Science.gov

Sample records for a1 heterogeneous nuclear

  1. Regulation of heterogenous nuclear ribonucleoprotein A1 transport by phosphorylation in cells stressed by osmotic shock

    PubMed Central

    Allemand, Eric; Guil, Sònia; Myers, Michael; Moscat, Jorge; Cáceres, Javier F.; Krainer, Adrian R.

    2005-01-01

    Heterogenous nuclear ribonucleoprotein (hnRNP) A1 is an alternative splicing factor that is mainly nuclear, although it shuttles rapidly between nuclear and cytoplasmic compartments. Cells stressed by osmotic shock (OSM) activate the mitogen-activated protein kinase kinase3/6-p38 signaling pathway, which in turn results in accumulation of hnRNP A1 in the cytoplasm. This effect modulates alternative splicing regulation in vivo and correlates with increased hnRNP A1 phosphorylation. We have characterized the molecular mechanism involved in the cytoplasmic accumulation of hnRNP A1 in NIH 3T3 cells subjected to OSM. This treatment results in serine-specific phosphorylation within a C-terminal peptide, dubbed the “F-peptide,” which is adjacent to the M9 motif that mediates bidirectional transport of hnRNP A1. Analysis of mutants in which the F-peptide serines were replaced by aspartic acids or alanines showed that F-peptide phosphorylation is required for the subcellular redistribution of hnRNP A1 in cells subjected to OSM. Furthermore, F-peptide phosphorylation modulates the interaction of hnRNP A1 with transportin Trn1. Our findings suggest that the phosphorylation of F-peptide by cell-signaling pathways regulates the rate of hnRNP A1 nuclear import. PMID:15738418

  2. Heterogeneous nuclear ribonucleoprotein A1 post-transcriptionally regulates Drp1 expression in neuroblastoma cells.

    PubMed

    Park, So Jung; Lee, Heejin; Jo, Doo Shin; Jo, Yoon Kyung; Shin, Ji Hyun; Kim, Han Byeol; Seo, Hae Mi; Rubinsztein, David C; Koh, Jae-Young; Lee, Eun Kyung; Cho, Dong-Hyung

    2015-12-01

    Excessive mitochondrial fission is associated with the pathogenesis of neurodegenerative diseases. Dynamin-related protein 1 (Drp1) possesses specific fission activity in the mitochondria and peroxisomes. Various post-translational modifications of Drp1 are known to modulate complex mitochondrial dynamics. However, the post-transcriptional regulation of Drp1 remains poorly understood. Here, we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) regulates Drp1 expression at the post-transcriptional level. hnRNP A1 directly interacts with Drp1 mRNA at its 3'UTR region, and enhances translation potential without affecting mRNA stability. Down-regulation of hnRNP A1 induces mitochondrial elongation by reducing Drp1 expression. Moreover, depletion of hnRNP A1 suppresses 3-NP-mediated mitochondrial fission and dysfunction. In contrast, over-expression of hnRNP A1 promotes mitochondrial fragmentation by increasing Drp1 expression. Additionally, hnRNP A1 significantly exacerbates 3-NP-induced mitochondrial dysfunction and cell death in neuroblastoma cells. Interestingly, treatment with 3-NP induces subcellular translocation of hnRNP A1 from the nucleus to the cytoplasm, which accelerates the increase in Drp1 expression in hnRNP A1 over-expressing cells. Collectively, our findings suggest that hnRNP A1 controls mitochondrial dynamics by post-transcriptional regulation of Drp1.

  3. The A1 and A1B proteins of heterogeneous nuclear ribonucleoparticles modulate 5' splice site selection in vivo.

    PubMed Central

    Yang, X; Bani, M R; Lu, S J; Rowan, S; Ben-David, Y; Chabot, B

    1994-01-01

    Recent in vitro results suggest that the heterogeneous nuclear ribonucleoparticle (hnRNP) A1 protein modulates alternative splicing by favoring distal 5' splice site (5'SS) selection and exon skipping. We used a mouse erythroleukemia (MEL) cell line (CB3C7) deficient in the expression of hnRNP A1 to test whether variations in hnRNP A1 and AlB protein levels affected alternative splicing in vivo. In contrast to A1-expressing MEL cell lines, CB3C7 cells preferentially selected the proximal 13S and 12S 5'SS on the adenovirus E1A pre-mRNA. Transiently expressing the A1 or A1B cDNA in CB3C7 cells shifted 5'SS selection toward the more distal 9S donor site. A1 protein synthesis was required for this effect since the expression of a mutated A1 cDNA did not affect 5'SS selection. These results demonstrate that in vivo variations in hnRNP A1 protein levels can influence 5'SS selection. Images PMID:8041722

  4. Muscle developmental defects in heterogeneous nuclear Ribonucleoprotein A1 knockout mice

    PubMed Central

    Liu, Ting-Yuan; Chen, Yu-Chia; Jong, Yuh-Jyh; Tsai, Huai-Jen; Lee, Chien-Chin; Chang, Ya-Sian; Chang, Jan-Gowth

    2017-01-01

    Heterogeneous ribonucleoprotein A1 (hnRNP A1) is crucial for regulating alternative splicing. Its integrated function within an organism has not, however, been identified. We generated hnRNP A1 knockout mice to study the role of hnRNP A1 in vivo. The knockout mice, hnRNP A1−/−, showed embryonic lethality because of muscle developmental defects. The blood pressure and heart rate of the heterozygous mice were higher than those of the wild-type mice, indicating heart function defects. We performed mouse exon arrays to study the muscle development mechanism. The processes regulated by hnRNP A1 included cell adhesion and muscle contraction. The expression levels of muscle development-related genes in hnRNP A1+/− mice were significantly different from those in wild-type mice, as detected using qRT-PCR. We further confirmed the alternative splicing patterns of muscle development-related genes including mef2c, lrrfip1, usp28 and abcc9. Alternative mRNA isoforms of these genes were increased in hnRNP A1+/− mice compared with wild-type mice. Furthermore, we revealed that the functionally similar hnRNP A2/B1 did not compensate for the expression of hnRNP A1 in organisms. In summary, our study demonstrated that hnRNP A1 plays a critical and irreplaceable role in embryonic muscle development by regulating the expression and alternative splicing of muscle-related genes. PMID:28077597

  5. Heterogeneous nuclear ribonucleoprotein A1 regulates rhythmic synthesis of mouse Nfil3 protein via IRES-mediated translation

    PubMed Central

    Kim, Hyo-Jin; Lee, Hwa-Rim; Seo, Ji-Young; Ryu, Hye Guk; Lee, Kyung-Ha; Kim, Do-Yeon; Kim, Kyong-Tai

    2017-01-01

    Nuclear factor, interleukin 3, regulated (Nfil3, also known as E4 Promoter-Binding Protein 4 (E4BP4)) protein is a transcription factor that binds to DNA and generally represses target gene expression. In the circadian clock system, Nfil3 binds to a D-box element residing in the promoter of clock genes and contributes to their robust oscillation. Here, we show that the 5′-untranslated region (5′-UTR) of Nfil3 mRNA contains an internal ribosome entry site (IRES) and that IRES-mediated translation occurs in a phase-dependent manner. We demonstrate that heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) binds to a specific region of Nfil3 mRNA and regulates IRES-mediated translation. Knockdown of hnRNP A1 almost completely abolishes protein oscillation without affecting mRNA oscillation. Moreover, we observe that intracellular calcium levels, which are closely related to bone formation, depend on Nfil3 levels in osteoblast cell lines. We suggest that the 5′-UTR mediated cap-independent translation of Nfil3 mRNA contributes to the rhythmic expression of Nfil3 by interacting with the RNA binding protein hnRNP A1. These data provide new evidence that the posttranscriptional regulation of clock gene expression is important during bone metabolism. PMID:28220845

  6. Heterogeneous nuclear ribonucleoprotein A1 regulates rhythmic synthesis of mouse Nfil3 protein via IRES-mediated translation.

    PubMed

    Kim, Hyo-Jin; Lee, Hwa-Rim; Seo, Ji-Young; Ryu, Hye Guk; Lee, Kyung-Ha; Kim, Do-Yeon; Kim, Kyong-Tai

    2017-02-21

    Nuclear factor, interleukin 3, regulated (Nfil3, also known as E4 Promoter-Binding Protein 4 (E4BP4)) protein is a transcription factor that binds to DNA and generally represses target gene expression. In the circadian clock system, Nfil3 binds to a D-box element residing in the promoter of clock genes and contributes to their robust oscillation. Here, we show that the 5'-untranslated region (5'-UTR) of Nfil3 mRNA contains an internal ribosome entry site (IRES) and that IRES-mediated translation occurs in a phase-dependent manner. We demonstrate that heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) binds to a specific region of Nfil3 mRNA and regulates IRES-mediated translation. Knockdown of hnRNP A1 almost completely abolishes protein oscillation without affecting mRNA oscillation. Moreover, we observe that intracellular calcium levels, which are closely related to bone formation, depend on Nfil3 levels in osteoblast cell lines. We suggest that the 5'-UTR mediated cap-independent translation of Nfil3 mRNA contributes to the rhythmic expression of Nfil3 by interacting with the RNA binding protein hnRNP A1. These data provide new evidence that the posttranscriptional regulation of clock gene expression is important during bone metabolism.

  7. Human Immunodeficiency Virus Type 1 (HIV-1) Induces the Cytoplasmic Retention of Heterogeneous Nuclear Ribonucleoprotein A1 by Disrupting Nuclear Import

    PubMed Central

    Monette, Anne; Ajamian, Lara; López-Lastra, Marcelo; Mouland, Andrew J.

    2009-01-01

    Human immunodeficiency virus type 1 (HIV-1) co-opts host proteins and cellular machineries to its advantage at every step of the replication cycle. Here we show that HIV-1 enhances heterogeneous nuclear ribonucleoprotein (hnRNP) A1 expression and promotes the relocalization of hnRNP A1 to the cytoplasm. The latter was dependent on the nuclear export of the unspliced viral genomic RNA (vRNA) and to alterations in the abundance and localization of the FG-repeat nuclear pore glycoprotein p62. hnRNP A1 and vRNA remain colocalized in the cytoplasm supporting a post-nuclear function during the late stages of HIV-1 replication. Consistently, we show that hnRNP A1 acts as an internal ribosomal entry site trans-acting factor up-regulating internal ribosome entry site-mediated translation initiation of the HIV-1 vRNA. The up-regulation and cytoplasmic retention of hnRNP A1 by HIV-1 would ensure abundant expression of viral structural proteins in cells infected with HIV-1. PMID:19737937

  8. Heterogeneous nuclear ribonucleoprotein A1 in health and neurodegenerative disease: from structural insights to post-transcriptional regulatory roles.

    PubMed

    Bekenstein, Uriya; Soreq, Hermona

    2013-09-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) are a family of conserved nuclear proteins that associate with nascent RNA polymerase II transcripts to yield hnRNP particles, playing key roles in mRNA metabolism, DNA-related functions and microRNA biogenesis. HnRNPs accompany transcripts from stages of transcriptional regulation through splicing and post-transcriptional regulation, and are believed to affect the majority of expressed genes in mammals. Most hnRNP mRNA transcripts undergo alternative splicing and post-translational modifications, to yield a remarkable diversity of proteins with numerous functional elements that work in concert in their multiple functions. Therefore, mis-regulation of hnRNPs leads to different maladies. Here, we focus on the role of one of the best-known members of this protein family, hnRNP A1 in RNA metabolism, and address recent works that note its multileveled involvement in several neurodegenerative disorders. Initially discovered as a DNA binding protein, hnRNP A1 includes two RNA recognition motifs, and post-translational modifications of these and other regions in this multifunctional protein alter both its nuclear pore shuttling properties and its RNA interactions and affect transcription, mRNA splicing and microRNA biogenesis. HnRNP A1 plays several key roles in neuronal functioning and its depletion, either due to debilitated cholinergic neurotransmission or under autoimmune reactions causes drastic changes in RNA metabolism. Consequently, hnRNP A1 decline contributes to the severity of symptoms in several neurodegenerative diseases, including Alzheimer's disease (AD), spinal muscular atrophy (SMA), fronto-temporal lobar degeneration (FTLD), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), hereditary spastic paraparesis (HSP) and HTLV-I associated myelopathy/tropical spastic paraparesis (HAM/TSP). At the translational level, these properties of hnRNP A1 led to massive research efforts aimed at developing RNA

  9. Modulation of exon skipping and inclusion by heterogeneous nuclear ribonucleoprotein A1 and pre-mRNA splicing factor SF2/ASF.

    PubMed Central

    Mayeda, A; Helfman, D M; Krainer, A R

    1993-01-01

    The essential splicing factor SF2/ASF and the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) modulate alternative splicing in vitro of pre-mRNAs that contain 5' splice sites of comparable strengths competing for a common 3' splice site. Using natural and model pre-mRNAs, we have examined whether the ratio of SF2/ASF to hnRNP A1 also regulates other modes of alternative splicing in vitro. We found that an excess of SF2/ASF effectively prevents inappropriate exon skipping and also influences the selection of mutually exclusive tissue-specific exons in natural beta-tropomyosin pre-mRNA. In contrast, an excess of hnRNP A1 does not cause inappropriate exon skipping in natural constitutively or alternatively spliced pre-mRNAs. Although hnRNP A1 can promote alternative exon skipping, this effect is not universal and is dependent, e.g., on the size of the internal alternative exon and on the strength of the polypyrimidine tract in the preceding intron. With appropriate alternative exons, an excess of SF2/ASF promotes exon inclusion, whereas an excess of hnRNP A1 causes exon skipping. We propose that in some cases the ratio of SF2/ASF to hnRNP A1 may play a role in regulating alternative splicing by exon inclusion or skipping through the antagonistic effects of these proteins on alternative splice site selection. Images PMID:8474457

  10. The human telomerase RNA component, hTR, activates the DNA-dependent protein kinase to phosphorylate heterogeneous nuclear ribonucleoprotein A1.

    PubMed

    Ting, Nicholas S Y; Pohorelic, Brant; Yu, Yaping; Lees-Miller, Susan P; Beattie, Tara L

    2009-10-01

    Telomere integrity in human cells is maintained by the dynamic interplay between telomerase, telomere associated proteins, and DNA repair proteins. These interactions are vital to suppress DNA damage responses and unfavorable changes in chromosome dynamics. The DNA-dependent protein kinase (DNA-PK) is critical for this process. Cells deficient for functional DNA-PKcs show increased rates of telomere loss, accompanied by chromosomal fusions and translocations. Treatment of cells with specific DNA-PK kinase inhibitors leads to similar phenotypes. These observations indicate that the kinase activity of DNA-PK is required for its function at telomeres possibly through phosphorylation of essential proteins needed for telomere length maintenance. Here we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a direct substrate for DNA-PK in vitro. Phosphorylation of hnRNP A1 is stimulated not only by the presence of DNA but also by the telomerase RNA component, hTR. Furthermore, we show that hnRNP A1 is phosphorylated in vivo in a DNA-PK-dependent manner and that this phosphorylation is greatly reduced in cell lines which lack hTR. These data are the first to report that hTR stimulates the kinase activity of DNA-PK toward a known telomere-associated protein, and may provide further insights into the function of DNA-PK at telomeres.

  11. Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1.

    PubMed

    Jain, Niyati; Morgan, Christopher E; Rife, Brittany D; Salemi, Marco; Tolbert, Blanton S

    2016-01-29

    Splicing patterns in human immunodeficiency virus type 1 (HIV-1) are maintained through cis regulatory elements that recruit antagonistic host RNA-binding proteins. The activity of the 3' acceptor site A7 is tightly regulated through a complex network of an intronic splicing silencer (ISS), a bipartite exonic splicing silencer (ESS3a/b), and an exonic splicing enhancer (ESE3). Because HIV-1 splicing depends on protein-RNA interactions, it is important to know the tertiary structures surrounding the splice sites. Herein, we present the NMR solution structure of the phylogenetically conserved ISS stem loop. ISS adopts a stable structure consisting of conserved UG wobble pairs, a folded 2X2 (GU/UA) internal loop, a UU bulge, and a flexible AGUGA apical loop. Calorimetric and biochemical titrations indicate that the UP1 domain of heterogeneous nuclear ribonucleoprotein A1 binds the ISS apical loop site-specifically and with nanomolar affinity. Collectively, this work provides additional insights into how HIV-1 uses a conserved RNA structure to commandeer a host RNA-binding protein.

  12. Chemical Proteomics Identifies Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1 as the Molecular Target of Quercetin in Its Anti-cancer Effects in PC-3 Cells*

    PubMed Central

    Ko, Chia-Chen; Chen, Yun-Ju; Chen, Chih-Ta; Liu, Yu-Chih; Cheng, Fong-Chi; Hsu, Kai-Chao; Chow, Lu-Ping

    2014-01-01

    Quercetin, a flavonoid abundantly present in plants, is widely used as a phytotherapy in prostatitis and prostate cancer. Although quercetin has been reported to have a number of therapeutic effects, the cellular target(s) responsible for its anti-cancer action has not yet been clearly elucidated. Here, employing affinity chromatography and mass spectrometry, we identified heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) as a direct target of quercetin. A specific interaction between quercetin and hnRNPA1 was validated by immunoblotting and in vitro binding experiments. We found that quercetin bound the C-terminal region of hnRNPA1, impairing the ability of hnRNPA1 to shuttle between the nucleus and cytoplasm and ultimately resulting in its cytoplasmic retention. In addition, hnRNPA1 was recruited to stress granules after treatment of cells with quercetin for up to 48 h, and the levels of cIAP1 (cellular inhibitor of apoptosis), an internal ribosome entry site translation-dependent protein, were reduced by hnRNPA1 regulation. This is the first report that anti-cancer effects of quercetin are mediated, in part, by impairing functions of hnRNPA1, insights that were obtained using a chemical proteomics strategy. PMID:24962584

  13. Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1*

    PubMed Central

    Jain, Niyati; Morgan, Christopher E.; Rife, Brittany D.; Salemi, Marco; Tolbert, Blanton S.

    2016-01-01

    Splicing patterns in human immunodeficiency virus type 1 (HIV-1) are maintained through cis regulatory elements that recruit antagonistic host RNA-binding proteins. The activity of the 3′ acceptor site A7 is tightly regulated through a complex network of an intronic splicing silencer (ISS), a bipartite exonic splicing silencer (ESS3a/b), and an exonic splicing enhancer (ESE3). Because HIV-1 splicing depends on protein-RNA interactions, it is important to know the tertiary structures surrounding the splice sites. Herein, we present the NMR solution structure of the phylogenetically conserved ISS stem loop. ISS adopts a stable structure consisting of conserved UG wobble pairs, a folded 2X2 (GU/UA) internal loop, a UU bulge, and a flexible AGUGA apical loop. Calorimetric and biochemical titrations indicate that the UP1 domain of heterogeneous nuclear ribonucleoprotein A1 binds the ISS apical loop site-specifically and with nanomolar affinity. Collectively, this work provides additional insights into how HIV-1 uses a conserved RNA structure to commandeer a host RNA-binding protein. PMID:26607354

  14. Chemical proteomics identifies heterogeneous nuclear ribonucleoprotein (hnRNP) A1 as the molecular target of quercetin in its anti-cancer effects in PC-3 cells.

