both B3LYP and MP2 methods confirm that the C8 site of isolated adenine has the highest possibility to form covalent bond with the hydroxyl radicals, though with different energetics: B3LYP predicts a barrierless pathway, while MP2 finds a transition state with an energy of 106.1 kJ/mol. For the dehydrogenation reactions, B3LYP method predicts that the free energy barrier increases in the order of HN9 < HN61 < HN62 < H2 < H8.

  5. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

    PubMed

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

    2012-10-11

    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  6. An efficient and near linear scaling pair natural orbital based local coupled cluster method.

    PubMed

    Riplinger, Christoph; Neese, Frank

    2013-01-21

    In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on

  7. Thermal transport in topological-insulator-based superconducting hybrid structures with mixed singlet and triplet pairing states.

    PubMed

    Li, Hai; Zhao, Yuan Yuan

    2017-11-22

    In the framework of the Bogoliubov-de Gennes equation, we investigate the thermal transport properties in topological-insulator-based superconducting hybrid structures with mixed spin-singlet and spin-triplet pairing states, and emphasize the different manifestations of the spin-singlet and spin-triplet pairing states in the thermal transport signatures. It is revealed that the temperature-dependent differential thermal conductance strongly depends on the components of the pairing state, and the negative differential thermal conductance only occurs in the spin-singlet pairing state dominated regime. It is also found that the thermal conductance is profoundly sensitive to the components of the pairing state. In the spin-singlet pairing state controlled regime, the thermal conductance obviously oscillates with the phase difference and junction length. With increasing the proportion of the spin-triplet pairing state, the oscillating characteristic of the thermal conductance fades out distinctly. These results suggest an alternative route for distinguishing the components of pairing states in topological-insulator-based superconducting hybrid structures.

  8. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  10. Evaluating changes in matrix based, recovery-adjusted concentrations in paired data for pesticides in groundwater

    USGS Publications Warehouse

    Zimmerman, Tammy M.; Breen, Kevin J.

    2012-01-01

    Pesticide concentration data for waters from selected carbonate-rock aquifers in agricultural areas of Pennsylvania were collected in 1993–2009 for occurrence and distribution assessments. A set of 30 wells was visited once in 1993–1995 and again in 2008–2009 to assess concentration changes. The data include censored matched pairs (nondetections of a compound in one or both samples of a pair). A potentially improved approach for assessing concentration changes is presented where (i) concentrations are adjusted with models of matrix-spike recovery and (ii) area-wide temporal change is tested by use of the paired Prentice-Wilcoxon (PPW) statistical test. The PPW results for atrazine, simazine, metolachlor, prometon, and an atrazine degradate, deethylatrazine (DEA), are compared using recovery-adjusted and unadjusted concentrations. Results for adjusted compared with unadjusted concentrations in 2008–2009 compared with 1993–1995 were similar for atrazine and simazine (significant decrease; 95% confidence level) and metolachlor (no change) but differed for DEA (adjusted, decrease; unadjusted, increase) and prometon (adjusted, decrease; unadjusted, no change). The PPW results were different on recovery-adjusted compared with unadjusted concentrations. Not accounting for variability in recovery can mask a true change, misidentify a change when no true change exists, or assign a direction opposite of the true change in concentration that resulted from matrix influences on extraction and laboratory method performance. However, matrix-based models of recovery derived from a laboratory performance dataset from multiple studies for national assessment, as used herein, rather than time- and study-specific recoveries may introduce uncertainty in recovery adjustments for individual samples that should be considered in assessing change.

  11. Evaluation of the Project P.A.T.H.S. Based on Students' Weekly Diaries: Findings from Eight Datasets

    PubMed Central

    Shek, Daniel T. L.; Sun, Rachel C. F.

    2012-01-01

    This paper aims to investigate the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. (positive adolescent training through holistic social programmes) based on eight datasets collected between 2005 and 2009. A total of 1,138 students who participated in the program were randomly invited (from the whole grade or in some classes) to write a piece of journal in the form of a weekly diary in order to reveal their perceptions and feelings regarding the program and the perceived benefits of the program. Based on an integration of findings from different databases, results showed that the respondents generally (1) had positive views on the program, (2) had positive views on the instructors, and (3) perceived that they had acquired competencies at the societal, school, familial, interpersonal, and personal levels after joining the program. Acknowledging the limitations of diaries, the present qualitative findings provide support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. in Hong Kong. PMID:22593676

  12. Additional hydrogen bonds and base-pair kinetics in the symmetrical AMP-DNA aptamer complex.

    PubMed Central

    Nonin-Lecomte, S; Lin, C H; Patel, D J

    2001-01-01

    The solution structure of an adenosine monophosphate (AMP)-DNA aptamer complex has been determined previously [Lin, C. H., and Patel, D. J. (1997) Chem. Biol. 4:817-832]. On a symmetrical aptamer complex containing the same binding loop, but with better resolved spectra, we have identified two additional hydrogen bond-mediated associations in the binding loop. One of these involves a rapidly exchanging G imino proton. The phosphate group of the AMP ligand was identified as the acceptor by comparison with other aptamer complexes. Imino proton exchange measurements also yielded the dissociation constants of the stem and binding loop base pairs. This study shows that nuclear magnetic resonance-based imino proton exchange is a good probe for detection of weak hydrogen-bond associations. PMID:11721004

  13. A structural determinant in the uracil DNA glycosylase superfamily for the removal of uracil from adenine/uracil base pairs

    PubMed Central

    Lee, Dong-Hoon; Liu, Yinling; Lee, Hyun-Wook; Xia, Bo; Brice, Allyn R.; Park, Sung-Hyun; Balduf, Hunter; Dominy, Brian N.; Cao, Weiguo

    2015-01-01

    The uracil DNA glycosylase superfamily consists of several distinct families. Family 2 mismatch-specific uracil DNA glycosylase (MUG) from Escherichia coli is known to exhibit glycosylase activity on three mismatched base pairs, T/U, G/U and C/U. Family 1 uracil N-glycosylase (UNG) from E. coli is an extremely efficient enzyme that can remove uracil from any uracil-containing base pairs including the A/U base pair. Here, we report the identification of an important structural determinant that underlies the functional difference between MUG and UNG. Substitution of a Lys residue at position 68 with Asn in MUG not only accelerates the removal of uracil from mismatched base pairs but also enables the enzyme to gain catalytic activity on A/U base pairs. Binding and kinetic analysis demonstrate that the MUG-K68N substitution results in enhanced ground state binding and transition state interactions. Molecular modeling reveals that MUG-K68N, UNG-N123 and family 5 Thermus thermophiles UDGb-A111N can form bidentate hydrogen bonds with the N3 and O4 moieties of the uracil base. Genetic analysis indicates the gain of function for A/U base pairs allows the MUG-K68N mutant to remove uracil incorporated into the genome during DNA replication. The implications of this study in the origin of life are discussed. PMID:25550433

  14. Quantum correlation of fiber-based telecom-band photon pairs through standard loss and random media.

    PubMed

    Sua, Yong Meng; Malowicki, John; Lee, Kim Fook

    2014-08-15

    We study quantum correlation and interference of fiber-based telecom-band photon pairs with one photon of the pair experiencing multiple scattering in a random medium. We measure joint probability of two-photon detection for signal photon in a normal channel and idler photon in a channel, which is subjected to two independent conditions: standard loss (neutral density filter) and random media. We observe that both conditions degrade the correlation of signal and idler photons, and depolarization of the idler photon in random medium can enhance two-photon interference at certain relative polarization angles. Our theoretical calculation on two-photon polarization correlation and interference as a function of mean free path is in agreement with our experiment data. We conclude that quantum correlation of a polarization-entangled photon pair is better preserved than a polarization-correlated photon pair as one photon of the pair scatters through a random medium.

  15. Cloud Base Height Measurements at Manila Observatory: Initial Results from Constructed Paired Sky Imaging Cameras

    NASA Astrophysics Data System (ADS)

    Lagrosas, N.; Tan, F.; Antioquia, C. T.

    2014-12-01

    Fabricated all sky imagers are efficient and cost effective instruments for cloud detection and classification. Continuous operation of this instrument can result in the determination of cloud occurrence and cloud base heights for the paired system. In this study, a fabricated paired sky imaging system - consisting two commercial digital cameras (Canon Powershot A2300) enclosed in weatherproof containers - is developed in Manila Observatory for the purpose of determining cloud base heights at the Manila Observatory area. One of the cameras is placed on the rooftop of Manila Observatory and the other is placed on the rooftop of the university dormitory, 489m from the first camera. The cameras are programmed to simultaneously gather pictures every 5 min. Continuous operation of these cameras were implemented since the end of May of 2014 but data collection started end of October 2013. The data were processed following the algorithm proposed by Kassianov et al (2005). The processing involves the calculation of the merit function that determines the area of overlap of the two pictures. When two pictures are overlapped, the minimum of the merit function corresponds to the pixel column positions where the pictures have the best overlap. In this study, pictures of overcast sky prove to be difficult to process for cloud base height and were excluded from processing. The figure below shows the initial results of the hourly average of cloud base heights from data collected from November 2013 to July 2014. Measured cloud base heights ranged from 250m to 1.5km. These are the heights of cumulus and nimbus clouds that are dominant in this part of the world. Cloud base heights are low in the early hours of the day indicating low convection process during these times. However, the increase in the convection process in the atmosphere can be deduced from higher cloud base heights in the afternoon. The decrease of cloud base heights after 15:00 follows the trend of decreasing solar

  16. Exploiting Bounded Signal Flow for Graph Orientation Based on Cause-Effect Pairs

    NASA Astrophysics Data System (ADS)

    Dorn, Britta; Hüffner, Falk; Krüger, Dominikus; Niedermeier, Rolf; Uhlmann, Johannes

    We consider the following problem: Given an undirected network and a set of sender-receiver pairs, direct all edges such that the maximum number of "signal flows" defined by the pairs can be routed respecting edge directions. This problem has applications in communication networks and in understanding protein interaction based cell regulation mechanisms. Since this problem is NP-hard, research so far concentrated on polynomial-time approximation algorithms and tractable special cases. We take the viewpoint of parameterized algorithmics and examine several parameters related to the maximum signal flow over vertices or edges. We provide several fixed-parameter tractability results, and in one case a sharp complexity dichotomy between a linear-time solvable case and a slightly more general NP-hard case. We examine the value of these parameters for several real-world network instances. For many relevant cases, the NP-hard problem can be solved to optimality. In this way, parameterized analysis yields both deeper insight into the computational complexity and practical solving strategies.

  17. Program Implementers' Evaluation of the Project P.A.T.H.S.: Findings Based on Different Datasets over Time

    PubMed Central

    Shek, Daniel T. L.; Ma, Cecilia M. S.

    2012-01-01

    This paper integrates the evaluation findings based on program implementers in nine datasets collected from 2005 to 2009 (244 schools and 7,926 implementers). Using consolidated data with schools as the unit of analysis, results showed that program implementers generally had positive perceptions of the program, themselves, and benefits of the program, with more than four-fifths of the implementers regarding the program as beneficial to the program participants. The subjective outcome evaluation instrument was found to be internally consistent. Multiple regression analyses revealed that perceived qualities of the program and program implementers predicted perceived effectiveness of the program. In conjunction with evaluation findings based on other sources, the present study provides support for the effectiveness of the Tier 1 Program of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in Hong Kong. PMID:22629224

  18. Theory of nodal s ±-wave pairing symmetry in the Pu-based 115 superconductor family

    DOE PAGES

    Das, Tanmoy; Zhu, Jian -Xin; Graf, Matthias J.

    2015-02-27

    The spin-fluctuation mechanism of superconductivity usually results in the presence of gapless or nodal quasiparticle states in the excitation spectrum. Nodal quasiparticle states are well established in copper-oxide, and heavy-fermion superconductors, but not in iron-based superconductors. Here, we study the pairing symmetry and mechanism of a new class of plutonium-based high-T c superconductors and predict the presence of a nodal s⁺⁻ wave pairing symmetry in this family. Starting from a density-functional theory (DFT) based electronic structure calculation we predict several three-dimensional (3D) Fermi surfaces in this 115 superconductor family. We identify the dominant Fermi surface “hot-spots” in the inter-band scatteringmore » channel, which are aligned along the wavevector Q = (π, π, π), where degeneracy could induce sign-reversal of the pairing symmetry. Our calculation demonstrates that the s⁺⁻ wave pairing strength is stronger than the previously thought d-wave pairing; and more importantly, this pairing state allows for the existence of nodal quasiparticles. Finally, we predict the shape of the momentum- and energy-dependent magnetic resonance spectrum for the identification of this pairing symmetry.« less

  19. Ultrashort fluorescence lifetimes of hydrogen-bonded base pairs of guanosine and cytidine in solution.

    PubMed

    Schwalb, Nina K; Michalak, Thomas; Temps, Friedrich

    2009-12-24

    The optically excited electronic states of hydrogen-bonded homo- and heterodimers of guanosine (G) and deoxycytidine (C) were investigated by femtosecond fluorescence up-conversion spectroscopy. The base pairs were prepared in CHCl(3) solution by employing tert-butyldimethylsilyl (TBDMS) groups at the OH positions of the ribose (G) or deoxyribose (C) moieties to enhance the solubilities of the nucleosides in organic solvents. The H-bonded complexes that were obtained were characterized by FTIR spectroscopy. Fluorescence lifetime measurements were performed following electronic excitation at a series of UV wavelengths from lambda(pump) = 294 nm, close to the electronic origins of the bases, to lambda(pump) = 262 nm, where significant excess vibronic energy is deposited in the molecules, at nucleoside concentrations of c(0) = 0.1 and 1.0 mM. The experimental results revealed the existence of an ultrafast deactivation pathway for the optically prepared electronically excited state(s) of the G.C Watson-Crick base pair, which was found to have a lifetime of tau(GC) = 0.30(3) ps (with 2sigma error limits) irrespective of the pump wavelength. A similar short decay time, tau(GG) = 0.32(2) ps, was observed for the respective excited G.G homodimer. In contrast, the excited G monomer displayed a significantly longer-lived and wavelength-dependent deactivation, requiring three time constants, between 0.43(6) ps < or = tau(G,1) < or = 1.2(1) ps, 4.2(8) ps < or = tau(G,2) < or = 8(1) ps, and tau(G,3) = 195(32) ps. Self-complexation of C, on the other hand, led to a longer-lived excited state with a lifetime estimated between 1 ps < or = tau(CC) < or = 10 ps, compared to the dominant initial subpicosecond decay time of the C monomer of tau(C,1) = 0.80(4) ps.

  20. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    PubMed Central

    Zhou, Ru; Zhong, Dexing; Han, Jiuqiang

    2013-01-01

    The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT) descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1) the similar patterns of parallel ridges; and (2) high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD) to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM), is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA) achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements. PMID:23467056

  1. High-speed true random number generation based on paired memristors for security electronics

    NASA Astrophysics Data System (ADS)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-01

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  2. High-speed true random number generation based on paired memristors for security electronics.

    PubMed

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru

    2017-11-10

    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ∼30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  3. Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

    PubMed Central

    2016-01-01

    Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

  4. Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

    PubMed

    Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

    1997-07-01

    The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

  5. A bilinear pairing based anonymous authentication scheme in wireless body area networks for mHealth.

    PubMed

    Jiang, Qi; Lian, Xinxin; Yang, Chao; Ma, Jianfeng; Tian, Youliang; Yang, Yuanyuan

    2016-11-01

    Wireless body area networks (WBANs) have become one of the key components of mobile health (mHealth) which provides 24/7 health monitoring service and greatly improves the quality and efficiency of healthcare. However, users' concern about the security and privacy of their health information has become one of the major obstacles that impede the wide adoption of WBANs. Anonymous and unlinkable authentication is critical to protect the security and privacy of sensitive physiological information in transit from the client to the application provider. We first show that the anonymous authentication scheme of Wang and Zhang based on bilinear pairing is prone to client impersonation attack. Then, we propose an enhanced anonymous authentication scheme to remedy the flaw in Wang and Zhang's scheme. We give the security analysis to demonstrate that the enhanced scheme achieves the desired security features and withstands various known attacks.

  6. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    NASA Astrophysics Data System (ADS)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  7. Kinetic selection vs. free energy of DNA base pairing in control of polymerase fidelity.

    PubMed

    Oertell, Keriann; Harcourt, Emily M; Mohsen, Michael G; Petruska, John; Kool, Eric T; Goodman, Myron F

    2016-04-19

    What is the free energy source enabling high-fidelity DNA polymerases (pols) to favor incorporation of correct over incorrect base pairs by 10(3)- to 10(4)-fold, corresponding to free energy differences of ΔΔGinc∼ 5.5-7 kcal/mol? Standard ΔΔG° values (∼0.3 kcal/mol) calculated from melting temperature measurements comparing matched vs. mismatched base pairs at duplex DNA termini are far too low to explain pol accuracy. Earlier analyses suggested that pol active-site steric constraints can amplify DNA free energy differences at the transition state (kinetic selection). A recent paper [Olson et al. (2013)J Am Chem Soc135:1205-1208] used Vent pol to catalyze incorporations in the presence of inorganic pyrophosphate intended to equilibrate forward (polymerization) and backward (pyrophosphorolysis) reactions. A steady-state leveling off of incorporation profiles at long reaction times was interpreted as reaching equilibrium between polymerization and pyrophosphorolysis, yielding apparent ΔG° = -RTlnKeq, indicating ΔΔG° of 3.5-7 kcal/mol, sufficient to account for pol accuracy without need of kinetic selection. Here we perform experiments to measure and account for pyrophosphorolysis explicitly. We show that forward and reverse reactions attain steady states far from equilibrium for wrong incorporations such as G opposite T. Therefore,[Formula: see text]values obtained from such steady-state evaluations ofKeqare not dependent on DNA properties alone, but depend largely on constraints imposed on right and wrong substrates in the polymerase active site.

  8. Single-base-pair discrimination of terminal mismatches by using oligonucleotide microarrays and neural network analyses

    NASA Technical Reports Server (NTRS)

    Urakawa, Hidetoshi; Noble, Peter A.; El Fantroussi, Said; Kelly, John J.; Stahl, David A.

    2002-01-01

    The effects of single-base-pair near-terminal and terminal mismatches on the dissociation temperature (T(d)) and signal intensity of short DNA duplexes were determined by using oligonucleotide microarrays and neural network (NN) analyses. Two perfect-match probes and 29 probes having a single-base-pair mismatch at positions 1 to 5 from the 5' terminus of the probe were designed to target one of two short sequences representing 16S rRNA. Nonequilibrium dissociation rates (i.e., melting profiles) of all probe-target duplexes were determined simultaneously. Analysis of variance revealed that position of the mismatch, type of mismatch, and formamide concentration significantly affected the T(d) and signal intensity. Increasing the concentration of formamide in the washing buffer decreased the T(d) and signal intensity, and it decreased the variability of the signal. Although T(d)s of probe-target duplexes with mismatches in the first or second position were not significantly different from one another, duplexes with mismatches in the third to fifth positions had significantly lower T(d)s than those with mismatches in the first or second position. The trained NNs predicted the T(d) with high accuracies (R(2) = 0.93). However, the NNs predicted the signal intensity only moderately accurately (R(2) = 0.67), presumably due to increased noise in the signal intensity at low formamide concentrations. Sensitivity analysis revealed that the concentration of formamide explained most (75%) of the variability in T(d)s, followed by position of the mismatch (19%) and type of mismatch (6%). The results suggest that position of the mismatch at or near the 5' terminus plays a greater role in determining the T(d) and signal intensity of duplexes than the type of mismatch.

  9. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.

    PubMed

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T

    2016-05-05

    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  10. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    PubMed Central

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  11. biobambam: tools for read pair collation based algorithms on BAM files

    PubMed Central

    2014-01-01

    Background Sequence alignment data is often ordered by coordinate (id of the reference sequence plus position on the sequence where the fragment was mapped) when stored in BAM files, as this simplifies the extraction of variants between the mapped data and the reference or of variants within the mapped data. In this order paired reads are usually separated in the file, which complicates some other applications like duplicate marking or conversion to the FastQ format which require to access the full information of the pairs. Results In this paper we introduce biobambam, a set of tools based on the efficient collation of alignments in BAM files by read name. The employed collation algorithm avoids time and space consuming sorting of alignments by read name where this is possible without using more than a specified amount of main memory. Using this algorithm tasks like duplicate marking in BAM files and conversion of BAM files to the FastQ format can be performed very efficiently with limited resources. We also make the collation algorithm available in the form of an API for other projects. This API is part of the libmaus package. Conclusions In comparison with previous approaches to problems involving the collation of alignments by read name like the BAM to FastQ or duplication marking utilities our approach can often perform an equivalent task more efficiently in terms of the required main memory and run-time. Our BAM to FastQ conversion is faster than all widely known alternatives including Picard and bamUtil. Our duplicate marking is about as fast as the closest competitor bamUtil for small data sets and faster than all known alternatives on large and complex data sets.

  12. Current hormonal contraceptive use predicts female extra-pair and dyadic sexual behavior: evidence based on Czech National Survey data.

    PubMed

    Klapilová, Kateřina; Cobey, Kelly D; Wells, Timothy; Roberts, S Craig; Weiss, Petr; Havlíček, Jan

    2014-01-10

    Data from 1155 Czech women (493 using oral contraception, 662 non-users), obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC) use on extra-pair and dyadic (in-pair) sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP) regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length). The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not). However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  13. Novel H+-Ion Sensor Based on a Gated Lateral BJT Pair

    PubMed Central

    Yuan, Heng; Zhang, Jixing; Cao, Chuangui; Zhang, Gangyuan; Zhang, Shaoda

    2015-01-01

    An H+-ion sensor based on a gated lateral bipolar junction transistor (BJT) pair that can operate without the classical reference electrode is proposed. The device is a special type of ion-sensitive field-effect transistor (ISFET). Classical ISFETs have the advantage of miniaturization, but  they are difficult to fabricate by a single fabrication process because of the bulky and brittle reference electrode materials. Moreover, the reference electrodes need to be separated from the sensor device in some cases. The proposed device is composed of two gated lateral BJT components, one of which had a silicide layer while the other was without the layer. The two components were operated under the metal-oxide semiconductor field-effect transistor (MOSFET)-BJT hybrid mode, which can be controlled by emitter voltage and base current. Buffer solutions with different pH values were used as the sensing targets to verify the characteristics of the proposed device. Owing to their different sensitivities, both components could simultaneously detect the H+-ion concentration and function as a reference to each other. Per the experimental results, the sensitivity of the proposed device was found to be approximately 0.175 μA/pH. This experiment demonstrates enormous potential to lower the cost of the ISFET-based sensor technology. PMID:26703625

  14. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    PubMed

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    PubMed

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  16. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  17. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  18. Distribution of Base Pair Alternations in a Periodic DNA Chain: Application of Pólya Counting to a Physical System

    NASA Astrophysics Data System (ADS)

    Hillebrand, Malcolm; Paterson-Jones, Guy; Kalosakas, George; Skokos, Charalampos

    2018-03-01

    In modeling DNA chains, the number of alternations between Adenine-Thymine (AT) and Guanine-Cytosine (GC) base pairs can be considered as a measure of the heterogeneity of the chain, which in turn could affect its dynamics. A probability distribution function of the number of these alternations is derived for circular or periodic DNA. Since there are several symmetries to account for in the periodic chain, necklace counting methods are used. In particular, Polya's Enumeration Theorem is extended for the case of a group action that preserves partitioned necklaces. This, along with the treatment of generating functions as formal power series, allows for the direct calculation of the number of possible necklaces with a given number of AT base pairs, GC base pairs and alternations. The theoretically obtained probability distribution functions of the number of alternations are accurately reproduced by Monte Carlo simulations and fitted by Gaussians. The effect of the number of base pairs on the characteristics of these distributions is also discussed, as well as the effect of the ratios of the numbers of AT and GC base pairs.

  19. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    PubMed

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  20. Graph-based surface reconstruction from stereo pairs using image segmentation

    NASA Astrophysics Data System (ADS)

    Bleyer, Michael; Gelautz, Margrit

    2005-01-01

    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  1. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests

  2. Ion Pairing and Diffusion in Magnesium Electrolytes Based on Magnesium Borohydride.

    PubMed

    Samuel, Devon; Steinhauser, Carl; Smith, Jeffrey G; Kaufman, Aaron; Radin, Maxwell D; Naruse, Junichi; Hiramatsu, Hidehiko; Siegel, Donald J

    2017-12-20

    One obstacle to realizing a practical, rechargeable magnesium-ion battery is the development of efficient Mg electrolytes. Electrolytes based on simple Mg(BH 4 ) 2 salts suffer from poor salt solubility and/or low conductivity, presumably due to strong ion pairing. Understanding the molecular-scale processes occurring in these electrolytes would aid in overcoming these performance limitations. Toward this goal, the present study examines the solvation, agglomeration, and transport properties of a family of Mg electrolytes based on the Mg(BH 4 ) 2 salt using classical molecular dynamics. These properties were examined across five different solvents (tetrahydrofuran and the glymes G1-G4) and at four salt concentrations ranging from the dilute limit up to 0.4 M. Significant and irreversible salt agglomeration was observed in all solvents at all nondilute Mg(BH 4 ) 2 concentrations. The degree of clustering observed in these divalent Mg systems is much larger than that reported for electrolytes containing monovalent cations, such as Li. The salt agglomeration rate and diffusivity of Mg 2+ were both observed to correlate with solvent self-diffusivity: electrolytes using longer- (shorter-) chain solvents had the lowest (highest) Mg 2+ diffusivity and agglomeration rates. Incorporation of Mg 2+ into Mg 2+ -BH 4 - clusters significantly reduces the diffusivity of Mg 2+ by restricting displacements to localized motion within largely immobile agglomerates. Consequently, diffusion is increasingly impeded with increasing Mg(BH 4 ) 2 concentration. These data are consistent with the solubility limitations observed experimentally for Mg(BH 4 ) 2 -based electrolytes and highlight the need for strategies that minimize salt agglomeration in electrolytes containing divalent cations.

  3. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    PubMed

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  4. Simplified Aircraft-Based Paired Approach: Concept Definition and Initial Analysis

    NASA Technical Reports Server (NTRS)

    Johnson, Sally C.; Lohr, Gary W.; McKissick, Burnell T.; Abbott, Terence S.; Geurreiro, Nelson M.; Volk, Paul

    2013-01-01

    Simplified Aircraft-based Parallel Approach (SAPA) is an advanced concept proposed by the Federal Aviation Administration (FAA) to support dependent parallel approach operations to runways with lateral spacing closer than 2500 ft. At the request of the FAA, NASA performed an initial assessment of the potential performance and feasibility of the SAPA concept, including developing and assessing an operational implementation of the concept and conducting a Monte Carlo wake simulation study to examine the longitudinal spacing requirements. The SAPA concept was shown to have significant operational advantages in supporting the pairing of aircraft with dissimilar final approach speeds. The wake simulation study showed that support for dissimilar final approach speeds could be significantly enhanced through the use of a two-phased altitudebased longitudinal positioning requirement, with larger longitudinal positioning allowed for higher altitudes out of ground effect and tighter longitudinal positioning defined for altitudes near and in ground effect. While this assessment is preliminary and there are a number of operational issues still to be examined, it has shown the basic SAPA concept to be technically and operationally feasible.