    PubMed

    Ko, Chia-Chen; Chen, Yun-Ju; Chen, Chih-Ta; Liu, Yu-Chih; Cheng, Fong-Chi; Hsu, Kai-Chao; Chow, Lu-Ping

    2014-08-08

    Quercetin, a flavonoid abundantly present in plants, is widely used as a phytotherapy in prostatitis and prostate cancer. Although quercetin has been reported to have a number of therapeutic effects, the cellular target(s) responsible for its anti-cancer action has not yet been clearly elucidated. Here, employing affinity chromatography and mass spectrometry, we identified heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) as a direct target of quercetin. A specific interaction between quercetin and hnRNPA1 was validated by immunoblotting and in vitro binding experiments. We found that quercetin bound the C-terminal region of hnRNPA1, impairing the ability of hnRNPA1 to shuttle between the nucleus and cytoplasm and ultimately resulting in its cytoplasmic retention. In addition, hnRNPA1 was recruited to stress granules after treatment of cells with quercetin for up to 48 h, and the levels of cIAP1 (cellular inhibitor of apoptosis), an internal ribosome entry site translation-dependent protein, were reduced by hnRNPA1 regulation. This is the first report that anti-cancer effects of quercetin are mediated, in part, by impairing functions of hnRNPA1, insights that were obtained using a chemical proteomics strategy.

  15. Novel Pathological Role of hnRNPA1 (Heterogeneous Nuclear Ribonucleoprotein A1) in Vascular Smooth Muscle Cell Function and Neointima Hyperplasia.

    PubMed

    Zhang, Li; Chen, Qishan; An, Weiwei; Yang, Feng; Maguire, Eithne Margaret; Chen, Dan; Zhang, Cheng; Wen, Guanmei; Yang, Mei; Dai, Bin; Luong, Le Anh; Zhu, Jianhua; Xu, Qingbo; Xiao, Qingzhong

    2017-09-14

    hnRNPA1 (heterogeneous nuclear ribonucleoprotein A1) plays a variety of roles in gene expression. However, little is known about the functional involvement of hnRNPA1 in vascular smooth muscle cell (VSMC) function and neointima hyperplasia. In this study, we have attempted to investigate the functional roles of hnRNPA1 in the contexts of VSMC function, injury-induced vessel remodeling, and human atherosclerotic lesions, as well as discern the molecular mechanisms involved. APPROACH AND RESULTS: hnRNPA1 expression levels were consistently modulated during VSMC phenotype switching and neointimal lesion formation induced by wire injury. Functional studies showed that VSMC-specific gene expression, proliferation, and migration were regulated by hnRNPA1. Our data show that hnRNPA1 exerts its effects on VSMC functions through modulation of IQGAP1 (IQ motif containing GTPase activating protein 1). Mechanistically, hnRNPA1 regulates IQGAP1 mRNA degradation through 2 mechanisms: upregulating microRNA-124 (miR-124) and binding to AU-rich element of IQGAP1 gene. Further evidence suggests that hnRNPA1 upregulates miR-124 by modulating miR-124 biogenesis and that IQGAP1 is the authentic target gene of miR-124. Importantly, ectopic overexpression of hnRNPA1 greatly reduced VSMC proliferation and inhibited neointima formation in wire-injured carotid arteries. Finally, lower expression levels of hnRNPA1 and miR-124, while higher expression levels of IQGAP1, were observed in human atherosclerotic lesions. Our data show that hnRNPA1 is a critical regulator of VSMC function and behavior in the context of neointima hyperplasia, and the hnRNPA1/miR-124/IQGAP1 regulatory axis represents a novel therapeutic target for the prevention of cardiovascular diseases. © 2017 The Authors.

  16. p38 MAP kinase-dependent regulation of the expression level and subcellular distribution of heterogeneous nuclear ribonucleoprotein A1 and its involvement in cellular senescence in normal human fibroblasts

    PubMed Central

    Shimada, Naoko; Rios, Ileana; Moran, Heriberto; Sayers, Brendan; Hubbard, Karen

    2010-01-01

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a RNA binding protein that plays important role in the biogenesis of mRNA, such as alternative splicing and mRNA stability. We have previously demonstrated that hnRNP A1 has diminished protein levels and shows cytoplasmic accumulation in senescent human diploid fibroblasts. Recent reports showed that p38 MAP kinase (p38 MAPK), a member of the MAP kinase family is necessary and sufficient for the cytoplasmic accumulation of hnRNP A1 by stress stimuli such as osmotic shock. p38 MAP kinase has been shown to be involved in cell proliferation and the induction of senescence in response to extracellular stimuli. However, the relationship between hnRNP A1 and p38 MAPK and the roles of hnRNP A1 in cellular senescence have not yet been elucidated. Here we show that hnRNP A1 forms a complex with phospho-p38 MAPK in vivo. Inhibition of p38 MAPK activity with SB203580 elevated hnRNP A1 protein levels and prohibited the cytoplasmic accumulation of the protein, but not hnRNP A2, in senescent cells. The phosphorylation level of hnRNP A1 was elevated in senescent cells. Reduction of hnRNP A1 and A2 levels by siRNA transfection induced a senescence-like morphology and elevated the level of F-actin, a marker of senescence. These results suggest that the expression levels and subcellular distribution of hnRNP A1 are regulated in a p38 MAPK-dependent manner, probably via its phosphorylation. Our results also suggest that hnRNP A2 in addition to hnRNP A1 may play a role in establishing the senescence phenotype. PMID:19430204

  17. HIGH TEMPERATURE, HIGH POWER HETEROGENEOUS NUCLEAR REACTOR

    DOEpatents

    Hammond, R.P.; Wykoff, W.R.; Busey, H.M.

    1960-06-14

    A heterogeneous nuclear reactor is designed comprising a stationary housing and a rotatable annular core being supported for rotation about a vertical axis in the housing, the core containing a plurality of radial fuel- element supporting channels, the cylindrical empty space along the axis of the core providing a central plenum for the disposal of spent fuel elements, the core cross section outer periphery being vertically gradated in radius one end from the other to provide a coolant duct between the core and the housing, and means for inserting fresh fuel elements in the supporting channels under pressure and while the reactor is in operation.

  18. The expression profile of RNA-binding proteins in primary and metastatic colorectal cancer: relationship of heterogeneous nuclear ribonucleoproteins with prognosis.

    PubMed

    Hope, Nicholas R; Murray, Graeme I

    2011-03-01

    The heterogeneous nuclear ribonucleoproteins are a group of RNA-binding proteins with a range of key cellular functions, which are dysregulated in tumorigenesis including regulation of translational and RNA processing. The aims of this study were to define the heterogeneous nuclear ribonucleoprotein expression profile in primary and metastatic colorectal cancer and to establish the clinicopathologic significance of this expression. A tissue microarray containing 515 primary colorectal cancers, 224 lymph node metastasis of colorectal cancer, and 50 normal colon samples was immunostained for 6 heterogeneous nuclear ribonucleoproteins. Heterogeneous nuclear ribonucleoprotein I, heterogeneous nuclear ribonucleoprotein K, and heterogeneous nuclear ribonucleoprotein L displayed the most frequent strong immunoreactivity in primary colorectal tumor samples. Heterogeneous nuclear ribonucleoprotein A1 (P < .001) and heterogeneous nuclear ribonucleoprotein U (P = .003) showed significant alterations in nuclear expression in tumors compared with normal colonic epithelium, whereas heterogeneous nuclear ribonucleoprotein A1 (P = .001), heterogeneous nuclear ribonucleoprotein I (P < .001), and heterogeneous nuclear ribonucleoprotein K (P < .001) all showed significant aberrant cytoplasmic immunoreactivity in tumor cells. There were also significant differences in cytoplasmic immunoreactivity between the primary tumor and the corresponding lymph node metastasis for heterogeneous nuclear ribonucleoprotein A1 (P = .001), heterogeneous nuclear ribonucleoprotein I (P < .001), and heterogeneous nuclear ribonucleoprotein K (P = .001). Nuclear heterogeneous nuclear ribonucleoprotein H (χ(2) = 72.1; P < .001), cytoplasmic heterogeneous nuclear ribonucleoprotein I (χ(2) = 28.1; P < .001), and cytoplasmic heterogeneous nuclear ribonucleoprotein K (χ(2) = 13.2; P = .04) all showed significant associations with tumor stage. There was a significant relationship between strong nuclear

  19. Mechanistic Control of Carcinoembryonic Antigen-related Cell Adhesion Molecule-1 (CEACAM1) Splice Isoforms by the Heterogeneous Nuclear Ribonuclear Proteins hnRNP L, hnRNP A1, and hnRNP M*

    PubMed Central

    Dery, Kenneth J.; Gaur, Shikha; Gencheva, Marieta; Yen, Yun; Shively, John E.; Gaur, Rajesh K.

    2011-01-01

    Carcinoembryonic antigen-related cell adhesion molecule-1 (CEACAM1) is expressed in a variety of cell types and is implicated in carcinogenesis. Alternative splicing of CEACAM1 pre-mRNA generates two cytoplasmic domain splice variants characterized by the inclusion (L-isoform) or exclusion (S-isoform) of exon 7. Here we show that the alternative splicing of CEACAM1 pre-mRNA is regulated by novel cis elements residing in exon 7. We report the presence of three exon regulatory elements that lead to the inclusion or exclusion of exon 7 CEACAM1 mRNA in ZR75 breast cancer cells. Heterologous splicing reporter assays demonstrated that the maintenance of authentic alternative splicing mechanisms were independent of the CEACAM1 intron sequence context. We show that forced expression of these exon regulatory elements could alter CEACAM1 splicing in HEK-293 cells. Using RNA affinity chromatography, three members of the heterogeneous nuclear ribonucleoprotein family (hnRNP L, hnRNP A1, and hnRNP M) were identified. RNA immunoprecipitation of hnRNP L and hnRNP A1 revealed a binding motif located central and 3′ to exon 7, respectively. Depletion of hnRNP A1 or L by RNAi in HEK-293 cells promoted exon 7 inclusion, whereas overexpression led to exclusion of the variable exon. By contrast, overexpression of hnRNP M showed exon 7 inclusion and production of CEACAM1-L mRNA. Finally, stress-induced cytoplasmic accumulation of hnRNP A1 in MDA-MB-468 cells dynamically alters the CEACAM1-S:CEACAM1:L ratio in favor of the l-isoform. Thus, we have elucidated the molecular factors that control the mechanism of splice-site recognition in the alternative splicing regulation of CEACAM1. PMID:21398516

  20. Serine/Arginine-Rich Splicing Factor 3 and Heterogeneous Nuclear Ribonucleoprotein A1 Regulate Alternative RNA Splicing and Gene Expression of Human Papillomavirus 18 through Two Functionally Distinguishable cis Elements

    PubMed Central

    Ajiro, Masahiko; Tang, Shuang; Doorbar, John

    2016-01-01

    ABSTRACT Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. IMPORTANCE Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been

  1. Serine/Arginine-Rich Splicing Factor 3 and Heterogeneous Nuclear Ribonucleoprotein A1 Regulate Alternative RNA Splicing and Gene Expression of Human Papillomavirus 18 through Two Functionally Distinguishable cis Elements.

    PubMed

    Ajiro, Masahiko; Tang, Shuang; Doorbar, John; Zheng, Zhi-Ming

    2016-10-15

    Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been discovered in this

  2. Saw palmetto extract induces nuclear heterogeneity in mice.

    PubMed

    Trinachartvanit, Wachareeporn; Francis, Bettina M; Rayburn, A Lane

    2009-01-01

    Saw palmetto (SW), a phytotherapeutic compound used in the treatment of prostate disease, was examined for potential nuclear effects. SW extract was incorporated into a complete casein-based semisynthetic rodent chow at 0%, 0.1% and 1% SW. SW was fed to mice for 6 weeks, after which the mice received a single i/p injection of either the known genotoxic agent methyl methanesulfonate (MMS) in saline or just saline. Forty-eight hours after injection, blood and bone marrow were collected for flow cytometric analysis. A significant effect of MMS was observed in both male and female mice with respect to: an increase in nuclear heterogeneity in bone marrow cells as measured by the coefficient of variation of the G1 peak in a flow histogram (6.32 versus 4.8 in male mice, 7.0 versus 4.9 in female mice) and an increase in the number of micronucleated blood cells (3.4% versus 0.56% male mice, 3.1% versus 0.6 in female mice) indicating a positive genotoxic response. SW also appears to increase the heterogeneity of bone marrow nuclei in a dose dependent manner (0-5.1%, 0.1-5.5% and 1-5.7% in male mice, 0-5.7%, 0.1-6.0% and 1-6.2% in female mice) without a concomitant increase in blood cell micronuclei. These results indicate that SW is not genotoxic with respect to physical DNA damage and that the changes observed in the bone marrow are due to chromatin conformation modifications in the nuclei of in vivo treated mouse cells.

  3. Heterogeneous Nuclear Reactor Models for Optimal Xenon Control.

    NASA Astrophysics Data System (ADS)

    Gondal, Ishtiaq Ahmad

    Nuclear reactors are generally modeled as homogeneous mixtures of fuel, control, and other materials while in reality they are heterogeneous-homogeneous configurations comprised of fuel and control rods along with other materials. Similarly, for space-time studies of a nuclear reactor, homogeneous, usually one-group diffusion theory, models are used, and the system equations are solved by either nodal or modal expansion approximations. Study of xenon-induced problems has also been carried out using similar models and with the help of dynamic programming or classical calculus of variations or the minimum principle. In this study a thermal nuclear reactor is modeled as a two-dimensional lattice of fuel and control rods placed in an infinite-moderator in plane geometry. The two-group diffusion theory approximation is used for neutron transport. Space -time neutron balance equations are written for two groups and reduced to one space-time algebraic equation by using the two-dimensional Fourier transform. This equation is written at all fuel and control rod locations. Iodine -xenon and promethium-samarium dynamic equations are also written at fuel rod locations only. These equations are then linearized about an equilibrium point which is determined from the steady-state form of the original nonlinear system equations. After studying poisonless criticality, with and without control, and the stability of the open-loop system and after checking its controllability, a performance criterion is defined for the xenon-induced spatial flux oscillation problem in the form of a functional to be minimized. Linear -quadratic optimal control theory is then applied to solve the problem. To perform a variety of different additional useful studies, this formulation has potential for various extensions and variations; for example, different geometry of the problem, with possible extension to three dimensions, heterogeneous -homogeneous formulation to include, for example, homogeneously

  4. A nuclear localization domain in the hnRNP A1 protein

    PubMed Central

    1995-01-01

    The heterogeneous nuclear RNP (hnRNP) A1 protein is one of the major pre-mRNA/mRNA binding proteins in eukaryotic cells and one of the most abundant proteins in the nucleus. It is localized to the nucleoplasm and it also shuttles between the nucleus and the cytoplasm. The amino acid sequence of A1 contains two RNP motif RNA-binding domains (RBDs) at the amino terminus and a glycine-rich domain at the carboxyl terminus. This configuration, designated 2x RBD-Gly, is representative of perhaps the largest family of hnRNP proteins. Unlike most nuclear proteins characterized so far, A1 (and most 2x RBD-Gly proteins) does not contain a recognizable nuclear localization signal (NLS). We have found that a segment of ca. 40 amino acids near the carboxyl end of the protein (designated M9) is necessary and sufficient for nuclear localization; attaching this segment to the bacterial protein beta- galactosidase or to pyruvate kinase completely localized these otherwise cytoplasmic proteins to the nucleus. The RBDs and another RNA binding motif found in the glycine-rich domain, the RGG box, are not required for A1 nuclear localization. M9 is a novel type of nuclear localization domain as it does not contain sequences similar to classical basic-type NLS. Interestingly, sequences similar to M9 are found in other nuclear RNA-binding proteins including hnRNP A2. PMID:7730395

  5. Higher expression of the heterogeneous nuclear ribonucleoprotein k in melanoma.

    PubMed

    Wen, Fushi; Shen, Alex; Shanas, Reneé; Bhattacharyya, Achyut; Lian, Fangru; Hostetter, Galen; Shi, Jiaqi

    2010-10-01

    The heterogeneous nuclear ribonucleoprotein (hnRNP) K is an essential RNA and DNA binding protein involved in gene expression and signal transduction. The role of hnRNP K in cancer is relatively understudied. However, several cellular functions strongly indicate that hnRNP K is involved in tumorigenesis. Oncogenes c-Src, c-myc, and eIF4E are regulated by hnRNP K. We have shown an increased cytoplasmic hnRNP K in pancreatic cancer. In the present study, we investigated the altered expression of hnRNP K protein and its correlation with p-ERK in melanoma using human melanoma cell lines and tissue microarray. The protein levels of hnRNP K and p-ERK in 8 human melanoma cell lines and a melanoma progression tissue microarray containing 80 melanoma, 23 dysplastic nevi, and 14 benign nevi specimens were analyzed using Western blot and immunohistochemistry analysis. hnRNP K was knocked down by siRNA, and its effect on melanoma cells was assessed. We showed a higher hnRNP K protein level in both melanoma cell lines and melanoma tissue specimens, which correlated with a higher c-myc expression. An increase in the cytoplasmic hnRNP K and eIF4E protein levels in melanoma cells is also seen. p-ERK level was also higher in dysplastic nevi and melanoma tissues, but did not correlate with hnRNP K protein level. We then demonstrated that knocking down of hnRNP K by siRNA inhibited melanoma cell growth and colony formation, as well as c-myc expression. hnRNP K expression correlated with melanoma and may play a role in melanoma tumorigenesis.

  6. A chicken mRNA similar to heterogeneous nuclear ribonucleoprotein H1.

    PubMed

    Mozdziak, Paul E; Giamario, Carol; Dibner, Julia J; McCoy, Darell W

    2004-01-01

    Heterogeneous nuclear ribonucleoproteins are predominantly nuclear RNA-binding proteins that function in a variety of cellular activities. The objective of these experiments was to clone a cDNA for a chicken protein similar to other previously reported heterogeneous ribonucleoproteins for other species. The 5' and 3' ends of the chicken mRNA were cloned using Rapid Amplification of cDNA Ends (RACE). Subsequently, the expression of the mRNA sequence was confirmed via Northern analysis. The deduced amino acid sequence was approximately 86% identical to corresponding regions of human, mouse, or zebrafish proteins similar to heterogeneous nuclear ribonucleoprotein H1. The expression data confirmed the size of the predicted mRNA sequence. The newly identified sequence may be employed in future studies aimed at understanding the role of heterogeneous nuclear ribonucleoproteins in avian species.

  7. Heterokaryotic nuclear conditions and a heterogeneous nuclear population are observed by flow cytometry in Phytophthora infestans.

    PubMed

    Catal, Mursel; King, Louis; Tumbalam, Pavani; Wiriyajitsomboon, Prissana; Kirk, William W; Adams, Gerard C

    2010-08-01

    A simple and reliable method for preparation of whole nuclei of a common oomycete, Phytophthora infestans, is described for laser flow cytometry. The ease of preparation, the absence of detectable debris and aggregates, and the precision in determinations of DNA content per nucleus improve interpretation and understanding of the genetics of the organism. Phytophthora infestans is the pathogen that causes potato and tomato late blight. The genetic flexibility of P. infestans and other oomycete pathogens has complicated understanding of the mechanisms of variation contributing to shifts in race structure and virulence profiles on important agricultural crops. Significant phenotypic and genotypic changes are being reported in the apparent absence of sexual recombination in the field. Laser flow cytometry with propidium iodide is useful in investigating the nuclear condition of the somatic colony of field strains of P. infestans. The majority of the studied strains contain a single population of nuclei in nonreplicated diplophase. However, mean DNA content per nucleus varies considerably among isolates confirming the heterogeneity of the nuclear population in regard to C-value, for field isolates. Nuclear DNA content varies from 1.75x to 0.75x that of nuclei in a standard strain from central Mexico. Some strains contain two to three populations of nuclei with differing DNA contents in the mycelium and are heterokaryons. Such a range in DNA content suggests DNA-aneuploidy, but direct confirmation of aneuploidy will require microscopy of chromosomes. Heterokaryosis and populations of nuclei of differing DNA content necessarily confound standardized assays used worldwide in crop breeding programs for determination of race profiles and virulence phenotypes of this important pathogen.

  8. Quantitative tumor heterogeneity assessment on a nuclear population basis.

    PubMed

    Wessel Lindberg, Anne-Sofie; Conradsen, Knut; Larsen, Rasmus; Friis Lippert, Michael; Røge, Rasmus; Vyberg, Mogens

    2017-01-31

    Immunohistochemistry Ki-67 stain is widely used for visualizing cell proliferation. The common method for scoring the proliferation is to manually select and score a hot spot. This method is time-consuming and will often not give reproducible results due to subjective selection of the hotspots and subjective scoring. An automatic hotspot detection and proliferative index scoring would be time-saving, make the determination of the Ki-67 score easier and minimize the uncertainty of the score by introducing a more objective and standardized score. Tissue Micro Array cores stained for Ki-67 and their neighbor slide stained for Pan Cytokeratin were aligned and Ki-67 positive and negative nuclei were identified inside tumor regions. A heatmap was calculated based on these and illustrates the distribution of the heterogenous response of Ki-67 positive nuclei in the tumor tissue. An automatic hot spot detection was developed and the Ki-67 score was calculated. All scores were compared with scores provided by a pathologist using linear regression models. No significant difference was found between the Ki-67 scores guided by the developed heatmap and the scores provided by a pathologist. For comparison, scores were also calculated at a random place outside the hot spot and these scores were found to be significantly different from the pathologist scores. A heatmap visualizing the heterogeneity in tumor tissue expressed by Ki-67 was developed and used for an automatic identification of hot spots in which a Ki-67 score was calculated. The Ki-67 scores did not differ significantly from scores provided by a pathologist. © 2017 International Society for Advancement of Cytometry.

  9. Inferring Diffusion Dynamics from FCS in Heterogeneous Nuclear Environments

    PubMed Central

    Tsekouras, Konstantinos; Siegel, Amanda P.; Day, Richard N.; Pressé, Steve

    2015-01-01

    Fluorescence correlation spectroscopy (FCS) is a noninvasive technique that probes the diffusion dynamics of proteins down to single-molecule sensitivity in living cells. Critical mechanistic insight is often drawn from FCS experiments by fitting the resulting time-intensity correlation function, G(t), to known diffusion models. When simple models fail, the complex diffusion dynamics of proteins within heterogeneous cellular environments can be fit to anomalous diffusion models with adjustable anomalous exponents. Here, we take a different approach. We use the maximum entropy method to show—first using synthetic data—that a model for proteins diffusing while stochastically binding/unbinding to various affinity sites in living cells gives rise to a G(t) that could otherwise be equally well fit using anomalous diffusion models. We explain the mechanistic insight derived from our method. In particular, using real FCS data, we describe how the effects of cell crowding and binding to affinity sites manifest themselves in the behavior of G(t). Our focus is on the diffusive behavior of an engineered protein in 1) the heterochromatin region of the cell’s nucleus as well as 2) in the cell’s cytoplasm and 3) in solution. The protein consists of the basic region-leucine zipper (BZip) domain of the CCAAT/enhancer-binding protein (C/EBP) fused to fluorescent proteins. PMID:26153697

  10. Nuclear estrogen receptor molecular heterogeneity in the mouse uterus

    SciTech Connect

    Golding, T.S.; Korach, K.S.

    1988-01-01

    Holomeric estrogen receptor (ER) prepared from ovariectomized mouse uteri displays heterogeneous electrophoretic mobility when analyzed by NaDodSO/sub 4//PAGE. ER derived from nuclei (ER/sub n/) appears as a closely spaced doublet having apparent molecular masses of 66.4 and 65 kDa, while ER from the cytosolic compartment (ER/sub c/) has a single band of 65 kDa. Both partially purified ER/sub c/ and the 8S form of unactivated ER/sub c/ show only the 65-kDa band. The appearance of the ER/sub n/ doublet is hormonally inducible, and the relative proportions of the two doublet bands are influenced by the type of hormone treatment, with weakly estrogenic compounds yielding the lower band as predominant while potent estrogens increase the proportion of the upper band. Steroid binding of the ER/sub n/ doublet was determined by (/sup 3/H)tamoxifen aziridine affinity labeling of both the 66.4- and the 65-kDa peptides; binding to the 65-kDa peptide was predominant. The ER/sub n/ doublet displays a time dependency after estrogen administration with maximal amounts occurring in a bimodal fashion at 1 and 8 hr.

  11. Small nuclear ribonucleoproteins and heterogeneous nuclear ribonucleoproteins in the amphibian germinal vesicle: loops, spheres, and snurposomes

    PubMed Central

    1991-01-01

    We have examined the distribution of snRNPs in the germinal vesicle (GV) of frogs and salamanders by immunofluorescent staining and in situ nucleic acid hybridization. The major snRNAs involved in pre-mRNA splicing (U1, U2, U4, U5, and U6) occur together in nearly all loops of the lampbrush chromosomes, and in hundreds to thousands of small granules (1-4 microns diameter) suspended in the nucleoplasm. The loops and granules also contain several antigens that are regularly associated with snRNAs or spliceosomes (the Sm antigen, U1- and U2- specific antigens, and the splicing factor SC35). A second type of granule, often distinguishable by morphology, contains only U1 snRNA and associated antigens. We propose the term "snurposome" to describe the granules that contain snRNPs ("snurps"). Those that contain only U1 snRNA are A snurposomes, whereas those that contain all the splicing snRNAs are B snurposomes. GVs contain a third type of snRNP granule, which we call the C snurposome. C snurposomes range in size from less than 1 micron to giant structures greater than 20 microns in diameter. Usually, although not invariably, they have B snurposomes on their surface. They may also contain from one to hundreds of inclusions. Because of their remarkably spherical shape, C snurposomes with their associated B snurposomes have long been referred to as spheres or sphere organelles. Most spheres are free in the nucleoplasm, but a few are attached to chromosomes at specific chromosome loci, the sphere organizers (SOs). The relationship of sphere organelles to other snRNP- containing structures in the GV is obscure. We show by immunofluorescent staining that the lampbrush loops and B snurposomes also react with antibodies against heterogeneous nuclear ribonucleoproteins (hnRNPs). Transcription units on the loops are uniformly stained by anti-hnRNP and anti-snRNP antibodies, suggesting that nascent transcripts are associated with hnRNPs and snRNPs along their entire length, perhaps

  12. Communication: Heterogeneous water dynamics on a clathrate hydrate lattice detected by multidimensional oxygen nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Adjei-Acheamfour, Mischa; Storek, Michael; Böhmer, Roland

    2017-05-01

    Previous deuteron nuclear magnetic resonance studies revealed conflicting evidence regarding the possible motional heterogeneity of the water dynamics on the hydrate lattice of an ice-like crystal. Using oxygen-17 nuclei as a sensitive quadrupolar probe, the reorientational two-time correlation function displays a clear nonexponentiality. To check whether this dispersive behavior is a consequence of dynamic heterogeneity or rather of an intrinsic nonexponentiality, a multidimensional, four-time magnetic resonance experiment was devised that is generally applicable to strongly quadrupolarly perturbed half-integer nuclei such as oxygen-17. Measurements of an appropriate four-time function demonstrate that it is possible to select a subensemble of slow water molecules. Its mean time scale is compared to theoretical predictions and evidence for significant motional heterogeneity is found.

  13. Heat transfer analysis of fuel assemblies in a heterogeneous gas core nuclear rocket

    NASA Technical Reports Server (NTRS)

    Watanabe, Yoichi; Appelbaum, Jacob; Diaz, Nils; Maya, Isaac

    1991-01-01

    Heat transfer problems of a heterogeneous gaseous core nuclear rocket were studied. The reactor core consists of 1.5-m long hexagonal fuel assemblies filled with pressurized uranium tetrafluoride (UF4) gas. The fuel gas temperature ranges from 3500 to 7000 K at a nominal operating condition of 40 atm. Each fuel assembly has seven coolant tubes, through which hydrogen propellant flows. The propellant temperature is not constrained by the fuel temperature but by the maximum temperature of the graphite coolant tube. For a core achieving a fission power density of 1000 MW/cu m, the propellant core exit temperature can be as high as 3200 K. The physical size of a 1250 MW gaseous core nuclear rocket is comparable with that of a NERVA-type solid core nuclear rocket. The engine can deliver a specific impulse of 1020 seconds and a thrust of 330 kN.

  14. Heat transfer analysis of fuel assemblies in a heterogeneous gas core nuclear rocket

    NASA Technical Reports Server (NTRS)

    Watanabe, Yoichi; Appelbaum, Jacob; Diaz, Nils; Maya, Isaac

    1991-01-01

    Heat transfer problems of a heterogeneous gaseous core nuclear rocket were studied. The reactor core consists of 1.5-m long hexagonal fuel assemblies filled with pressurized uranium tetrafluoride (UF4) gas. The fuel gas temperature ranges from 3500 to 7000 K at a nominal operating condition of 40 atm. Each fuel assembly has seven coolant tubes, through which hydrogen propellant flows. The propellant temperature is not constrained by the fuel temperature but by the maximum temperature of the graphite coolant tube. For a core achieving a fission power density of 1000 MW/cu m, the propellant core exit temperature can be as high as 3200 K. The physical size of a 1250 MW gaseous core nuclear rocket is comparable with that of a NERVA-type solid core nuclear rocket. The engine can deliver a specific impulse of 1020 seconds and a thrust of 330 kN.

  15. Antibodies specific for Epstein-Barr virus nuclear antigen-1 cross-react with human heterogeneous nuclear ribonucleoprotein L

    PubMed Central

    Lindsey, J. William; deGannes, Samantha L.; Pate, Kimberly A.; Zhao, Xiurong

    2015-01-01

    Epstein-Barr virus (EBV) is associated with multiple sclerosis (MS), and antibodies to the EBV nuclear antigen-1 (EBNA-1) are consistently increased in MS patients. The hypothesis of this study is that anti-EBNA-1 antibodies cross-react with a self antigen in MS patients. We affinity purified anti-EBNA-1 antibodies from human plasma, used the anti-EBNA-1 to immunoprecipitate antigens from human brain, and identified bound antigens with mass spectrometry. Anti-EBNA-1 consistently bound heterogeneous nuclear ribonucleoprotein L (HNRNPL). We expressed both the long and short isoforms of this protein, and verified with Western blots and ELISA that the long isoform cross-reacts with EBNA-1. Immunohistochemistry demonstrated that anti-EBNA-1 bound to an antigen in the nucleus of cultured rat central nervous system cells. ELISA demonstrated the presence of antibodies to HNRNPL in the plasma of both healthy controls and MS patients, but anti-HNRNPL was not increased in MS patients. We conclude that HNRNPL is an autoantigen which cross-reacts with EBNA-1. The relevance of this autoantigen to MS and other autoimmune diseases remains to be investigated. PMID:26637929

  16. Antibodies specific for Epstein-Barr virus nuclear antigen-1 cross-react with human heterogeneous nuclear ribonucleoprotein L.

    PubMed

    Lindsey, J William; deGannes, Samantha L; Pate, Kimberly A; Zhao, Xiurong

    2016-01-01

    Epstein-Barr virus (EBV) is associated with multiple sclerosis (MS), and antibodies to the EBV nuclear antigen-1 (EBNA-1) are consistently increased in MS patients. The hypothesis of this study is that anti-EBNA-1 antibodies cross-react with a self antigen in MS patients. We affinity purified anti-EBNA-1 antibodies from human plasma, used the anti-EBNA-1 to immunoprecipitate antigens from human brain, and identified bound antigens with mass spectrometry. Anti-EBNA-1 consistently bound heterogeneous nuclear ribonucleoprotein L (HNRNPL). We expressed both the long and short isoforms of this protein, and verified with Western blots and ELISA that the long isoform cross-reacts with EBNA-1. Immunohistochemistry demonstrated that anti-EBNA-1 bound to an antigen in the nucleus of cultured rat central nervous system cells. ELISA demonstrated the presence of antibodies to HNRNPL in the plasma of both healthy controls and MS patients, but anti-HNRNPL was not increased in MS patients. We conclude that HNRNPL is an autoantigen which cross-reacts with EBNA-1. The relevance of this autoantigen to MS and other autoimmune diseases remains to be investigated. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Ribosome-dependent conversion of polyA-containing heterogenous nuclear RNA into smaller RNA molecules.

    PubMed Central

    Grozdanovic, J; Hradec, J

    1975-01-01

    The polyA-containing heterogenous nuclear RNA fraction separated from total rat liver nRNA by gel filtration on Sepharose 4B followed by affinity chromatography on polyU-Sepharose and containing predominantly the 45S components becomes enzymatically bound to homologous 80S ribosomes and polyribosomes at 0 degree C. If 80S ribosomes or polyribosomes with bound poly-a-containing HnRNA are subjected to a further incubation at 37 degree C, the original 45S RNA is gradually converted into smaller RNA species of 10- 35S which remain bound to the particle. This ribosome-dependent cleavage of larger HnRNA species into smaller RNA molecules may represent the ultimate step of mRNA maturation. PMID:1144064

  18. Recognition of subsets of the mammalian A/B-type core heterogeneous nuclear ribonucleoprotein polypeptides by novel autoantibodies.

    PubMed Central

    Dangli, A; Plomaritoglou, A; Boutou, E; Vassiliadou, N; Moutsopoulos, H M; Guialis, A

    1996-01-01

    The structurally related A/B-type core heterogeneous nuclear ribonucleoprotein (hnRNP) polypeptides of 34-39 kDa (A1, A2, B1 and B2) belong to a family of RNA-binding proteins that are major components of 40 S hnRNP complexes. By two-dimensional gel electrophoresis and peptide mapping analysis we compared each member of the A/B-type core proteins in the human and rat liver cells. This comparison revealed the unique presence in rat cells of major protein species, referred to as mBx polypeptides, that appeared as three charge isoforms at a position corresponding to the minor HeLa B1b protein spot. In addition, clear differences in the ratios of the A1 polypeptide to the A1b isoform were observed. The detection, in sera of patients with rheumatic autoimmune diseases, of two novel autoantibody specificities, one recognizing solely B2 protein and the second both the B2 and mBx polypeptides, helped to identify mBx proteins as new A/B-type hnRNP components, immunologically related to B2 protein. A common immunoreactive V8 protease peptide of approx. 17 kDa has been identified in B2 and mBx hnRNP polypeptides. mBx protein species are identified in cells of murine origin, and have a ubiquitous tissue distribution and developmental appearance. PMID:9003360

  19. N-methylation of the heterogeneous nuclear ribonucleoproteins in HeLa cells

    SciTech Connect

    Rieker, J.P.

    1984-01-01

    Several of the core proteins on the 40S heterogeneous nuclear ribonucleoprotein particles (hnRNP) from HeLa cells contain N/sup G/,N/sup G/-dimethyl-L-arginine (uDMA). 3-deazaadenosine (c/sup 3/Ado), an inhibitor of and substrate for s-adenosyl-L-homocysteine hydrolase, has been used to study the methylation patterns of the individual polypeptides. Trimethyllysine and uDMA formation in total cellular protein were inhibited in the presence of the drug while other methylated basic amino acids were unaffected. This inhibition was reversed within 60 min after removal of the drug from the medium. Monolayer HeLa cultures were incubated with (methyl-/sup 3/H)-L-methoinine for 12 hours in the presence of 50 uM c/sup 3/Ado. Purified particles were obtained by centrifugation of nuclear extracts on sucrose density gradients. The core proteins were isolated by two-dimensional gel electrophoresis, acid hydrolyzed and analyzed for radioactivity incorporated into methionine and methylated basic amino acids. The ratio of radioactivity incorporated into uDMA relative to that into methionine for the two major particle proteins with molecular weights of 31,000 (A/sub 1/) and 43,000 (A/sub 2/) was about 2.0 and 0.2 in control cultures. In the presence of c/sup 3/Ado, these ratios were depressed 60 to 80%. Results of pulse-chase experiments suggested that A/sub 1/ and A/sub 2/ are metabolically stable proteins (t/sub 0.5/ > 75 hr), whether or not the proteins were undermethylated. Monomethyl-L-arginine may be a precursor in the formation of u-DMA.

  20. Insulin Inhibits Nrf2 Gene Expression via Heterogeneous Nuclear Ribonucleoprotein F/K in Diabetic Mice.

    PubMed

    Ghosh, Anindya; Abdo, Shaaban; Zhao, Shuiling; Wu, Chin-Han; Shi, Yixuan; Lo, Chao-Sheng; Chenier, Isabelle; Alquier, Thierry; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao-Ling; Chan, John S D

    2017-01-23

    Oxidative stress induces endogenous antioxidants via nuclear factor erythroid 2-related factor 2 (Nrf2), potentially preventing tissue injury. We investigated whether insulin affects renal Nrf2 expression in type 1 diabetes (T1D) and studied its underlying mechanism. Insulin normalized hyperglycemia, hypertension, oxidative stress and renal injury, inhibited renal Nrf2 and angiotensinogen (Agt) gene expression and up-regulated heterogeneous nuclear ribonucleoprotein F (hnRNP F) and hnRNP K expression in Akita mice with T1D. In immortalized rat renal proximal tubular cells, insulin suppressed Nrf2 and Agt but stimulated hnRNP F and hnRNP K gene transcription in high glucose via p44/42 mitogen-activated protein kinase signalling. Transfection with small interfering RNAs of p44/42 MAPK, hnRNP F or hnRNP K blocked insulin inhibition of Nrf2 gene transcription. Insulin curbed Nrf2 promoter activity via a specific DNA-responsive element that binds hnRNP F/K, and hnRNP F/K overexpression curtailed Nrf2 promoter activity. In hyperinsulinemic-euglycemic mice, renal Nrf2 and Agt expression was down-regulated, whereas hnRNP F/K expression was up-regulated. Thus, the beneficial actions of insulin in diabetic nephropathy appear to be mediated, in part, by suppressing renal Nrf2 and Agt gene transcription and preventing Nrf2 stimulation of Agt expression via hnRNP F/K. These findings identify hnRNP F/K and Nrf2 as potential therapeutic targets in diabetes.

  1. Heterogeneous nuclear ribonucleoprotein K inhibits heat shock-induced transcriptional activity of heat shock factor 1.

    PubMed

    Kim, Hee-Jung; Lee, Jae-Jin; Cho, Jin-Hwan; Jeong, Jaeho; Park, A Young; Kang, Wonmo; Lee, Kong-Joo

    2017-08-04

    When cells are exposed to heat shock and various other stresses, heat shock factor 1 (HSF1) is activated, and the heat shock response (HSR) is elicited. To better understand the molecular regulation of the HSR, we used 2D-PAGE-based proteome analysis to screen for heat shock-induced post-translationally modified cellular proteins. Our analysis revealed that two protein spots typically present on 2D-PAGE gels and containing heterogeneous nuclear ribonucleoprotein K (hnRNP K) with trioxidized Cys(132) disappeared after the heat shock treatment and reappeared during recovery, but the total amount of hnRNP K protein remained unchanged. We next tested whether hnRNP K plays a role in HSR by regulating HSF1 and found that hnRNP K inhibits HSF1 activity, resulting in reduced expression of hsp70 and hsp27 mRNAs. hnRNP K also reduced binding affinity of HSF1 to the heat shock element by directly interacting with HSF1 but did not affect HSF1 phosphorylation-dependent activation or nuclear localization. hnRNP K lost its ability to induce these effects when its Cys(132) was substituted with Ser, Asp, or Glu. These findings suggest that hnRNP K inhibits transcriptional activity of HSF1 by inhibiting its binding to heat shock element and that the oxidation status of Cys(132) in hnRNP K is critical for this inhibition. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Phosphorylation of rat liver heterogeneous nuclear ribonucleoproteins A2 and C can be modulated by calmodulin.