  5. The Common Prescription Patterns Based on the Hierarchical Clustering of Herb-Pairs Efficacies

    PubMed Central

    2016-01-01

    Prescription patterns are rules or regularities used to generate, recognize, or judge a prescription. Most of existing studies focused on the specific prescription patterns for diverse diseases or syndromes, while little attention was paid to the common patterns, which reflect the global view of the regularities of prescriptions. In this paper, we designed a method CPPM to find the common prescription patterns. The CPPM is based on the hierarchical clustering of herb-pair efficacies (HPEs). Firstly, HPEs were hierarchically clustered; secondly, the individual herbs are labeled by the HPEC (the clusters of HPEs); and then the prescription patterns were extracted from the combinations of HPEC; finally the common patterns are recognized statistically. The results showed that HPEs have hierarchical clustering structure. When the clustering level is 2 and the HPEs were classified into two clusters, the common prescription patterns are obvious. Among 332 candidate prescriptions, 319 prescriptions follow the common patterns. The description of the patterns is that if a prescription contains the herbs of the cluster (C 1), it is very likely to have other herbs of another cluster (C 2); while a prescription has the herbs of C 2, it may have no herbs of C 1. Finally, we discussed that the common patterns are mathematically coincident with the Blood-Qi theory. PMID:27190534

  6. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae).

    PubMed

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-10-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  7. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    PubMed

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  8. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems.

    PubMed

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  9. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

    PubMed Central

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

    2016-01-01

    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning. PMID:27445958

  10. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    NASA Astrophysics Data System (ADS)

    Lee, Kwan-Soo; Spendelow, Jacob S.; Choe, Yoong-Kee; Fujimoto, Cy; Kim, Yu Seung

    2016-09-01

    Fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100 ∘C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180 ∘C however, these devices degrade when exposed to water below 140 ∘C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibit stable performance at 80-160 ∘C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.

  11. Combining Accuracy and Efficiency: An Incremental Focal-Point Method Based on Pair Natural Orbitals.

    PubMed

    Fiedler, Benjamin; Schmitz, Gunnar; Hättig, Christof; Friedrich, Joachim

    2017-12-12

    In this work, we present a new pair natural orbitals (PNO)-based incremental scheme to calculate CCSD(T) and CCSD(T0) reaction, interaction, and binding energies. We perform an extensive analysis, which shows small incremental errors similar to previous non-PNO calculations. Furthermore, slight PNO errors are obtained by using T PNO = T TNO with appropriate values of 10 -7 to 10 -8 for reactions and 10 -8 for interaction or binding energies. The combination with the efficient MP2 focal-point approach yields chemical accuracy relative to the complete basis-set (CBS) limit. In this method, small basis sets (cc-pVDZ, def2-TZVP) for the CCSD(T) part are sufficient in case of reactions or interactions, while some larger ones (e.g., (aug)-cc-pVTZ) are necessary for molecular clusters. For these larger basis sets, we show the very high efficiency of our scheme. We obtain not only tremendous decreases of the wall times (i.e., factors >10 2 ) due to the parallelization of the increment calculations as well as of the total times due to the application of PNOs (i.e., compared to the normal incremental scheme) but also smaller total times with respect to the standard PNO method. That way, our new method features a perfect applicability by combining an excellent accuracy with a very high efficiency as well as the accessibility to larger systems due to the separation of the full computation into several small increments.

  12. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring

    PubMed Central

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann

    2012-01-01

    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s < .01). Conclusions Understanding where joint parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  13. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    PubMed

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH < 0 and ΔS < 0) indicated that hydrogen bond and Van der Waals play main roles in this binding prose. Competitive fluorimetric studies with methylene blue (MB) dye have shown that Zn(II) complex exhibits the ability of this complex to displace with DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  14. An operationally flexible fuel cell based on quaternary ammonium-biphosphate ion pairs

    DOE PAGES

    Lee, Kwan -Soo; Spendelow, Jacob Schatz; Choe, Yoong -Kee; ...

    2016-08-22

    Here, fuel cells are promising devices for clean power generation in a variety of economically and environmentally significant applications. Low-temperature proton exchange membrane (PEM) fuel cells utilizing Nafion require a high level of hydration, which limits the operating temperature to less than 100°C. In contrast, high-temperature PEM fuel cells utilizing phosphoric acid-doped polybenzimidazole can operate effectively up to 180°C; however, these devices degrade when exposed to water below 140°C. Here we present a different class of PEM fuel cells based on quaternary ammonium-biphosphate ion pairs that can operate under conditions unattainable with existing fuel cell technologies. These fuel cells exhibitmore » stable performance at 80–160°C with a conductivity decay rate more than three orders of magnitude lower than that of a commercial high-temperature PEM fuel cell. By increasing the operational flexibility, this class of fuel cell can simplify the requirements for heat and water management, and potentially reduce the costs associated with the existing fully functional fuel cell systems.« less

  15. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs

    PubMed Central

    2013-01-01

    Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077

  16. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs.

    PubMed

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W

    2013-05-04

    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.

  17. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  18. The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

    NASA Technical Reports Server (NTRS)

    Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

    2013-01-01

    This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

  19. A DNA methylation map of human cancer at single base-pair resolution

    PubMed Central

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-01-01

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523

  20. A DNA methylation map of human cancer at single base-pair resolution.

    PubMed

    Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M

    2017-10-05

    Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.

  1. Universal quantum gates for Single Cooper Pair Box based quantum computing

    NASA Technical Reports Server (NTRS)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

    2000-01-01

    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. Pair distribution function study and mechanical behavior of as-cast and structurally relaxed Zr-based bulk metallic glasses

    NASA Astrophysics Data System (ADS)

    Fan, Cang; Liaw, P. K.; Wilson, T. W.; Choo, H.; Gao, Y. F.; Liu, C. T.; Proffen, Th.; Richardson, J. W.

    2006-12-01

    Contrary to reported results on structural relaxation inducing brittleness in amorphous alloys, the authors found that structural relaxation actually caused an increase in the strength of Zr55Cu35Al10 bulk metallic glass (BMG) without changing the plasticity. Three dimensional models were rebuilt for the as-cast and structurally relaxed BMGs by reverse Monte Carlo (RMC) simulations based on the pair distribution function (PDF) measured by neutron scattering. Only a small portion of the atom pairs was found to change to more dense packing. The concept of free volume was defined based on the PDF and RMC studies, and the mechanism of mechanical behavior was discussed.

  4. Perfluorocarbons enhance a T2*-based MRI technique for identifying the penumbra in a rat model of acute ischemic stroke

    PubMed Central

    Deuchar, Graeme A; Brennan, David; Griffiths, Hugh; Macrae, I  Mhairi; Santosh, Celestine

    2013-01-01

    Accurate imaging of ischemic penumbra is crucial for improving the management of acute stroke patients. T2* magnetic resonance imaging (MRI) combined with a T2*oxygen challenge (T2*OC) is being developed to detect penumbra based on changes in blood deoxyhemoglobin. Using 100% O2, T2*OC-defined penumbra exhibits ongoing glucose metabolism and tissue recovery on reperfusion. However, potential limitations in translating this technique include a sinus artefact in human scans with delivery of 100% OC and relatively small signal changes. Here we investigate whether an oxygen-carrying perfluorocarbon (PFC) emulsion can enhance the sensitivity of the technique, enabling penumbra detection with lower levels of inspired oxygen. Stroke was induced in male Sprague-Dawley rats (n=17) with ischemic injury and perfusion deficit determined by diffusion and perfusion MRI, respectively. T2* signal change was measured in regions of interest (ROIs) located within ischemic core, T2*OC-defined penumbra and equivalent contralateral areas during 40% O2±prior PFC injection. Region of interest analyses between groups showed that PFC significantly enhanced the T2* response to 40% O2 in T2*-defined penumbra (mean increase of 10.6±2.3% compared to 5.6±1.5% with 40% O2, P<0.001). This enhancement was specific to the penumbra ROI. Perfluorocarbon emulsions therefore enhances the translational potential of the T2*OC technique for identifying penumbra in acute stroke patients. PMID:23801243

  5. A Heterogeneous Metal-Free Catalyst for Hydrogenation: Lewis Acid-Base Pairs Integrated into a Carbon Lattice.

    PubMed

    Ding, Yuxiao; Huang, Xing; Yi, Xianfeng; Qiao, Yunxiang; Sun, Xiaoyan; Zheng, Anmin; Su, Dang Sheng

    2018-06-04

    Designing heterogeneous metal-free catalysts for hydrogenation is a long-standing challenge in catalysis. Nanodiamond-based carbon materials were prepared that are surface-doped with electron-rich nitrogen and electron-deficient boron. The two heteroatoms are directly bonded to each other to form unquenched Lewis pairs with infinite π-electron donation from the surrounding graphitic structure. Remarkably, these Lewis pairs can split H 2 to form H + /H - pairs, which subsequently serve as the active species for hydrogenation of different substrates. This unprecedented finding sheds light on the uptake of H 2 across carbon-based materials and suggests that dual Lewis acidity-basicity on the carbon surface may be used to heterogeneously activate a variety of small molecules. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. ReLiance: a machine learning and literature-based prioritization of receptor—ligand pairings

    PubMed Central

    Iacucci, Ernesto; Tranchevent, Léon-Charles; Popovic, Dusan; Pavlopoulos, Georgios A.; De Moor, Bart; Schneider, Reinhard; Moreau, Yves

    2012-01-01

    Motivation: The prediction of receptor—ligand pairings is an important area of research as intercellular communications are mediated by the successful interaction of these key proteins. As the exhaustive assaying of receptor—ligand pairs is impractical, a computational approach to predict pairings is necessary. We propose a workflow to carry out this interaction prediction task, using a text mining approach in conjunction with a state of the art prediction method, as well as a widely accessible and comprehensive dataset. Among several modern classifiers, random forests have been found to be the best at this prediction task. The training of this classifier was carried out using an experimentally validated dataset of Database of Ligand-Receptor Partners (DLRP) receptor—ligand pairs. New examples, co-cited with the training receptors and ligands, are then classified using the trained classifier. After applying our method, we find that we are able to successfully predict receptor—ligand pairs within the GPCR family with a balanced accuracy of 0.96. Upon further inspection, we find several supported interactions that were not present in the Database of Interacting Proteins (DIPdatabase). We have measured the balanced accuracy of our method resulting in high quality predictions stored in the available database ReLiance. Availability: http://homes.esat.kuleuven.be/~bioiuser/ReLianceDB/index.php Contact: yves.moreau@esat.kuleuven.be; ernesto.iacucci@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22962483

  7. Expanding Water/Base Tolerant Frustrated Lewis Pair Chemistry to Alkylamines Enables Broad Scope Reductive Aminations

    PubMed Central

    Fasano, Valerio

    2017-01-01

    Abstract Lower Lewis acidity boranes demonstrate greater tolerance to combinations of water/strong Brønsted bases than B(C6F5)3, this enables Si−H bond activation by a frustrated Lewis pair (FLP) mechanism to proceed in the presence of H2O/alkylamines. Specifically, BPh3 has improved water tolerance in the presence of alkylamines as the Brønsted acidic adduct H2O–BPh3 does not undergo irreversible deprotonation with aliphatic amines in contrast to H2O–B(C6F5)3. Therefore BPh3 is a catalyst for the reductive amination of aldehydes and ketones with alkylamines using silanes as reductants. A range of amines inaccessible using B(C6F5)3 as catalyst, were accessible by reductive amination catalysed by BPh3 via an operationally simple methodology requiring no purification of BPh3 or reagents/solvent. BPh3 has a complementary reductive amination scope to B(C6F5)3 with the former not an effective catalyst for the reductive amination of arylamines, while the latter is not an effective catalyst for the reductive amination of alkylamines. This disparity is due to the different pK a values of the water–borane adducts and the greater susceptibility of BPh3 species towards protodeboronation. An understanding of the deactivation processes occurring using B(C6F5)3 and BPh3 as reductive amination catalysts led to the identification of a third triarylborane, B(3,5‐Cl2C6H3)3, that has a broader substrate scope being able to catalyse the reductive amination of both aryl and alkyl amines with carbonyls. PMID:27977048

  8. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

    PubMed Central

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

    2003-01-01

    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  9. A Comparison of the Results of Many-Facet Rasch Analyses Based on Crossed and Judge Pair Designs

    ERIC Educational Resources Information Center

    Ilhan, Mustafa

    2016-01-01

    The aim of this study was to compare the results of many-facet Rasch analyses based on crossed and judge pair designs. The study was conducted with 168 eighth grade students and five judges. The study data were collected using an achievement test with open-ended questions and a holistic rubric that was used to rate the responses. In the data…

  10. Guide-substrate base-pairing requirement for box H/ACA RNA-guided RNA pseudouridylation.

    PubMed

    De Zoysa, Meemanage D; Wu, Guowei; Katz, Raviv; Yu, Yi-Tao

    2018-06-05

    Box H/ACA RNAs are a group of small RNAs found in abundance in eukaryotes (as well as in archaea). Although their sequences differ, eukaryotic box H/ACA RNAs all share the same unique hairpin-hinge-hairpin-tail structure. Almost all of them function as guides that primarily direct pseudouridylation of rRNAs and spliceosomal snRNAs at specific sites. Although box H/ACA RNA-guided pseudouridylation has been extensively studied, the detailed rules governing this reaction, especially those concerning the guide RNA-substrate RNA base-pairing interactions that determine the specificity and efficiency of pseudouridylation, are still not exactly clear. This is particularly relevant given that the lengths of the guide sequences involved in base-pairing vary from one box H/ACA RNA to another. Here, we carry out a detailed investigation into guide-substrate base-pairing interactions, and identify the minimum number of base-pairs (8), required for RNA-guided pseudouridylation. In addition, we find that the pseudouridylation pocket, present in each hairpin of box H/ACA RNA, exhibits flexibility in fitting slightly different substrate sequences. Our results are consistent across three independent pseudouridylation pockets tested, suggesting that our findings are generally applicable to box H/ACA RNA-guided RNA pseudouridylation. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. New Quantum Key Distribution Scheme Based on Random Hybrid Quantum Channel with EPR Pairs and GHZ States

    NASA Astrophysics Data System (ADS)

    Yan, Xing-Yu; Gong, Li-Hua; Chen, Hua-Ying; Zhou, Nan-Run

    2018-05-01

    A theoretical quantum key distribution scheme based on random hybrid quantum channel with EPR pairs and GHZ states is devised. In this scheme, EPR pairs and tripartite GHZ states are exploited to set up random hybrid quantum channel. Only one photon in each entangled state is necessary to run forth and back in the channel. The security of the quantum key distribution scheme is guaranteed by more than one round of eavesdropping check procedures. It is of high capacity since one particle could carry more than two bits of information via quantum dense coding.

  12. Toxicity prediction of PHDDs and phenols in the light of nucleic acid bases and DNA base pair interaction.

    PubMed

    Mondal Roy, Sutapa; Roy, Debesh R; Sahoo, Suban K

    2015-11-01

    The applicability of Density Functional Theory (DFT) based descriptors for the development of quantitative structure-toxicity relationships (QSTR) is assessed for two different series of toxic aromatic compounds, viz., polyhalogenated dibenzo-p-dioxins (PHDDs) and phenols (PHs). A series of 20 compounds each for PHDDs and PHs with their experimental toxicities (IC50 and IGC50) is chosen in the present study to develop DFT based efficient quantum chemical parameters (QCPs) for explaining the toxin potential of the considered compounds. A systematic analysis to find out the electron donation/acceptance nature of these selected compounds with the considered model biosystems, viz., nucleic acid (NA) bases and DNA base pairs, is performed to identify potential QCPs. Accordingly, PHDDs is found to be electron acceptors whereas phenols as donors, during their interaction with biosystems. Two parameter regression model is carried out comprising global charge transfer (ΔN), and local Fukui Function's for nucleophilic attack (fk(+)) for PHDDs and the same for electrophilic attack (fk(-)) in case of PHs. It is heartening to note that our chosen descriptors, viz, charge transfer (ΔN) and Fukui Function (fk(±)) plays a crucial role by explaining more than 90% of the observed toxic behavior (in terms of correlation-coefficient, R) of PHDDs and PHs. The developed QCPs, viz., ΔN and fk(±) can be added as the new descriptors in the QSTR parlance. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    PubMed

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Prediction of missing common genes for disease pairs using network based module separation on incomplete human interactome.

    PubMed

    Akram, Pakeeza; Liao, Li

    2017-12-06

    Identification of common genes associated with comorbid diseases can be critical in understanding their pathobiological mechanism. This work presents a novel method to predict missing common genes associated with a disease pair. Searching for missing common genes is formulated as an optimization problem to minimize network based module separation from two subgraphs produced by mapping genes associated with disease onto the interactome. Using cross validation on more than 600 disease pairs, our method achieves significantly higher average receiver operating characteristic ROC Score of 0.95 compared to a baseline ROC score 0.60 using randomized data. Missing common genes prediction is aimed to complete gene set associated with comorbid disease for better understanding of biological intervention. It will also be useful for gene targeted therapeutics related to comorbid diseases. This method can be further considered for prediction of missing edges to complete the subgraph associated with disease pair.

  15. Optimal Therapy Scheduling Based on a Pair of Collaterally Sensitive Drugs.

    PubMed

    Yoon, Nara; Vander Velde, Robert; Marusyk, Andriy; Scott, Jacob G

    2018-05-07

    Despite major strides in the treatment of cancer, the development of drug resistance remains a major hurdle. One strategy which has been proposed to address this is the sequential application of drug therapies where resistance to one drug induces sensitivity to another drug, a concept called collateral sensitivity. The optimal timing of drug switching in these situations, however, remains unknown. To study this, we developed a dynamical model of sequential therapy on heterogeneous tumors comprised of resistant and sensitive cells. A pair of drugs (DrugA, DrugB) are utilized and are periodically switched during therapy. Assuming resistant cells to one drug are collaterally sensitive to the opposing drug, we classified cancer cells into two groups, [Formula: see text] and [Formula: see text], each of which is a subpopulation of cells resistant to the indicated drug and concurrently sensitive to the other, and we subsequently explored the resulting population dynamics. Specifically, based on a system of ordinary differential equations for [Formula: see text] and [Formula: see text], we determined that the optimal treatment strategy consists of two stages: an initial stage in which a chosen effective drug is utilized until a specific time point, T, and a second stage in which drugs are switched repeatedly, during which each drug is used for a relative duration (i.e., [Formula: see text]-long for DrugA and [Formula: see text]-long for DrugB with [Formula: see text] and [Formula: see text]). We prove that the optimal duration of the initial stage, in which the first drug is administered, T, is shorter than the period in which it remains effective in decreasing the total population, contrary to current clinical intuition. We further analyzed the relationship between population makeup, [Formula: see text], and the effect of each drug. We determine a critical ratio, which we term [Formula: see text], at which the two drugs are equally effective. As the first stage of the

  16. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    PubMed

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A terrain-based paired-site sampling design to assess biodiversity losses from eastern hemlock decline

    USGS Publications Warehouse

    Young, J.A.; Smith, D.R.; Snyder, C.D.; Lemarie, D.P.

    2002-01-01

    Biodiversity surveys are often hampered by the inability to control extraneous sources of variability introduced into comparisons of populations across a heterogenous landscape. If not specifically accounted for a priori, this noise can weaken comparisons between sites, and can make it difficult to draw inferences about specific ecological processes. We developed a terrain-based, paired-site sampling design to analyze differences in aquatic biodiversity between streams draining eastern hemlock (Tsuga canadensis) forests, and those draining mixed hardwood forests in Delaware Water Gap National Recreation Area (USA). The goal of this design was to minimize variance due to terrain influences on stream communities, while representing the range of hemlock dominated stream environments present in the park. We used geographic information systems (GIS) and cluster analysis to define and partition hemlock dominated streams into terrain types based on topographic variables and stream order. We computed similarity of forest stands within terrain types and used this information to pair hemlock-dominated streams with hardwood counterparts prior to sampling. We evaluated the effectiveness of the design through power analysis and found that power to detect differences in aquatic invertebrate taxa richness was highest when sites were paired and terrain type was included as a factor in the analysis. Precision of the estimated difference in mean richness was nearly doubled using the terrain-based, paired site design in comparison to other evaluated designs. Use of this method allowed us to sample stream communities representative of park-wide forest conditions while effectively controlling for landscape variability.

  18. Paired Learners' Verbalised Strategies for Determining Grammatical Correctness: A Turn-Based System for Coding Metatalk

    ERIC Educational Resources Information Center

    Ishii, David N.

    2011-01-01

    The purpose of this paper is to explore the use of a new coding system that incorporates the various types of metatalk that occurred during paired learners' engagement in a consciousness-raising task. On the basis of previous studies, metalanguage (e.g. with or without terminology), knowledge sources (e.g. intuition), and verbalisation strategies…

  19. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data

    ERIC Educational Resources Information Center

    Bonett, Douglas G.; Price, Robert M.

    2012-01-01

    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  20. Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

    PubMed Central

    Zhang, X; Gottlieb, P A

    1995-01-01

    Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

  1. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task.

    PubMed

    Bott, Nicholas T; Lange, Alex; Rentz, Dorene; Buffalo, Elizabeth; Clopton, Paul; Zola, Stuart

    2017-01-01

    Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive "window on the brain," and the recording of eye movements using web cameras is a burgeoning area of research. Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC) decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS)] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS). Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera. Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits ( r = 0.88-0.92). Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81-0.88). There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets ( r = 0.88-0.94). Significantly fewer data quality issues were encountered using the built-in web camera. Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as fixation points, built

  2. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes

    PubMed Central

    Kallemeijn, Wouter W.; Scheij, Saskia; Hoogendoorn, Sascha; Witte, Martin D.; Herrera Moro Chao, Daniela; van Roomen, Cindy P. A. A.; Ottenhoff, Roelof; Overkleeft, Herman S.; Boot, Rolf G.; Aerts, Johannes M. F. G.

    2017-01-01

    Deficiency of glucocerebrosidase (GBA) causes Gaucher disease (GD). In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s). Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme), contains predominantly Man(3) glycans, and velaglucerase (Shire PLC) Man(9) glycans. Activity-based probes (ABPs) enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors (n = 12

  3. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

    PubMed

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

    2013-12-12

    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  4. Paired Comparisons.

    DTIC Science & Technology

    1982-05-01

    including multidimensional scaling. Applications have arisen in many areas, but most notably in food technolog, marketing research, and sports ... competition .- An extensive bibliography on paired comparisons by Davidson and Farquhar (1976) contains some 400 references. - Paired comparisons have been...consideration of chess competition . Ford (1957) pro- posed the model independently. Both Zermelo and Ford concentrated on solution of normal equations for

  5. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    PubMed

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  6. A model for 3:2 HFQPO pairs in black hole binaries based on cosmic battery

    NASA Astrophysics Data System (ADS)

    Huang, Chang-Yin; Ye, Yong-Chun; Wang, Ding-Xiong; Li, Yang

    2016-04-01

    A model for 3:2 high-frequency quasi-periodic oscillations (HFQPOs) with 3:2 pairs observed in four black hole X-ray binaries (BHXBs) is proposed by invoking the epicyclic resonances with the magnetic connection (MC) between a spinning black hole (BH) with a relativistic accretion disc. It turns out that the MC can be worked out due to Poynting-Robertson cosmic battery, and the 3:2 HFQPO pairs associated with the steep power-law states can be fitted in this model. Furthermore, the severe damping problem in the epicyclic resonance model can be overcome by transferring energy from the BH to the inner disc via the MC process for emitting X-rays with sufficient amplitude and coherence to produce the HFQPOs. In addition, we discuss the important role of the magnetic field in state transition of BHXBs.

  7. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    PubMed Central

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  8. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

    PubMed Central

    2011-01-01

    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  9. Qualitative Evaluation of Project P.A.T.H.S.: An Integration of Findings Based on Program Participants

    PubMed Central

    Shek, Daniel T. L.; Sun, Rachel C. F.

    2012-01-01

    An integration of the qualitative evaluation findings collected in different cohorts of students who participated in Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) (n = 252 students in 29 focus groups) was carried out. With specific focus on how the informants described the program, results showed that the descriptions were mainly positive in nature, suggesting that the program was well received by the program participants. When the informants were invited to name three metaphors that could stand for the program, positive metaphors were commonly used. Beneficial effects of the program in different psychosocial domains were also voiced by the program participants. The qualitative findings integrated in this paper provide further support for the effectiveness of the Tier 1 Program of Project P.A.T.H.S. in promoting holistic development in Chinese adolescents in Hong Kong. PMID:22666134

  10. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

    PubMed

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

    2014-04-01

    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  11. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base

    PubMed Central

    McCoy, Allison B.; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J.; Sittig, Dean F.

    2014-01-01

    Background Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. Objective We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. Approach We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Results Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of

  12. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    PubMed

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  13. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  14. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    PubMed

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    PubMed Central

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  16. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks

    PubMed Central

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua

    2013-01-01

    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  17. Pick a Pair. Pancake Pairs

    ERIC Educational Resources Information Center

    Miller, Pat

    2005-01-01

    Cold February weather and pancakes are a traditional pairing. Pancake Day began as a way to eat up the foods that were abstained from in Lent--traditionally meat, fat, eggs and dairy products. The best-known pancake event is The Pancake Day Race in Buckinghamshire, England, which has been run since 1445. This column describes pairs of books that…

  18. Communication: Exact analytical derivatives for the domain-based local pair natural orbital MP2 method (DLPNO-MP2)

    NASA Astrophysics Data System (ADS)

    Pinski, Peter; Neese, Frank

    2018-01-01

    Electron correlation methods based on pair natural orbitals (PNOs) have gained an increasing degree of interest in recent years, as they permit energy calculations to be performed on systems containing up to many hundred atoms, while maintaining chemical accuracy for reaction energies. We present an approach for taking exact analytical first derivatives of the energy contributions in the simplest method of the family of Domain-based Local Pair Natural Orbital (DLPNO) methods, closed-shell DLPNO-MP2. The Lagrangian function contains constraints to account for the relaxation of PNOs. RI-MP2 reference geometries are reproduced accurately, as exemplified for four systems with a substantial degree of nonbonding interactions. By the example of electric field gradients, we demonstrate that omitting PNO-specific constraints can lead to dramatic errors for orbital-relaxed properties.

  19. 2-Thiouracil deprived of thiocarbonyl function preferentially base pairs with guanine rather than adenine in RNA and DNA duplexes

    PubMed Central

    Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara

    2015-01-01

    2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900

  20. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    PubMed

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  1. Josephson Parametric Amplifer Based on a Cavity-Embedded Cooper Pair Transistor

    NASA Astrophysics Data System (ADS)

    Li, Juliang; Rimberg, A. J.