    PubMed Central

    Bosser, R; Faura, M; Serratosa, J; Renau-Piqueras, J; Pruschy, M; Bachs, O

    1995-01-01

    It was previously reported that the phosphorylation of three proteins of 36, 40 to 42, and 50 kDa by casein kinase 2 is inhibited by calmodulin in nuclear extracts from rat liver cells (R. Bosser, R. Aligué, D. Guerini, N. Agell, E. Carafoli, and O. Bachs, J. Biol. Chem. 268:15477-15483, 1993). By immunoblotting, peptide mapping, and endogenous phosphorylation experiments, the 36- and 40- to 42-kDa proteins have been identified as the A2 and C proteins, respectively, of the heterogeneous nuclear ribonucleoprotein particles. To better understand the mechanism by which calmodulin inhibits the phosphorylation of these proteins, they were purified by using single-stranded DNA chromatography, and the effect of calmodulin on their phosphorylation by casein kinase 2 was analyzed. Results revealed that whereas calmodulin inhibited the phosphorylation of purified A2 and C proteins in a Ca(2+)-dependent manner, it did not affect the casein kinase 2 phosphorylation of a different protein substrate, i.e., beta-casein. These results indicate that the effect of calmodulin was not on casein kinase 2 activity but on specific protein substrates. The finding that the A2 and C proteins can bind to a calmodulin-Sepharose column in a Ca(2+)-dependent manner suggests that this association could prevent the phosphorylation of the proteins by casein kinase 2. Immunoelectron microscopy studies have revealed that such interactions could also occur in vivo, since calmodulin and A2 and C proteins colocalize on the ribonucleoprotein particles in rat liver cell nuclei. PMID:7823935

  3. An association between RBMX, a heterogeneous nuclear ribonucleoprotein, and ARTS-1 regulates extracellular TNFR1 release

    SciTech Connect

    Adamik, Barbara; Islam, Aminul; Rouhani, Farshid N.; Hawari, Feras I.; Zhang Jing; Levine, Stewart J.

    2008-07-04

    The type I, 55-kDa tumor necrosis factor receptor (TNFR1) is released to the extracellular space by two mechanisms, the constitutive release of TNFR1 exosome-like vesicles and the inducible proteolytic cleavage of TNFR1 ectodomains. Both pathways appear to be regulated by an interaction between TNFR1 and ARTS-1 (aminopeptidase regulator of TNFR1 shedding). Here, we sought to identify ARTS-1-interacting proteins that modulate TNFR1 release. Co-immunoprecipitation identified an association between ARTS-1 and RBMX (RNA-binding motif gene, X chromosome), a 43-kDa heterogeneous nuclear ribonucleoprotein. RNA interference attenuated RBMX expression, which reduced both the constitutive release of TNFR1 exosome-like vesicles and the IL-1{beta}-mediated inducible proteolytic cleavage of soluble TNFR1 ectodomains. Reciprocally, over-expression of RBMX increased TNFR1 exosome-like vesicle release and the IL-1{beta}-mediated inducible shedding of TNFR1 ectodomains. This identifies RBMX as an ARTS-1-associated protein that regulates both the constitutive release of TNFR1 exosome-like vesicles and the inducible proteolytic cleavage of TNFR1 ectodomains.

  4. DNA Damage-induced Heterogeneous Nuclear Ribonucleoprotein K SUMOylation Regulates p53 Transcriptional Activation*

    PubMed Central

    Pelisch, Federico; Pozzi, Berta; Risso, Guillermo; Muñoz, Manuel Javier; Srebrow, Anabella

    2012-01-01

    Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a nucleocytoplasmic shuttling protein that is a key player in the p53-triggered DNA damage response, acting as a cofactor for p53 in response to DNA damage. hnRNP K is a substrate of the ubiquitin E3 ligase MDM2 and, upon DNA damage, is de-ubiquitylated. In sharp contrast with the role and consequences of the other post-translational modifications, nothing is known about the role of SUMO conjugation to hnRNP K in p53 transcriptional co-activation. In the present work, we show that hnRNP K is modified by SUMO in lysine 422 within its KH3 domain, and sumoylation is regulated by the E3 ligase Pc2/CBX4. Most interestingly, DNA damage stimulates hnRNP K sumoylation through Pc2 E3 activity, and this modification is required for p53 transcriptional activation. Abrogation of hnRNP K sumoylation leads to an aberrant regulation of the p53 target gene p21. Our findings link the DNA damage-induced Pc2 activation to the p53 transcriptional co-activation through hnRNP K sumoylation. PMID:22825850

  5. Expression and localization of heterogeneous nuclear ribonucleoprotein K in mouse ovaries and preimplantation embryos

    SciTech Connect

    Zhang, Ping; Wang, Ningling; Lin, Xianhua; Jin, Li; Xu, Hong; Li, Rong; Huang, Hefeng

    2016-02-26

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K), an evolutionarily conserved protein, is involved in several important cellular processes that are relevant to cell proliferation, differentiation, apoptosis, and cancer development. However, details of hnRNP K expression during mammalian oogenesis and preimplantation embryo development are lacking. The present study investigates the expression and cellular localization of K protein in the mouse ovaries and preimplantation embryos using immunostaining. We demonstrate, for the first time, that hnRNP K is abundantly expressed in the nuclei of mouse oocytes in primordial, primary and secondary follicles. In germ vesicle (GV)-stage oocytes, hnRNP K accumulates in the germinal vesicle in a spot distribution manner. After germinal vesicle breakdown, speckled hnRNP K is diffusely distributed in the cytoplasm. However, after fertilization, the K protein relocates into the female and male pronucleus and persists in the blastomere nuclei. Localization of K protein in the human ovary and ovarian granulosa cell tumor (GCT) was also investigated. Overall, this study provides important morphological evidence to better understand the possible roles of hnRNP K in mammalian oogenesis and early embryo development. - Highlights: • HnRNP K localizes in the nucleus of GV-stage oocyte in a punctate distribution. • HnRNP K strongly accumulates in zygotic pronuclei as condensed spots. • The localization of hnRNP K during oogenesis and embryogenesis is characteristic. • HnRNP K might have an important role in oogenesis and embryonic development.

  6. Role and molecular mechanism of heterogeneous nuclear ribonucleoprotein K in tumor development and progression.

    PubMed

    Lu, Jing; Gao, Feng-Hou

    2016-06-01

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a member of the hnRNP family, which exists in the nucleus and the cytoplasm simultaneously. It is a multifunctional protein that can participate in a variety of regulatory progressions of gene expression and signal transduction, such as chromatin remodeling, transcription, RNA alternative splicing and translation. hnRNP K not only directly binds to the kinases, but also recruits the associated factors regarding transcription, splicing and translation to control gene expression, and therefore, it serves as a docking platform for integrating transduction pathways to nucleic acid-directed processes. Numerous studies also show that abnormal expression of hnRNP K is closely associated with the tumor formation. This protein is overexpressed in numerous types of cancer and its aberrant cytoplasmic localization is also associated with a worse prognosis for patients. These results consistently indicate that hnRNP K has a key role in cancer progression. To understand the hnRNP K pathophysiological process in tumor disease, the previous research results regarding the association between hnRNP K and tumors were reviewed.

  7. Requirement of Heterogeneous Nuclear Ribonucleoprotein C for BRCA Gene Expression and Homologous Recombination

    PubMed Central

    Anantha, Rachel W.; Cai, Hong; Simhadri, Srilatha; Ule, Jernej; König, Julian; Xia, Bing

    2013-01-01

    Background Heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNP C) is a core component of 40S ribonucleoprotein particles that bind pre-mRNAs and influence their processing, stability and export. Breast cancer tumor suppressors BRCA1, BRCA2 and PALB2 form a complex and play key roles in homologous recombination (HR), DNA double strand break (DSB) repair and cell cycle regulation following DNA damage. Methods PALB2 nucleoprotein complexes were isolated using tandem affinity purification from nuclease-solubilized nuclear fraction. Immunofluorescence was used for localization studies of proteins. siRNA-mediated gene silencing and flow cytometry were used for studying DNA repair efficiency and cell cycle distribution/checkpoints. The effect of hnRNP C on mRNA abundance was assayed using quantitative reverse transcriptase PCR. Results and Significance We identified hnRNP C as a component of a nucleoprotein complex containing breast cancer suppressor proteins PALB2, BRCA2 and BRCA1. Notably, other components of the 40S ribonucleoprotein particle were not present in the complex. hnRNP C was found to undergo significant changes of sub-nuclear localization after ionizing radiation (IR) and to partially localize to DNA damage sites. Depletion of hnRNP C substantially altered the normal balance of repair mechanisms following DSB induction, reducing HR usage in particular, and impaired S phase progression after IR. Moreover, loss of hnRNP C strongly reduced the abundance of key HR proteins BRCA1, BRCA2, RAD51 and BRIP1, which can be attributed, at least in part, to the downregulation of their mRNAs due to aberrant splicing. Our results establish hnRNP C as a key regulator of BRCA gene expression and HR-based DNA repair. They also suggest the existence of an RNA regulatory program at sites of DNA damage, which involves a unique function of hnRNP C that is independent of the 40S ribonucleoprotein particles and most other hnRNP proteins. PMID:23585894

  8. Heterogeneous Nuclear Ribonucleoprotein F Stimulates Sirtuin-1 Gene Expression and Attenuates Nephropathy Progression in Diabetic Mice.

    PubMed

    Lo, Chao-Sheng; Shi, Yixuan; Chenier, Isabelle; Ghosh, Anindya; Wu, Chin-Han; Cailhier, Jean-Francois; Ethier, Jean; Lattouf, Jean-Baptiste; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao-Ling; Chan, John S D

    2017-07-01

    We investigated the mechanism of heterogeneous nuclear ribonucleoprotein F (hnRNP F) renoprotective action in a type 2 diabetes (T2D) mouse model (db/db). Immortalized rat renal proximal tubular cells (IRPTCs) and kidneys from humans with T2D were also studied. The db/db mice developed hyperglycemia, oxidative stress, and nephropathy at age 20 weeks compared with their db/m littermates. These abnormalities, with the exception of hyperglycemia, were attenuated in db/dbhnRNP F-transgenic (Tg) mice specifically overexpressing hnRNP F in their RPTCs. Sirtuin-1, Foxo3α, and catalase expression were significantly decreased in RPTCs from db/db mice and normalized in db/dbhnRNP F-Tg mice. In vitro, hnRNP F overexpression stimulated Sirtuin-1 and Foxo3α with downregulation of acetylated p53 expression and prevented downregulation of Sirtuin-1 and Foxo3α expression in IRPTCs by high glucose plus palmitate. Transfection of Sirtuin-1 small interfering RNA prevented hnRNP F stimulation of Foxo3α and downregulation of acetylated p53 expression. hnRNP F stimulated Sirtuin-1 transcription via hnRNP F-responsive element in the Sirtuin-1 promoter. Human T2D kidneys exhibited more RPTC apoptosis and lower expression of hnRNP F, SIRTUIN-1, and FOXO3α than nondiabetic kidneys. Our results demonstrate that hnRNP F protects kidneys against oxidative stress and nephropathy via stimulation of Sirtuin-1 expression and signaling in diabetes. © 2017 by the American Diabetes Association.

  9. Heterogeneous nuclear ribonucleoprotein M associates with mTORC2 and regulates muscle differentiation.

    PubMed

    Chen, Wei-Yen; Lin, Chia-Lung; Chuang, Jen-Hua; Chiu, Fu-Yu; Sun, Yun-Ya; Liang, Mei-Chih; Lin, Yenshou

    2017-01-20

    Mammalian target of rapamycin (mTOR) plays a range of crucial roles in cell survival, growth, proliferation, metabolism, and morphology. However, mTOR forms two distinct complexes, mTOR complex 1 and mTOR complex 2 (mTORC1 and mTORC2), via association with a series of different components; this allows the complexes to execute their wide range of functions. This study explores further the composition of the mTORC2 complex. Utilizing Rictor knock-out cells, immunoprecipitation and mass spectrometry, a novel Rictor associated protein, heterogeneous nuclear ribonucleoprotein M (hnRNP M), was identified. The association between hnRNP M and Rictor was verified using recombinant and endogenous protein and the binding site was found to be within aa 1~532 of hnRNP M. The presence of hnRNP M significantly affects phosphorylation of SGK1 S422, but not of Akt S473, PKCα S657 and PKCζ T560. Furthermore, hnRNP M also plays a critical role in muscle differentiation because knock-down of either hnRNP M or Rictor in C2C12 myoblasts reduced differentiation. This decrease is able to be rescued by overexpression SGK S422D in hnRNP M knockdown C2C12 myoblasts. Taken together, we have identified a novel Rictor/mTOR binding molecule, hnRNP M, that allows mTORC2 signaling to phosphorylate SGK1 thus regulating muscle differentiation.

  10. Heterogeneous Nuclear Ribonucleoprotein K is a Novel Regulator of Androgen Receptor Translation

    PubMed Central

    Mukhopadhyay, Nishit K; Kim, Jayoung; Cinar, Bekir; Ramachandran, Aruna; Hager, Martin H; Di Vizio, Dolores; Adam, Rosalyn M; Rubin, Mark A; Raychaudhuri, Pradip; De Benedetti, Arrigo; Freeman, Michael R

    2009-01-01

    Regulation of androgen receptor (AR) expression in prostate cancer (PCa) is still poorly understood. Activation of the epidermal growth factor receptor (EGFR) in PCa cells was previously shown to lower AR expression by a rapamycin-sensitive, post-transcriptional mechanism involving the AR mRNA 5′-untranslated region (5′-UTR). In a search for an intermediate within the EGFR/PI3-kinase/Akt/mTOR pathway that regulates AR at this site, we identified the nucleic acid binding protein, heterogeneous nuclear ribonucleoprotein K (hnRNP-K), by mass spectrometric analysis of Akt immune complexes from lipid raft-enriched subcellular fractions. We show here that hnRNP-K is a novel inhibitor of AR mRNA translation that regulates androgen-responsive gene expression and PCa cell proliferation. A functional hnRNP-K binding site involved in down-regulating AR protein levels was identified in the AR mRNA 5′-UTR. Further analysis revealed that hnRNP-K is also able to inhibit AR translation in the absence of the 5′-UTR, consistent with the presence of additional predicted hnRNP-K binding sites within the AR open reading frame and in the 3′-UTR. Immunohistochemical analysis of a human PCa tissue microarray revealed an inverse correlation between hnRNP-K expression and AR protein levels in organ-confined PCa tumors and a substantial decline in cytoplasmic hnRNP-K in metastases, despite an overall increase in hnRNP-K levels in metastatic tumors. These data suggest that translational inhibition of AR by hnRNP-K may occur in organ-confined tumors but possibly at a reduced level in metastases. HnRNP-K is the first protein identified that directly interacts with and regulates the AR translational apparatus. PMID:19258514

  11. Heterogeneous nuclear ribonucleoprotein M associates with mTORC2 and regulates muscle differentiation

    PubMed Central

    Chen, Wei-Yen; Lin, Chia-Lung; Chuang, Jen-Hua; Chiu, Fu-Yu; Sun, Yun-Ya; Liang, Mei-Chih; Lin, Yenshou

    2017-01-01

    Mammalian target of rapamycin (mTOR) plays a range of crucial roles in cell survival, growth, proliferation, metabolism, and morphology. However, mTOR forms two distinct complexes, mTOR complex 1 and mTOR complex 2 (mTORC1 and mTORC2), via association with a series of different components; this allows the complexes to execute their wide range of functions. This study explores further the composition of the mTORC2 complex. Utilizing Rictor knock-out cells, immunoprecipitation and mass spectrometry, a novel Rictor associated protein, heterogeneous nuclear ribonucleoprotein M (hnRNP M), was identified. The association between hnRNP M and Rictor was verified using recombinant and endogenous protein and the binding site was found to be within aa 1~532 of hnRNP M. The presence of hnRNP M significantly affects phosphorylation of SGK1 S422, but not of Akt S473, PKCα S657 and PKCζ T560. Furthermore, hnRNP M also plays a critical role in muscle differentiation because knock-down of either hnRNP M or Rictor in C2C12 myoblasts reduced differentiation. This decrease is able to be rescued by overexpression SGK S422D in hnRNP M knockdown C2C12 myoblasts. Taken together, we have identified a novel Rictor/mTOR binding molecule, hnRNP M, that allows mTORC2 signaling to phosphorylate SGK1 thus regulating muscle differentiation. PMID:28106162

  12. Protein and gene expression characteristics of heterogeneous nuclear ribonucleoprotein H1 in esophageal squamous cell carcinoma

    PubMed Central

    Sun, Yu-Lin; Liu, Fei; Liu, Fang; Zhao, Xiao-Hang

    2016-01-01

    AIM To investigate the expression characteristics of heterogeneous nuclear ribonucleoprotein H1 (HNRNPH1) mRNA and protein in cell lines and tissues of esophageal squamous cell carcinoma (ESCC). METHODS Western blotting was used to assess the expression of HNRNPH1 protein in seven ESCC cell lines and 30 paired fresh tissue specimens. The subcellular localization of HNRNPH1 was determined by immunofluorescence in ESCC cells. The RNA sequencing data from 87 patients with ESCC were obtained from the cancer genome atlas (TCGA), and the expression and clinical characteristics analysis of different transcript variants of HNRNPH1 were evaluated in this dataset. In addition, immunohistochemistry was carried out to detect the expression of HNRNPH1 protein in 125 patients. RESULTS The expression of HNRNPH1 protein varied across different ESCC cell lines. It was exclusively restricted to the nucleus of the ESCC cells. There are two transcript variants of the HNRNPH1 gene. Variant 1 was constitutively expressed, and its expression did not change during tumorigenesis. In contrast, levels of variant 2 were low in non-tumorous tissues and were dramatically increased in ESCC (P = 0.0026). The high levels of variant 2 were associated with poorer differentiated tumors (P = 0.0287). Furthermore, in paired fresh tissue specimens, HNRNPH1 protein was overexpressed in 73.3% (22/30) of neoplastic tissues. HNRNPH1 was significantly upregulated in ESCC, with strong staining in 43.2% (54/125) of tumor tissues and 22.4% (28/125) of matched non-cancerous tissues (P = 0.0005). Positive HNRNPH1 expression was significantly associated with poor tumor differentiation degree (P = 0.0337). CONCLUSION The different alternative transcript variants of HNRNPH1 exhibited different expression changes during tumorigenesis. Its mRNA and protein were overexpressed in ESCC and associated with poorer differentiation of tumor cells. These findings highlight the potential of HNRNPH1 in the therapy and diagnosis

  13. Heterogeneous Nuclear Ribonucleoprotein K Interacts with Abi-1 at Postsynaptic Sites and Modulates Dendritic Spine Morphology

    PubMed Central

    Proepper, Christian; Steinestel, Konrad; Schmeisser, Michael J.; Heinrich, Jutta; Steinestel, Julie; Bockmann, Juergen; Liebau, Stefan; Boeckers, Tobias M.

    2011-01-01

    Background Abelson-interacting protein 1 (Abi-1) plays an important role for dendritic branching and synapse formation in the central nervous system. It is localized at the postsynaptic density (PSD) and rapidly translocates to the nucleus upon synaptic stimulation. At PSDs Abi-1 is in a complex with several other proteins including WASP/WAVE or cortactin thereby regulating the actin cytoskeleton via the Arp 2/3 complex. Principal Findings We identified heterogeneous nuclear ribonucleoprotein K (hnRNPK), a 65 kDa ssDNA/RNA-binding-protein that is involved in multiple intracellular signaling cascades, as a binding partner of Abi-1 at postsynaptic sites. The interaction with the Abi-1 SH3 domain is mediated by the hnRNPK-interaction (KI) domain. We further show that during brain development, hnRNPK expression becomes more and more restricted to granule cells of the cerebellum and hippocampal neurons where it localizes in the cell nucleus as well as in the spine/dendritic compartment. The downregulation of hnRNPK in cultured hippocampal neurons by RNAi results in an enlarged dendritic tree and a significant increase in filopodia formation. This is accompanied by a decrease in the number of mature synapses. Both effects therefore mimic the neuronal morphology after downregulation of Abi-1 mRNA in neurons. Conclusions Our findings demonstrate a novel interplay between hnRNPK and Abi-1 in the nucleus and at synaptic sites and show obvious similarities regarding both protein knockdown phenotypes. This indicates that hnRNPK and Abi-1 act synergistic in a multiprotein complex that regulates the crucial balance between filopodia formation and synaptic maturation in neurons. PMID:22102872

  14. Heterogeneous nuclear ribonucleoprotein k interacts with Abi-1 at postsynaptic sites and modulates dendritic spine morphology.

    PubMed

    Proepper, Christian; Steinestel, Konrad; Schmeisser, Michael J; Heinrich, Jutta; Steinestel, Julie; Bockmann, Juergen; Liebau, Stefan; Boeckers, Tobias M

    2011-01-01

    Abelson-interacting protein 1 (Abi-1) plays an important role for dendritic branching and synapse formation in the central nervous system. It is localized at the postsynaptic density (PSD) and rapidly translocates to the nucleus upon synaptic stimulation. At PSDs Abi-1 is in a complex with several other proteins including WASP/WAVE or cortactin thereby regulating the actin cytoskeleton via the Arp 2/3 complex. We identified heterogeneous nuclear ribonucleoprotein K (hnRNPK), a 65 kDa ssDNA/RNA-binding-protein that is involved in multiple intracellular signaling cascades, as a binding partner of Abi-1 at postsynaptic sites. The interaction with the Abi-1 SH3 domain is mediated by the hnRNPK-interaction (KI) domain. We further show that during brain development, hnRNPK expression becomes more and more restricted to granule cells of the cerebellum and hippocampal neurons where it localizes in the cell nucleus as well as in the spine/dendritic compartment. The downregulation of hnRNPK in cultured hippocampal neurons by RNAi results in an enlarged dendritic tree and a significant increase in filopodia formation. This is accompanied by a decrease in the number of mature synapses. Both effects therefore mimic the neuronal morphology after downregulation of Abi-1 mRNA in neurons. Our findings demonstrate a novel interplay between hnRNPK and Abi-1 in the nucleus and at synaptic sites and show obvious similarities regarding both protein knockdown phenotypes. This indicates that hnRNPK and Abi-1 act synergistic in a multiprotein complex that regulates the crucial balance between filopodia formation and synaptic maturation in neurons.

  15. Purification and partial sequencing of the nuclear autoantigen RA33 shows that it is indistinguishable from the A2 protein of the heterogeneous nuclear ribonucleoprotein complex.

    PubMed Central

    Steiner, G; Hartmuth, K; Skriner, K; Maurer-Fogy, I; Sinski, A; Thalmann, E; Hassfeld, W; Barta, A; Smolen, J S

    1992-01-01

    RA33 is a nuclear autoantigen with an apparent molecular mass of 33 kD. Autoantibodies against RA33 are found in about 30% of sera from RA patients, but only occasionally in sera from patients with other connective tissue diseases. To characterize RA33, the antigen was purified from HeLa cell nuclear extracts to more than 90% homogeneity by affinity chromatography on heparin-Sepharose and by chromatofocusing. Sequence analysis of five tryptic peptides revealed that their sequences matched corresponding sequences of the A2 protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. Furthermore, RA33 was shown to be present in the 40S hnRNP complex and to behave indistinguishably from A2 in binding to single stranded DNA. In summary, these data strongly indicate that RA33 and A2 are the same protein, and thus identify on a molecular level a new autoantigen. Images PMID:1522214

  16. Differential effect of acute and persistent Junin virus infections on the nucleo-cytoplasmic trafficking and expression of heterogeneous nuclear ribonucleoproteins type A and B.

    PubMed

    Maeto, Cynthia A; Knott, María E; Linero, Florencia N; Ellenberg, Paula C; Scolaro, Luis A; Castilla, Viviana

    2011-09-01

    Heterogeneous nuclear ribonucleoproteins A and B (hnRNPs A/B), cellular RNA-binding proteins that participate in splicing, trafficking, translation and turnover of mRNAs, have been implicated in the life cycles of several cytoplasmic RNA viruses. Here, we demonstrate that silencing of hnRNPs A1 and A2 significantly reduces the replication of the arenavirus Junín virus (JUNV), the aetiological agent of Argentine haemorrhagic fever. While acute JUNV infection did not modify total levels of expression of hnRNPs A/B in comparison with uninfected cells, non-cytopathic persistent infection exhibited low levels of these cell proteins. Furthermore, acutely infected cells showed a cytoplasmic relocalization of overexpressed hnRNP A1, probably related to the involvement of this protein in virus replicative cycle. This cytoplasmic accumulation was also observed in cells expressing viral nucleoprotein (N), and co-immunoprecipitation studies revealed the interaction between hnRNP A1 and N protein. By contrast, a predominantly nuclear distribution of overexpressed hnRNP A1 was found during persistent infection, even in the presence of endogenous or overexpressed N protein, indicating a differential modulation of nucleo-cytoplasmic trafficking in acute and persistent JUNV infections.

  17. In Silico Adoption of an Orphan Nuclear Receptor NR4A1

    PubMed Central

    Lanig, Harald; Reisen, Felix; Whitley, David; Schneider, Gisbert; Banting, Lee; Clark, Timothy

    2015-01-01

    A 4.1μs molecular dynamics simulation of the NR4A1 (hNur77) apo-protein has been undertaken and a previously undetected druggable pocket has become apparent that is located remotely from the ‘traditional’ nuclear receptor ligand-binding site. A NR4A1/bis-indole ligand complex at this novel site has been found to be stable over 1 μs of simulation and to result in an interesting conformational transmission to a remote loop that has the capacity to communicate with a NBRE within a RXR-α/NR4A1 heterodimer. Several features of the simulations undertaken indicate how NR4A1 can be affected by alternate-site modulators. PMID:26270486

  18. Relaxation Nuclear Magnetic Resonance Imaging Investigation of Heterogeneous Aging in a Hydroxy-Terminated Polybutadiene-Based Elastomer

    SciTech Connect

    Alam, Todd M.; Cherry, Brian R.; Minard, Kevin R.; Celina, Mat C.

    2005-12-27

    Relaxation nuclear magnetic resonance imaging (R-NMRI) was employed to investigate the effects of thermo-oxidative aging in a hydroxy-terminated polybutadiene (HTPB) based elastomer. A series of three-dimensional (3D) Hahn-echo weighted single point images (SPI) of the elastomer were utilized to generate a 3D parameter map of the aged material. NMR spin-spin relaxation times (T2) were measured for each voxel producing a 3D NMR parameter (T2) map of the aged polymer. These T2 maps reveal a dramatic reduction of local polymer mobility near the aging surface with the degree of T2 heterogeneity varying as a function of aging. Using correlations between NMR T2 and material modulus, the impact of this heterogeneous thermo-oxidative aging on the material properties is discussed.

  19. Histone acetylation regulates orphan nuclear receptor NR4A1 expression in hypercholesterolaemia.

    PubMed

    Xie, Xina; Song, Xuhong; Yuan, Song; Cai, Haitao; Chen, Yequn; Chang, Xiaolan; Liang, Bin; Huang, Dongyang

    2015-12-01

    Hypercholesterolaemia and inflammation are correlated with atherogenesis. Orphan nuclear receptor NR4A1, as a key regulator of inflammation, is closely associated with lipid levels in vivo. However, the mechanism by which lipids regulate NR4A1 expression remains unknown. We aimed to elucidate the underlying mechanism of NR4A1 expression in monocytes during hypercholesterolaemia, and reveal the potential role of NR4A1 in hypercholesterolaemia-induced circulating inflammation. Circulating leucocytes were collected from blood samples of 139 patients with hypercholesterolaemia and 139 sex- and age-matched healthy subjects. We found that there was a low-grade inflammatory state and higher expression of NR4A1 in patients. Both total cholesterol and low-density lipoprotein cholesterol levels in plasma were positively correlated with NR4A1 mRNA level. ChIP revealed that acetylation of histone H3 was enriched in the NR4A1 promoter region in patients. Human mononuclear cell lines THP-1 and U937 were treated with cholesterol. Supporting our clinical observations, cholesterol enhanced p300 acetyltransferase and decreased HDAC7 (histone deacetylase 7) recruitment to the NR4A1 promoter region, resulting in histone H3 hyperacetylation and further contributing to NR4A1 up-regulation in monocytes. Moreover, cytosporone B, an NR4A1 agonist, completely reversed cholesterol-induced IL-6 (interleukin 6) and MCP-1 (monocyte chemoattractant protein 1) expression to below basal levels, and knockdown of NR4A1 expression by siRNA not only mimicked, but also exaggerated the effects of cholesterol on inflammatory biomarker up-regulation. Thus we conclude that histone acetylation contributes to the regulation of NR4A1 expression in hypercholesterolaemia, and that NR4A1 expression reduces hypercholesterolaemia-induced inflammation. © 2015 Authors; published by Portland Press Limited.

  20. Patterns of cyto-nuclear linkage disequilibrium in Silene latifolia: genomic heterogeneity and temporal stability

    PubMed Central

    Fields, P D; McCauley, D E; McAssey, E V; Taylor, D R

    2014-01-01

    Non-random association of alleles in the nucleus and cytoplasmic organelles, or cyto-nuclear linkage disequilibrium (LD), is both an important component of a number of evolutionary processes and a statistical indicator of others. The evolutionary significance of cyto-nuclear LD will depend on both its magnitude and how stable those associations are through time. Here, we use a longitudinal population genetic data set to explore the magnitude and temporal dynamics of cyto-nuclear disequilibria through time. We genotyped 135 and 170 individuals from 16 and 17 patches of the plant species Silene latifolia in Southwestern VA, sampled in 1993 and 2008, respectively. Individuals were genotyped at 14 highly polymorphic microsatellite markers and a single-nucleotide polymorphism (SNP) in the mitochondrial gene, atp1. Normalized LD (D′) between nuclear and cytoplasmic loci varied considerably depending on which nuclear locus was considered (ranging from 0.005–0.632). Four of the 14 cyto-nuclear associations showed a statistically significant shift over approximately seven generations. However, the overall magnitude of this disequilibrium was largely stable over time. The observed origin and stability of cyto-nuclear LD is most likely caused by the slow admixture between anciently diverged lineages within the species' newly invaded range, and the local spatial structure and metapopulation dynamics that are known to structure genetic variation in this system. PMID:24002238

  1. Dynamic nuclear polarization solid-state NMR in heterogeneous catalysis research

    SciTech Connect

    Kobayashi, Takeshi; Perras, Frédéric A.; Slowing, Igor I.; Sadow, Aaron D.; Pruski, Marek

    2015-10-20

    In this study, a revolution in solid-state nuclear magnetic resonance (SSNMR) spectroscopy is taking place, attributable to the rapid development of high-field dynamic nuclear polarization (DNP), a technique yielding sensitivity improvements of 2–3 orders of magnitude. This higher sensitivity in SSNMR has already impacted materials research, and the implications of new methods on catalytic sciences are expected to be profound.

  2. Dynamic nuclear polarization solid-state NMR in heterogeneous catalysis research

    DOE PAGES

    Kobayashi, Takeshi; Perras, Frédéric A.; Slowing, Igor I.; ...

    2015-10-20

    In this study, a revolution in solid-state nuclear magnetic resonance (SSNMR) spectroscopy is taking place, attributable to the rapid development of high-field dynamic nuclear polarization (DNP), a technique yielding sensitivity improvements of 2–3 orders of magnitude. This higher sensitivity in SSNMR has already impacted materials research, and the implications of new methods on catalytic sciences are expected to be profound.

  3. Nuclear receptor 4A1 as a drug target for breast cancer chemotherapy.

    PubMed

    Hedrick, Erik; Lee, Syng-Ook; Doddapaneni, Ravi; Singh, Mandip; Safe, Stephen

    2015-10-01

    The orphan nuclear receptor 4A1 (NR4A1) is overexpressed in mammary tumors and breast cancer cell lines. The functional activity of this receptor was investigated by RNA interference with oligonucleotides targeted to NR4A1 (siNR4A1) and by treatment with NR4A1 antagonists. Breast cancer cells were treated with NR4A1 antagonists or transfected with siNR4A. Effects on cell proliferation and apoptosis as well as specific genes associated with these responses were investigated in MCF-7, SKBR3, and MDA-MB-231 cells, and in athymic nude mice bearing MDA-MB-231 cells as xenografts. Transfection of MCF-7, MDA-MB-231, and SKBR3 breast cancer cells with siNR4A1 decreased cell proliferation and induced apoptosis in these cell lines. Transfection of breast cancer cells with siNR4A1 also decreased expression of Sp-regulated genes including survivin, bcl-2, and epidermal growth factor receptor, inhibited mTOR signaling in MCF-7 cells that express WT p53, and activated oxidative and endoplasmic reticulum stress through downregulation of thioredoxin domain-containing 5 and isocitrate dehydrogenase 1. 1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methanes (C-DIMs) are NR4A1 ligands that act as NR4A1 antagonists. Treatment with selected analogs also inhibited breast cancer cell and tumor growth and induced apoptosis. The effects of C-DIM/NR4A1 antagonists were comparable to those observed after NR4A1 knockdown. Results with siNR4A1 or C-DIMs/NR4A1 antagonists in breast cancer cells and tumors were similar to those previously reported in pancreatic, lung, and colon cancer cells. They demonstrate the potential clinical applications of NR4A1 antagonists in patients with tumors that overexpress this receptor. © 2015 Society for Endocrinology.

  4. Identification of the methylation preference region in heterogeneous nuclear ribonucleoprotein K by protein arginine methyltransferase 1 and its implication in regulating nuclear/cytoplasmic distribution

    SciTech Connect

    Chang, Yuan-I; Hsu, Sheng-Chieh; Chau, Gar-Yang; Huang, Chi-Ying F.; Sung, Jung-Sung; Hua, Wei-Kai; Lin, Wey-Jinq

    2011-01-21

    Research highlights: {yields} Verifying by direct methylation assay the substrate sites of PRMT1 in the hnRNP K protein. {yields} Identifying the preferred PMRT1 methylation regions in hnRNP K by kinetic analysis. {yields} Linking methylation in regulating nuclear localization of hnRNP K. -- Abstract: Protein arginine methylation plays crucial roles in numerous cellular processes. Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein participating in a variety of cellular functions including transcription and RNA processing. HnRNP K is methylated at multiple sites in the glycine- and arginine-rich (RGG) motif. Using various RGG domain deletion mutants of hnRNP K as substrates, here we show by direct methylation assay that protein arginine methyltransferase 1 (PRMT1) methylated preferentially in a.a. 280-307 of the RGG motif. Kinetic analysis revealed that deletion of a.a. 280-307, but not a.a. 308-327, significantly inhibited rate of methylation. Importantly, nuclear localization of hnRNP K was significantly impaired in mutant hnRNP K lacking the PRMT1 methylation region or upon pharmacological inhibition of methylation. Together our results identify preferred PRMT1 methylation sequences of hnRNP K by direct methylation assay and implicate a role of arginine methylation in regulating intracellular distribution of hnRNP K.

  5. [Nuclear heterogeneity and proliferative capacity of human adipose derived MSC-like cells].

    PubMed

    Lavrov, A V; Smirnichina, S A

    2010-01-01

    Adipose derived stem cells (ADSCs) are MSC-like cells which could be easily used for regenerative medicine. Here, the morphology and proliferative capacity of human ADSCs is discribed. ADSCs were analyzed after one month of cultivation at a density of 10 cells/cm2. 21 colonies were counted. Few atypical cells (huge nuclei and cytoplasm) were found in 9 out of 17 colonies analyzed. ANOVA demonstrated that colonies also differed (P = 0.0025) in nuclei dimensions and scatter in the dimensions in each colony. Nuclei dimensions and cell density logarithms correlated in reverse proportion (-0.7; P = 0.002). Thus, ADSCs were heterogeneous and represented two types of cells: small highly proliferative and large low proliferative cells. Cell heterogeneity observed in some colonies might be due to cells registered at different cell cycle phases. Stable and typical morphology, colony-formation capability and high proliferative capacity of cells indicate visceral adipose tissue as a rich source of ADSCs.

  6. Heterogeneity in mitochondrial morphology and membrane potential is independent of the nuclear division cycle in multinucleate fungal cells.

    PubMed

    Gerstenberger, John P; Occhipinti, Patricia; Gladfelter, Amy S

    2012-03-01

    In the multinucleate filamentous fungus Ashbya gossypii, nuclei divide asynchronously in a common cytoplasm. We hypothesize that the division cycle machinery has a limited zone of influence in the cytoplasm to promote nuclear autonomy. Mitochondria in cultured mammalian cells undergo cell cycle-specific changes in morphology and membrane potential and therefore can serve as a reporter of the cell cycle state of the cytoplasm. To evaluate if the cell cycle state of nuclei in A. gossypii can influence the adjacent cytoplasm, we tested whether local mitochondrial morphology and membrane potential in A. gossypii are associated with the division state of a nearby nucleus. We found that mitochondria exhibit substantial heterogeneity in both morphology and membrane potential within a single multinucleated cell. Notably, differences in mitochondrial morphology or potential are not associated with a specific nuclear division state. Heterokaryon mutants with a mixture of nuclei with deletions of and wild type for the mitochondrial fusion/fission genes DNM1 and FZO1 exhibit altered mitochondrial morphology and severe growth and sporulation defects. This dominant effect suggests that the gene products may be required locally near their expression site rather than diffusing widely in the cell. Our results demonstrate that mitochondrial dynamics are essential in these large syncytial cells, yet morphology and membrane potential are independent of nuclear cycle state.

  7. HETEROGENEOUS NUCLEAR REACTOR EMPLOYING SMALL UNCLAD BODIES OF FISSIONABLE MATERIAL AS FUEL

    DOEpatents

    Hyman, H.H.; Katz, J.J.

    1961-05-01

    A nuclear reactor in which fuel pellets are continuously dissolved in a moderator liquid is described. The fuel pellets are fed into the top of elongated baskets which are submerged in moderator liquid, and a portion of the moderator liquid is continuously withdrawn and processed to recove r reaction products.

  8. Nuclear analysis of the chornobyl fuel containing masses with heterogeneous fuel distribution.

    SciTech Connect

    Turski, R. B.

    1998-10-14

    Although significant data has been obtained on the condition and composition of the fuel containing masses (FCM) located in the concrete chambers under the Chernobyl Unit 4 reactor cavity, there is still uncertainty regarding the possible recriticality of this material. The high radiation levels make access extremely difficult, and most of the samples are from the FCM surface regions. There is little information on the interior regions of the FCM, and one cannot assume with confidence that the surface measurements are representative of the interior regions. Therefore, reasonable assumptions on the key parameters such as fuel concentration, the concentrations of impurities and neutron poisons (especially boron), the void fraction of the FCM due to its known porosity, and the degrees of fuel heterogeneity, are necessary to evaluate the possibility of recriticality. The void fraction is important since it introduces the possibility of water moderator being distributed throughout the FCM. Calculations indicate that the addition of 10 to 30 volume percent (v/o) water to the FCM has a significant impact on the calculated reactivity of the FCM. Therefore, water addition must be considered carefully. The other possible moderators are graphite and silicone dioxide. As discussed later in this paper, silicone dioxide moderation does not represent a criticality threat. For graphite, both heterogeneous fuel arrangements and very large volume fractions of graphite are necessary for a graphite moderated system to go critical. Based on the observations and measurements of the FCM compositions, these conditions do not appear creditable for the Chernobyl FCM. Therefore, the focus of the analysis reported in this paper will be on reasonable heterogeneous fuel arrangements and water moderation. The analysis will evaluate a range of fuel and diluent compositions.