    In this experiment a cavity-embedded Cooper-pair transistor (cCPT) is used as a Josephson parametric amplifier. The cCPT consists of a Cooper pair transistor placed at the voltage antinode of a 5.7 GHz shorted quarter-wave resonator so that the CPT provides a galvanic connection between the cavity's central conductor and ground plane, which forms a SQUID loop. Both the flux threading the loop as well as the gate charge can be modulated, and each can provide the parametric pumping. The reflected signal from the cCPT is further amplified by both SLUG and HEMT amplifiers for characterizing the parametric amplification. A first application of the parametric amplification is to improve the charge sensitivity of a single electron charge detector. This can be done either by pumping on a side band or by shifting the charge state of the cCPT near a bifurcation point. Stimulated emission has been also observed when the cCPT is pumped at twice the resonant frequency in the absence of an input signal. This could allow investigation of the dynamic Casimir effect as well as generation of non-classical photon states. Supported by Grants ARO W911NF-13-10377 and NSF DMR 1507400.

  2. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    PubMed

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  3. An Ultra-Sensitive Electrometer based on the Cavity-Embedded Cooper-Pair Transistor

    NASA Astrophysics Data System (ADS)

    Li, Juliang; Miller, Marco; Rimberg, Alex

    2015-03-01

    We discuss use of a cavity-embedded Cooper-pair transistor (cCPT) as a potentially quantum-limited electrometer. The cCPT consists of a Cooper pair transistor placed at the voltage antinode of a 5.7 GHz shorted quarter-wave resonator so that the CPT provides a galvanic connection between the cavity's central conductor and ground plane. The quantum inductance of the CPT, which appears in parallel with the effective inductance of the cavity resonance, can be modulated by application of either a gate voltage to the CPT island or a flux bias to the CPT/cavity loop. Changes in the CPT inductance shift the cavity resonant frequency, and therefore the phase of a microwave signal reflected from the cavity. The reflected wave is amplified by both SLUG and HEMT amplifiers before its phase is measured. Results of recent measurements on the cCPT electrometer will be compared with theoretical predictions. This work was supported by the NSF under Grant No. DMR-1104821, by the ARO under Contract No, W911NF-13-1-0377 and by AFOSR/DARPA under Agreement No. FA8750-12-2-0339.

  4. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    PubMed

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  5. A double chain reversal loop and two diagonal loops define the architecture of a unimolecular DNA quadruplex containing a pair of stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads flanked by a G-(T-T) Triad and a T-T-T triple.

    PubMed

    Kuryavyi, V; Majumdar, A; Shallop, A; Chernichenko, N; Skripkin, E; Jones, R; Patel, D J

    2001-06-29

    The architecture of G-G-G-G tetrad-aligned DNA quadruplexes in monovalent cation solution is dependent on the directionality of the four strands, which in turn are defined by loop connectivities and the guanine syn/anti distribution along individual strands and within individual G-G-G-G tetrads. The smallest unimolecular G-quadruplex belongs to the d(G2NnG2NnG2NnG2) family, which has the potential to form two stacked G-tetrads linked by Nn loop connectivities. Previous studies have focused on the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), where Nn was T2 for the first and third connecting loops and TGT for the middle connecting loop. This DNA aptamer in K(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(anti)-G(syn)-G(anti) tetrads, adjacent strands which are antiparallel to each other and edge-wise connecting T2, TGT and T2 loops. We now report on the NMR-based solution structure of the d(G2T4G2CAG2GT4G2T) sequence, which differs from the thrombin-binding DNA aptamer sequence in having longer first (T4) and third (GT4) loops and a shorter (CA) middle loop. This d(G2T4G2CAG2GT4G2T) sequence in Na(+) cation solution forms a unimolecular G-quadruplex stabilized by two stacked G(syn)-G(syn)-G(anti)-G(anti) tetrads, adjacent strands which have one parallel and one antiparallel neighbors and distinct non-edge-wise loop connectivities. Specifically, the longer first (T4) and third (GT4) loops are of the diagonal type while the shorter middle loop is of the double chain reversal type. In addition, the pair of stacked G-G-G-G tetrads are flanked on one side by a G-(T-T) triad and on the other side by a T-T-T triple. The distinct differences in strand directionalities, loop connectivities and syn/anti distribution within G-G-G-G tetrads between the thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2) quadruplex reported previously, and the d(G2T4G2CAG2GT4G2T) quadruplex reported here, reinforces the polymorphic nature of higher

  6. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  7. Initial Development of C.A.T.E.S.: A Simulation-Based Competency Assessment Instrument for Neonatal Nurse Practitioners.

    PubMed

    Cates, Leigh Ann; Bishop, Sheryl; Armentrout, Debra; Verklan, Terese; Arnold, Jennifer; Doughty, Cara

    2015-01-01

    Determine content validity of global statements and operational definitions and choose scenarios for Competency, Assessment, Technology, Education, and Simulation (C.A.T.E.S.), instrument in development to evaluate multidimensional competency of neonatal nurse practitioners (NNPs). Real-time Delphi (RTD) method to pursue four specific aims (SAs): (1) identify which cognitive, technical, or behavioral dimension of NNP competency accurately reflects each global statement; (2) map the global statements to the National Association of Neonatal Nurse Practitioners (NANNP) core competency domains; (3) define operational definitions for the novice to expert performance subscales; and (4) determine the essential scenarios to assess NNPs. Twenty-five NNPs and nurses with competency and simulation experience Main outcome variable: One hundred percent of global statements correct for competency dimension and all but two correct for NANNP domain. One hundred percent novice to expert operational definitions and eight scenarios chosen. Content validity determined for global statements and novice to expert definitions and essential scenarios chosen.

  8. Effect of protonation on the electronic properties of DNA base pairs: applications for molecular electronics.

    PubMed

    Mallajosyula, Sairam S; Pati, Swapan K

    2007-10-11

    Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.

  9. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  10. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    PubMed Central

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  11. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts

    NASA Astrophysics Data System (ADS)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz

    2018-05-01

    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  12. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    PubMed

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

  13. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    PubMed

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  14. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    PubMed

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Impact of the Project P.A.T.H.S. in the junior secondary school years: objective outcome evaluation based on eight waves of longitudinal data.

    PubMed

    Shek, Daniel T L; Ma, Cecilia M S

    2012-01-01

    To assess the effectiveness of the Tier 1 Program of the Project P.A.T.H.S., a randomized group trial with eight waves of data collected was carried out. At the fifth year of data collection, 19 experimental schools (n = 2, 662 students) and 24 control schools (n = 3, 272 students) participated in the study. Analyses based on individual growth curve modeling showed that participants in the experimental schools displayed better positive youth development than did participants in the control schools in terms of different indicators derived from the Chinese Positive Youth Development Scale, including moral competence and behavioral competence and cognitive behavioral competencies. Significant results were also found when examining the trajectories of psychological development among control and experimental participants who perceived the program to be beneficial. Findings based on longitudinal objective outcome evaluation strongly suggest that the Project P.A.T.H.S. is effective in promoting positive development in Hong Kong secondary school students.

  16. pgRNAFinder: a web-based tool to design distance independent paired-gRNA.

    PubMed

    Xiong, Yuanyan; Xie, Xiaowei; Wang, Yanzhi; Ma, Wenbing; Liang, Puping; Songyang, Zhou; Dai, Zhiming

    2017-11-15

    The CRISPR/Cas System has been shown to be an efficient and accurate genome-editing technique. There exist a number of tools to design the guide RNA sequences and predict potential off-target sites. However, most of the existing computational tools on gRNA design are restricted to small deletions. To address this issue, we present pgRNAFinder, with an easy-to-use web interface, which enables researchers to design single or distance-free paired-gRNA sequences. The web interface of pgRNAFinder contains both gRNA search and scoring system. After users input query sequences, it searches gRNA by 3' protospacer-adjacent motif (PAM), and possible off-targets, and scores the conservation of the deleted sequences rapidly. Filters can be applied to identify high-quality CRISPR sites. PgRNAFinder offers gRNA design functionality for 8 vertebrate genomes. Furthermore, to keep pgRNAFinder open, extensible to any organism, we provide the source package for local use. The pgRNAFinder is freely available at http://songyanglab.sysu.edu.cn/wangwebs/pgRNAFinder/, and the source code and user manual can be obtained from https://github.com/xiexiaowei/pgRNAFinder. songyang@bcm.edu or daizhim@mail.sysu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  17. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays

    NASA Astrophysics Data System (ADS)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao

    2018-05-01

    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  18. Designed Synthesis of Mesoporous Solid-Supported Lewis Acid-Base Pairs and Their CO2 Adsorption Behaviors.

    PubMed

    Zakharova, Maria V; Masoumifard, Nima; Hu, Yimu; Han, Jongho; Kleitz, Freddy; Fontaine, Frédéric-Georges

    2018-04-18

    Conventional amines and phosphines, such as diethylenetriamine, diphenylpropylphosphine, triethylamine, and tetramethylpiperidine, were grafted or impregnated on the surface of metalated SBA-15 materials, such as Ti-, Al-, and Zr-SBA-15, to generate air-stable solid-supported Lewis acid-base pairs. The Lewis acidity of the metalated materials before and after the introduction of Lewis bases was verified by means of pyridine adsorption-Fourier transform infrared spectroscopy. Detailed characterization of the materials was achieved by solid-state 13 C and 31 P MAS NMR spectroscopy, low-temperature N 2 physisorption, X-ray photoelectron spectroscopy, and energy-dispersive X-ray mapping analyses. Study of their potential interactions with CO 2 was performed using CO 2 adsorption isotherm experiments, which provided new insights into their applicability as solid CO 2 adsorbents. A correlation between solid-supported Lewis acid-base pair strength and the resulting affinity to CO 2 is discussed based on the calculation of isosteric enthalpy of adsorption.

  19. Ionic force field optimization based on single-ion and ion-pair solvation properties: Going beyond standard mixing rules

    NASA Astrophysics Data System (ADS)

    Fyta, Maria; Netz, Roland R.

    2012-03-01

    Using molecular dynamics (MD) simulations in conjunction with the SPC/E water model, we optimize ionic force-field parameters for seven different halide and alkali ions, considering a total of eight ion-pairs. Our strategy is based on simultaneous optimizing single-ion and ion-pair properties, i.e., we first fix ion-water parameters based on single-ion solvation free energies, and in a second step determine the cation-anion interaction parameters (traditionally given by mixing or combination rules) based on the Kirkwood-Buff theory without modification of the ion-water interaction parameters. In doing so, we have introduced scaling factors for the cation-anion Lennard-Jones (LJ) interaction that quantify deviations from the standard mixing rules. For the rather size-symmetric salt solutions involving bromide and chloride ions, the standard mixing rules work fine. On the other hand, for the iodide and fluoride solutions, corresponding to the largest and smallest anion considered in this work, a rescaling of the mixing rules was necessary. For iodide, the experimental activities suggest more tightly bound ion pairing than given by the standard mixing rules, which is achieved in simulations by reducing the scaling factor of the cation-anion LJ energy. For fluoride, the situation is different and the simulations show too large attraction between fluoride and cations when compared with experimental data. For NaF, the situation can be rectified by increasing the cation-anion LJ energy. For KF, it proves necessary to increase the effective cation-anion Lennard-Jones diameter. The optimization strategy outlined in this work can be easily adapted to different kinds of ions.

  20. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    PubMed

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  1. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves

    NASA Astrophysics Data System (ADS)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin

    2018-05-01

    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  2. MRI-based finite element modeling of facial mimics: a case study on the paired zygomaticus major muscles.

    PubMed

    Fan, Ang-Xiao; Dakpé, Stéphanie; Dao, Tien Tuan; Pouletaut, Philippe; Rachik, Mohamed; Ho Ba Tho, Marie Christine

    2017-07-01

    Finite element simulation of facial mimics provides objective indicators about soft tissue functions for improving diagnosis, treatment and follow-up of facial disorders. There is a lack of in vivo experimental data for model development and validation. In this study, the contribution of the paired Zygomaticus Major (ZM) muscle contraction on the facial mimics was investigated using in vivo experimental data derived from MRI. Maximal relative differences of 7.7% and 37% were noted between MRI-based measurements and numerical outcomes for ZM and skin deformation behaviors respectively. This study opens a new direction to simulate facial mimics with in vivo data.

  3. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra.

    PubMed

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza

    2017-04-01

    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  4. Evaluation of programs for adolescents with greater psychosocial needs: community-based Project P.A.T.H.S. in Hong Kong.

    PubMed

    Shek, Daniel T L; Law, Moon Y M

    2017-02-01

    This study examined the perceptions of the Tier 2 Program of the Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social programmes) among Chinese secondary school students displaying greater psychosocial needs. Results showed that participants held positive views of program qualities, implementer qualities, as well as the perceived effectiveness of the program. Significant grade differences in terms of various indicators of satisfaction related to program qualities, implementer qualities, and program effectiveness were found. Correlation analyses showed that there were significant inter-relationships amongst program qualities, implementer qualities and program effectiveness. In line with the predictions, both program qualities and implementer qualities were significant predictors of perceived program effectiveness. The present study provides support for the perceived effectiveness of the Tier 2 Program of the Project P.A.T.H.S. in the community-based project context.

  5. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

    PubMed

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

    2016-12-01

    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Experimental demonstration of wavelength domain rogue-free ONU based on wavelength-pairing for TDM/WDM optical access networks.

    PubMed

    Lee, Jie Hyun; Park, Heuk; Kang, Sae-Kyoung; Lee, Joon Ki; Chung, Hwan Seok

    2015-11-30

    In this study, we propose and experimentally demonstrate a wavelength domain rogue-free ONU based on wavelength-pairing of downstream and upstream signals for time/wavelength division-multiplexed optical access networks. The wavelength-pairing tunable filter is aligned to the upstream wavelength channel by aligning it to one of the downstream wavelength channels. Wavelength-pairing is implemented with a compact and cyclic Si-AWG integrated with a Ge-PD. The pairing filter covered four 100 GHz-spaced wavelength channels. The feasibility of the wavelength domain rogue-free operation is investigated by emulating malfunction of the misaligned laser. The wavelength-pairing tunable filter based on the Si-AWG blocks the upstream signal in the non-assigned wavelength channel before data collision with other ONUs.

  7. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y.

    PubMed

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P

    2017-02-01

    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  8. Young Foreign Language Learners' Interactions during Task-Based Paired Assessments

    ERIC Educational Resources Information Center

    Butler, Yuko Goto; Zeng, Wei

    2014-01-01

    Despite the popularity of task-based language teaching (TBLT) in foreign language (FL) education at elementary school, it remains unclear how young learners' FL abilities can best be evaluated with tasks. The present study seeks to understand developmental differences in interactions among elementary-school students during task-based language…

  9. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    PubMed

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  10. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    PubMed Central

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  11. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease 'driver' mutations.

    PubMed

    Villagrán, Martha Y Suárez; Miller, John H

    2015-08-27

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease 'driver' mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands.

  12. Seventeen {alpha}-hydroxylase deficiency with one base pair deletion of the cytochrome P450c17 (CYP17) gene

    SciTech Connect

    Oshiro, Chikara; Takasu, Nobuyuki; Wakugami, Tamio

    1995-08-01

    Mutation of the cytochrome P450c17 (CYP17) gene causes 17{alpha}-hydroxylase deficiency (170HD). Recently, several researchers have elucidated the molecular basis of 170HD by gene analysis. We experienced a case of 170HD and intended to reveal the abnormality of the CYP17 gene in this Japanese female with 170HD. Leukocytes were obtained from the patient, her mother and sister, and normal control subjects. We amplified the CYP17 gene using polymerase chain reaction and performed the sequence analysis using the dideoxy terminator method and restriction enzyme analysis. We found that the patient had one base-pair deletion at the position of amino acid 438. Anmore » indentical result was obtained with restriction enzyme analysis. This G deletion altered the reading frame and resulted in a premature stop codon at position 443; the ligand of heme iron (Cys: cystine 442) was absent. This small mutation may account for the patient`s clinical manifestations of 170HD. This is the first case of 170HD with only one base pair deletion of the CYP17 gene. 18 refs., 3 figs.« less

  13. Computational DNA hole spectroscopy: A new tool to predict mutation hotspots, critical base pairs, and disease ‘driver’ mutations

    PubMed Central

    Suárez, Martha Y.; Villagrán; Miller, John H.

    2015-01-01

    We report on a new technique, computational DNA hole spectroscopy, which creates spectra of electron hole probabilities vs. nucleotide position. A hole is a site of positive charge created when an electron is removed. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of mitochondrial DNA reveal a correlation between L-strand hole spectrum peaks and spikes in the human mutation spectrum. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with disease-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential disease ‘driver’ mutations. Such integration of DNA hole and variance spectra could ultimately prove invaluable for pinpointing critical regions of the vast non-protein-coding genome. An observed asymmetry in correlations, between the spectrum of human mtDNA variations and the L- and H-strand hole spectra, is attributed to asymmetric DNA replication processes that occur for the leading and lagging strands. PMID:26310834

  14. Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

    PubMed Central

    O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

    2006-01-01

    Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

  15. Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

    PubMed

    Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

    2013-06-01

    Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

  16. Quantum State Tomography of a Fiber-Based Source of Polarization-Entangled Photon Pairs

    DTIC Science & Technology

    2007-12-20

    Processing 175−179 (IEEE, Bangalore, 1984). 4. A. K. Ekert, “ Quantum cryptography based on Bell’s theorem ,” Phys. Rev. Lett. 67, 661–663 (1991). 5...NUMBERS Quantum State Tomography of a Fiber- Based Source of MURI Center for Photonic Quantum Information Systems: AROIARDA Program Polarization...Computer Society Press, Los Alamitos, 1996). 7. N. Gisin, G. Ribordy, W. Tittel, and H. Zbinden, “ Quantum cryptography ,” Rev. Mod. Phys. 74, 145

  17. Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

    PubMed

    Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

    1998-09-23

    The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

  18. Activation Energies for Dissociation of Double Strand Oligonucleotide Anions: Evidence for Watson–Crick Base Pairing in Vacuo

    PubMed Central

    Schnier, Paul D.; Klassen, John S.; Strittmatter, Eric F.; Williams*, Evan R.

    2005-01-01

    The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)23−, (CCGG)23−, (AATTAAT)23−, (CCGGCCG)23−, A7·T73−, A7·A73−, T7·T73−, and A7·C73− were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 1013 to 1019 s−1. Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a – base) and w ions. Four pieces of evidence are presented which indicate that Watson–Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A7·T73−, to the single strands is significantly higher than that for the related noncomplementary A7·A73− and T7·T73− dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A7·A73− and A7·C73− but not for A7·T73− consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (−ΔHd) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A7·T73− duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent. PMID:16498487

  19. Impact of Project P.A.T.H.S. on adolescent developmental outcomes in Hong Kong: findings based on seven waves of data.

    PubMed

    Shek, Daniel T L; Ma, Cecilia M S

    2012-01-18

    The present study examined the longitudinal impact of Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) on adolescent developmental outcomes in Hong Kong. Using a longitudinal randomized group design, seven waves of data were collected from 24 experimental schools (n=4049 at wave 1) in which students participated in the Tier 1 Program of Project P.A.T.H.S. and 24 control schools (n=3797 at wave 1). Results based on individual growth curve modeling generally showed that, relative to the control participants, participants in the experimental group had: (a) a higher level of positive development; (b) a lower level of substance abuse; and (c) a lower level of delinquent behavior. Participants who regarded the program to be beneficial also showed higher levels of positive development and lower levels of problem behavior than did the control school students. The present findings suggest that Project P.A.T.H.S. is effective in promoting positive development and preventing adolescent problem behavior in Chinese adolescents in Hong Kong.

  20. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    NASA Astrophysics Data System (ADS)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  1. Nonmagnetic impurity resonances as a signature of sign-reversal pairing in FeAs-based superconductors.

    PubMed

    Zhang, Degang

    2009-10-30

    The energy band structure of FeAs-based superconductors is fitted by a tight-binding model with two Fe ions per unit cell and two degenerate orbitals per Fe ion. Based on this, superconductivity with extended s-wave pairing symmetry of the form cosk(x)+cosk(y) is examined. The local density of states near an impurity is also investigated by using the T-matrix approach. For the nonmagnetic scattering potential, we found that there exist two major resonances inside the gap. The height of the resonance peaks depends on the strength of the impurity potential. These in-gap resonances are originated in the Andreev's bound states due to the quasiparticle scattering between the hole Fermi surfaces around Gamma point with positive order parameter and the electron Fermi surfaces around M point with negative order parameter.

  2. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  3. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks

    ERIC Educational Resources Information Center

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita

    2017-01-01

    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  4. Self-association and base pairing of guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide solution measured by 15N nuclear magnetic resonance spectroscopy.

    PubMed Central

    Dyllick-Brenzinger, C; Sullivan, G R; Pang, P P; Roberts, J D

    1980-01-01

    The self-association of guanosine, cytidine, and adenosine and base pairing between guanosine, cytidine, adenosine, and uridine in dimethyl sulfoxide have been investigated by the variation of their 15N NMR chemical shifts with concentration and temperature. Guanosine, cytidine, and adenosine all showed evidence of self-association by hydrogen bonding. In guanosine/cytidine mixtures, a hydrogen-bonded dimer is formed; however, no base pairing could be detected with adenosine/cytidine or adenosine/uridine mixtures. PMID:6932658

  5. A likelihood-based approach for assessment of extra-pair paternity and conspecific brood parasitism in natural populations

    USGS Publications Warehouse

    Lemons, Patrick R.; Marshall, T.C.; McCloskey, Sarah E.; Sethi, S.A.; Schmutz, Joel A.; Sedinger, James S.

    2015-01-01

    Genotypes are frequently used to assess alternative reproductive strategies such as extra-pair paternity and conspecific brood parasitism in wild populations. However, such analyses are vulnerable to genotyping error or molecular artifacts that can bias results. For example, when using multilocus microsatellite data, a mismatch at a single locus, suggesting the offspring was not directly related to its putative parents, can occur quite commonly even when the offspring is truly related. Some recent studies have advocated an ad-hoc rule that offspring must differ at more than one locus in order to conclude that they are not directly related. While this reduces the frequency with which true offspring are identified as not directly related young, it also introduces bias in the opposite direction, wherein not directly related young are categorized as true offspring. More importantly, it ignores the additional information on allele frequencies which would reduce overall bias. In this study, we present a novel technique for assessing extra-pair paternity and conspecific brood parasitism using a likelihood-based approach in a new version of program cervus. We test the suitability of the technique by applying it to a simulated data set and then present an example to demonstrate its influence on the estimation of alternative reproductive strategies.

  6. Roles of the Lewis acid and base in the chemical reduction of CO2 catalyzed by frustrated Lewis pairs.

    PubMed

    Lim, Chern-Hooi; Holder, Aaron M; Hynes, James T; Musgrave, Charles B

    2013-09-03

    We employ quantum chemical calculations to discover how frustrated Lewis pairs (FLP) catalyze the reduction of CO2 by ammonia borane (AB); specifically, we examine how the Lewis acid (LA) and Lewis base (LB) of an FLP activate CO2 for reduction. We find that the LA (trichloroaluminum, AlCl3) alone catalyzes hydride transfer (HT) to CO2 while the LB (trimesitylenephosphine, PMes3) actually hinders HT; inclusion of the LB increases the HT barrier by ∼8 kcal/mol relative to the reaction catalyzed by LAs only. The LB hinders HT by donating its lone pair to the LUMO of CO2, increasing the electron density on the C atom and thus lowering its hydride affinity. Although the LB hinders HT, it nonetheless plays a crucial role by stabilizing the active FLP·CO2 complex relative to the LA dimer, free CO2, and free LB. This greatly increases the concentration of the reactive complex in the form FLP·CO2 and thus increases the rate of reaction. We expect that the principles we describe will aid in understanding other catalytic CO2 reductions.

  7. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  8. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task

    PubMed Central

    Vallila-Rohter, Sofia; Kiran, Swathi

    2013-01-01

    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  9. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  10. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  11. Properties of solid and gaseous hydrogen, based upon anisotropic pair interactions

    NASA Technical Reports Server (NTRS)

    Etters, R. D.; Danilowicz, R.; England, W.

    1975-01-01

    Properties of H2 are studied on the basis of an analytic anisotropic potential deduced from atomic orbital and perturbation calculations. The low-pressure solid results are based on a spherical average of the anisotropic potential. The ground state energy and the pressure-volume relation are calculated. The metal-insulator phase transition pressure is predicted. Second virial coefficients are calculated for H2 and D2, as is the difference in second virial coefficients between ortho and para H2 and D2.

  12. Electron pairing without superconductivity

    NASA Astrophysics Data System (ADS)

    Levy, Jeremy

    Strontium titanate (SrTiO3) is the first and best known superconducting semiconductor. It exhibits an extremely low carrier density threshold for superconductivity, and possesses a phase diagram similar to that of high-temperature superconductors--two factors that suggest an unconventional pairing mechanism. Despite sustained interest for 50 years, direct experimental insight into the nature of electron pairing in SrTiO3 has remained elusive. Here we perform transport experiments with nanowire-based single-electron transistors at the interface between SrTiO3 and a thin layer of lanthanum aluminate, LaAlO3. Electrostatic gating reveals a series of two-electron conductance resonances--paired electron states--that bifurcate above a critical pairing field Bp of about 1-4 tesla, an order of magnitude larger than the superconducting critical magnetic field. For magnetic fields below Bp, these resonances are insensitive to the applied magnetic field; for fields in excess of Bp, the resonances exhibit a linear Zeeman-like energy splitting. Electron pairing is stable at temperatures as high as 900 millikelvin, well above the superconducting transition temperature (about 300 millikelvin). These experiments demonstrate the existence of a robust electronic phase in which electrons pair without forming a superconducting state. Key experimental signatures are captured by a model involving an attractive Hubbard interaction that describes real-space electron pairing as a precursor to superconductivity. Support from AFOSR, ONR, ARO, NSF, DOE and NSSEFF is gratefully acknowledged.

  13. Donor/acceptor nanoparticle pair-based singlet oxygen channeling homogenous chemiluminescence immunoassay for quantitative determination of bisphenol A.

    PubMed

    Hou, Changjiang; Zhao, Lixia; Geng, Fanglan; Wang, Dan; Guo, Liang-Hong

    2016-12-01

    Bisphenol A (BPA) is widely used in consumer products such as plastic bottles and food containers. It has become a ubiquitous environmental contaminant and poses a serious risk to human health. A rapid, sensitive, and high-throughput method for detecting BPA is therefore desirable. Herein, a donor/acceptor nanoparticle pair-based singlet oxygen channeling chemiluminescence homogenous immunoassay is developed for the determination of BPA. The donor nanoparticles were modified with phthalocyanine as a photosensitizer and were then coated with streptavidin. The acceptor nanoparticles were doped with thioxene derivatives and Eu(III) as a chemiluminescence emitter and then coated with anti-BPA antibody. Under light irradiation, oxygen near the donor surface transforms to singlet oxygen ( 1 O 2 ), which migrates to the acceptor and reacts with it, generating luminescence. Because 1 O 2 has a very short lifetime, luminescence is generated only when the donor and acceptor are in close proximity. This occurs when they are brought together by the antigen/antibody and streptavidin/biotin reaction. Based on this singlet oxygen channeling mechanism, a competitive homogenous chemiluminescence immunoassay for BPA was developed on 384 microplates. The assay exhibited linear detection over the range 10-1000 ng/mL and a limit of detection of 2.9 ng/mL. The intra- and inter-assay precisions were both below 5.1 %. The average recoveries of three spiked samples in tap and river water samples were in the range 95.5-121.0 %, in agreement with values obtained using high-performance liquid chromatography. The homogeneous assay is rapid, low cost, sensitive, and allows high-throughput, so is well suited for screening large numbers of environmental samples. Graphical abstract Principle of the singlet oxygen channeling homogenous chemiluminescence competitive immunoassay based on nanoparticle pairs for determination of BPA.

  14. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

    DOEpatents

    Mayer-Cumblidge, M. Uljana; Cao, Haishi

    2013-01-15

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  15. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.

    PubMed Central

    Cotton, R G; Rodrigues, N R; Campbell, R D

    1988-01-01

    The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032

  16. Correlating Transcription Initiation and Conformational Changes by a Single-Subunit RNA Polymerase with Near Base-Pair Resolution.

    PubMed

    Koh, Hye Ran; Roy, Rahul; Sorokina, Maria; Tang, Guo-Qing; Nandakumar, Divya; Patel, Smita S; Ha, Taekjip

    2018-05-17

    We provide a comprehensive analysis of transcription in real time by T7 RNA Polymerase (RNAP) using single-molecule fluorescence resonance energy transfer by monitoring the entire life history of transcription initiation, including stepwise RNA synthesis with near base-pair resolution, abortive cycling, and transition into elongation. Kinetically branching pathways were observed for abortive initiation with an RNAP either recycling on the same promoter or exchanging with another RNAP from solution. We detected fast and slow populations of RNAP in their transition into elongation, consistent with the efficient and delayed promoter release, respectively, observed in ensemble studies. Real-time monitoring of abortive cycling using three-probe analysis showed that the initiation events are stochastically branched into productive and failed transcription. The abortive products are generated primarily from initiation events that fail to progress to elongation, and a majority of the productive events transit to elongation without making abortive products. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. The Challenges and Opportunities for Development of a T-Cell Epitope-Based Herpes Simplex Vaccine

    PubMed Central

    Kuo, Tiffany; Wang, Christine; Badakhshan, Tina; Chilukuri, Sravya; BenMohamed, Lbachir

    2014-01-01

    The infections with herpes simplex virus type 1 and type 2 (HSV-1 & HSV-2) have been prevalent since the ancient Greek times. To this day, they still affect a staggering number of over a half billion individuals worldwide. HSV-2 infections cause painful genital herpes, encephalitis, and death in newborns. HSV-1 infections are more prevalent than HSV-2 infections and cause potentially blinding ocular herpes, oro-facial herpes and encephalitis. While genital herpes in mainly caused by HSV-2 infections, in recent years, there is an increase in the proportion of genital herpes caused by HSV-1 infections in young adults, which reach 50% in some western societies. While prophylactic and therapeutic HSV vaccines remain urgently needed for centuries their development has been notoriously difficult. During the most recent National Institute of Health (NIH) workshop titled "Next Generation Herpes Simplex Virus Vaccines: The Challenges and Opportunities", basic researchers, funding agencies, and pharmaceutical representatives gathered: (i) to assess the status of herpes vaccine research; and (ii) to identify the gaps and propose alternative approaches in developing a safe and efficient herpes vaccine. One “common denominator” among previously failed clinical herpes vaccine trials is that they either used a whole virus or whole viral proteins, which contain both pathogenic “symptomatic” and protective “asymptomatic” antigens/epitopes. In this report, we continue to advocate that using an “asymptomatic” epitope-based vaccine strategy that selectively incorporates protective epitopes which: (i) are exclusively recognized, in vitro, by effector memory CD4+ and CD8+ TEM cells from “naturally” protected seropositive asymptomatic individuals; and (ii) protect, in vivo, human leukocyte antigen (HLA) transgenic animal models from ocular and genital herpes infections and diseases, could be the answer to many of the scientific challenges facing HSV vaccine

  18. Canine GM2-Gangliosidosis Sandhoff Disease Associated with a 3-Base Pair Deletion in the HEXB Gene.

    PubMed

    Wang, P; Henthorn, P S; Galban, E; Lin, G; Takedai, T; Casal, M

    2018-01-01

    GM2-gangliosidosis is a fatal neurodegenerative lysosomal storage disease (LSD) caused by deficiency of either β-hexosaminidase A (Hex-A) and β-hexosaminidase B (Hex-B) together, or the GM2 activator protein. Clinical signs can be variable and are not pathognomonic for the specific, causal deficiency. To characterize the phenotype and genotype of GM2-gangliosidosis disease in an affected dog. One affected Shiba Inu and a clinically healthy dog. Clinical and neurologic evaluation, brain magnetic resonance imaging (MRI), assays of lysosomal enzyme activities, and sequencing of all coding regions of HEXA, HEXB, and GM2A genes. A 14-month-old, female Shiba Inu presented with clinical signs resembling GM2-gangliosidosis in humans and GM1-gangliosidosis in the Shiba Inu. Magnetic resonance imaging (MRI) of the dog's brain indicated neurodegenerative disease, and evaluation of cerebrospinal fluid (CSF) identified storage granules in leukocytes. Lysosomal enzyme assays of plasma and leukocytes showed deficiencies of Hex-A and Hex-B activities in both tissues. Genetic analysis identified a homozygous, 3-base pair deletion in the HEXB gene (c.618-620delCCT). Clinical, biochemical, and molecular features are characterized in a Shiba Inu with GM2-gangliosidosis. The deletion of 3 adjacent base pairs in HEXB predicts the loss of a leucine residue at amino acid position 207 (p.Leu207del) supporting the hypothesis that GM2-gangliosidosis seen in this dog is the Sandhoff type. Because GM1-gangliosidosis also exists in this breed with almost identical clinical signs, genetic testing for both GM1- and GM2-gangliosidosis should be considered to make a definitive diagnosis. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  19. Dynamics and couplings of N-H stretching excitations of guanosine-cytidine base pairs in solution.

    PubMed

    Yang, Ming; Szyc, Łukasz; Röttger, Katharina; Fidder, Henk; Nibbering, Erik T J; Elsaesser, Thomas; Temps, Friedrich

    2011-05-12

    N-H stretching vibrations of hydrogen-bonded guanosine-cytidine (G·C) base pairs in chloroform solution are studied with linear and ultrafast nonlinear infrared (IR) spectroscopy. Assignment of the IR-active bands in the linear spectrum is made possible by combining structural information on the hydrogen bonds in G·C base pairs with literature results of density functional theory calculations, and empirical relations connecting frequency shifts and intensity of the IR-active vibrations. A local mode representation of N-H stretching vibrations is adopted, consisting of ν(G)(NH(2))(f) and ν(C)(NH(2))(f) modes for free NH groups of G and C, and of ν(G)(NH(2))(b), ν(G)(NH), and ν(C)(NH(2))(b) modes associated with N-H stretching motions of hydrogen-bonded NH groups. The couplings and relaxation dynamics of the N-H stretching excitations are studied with femtosecond mid-infrared two-dimensional (2D) and pump-probe spectroscopy. The N-H stretching vibrations of the free NH groups of G and C have an average population lifetime of 2.4 ps. Besides a vibrational population lifetime shortening to subpicosecond values observed for the hydrogen-bonded N-H stretching vibrations, the 2D spectra reveal vibrational excitation transfer from the ν(G)(NH(2))(b) mode to the ν(G)(NH) and/or ν(C)(NH(2))(b) modes. The underlying intermode vibrational couplings are on the order of 10 cm(-1).

  20. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    PubMed

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Treating Subvalence Correlation Effects in Domain Based Pair Natural Orbital Coupled Cluster Calculations: An Out-of-the-Box Approach.

    PubMed

    Bistoni, Giovanni; Riplinger, Christoph; Minenkov, Yury; Cavallo, Luigi; Auer, Alexander A; Neese, Frank

    2017-07-11

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is used for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF 3 , CaF 2 , CuF, GaF 3 , YF 3 , AgF, InF 3 , HfF 4 , and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions subvalence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence, and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  2. Paired basic science and clinical problem-based learning faculty teaching side by side: do students evaluate them differently?

    PubMed

    Stevenson, Frazier T; Bowe, Connie M; Gandour-Edwards, Regina; Kumari, Vijaya G

    2005-02-01

    Many studies have evaluated the desirability of expert versus non-expert facilitators in problem-based learning (PBL), but performance differences between basic science and clinical facilitators has been less studied. In a PBL course at our university, pairs of faculty facilitators (1 clinician, 1 basic scientist) were assigned to student groups to maximise integration of basic science with clinical science. This study set out to establish whether students evaluate basic science and clinical faculty members differently when they teach side by side. Online questionnaires were used to survey 188 students about their faculty facilitators immediately after they completed each of 3 serial PBL cases. Overall satisfaction was measured using a scale of 1-7 and yes/no responses were gathered from closed questions describing faculty performance. results: Year 1 students rated basic science and clinical facilitators the same, but Year 2 students rated the clinicians higher overall. Year 1 students rated basic scientists higher in their ability to understand the limits of their own knowledge. Year 2 students rated the clinicians higher in several content expertise-linked areas: preparedness, promotion of in-depth understanding, and ability to focus the group, and down-rated the basic scientists for demonstrating overspecialised knowledge. Students' overall ratings of individual faculty best correlated with the qualities of stimulation, focus and preparedness, but not with overspecialisation, excessive interjection of the faculty member's own opinions, and encouragement of psychosocial issue discussion. When taught by paired basic science and clinical PBL facilitators, students in Year 1 rated basic science and clinical PBL faculty equally, while Year 2 students rated clinicians more highly overall. The Year 2 difference may be explained by perceived differences in content expertise.

  3. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

    PubMed

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

    2017-09-01

    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Standard operating procedure for calculating genome-to-genome distances based on high-scoring segment pairs.

    PubMed

    Auch, Alexander F; Klenk, Hans-Peter; Göker, Markus

    2010-01-28

    DNA-DNA hybridization (DDH) is a widely applied wet-lab technique to obtain an estimate of the overall similarity between the genomes of two organisms. To base the species concept for prokaryotes ultimately on DDH was chosen by microbiologists as a pragmatic approach for deciding about the recognition of novel species, but also allowed a relatively high degree of standardization compared to other areas of taxonomy. However, DDH is tedious and error-prone and first and foremost cannot be used to incrementally establish a comparative database. Recent studies have shown that in-silico methods for the comparison of genome sequences can be used to replace DDH. Considering the ongoing rapid technological progress of sequencing methods, genome-based prokaryote taxonomy is coming into reach. However, calculating distances between genomes is dependent on multiple choices for software and program settings. We here provide an overview over the modifications that can be applied to distance methods based in high-scoring segment pairs (HSPs) or maximally unique matches (MUMs) and that need to be documented. General recommendations on determining HSPs using BLAST or other algorithms are also provided. As a reference implementation, we introduce the GGDC web server (http://ggdc.gbdp.org).

  5. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    PubMed

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  6. The tolerance to exchanges of the Watson–Crick base pair in the hammerhead ribozyme core is determined by surrounding elements

    PubMed Central

    Przybilski, Rita; Hammann, Christian

    2007-01-01

    Tertiary interacting elements are important features of functional RNA molecules, for example, in all small nucleolytic ribozymes. The recent crystal structure of a tertiary stabilized type I hammerhead ribozyme revealed a conventional Watson–Crick base pair in the catalytic core, formed between nucleotides C3 and G8. We show that any Watson–Crick base pair between these positions retains cleavage competence in two type III ribozymes. In the Arabidopsis thaliana sequence, only moderate differences in cleavage rates are observed for the different base pairs, while the peach latent mosaic viroid (PLMVd) ribozyme exhibits a preference for a pyrimidine at position 3 and a purine at position 8. To understand these differences, we created a series of chimeric ribozymes in which we swapped sequence elements that surround the catalytic core. The kinetic characterization of the resulting ribozymes revealed that the tertiary interacting loop sequences of the PLMVd ribozyme are sufficient to induce the preference for Y3–R8 base pairs in the A. thaliana hammerhead ribozyme. In contrast to this, only when the entire stem–loops I and II of the A. thaliana sequences are grafted on the PLMVd ribozyme is any Watson–Crick base pair similarly tolerated. The data provide evidence for a complex interplay of secondary and tertiary structure elements that lead, mediated by long-range effects, to an individual modulation of the local structure in the catalytic core of different hammerhead ribozymes. PMID:17666711

  7. m1A and m1G Potently Disrupt A-RNA Structure Due to the Intrinsic Instability of Hoogsteen Base Pairs

    PubMed Central

    Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.

    2016-01-01

    The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929

  8. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

    PubMed

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

    2012-11-01

    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  9. Energetics, Ion and Water Binding of the Unfolding of AA/UU Base Pair Stacks and UAU/UAU Base Triplet Stacks in RNA.

    PubMed

    Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A

    2018-06-22

    Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.

  10. Thermodynamic Signature of DNA Damage: Characterization of DNA with a 5-Hydroxy-2'-deoxycytidine•2'-Deoxyguanosine Base Pair

    PubMed Central

    Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry

    2012-01-01

    Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945

  11. Excited state properties of naphtho-homologated xxDNA bases and effect of methanol solution, deoxyribose, and base pairing.

    PubMed

    Zhang, Laibin; Ren, Tingqi; Tian, Jianxiang; Yang, Xiuqin; Zhou, Liuzhu; Li, Xiaoming

    2013-04-18

    Design and synthesis of fluorescent nucleobase analogues for studying structures and dynamics of nucleic acids have attracted much attention in recent years. In the present work, a comprehensive theoretical study of electronic transitions of naphtho-homologated base analogues, namely, xxC, xxT, xxA, and xxG, was performed. The nature of the low-lying excited states was discussed, and the results were compared with those of x-bases. Geometrical characteristics of the lowest excited singlet ππ* states were explored using the CIS method. The calculated excitation maxima are 423, 397, 383, and 357 nm for xxA, xxG, xxC, and xxT, respectively, and they are greatly red-shifted compared with x-bases and natural bases, allowing them to be selectively excited in the presence of the natural bases. In the gas phase, the fluorescence from them would be expected to occur around 497, 461, 457, and 417 nm, respectively. The effects of methanol solution, deoxyribose, and base paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were also examined.

  12. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    PubMed

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains.

    PubMed

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai

    2017-08-01

    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  14. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory

    NASA Astrophysics Data System (ADS)

    Frank, Marius S.; Hättig, Christof

    2018-04-01

    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  15. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques.

    PubMed

    Schmitz, Gunnar; Hättig, Christof

    2016-12-21

    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  16. Design and isolation of ribozyme-substrate pairs using RNase P-based ribozymes containing altered substrate binding sites.

    PubMed Central

    Mobley, E M; Pan, T

    1999-01-01

    Substrate recognition and cleavage by the bacterial RNase P RNA requires two domains, a specificity domain, or S-domain, and a catalytic domain, or C-domain. The S-domain binds the T stem-loop region in a pre-tRNA substrate to confer specificity for tRNA substrates. In this work, the entire S-domain of the Bacillus subtilis RNase P RNA is replaced with an artificial substrate binding module. New RNA substrates are isolated by in vitro selection using two libraries containing random regions of 60 nt. At the end of the selection, the cleavage rates of the substrate library are approximately 0.7 min(-1)in 10 mM MgCl(2)at 37 degrees C, approximately 4-fold better than the cleavage of a pre-tRNA substrate by the wild-type RNase P RNA under the same conditions. The contribution of the S-domain replacement to the catalytic efficiency is from 6- to 22 000-fold. Chemical and nuclease mapping of two ribozyme-product complexes shows that this contribution correlates with direct interactions between the S-domain replacement and the selected substrate. These results demonstrate the feasibility of design and isolation of RNase P-based, matching ribozyme-substrate pairs without prior knowledge of the sequence or structure of the interactive modules in the ribozyme or substrate. PMID:10518624

  17. Local energy decomposition analysis of hydrogen-bonded dimers within a domain-based pair natural orbital coupled cluster study.

    PubMed

    Altun, Ahmet; Neese, Frank; Bistoni, Giovanni

    2018-01-01

    The local energy decomposition (LED) analysis allows for a decomposition of the accurate domain-based local pair natural orbital CCSD(T) [DLPNO-CCSD(T)] energy into physically meaningful contributions including geometric and electronic preparation, electrostatic interaction, interfragment exchange, dynamic charge polarization, and London dispersion terms. Herein, this technique is employed in the study of hydrogen-bonding interactions in a series of conformers of water and hydrogen fluoride dimers. Initially, DLPNO-CCSD(T) dissociation energies for the most stable conformers are computed and compared with available experimental data. Afterwards, the decay of the LED terms with the intermolecular distance ( r ) is discussed and results are compared with the ones obtained from the popular symmetry adapted perturbation theory (SAPT). It is found that, as expected, electrostatic contributions slowly decay for increasing r and dominate the interaction energies in the long range. London dispersion contributions decay as expected, as r -6 . They significantly affect the depths of the potential wells. The interfragment exchange provides a further stabilizing contribution that decays exponentially with the intermolecular distance. This information is used to rationalize the trend of stability of various conformers of the water and hydrogen fluoride dimers.

  18. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data.

    PubMed

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai

    2012-02-15

    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion.

  19. A theoretical thermochemical study of solute-solvent dielectric effects in the displacement of codon-anticodon base pairs

    NASA Astrophysics Data System (ADS)

    Monajjemi, M.; Razavian, M. H.; Mollaamin, F.; Naderi, F.; Honarparvar, B.

    2008-12-01

    Quantum-chemical solvent effect theories describe the electronic structure of a molecular subsystem embedded in a solvent or other molecular environment. The solvation of biomolecules is important in molecular biology, since numerous processes involve proteins interacting in changing solvent-solute systems. In this theoretical study, we focus on mRNA-tRNA base pairs as a fundamental step in protein synthesis influenced by hydrogen bonding between two antiparallel trinucleotides, namely, the mRNA codon and tRNA anticodon. We use the mean reaction field theories, which describe electrostatic and polarization interactions between solute and solvent in the AAA, UUU, AAG, and UUC triplex sequences optimized in various solvent media such as water, dimethylsulfoxide, methanol, ethanol, and cyclopean using the self-consistent reaction field model. This process depends on either the reaction potential function of the solvent or charge transfer operators that appear in solute-solvent interaction. Because of codon and anticodon biological criteria, we performed nonempirical quantum-mechanical calculations at the BLYP and B3LYP/3-21G, 6-31G, and 6-31G* levels of theory in the gas phase and five solvents at three temperatures. Finally, to obtain more information, we calculated thermochemical parameters to find that the dielectric constant of solvents plays an important role in the displacement of amino acid sequences on codon-anticodon residues in proteins, which can cause some mutations in humans.

  20. Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

    PubMed Central

    Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

    2004-01-01

    To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

  1. High yield and ultrafast sources of electrically triggered entangled-photon pairs based on strain-tunable quantum dots.

    PubMed

    Zhang, Jiaxiang; Wildmann, Johannes S; Ding, Fei; Trotta, Rinaldo; Huo, Yongheng; Zallo, Eugenio; Huber, Daniel; Rastelli, Armando; Schmidt, Oliver G

    2015-12-01

    Triggered sources of entangled photon pairs are key components in most quantum communication protocols. For practical quantum applications, electrical triggering would allow the realization of compact and deterministic sources of entangled photons. Entangled-light-emitting-diodes based on semiconductor quantum dots are among the most promising sources that can potentially address this task. However, entangled-light-emitting-diodes are plagued by a source of randomness, which results in a very low probability of finding quantum dots with sufficiently small fine structure splitting for entangled-photon generation (∼10(-2)). Here we introduce strain-tunable entangled-light-emitting-diodes that exploit piezoelectric-induced strains to tune quantum dots for entangled-photon generation. We demonstrate that up to 30% of the quantum dots in strain-tunable entangled-light-emitting-diodes emit polarization-entangled photons. An entanglement fidelity as high as 0.83 is achieved with fast temporal post selection. Driven at high speed, that is 400 MHz, strain-tunable entangled-light-emitting-diodes emerge as promising devices for high data-rate quantum applications.

  2. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  3. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons.

    PubMed

    Lin, Jia-Hui; Tseng, Wei-Lung

    2014-03-21

    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  4. Investigation of base pairs containing oxidized guanine using ab initio method and ABEEMσπ polarizable force field.

    PubMed

    Liu, Cui; Wang, Yang; Zhao, Dongxia; Gong, Lidong; Yang, Zhongzhi

    2014-02-01

    The integrity of the genetic information is constantly threatened by oxidizing agents. Oxidized guanines have all been linked to different types of cancers. Theoretical approaches supplement the assorted experimental techniques, and bring new sight and opportunities to investigate the underlying microscopic mechanics. Unfortunately, there is no specific force field to DNA system including oxidized guanines. Taking high level ab initio calculations as benchmark, we developed the ABEEMσπ fluctuating charge force field, which uses multiple fluctuating charges per atom. And it was applied to study the energies, structures and mutations of base pairs containing oxidized guanines. The geometries were obtained in reference to other studies or using B3LYP/6-31+G* level optimization, which is more rational and timesaving among 24 quantum mechanical methods selected and tested by this work. The energies were determined at MP2/aug-cc-pVDZ level with BSSE corrections. Results show that the constructed potential function can accurately simulate the change of H-bond and the buckled angle formed by two base planes induced by oxidized guanine, and it provides reliable information of hydrogen bonding, stacking interaction and the mutation processes. The performance of ABEEMσπ polarizable force field in predicting the bond lengths, bond angles, dipole moments etc. is generally better than those of the common force fields. And the accuracy of ABEEMσπ PFF is close to that of the MP2 method. This shows that ABEEMσπ model is a reliable choice for further research of dynamics behavior of DNA fragment including oxidized guanine. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    PubMed

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  6. To pair or not to pair: chromosome pairing and evolution.

    PubMed

    Moore, G

    1998-04-01

    Chromosome pairing in wild-type wheat closely resembles the process in both yeast and Drosophila. The recent characterisation of a mutant Ph1 wheat and the observation that chromosome pairing in the absence of Ph1 more closely resembles that of mammals and maize has shed light on the evolution of chromosome pairing in the cereals.

  7. QM and QM/MM Studies on Excited-State Relaxation Mechanisms of Unnatural Bases in Vacuo and Base Pairs in DNA.

    PubMed

    Wang, Qian; Xie, Xiao-Ying; Han, Juan; Cui, Ganglong

    2017-11-22

    Semisynthetic alphabet can potentially increase the genetic information stored in DNA through the formation of unusual base pairs such as d5SICS:dNaM. However, recent experiments show that near-visible-light irradiation on the d5SICS and dNaM chromophores could lead to genetic mutations and damages. Until now, their photophysical mechanisms remain elusive. Herein, we have employed MS-CASPT2//CASSCF and QM(MS-CASPT2//CASSCF)/MM methods to explore the spectroscopic properties and excited-state relaxation mechanisms of d5SICS, dNaM, and d5SICS:dNaM in DNA. We have found that (1) the S 2 state of d5SICS, the S 1 state of dNaM, and the S 2 state of d5SICS:dNaM are initially populated upon near-visible-light irradiation and (2) for d5SICS and d5SICS:dNaM, there are several parallel relaxation pathways to populate the lowest triplet state, but for dNaM, a main relaxation pathway is uncovered. Moreover, we have found that the excited-state relaxation mechanism of d5SICS:dNaM in DNA is similar to that of the isolated d5SICS chromophore. These mechanistic insights contribute to the understanding of photophysics and photochemistry of unusual base pairs and to the design of better semisynthetic genetic alphabet.

  8. Prospective very young asteroid pairs

    NASA Astrophysics Data System (ADS)

    Galád, A.; Vokrouhlický, D.; Zizka, J.

    2014-07-01

    Several tens of asteroid pairs can be discerned from the background main-belt asteroids. The majority of them are thought to have formed within only the last few 10^6 yr. The youngest recognized pairs have formed more than ≈ 10 kyr ago. As some details of pair formation are still not understood well, the study of young pairs is of great importance. It is mainly because the conditions at the time of the pair formation could be deduced much more reliably for young pairs. For example, space weathering on the surfaces of the components, or changes in their rotational properties (in spin rates, tumbling, coordinates of rotational pole) could be negligible since the formation of young pairs. Also, possible strong perturbations by main-belt bodies on pair formation can be reliably studied only for extremely young pairs. Some pairs can quickly blend in with the background asteroids, so even the frequency of asteroid pair formation could be determined more reliably based on young pairs (though only after a statistically significant sample is at disposal). In our regular search for young pairs in the growing asteroid database, only multiopposition asteroids with very similar orbital and proper elements are investigated. Every pair component is represented by a number of clones within orbital uncertainties and drifting in semimajor axis due to the Yarkovsky effect. We found that, if the previously unrecognized pairs (87887) 2000 SS_{286} - 2002 AT_{49} and (355258) 2007 LY_{4} - 2013AF_{40} formed at the recent very close approach of their components, they could become the youngest known pairs. In both cases, the relative encounter velocities of the components were only ˜ 0.1 m s^{-1}. However, the minimum distances between some clones are too large and a few clones of the latter pair did not encounter recently (within ≈ 10 kyr). The age of some prospective young pairs cannot be determined reliably without improved orbital properties (e.g., the second component of a pair

  9. Error-correcting pairs for a public-key cryptosystem

    NASA Astrophysics Data System (ADS)

    Pellikaan, Ruud; Márquez-Corbella, Irene

    2017-06-01

    Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t-bounded decoding algorithms which is achieved in the case the code has a t-error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t-ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t-error correcting pair.

  10. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes

    NASA Astrophysics Data System (ADS)

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree kmax of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large kmax. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  11. Lumping of degree-based mean-field and pair-approximation equations for multistate contact processes.

    PubMed

    Kyriakopoulos, Charalampos; Grossmann, Gerrit; Wolf, Verena; Bortolussi, Luca

    2018-01-01

    Contact processes form a large and highly interesting class of dynamic processes on networks, including epidemic and information-spreading networks. While devising stochastic models of such processes is relatively easy, analyzing them is very challenging from a computational point of view, particularly for large networks appearing in real applications. One strategy to reduce the complexity of their analysis is to rely on approximations, often in terms of a set of differential equations capturing the evolution of a random node, distinguishing nodes with different topological contexts (i.e., different degrees of different neighborhoods), such as degree-based mean-field (DBMF), approximate-master-equation (AME), or pair-approximation (PA) approaches. The number of differential equations so obtained is typically proportional to the maximum degree k_{max} of the network, which is much smaller than the size of the master equation of the underlying stochastic model, yet numerically solving these equations can still be problematic for large k_{max}. In this paper, we consider AME and PA, extended to cope with multiple local states, and we provide an aggregation procedure that clusters together nodes having similar degrees, treating those in the same cluster as indistinguishable, thus reducing the number of equations while preserving an accurate description of global observables of interest. We also provide an automatic way to build such equations and to identify a small number of degree clusters that give accurate results. The method is tested on several case studies, where it shows a high level of compression and a reduction of computational time of several orders of magnitude for large networks, with minimal loss in accuracy.