  9. Physical and Functional Interaction between Heterochromatin Protein 1α and the RNA-binding Protein Heterogeneous Nuclear Ribonucleoprotein U*

    PubMed Central

    Ameyar-Zazoua, Maya; Souidi, Mouloud; Fritsch, Lauriane; Robin, Philippe; Thomas, Audrey; Hamiche, Ali; Percipalle, Piergiorgio; Ait-Si-Ali, Slimane; Harel-Bellan, Annick

    2009-01-01

    By combining biochemical purification and mass spectrometry, we identified proteins associated with human heterochromatin protein 1α (HP1α) both in the nucleoplasm and in chromatin. Some of these are RNA-binding proteins, and among them is the protein heterogeneous nuclear ribonucleoprotein U (hnRNP U)/SAF-A, which is linked to chromatin organization and transcriptional regulation. Here, we demonstrate that hnRNP U is a bona fide HP1α-interacting molecule. More importantly, hnRNP U depletion reduces HP1α-dependent gene silencing and disturbs HP1α subcellular localization. Thus, our data demonstrate that hnRNP U is involved in HP1α function, shedding new light on the mode of action of HP1α and on the function of hnRNP U. PMID:19617346

  10. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In general...

  11. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 6 2012-04-01 2012-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In general...

  12. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 6 2014-04-01 2014-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In general...

  13. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 6 2013-04-01 2013-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In general...

  14. An investigation into heterogeneity in a single vein-type uranium ore deposit: Implications for nuclear forensics.

    PubMed

    Keatley, A C; Scott, T B; Davis, S; Jones, C P; Turner, P

    2015-12-01

    Minor element composition and rare earth element (REE) concentrations in nuclear materials are important as they are used within the field of nuclear forensics as an indicator of sample origin. However recent studies into uranium ores and uranium ore concentrates (UOCs) have shown significant elemental and isotopic heterogeneity from a single mine site such that some sites have shown higher variation within the mine site than that seen between multiple sites. The elemental composition of both uranium and gangue minerals within ore samples taken along a single mineral vein in South West England have been measured and reported here. The analysis of the samples was undertaken to determine the extent of the localised variation in key elements. Energy Dispersive X-ray spectroscopy (EDS) was used to analyse the gangue mineralogy and measure major element composition. Minor element composition and rare earth element (REE) concentrations were measured by Electron Probe Microanalysis (EPMA). The results confirm that a number of key elements, REE concentrations and patterns used for origin location do show significant variation within mine. Furthermore significant variation is also visible on a meter scale. In addition three separate uranium phases were identified within the vein which indicates multiple uranium mineralisation events. In light of these localised elemental variations it is recommended that representative sampling for an area is undertaken prior to establishing the REE pattern that may be used to identify the originating mine for an unknown ore sample and prior to investigating impact of ore processing on any arising REE patterns.

  15. Comparison of Different Upscaling Methods for Predicting Thermal Conductivity of Complex Heterogeneous Materials System: Application on Nuclear Waste Forms

    SciTech Connect

    Li, Dongsheng; Sun, Xin; Khaleel, Mohammad A.

    2012-06-16

    To develop a strategy in thermal conductivity prediction of a complex heterogeneous materials system, loaded nuclear waste forms, the computational efficiency and accuracy of different upscaling methods have been evaluated. The effective thermal conductivity, obtained from microstructure information and local thermal conductivity of different components, is critical in predicting the life and performance of waste form during storage. Several methods, including the Taylor model, Sachs model, self-consistent model, and statistical upscaling method, were developed and implemented. Microstructure based finite element method (FEM) prediction results were used to as benchmark to determine the accuracy of the different upscaling methods. Micrographs from waste forms with varying waste loadings were used in the prediction of thermal conductivity in FEM and homogenization methods. Prediction results demonstrated that in term of efficiency, boundary models (e.g., Taylor model and Sachs model) are stronger than the self-consistent model, statistical upscaling method, and finite element method. However, when balancing computational efficiency and accuracy, statistical upscaling is a useful method in predicting effective thermal conductivity for nuclear waste forms.

  16. Content of N-6 methyl adenylic acid in heterogeneous nuclear and messenger RNA of HeLa cells.

    PubMed Central

    Lavi, U; Fernandez-Muñoz, R; Darnell, J E

    1977-01-01

    With the aid of a suitable thin layer chromatographic procedure, the N-6 methyl adenylic acid (m6A), content of a variety of 32P labeled RNA species from HeLa cells has been measured. Poly(A)-containing (poly(A)+) cytoplasmic RNA has on the average one m6Ap per 800 to 900 nucleotides. This value is independent of the length of the molecules. The proportion of m6Ap in poly(A)+ cytoplasmic RNA does not change between 4 and 18 hours of labeling with 32P, suggesting that the majority of the messenger RNA molecules may have a similar level of internal methylation regardless of their half-life. The non-polyadenylated, non-ribosomal cytoplasmic RNA fraction sedimenting from 10S TO 28S is less methylated with approximately one m6A per 2,700 nucleotides. Heterogeneous nuclear RNA molecules (DMSO treated) which sediment from 28S to 45S have approximately one m6Ap per 3,000 nucleotides. The hnRNA molecules sedimenting from 10S to 28S have one m6Ap per 1,800 nucleotides. Poly(A)+ nuclear RNA is enriched in m6A, containing 1 residue of m6A per 700 to 800 nucleotides, a value close to that obtained for the polyadenylated cytoplasmic RNA. Images PMID:866178

  17. Targeted identification of short interspersed nuclear element families shows their widespread existence and extreme heterogeneity in plant genomes.

    PubMed

    Wenke, Torsten; Döbel, Thomas; Sörensen, Thomas Rosleff; Junghans, Holger; Weisshaar, Bernd; Schmidt, Thomas

    2011-09-01

    Short interspersed nuclear elements (SINEs) are non-long terminal repeat retrotransposons that are highly abundant, heterogeneous, and mostly not annotated in eukaryotic genomes. We developed a tool designated SINE-Finder for the targeted discovery of tRNA-derived SINEs. We analyzed sequence data of 16 plant genomes, including 13 angiosperms and three gymnosperms and identified 17,829 full-length and truncated SINEs falling into 31 families showing the widespread occurrence of SINEs in higher plants. The investigation focused on potato (Solanum tuberosum), resulting in the detection of seven different SolS SINE families consisting of 1489 full-length and 870 5' truncated copies. Consensus sequences of full-length members range in size from 106 to 244 bp depending on the SINE family. SolS SINEs populated related species and evolved separately, which led to some distinct subfamilies. Solanaceae SINEs are dispersed along chromosomes and distributed without clustering but with preferred integration into short A-rich motifs. They emerged more than 23 million years ago and were species specifically amplified during the radiation of potato, tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum). We show that tobacco TS retrotransposons are composite SINEs consisting of the 3' end of a long interspersed nuclear element integrated downstream of a nonhomologous SINE family followed by successfully colonization of the genome. We propose an evolutionary scenario for the formation of TS as a spontaneous event, which could be typical for the emergence of SINE families.

  18. Targeted Identification of Short Interspersed Nuclear Element Families Shows Their Widespread Existence and Extreme Heterogeneity in Plant Genomes[W

    PubMed Central

    Wenke, Torsten; Döbel, Thomas; Sörensen, Thomas Rosleff; Junghans, Holger; Weisshaar, Bernd; Schmidt, Thomas

    2011-01-01

    Short interspersed nuclear elements (SINEs) are non-long terminal repeat retrotransposons that are highly abundant, heterogeneous, and mostly not annotated in eukaryotic genomes. We developed a tool designated SINE-Finder for the targeted discovery of tRNA-derived SINEs. We analyzed sequence data of 16 plant genomes, including 13 angiosperms and three gymnosperms and identified 17,829 full-length and truncated SINEs falling into 31 families showing the widespread occurrence of SINEs in higher plants. The investigation focused on potato (Solanum tuberosum), resulting in the detection of seven different SolS SINE families consisting of 1489 full-length and 870 5′ truncated copies. Consensus sequences of full-length members range in size from 106 to 244 bp depending on the SINE family. SolS SINEs populated related species and evolved separately, which led to some distinct subfamilies. Solanaceae SINEs are dispersed along chromosomes and distributed without clustering but with preferred integration into short A-rich motifs. They emerged more than 23 million years ago and were species specifically amplified during the radiation of potato, tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum). We show that tobacco TS retrotransposons are composite SINEs consisting of the 3′ end of a long interspersed nuclear element integrated downstream of a nonhomologous SINE family followed by successfully colonization of the genome. We propose an evolutionary scenario for the formation of TS as a spontaneous event, which could be typical for the emergence of SINE families. PMID:21908723

  19. Heterogeneous Nuclear Ribonucleoprotein H1/H2-dependent Unsplicing of Thymidine Phosphorylase Results in Anticancer Drug Resistance

    PubMed Central

    Stark, Michal; Bram, Eran E.; Akerman, Martin; Mandel-Gutfreund, Yael; Assaraf, Yehuda G.

    2011-01-01

    Thymidine phosphorylase (TP) catalyzes the conversion of thymidine to thymine and 2-deoxyribose-1-phosphate. The latter plays an important role in induction of angiogenesis. As such, many human malignancies exhibit TP overexpression that correlates with increased microvessel density, formation of aggressive tumors, and dismal prognosis. Because TP is frequently overexpressed in cancer, pro-drugs were developed that utilize TP activity for their bioactivation to cytotoxic drugs. In this respect, TP is indispensable for the pharmacologic activity of the chemotherapeutic drug capecitabine, as it converts its intermediary metabolite 5′-deoxyfluorouridine to 5-fluorouracil. Thus, loss of TP function confers resistance to the prodrug capecitabine, currently used for the treatment of metastatic colorectal cancer and breast cancer. However, drug resistance phenomena may frequently emerge that compromise the pharmacologic activity of capecitabine. Deciphering the molecular mechanisms underlying resistance to TP-activated prodrugs is an important goal toward the overcoming of such drug resistance phenomena. Here, we discovered that lack of TP protein in drug-resistant tumor cells is due to unsplicing of its pre-mRNA. Advanced bioinformatics identified the family of heterogeneous nuclear ribonucleoproteins (hnRNP) H/F as candidate splicing factors potentially responsible for impaired TP splicing. Indeed, whereas parental cells lacked nuclear localization of hnRNPs H1/H2 and F, drug-resistant cells harbored marked levels of these splicing factors. Nuclear RNA immunoprecipitation experiments established a strong binding of hnRNP H1/H2 to TP pre-mRNA, hence implicating them in TP splicing. Moreover, introduction of hnRNP H2 into drug-sensitive parental cells recapitulated aberrant TP splicing and 5′-deoxyfluorouridine resistance. Thus, this is the first study identifying altered function of hnRNP H1/H2 in tumor cells as a novel determinant of aberrant TP splicing thereby

  20. Heterogeneous nuclear ribonucleoprotein H1/H2-dependent unsplicing of thymidine phosphorylase results in anticancer drug resistance.

    PubMed

    Stark, Michal; Bram, Eran E; Akerman, Martin; Mandel-Gutfreund, Yael; Assaraf, Yehuda G

    2011-02-04

    Thymidine phosphorylase (TP) catalyzes the conversion of thymidine to thymine and 2-deoxyribose-1-phosphate. The latter plays an important role in induction of angiogenesis. As such, many human malignancies exhibit TP overexpression that correlates with increased microvessel density, formation of aggressive tumors, and dismal prognosis. Because TP is frequently overexpressed in cancer, pro-drugs were developed that utilize TP activity for their bioactivation to cytotoxic drugs. In this respect, TP is indispensable for the pharmacologic activity of the chemotherapeutic drug capecitabine, as it converts its intermediary metabolite 5'-deoxyfluorouridine to 5-fluorouracil. Thus, loss of TP function confers resistance to the prodrug capecitabine, currently used for the treatment of metastatic colorectal cancer and breast cancer. However, drug resistance phenomena may frequently emerge that compromise the pharmacologic activity of capecitabine. Deciphering the molecular mechanisms underlying resistance to TP-activated prodrugs is an important goal toward the overcoming of such drug resistance phenomena. Here, we discovered that lack of TP protein in drug-resistant tumor cells is due to unsplicing of its pre-mRNA. Advanced bioinformatics identified the family of heterogeneous nuclear ribonucleoproteins (hnRNP) H/F as candidate splicing factors potentially responsible for impaired TP splicing. Indeed, whereas parental cells lacked nuclear localization of hnRNPs H1/H2 and F, drug-resistant cells harbored marked levels of these splicing factors. Nuclear RNA immunoprecipitation experiments established a strong binding of hnRNP H1/H2 to TP pre-mRNA, hence implicating them in TP splicing. Moreover, introduction of hnRNP H2 into drug-sensitive parental cells recapitulated aberrant TP splicing and 5'-deoxyfluorouridine resistance. Thus, this is the first study identifying altered function of hnRNP H1/H2 in tumor cells as a novel determinant of aberrant TP splicing thereby

  1. Heterogeneous nuclear ribonucleoprotein K is over expressed, aberrantly localised and is associated with poor prognosis in colorectal cancer.

    PubMed

    Carpenter, B; McKay, M; Dundas, S R; Lawrie, L C; Telfer, C; Murray, G I

    2006-10-09

    Heterogeneous ribonucleoprotein K (hnRNP K) is a member of the hnRNP family which has several different cellular roles including transcription, mRNA shuttling, RNA editing and translation. Several reports implicate hnRNP K having a role in tumorigenesis, for instance hnRNP K increases transcription of the oncogene c-myc and hnRNP K expression is regulated by the p53/MDM 2 pathway. In this study comparing normal colon to colorectal cancer by proteomics, hnRNP K was identified as being overexpressed in this type of cancer. Immunohistochemistry with a monoclonal antibody to hnRNP K (which we developed) on colorectal cancer tissue microarray, confirmed that hnRNP K was overexpressed in colorectal cancer (P<0.001) and also showed that hnRNP K had an aberrant subcellular localisation in cancer cells. In normal colon hnRNP K was exclusively nuclear whereas in colorectal cancer the protein localised both in the cytoplasm and the nucleus. There were significant increases in both nuclear (P=0.007) and cytoplasmic (P=0.001) expression of hnRNP K in Dukes C tumours compared with early stage tumours. In Dukes C patient's good survival was associated with increased hnRNP K nuclear expression (P=0.0093). To elaborate on the recent observation that hnRNP K is regulated by p53, the expression profiles of these two proteins were also analysed. There was no correlation between hnRNP K and p53 expression, however, patients who presented tumours that were positive for hnRNP K and p53 had a poorer survival outcome (P=0.045).

  2. Reconstruction of the isotope activity content of heterogeneous nuclear waste drums.

    PubMed

    Krings, Thomas; Mauerhofer, Eric

    2012-07-01

    Radioactive waste must be characterized in order to verify its conformance with national regulations for intermediate storage or its disposal. Segmented gamma scanning (SGS) is a most widely applied non-destructive analytical technique for the characterization of radioactive waste drums. The isotope specific activity content is generally calculated assuming a homogeneous matrix and activity distribution for each measured drum segment. However, real radioactive waste drums exhibit non-uniform isotope and density distributions most affecting the reliability and accuracy of activities reconstruction in SGS. The presence of internal shielding structures in the waste drum contributes generally to a strong underestimation of the activity and this in particular for radioactive sources emitting low energy gamma-rays independently of their spatial distribution. In this work we present an improved method to quantify the activity of spatially concentrated gamma-emitting isotopes (point sources or hot spots) in heterogeneous waste drums with internal shielding structures. The isotope activity is reconstructed by numerical simulations and fits of the angular dependent count rate distribution recorded during the drum rotation in SGS using an analytical expression derived from a geometric model. First results of the improved method and enhancements of this method are shown and are compared to each other as well as to the conventional method which assumes a homogeneous matrix and activity distribution. It is shown that the new model improves the accuracy and the reliability of the activity reconstruction in SGS and that the presented algorithm is suitable with respect to the framework requirement of industrial application.

  3. Concerted effects of heterogeneous nuclear ribonucleoprotein C1/C2 to control vitamin D-directed gene transcription and RNA splicing in human bone cells

    PubMed Central

    Zhou, Rui; Park, Juw Won; Chun, Rene F.; Lisse, Thomas S.; Garcia, Alejandro J.; Zavala, Kathryn; Sea, Jessica L.; Lu, Zhi-xiang; Xu, Jianzhong; Adams, John S.; Xing, Yi; Hewison, Martin

    2017-01-01

    Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH)2D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH)2D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH)2D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH)2D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH)2D-mediated induction of transcription. PMID:27672039

  4. Concerted effects of heterogeneous nuclear ribonucleoprotein C1/C2 to control vitamin D-directed gene transcription and RNA splicing in human bone cells.

    PubMed

    Zhou, Rui; Park, Juw Won; Chun, Rene F; Lisse, Thomas S; Garcia, Alejandro J; Zavala, Kathryn; Sea, Jessica L; Lu, Zhi-Xiang; Xu, Jianzhong; Adams, John S; Xing, Yi; Hewison, Martin

    2017-01-25

    Traditionally recognized as an RNA splicing regulator, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC1/C2) can also bind to double-stranded DNA and function in trans as a vitamin D response element (VDRE)-binding protein. As such, hnRNPC1/C2 may couple transcription induced by the active form of vitamin D, 1,25-dihydroxyvitamin D (1,25(OH)2D) with subsequent RNA splicing. In MG63 osteoblastic cells, increased expression of the 1,25(OH)2D target gene CYP24A1 involved immunoprecipitation of hnRNPC1/C2 with CYP24A1 chromatin and RNA. Knockdown of hnRNPC1/C2 suppressed expression of CYP24A1, but also increased expression of an exon 10-skipped CYP24A1 splice variant; in a minigene model the latter was attenuated by a functional VDRE in the CYP24A1 promoter. In genome-wide analyses, knockdown of hnRNPC1/C2 resulted in 3500 differentially expressed genes and 2232 differentially spliced genes, with significant commonality between groups. 1,25(OH)2D induced 324 differentially expressed genes, with 187 also observed following hnRNPC1/C2 knockdown, and a further 168 unique to hnRNPC1/C2 knockdown. However, 1,25(OH)2D induced only 10 differentially spliced genes, with no overlap with differentially expressed genes. These data indicate that hnRNPC1/C2 binds to both DNA and RNA and influences both gene expression and RNA splicing, but these actions do not appear to be linked through 1,25(OH)2D-mediated induction of transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Heterogeneous nuclear expression of the promyelocytic leukemia (PML) protein in normal and neoplastic human tissues.

    PubMed Central

    Gambacorta, M.; Flenghi, L.; Fagioli, M.; Pileri, S.; Leoncini, L.; Bigerna, B.; Pacini, R.; Tanci, L. N.; Pasqualucci, L.; Ascani, S.; Mencarelli, A.; Liso, A.; Pelicci, P. G.; Falini, B.