  12. N-H stretching vibrations of guanosine-cytidine base pairs in solution: ultrafast dynamics, couplings, and line shapes.

    PubMed

    Fidder, Henk; Yang, Ming; Nibbering, Erik T J; Elsaesser, Thomas; Röttger, Katharina; Temps, Friedrich

    2013-02-07

    Dynamics and couplings of N-H stretching vibrations of chemically modified guanosine-cytidine (G·C) base pairs in chloroform are investigated with linear infrared spectroscopy and ultrafast two-dimensional infrared (2D-IR) spectroscopy. Comparison of G·C absorption spectra before and after H/D exchange reveals significant N-H stretching absorption in the region from 2500 up to 3300 cm(-1). Both of the local stretching modes ν(C)(NH(2))(b) of the hydrogen-bonded N-H moiety of the cytidine NH(2) group and ν(G)(NH) of the guanosine N-H group contribute to this broad absorption band. Its complex line shape is attributed to Fermi resonances of the N-H stretching modes with combination and overtones of fingerprint vibrations and anharmonic couplings to low-frequency modes. Cross-peaks in the nonlinear 2D spectra between the 3491 cm(-1) free N-H oscillator band and the bands centered at 3145 and 3303 cm(-1) imply N-H···O═C hydrogen bond character for both of these transitions. Time evolution illustrates that the 3303 cm(-1) band is composed of a nearly homogeneous band absorbing at 3301 cm(-1), ascribed to ν(G)(NH(2))(b), and a broad inhomogeneous band peaking at 3380 cm(-1) with mainly guanosine carbonyl overtone character. Kinetics and signal strengths indicate a <0.2 ps virtually complete population transfer from the excited ν(G)(NH(2))(b) mode to the ν(G)(NH) mode at 3145 cm(-1), suggesting lifetime broadening as the dominant source for the homogeneous line shape of the 3301 cm(-1) transition. For the 3145 cm(-1) band, a 0.3 ps population lifetime was obtained.

  13. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data

    PubMed Central

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A. C.; Ning, Zemin; Slagboom, P. Eline; Ye, Kai

    2012-01-01

    Motivation: RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon–exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. Results: We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ∼ 137 000 and 173 000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. Availability: The code and utilities can be freely downloaded from https://trac.nbic.nl/passion and ftp://ftp.sanger.ac.uk/pub/zn1/passion Contact: y.zhang@lumc.nl; k.ye@lumc.nl Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22219203

  14. Evaluating a team-based approach to research capacity building using a matched-pairs study design.

    PubMed

    Holden, Libby; Pager, Susan; Golenko, Xanthe; Ware, Robert S; Weare, Robyn

    2012-03-12

    There is a continuing need for research capacity building initiatives for primary health care professionals. Historically strategies have focused on interventions aimed at individuals but more recently theoretical frameworks have proposed team-based approaches. Few studies have evaluated these new approaches. This study aims to evaluate a team-based approach to research capacity building (RCB) in primary health using a validated quantitative measure of research capacity in individual, team and organisation domains. A non-randomised matched-pairs trial design was used to evaluate the impact of a multi-strategy research capacity building intervention. Four intervention teams recruited from one health service district were compared with four control teams from outside the district, matched on service role and approximate size. All were multi-disciplinary allied health teams with a primary health care role. Random-effects mixed models, adjusting for the potential clustering effect of teams, were used to determine the significance of changes in mean scores from pre- to post-intervention. Comparisons of intervention versus control groups were made for each of the three domains: individual, team and organisation. The Individual Domain measures the research skills of the individual, whereas Team and Organisation Domains measure the team/organisation's capacity to support and foster research, including research culture. In all three domains (individual, team and organisation) there were no occasions where improvements were significantly greater for the control group (comprising the four control teams, n = 32) compared to the intervention group (comprising the four intervention teams, n = 37) either in total domain score or domain item scores. However, the intervention group had a significantly greater improvement in adjusted scores for the Individual Domain total score and for six of the fifteen Individual Domain items, and to a lesser extent with Team and Organisation

  15. An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

    PubMed

    Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

    2011-03-07

    Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

  16. Role of 6-Mercaptopurine in the potential therapeutic targets DNA base pairs and G-quadruplex DNA: insights from quantum chemical and molecular dynamics simulations.

    PubMed

    Radhika, R; Shankar, R; Vijayakumar, S; Kolandaivel, P

    2018-05-01

    The theoretical studies on DNA with the anticancer drug 6-Mercaptopurine (6-MP) are investigated using theoretical methods to shed light on drug designing. Among the DNA base pairs considered, 6-MP is stacked with GC with the highest interaction energy of -46.19 kcal/mol. Structural parameters revealed that structure of the DNA base pairs is deviated from the planarity of the equilibrium position due to the formation of hydrogen bonds and stacking interactions with 6-MP. These deviations are verified through the systematic comparison between X-H bond contraction and elongation and the associated blue shift and red shift values by both NBO analysis and vibrational analysis. Bent's rule is verified for the C-H bond contraction in the 6-MP interacted base pairs. The AIM results disclose that the higher values of electron density (ρ) and Laplacian of electron density (∇ 2 ρ) indicate the increased overlap between the orbitals that represent the strong interaction and positive values of the total electron density show the closed-shell interaction. The relative sensitivity of the chemical shift values for the DNA base pairs with 6-MP is investigated to confirm the hydrogen bond strength. Molecular dynamics simulation studies of G-quadruplex DNA d(TGGGGT) 4 with 6-MP revealed that the incorporation of 6-MP appears to cause local distortions and destabilize the G-quadruplex DNA.

  17. Young Learners' Interactional Development in Task-Based Paired-Assessment in Their First and Foreign Languages: A Case of English Learners in China

    ERIC Educational Resources Information Center

    Butler, Yuko Goto; Zeng, Wei

    2015-01-01

    In response to the growing interest in evaluating young learners' foreign language (FL) performance, this study aims to deepen our understanding of young learners' developmental differences in interaction during task-based paired-language assessments. To examine age effects separately from the effect of general language proficiency, we analysed…

  18. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    PubMed

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    PubMed

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Complexes of DNA bases and Watson-Crick base pairs interaction with neutral silver Agn (n = 8, 10, 12) clusters: a DFT and TDDFT study.

    PubMed

    Srivastava, Ruby

    2018-03-01

    We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.

  1. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    PubMed Central

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  2. 3D-Subspace-Based Auto-Paired Azimuth Angle, Elevation Angle, and Range Estimation for 24G FMCW Radar with an L-Shaped Array

    PubMed Central

    Nam, HyungSoo; Choi, ByungGil; Oh, Daegun

    2018-01-01

    In this paper, a three-dimensional (3D)-subspace-based azimuth angle, elevation angle, and range estimation method with auto-pairing is proposed for frequency-modulated continuous waveform (FMCW) radar with an L-shaped array. The proposed method is designed to exploit the 3D shift-invariant structure of the stacked Hankel snapshot matrix for auto-paired azimuth angle, elevation angle, and range estimation. The effectiveness of the proposed method is verified through a variety of experiments conducted in a chamber. For the realization of the proposed method, K-band FMCW radar is implemented with an L-shaped antenna. PMID:29621193

  3. All-optical switching application based on optical nonlinearity of Yb(3+) doped aluminosilicate glass fiber with a long-period fiber gratings pair.

    PubMed

    Kim, Yune; Kim, Nam; Chung, Youngjoo; Paek, Un-Chul; Han, Won-Taek

    2004-02-23

    We propose a new fiber-type all-optical switching device based on the optical nonlinearity of Yb(3+) doped fiber and a long-period fiber gratings(LPG) pair. The all-optical ON-OFF switching with the continuous wave laser signal at ~1556nm in the LPG pair including the 25.5cm long Yb(3+) doped fiber was demonstrated up to ~200Hz upon pumping with the modulated square wave pulses at 976nm, where a full optical switching with the ~18dB extinction ratio was obtained at the launched pump power of ~35mW.

  4. A Selective Surface-Enhanced Raman Scattering Sensor for Mercury(II) Based on a Porous Polymer Material and the Target-Mediated Displacement of a T-Rich Strand

    NASA Astrophysics Data System (ADS)

    Kang, Y.; Zhang, L.; Zhang, H.; Wu, T.; Du, Y.

    2017-05-01

    A sensitive and selective surface-enhanced Raman scattering (SERS) sensor for mercury(II) was fabricated based on the target-mediated displacement of a T-rich oligonucleotide strand. A DNA/aptamer duplex was prepared by the hybridization between a tetramethylrhodamine(TMR)-labeled thymine(T)-rich Hg2+-specific aptamer (denoted as TMR-aptamer) and a thiolated adenine-rich capturing DNA. The duplex can be immobilized onto the SERS substrate of the Ag-moiety modified glycidyl methacrylate-ethylene dimethacrylate (denoted as Ag-GMA-EDMA) via self-assembly by the thiol anchor, in which the TMR-aptamer exists in a double-stranded chain. In this case, the label of the TMR moiety approaches the substrate surface and produces a strong SERS signal. Upon the addition of the target, a pair of TMR-aptamers could cooperatively coordinate with Hg2+ to form a stable duplex-like structure mediated by the T-Hg2+-T complex between two adjacent strands, which triggers the release of the TMR-aptamer from the SERS substrate surface, thus drawing the TMR tags away from the substrate with a significant decrease in the SERS signal. This optical sensor shows a sensitive response to Hg2+ in a concentration from 5 nM to 2.0 μM with a detection limit of 2.5 nM. The prepared sensor is negligibly responsive to other metal ions, can be easily regenerated, and shows good performance in real sample analysis.

  5. Pair-bonded humans conform to sexual stereotypes in web-based advertisements for extra-marital partners.

    PubMed

    Kelley, Trish C; Hare, James F

    2010-10-20

    Partners advertisements provide advertisers with access to a large pool of prospective mates, and have proven useful in documenting sex differences in human mating preferences. We coded data from an Internet site (AshleyMadison.com) catering to advertisers engaged in existing pair-bonded relationships. While we predicted that pair-bonding may liberate advertisers from conforming to sexual stereotypes of male promiscuity and female choosiness, our results are uniformly consistent with those stereotypes. Our findings thus provide further evidence that human mating behavior is highly constrained by fundamental biological differences between males and females.

  6. Epidemiological Characteristics of 2009 (H1N1) Pandemic Influenza Based on Paired Sera from a Longitudinal Community Cohort Study

    PubMed Central

    Riley, Steven; Kwok, Kin O.; Wu, Kendra M.; Ning, Danny Y.; Cowling, Benjamin J.; Wu, Joseph T.; Ho, Lai-Ming; Tsang, Thomas; Lo, Su-Vui; Chu, Daniel K. W.; Ma, Edward S. K.; Peiris, J. S. Malik

    2011-01-01

    Background While patterns of incidence of clinical influenza have been well described, much uncertainty remains over patterns of incidence of infection. The 2009 pandemic provided both the motivation and opportunity to investigate patterns of mild and asymptomatic infection using serological techniques. However, to date, only broad epidemiological patterns have been defined, based on largely cross-sectional study designs with convenience sampling frameworks. Methods and Findings We conducted a paired serological survey of a cohort of households in Hong Kong, recruited using random digit dialing, and gathered data on severe confirmed cases from the public hospital system (>90% inpatient days). Paired sera were obtained from 770 individuals, aged 3 to 103, along with detailed individual-level and household-level risk factors for infection. Also, we extrapolated beyond the period of our study using time series of severe cases and we simulated alternate study designs using epidemiological parameters obtained from our data. Rates of infection during the period of our study decreased substantially with age: for 3–19 years, the attack rate was 39% (31%–49%); 20–39 years, 8.9% (5.3%–14.7%); 40–59 years, 5.3% (3.5%–8.0%); and 60 years or older, 0.77% (0.18%–4.2%). We estimated parameters for a parsimonious model of infection in which a linear age term and the presence of a child in the household were used to predict the log odds of infection. Patterns of symptom reporting suggested that children experienced symptoms more often than adults. The overall rate of confirmed pandemic (H1N1) 2009 influenza (H1N1pdm) deaths was 7.6 (6.2–9.5) per 100,000 infections. However, there was substantial and progressive increase in deaths per 100,000 infections with increasing age from 0.66 (0.65–0.86) for 3–19 years up to 220 (50–4,000) for 60 years and older. Extrapolating beyond the period of our study using rates of severe disease, we estimated that 56% (43%–69

  7. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories

    NASA Astrophysics Data System (ADS)

    Guo, Yang; Becker, Ute; Neese, Frank

    2018-03-01

    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  8. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2′-deoxyadenosine:dT Base Pairing in DNA

    PubMed Central

    2011-01-01

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929

  9. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  10. Experimental study on melting and flowing behavior of thermoplastics combustion based on a new setup with a T-shape trough.

    PubMed

    Xie, Qiyuan; Zhang, Heping; Ye, Ruibo

    2009-07-30

    The objective of this work is to quantitatively study the burning characteristics of thermoplastics. A new experimental setup with a T-shape trough is designed. Based on this setup, the loop mechanism between the wall fire and pool fires induced by the melting and dripping of thermoplastic can be well simulated and studied. Additionally, the flowing characteristics of pool fires can also be quantitatively analyzed. Experiments are conducted for PP and PE sheets with different thicknesses. The maximum distances of the induced flowing pool flame in the T-shape trough are recorded and analyzed. The typical fire parameters, such as heat release rates (HRRs), CO concentrations are also monitored. The results show that the softening and clinging of the thermoplastic sheets plays a considerable role for their vertical wall burning. It is illustrated that the clinging of burning thermoplastic sheet may be mainly related with the softening temperatures and the ignition temperatures of the thermoplastics, as well as their viscosity coefficients. Through comparing the maximum distances of flowing flame of induced pool fires in the T-shape trough for thermoplastic sheets with different thicknesses, it is indicated that the pool fires induced by PE materials are easier to flow away than that of PP materials. Therefore, PE materials may be more dangerous for their faster pool fire spread on the floor. These experimental results preliminarily illustrate that this new experimental setup is helpful for quantitatively studying the special burning feature of thermoplastics although further modifications is needed for this setup in the future.

  11. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks

    PubMed Central

    2018-01-01

    Abstract Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element–target gene pairs (E–G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. PMID:29140525

  12. Enhancement of galaxy overdensity around quasar pairs at z < 3.6 based on the Hyper Suprime-Cam Subaru Strategic Program Survey

    NASA Astrophysics Data System (ADS)

    Onoue, Masafusa; Kashikawa, Nobunari; Uchiyama, Hisakazu; Akiyama, Masayuki; Harikane, Yuichi; Imanishi, Masatoshi; Komiyama, Yutaka; Matsuoka, Yoshiki; Nagao, Tohru; Nishizawa, Atsushi J.; Oguri, Masamune; Ouchi, Masami; Tanaka, Masayuki; Toba, Yoshiki; Toshikawa, Jun

    2018-01-01

    We investigate the galaxy overdensity around proto-cluster scale quasar pairs at high (z > 3) and low (z ˜ 1) redshift based on the unprecedentedly wide and deep optical survey of the Hyper Suprime-Cam Subaru Strategic Program (HSC-SSP). Using the first-year survey data covering effectively ˜121 deg2 with the 5σ depth of i ˜ 26.4 and the SDSS DR12Q catalog, we find two luminous pairs at z ˜ 3.3 and 3.6 which reside in >5σ overdensity regions of g-dropout galaxies at i < 25. The projected separations of the two pairs are R⊥ = 1.75 and 1.04 proper Mpc (pMpc), and their velocity offsets are ΔV = 692 and 1448 km s-1, respectively. This result is in clear contrast to the average z ˜ 4 quasar environments as discussed in Uchiyama et al. (2018, PASJ 70, S32) and implies that the quasar activities of the pair members are triggered via major mergers in proto-clusters, unlike the vast majority of isolated quasars in general fields that may turn on via non-merger events such as bar and disk instabilities. At z ˜ 1, we find 37 pairs with R⊥ < 2 pMpc and ΔV < 2300 km s-1 in the current HSC-Wide coverage, including four from Hennawi et al. (2006, AJ, 131, 1). The distribution of the peak overdensity significance within two arcminutes around the pairs has a long tail toward high-density (>4σ) regions. Thanks to the large sample size, we find statistical evidence that this excess is unique to the pair environments when compared to single-quasar and randomly selected galaxy environments at the same redshift range. Moreover, there are nine small-scale (R⊥ < 1 pMpc) pairs, two of which are found to reside in cluster fields. Our results demonstrate that <2 pMpc scale quasar pairs at both redshift ranges tend to occur in massive haloes, although perhaps not the most massive ones, and that they are useful in searching for rare density peaks.

  13. Formative Value of an Active Learning Strategy: Technology Based Think-Pair-Share in an EFL Writing Classroom

    ERIC Educational Resources Information Center

    Demirci, Cavide; Düzenli, Halil

    2017-01-01

    Think-Pair-Share (TPS) activities in classrooms provide an opportunity for students to revise, practice and reproduce previously learned knowledge. Teachers also benefit from this active learning strategy by exploiting new learning materials, saving time by minimizing presentations and using it as a formative assessment tool. This article explores…

  14. Absorption and fluorescence emission spectroscopic characters of naphtho-homologated yy-DNA bases and effect of methanol solution and base pairing.

    PubMed

    Zhang, Laibin; Li, Huifang; Li, Jilai; Chen, Xiaohua; Bu, Yuxiang

    2010-03-01

    A comprehensive theoretical study of electronic transitions of naphtho-homologated base analogs, namely, yy-T, yy-C, yy-A, and yy-G, was performed. The nature of the low-lying excited states is discussed, and the results are compared with those from experiment and also with those of y-bases. Geometrical characteristics of the lowest excited singlet pipi* and npi* states were explored using the CIS method, and the effects of methanol solution and paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were examined. The calculated excitation and emission energies agree well with the measured data, where experimental results are available. In methanol solution, the fluorescence from yy-A and yy-G would be expected to occur around 539 and 562 nm, respectively, suggesting that yy-A is a green-colored fluorophore, whereas yy-G is a yellow-colored fluorophore. The methanol solution was found to red-shift both the absorption and emission maxima of yy-A, yy-T, and yy-C, but blue-shift those for yy-G. Generally, though base pairing has no significant effects on the absorption and fluorescence maxima of yy-A, yy-C, and yy-T, it blue-shifts those for yy-G. (c) 2009 Wiley Periodicals, Inc.

  15. Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

    PubMed Central

    Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

    2002-01-01

    An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

  16. [Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

    PubMed

    Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

    2017-08-01

    To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

  17. Effect of BrU on the transition between wobble Gua-Thy and tautomeric Gua-Thy base-pairs: ab initio molecular orbital calculations

    NASA Astrophysics Data System (ADS)

    Nomura, Kazuya; Hoshino, Ryota; Hoshiba, Yasuhiro; Danilov, Victor I.; Kurita, Noriyuki

    2013-04-01

    We investigated transition states (TS) between wobble Guanine-Thymine (wG-T) and tautomeric G-T base-pair as well as Br-containing base-pairs by MP2 and density functional theory (DFT) calculations. The obtained TS between wG-T and G*-T (asterisk is an enol-form of base) is different from TS got by the previous DFT calculation. The activation energy (17.9 kcal/mol) evaluated by our calculation is significantly smaller than that (39.21 kcal/mol) obtained by the previous calculation, indicating that our TS is more preferable. In contrast, the obtained TS and activation energy between wG-T and G-T* are similar to those obtained by the previous DFT calculation. We furthermore found that the activation energy between wG-BrU and tautomeric G-BrU is smaller than that between wG-T and tautomeric G-T. This result elucidates that the replacement of CH3 group of T by Br increases the probability of the transition reaction producing the enol-form G* and T* bases. Because G* prefers to bind to T rather than to C, and T* to G not A, our calculated results reveal that the spontaneous mutation from C to T or from A to G base is accelerated by the introduction of wG-BrU base-pair.

  18. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  19. The physico-chemical "anatomy" of the tautomerization through the DPT of the biologically important pairs of hypoxanthine with DNA bases: QM and QTAIM perspectives.

    PubMed

    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M

    2013-10-01

    The biologically important tautomerization of the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs to the Hyp·Cyt, Hyp·Thy and Hyp·Hyp base pairs, respectively, by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ε = 4) corresponding to hydrophobic interfaces of protein-nucleic acid interactions by combining theoretical investigations at the B3LYP/6-311++G(d,p) level of QM theory with QTAIM topological analysis. Based on the sweeps of the energetic, electron-topological, geometric and polar parameters, which describe the course of the tautomerization along the intrinsic reaction coordinate (IRC), it was proved that the tautomerization through the DPT is concerted and asynchronous process for the Hyp·Cyt and Hyp·Thy base pairs, while concerted and synchronous for the Hyp·Hyp homodimer. The continuum with ε = 4 does not affect qualitatively the course of the tautomerization reaction for all studied complexes. The nine key points along the IRC of the Hyp·Cyt↔Hyp·Cyt and Hyp·Thy↔Hyp·Thy tautomerizations and the six key points of the Hyp·Hyp↔Hyp·Hyp tautomerization have been identified and fully characterized. These key points could be considered as electron-topological "fingerprints" of concerted asynchronous (for Hyp·Cyt and Hyp·Thy) or synchronous (for Hyp·Hyp) tautomerization process via the DPT. It was found, that in the Hyp·Cyt, Hyp·Thy, Hyp·Hyp and Hyp·Hyp base pairs all H-bonds are significantly cooperative and mutually reinforce each other, while the C2H…O2 H-bond in the Hyp·Cyt base pair and the O6H…O4 H-bond in the Hyp·Thy base pair behave anti-cooperatively, i.e., they become weakened, while two others become strengthened.

  20. A homonuclear spin-pair filter for solid-state NMR based on adiabatic-passage techniques

    NASA Astrophysics Data System (ADS)

    Verel, René; Baldus, Marc; Ernst, Matthias; Meier, Beat H.

    1998-05-01

    A filtering scheme for the selection of spin pairs (and larger spin clusters) under fast magic-angle spinning is proposed. The scheme exploits the avoided level crossing in spin pairs during an adiabatic amplitude sweep through the so-called HORROR recoupling condition. The advantages over presently used double-quantum filters are twofold. (i) The maximum theoretical filter efficiency is, due to the adiabatic variation, 100% instead of 73% as for transient methods. (ii) Since the filter does not rely on the phase-cycling properties of the double-quantum coherence, there is no need to obtain the full double-quantum intensity for all spins in the sample at one single point in time. The only important requirement is that all coupled spins pass through a two-spin state during the amplitude sweep. This makes the pulse scheme robust with respect to rf-amplitude missetting, rf-field inhomogeneity and chemical-shift offset.

  1. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed

    Nonin, S; Leroy, J L; Gueron, M

    1996-02-15

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine.

  2. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    SciTech Connect

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  3. Predicting Bond Dissociation Energies of Transition-Metal Compounds by Multiconfiguration Pair-Density Functional Theory and Second-Order Perturbation Theory Based on Correlated Participating Orbitals and Separated Pairs.

    PubMed

    Bao, Junwei Lucas; Odoh, Samuel O; Gagliardi, Laura; Truhlar, Donald G

    2017-02-14

    We study the performance of multiconfiguration pair-density functional theory (MC-PDFT) and multireference perturbation theory for the computation of the bond dissociation energies in 12 transition-metal-containing diatomic molecules and three small transition-metal-containing polyatomic molecules and in two transition-metal dimers. The first step is a multiconfiguration self-consistent-field calculation, for which two choices must be made: (i) the active space and (ii) its partition into subspaces, if the generalized active space formulation is used. In the present work, the active space is chosen systematically by using three correlated-participating-orbitals (CPO) schemes, and the partition is chosen by using the separated-pair (SP) approximation. Our calculations show that MC-PDFT generally has similar accuracy to CASPT2, and the active-space dependence of MC-PDFT is not very great for transition-metal-ligand bond dissociation energies. We also find that the SP approximation works very well, and in particular SP with the fully translated BLYP functional SP-ftBLYP is more accurate than CASPT2. SP greatly reduces the number of configuration state functions relative to CASSCF. For the cases of FeO and NiO with extended-CPO active space, for which complete active space calculations are unaffordable, SP calculations are not only affordable but also of satisfactory accuracy. All of the MC-PDFT results are significantly better than the corresponding results with broken-symmetry spin-unrestricted Kohn-Sham density functional theory. Finally we test a perturbation theory method based on the SP reference and find that it performs slightly worse than CASPT2 calculations, and for most cases of the nominal-CPO active space, the approximate SP perturbation theory calculations are less accurate than the much less expensive SP-PDFT calculations.

  4. Transdermal penetration of vasoconstrictors--present understanding and assessment of the human epidermal flux and retention of free bases and ion-pairs.

    PubMed

    Cross, Sheree E; Thompson, Melanie J; Roberts, Michael S

    2003-02-01

    As reductions in dermal clearance increase the residence time of solutes in the skin and underlying tissues we compared the topical penetration of potentially useful vasoconstrictors (VCs) through human epidermis as both free bases and ion-pairs with salicylic acid (SA). We determined the in vitro epidermal flux of ephedrine, naphazoline, oxymetazoline, phenylephrine, and xylometazoline applied as saturated solutions in propylene glycol:water (1:1) and of ephedrine, naphazoline and tetrahydrozoline as 10% solutions of 1:1 molar ratio ion-pairs with SA in liquid paraffin. As free bases, ephedrine had the highest maximal flux, Jmax = 77.4 +/- 11.7 microg/cm2/h, being 4-fold higher than tetrahydrozoline and xylometazoline, 6-fold higher than phenylephrine, 10-fold higher than naphazoline and 100-fold higher than oxymetazoline. Stepwise regression of solute physicochemical properties identified melting point as the most significant predictor of flux. As ion-pairs with SA, ephedrine and naphazoline had similar fluxes (11.5 +/- 2.3 and 12.0 +/- 1.6 microg/cm2/h respectively), whereas tetrahydrozoline was approximately 3-fold slower. Corresponding fluxes of SA from the ion-pairs were 18.6 +/- 0.6, 7.8+/- 0.8 and 1.1 +/- 0.1 respectively. Transdermal transport of VC's is discussed. Epidermal retention of VCs and SA did not correspond to their molar ratio on application and confirmed that following partitioning into the stratum corneum, ion-pairs separate and further penetration is governed by individual solute characteristics.

  5. Combinatorial interactions of two amino acids with a single base pair define target site specificity in plant dimeric homeodomain proteins

    PubMed Central

    Tron, Adriana E.; Bertoncini, Carlos W.; Palena, Claudia M.; Chan, Raquel L.; Gonzalez, Daniel H.

    2001-01-01

    Four groups of plant homeodomain proteins contain a dimerization motif closely linked to the homeodomain. We here show that two sunflower homeodomain proteins, Hahb-4 and HAHR1, which belong to the Hd-Zip I and GL2/Hd-Zip IV groups, respectively, show different binding preferences at a defined position of a pseudopalindromic DNA-binding site used as a target. HAHR1 shows a preference for the sequence 5′-CATT(A/T)AATG-3′, rather than 5′-CAAT(A/T)ATTG-3′, recognized by Hahb-4. To analyze the molecular basis of this behavior, we have constructed a set of mutants with exchanged residues (Phe→Ile and Ile→Phe) at position 47 of the homeodomain, together with chimeric proteins between HAHR1 and Hahb-4. The results obtained indicate that Phe47, but not Ile47, allows binding to 5′-CATT(A/T)AATG-3′. However, the preference for this sequence is determined, in addition, by amino acids located C-terminal to residue 53 of the HAHR1 homeodomain. A double mutant of Hahb-4 (Ile47→Phe/Ala54→Thr) shows the same binding behavior as HAHR1, suggesting that combinatorial interactions of amino acid residues at positions 47 and 54 of the homeodomain are involved in establishing the affinity and selectivity of plant dimeric homeodomain proteins with different DNA target sequences. PMID:11726696

  6. [Pharmacokinetic research strategies of compatibilities and synergistic effects of classical Danshen herb pairs based on pharmacokinetics of "Danshen-Bingpian" and "Danshen-Honghua"].

    PubMed

    Zhang, Cui-Ying; Ren, Wei-Guang

    2017-06-01

    Herb pairs are usual clinical compatibility forms and one of compound prescription sources in Chinese medicine. Pharmacokinetic research in vivo is one of the important items in elucidating the mechanism for synergistic and attenuated mechanisms of herb pairs. The paper comprehensively summarized and systemized the pharmacokinetic researches of marker-ingredients about Danshen-Honghua and Danshen-Bingpian in order to elucidate the rationality and scientificity of herb pairs and provide some feasible suggestions on the pharmacokinetics of drugs in the future. In view of complicated system of Traditional Chinese medicines and a chemical system that is not separated from its natural state, comparative pharmacokinetic researches on marker-ingredients from the herb pairs are reasonable to elucidate the synergistic and attenuated mechanisms of monarch-subjects compatible herbs and monarch-guide compatible herbs. Such pharmacokinetic research can better explain the mechanism of drug compatibility, while the pharmacokinetic researches based on the monomer chemical compositions and marker-ingredients that have been separated from complex chemical environment of traditional Chinese Medicine are still unreasonable and should be discussed deeply. Copyright© by the Chinese Pharmaceutical Association.

  7. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    PubMed

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  8. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    PubMed

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Functional base-pairing interaction between highly conserved elements of U3 small nucleolar RNA and the small ribosomal subunit RNA.

    PubMed

    Hughes, J M

    1996-06-21

    The U3 nucleolar RNA has a remarkably wide phyletic distribution extending from the Eukarya to the Archaea. It functions in maturation of the small subunit (SSU) rRNA through a mechanism which is as yet unknown but which involves base-pairing with pre-rRNA. The most conserved part of U3 is within 30 nucleotides of the 5' end, but as yet no function for this domain has been proposed. Elements within this domain are complementary to highly conserved sequences in the SSU rRNA which, in the mature form, fold into a universally conserved pseudoknot. The nature of the complementarity suggests a novel mechanism for U3 function whereby U3 facilitates correct folding of the pseudoknot. Wide phylogenetic comparison provides compelling evidence in support of the interaction in that significant complementary changes have taken place, particularly in the archaeon Sulfolobus, which maintain the base-pairing. Base-substitution mutations in yeast U3 designed to disrupt the base-pairing indicate that the interaction is probably essential. These include cold-sensitivity mutations which exhibit phenotypes similar to U3-depletion, but without impairment of the AO processing step, which occurs within the 5' ETS. These phenotypes are consistent with the destabilization of SSU precursors and partial impairment of the processing steps A1, at the 5' ETS/18 S boundary, and A2, within the ITS1.

  10. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    PubMed Central

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  11. Inherited Creutzfeldt-Jakob disease in a British family associated with a novel 144 base pair insertion of the prion protein gene.

    PubMed Central

    Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G

    1995-01-01

    A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070

  12. A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

    PubMed

    Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

    2015-03-28

    A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

  13. A 'bottom up', ab initio computational approach to understanding fundamental photophysical processes in nitrogen containing heterocycles, DNA bases and base pairs.

    PubMed

    Marchetti, Barbara; Karsili, Tolga N V; Ashfold, Michael N R; Domcke, Wolfgang

    2016-07-27

    The availability of non-radiative decay mechanisms by which photoexcited molecules can revert to their ground electronic state, without experiencing potentially deleterious chemical transformation, is fundamental to molecular photostability. This Perspective Article combines results of new ab initio electronic structure calculations and prior experimental data in an effort to systematise trends in the non-radiative decay following UV excitation of selected families of heterocyclic molecules. We start with the prototypical uni- and bicyclic molecules phenol and indole, and explore the structural and photophysical consequences of incorporating progressively more nitrogen atoms within the respective ring structures en route to the DNA bases thymine, cytosine, adenine and guanine. For each of the latter, we identify low energy non-radiative decay pathways via conical intersections with the ground state potential energy surface accessed by out-of-plane ring deformations. This is followed by summary descriptions and illustrations of selected rival (electron driven H atom transfer) non-radiative excited state decay processes that demand consideration once the nucleobases are merely components in larger biomolecular systems like nucleosides, and both individual and stacked base-pairs.

  14. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    PubMed

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  15. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  16. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    PubMed

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  17. Evaluation of Project P.A.T.H.S. (Secondary 1 Program) by the Program Participants: Findings Based on the Full Implementation Phase

    ERIC Educational Resources Information Center

    Shek, Daniel T. L.; Sun, Rachel C. F.

    2008-01-01

    A total of 207 schools (N = 33,693 students) participated in the Secondary 1 Program of Project P.A.T.H.S. in the Full Implementation Phase (2006-07). Participants responded to a Subjective Outcome Evaluation Form (Form A) to assess their views of the program, instructors, and perceived effectiveness after program completion. Utilizing the…

  18. Frequency band adjustment match filtering based on variable frequency GPR antennas pairing scheme for shallow subsurface investigations

    NASA Astrophysics Data System (ADS)

    Shaikh, Shahid Ali; Tian, Gang; Shi, Zhanjie; Zhao, Wenke; Junejo, S. A.

    2018-02-01

    Ground penetrating Radar (GPR) is an efficient tool for subsurface geophysical investigations, particularly at shallow depths. The non-destructiveness, cost efficiency, and data reliability are the important factors that make it an ideal tool for the shallow subsurface investigations. Present study encompasses; variations in central frequency of transmitting and receiving GPR antennas (Tx-Rx) have been analyzed and frequency band adjustment match filters are fabricated and tested accordingly. Normally, the frequency of both the antennas remains similar to each other whereas in this study we have experimentally changed the frequencies of Tx-Rx and deduce the response. Instead of normally adopted three pairs, a total of nine Tx-Rx pairs were made from 50 MHz, 100 MHz, and 200 MHz antennas. The experimental data was acquired at the designated near surface geophysics test site of the Zhejiang University, Hangzhou, China. After the impulse response analysis of acquired data through conventional as well as varied Tx-Rx pairs, different swap effects were observed. The frequency band and exploration depth are influenced by transmitting frequencies rather than the receiving frequencies. The impact of receiving frequencies was noticed on the resolution; the more noises were observed using the combination of high frequency transmitting with respect to low frequency receiving. On the basis of above said variable results we have fabricated two frequency band adjustment match filters, the constant frequency transmitting (CFT) and the variable frequency transmitting (VFT) frequency band adjustment match filters. By the principle, the lower and higher frequency components were matched and then incorporated with intermediate one. Therefore, this study reveals that a Tx-Rx combination of low frequency transmitting with high frequency receiving is a better choice. Moreover, both the filters provide better radargram than raw one, the result of VFT frequency band adjustment filter is

  19. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    PubMed

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  20. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    PubMed

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  1. Tautomeric selectivity of the excited-state lifetime of guanine/cytosine base pairs: The role of electron-driven proton-transfer processes

    PubMed Central

    Sobolewski, Andrzej L.; Domcke, Wolfgang; Hättig, C.

    2005-01-01

    The UV spectra of three different conformers of the guanine/cytosine base pair were recorded recently with UV-IR double-resonance techniques in a supersonic jet [Abo-Riziq, A., Grace, L., Nir, E., Kabelac, M., Hobza, P. & de Vries, M. S. (2005) Proc. Natl. Acad. Sci. USA 102, 20–23]. The spectra provide evidence for a very efficient excited-state deactivation mechanism that is specific for the Watson–Crick structure and may be essential for the photostability of DNA. Here we report results of ab initio electronic-structure calculations for the excited electronic states of the three lowest-energy conformers of the guanine/cytosine base pair. The calculations reveal that electron-driven interbase proton-transfer processes play an important role in the photochemistry of these systems. The exceptionally short lifetime of the UV-absorbing states of the Watson–Crick conformer is tentatively explained by the existence of a barrierless reaction path that connects the spectroscopic 1π π * excited state with the electronic ground state via two electronic curve crossings. For the non-Watson–Crick structures, the photochemically reactive state is located at higher energies, resulting in a barrier for proton transfer and, thus, a longer lifetime of the UV-absorbing 1π π * state. The computational results support the conjecture that the photochemistry of hydrogen bonds plays a decisive role for the photostability of the molecular encoding of the genetic information in isolated DNA base pairs. PMID:16330778

  2. The integrity of the G2421-C2395 base pair in the ribosomal E-site is crucial for protein synthesis

    PubMed Central

    Koch, Miriam; Clementi, Nina; Rusca, Nicola; Vögele, Paul; Erlacher, Matthias; Polacek, Norbert

    2015-01-01

    During the elongation cycle of protein biosynthesis, tRNAs traverse through the ribosome by consecutive binding to the 3 ribosomal binding sites (A-, P-, and E- sites). While the ribosomal A- and P-sites have been functionally well characterized in the past, the contribution of the E-site to protein biosynthesis is still poorly understood in molecular terms. Previous studies suggested an important functional interaction of the terminal residue A76 of E-tRNA with the nucleobase of the universally conserved 23S rRNA residue C2394. Using an atomic mutagenesis approach to introduce non-natural nucleoside analogs into the 23S rRNA, we could show that removal of the nucleobase or the ribose 2'-OH at C2394 had no effect on protein synthesis. On the other hand, our data disclose the importance of the highly conserved E-site base pair G2421-C2395 for effective translation. Ribosomes with a disrupted G2421-C2395 base pair are defective in tRNA binding to the E-site. This results in an impaired translation of genuine mRNAs, while homo-polymeric templates are not affected. Cumulatively our data emphasize the importance of E-site tRNA occupancy and in particular the intactness of the 23S rRNA base pair G2421-C2395 for productive protein biosynthesis. PMID:25826414

  3. Combining Voxel-based Lesion-symptom Mapping (VLSM) With A-tDCS Language Treatment: Predicting Outcome of Recovery in Nonfluent Chronic Aphasia.

    PubMed

    Campana, Serena; Caltagirone, Carlo; Marangolo, Paola

    2015-01-01

    Most of transcranial direct current stimulation (tDCS) studies in aphasia have already shown that significant changes in language performance could be improved by increased monitoring of the perilesional cortex in the left lesioned hemisphere with excitatory anodal tDCS (A-tDCS). However, no report to date has investigated which areas may be less predictable or may play a major role in the recovery from language impairment after brain stimulation. We investigated the relationship between the localization of damage in the left hemisphere and the amount of language recovery after A-tDCS. We conducted a Voxel-lesion mapping-symptom (VLSM) analysis on twenty non-fluent aphasics who underwent a language treatment in concomitance with left A-tDCS delivered over the left inferior frontal gyrus (IFG) and a sham condition. Significant changes in language performance before and after the two conditions were examined in three language tasks (picture description, noun and verb naming). VLSM analysis revealed that damage to distinct left hemispheric structures and, in particular, to the basal ganglia, the insula and the superior and inferior longitudinal fasciculi, resulted in lower responses to A-tDCS in all language measures. Beneficial effects after A-tDCS over the left IFG depend on the anatomical integrity of different left subcortical structures among which are the white matter language pathways. Future studies combining different approaches on larger samples of subjects will further elucidate our understanding of how the human brain responds to tDCS. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Pathway-GPS and SIGORA: identifying relevant pathways based on the over-representation of their gene-pair signatures

    PubMed Central

    Foroushani, Amir B.K.; Brinkman, Fiona S.L.

    2013-01-01

    Motivation. Predominant pathway analysis approaches treat pathways as collections of individual genes and consider all pathway members as equally informative. As a result, at times spurious and misleading pathways are inappropriately identified as statistically significant, solely due to components that they share with the more relevant pathways. Results. We introduce the concept of Pathway Gene-Pair Signatures (Pathway-GPS) as pairs of genes that, as a combination, are specific to a single pathway. We devised and implemented a novel approach to pathway analysis, Signature Over-representation Analysis (SIGORA), which focuses on the statistically significant enrichment of Pathway-GPS in a user-specified gene list of interest. In a comparative evaluation of several published datasets, SIGORA outperformed traditional methods by delivering biologically more plausible and relevant results. Availability. An efficient implementation of SIGORA, as an R package with precompiled GPS data for several human and mouse pathway repositories is available for download from http://sigora.googlecode.com/svn/. PMID:24432194

  5. A pair of novel Cd(II) enantiomers based on lactate derivatives: Synthesis, crystal structures and properties

    SciTech Connect

    Xu, Zhong-Xuan, E-mail: xuzhongxuan1974@163.com; State Key Laboratory of Structural Chemistry, Fujian Institute of Research on the Structure of Matter, the Chinese Academy of Sciences, Fuzhou, Fujian 350002; Ao, Ke-Hou

    A pair of novel 3D homochiral metal−organic frameworks (HMOFs), namely [Cd{sub 2.5}((R)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-D), [Cd{sub 2.5}((S)-CIA){sub 6}(1,4-DIB)(H{sub 2}O){sub 2}]·((CH{sub 3}){sub 2}NH{sub 2})·H{sub 2}O (1-L), have been synthesized using lactic acid derivative ligands ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB. Crystallographic analyses indicate that the complexes 1-D and 1-L are packed by cage substructures. Some physical characteristics, such as solid-state circular dichroism (CD), thermal stabilities and photoluminescent properties are also investigated. Our results highlight the effective method to apply lactic acid derivative ligands to form interesting HMOFs. - Graphical abstract: Using lactic acid derivative ligandsmore » ((R)-H{sub 3}CIA and (S)-H{sub 3}CIA) and 1,4-DIB to assemble with Cd{sup 2+} ions, a pair of novel 3D homochiral metal-organic frameworks (HMOFs) with cage substructures have been synthesized. Display Omitted - Highlights: • Lactic acid derivative ligands • Cage substructure • Enantiomers.« less

  6. rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

    PubMed

    Guo, Liyuan; Wang, Jing

    2018-01-04

    Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Altering the Electrostatic Potential in the Major Groove: Thermodynamic and Structural Characterization of 7-Deaza-2;#8242;-deoxyadenosine:dT Base Pairing in DNA

    SciTech Connect

    Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.

    As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less

  8. Merging Problem-Based Learning with Simulation-Based Learning in the Medical Undergraduate Curriculum: The PAIRED Framework for Enhancing Lifelong Learning

    PubMed Central

    Koh, Jansen

    2016-01-01

    Lifelong learning is an essential trait that is expected of every physician. The CanMeds 2005 Physician Competency Framework emphasizes lifelong learning as a key competency that physicians must achieve in becoming better physicians. However, many physicians are not competent at engaging in lifelong learning. The current medical education system is deficient in preparing medical students to develop and carry out their own lifelong learning curriculum upon graduation. Despite understanding how physicians learn at work, medical students are not trained to learn while working. Similarly, although barriers to lifelong learning are known, medical students are not adequately skilled in overcoming these barriers. Learning to learn is just as important, if not more, as acquiring the skills and knowledge required of a physician. The medical undergraduate curriculum lacks a specific learning strategy to prepare medical students in becoming an adept lifelong learner. In this article, we propose a learning strategy for lifelong learning at the undergraduate level. In developing this novel strategy, we paid particular attention to two parameters. First, this strategy should be grounded on literature describing a physician’s lifelong learning process. Second, the framework for implementing this strategy must be based on existing undergraduate learning strategies to obviate the need for additional resources, learner burden, and faculty time. In this paper, we propose a Problem, Analysis, Independent Research Reporting, Experimentation Debriefing (PAIRED) framework that follows the learning process of a physician and serves to synergize the components of problem-based learning and simulation-based learning in specifically targeting the barriers to lifelong learning. PMID:27446767

  9. Anomalous scaling of Δ C versus T c in the Fe-based superconductors: the $${S}_{\\pm }$$-wave pairing state model

    DOE PAGES

    Bang, Yunkyu; Stewart, G. R.

    2016-02-01

    The strong power law behavior of the specific heat jumpmore » $${\\rm{\\Delta }}C\\;$$ versus T c $$({\\rm{\\Delta }}C/{T}_{{\\rm{c}}}\\sim {T}_{{\\rm{c}}}^{\\alpha },\\alpha \\approx 2)$$, first observed by Bud'ko et al (2009 Phys. Rev. B 79 220516), has been confirmed with several families of the Fe-based superconducting compounds with various dopings. We tested a minimal two band BCS model to understand this anomalous behavior and showed that this non-BCS relation between $${\\rm{\\Delta }}C\\;$$ versus T c is a generic property of the multiband superconducting state paired by a dominant interband interaction ($${V}_{\\mathrm{inter}}\\gt {V}_{\\mathrm{intra}}$$) reflecting the relation $$\\frac{{{\\rm{\\Delta }}}_{{\\rm{h}}}}{{{\\rm{\\Delta }}}_{{\\rm{e}}}}\\sim \\sqrt{\\frac{{N}_{{\\rm{e}}}}{{N}_{{\\rm{h}}}}}$$ near T c, as in the $${S}_{\\pm }$$-wave pairing state. We also found that this $${\\rm{\\Delta }}C\\;$$ versus T c power law can continuously change from the ideal BNC scaling to a considerable deviation by a moderate variation of the impurity scattering rate $${{\\rm{\\Gamma }}}_{0}$$ (non-pair-breaking). Finally, as a result, our model provides a consistent explanation why the electron-doped Fe-based superconductors follow the ideal BNC scaling very well while the hole-doped systems often show varying degree of deviations.« less

  10. Exactly solvable model of transitional nuclei based on dual algebraic structure for the three level pairing model in the framework of sdg interacting boson model

    NASA Astrophysics Data System (ADS)

    Jafarizadeh, M. A.; Ranjbar, Z.; Fouladi, N.; Ghapanvari, M.

    2018-01-01

    In this paper, a successful algebraic method based on the dual algebraic structure for three level pairing model in the framework of sdg IBM is proposed for transitional nuclei which show transitional behavior from spherical to gamma-unstable quantum shape phase transition. In this method complicated sdg Hamiltonian, which is a three level pairing Hamiltonian is determined easily via the exactly solvable method. This description provides a better interpretation of some observables such as BE (4) in nuclei which exhibits the necessity of inclusion of g boson in the sd IBM, while BE (4) cannot be explained in the sd boson model. Some observables such as Energy levels, BE (2), BE (4), the two neutron separation energies signature splitting of the γ-vibrational band and expectation values of the g-boson number operator are calculated and examined for 46 104 - 110Pd isotopes.

  11. Ross filter pairs for metal artefact reduction in x-ray tomography: a case study based on imaging and segmentation of metallic implants

    NASA Astrophysics Data System (ADS)

    Arhatari, Benedicta D.; Abbey, Brian

    2018-01-01

    Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.

  12. Implementation of the Secondary 3 Program of Project P.A.T.H.S.: observations based on the co-walker scheme.

    PubMed

    Shek, Daniel T L; Ma, Cecilia M S

    2012-01-17

    The present study was conducted to explore the implementation quality of the Secondary 3 Program of the Tier 1 Program of Project P.A.T.H.S. (Positive Adolescent Training through Holistic Social Programmes) in the third year of the Full Implementation Phase. Classroom observations of 182 units in 129 schools were conducted. Results showed that the overall level of program adherence was 73.9%. Thirteen aspects concerning program delivery were significantly correlated. Multiple regression analyses revealed that overall implementation quality was significantly predicted by student participation and involvement, strategies to enhance student motivation, use of positive and supportive feedback, degree of achievement of the objectives, and lesson preparation. Success of implementation was significantly predicted by student participation and involvement, classroom control, use of positive and supportive feedback, opportunity for reflection, degree of achievement of the objectives and time management. The present findings generally suggest that the implementation quality of Project P.A.T.H.S. was high.

  13. Pair-Wise, Deformable Mirror, Image Plane-Based Diversity Electric Field Estimation for High Contrast Coronagraphy

    NASA Technical Reports Server (NTRS)

    Give'on, Amir; Kern, Brian D.; Shaklan, Stuart

    2011-01-01

    In this paper we describe the complex electric field reconstruction from image plane intensity measurements for high contrast coronagraphic imaging. A deformable mirror (DM) surface is modied with pairs of complementary shapes to create diversity in the image plane of the science camera where the intensity of the light is measured. Along with the Electric Field Conjugation correction algorithm, this estimation method has been used in various high contrast imaging testbeds to achieve the best contrasts to date both in narrow and in broad band light. We present the basic methodology of estimation in easy to follow list of steps, present results from HCIT and raise several open quations we are confronted with using this method.

  14. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)].

    PubMed

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-07

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T 0 ) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T 0 ) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T 0 ) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T 0 ) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T 0 ) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T 0 ) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T 0 ), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  15. Communication: An improved linear scaling perturbative triples correction for the domain based local pair-natural orbital based singles and doubles coupled cluster method [DLPNO-CCSD(T)

    NASA Astrophysics Data System (ADS)

    Guo, Yang; Riplinger, Christoph; Becker, Ute; Liakos, Dimitrios G.; Minenkov, Yury; Cavallo, Luigi; Neese, Frank

    2018-01-01

    In this communication, an improved perturbative triples correction (T) algorithm for domain based local pair-natural orbital singles and doubles coupled cluster (DLPNO-CCSD) theory is reported. In our previous implementation, the semi-canonical approximation was used and linear scaling was achieved for both the DLPNO-CCSD and (T) parts of the calculation. In this work, we refer to this previous method as DLPNO-CCSD(T0) to emphasize the semi-canonical approximation. It is well-established that the DLPNO-CCSD method can predict very accurate absolute and relative energies with respect to the parent canonical CCSD method. However, the (T0) approximation may introduce significant errors in absolute energies as the triples correction grows up in magnitude. In the majority of cases, the relative energies from (T0) are as accurate as the canonical (T) results of themselves. Unfortunately, in rare cases and in particular for small gap systems, the (T0) approximation breaks down and relative energies show large deviations from the parent canonical CCSD(T) results. To address this problem, an iterative (T) algorithm based on the previous DLPNO-CCSD(T0) algorithm has been implemented [abbreviated here as DLPNO-CCSD(T)]. Using triples natural orbitals to represent the virtual spaces for triples amplitudes, storage bottlenecks are avoided. Various carefully designed approximations ease the computational burden such that overall, the increase in the DLPNO-(T) calculation time over DLPNO-(T0) only amounts to a factor of about two (depending on the basis set). Benchmark calculations for the GMTKN30 database show that compared to DLPNO-CCSD(T0), the errors in absolute energies are greatly reduced and relative energies are moderately improved. The particularly problematic case of cumulene chains of increasing lengths is also successfully addressed by DLPNO-CCSD(T).

  16. Support Vector Machine-based classification of protein folds using the structural properties of amino acid residues and amino acid residue pairs.

    PubMed

    Shamim, Mohammad Tabrez Anwar; Anwaruddin, Mohammad; Nagarajaram, H A

    2007-12-15

    Fold recognition is a key step in the protein structure discovery process, especially when traditional sequence comparison methods fail to yield convincing structural homologies. Although many methods have been developed for protein fold recognition, their accuracies remain low. This can be attributed to insufficient exploitation of fold discriminatory features. We have developed a new method for protein fold recognition using structural information of amino acid residues and amino acid residue pairs. Since protein fold recognition can be treated as a protein fold classification problem, we have developed a Support Vector Machine (SVM) based classifier approach that uses secondary structural state and solvent accessibility state frequencies of amino acids and amino acid pairs as feature vectors. Among the individual properties examined secondary structural state frequencies of amino acids gave an overall accuracy of 65.2% for fold discrimination, which is better than the accuracy by any method reported so far in the literature. Combination of secondary structural state frequencies with solvent accessibility state frequencies of amino acids and amino acid pairs further improved the fold discrimination accuracy to more than 70%, which is approximately 8% higher than the best available method. In this study we have also tested, for the first time, an all-together multi-class method known as Crammer and Singer method for protein fold classification. Our studies reveal that the three multi-class classification methods, namely one versus all, one versus one and Crammer and Singer method, yield similar predictions. Dataset and stand-alone program are available upon request.

  17. Solution structure and base pair opening kinetics of the i-motif dimer of d(5mCCTTTACC): a noncanonical structure with possible roles in chromosome stability.

    PubMed

    Nonin, S; Phan, A T; Leroy, J L

    1997-09-15

    Repetitive cytosine-rich DNA sequences have been identified in telomeres and centromeres of eukaryotic chromosomes. These sequences play a role in maintaining chromosome stability during replication and may be involved in chromosome pairing during meiosis. The C-rich repeats can fold into an 'i-motif' structure, in which two parallel-stranded duplexes with hemiprotonated C.C+ pairs are intercalated. Previous NMR studies of naturally occurring repeats have produced poor NMR spectra. This led us to investigate oligonucleotides, based on natural sequences, to produce higher quality spectra and thus provide further information as to the structure and possible biological function of the i-motif. NMR spectroscopy has shown that d(5mCCTTTACC) forms an i-motif dimer of symmetry-related and intercalated folded strands. The high-definition structure is computed on the basis of the build-up rates of 29 intraresidue and 35 interresidue nuclear Overhauser effect (NOE) connectivities. The i-motif core includes intercalated interstrand C.C+ pairs stacked in the order 2*.8/1.7*/1*.7/2.8* (where one strand is distinguished by an asterisk and the numbers relate to the base positions within the repeat). The TTTA sequences form two loops which span the two wide grooves on opposite sides of the i-motif core; the i-motif core is extended at both ends by the stacking of A6 onto C2.C8+. The lifetimes of pairs C2.C8+ and 5mC1.C7+ are 1 ms and 1 s, respectively, at 15 degrees C. Anomalous exchange properties of the T3 imino proton indicate hydrogen bonding to A6 N7 via a water bridge. The d(5mCCTTTTCC) deoxyoligonucleotide, in which position 6 is occupied by a thymidine instead of an adenine, also forms a symmetric i-motif dimer. However, in this structure the two TTTT loops are located on the same side of the i-motif core and the C.C+ pairs are formed by equivalent cytidines stacked in the order 8*.8/1.1*/7*.7/2.2*. Oligodeoxynucleotides containing two C-rich repeats can fold and dimerize

  18. Surface finish quality of the outer AXAF mirror pair based on x ray measurements of the VETA-I

    NASA Technical Reports Server (NTRS)

    Hughes, John P.; Schwartz, Daniel A.; Szentgyorgyi, Andrew; Vanspeybroeck, Leon; Zhao, Ping

    1992-01-01

    We employ the X-ray measurements of the VETA-I taken at the X-Ray Calibration Facility (XRCF) of the Marshall Space Flight Center (MSFC) to extract information about the surface finish quality of the outermost pair of AXAF mirrors. The particular measurements we consider are one dimensional scans of the core of the point response function (PRF) (full width half maximum (FWHM) scans), the encircled energy as a function of radius, and one dimensional scans of the wings of the PRF. We discuss briefly our ray trace model which incorporates the numerous effects present in the VETA-I test, such as the finite source distance, the size and shape of the X-ray source, the residual gravitational distortions of the optic, the despace of the VETA-I, and particulate contamination. We show how the data constrain the amplitude of mirror surface deviations for spatial frequencies greater than about 0.1 mm(exp -1). Constraints on the average amplitude of circumferential slope errors are derived as well.