    1996-01-01

    The RING-finger promyelocytic leukemia (PML) protein is the product of the PML gene that fuses with the retinoic acid receptor-alpha gene in the t(15; 17) translocation of acute promyelocytic leukemia. Wild-type PML localizes in the nucleus with a typical speckled pattern that is a consequence of the concentration of the protein within discrete subnuclear domains known as nuclear bodies. Delocalization of PML from nuclear bodies has been documented in acute promyelocytic leukemia cells and suggested to contribute to leukemogenesis. In an attempt to get new insights into the function of the wild-type PML protein and to investigate whether it displays an altered expression pattern in neoplasms other than acute promyelocytic leukemia, we stained a large number of normal and neoplastic human tissues with a new murine monoclonal antibody (PG-M3) directed against the amino-terminal region of PML. As the PG-M3 epitope is partially resistant to fixatives, only cells that overexpress PML are detected by the antibody in microwave-heated paraffin sections. Among normal tissues, PML was characteristically up-regulated in activated epithelioid histiocytes and fibroblasts in a variety of pathological conditions, columnar epithelium in small active thyroid follicles, well differentiated foamy cells in the center of sebaceous glands, and hypersecretory endometria (Arias-Stella). Interferons, the PML of which is a primary target gene, and estrogens are likely to represent some of the cytokines and/or hormones that may be involved in the up-regulation of PML under these circumstances. In keeping with this concept, we found that PML is frequently overexpressed in Hodgkin and Reed-Sternberg cells of Hodgkin's disease, a tumor of cytokine-producing cells. Among solid tumors, overexpression of PML was frequently found in carcinomas of larynx and thyroid (papillary), epithelial thymomas, and Kaposi's sarcoma, whereas carcinomas of the lung, thyroid (follicular), breast, and colon were

  6. Considerations for a US Nuclear Force Structure below a 1,000-Warhead Limit

    DTIC Science & Technology

    2011-01-01

    discussion between the two counties on tactical nuclear weapons.13 By 26 January 2011 both the Russian State Duma and Federation Council ratified the...country brings to the table. The challenge is to coordinate the step-by-step disarmament of the nine current members of the nuclear weapons club while

  7. 26 CFR 1.468A-1T - Nuclear decommissioning costs; general rules (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... an elective method for taking into account nuclear decommissioning costs for Federal income tax... accrual method of accounting that do not elect the application of section 468A are not allowed a deduction.... (c) Special rules applicable to certain experimental nuclear facilities. (1) The owner of...

  8. Carbon pools and productivity in a 1-km2 heterogeneous forest and peatland mosaic in Minnesota, USA

    Treesearch

    Peter Weishampel; Randall Kolka; Jennifer Y. King

    2009-01-01

    Determining the magnitude of carbon (C) storage in forests and peatlands is an important step towards predicting how regional carbon balance will respond to climate change. However, spatial heterogeneity of dominant forest and peatland cover types can inhibit accurate C storage estimates. We evaluated ecosystem C pools and productivity in the Marcell Experimental...

  9. Ocean dynamic processes causing spatially heterogeneous distribution of sedimentary caesium-137 massively released from the Fukushima Daiichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Higashi, H.; Morino, Y.; Furuichi, N.; Ohara, T.

    2015-12-01

    Massive amounts of anthropogenic radiocaesium 137Cs that were released into the environment by the Fukushima Daiichi Nuclear Power Plant accident in March 2011 are widely known to have extensively migrated to Pacific Ocean sediment off of eastern Japan. Several recent reports have stated that the sedimentary 137Cs is now stable with a remarkably heterogeneous distribution. The present study elucidates ocean dynamic processes causing this heterogeneous sedimentary 137Cs distribution in and around the shelf off Fukushima and adjacent prefectures. We performed a numerical simulation of oceanic 137Cs behaviour for about 10 months after the accident, using a comprehensive dynamic model involving advection-diffusion transport in seawater, adsorption and desorption to and from particulate matter, sedimentation and suspension on and from the bottom, and vertical diffusion transport in the sediment. A notable simulated result was that the sedimentary 137Cs significantly accumulated in a swath just offshore of the shelf break (along the 50-100 m isobath) as in recent observations, although the seabed in the entire simulation domain was assumed to have ideal properties such as identical bulk density, uniform porosity, and aggregation of particles with a single grain diameter. This result indicated that the heterogeneous sedimentary 137Cs distribution was not necessarily a result of the spatial distribution of 137Cs sediment adsorptivity. The present simulation suggests that the shape of the swath is mainly associated with spatiotemporal variation between bottom shear stress in the shallow shelf (< 50 m depths) and that offshore of the shelf break. In a large part of the shallow shelf, the simulation indicated that strong bottom friction suspending particulate matter from the seabed frequently occurred via a periodic spring tide about every 2 weeks and via occasional strong wind. The sedimentary 137Cs thereby could hardly stay on the surface of the seabed with the result that

  10. Experimental results from pressure testing a 1:6-scale nuclear power plant containment

    SciTech Connect

    Horschel, D.S.

    1992-01-01

    This report discusses the testing of a 1:6-scale, reinforced-concrete containment building at Sandia National Laboratories, in Albuquerque, New Mexico. The scale-model, Light Water Reactor (LWR) containment building was designed and built to the American Society of Mechanical Engineers (ASME) code by United Engineers and Constructors, Inc., and was instrumented with over 1200 transducers to prepare for the test. The containment model was tested to failure to determine its response to static internal overpressurization. As part of the US Nuclear Regulatory Commission`s program on containment integrity, the test results will be used to assess the capability of analytical methods to predict the performance of containments under severe-accident loads. The scaled dimensions of the cylindrical wall and hemispherical dome were typical of a full-size containment. Other typical features included in the heavily reinforced model were equipment hatches, personnel air locks, several small piping penetrations, and a ihin steel liner that was attached to the concrete by headed studs. In addition to the transducers attached to the model, an acoustic detection system and several video and still cameras were used during testing to gather data and to aid in the conduct of the test. The model and its instrumentation are briefly discussed, and is followed by the testing procedures and measured response of the containment model. A summary discussion is included to aid in understanding the significance of the test as it applies to real world reinforced concrete containment structures. The data gathered during SIT and overpressure testing are included as an appendix.

  11. Translational upregulation of folate receptors is mediated by homocysteine via RNA-heterogeneous nuclear ribonucleoprotein E1 interactions

    PubMed Central

    Antony, Aśok C.; Tang, Ying-Sheng; Khan, Rehana A.; Biju, Mangatt P.; Xiao, Xiangli; Li, Qing-Jun; Sun, Xin-Lai; Jayaram, Hiremagalur N.; Stabler, Sally P.

    2004-01-01

    Cellular acquisition of folate is mediated by folate receptors (FRs) in many malignant and normal human cells. Although FRs are upregulated in folate deficiency and downregulated following folate repletion, the mechanistic basis for this relationship is unclear. Previously we demonstrated that interaction of an 18-base cis-element in the 5′-untranslated region of FR mRNA and a cystolic trans-factor (heterogeneous nuclear ribonucleoprotein E1 [hnRNP E1]) is critical for FR synthesis. However, the molecular mechanisms controlling this interaction, especially within the context of FR regulation and folate status, have remained obscure. Human cervical carcinoma cells exhibited progressively increasing upregulation of FRs after shifting of folate-replete cells to low-folate media, without a proportionate rise in FR mRNA or rise in hnRNP E1. Translational FR upregulation was accompanied by a progressive accumulation of the metabolite homocysteine within cultured cells, which stimulated interaction of the FR mRNA cis-element and hnRNP E1 as well as FR biosynthesis in a dose-dependent manner. Abrupt reversal of folate deficiency also led to a rapid parallel reduction in homocysteine and FR biosynthesis to levels observed in folate-replete cells. Collectively, these results suggest that homocysteine is the key modulator of translational upregulation of FRs and establishes the linkage between perturbed folate metabolism and coordinated upregulation of FRs. PMID:14722620

  12. Heterogeneous Nuclear Ribonucleoprotein R Cooperates with Mediator to Facilitate Transcription Reinitiation on the c-Fos Gene

    PubMed Central

    Fukuda, Aya; Shimada, Miho; Nakadai, Tomoyoshi; Nishimura, Ken; Hisatake, Koji

    2013-01-01

    The c-fos gene responds to extracellular stimuli and undergoes robust but transient transcriptional activation. Here we show that heterogeneous nuclear ribonucleoprotein R (hnRNP R) facilitates transcription reinitiation of the c-fos promoter in vitro in cooperation with Mediator. Consistently, hnRNP R interacts with the Scaffold components (Mediator, TBP, and TFIIH) as well as TFIIB, which recruits RNA polymerase II (Pol II) and TFIIF to Scaffold. The cooperative action of hnRNP R and Mediator is diminished by the cyclin-dependent kinase 8 (CDK8) module, which is comprised of CDK8, Cyclin C, MED12 and MED13 of the Mediator subunits. Interestingly, we find that the length of the G-free cassettes, and thereby their transcripts, influences the hnRNP R-mediated facilitation of reinitiation. Indeed, indicative of a possible role of the transcript in facilitating transcription reinitiation, the RNA transcript produced from the G-free cassette interacts with hnRNP R through its RNA recognition motifs (RRMs) and arginine-glycine-glycine (RGG) domain. Mutational analyses of hnRNP R indicate that facilitation of initiation and reinitiation requires distinct domains of hnRNP R. Knockdown of hnRNP R in mouse cells compromised rapid induction of the c-fos gene but did not affect transcription of constitutive genes. Together, these results suggest an important role for hnRNP R in regulating robust response of the c-fos gene. PMID:23967313

  13. Mutational definition of RNA-binding and protein-protein interaction domains of heterogeneous nuclear RNP C1.

    PubMed

    Wan, L; Kim, J K; Pollard, V W; Dreyfuss, G

    2001-03-09

    The heterogeneous nuclear ribonucleoprotein (hn- RNP) C proteins, among the most abundant pre-mRNA-binding proteins in the eukaryotic nucleus, have a single RNP motif RNA-binding domain. The RNA-binding domain (RBD) is comprised of approximately 80-100 amino acids, and its structure has been determined. However, relatively little is known about the role of specific amino acids of the RBD in the binding to RNA. We have devised a phage display-based screening method for the rapid identification of amino acids in hnRNP C1 that are essential for its binding to RNA. The identified mutants were further tested for binding to poly(U)-Sepharose, a substrate to which wild type hnRNP C1 binds with high affinity. We found both previously predicted, highly conserved residues as well as additional residues in the RBD to be essential for C1 RNA binding. We also identified three mutations in the leucine-rich C1-C1 interaction domain near the carboxyl terminus of the protein that both abolished C1 oligomerization and reduced RNA binding. These results demonstrate that although the RBD is the primary determinant of C1 RNA binding, residues in the C1-C1 interaction domain also influence the RNA binding activity of the protein. The experimental approach we described should be generally applicable for the screening and identification of amino acids that play a role in the binding of proteins to nucleic acid substrates.

  14. Heterogeneous Nuclear Ribonucleoprotein L is required for the survival and functional integrity of murine hematopoietic stem cells

    PubMed Central

    Gaudreau, Marie-Claude; Grapton, Damien; Helness, Anne; Vadnais, Charles; Fraszczak, Jennifer; Shooshtarizadeh, Peiman; Wilhelm, Brian; Robert, François; Heyd, Florian; Möröy, Tarik

    2016-01-01

    The proliferation and survival of hematopoietic stem cells (HSCs) has to be strictly coordinated to ensure the timely production of all blood cells. Here we report that the splice factor and RNA binding protein hnRNP L (heterogeneous nuclear ribonucleoprotein L) is required for hematopoiesis, since its genetic ablation in mice reduces almost all blood cell lineages and causes premature death of the animals. In agreement with this, we observed that hnRNP L deficient HSCs lack both the ability to self-renew and foster hematopoietic differentiation in transplanted hosts. They also display mitochondrial dysfunction, elevated levels of γH2AX, are Annexin V positive and incorporate propidium iodide indicating that they undergo cell death. Lin-c-Kit+ fetal liver cells from hnRNP L deficient mice show high p53 protein levels and up-regulation of p53 target genes. In addition, cells lacking hnRNP L up-regulated the expression of the death receptors TrailR2 and CD95/Fas and show Caspase-3, Caspase-8 and Parp cleavage. Treatment with the pan-caspase inhibitor Z-VAD-fmk, but not the deletion of p53, restored cell survival in hnRNP L deficient cells. Our data suggest that hnRNP L is critical for the survival and functional integrity of HSCs by restricting the activation of caspase-dependent death receptor pathways. PMID:27271479

  15. Heterogeneous nuclear ribonucleoprotein A/B and G inhibits the transcription of gonadotropin-releasing-hormone 1

    PubMed Central

    Zhao, Sheng; Korzan, Wayne J.; Chen, Chun-Chun; Fernald, Russell D.

    2008-01-01

    Gonadotropin releasing hormone 1 (GnRH1) causes the release of gonadotropins from the pituitary to control reproduction. Here we report that two heterogeneous nuclear ribonucleoproteins (hnRNP-A/B and hnRNP-G) bind to the GnRH-I upstream promoter region in a cichlid fish, Astatotilapia burtoni. We identified these binding proteins using a newly developed homology based method of mass spectrometric peptide mapping. We show that both hnRNP-A/B and hnRNP-G co-localize with GnRH1 in the pre-optic area of the hypothalamus in the brain. We also demonstrated that these ribonucleoproteins exhibit similar binding capacity in vivo, using immortalized mouse GT1-7 cells where overexpression of either hnRNP-A/B or hnRNP-G significantly down-regulate GnRH1 mRNA levels in GT1-7 cells, suggesting that both act as repressors in GnRH1 transcriptional regulation. PMID:17920292

  16. Heterogeneous Nuclear Ribonucleoprotein F Suppresses Angiotensinogen Gene Expression and Attenuates Hypertension and Kidney Injury in Diabetic Mice

    PubMed Central

    Lo, Chao-Sheng; Chang, Shiao-Ying; Chenier, Isabelle; Filep, Janos G.; Ingelfinger, Julie R.; Zhang, Shao Ling; Chan, John S.D.

    2012-01-01

    We investigated the impact of heterogeneous nuclear ribonucleoprotein F (hnRNP F) overexpression on angiotensinogen (Agt) gene expression, hypertension, and renal proximal tubular cell (RPTC) injury in high-glucose milieu both in vivo and in vitro. Diabetic Akita transgenic (Tg) mice specifically overexpressing hnRNP F in their RPTCs were created, and the effects on systemic hypertension, Agt gene expression, renal hypertrophy, and interstitial fibrosis were studied. We also examined immortalized rat RPTCs stably transfected with control plasmid or plasmid containing hnRNP F cDNA in vitro. The results showed that hnRNP F overexpression attenuated systemic hypertension, suppressed Agt and transforming growth factor-β1 (TGF-β1) gene expression, and reduced urinary Agt and angiotensin II levels, renal hypertrophy, and glomerulotubular fibrosis in Akita hnRNP F-Tg mice. In vitro, hnRNP F overexpression prevented the high-glucose stimulation of Agt and TGF-β1 mRNA expression and cellular hypertrophy in RPTCs. These data suggest that hnRNP F plays a modulatory role and can ameliorate hypertension, renal hypertrophy, and interstitial fibrosis in diabetes. The underlying mechanism is mediated, at least in part, via the suppression of intrarenal Agt gene expression in vivo. hnRNP F may be a potential target in the treatment of hypertension and kidney injury in diabetes. PMID:22664958

  17. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    SciTech Connect

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo . E-mail: sueokae@post.saga-med.ac.jp

    2005-08-05

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression.

  18. Isolation and characterization of the heterogeneous nuclear RNA-ribonucleoprotein complex

    SciTech Connect

    Choi, Y.D.

    1985-01-01

    Exposure of cells to UV light of sufficient intensity brings about crosslinking of RNA to proteins which are in direct contact with it in vivo. The major (/sup 35/S)methionine-labeled proteins which become crosslinked to poly(A)/sup +/hnRNA in HeLa cells are of 120K, 68K, 53K, 43K, 41K, 38K, and 36K (K = kilodaltons). By immunizing mice with UV crosslinked complexes two monoclonal antibodies (2B12 and 4F4) against the C proteins (41K and 43K) and one (3G6) against the 120K protein of the hnRNP complex were obtained. Immunofluorescence microscopy demonstrates that the C proteins and 120K are segregated to the nucleus and are not associated with nucleoli or chromatin. The two C proteins are highly related to each other antigenically. Monoclonal antibody 4F4 identifies the C proteins of the hnRNP complex in widely divergent species from human to lizard. The C proteins are phosphorylated and are in contact with hnRNA in vivo. The hnRNP complex was isolated from vertebrate cell nuclei by immunoprecipitation with these monoclonal antibodies. This complex contains proteins and hnRNA of up to approx.10 kb. The major steady state labeled (/sup 35/S)methionine labeled proteins of the isolated complex from HeLa cells are of 34K, 36K, 36K (A1 and A2), 37K, 38K (B1 and B2), 41K, 43K (C1 and C2) and doublets at 68K and at 120K. These proteins are organized into a 30S particle. Large hnRNP complexes are composed of multiples of 30S particles which are connected by highly nuclease sensitive stretches of hnRNA. It it concluded that the hnRNP structure is an integral component of the mRNA formation pathway in the eukaryotic cell.

  19. Nuclear receptors HNF4α and LRH-1 cooperate in regulating Cyp7a1 in vivo.

    PubMed

    Kir, Serkan; Zhang, Yuan; Gerard, Robert D; Kliewer, Steven A; Mangelsdorf, David J

    2012-11-30

    Fibroblast growth factor 19 (FGF19) is a postprandial enterokine induced by the nuclear bile acid receptor, FXR, in ileum. FGF19 inhibits bile acid synthesis in liver through transcriptional repression of cholesterol 7α-hydroxylase (CYP7A1) via a mechanism involving the nuclear receptor SHP. Here, in a series of loss-of-function studies, we show that the nuclear receptors HNF4α and LRH-1 have dual roles in regulating Cyp7a1 in vivo. First, they cooperate in maintaining basal Cyp7a1 expression. Second, they enable SHP binding to the Cyp7a1 promoter and facilitate FGF19-mediated repression of bile acid synthesis. HNF4α and LRH-1 promote active transcription histone marks on the Cyp7a1 promoter that are reversed by FGF19 in a SHP-dependent manner. These findings demonstrate that both HNF4α and LRH-1 are important regulators of Cyp7a1 transcription in vivo.

  20. Protein Kinase C-{delta} mediates down-regulation of heterogeneous nuclear ribonucleoprotein K protein: involvement in apoptosis induction

    SciTech Connect

    Gao, Feng-Hou; Wu, Ying-Li; Zhao, Meng; Chen, Guo-Qiang

    2009-11-15

    We reported previously that NSC606985, a camptothecin analogue, induces apoptosis of acute myeloid leukemia (AML) cells through proteolytic activation of protein kinase C delta ({Delta}PKC-{delta}). By subcellular proteome analysis, heterogeneous nuclear ribonucleoprotein K (hnRNP K) was identified as being significantly down-regulated in NSC606985-treated leukemic NB4 cells. HnRNP K, a docking protein for DNA, RNA, and transcriptional or translational molecules, is implicated in a host of processes involving the regulation of gene expression. However, the molecular mechanisms of hnRNP K reduction and its roles during apoptosis are still not understood. In the present study, we found that, following the appearance of the {Delta}PKC-{delta}, hnRNP K protein was significantly down-regulated in NSC606985, doxorubicin, arsenic trioxide and ultraviolet-induced apoptosis. We further provided evidence that {Delta}PKC-{delta} mediated the down-regulation of hnRNP K protein during apoptosis: PKC-{delta} inhibitor could rescue the reduction of hnRNP K; hnRNP K failed to be decreased in PKC-{delta}-deficient apoptotic KG1a cells; conditional induction of {Delta}PKC-{delta} in U937T cells directly down-regulated hnRNP K protein. Moreover, the proteasome inhibitor also inhibited the down-regulation of hnRNP K protein by apoptosis inducer and the conditional expression of {Delta}PKC-{delta}. More intriguingly, the suppression of hnRNP K with siRNA transfection significantly induced apoptosis. To our knowledge, this is the first demonstration that proteolytically activated PKC-{delta} down-regulates hnRNP K protein in a proteasome-dependent manner, which plays an important role in apoptosis induction.

  1. Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

    SciTech Connect

    Sugimasa, Hironobu; Taniue, Kenzui; Kurimoto, Akiko; Takeda, Yasuko; Kawasaki, Yoshihiro; Akiyama, Tetsu

    2015-03-27

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells.