  19. Compact Optical Fiber 3D Shape Sensor Based on a Pair of Orthogonal Tilted Fiber Bragg Gratings

    NASA Astrophysics Data System (ADS)

    Feng, Dingyi; Zhou, Wenjun; Qiao, Xueguang; Albert, Jacques

    2015-11-01

    In this work, a compact fiber-optic 3D shape sensor consisting of two serially connected 2° tilted fiber Bragg gratings (TFBGs) is proposed, where the orientations of the grating planes of the two TFBGs are orthogonal. The measurement of the reflective transmission spectrum from the pair of TFBGs was implemented by Fresnel reflection of the cleaved fiber end. The two groups of cladding mode resonances in the reflection spectrum respond differentially to bending, which allows for the unique determination of the magnitude and orientation of the bend plane (i.e. with a ± 180 degree uncertainty). Bending responses ranging from -0.33 to + 0.21 dB/m-1 (depending on orientation) are experimentally demonstrated with bending from 0 to 3.03 m-1. In the third (axial) direction, the strain is obtained directly by the shift of the TFBG Bragg wavelengths with a sensitivity of 1.06 pm/μɛ.

  20. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

    PubMed Central

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2016-01-01

    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine–pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism. PMID:26791911

  1. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code

    NASA Astrophysics Data System (ADS)

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2016-01-01

    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  2. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code.

    PubMed

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara

    2016-01-21

    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNA(Lys)(UUU) with hypermodified 5-methylaminomethyl-2-thiouridine (mnm(5)s(2)U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm(5)s(2)U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  3. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  4. Magnetic properties and pairing tendencies of the iron-based superconducting ladder BaFe 2 S 3 : Combined ab initio and density matrix renormalization group study

    DOE PAGES

    Patel, Niravkumar D.; Nocera, Alberto; Alvarez, Gonzalo; ...

    2016-08-10

    The recent discovery of superconductivity under high pressure in the two-leg ladder compound BaFe 2S 3 [H. Takahashi et al., Nat. Mater. 14, 1008 (2015)] opens a broad avenue of research, because it represents the first report of pairing tendencies in a quasi-one-dimensional iron-based high-critical-temperature superconductor. Similarly, as in the case of the cuprates, ladders and chains can be far more accurately studied using many-body techniques and model Hamiltonians than their layered counterparts, particularly if several orbitals are active. In this publication, we derive a two-orbital Hubbard model from first principles that describes individual ladders of BaFe 2S 3. Themore » model is studied with the density matrix renormalization group. These first reported results are exciting for two reasons: (i) at half-filling, ferromagnetic order emerges as the dominant magnetic pattern along the rungs of the ladder, and antiferromagnetic order along the legs, in excellent agreement with neutron experiments; and (ii) with hole doping, pairs form in the strong coupling regime, as found by studying the binding energy of two holes doped on the half-filled system. In addition, orbital selective Mott phase characteristics develop with doping, with only oneWannier orbital receiving the hole carriers while the other remains half-filled. Lastly, these results suggest that the analysis of models for iron-based two-leg ladders could clarify the origin of pairing tendencies and other exotic properties of iron-based high-critical-temperature superconductors in general.« less

  5. Facile Modulation of FLP Properties: A Phosphinylvinyl Grignard Reagent and Ga/P- and In/P2 -Based Frustrated Lewis Pairs.

    PubMed

    Backs, Jana; Lange, Merten; Possart, Josephine; Wollschläger, Agnes; Mück-Lichtenfeld, Christian; Uhl, Werner

    2017-03-06

    An Al/P-based frustrated Lewis pair (FLP) reacted with PhMgCl by an unexpected transmetalation and formation of a phosphinylvinyl Grignard reagent. This compound is well suited for the transfer of the basic FLP component to other Lewis acidic metal atoms and allowed the generation of a Ga/P and an In/P 2 FLP. The Ga FLP showed a behavior different to that of the corresponding Al FLP, the In FLP allowed the chelating coordination of an Au atom by Au-Cl bond activation. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Orientation-dependent tensile deformation and damage of a T700 carbon fiber/epoxy composite: A synchrotron-based study

    SciTech Connect

    Bie, B. X.; Huang, J. Y.; Fan, D.

    Uniaxial tensile experiments are conducted on a T700 carbon fiber/epoxy composite along various offaxis angles. Stressestrain curves are measured along with strain fields mapped via synchrotron x-ray digital image correlation, as well as computerized tomography. Elastic modulus and tensile strength decrease with increasing off-axis angles, while fracture strain exhibits a nonmonotonic trend as a combined result of tensile strength decrease and fracture mode transition. At high off-axis angles, strain field mapping demonstrates distinct tensile and shear strain localizations and deformation bands approximately along the fiber directions, while deformation is mainly achieved via continuous growth of tensile strain at low off-axismore » angles. Roughness of fracture planes decreases exponentially as the off-axis angle increases. The stressestrain curves, strain fields, tomography and fractographs show consistent features, and reveal a fracture mode transition from mainly tension (fiber fracture) to in-plane shear (interface debonding).« less

  7. Process evaluation of the project P.A.T.H.S. (secondary 2 program): findings based on the co-walker scheme.

    PubMed

    Shek, Daniel T L; Tam, Suet-yan

    2009-01-01

    To understand the implementation quality of the Tier 1 Program (Secondary 2 Curriculum) of the P.A.T.H.S. Project, process evaluation was carried out by co-walkers through classroom observation of 195 units in 131 schools. Results showed that the overall level of program adherence was generally high with an average of 84.55%, and different factors of the implementation process were evaluated as positive. Quality of program implementation and achievement of program objectives were predicted by students' participation and involvement, strategies to enhance students' motivation, opportunity for reflection, time management, and class preparation. Success in program implementation was predicted by students' participation and involvement, classroom control, interactive delivery method, strategies to enhance students' motivation, opportunity for reflection, and lesson preparation.

  8. A gp41-based heteroduplex mobility assay provides rapid and accurate assessment of intrasubtype epidemiological linkage in HIV type 1 heterosexual transmission Pairs.

    PubMed

    Manigart, Olivier; Boeras, Debrah I; Karita, Etienne; Hawkins, Paulina A; Vwalika, Cheswa; Makombe, Nathan; Mulenga, Joseph; Derdeyn, Cynthia A; Allen, Susan; Hunter, Eric

    2012-12-01

    A critical step in HIV-1 transmission studies is the rapid and accurate identification of epidemiologically linked transmission pairs. To date, this has been accomplished by comparison of polymerase chain reaction (PCR)-amplified nucleotide sequences from potential transmission pairs, which can be cost-prohibitive for use in resource-limited settings. Here we describe a rapid, cost-effective approach to determine transmission linkage based on the heteroduplex mobility assay (HMA), and validate this approach by comparison to nucleotide sequencing. A total of 102 HIV-1-infected Zambian and Rwandan couples, with known linkage, were analyzed by gp41-HMA. A 400-base pair fragment within the envelope gp41 region of the HIV proviral genome was PCR amplified and HMA was applied to both partners' amplicons separately (autologous) and as a mixture (heterologous). If the diversity between gp41 sequences was low (<5%), a homoduplex was observed upon gel electrophoresis and the transmission was characterized as having occurred between partners (linked). If a new heteroduplex formed, within the heterologous migration, the transmission was determined to be unlinked. Initial blind validation of gp-41 HMA demonstrated 90% concordance between HMA and sequencing with 100% concordance in the case of linked transmissions. Following validation, 25 newly infected partners in Kigali and 12 in Lusaka were evaluated prospectively using both HMA and nucleotide sequences. Concordant results were obtained in all but one case (97.3%). The gp41-HMA technique is a reliable and feasible tool to detect linked transmissions in the field. All identified unlinked results should be confirmed by sequence analyses.

  9. Racemization of (S)-profen thioesters by strong neutral bases in nonpolar organic solvents: implication for ion-pair kinetic basicity.

    PubMed

    Chen, Chia-Yin; Chang, Yu-Shang; Lin, Shun-An; Wen, Hui-I; Cheng, Yu-Chi; Tsai, Shau-Wei

    2002-05-17

    The racemization of (S)-profen 2,2,2-trifluoroethyl thioesters in isooctane with trioctylamine as base was carried out, in which the Hammett equation log(k(int)) = 3.584sigma - 3.745 was successfully applied to describe the electron-withdrawing effect of the substituents to the alpha-phenyl moiety of the thioesters. A combination of neutral strong organic bases with different nonpolar solvents was employed to determine the second-order interconversion constants for the racemization of (S)-naproxen 2,2,2-trifluoroethyl thioester, in which solvent hydrophobicity was found to have less effect on the racemization. Implication for ion-pair kinetic basicity scale for the neutral strong bases in isooctane was further discussed.

  10. A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

    PubMed

    Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu

    2017-01-01

    Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (T R ) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the T R domain between MPVd-M ( 176 U:A 185 ) and MPVd-S ( 174 G:C 183 ) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the T R domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.

  11. Bacterial community structure analysis of sediment in the Sagami River, Japan using a rapid approach based on two-dimensional DNA gel electrophoresis mapping with selective primer pairs.

    PubMed

    Liu, Guo-hua; Rajendran, Narasimmalu; Amemiya, Takashi; Itoh, Kiminori

    2011-11-01

    A rapid approach based on two-dimensional DNA gel electrophroesis (2-DGE) mapping with selective primer pairs was employed to analyze bacterial community structure in sediments from upstream, midstream and downstream of Sagami River in Japan. The 2-DGE maps indicated that Alpha- and Delta-proteobacteria were major bacterial populations in the upstream and midstream sediments. Further bacterial community structure analysis showed that richness proportion of Alpha- and Delta-proteobacterial groups reflected a trend toward decreasing from the upstream to downstream sediments. The biomass proportion of bacterial populations in the midstream sediment showed a significantly difference from that in the other sediments, suggesting that there may be an environmental pressure on the midstream bacterial community. Lorenz curves, together with Gini coefficients were successfully applied to the 2-DGE mapping data for resolving evenness of bacterial populations, and showed that the plotted curve from high-resolution 2-DGE mapping became less linear and more an exponential function than that of the 1-DGE methods such as chain length analysis and denaturing gradient gel electrophoresis, suggesting that the 2-DGE mapping may achieve a more detailed evaluation of bacterial community. In conclusion, the 2-DGE mapping combined with the selective primer pairs enables bacterial community structure analysis in river sediment and thus it can also monitor sediment pollution based on the change of bacterial community structure.

  12. Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

    SciTech Connect

    Vivian, J. P.; Porter, C.; Wilce, J. A.

    2006-11-01

    A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

  13. Ion pair-based liquid-phase microextraction combined with cuvetteless UV-vis micro-spectrophotometry as a miniaturized assay for monitoring ammonia in waters.

    PubMed

    Senra-Ferreiro, Sonia; Pena-Pereira, Francisco; Costas-Mora, Isabel; Romero, Vanesa; Lavilla, Isela; Bendicho, Carlos

    2011-09-15

    A miniaturized method based on liquid-phase microextraction (LPME) in combination with microvolume UV-vis spectrophotometry for monitoring ammonia in waters is proposed. The methodology is based on the extraction of the ion pair formed between the blue indophenol obtained according to the Berthelot reaction and a quaternary ammonium salt into a microvolume of organic solvent. Experimental parameters affecting the LPME performance such as type and concentration of the quaternary ammonium ion salt required to form the ion pair, type and volume of extractant solvent, effect of disperser solvent, ionic strength and extraction time, were optimized. A detection limit of 5.0 μg L(-1) ammonia and an enrichment factor of 30 can be attained after a microextraction time of 4 min. The repeatability, expressed as relative standard deviation, was 7.6% (n=7). The proposed method can be successfully applied to the determination of trace amounts of ammonia in several environmental water samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

    PubMed

    KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

    2018-06-20

    Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

  15. Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

    NASA Technical Reports Server (NTRS)

    Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

    2014-01-01

    This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

  16. Low pressure ion chromatography with a low cost paired emitter-detector diode based detector for the determination of alkaline earth metals in water samples.

    PubMed

    Barron, Leon; Nesterenko, Pavel N; Diamond, Dermot; O'Toole, Martina; Lau, King Tong; Paull, Brett

    2006-09-01

    The use of a low pressure ion chromatograph based upon short (25 mm x 4.6 mm) surfactant coated monolithic columns and a low cost paired emitter-detector diode (PEDD) based detector, for the determination of alkaline earth metals in aqueous matrices is presented. The system was applied to the separation of magnesium, calcium, strontium and barium in less than 7min using a 0.15M KCl mobile phase at pH 3, with post-column reaction detection at 570 nm using o-cresolphthalein complexone. A comparison of the performance of the PEDD detector with a standard laboratory absorbance detector is shown, with limits of detection for magnesium and calcium using the low cost PEDD detector equal to 0.16 and 0.23 mg L(-1), respectively. Finally, the developed system was used for the determination of calcium and magnesium in a commercial spring water sample.

  17. Ion pair-based dispersive liquid-liquid microextraction followed by high performance liquid chromatography as a new method for determining five folate derivatives in foodstuffs.

    PubMed

    Nojavan, Yones; Kamankesh, Marzieh; Shahraz, Farzaneh; Hashemi, Maryam; Mohammadi, Abdorreza

    2015-05-01

    A novel technique for simultaneous determination of five folate derivatives in various food matrices was developed by ion pair-based dispersive liquid-liquid microextraction (IP-DLLME) combined with high-performance liquid chromatography (HPLC). In the proposed method, N-methyl-N,N-dioctyloctan-1-ammonium chloride (aliquat-336) was used as an ion-pair reagent. Effective variables of microextraction process were optimized. Under optimum conditions, the method yielded a linear calibration curve ranging from 1-200 ng g(-1) with correlation coefficients (r(2)) higher than 0.98. The relative standard deviation for the seven analyses was 5.2-7.4%. Enrichment factors for the five folates ranged between 108-135. Limits of detection were 2-4.1 ng g(-1). A comparison of this method with other methods described that the new proposed method is rapid and accurate, and gives very good enrichment factors and detection limits for determining five folate derivatives. The newly developed method was successfully applied for the determination of five folate derivatives in wheat flour, egg yolk and orange juice samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Vortex pairs on surfaces

    SciTech Connect

    Koiller, Jair; Boatto, Stefanella

    2009-05-06

    A pair of infinitesimally close opposite vortices moving on a curved surface moves along a geodesic, according to a conjecture by Kimura. We outline a proof. Numerical simulations are presented for a pair of opposite vortices at a close but nonzero distance on a surface of revolution, the catenoid. We conjecture that the vortex pair system on a triaxial ellipsoid is a KAM perturbation of Jacobi's geodesic problem. We outline some preliminary calculations required for this study. Finding the surfaces for which the vortex pair system is integrable is in order.

  19. A self-initiating eukaryotic transient gene expression system based on contransfection of bacteriophage T7 RNA polymerase and DNA vectors containing a T7 autogene.

    PubMed Central

    Chen, X; Li, Y; Xiong, K; Wagner, T E

    1994-01-01

    A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020

  20. The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

    PubMed

    Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

    2001-06-01

    A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In

  1. A forward-adjoint operator pair based on the elastic wave equation for use in transcranial photoacoustic computed tomography

    PubMed Central

    Mitsuhashi, Kenji; Poudel, Joemini; Matthews, Thomas P.; Garcia-Uribe, Alejandro; Wang, Lihong V.; Anastasio, Mark A.

    2017-01-01

    Photoacoustic computed tomography (PACT) is an emerging imaging modality that exploits optical contrast and ultrasonic detection principles to form images of the photoacoustically induced initial pressure distribution within tissue. The PACT reconstruction problem corresponds to an inverse source problem in which the initial pressure distribution is recovered from measurements of the radiated wavefield. A major challenge in transcranial PACT brain imaging is compensation for aberrations in the measured data due to the presence of the skull. Ultrasonic waves undergo absorption, scattering and longitudinal-to-shear wave mode conversion as they propagate through the skull. To properly account for these effects, a wave-equation-based inversion method should be employed that can model the heterogeneous elastic properties of the skull. In this work, a forward model based on a finite-difference time-domain discretization of the three-dimensional elastic wave equation is established and a procedure for computing the corresponding adjoint of the forward operator is presented. Massively parallel implementations of these operators employing multiple graphics processing units (GPUs) are also developed. The developed numerical framework is validated and investigated in computer19 simulation and experimental phantom studies whose designs are motivated by transcranial PACT applications. PMID:29387291

  2. Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

    DOEpatents

    Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

    2010-08-17

    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  3. Nodal-line pairing with 1D-3D coupled Fermi surfaces: A model motivated by Cr-based superconductors

    NASA Astrophysics Data System (ADS)

    Wachtel, Gideon; Kim, Yong Baek

    2016-09-01

    Motivated by the recent discovery of a new family of chromium-based superconductors, we consider a two-band model, where a band of electrons dispersing only in one direction interacts with a band of electrons dispersing in all three directions. Strong 2 kf density fluctuations in the one-dimensional band induces attractive interactions between the three-dimensional electrons, which, in turn, makes the system superconducting. Solving the associated Eliashberg equations, we obtain a gap function which is peaked at the "poles" of the three-dimensional Fermi sphere, and decreases towards the "equator." When strong enough local repulsion is included, the gap actually changes sign around the equator and nodal rings are formed. These nodal rings manifest themselves in several experimentally observable quantities, some of which resemble unconventional observations in the newly discovered superconductors which motivated this work.

  4. Relaxing in Pairs.

    ERIC Educational Resources Information Center

    Foot, Michael C.

    1999-01-01

    Discusses the practice of paired testing of oral languages, noting the lack of published research evidence and of results from the monitoring of these tests to support their introduction into wider use. Questions whether paired testing is more effective than, and a valid alternative to, the more traditional candidate/examiner model. (SM)

  5. Synthesis and monitored selection of nucleotide surrogates for binding T:A base pairs in homopurine-homopyrimidine DNA triple helices.

    PubMed

    Mokhir, A A; Connors, W H; Richert, C

    2001-09-01

    A total of 16 oligodeoxyribonucleotides of general sequence 5'-TCTTCTZTCTTTCT-3', where Z denotes an N-acyl-N-(2-hydroxyethyl)glycine residue, were prepared via solid phase synthesis. The ability of these oligonucleotides to form triplexes with the duplex 5'-AGAAGATAGAAAGA-HEG-TCTTTCTATCTTCT-3', where HEG is a hexaethylene glycol linker, was tested. In these triplexes, an 'interrupting' T:A base pair faces the Z residue in the third strand. Among the acyl moieties of Z tested, an anthraquinone carboxylic acid residue linked via a glycinyl group gave the most stable triplex, whose UV melting point was 8.4 degrees C higher than that of the triplex with 5'-TCTTCTGTCTTTCT-3' as the third strand. The results from exploratory nuclease selection experiments suggest that a combinatorial search for strands capable of recognizing mixed sequences by triple helix formation is feasible.

  6. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    NASA Astrophysics Data System (ADS)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  7. All-Fiber Dual-Parameter Sensor Based on Cascaded Long Period Fiber Grating Pair Fabricated by Femtosecond Laser and CO2 Laser

    NASA Astrophysics Data System (ADS)

    Zhang, Wen; Hao, Jiaqi; Lou, Xiaoping; Dong, Mingli; Zhu, Lianqing

    2018-03-01

    An all-fiber dual-parameter sensor based on cascaded long period grating pair fabricated by femtosecond laser and CO2 laser has been proposed and realized both theoretically and experimentally. The resonant wavelengths of LPFGs are 1557.80 nm and 1590.88 nm. In the strain range of 0-400 με, strain sensitivities are -7.2 pm/με for C-LPFG and -1.6 pm/με for F-LPFG. In the temperature range of 30-70°C, temperature sensitivities are -41.1 pm/°C for C-LPFG and -21.2 pm/°C for F-LPFG. By analyzing the resonant wavelength characterization, the proposed sensor can be efficiently used for dual-parameters measurement with promising application prospect and great research reference value.

  8. Optical sensing system based on wireless paired emitter detector diode device and ionogels for lab-on-a-disc water quality analysis.

    PubMed

    Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando

    2012-12-07

    This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.

  9. Highly Efficient One-Pot Synthesis of COS-Based Block Copolymers by Using Organic Lewis Pairs.

    PubMed

    Yang, Jia-Liang; Cao, Xiao-Han; Zhang, Cheng-Jian; Wu, Hai-Lin; Zhang, Xing-Hong

    2018-01-31

    A one-pot synthesis of block copolymer with regioregular poly(monothiocarbonate) block is described via metal-free catalysis. Lewis bases such as guanidine, quaternary onium salts, and Lewis acid triethyl borane (TEB) were equivalently combined and used as the catalysts. By using polyethylene glycol (PEG) as the macromolecular chain transfer agent (CTA), narrow polydispersity block copolymers were obtained from the copolymerization of carbonyl sulfide (COS) and propylene oxide (PO). The block copolymers had a poly(monothiocarbonate) block with perfect alternating degree and regioregularity. Unexpectedly, the addition of CTA to COS/PO copolymerization system could dramatically improve the turnover frequency (TOF) of PO (up to 240 h -1 ), higher than that of the copolymerization without CTA. In addition, the conversion of CTA could be up to 100% in most cases, as revealed by ¹H NMR spectra. Of consequence, the number-average molecular weights ( M n s) of the resultant block copolymers could be regulated by varying the feed ratio of CTA to PO. Oxygen-sulfur exchange reaction (O/S ER), which can generate randomly distributed thiocarbonate and carbonate units, was effectively suppressed in all of the cases in the presence of CTA, even at 80 °C. This work presents a versatile method for synthesizing sulfur-containing block copolymers through a metal-free route, providing an array of new block copolymers.

  10. Cooper Pairs in Insulators?!

    ScienceCinema

    James Valles

    2017-12-09

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions. 

  11. Sparse maps—A systematic infrastructure for reduced-scaling electronic structure methods. II. Linear scaling domain based pair natural orbital coupled cluster theory

    NASA Astrophysics Data System (ADS)

    Riplinger, Christoph; Pinski, Peter; Becker, Ute; Valeev, Edward F.; Neese, Frank

    2016-01-01

    Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate previous

  12. A comparative research of different ensemble surrogate models based on set pair analysis for the DNAPL-contaminated aquifer remediation strategy optimization.

    PubMed

    Hou, Zeyu; Lu, Wenxi; Xue, Haibo; Lin, Jin

    2017-08-01

    Surrogate-based simulation-optimization technique is an effective approach for optimizing the surfactant enhanced aquifer remediation (SEAR) strategy for clearing DNAPLs. The performance of the surrogate model, which is used to replace the simulation model for the aim of reducing computation burden, is the key of corresponding researches. However, previous researches are generally based on a stand-alone surrogate model, and rarely make efforts to improve the approximation accuracy of the surrogate model to the simulation model sufficiently by combining various methods. In this regard, we present set pair analysis (SPA) as a new method to build ensemble surrogate (ES) model, and conducted a comparative research to select a better ES modeling pattern for the SEAR strategy optimization problems. Surrogate models were developed using radial basis function artificial neural network (RBFANN), support vector regression (SVR), and Kriging. One ES model is assembling RBFANN model, SVR model, and Kriging model using set pair weights according their performance, and the other is assembling several Kriging (the best surrogate modeling method of three) models built with different training sample datasets. Finally, an optimization model, in which the ES model was embedded, was established to obtain the optimal remediation strategy. The results showed the residuals of the outputs between the best ES model and simulation model for 100 testing samples were lower than 1.5%. Using an ES model instead of the simulation model was critical for considerably reducing the computation time of simulation-optimization process and maintaining high computation accuracy simultaneously. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Structural Requirement in Clostridium perfringens Collagenase mRNA 5′ Leader Sequence for Translational Induction through Small RNA-mRNA Base Pairing

    PubMed Central

    Nomura, Nobuhiko; Nakamura, Kouji

    2013-01-01

    The Gram-positive anaerobic bacterium Clostridium perfringens is pathogenic to humans and animals, and the production of its toxins is strictly regulated during the exponential phase. We recently found that the 5′ leader sequence of the colA transcript encoding collagenase, which is a major toxin of this organism, is processed and stabilized in the presence of the small RNA VR-RNA. The primary colA 5′-untranslated region (5′UTR) forms a long stem-loop structure containing an internal bulge and masks its own ribosomal binding site. Here we found that VR-RNA directly regulates colA expression through base pairing with colA mRNA in vivo. However, when the internal bulge structure was closed by point mutations in colA mRNA, translation ceased despite the presence of VR-RNA. In addition, a mutation disrupting the colA stem-loop structure induced mRNA processing and ColA-FLAG translational activation in the absence of VR-RNA, indicating that the stem-loop and internal bulge structure of the colA 5′ leader sequence is important for regulation by VR-RNA. On the other hand, processing was required for maximal ColA expression but was not essential for VR-RNA-dependent colA regulation. Finally, colA processing and translational activation were induced at a high temperature without VR-RNA. These results suggest that inhibition of the colA 5′ leader structure through base pairing is the primary role of VR-RNA in colA regulation and that the colA 5′ leader structure is a possible thermosensor. PMID:23585542

  14. Growing Right Onto Wellness (GROW): A Family-Centered, Community-Based Obesity Prevention Randomized Controlled Trial for Preschool Child-Parent Pairs

    PubMed Central

    Po’e, Eli K.; Heerman, William J.; Mistry, Rishi S.; Barkin, Shari L.

    2013-01-01

    Growing Right Onto Wellness (GROW) is a randomized controlled trial that tests the efficacy of a family-centered, community-based, behavioral intervention to prevent childhood obesity among preschool-aged children. Focusing on parent-child pairs, GROW utilizes a multi-level framework, which accounts for macro (i.e., built-environment) and micro (i.e., genetics) level systems that contribute to the childhood obesity epidemic. Six hundred parent-child pairs will be randomized to a 3-year healthy lifestyle intervention or a 3-year school readiness program. Eligible children are enrolled between ages 3 and 5, are from minority communities, and are not obese. The principal site for the GROW intervention is local community recreation centers and libraries. The primary outcome is childhood Body Mass Index (BMI) trajectory at the end of the three-year study period. In addition to other anthropometric measurements, mediators and moderators of growth are considered, including genetics, accelerometry, and diet recall. GROW is a staged intensity intervention, consisting of intensive, maintenance, and sustainability phases. Throughout the study, parents build skills in nutrition, physical activity, and parenting, concurrently forming new social networks. Participants are taught goal-setting, self-monitoring, and problem solving techniques to facilitate sustainable behavior change. The GROW curriculum uses low health literacy communication and social media to communicate key health messages. The control arm is administered to both control and intervention participants. By conducting this trial in public community centers, and by implementing a family-centered approach to sustainable healthy childhood growth, we aim to develop an exportable community-based intervention to address the expanding public health crisis of pediatric obesity. PMID:24012890

  15. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    PubMed

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  16. ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

    PubMed Central

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins

  17. First comparative approach to touchscreen-based visual object-location paired-associates learning in humans (Homo sapiens) and a nonhuman primate (Microcebus murinus).

    PubMed

    Schmidtke, Daniel; Ammersdörfer, Sandra; Joly, Marine; Zimmermann, Elke

    2018-05-10

    A recent study suggests that a specific, touchscreen-based task on visual object-location paired-associates learning (PAL), the so-called Different PAL (dPAL) task, allows effective translation from animal models to humans. Here, we adapted the task to a nonhuman primate (NHP), the gray mouse lemur, and provide first evidence for the successful comparative application of the task to humans and NHPs. Young human adults reach the learning criterion after considerably less sessions (one order of magnitude) than young, adult NHPs, which is likely due to faster and voluntary rejection of ineffective learning strategies in humans and almost immediate rule generalization. At criterion, however, all human subjects solved the task by either applying a visuospatial rule or, more rarely, by memorizing all possible stimulus combinations and responding correctly based on global visual information. An error-profile analysis in humans and NHPs suggests that successful learning in NHPs is comparably based either on the formation of visuospatial associative links or on more reflexive, visually guided stimulus-response learning. The classification in the NHPs is further supported by an analysis of the individual response latencies, which are considerably higher in NHPs classified as spatial learners. Our results, therefore, support the high translational potential of the standardized, touchscreen-based dPAL task by providing first empirical and comparable evidence for two different cognitive processes underlying dPAL performance in primates. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  18. Acid-induced exchange of the imino proton in G.C pairs.

    PubMed Central

    Nonin, S; Leroy, J L; Gueron, M

    1996-01-01

    Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298

  19. Analytic energy derivatives for the calculation of the first-order molecular properties using the domain-based local pair-natural orbital coupled-cluster theory

    NASA Astrophysics Data System (ADS)

    Datta, Dipayan; Kossmann, Simone; Neese, Frank

    2016-09-01

    The domain-based local pair-natural orbital coupled-cluster (DLPNO-CC) theory has recently emerged as an efficient and powerful quantum-chemical method for the calculation of energies of molecules comprised of several hundred atoms. It has been demonstrated that the DLPNO-CC approach attains the accuracy of a standard canonical coupled-cluster calculation to about 99.9% of the basis set correlation energy while realizing linear scaling of the computational cost with respect to system size. This is achieved by combining (a) localized occupied orbitals, (b) large virtual orbital correlation domains spanned by the projected atomic orbitals (PAOs), and (c) compaction of the virtual space through a truncated pair natural orbital (PNO) basis. In this paper, we report on the implementation of an analytic scheme for the calculation of the first derivatives of the DLPNO-CC energy for basis set independent perturbations within the singles and doubles approximation (DLPNO-CCSD) for closed-shell molecules. Perturbation-independent one-particle density matrices have been implemented in order to account for the response of the CC wave function to the external perturbation. Orbital-relaxation effects due to external perturbation are not taken into account in the current implementation. We investigate in detail the dependence of the computed first-order electrical properties (e.g., dipole moment) on the three major truncation parameters used in a DLPNO-CC calculation, namely, the natural orbital occupation number cutoff used for the construction of the PNOs, the weak electron-pair cutoff, and the domain size cutoff. No additional truncation parameter has been introduced for property calculation. We present benchmark calculations on dipole moments for a set of 10 molecules consisting of 20-40 atoms. We demonstrate that 98%-99% accuracy relative to the canonical CCSD results can be consistently achieved in these calculations. However, this comes with the price of tightening the

  20. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    PubMed

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  1. Use of two sulfonthalein dyes in the extraction-free spectrophotometric assay of tramadol in dosage forms and in spiked human urine based on ion-pair reaction.

    PubMed

    Vinay, Kanakapura B; Revannasiddappa, Hosakere D; Rajendraprasad, Nagaraju; Ramesh, Pavagada J; Xavier, Cijo M; Basavaiah, Kanakapura

    2012-02-01

    Tramadol is a centrally acting analgesic used in the prevention and treatment of moderate to severe pain. Two sensitive, selective, and rapid spectrophotometric methods are described for the determination of tramadol in its dosage forms and in spiked human urine. The methods are based on formation of yellow ion-pairs between tramadol and two sulfonthalein dyes; bromocresol purple (BCP) and bromocresol green (BCG) in dichloromethane medium followed by absorbance measurement at 400 and 410 nm, respectively. Under the optimum conditions, tramadol could be assayed in the concentration ranges, 1-15 and 1-16 µg ml(-1) with correlation coefficient greater than 0.999 in both cases. The molar absorptivity values are calculated to be 1.84 × 10(4) and 1.97 × 10(4) l mol(-1) cm(-1) for BCP and BCG methods, respectively; and the corresponding Sandell sensitivity values are 0.0143 and 0.0134 µg cm(-2). The limits of detection (LOD) and quantification (LOQ) have also been reported. The stoichiometry of the reaction was found to be 1:1 in both cases and the conditional stability constant (K(f)) values of the ion pairs have been calculated. The within-day and between-day RSD were 0.9-1.96% and 1.56-3.21%, respectively. The methods were successfully applied to the determination of tramadol in tablets and injections and also in spiked human urine with good recoveries. The procedures are simple, accurate, and suitable for quality control application. Copyright © 2011 John Wiley & Sons, Ltd.

  2. Multivariate Genetic Correlates of the Auditory Paired Stimuli-Based P2 Event-Related Potential in the Psychosis Dimension From the BSNIP Study.

    PubMed

    Mokhtari, Mohammadreza; Narayanan, Balaji; Hamm, Jordan P; Soh, Pauline; Calhoun, Vince D; Ruaño, Gualberto; Kocherla, Mohan; Windemuth, Andreas; Clementz, Brett A; Tamminga, Carol A; Sweeney, John A; Keshavan, Matcheri S; Pearlson, Godfrey D

    2016-05-01

    The complex molecular etiology of psychosis in schizophrenia (SZ) and psychotic bipolar disorder (PBP) is not well defined, presumably due to their multifactorial genetic architecture. Neurobiological correlates of psychosis can be identified through genetic associations of intermediate phenotypes such as event-related potential (ERP) from auditory paired stimulus processing (APSP). Various ERP components of APSP are heritable and aberrant in SZ, PBP and their relatives, but their multivariate genetic factors are less explored. We investigated the multivariate polygenic association of ERP from 64-sensor auditory paired stimulus data in 149 SZ, 209 PBP probands, and 99 healthy individuals from the multisite Bipolar-Schizophrenia Network on Intermediate Phenotypes study. Multivariate association of 64-channel APSP waveforms with a subset of 16 999 single nucleotide polymorphisms (SNPs) (reduced from 1 million SNP array) was examined using parallel independent component analysis (Para-ICA). Biological pathways associated with the genes were assessed using enrichment-based analysis tools. Para-ICA identified 2 ERP components, of which one was significantly correlated with a genetic network comprising multiple linearly coupled gene variants that explained ~4% of the ERP phenotype variance. Enrichment analysis revealed epidermal growth factor, endocannabinoid signaling, glutamatergic synapse and maltohexaose transport associated with P2 component of the N1-P2 ERP waveform. This ERP component also showed deficits in SZ and PBP. Aberrant P2 component in psychosis was associated with gene networks regulating several fundamental biologic functions, either general or specific to nervous system development. The pathways and processes underlying the gene clusters play a crucial role in brain function, plausibly implicated in psychosis. © The Author 2015. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For

  3. Isosteric And Non-Isosteric Base Pairs In RNA Motifs: Molecular Dynamics And Bioinformatics Study Of The Sarcin-Ricin Internal Loop

    PubMed Central

    Havrila, Marek; Réblová, Kamila; Zirbel, Craig L.; Leontis, Neocles B.; Šponer, Jiří

    2013-01-01

    The Sarcin-Ricin RNA motif (SR motif) is one of the most prominent recurrent RNA building blocks that occurs in many different RNA contexts and folds autonomously, i.e., in a context-independent manner. In this study, we combined bioinformatics analysis with explicit-solvent molecular dynamics (MD) simulations to better understand the relation between the RNA sequence and the evolutionary patterns of SR motif. SHAPE probing experiment was also performed to confirm fidelity of MD simulations. We identified 57 instances of the SR motif in a non-redundant subset of the RNA X-ray structure database and analyzed their basepairing, base-phosphate, and backbone-backbone interactions. We extracted sequences aligned to these instances from large ribosomal RNA alignments to determine frequency of occurrence for different sequence variants. We then used a simple scoring scheme based on isostericity to suggest 10 sequence variants with highly variable expected degree of compatibility with the SR motif 3D structure. We carried out MD simulations of SR motifs with these base substitutions. Non isosteric base substitutions led to unstable structures, but so did isosteric substitutions which were unable to make key base-phosphate interactions. MD technique explains why some potentially isosteric SR motifs are not realized during evolution. We also found that inability to form stable cWW geometry is an important factor in case of the first base pair of the flexible region of the SR motif. Comparison of structural, bioinformatics, SHAPE probing and MD simulation data reveals that explicit solvent MD simulations neatly reflect viability of different sequence variants of the SR motif. Thus, MD simulations can efficiently complement bioinformatics tools in studies of conservation patterns of RNA motifs and provide atomistic insight into the role of their different signature interactions. PMID:24144333

  4. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    PubMed Central

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  5. Mesoscopic pairing without superconductivity

    NASA Astrophysics Data System (ADS)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  6. Stereo Pair, Pasadena, California

    NASA Image and Video Library

    2000-03-10

    This stereoscopic image pair is a perspective view that shows the western part of the city of Pasadena, California, looking north toward the San Gabriel Mountains. Portions of the cities of Altadena and La Canada Flintridge are also shown.

  7. Stereo Pair, Honolulu, Oahu

    NASA Image and Video Library

    2000-03-10

    Honolulu, on the island of Oahu, is a large and growing urban area. This stereoscopic image pair, combining a Landsat image with topography measured by NASA Shuttle Radar Topography Mission SRTM, shows how topography controls the urban pattern.

  8. Molecular dynamics of the frame-shifting pseudoknot from beet western yellows virus: the role of non-Watson-Crick base-pairing, ordered hydration, cation binding and base mutations on stability and unfolding.

    PubMed

    Csaszar, K; Spacková, N; Stefl, R; Sponer, J; Leontis, N B

    2001-11-09

    Molecular dynamics simulations of the frame-shifting pseudoknot from beet western yellows virus (BWYV, NDB file UR0004) were performed with explicit inclusion of solvent and counterions. In all, 33 ns of simulation were carried out, including 10 ns of the native structure with protonation of the crucial cytosine residue, C8(N3+). The native structure exhibited stable trajectories retaining all Watson-Crick and tertiary base-pairs, except for fluctuations or transient disruptions at specific sites. The most significant fluctuations involved the change or disruption of hydrogen-bonding between C8(N3+) and bases G12, A25, and C26, as well as disruption of the water bridges linking C8(N3+) with A25 and C26. To increase sampling of rare events, the native simulation was continued at 400 K. A partial, irreversible unfolding of the molecule was initiated by slippage of C8(N3+) relative to G12 and continued by sudden concerted changes in hydrogen-bonding involving A23, A24, and A25. These events were followed by a gradual loss of stacking interactions in loop 2. Of the Watson-Crick base-pairs, only the 5'-terminal pair of stem 1 dissociated at 400 K, while the trans sugar-edge/sugar-edge A20.G4 interaction remained surprisingly stable. Four additional room-temperature simulations were carried out to obtain insights into the structural and dynamic effects of selected mutations. In two of these, C8 was left unprotonated. Considerable local rearrangements occurred that were not observed in the crystal structure, thus confirming N3-protonation of C8 in the native molecule. We also investigated the effect of mutating C8(N3+) to U8, to correlate with experimental and phylogenetic studies, and of changing the G4 x C17 base-pair to A4 x U17 to weaken the trans sugar-edge interaction between positions 4 and 20 and to test models of unfolding. The simulations indicate that the C8 x G12 x C26 base-triple at the junction is the most labile region of the frame-shifting pseudoknot. They

  9. Association of IL8 -251A/T, IL12B -1188A/C and TNF-α -238A/G polymorphisms with Tourette syndrome in a family-based association study in a Chinese Han population.

    PubMed

    Liu, Shiguo; Yi, Mingji; Wang, Meijian; Sun, Yuping; Che, Fengyuan; Ma, Xu

    2011-05-16

    An earlier study indicated a possible relationship between Tourette syndrome (TS) and the cytokines. To explore this further, we analyzed the association of the polymorphisms, IL8 -251A/T, IL12B -1188A/C and TNF-α -238A/G, in the IL8, IL12B and TNF-α cytokine genes with TS in a Chinese Han population. A total of 108 patients diagnosed with TS and their parents were recruited for the study. The genetic contributions of the IL8 -251A/T, IL12B -1188A/C, and TNF-α -238A/G polymorphisms were evaluated using polymerase chain reaction and restriction enzyme digestion (PCR-RFLP) and haplotype relative risk (HRR) and transmission disequilibrium test (TDT) statistics. Our results revealed no significant associations between the IL8 -251A/T, IL12B -1188A/C and TNF-α -238A/G polymorphisms and TS (for IL8 -251A/T, TDT=0.418, df=1, P=0.518; HRR=2.17, X(2)=3.000, P=0.083, 95%CI: 0.900-5.230; for IL12B -1188A/C, TDT=1.131, df=1, P=0.288; HRR=1.27, X(2)=0.35, P=0.549, 95%CI: 0.580-2.790; for TNF-α -238A/G, TDT=2.793, df=1, P=0.095; HRR=0.27, X(2)=2.90, P=0.089, 95%CI: 0.061-1.217). This result was confirmed using haplotype-based haplotype relative risk (HHRR) which allows the two alleles in each genotype to be considered separately. Our data suggests that the IL-8 -251A/T, IL-12B -1188A/C and TNF-α -238A/G polymorphisms may not be associated with susceptibility to TS in the Chinese Han population studied. However, these results need to be replicated using larger datasets collected from different populations. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.

  10. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    PubMed

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  11. Validation of a T1 and T2* leakage correction method based on multi-echo DSC-MRI using MION as a reference standard

    PubMed Central

    Stokes, Ashley M.; Semmineh, Natenael; Quarles, C. Chad

    2015-01-01

    Purpose A combined biophysical- and pharmacokinetic-based method is proposed to separate, quantify, and correct for both T1 and T2* leakage effects using dual-echo DSC acquisitions to provide more accurate hemodynamic measures, as validated by a reference intravascular contrast agent (CA). Methods Dual-echo DSC-MRI data were acquired in two rodent glioma models. The T1 leakage effects were removed and also quantified in order to subsequently correct for the remaining T2* leakage effects. Pharmacokinetic, biophysical, and combined biophysical and pharmacokinetic models were used to obtain corrected cerebral blood volume (CBV) and cerebral blood flow (CBF), and these were compared with CBV and CBF from an intravascular CA. Results T1-corrected CBV was significantly overestimated compared to MION CBV, while T1+T2*-correction yielded CBV values closer to the reference values. The pharmacokinetic and simplified biophysical methods showed similar results and underestimated CBV in tumors exhibiting strong T2* leakage effects. The combined method was effective for correcting T1 and T2* leakage effects across tumor types. Conclusions Correcting for both T1 and T2* leakage effects yielded more accurate measures of CBV. The combined correction method yields more reliable CBV measures than either correction method alone, but for certain brain tumor types (e.g., gliomas) the simplified biophysical method may provide a robust and computationally efficient alternative. PMID:26362714

  12. A highly stable l-alanine-based mono(aquated) Mn(ii) complex as a T1-weighted MRI contrast agent.

    PubMed

    Khannam, Mahmuda; Weyhermüller, Thomas; Goswami, Upashi; Mukherjee, Chandan

    2017-08-08

    The synthesized lithium (S)-6,6'-(1-carboxyethylazanediyl)bis(methylene)dipicolinate (Li 3 cbda) is a new chiral, alanine-based ligand bearing two picolinate functionalities. The trianionic form of the ligand [(cbda) 3- ] constitutes a seven-coordinate, water-soluble, pentagonal bipyramidal Mn(ii) complex (1). The structural analysis reveals the presence of a water coordinating site in the complex. The complex is thermodynamically very stable, and the stability is not affected by the presence of physiological anions (HCO 3 - , PO 4 3- , and F - ). The pH of the medium exerts a small effect on the stability of the complex. The r 1 relaxivity of 3.02 mM -1 s -1 is exhibited by the complex at 1.41 T, pH ∼7.4, and 25 °C. Phantom images obtained via a clinical MRI BRIVO MR355 system established concentration-dependent signal enhancement by the complex. The cytotoxicity test confirmed complex 1 as a biocompatible potential T 1 -weighted MRI contrast agent.

  13. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    PubMed Central

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  14. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    NASA Astrophysics Data System (ADS)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  15. Kinetic measurement of 2-aminopurine X cytosine and 2-aminopurine X thymine base pairs as a test of DNA polymerase fidelity mechanisms.

    PubMed Central

    Watanabe, S M; Goodman, M F

    1982-01-01

    Enzyme kinetic measurements are presented showing that Km rather than maximum velocity (Vmax) discrimination governs the frequency of forming 2-aminopurine X cytosine base mispairs by DNA polymerase alpha. An in vitro system is used in which incorporation of dTMP or dCMP occurs opposite a template 2-aminopurine, and values for Km and Vmax are obtained. Results from a previous study in which dTTP and dCTP were competing simultaneously for insertion opposite 2-aminopurine indicated that dTMP is inserted 22 times more frequently than dCMP. We now report that the ratio of Km values KCm/KTm = 25 +/- 6, which agrees quantitatively with the dTMP/dCMP incorporation ratio obtained previously. We also report that VCmax is indistinguishable from VTmax. These Km and Vmax data are consistent with predictions from a model, the Km discrimination model, in which replication fidelity is determined by free energy differences between matched and mismatched base pairs. Central to this model is the prediction that the ratio of Km values for insertion of correct and incorrect nucleotides specifies the insertion fidelity, and the maximum velocities of insertion are the same for both nucleotides. PMID:6959128

  16. Multiple reaction monitoring-ion pair finder: a systematic approach to transform nontargeted mode to pseudotargeted mode for metabolomics study based on liquid chromatography-mass spectrometry.

    PubMed

    Luo, Ping; Dai, Weidong; Yin, Peiyuan; Zeng, Zhongda; Kong, Hongwei; Zhou, Lina; Wang, Xiaolin; Chen, Shili; Lu, Xin; Xu, Guowang

    2015-01-01

    Pseudotargeted metabolic profiling is a novel strategy combining the advantages of both targeted and untargeted methods. The strategy obtains metabolites and their product ions from quadrupole time-of-flight (Q-TOF) MS by information-dependent acquisition (IDA) and then picks targeted ion pairs and measures them on a triple-quadrupole MS by multiple reaction monitoring (MRM). The picking of ion pairs from thousands of candidates is the most time-consuming step of the pseudotargeted strategy. Herein, a systematic and automated approach and software (MRM-Ion Pair Finder) were developed to acquire characteristic MRM ion pairs by precursor ions alignment, MS(2) spectrum extraction and reduction, characteristic product ion selection, and ion fusion. To test the reliability of the approach, a mixture of 15 metabolite standards was first analyzed; the representative ion pairs were correctly picked out. Then, pooled serum samples were further studied, and the results were confirmed by the manual selection. Finally, a comparison with a commercial peak alignment software was performed, and a good characteristic ion coverage of metabolites was obtained. As a proof of concept, the proposed approach was applied to a metabolomics study of liver cancer; 854 metabolite ion pairs were defined in the positive ion mode from serum. Our approach provides a high throughput method which is reliable to acquire MRM ion pairs for pseudotargeted metabolomics with improved metabolite coverage and facilitate more reliable biomarkers discoveries.

  17. [Paired kidneys in transplant].

    PubMed

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  18. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    PubMed

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  19. Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

    PubMed Central

    Parker, K A; Steitz, J A

    1987-01-01

    The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

  20. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    PubMed

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  1. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    PubMed Central

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  2. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome

    PubMed Central

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.

    2008-01-01

    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  3. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    SciTech Connect

    Bricault, Christine A.; Perry, Keith L., E-mail: KLP3@cornell.edu

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majoritymore » of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.« less

  4. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    PubMed

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  5. Novel Validated RP-HPLC Method for Bendamustine Hydrochloride Based on Ion-pair Chromatography: Application in Determining Infusion Stability and Pharmacokinetics.

    PubMed

    Singh, Yuvraj; Chandrashekar, Anumandla; Pawar, Vivek K; Saravanakumar, Veeramuthu; Meher, Jayagopal; Raval, Kavit; Singh, Pankaj; Kumar, R Dinesh; Chourasia, Manish K

    2017-01-01

    Ion pair chromatography was used for quantifying bendamustine hydrochloride (BH) in its marketed vial. The permissive objective was to investigate time duration for which highly susceptible drug content of the marketed vial remained stable after reconstitution. However, the method could also be used to measure extremely low levels of drug in rat plasma and a pharmacokinetic study was accordingly conducted to further showcase method's applicability. Optimized separation was achieved on C-18 Purospher ® STAR (250 mm × 4.6 mm, 5 μm particle size) column. Mobile phase flowing at 1.5 mL/min consisted of 5 mM sodium salt of octane sulfonic acid dissolved in methanol, water and glacial acetic acid (55:45:0.075) maintained at pH 6. Detection was carried out at 233 nm with BH eluting after 7.8 min. Validation parameters were determined as per ICH guidelines. Limit of detection and limit of quantification were found to be 0.1 µg/mL and 0.33 µg/mL, respectively. The recoveries were 98-102% in bulk and 85-91% in plasma. The developed method was specific for BH, and utilized for assessing its short-term stability in physiologic solvents and forced degradation products in acid, base, oxidative, light and temperature induced stress environments. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. A reference skeletal dosimetry model for an adult male radionuclide therapy patient based on three-dimensional imaging and paired-image radiation transport

    NASA Astrophysics Data System (ADS)

    Shah, Amish P.

    The need for improved patient-specificity of skeletal dose estimates is widely recognized in radionuclide therapy. Current clinical models for marrow dose are based on skeletal mass estimates from a variety of sources and linear chord-length distributions that do not account for particle escape into cortical bone. To predict marrow dose, these clinical models use a scheme that requires separate calculations of cumulated activity and radionuclide S values. Selection of an appropriate S value is generally limited to one of only three sources, all of which use as input the trabecular microstructure of an individual measured 25 years ago, and the tissue mass derived from different individuals measured 75 years ago. Our study proposed a new modeling approach to marrow dosimetry---the Paired Image Radiation Transport (PIRT) model---that properly accounts for both the trabecular microstructure and the cortical macrostructure of each skeletal site in a reference male radionuclide patient. The PIRT model, as applied within EGSnrc, requires two sets of input geometry: (1) an infinite voxel array of segmented microimages of the spongiosa acquired via microCT; and (2) a segmented ex-vivo CT image of the bone site macrostructure defining both the spongiosa (marrow, endosteum, and trabeculae) and the cortical bone cortex. Our study also proposed revising reference skeletal dosimetry models for the adult male cancer patient. Skeletal site-specific radionuclide S values were obtained for a 66-year-old male reference patient. The derivation for total skeletal S values were unique in that the necessary skeletal mass and electron dosimetry calculations were formulated from the same source bone site over the entire skeleton. We conclude that paired-image radiation-transport techniques provide an adoptable method by which the intricate, anisotropic trabecular microstructure of the skeletal site; and the physical size and shape of the bone can be handled together, for improved

  7. Combinatorial DNA Damage Pairing Model Based on X-Ray-Induced Foci Predicts the Dose and LET Dependence of Cell Death in Human Breast Cells

    SciTech Connect

    Vadhavkar, Nikhil; Pham, Christopher; Georgescu, Walter

    our model are based on experimental RIF and are three times larger than the hypothetical LEM voxel used to fit survival curves. Our model is therefore an alternative to previous approaches that provides a testable biological mechanism (i.e., RIF). In addition, we propose that DSB pairing will help develop more accurate alternatives to the linear cancer risk model (LNT) currently used for regulating exposure to very low levels of ionizing radiation.« less

  8. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    PubMed

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  9. Cooperative Lewis pairs based on late transition metals: activation of small molecules by platinum(0) and B(C6 F5 )3.

    PubMed

    Forrest, Sebastian J K; Clifton, Jamie; Fey, Natalie; Pringle, Paul G; Sparkes, Hazel A; Wass, Duncan F

    2015-02-09

    A Lewis basic platinum(0)-CO complex supported by a diphosphine ligand and B(C6 F5 )3 act cooperatively, in a manner reminiscent of a frustrated Lewis pair, to activate small molecules such as hydrogen, CO2 , and ethene. This cooperative Lewis pair facilitates the coupling of CO and ethene in a new way. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Modeling uncertainty and correlation in soil properties using Restricted Pairing and implications for ensemble-based hillslope-scale soil moisture and temperature estimation

    NASA Astrophysics Data System (ADS)

    Flores, A. N.; Entekhabi, D.; Bras, R. L.

    2007-12-01

    Soil hydraulic and thermal properties (SHTPs) affect both the rate of moisture redistribution in the soil column and the volumetric soil water capacity. Adequately constraining these properties through field and lab analysis to parameterize spatially-distributed hydrology models is often prohibitively expensive. Because SHTPs vary significantly at small spatial scales individual soil samples are also only reliably indicative of local conditions, and these properties remain a significant source of uncertainty in soil moisture and temperature estimation. In ensemble-based soil moisture data assimilation, uncertainty in the model-produced prior estimate due to associated uncertainty in SHTPs must be taken into account to avoid under-dispersive ensembles. To treat SHTP uncertainty for purposes of supplying inputs to a distributed watershed model we use the restricted pairing (RP) algorithm, an extension of Latin Hypercube (LH) sampling. The RP algorithm generates an arbitrary number of SHTP combinations by sampling the appropriate marginal distributions of the individual soil properties using the LH approach, while imposing a target rank correlation among the properties. A previously-published meta- database of 1309 soils representing 12 textural classes is used to fit appropriate marginal distributions to the properties and compute the target rank correlation structure, conditioned on soil texture. Given categorical soil textures, our implementation of the RP algorithm generates an arbitrarily-sized ensemble of realizations of the SHTPs required as input to the TIN-based Realtime Integrated Basin Simulator with vegetation dynamics (tRIBS+VEGGIE) distributed parameter ecohydrology model. Soil moisture ensembles simulated with RP- generated SHTPs exhibit less variance than ensembles simulated with SHTPs generated by a scheme that neglects correlation among properties. Neglecting correlation among SHTPs can lead to physically unrealistic combinations of parameters that

  11. Micellar and analytical implications of a new potentiometric PVC sensor based on neutra