  2. A novel SDS-stable dimer of a heterogeneous nuclear ribonucleoprotein at presynaptic terminals of squid neurons.

    PubMed

    Lico, D T P; Lopes, G S; Brusco, J; Rosa, J C; Gould, R M; De Giorgis, J A; Larson, R E

    2015-08-06

    The presence of mRNAs in synaptic terminals and their regulated translation are important factors in neuronal communication and plasticity. Heterogeneous nuclear ribonucleoprotein (hnRNP) complexes are involved in the translocation, stability, and subcellular localization of mRNA and the regulation of its translation. Defects in these processes and mutations in components of the hnRNP complexes have been related to the formation of cytoplasmic inclusion bodies and neurodegenerative diseases. Despite much data on mRNA localization and evidence for protein synthesis, as well as the presence of translation machinery, in axons and presynaptic terminals, the identity of RNA-binding proteins involved in RNA transport and function in presynaptic regions is lacking. We previously characterized a strongly basic RNA-binding protein (p65), member of the hnRNPA/B subfamily, in squid presynaptic terminals. Intriguingly, in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), p65 migrated as a 65-kDa protein, whereas members of the hnRNPA/B family typically have molecular masses ranging from 35 to 42kDa. In this report we present further biochemical and molecular characterization that shows endogenous p65 to be an SDS-stable dimer composed of ∼37-kDa hnRNPA/B-like subunits. We cloned and expressed a recombinant protein corresponding to squid hnRNPA/B-like protein and showed its propensity to aggregate and form SDS-stable dimers in vitro. Our data suggest that this unique hnRNPA/B-like protein co-localizes with synaptic vesicle protein 2 and RNA-binding protein ELAV and thus may serve as a link between local mRNA processing and presynaptic function and regulation.

  3. Heterogeneous nuclear ribonucleoprotein F/H proteins modulate the alternative splicing of the apoptotic mediator Bcl-x.

    PubMed

    Garneau, Daniel; Revil, Timothée; Fisette, Jean-François; Chabot, Benoit

    2005-06-17

    Bcl-x is a member of the Bcl-2 family of proteins that are key regulators of apoptosis. The Bcl-x pre-mRNA is alternatively spliced to yield Bcl-x(S) and Bcl-x(L), two isoforms that have been associated, respectively, with the promotion and the prevention of apoptosis. We have investigated some of the elements and factors involved in the production of these two splice variants. Deletion mutagenesis using a human Bcl-x minigene identifies two regions in exon 2 that modulate Bcl-x 5'-splice site selection in human HeLa cells. One region (B3) is located upstream of the Bcl-x(L) 5'-splice site and enforces Bcl-x(L) production in cells and splicing extracts. The other region (B2) is located immediately downstream of the 5'-splice site of Bcl-x(S) and favors Bcl-x(S) production in vivo and in vitro. A 30-nucleotide G-rich element (B2G) is responsible for the activity of the B2 element. We show that recombinant heterogeneous nuclear ribonucleoprotein (hnRNP) F and H proteins bind to B2G, and mutating the G stretches abolishes binding. Moreover, the addition of hnRNP F to a HeLa extract improved the production of the Bcl-x(S) variant in a manner that was dependent on the integrity of the G stretches in B2G. Consistent with the in vitro results, small interfering RNA-mediated RNA interference targeting hnRNP F and H decreased the Bcl-x(S)/Bcl-x(L) ratio of plasmid-derived and endogenously produced Bcl-x transcripts. Our results document a positive role for the hnRNP F/H proteins in the production of the proapoptotic regulator Bcl-x(S.).

  4. Direct Recruitment of ERK Cascade Components to Inducible Genes Is Regulated by Heterogeneous Nuclear Ribonucleoprotein (hnRNP) K*

    PubMed Central

    Mikula, Michal; Bomsztyk, Karol

    2011-01-01

    Components of the ERK cascade are recruited to genes, but it remains unknown how they are regulated at these sites. The RNA-binding protein heterogeneous nuclear ribonucleoprotein (hnRNP) K interacts with kinases and is found along genes including the mitogen-inducible early response gene EGR-1. Here, we used chromatin immunoprecipitations to study co-recruitment of hnRNP K and ERK cascade activity along the EGR-1 gene. These measurements revealed that the spatiotemporal binding patterns of ERK cascade transducers (GRB2, SOS, B-Raf, MEK, and ERK) at the EGR-1 locus resemble both hnRNP K and RNA polymerase II (Pol II). Inhibition of EGR-1 transcription with either serum-responsive factor knockdown or 5,6-dichloro-1-β-d-ribofuranosylbenzimidazole altered recruitment of all of the above ERK cascade components along this locus that mirrored the changes in Pol II and hnRNP K profiles. siRNA knockdown of hnRNP K decreased the levels of active MEK and ERK at the EGR-1, changes associated with decreased levels of elongating pre-mRNA and less efficient splicing. The hnRNP K dependence and pattern of ERK cascade activation at the c-MYC locus were different from at EGR-1. Ribonucleoprotein immunoprecipitations revealed that hnRNP K was associated with the EGR-1 but not c-MYC mRNAs. These data suggest a model where Pol II transcription-driven recruitment of hnRNP K along the EGR-1 locus compartmentalizes activation of the ERK cascade at these genes, events that regulate synthesis of mature mRNA. PMID:21233203

  5. Primary structures of the heterogeneous nuclear ribonucleoprotein A2, B1, and C2 proteins: a diversity of RNA binding proteins is generated by small peptide inserts.

    PubMed Central

    Burd, C G; Swanson, M S; Görlach, M; Dreyfuss, G

    1989-01-01

    We have isolated cDNAs for the major heterogeneous nuclear ribonucleoprotein (hnRNP) A2, B1, and C2 proteins and determined their nucleotide and deduced amino acid sequences. The A2 and B1 cDNAs are identical except for a 36-nucleotide in-frame insert in B1. Similarly, the sequence of the C2 protein cDNA is related to that of C1 in that C2 contains an extra 39 in-frame nucleotides. Therefore, the B1 amino acid sequence is identical to A2 except for the insertion of 12 amino acids near its amino terminus, and C1 and C2 are also identical to each other except for an extra 13 amino acids near the middle of C2. All three proteins are members of a large family of RNA binding proteins that contain the consensus sequence-type RNA binding domain (CS-RBD). The A2 and B1 proteins have a modular structure similar to that of the hnRNP protein A1: they contain two CS-RBDs and a glycine-rich auxiliary domain at the carboxyl terminus. The CS-RBDs of A2 and B1 have approximately 80% amino acid identity with those of A1, whereas the glycine-rich auxiliary domain is considerably more divergent with less than 30% of the amino acids being identical. These findings indicate that the addition of small peptides, probably by alternative pre-mRNA splicing, generates some of the diversity apparent among hnRNP proteins. Images PMID:2557628

  6. Heterogeneity of polyelectrolyte diffusion in polyelectrolyte-protein coacervates: a 1H pulsed field gradient NMR study.

    PubMed

    Menjoge, Amrish R; Kayitmazer, A Basak; Dubin, Paul L; Jaeger, Werner; Vasenkov, Sergey

    2008-04-24

    Proton pulsed field gradient (PFG) NMR was used to study the diffusion of poly(diallyldimethylammonium chloride) (PDADMAC) in coacervates formed from this polycation and the protein bovine serum albumin (BSA). Application of high (up to 30 T/m) magnetic field gradients in PFG NMR measurements allowed probing the diffusion of PDADMAC on a length scale of displacements as small as 100 nm in coacervates formed at different pH's and ionic strengths, i.e., conditions of varying protein-polycation interaction energy. Studies were carried out for a broad range of diffusion times and corresponding values of the mean square displacements. Several ensembles of PDADMAC polycations with different diffusivities were observed in the measured range of diffusion times. The existence of these ensembles and the pattern of their changes with increasing diffusion time support the hypothesis about the microscopic heterogeneity of PDADMAC-BSA coacervates and also provide evidence for the dynamic disintegration and reformation of dense domains.

  7. Red cell life span heterogeneity in hematologically normal people is sufficient to alter HbA1c.

    PubMed

    Cohen, Robert M; Franco, Robert S; Khera, Paramjit K; Smith, Eric P; Lindsell, Christopher J; Ciraolo, Peter J; Palascak, Mary B; Joiner, Clinton H

    2008-11-15

    Although red blood cell (RBC) life span is a known determinant of percentage hemoglobin A1c (HbA1c), its variation has been considered insufficient to affect clinical decisions in hematologically normal persons. However, an unexplained discordance between HbA1c and other measures of glycemic control can be observed that could be, in part, the result of differences in RBC life span. To explore the hypothesis that variation in RBC life span could alter measured HbA1c sufficiently to explain some of this discordance, we determined RBC life span using a biotin label in 6 people with diabetes and 6 nondiabetic controls. Mean RBC age was calculated from the RBC survival curve for all circulating RBCs and for labeled RBCs at multiple time points as they aged. In addition, HbA1c in magnetically isolated labeled RBCs and in isolated transferrin receptor-positivereticulocytes was used to determine the in vivo synthetic rate of HbA1c. The mean age of circulating RBCs ranged from 39 to 56 days in diabetic subjects and 38 to 60 days in nondiabetic controls. HbA1c synthesis was linear and correlated with mean whole blood HbA1c (R(2) = 0.91). The observed variation in RBC survival was large enough to cause clinically important differences in HbA1c for a given mean blood glucose.

  8. Genetic heterogeneity in cystinuria: the SLC3A1 gene is linked to type I but not to type III cystinuria.

    PubMed Central

    Calonge, M J; Volpini, V; Bisceglia, L; Rousaud, F; de Sanctis, L; Beccia, E; Zelante, L; Testar, X; Zorzano, A; Estivill, X

    1995-01-01

    Cystinuria is an autosomal recessive amino-aciduria where three urinary phenotypes have been described (I, II, and III). An amino acid transporter gene, SLC3A1 (formerly rBAT), was found to be responsible for this disorder. To assess whether mutations in SLC3A1 are involved in different cystinuria phenotypes, linkage with this gene and its nearest marker (D2S119) was analyzed in 22 families with type I and/or type III cystinuria. Linkage with heterogeneity was proved (alpha = 0.45; P < 0.008). Type I/I families showed homogeneous linkage to SLC3A1 (Zmax > 3.0 at theta = 0.00; alpha = 1), whereas types I/III and III/III were not linked. Our data suggest that type I cystinuria is due to mutations in the SLC3A1 gene, whereas another locus is responsible for type III. This result establishes genetic heterogeneity for cystinuria, classically considered as a multiallelic monogenic disease. Images Fig. 2 Fig. 3 PMID:7568194

  9. The autism-related gene SNRPN regulates cortical and spine development via controlling nuclear receptor Nr4a1

    PubMed Central

    Li, Huiping; Zhao, Pingping; Xu, Qiong; Shan, Shifang; Hu, Chunchun; Qiu, Zilong; Xu, Xiu

    2016-01-01

    The small nuclear ribonucleoprotein polypeptide N (SNRPN) gene, encoding the RNA-associated SmN protein, duplications or deletions of which are strongly associated with neurodevelopmental disabilities. SNRPN-coding protein is highly expressed in the brain. However, the role of SNRPN protein in neural development remains largely unknown. Here we showed that the expression of SNRPN increased markedly during postnatal brain development. Overexpression or knockdown of SNRPN in cortical neurons impaired neurite outgrowth, neuron migration, and the distribution of dendritic spines. We found that SNRPN regulated the expression level of Nr4a1, a critical nuclear receptor during neural development, in cultured primary cortical neurons. The abnormal spine development caused by SNRPN overexpression could be fully rescued by Nr4a1 co-expression. Importantly, we found that either knockdown of Nr4a1 or 3, 3′- Diindolylmethane (DIM), an Nr4a1 antagonist, were able to rescue the effects of SNRPN knockdown on neurite outgrowth of embryonic cortical neurons, providing the potential therapeutic methods for SNRPN deletion disorders. We thus concluded that maintaining the proper level of SNRPN is critical in cortical neurodevelopment. Finally, Nr4a1 may serve as a potential drug target for SNRPN-related neurodevelopmental disabilities, including Prader-Willi syndrome (PWS) and autism spectrum disorders (ASDs). PMID:27430727

  10. Inactivation of the orphan nuclear receptor NR4A1 contributes to apoptosis induction by fangchinoline in pancreatic cancer cells.

    PubMed

    Lee, Hyo-Seon; Safe, Stephen; Lee, Syng-Ook

    2017-10-01

    Previous studies have demonstrated that the orphan nuclear receptor NR4A1 is overexpressed in human pancreatic cancer and antagonizing this receptor promotes apoptosis and inhibits pancreatic cancer cells and tumor growth. In the present study, we identified fangchinoline, a bisbenzyltetrahydroisoquinoline alkaloid from Stephania tetrandra, as a new inactivator of nuclear NR4A1 and demonstrated that fangchinoline inhibits cell proliferation and induces apoptosis, in part, via the NR4A1-dependent pro-apoptotic pathways in human pancreatic cancer cells. It decreased expression of the antiapoptotic protein survivin by inhibiting Sp1-mediated transcription and induced oxidative stress-mediated endoplasmic reticulum (ER) stress in pancreatic cancer cells. These results suggest that inhibition of NR4A1-mediated transcriptional activity was involved in the anticancer effects of fangchinoline, and fangchinoline represents a novel class of mechanism-based anticancer agents targeting NR4A1 that is overexpressed in pancreatic cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Incrimination of Heterogeneous Nuclear Ribonucleoprotein E1 (hnRNP-E1) as a Candidate Sensor of Physiological Folate Deficiency*

    PubMed Central

    Tang, Ying-Sheng; Khan, Rehana A.; Zhang, Yonghua; Xiao, Suhong; Wang, Mu; Hansen, Deborah K.; Jayaram, Hiremagalur N.; Antony, Aśok C.

    2011-01-01

    The mechanism underlying the sensing of varying degrees of physiological folate deficiency, prior to adaptive optimization of cellular folate uptake through the translational up-regulation of folate receptors (FR) is unclear. Because homocysteine, which accumulates intracellularly during folate deficiency, stimulated interactions between heterogeneous nuclear ribonucleoprotein E1 (hnRNP-E1) and an 18-base FR-α mRNA cis-element that led to increased FR biosynthesis and net up-regulation of FR at cell surfaces, hnRNP-E1 was a plausible candidate sensor of folate deficiency. Accordingly, using purified components, we evaluated the physiological basis whereby l-homocysteine triggered these RNA-protein interactions to stimulate FR biosynthesis. l-Homocysteine induced a concentration-dependent increase in RNA-protein binding affinity throughout the range of physiological folate deficiency, which correlated with a proportionate increase in translation of FR in vitro and in cultured human cells. Targeted reduction of newly synthesized hnRNP-E1 proteins by siRNA to hnRNP-E1 mRNA reduced both constitutive and l-homocysteine-induced rates of FR biosynthesis. Furthermore, l-homocysteine covalently bound hnRNP-E1 via multiple protein-cysteine-S-S-homocysteine mixed disulfide bonds within K-homology domains known to interact with mRNA. These data suggest that a concentration-dependent, sequential disruption of critical cysteine-S-S-cysteine bonds by covalently bound l-homocysteine progressively unmasks an underlying RNA-binding pocket in hnRNP-E1 to optimize interaction with FR-α mRNA cis-element preparatory to FR up-regulation. Collectively, such data incriminate hnRNP-E1 as a physiologically relevant, sensitive, cellular sensor of folate deficiency. Because diverse mammalian and viral mRNAs also interact with this RNA-binding domain with functional consequences to their protein expression, homocysteinylated hnRNP-E1 also appears well positioned to orchestrate a novel

  12. A Novel Heterogeneous Nuclear Ribonucleoprotein-Like Protein Interacts with NS1 of the Minute Virus of Mice

    PubMed Central

    Harris, Colin E.; Boden, Richard A.; Astell, Caroline R.

    1999-01-01

    NS1, the major nonstructural parvovirus protein of the minute virus of mice, is a multifunctional protein responsible for several aspects of viral replication. NS1 transactivates the P38 promoter (used to express the structural proteins), as well as its own strong promoter, P4. To study the mechanism of activation and to map regions of NS1 responsible for transactivation, NS1 and various deletions of NS1 were cloned in frame with the GAL4DB and cotransfected into COS-7 and LA9 cells with a synthetic GAL4-responsive reporter plasmid. These studies showed NS1 can directly activate transcription through its 129 carboxyl-terminal amino acid residues. Any deletion from this region of the C terminus, even as few as 8 amino acids, completely abolishes transactivation. A yeast two-hybrid system used to identify protein-protein interactions demonstrated that NS1 is able to dimerize when expressed in yeast cells. However, only an almost complete NS11–638 bait was able to interact with the full-length NS1. A two-hybrid screen identified a HeLa cell cDNA clone (NS1-associated protein 1 [NSAP1]) that interacts with NS11–276 and NS11–638. An additional sequence was predicted from human EST (expressed sequence tag) data, and the cDNA was estimated to be at least 2,221 bp long, potentially encoding a 562-amino-acid protein product. A polyclonal antibody raised to a synthetic peptide within NSAP1 recognizes an ∼65-kDa cellular protein. This NSAP1 cDNA has not previously been characterized, but the predicted protein sequence is 80% identical to the recently identified heterogeneous nuclear ribonucleoprotein (hnRNP) R (W. Hassfeld et al., Nucleic Acids Res. 26:439–445, 1998). NSAP1 contains four ribonucleoprotein domains, as well as a highly repetitive C-terminal region. A closely related mouse cDNA (deduced from murine EST data) encodes a protein with only a single amino acid residue change from the human protein. NSAP1 is predicted to be a 65-kDa polynucleotide binding

  13. Heterogeneous nuclear ribonucleoprotein E1 regulates protein disulphide isomerase translation in oxidized low-density lipoprotein-activated endothelial cells.

    PubMed

    Meng, N; Peng, N; Huang, S; Wang, S Q; Zhao, J; Su, L; Zhang, Y; Zhang, S; Zhao, B; Miao, J

    2015-03-01

    Endothelium-derived protein disulphide isomerase (PDI) is required for thrombus formation in vivo. But, how to control PDI overproduction in oxidized low-density lipoprotein (oxLDL)-activated vascular endothelial cells (VECs) is not well understood. In this study, we try to answer this question using our newly identified activator of mTOC1 3-benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2 (3H)-one (3BDO) that has been shown to protect VECs. First, we performed a proteomics analysis on the oxLDL-activated vascular VECs in the presence or absence of 3BDO. Next, we constructed the heterogeneous nuclear ribonucleoprotein E1 (hnRNP E1) mutants at Ser43 and used the RNA-ChIP technique to investigate the relationship between hnRNP E1 and PDI production. Furthermore, we examined the effect of 3BDO on oxLDL-altered phosphorylation of Akt1 and Akt2. Finally, we studied the effect of 3BDO on oxLDL-altered PDI protein level in apolipoprotein E(-/-) mice with advanced atherosclerosis. In VECs, oxLDL-increased PDI protein level, induced hnRNP E1 phosphorylation at Ser43, suppressed the binding of hnRNP E1 to PDI 5'UTR and induced the phosphorylation of Akt2 but not Akt1. All of these processes were blocked by 3BDO. Importantly, Ser43 mutant of hnRNP E1 inhibited the increase of PDI protein level and the decrease of the binding of hnRNP E1 and PDI 5'UTR induced by oxLDL. Furthermore, 3BDO suppressed oxLDL-induced PDI protein increase in the serum and plaque endothelium of apolipoprotein E(-/-) mice. hnRNP E1 is a new regulator of PDI translation in oxLDL-activated VECs, and 3BDO is a powerful agent for controlling PDI overproduction. © 2014 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  14. Noble metal-catalyzed homogeneous and heterogeneous processes in treating simulated nuclear waste media with formic acid

    SciTech Connect

    King, R.B.; Bhattacharyya, N.K.; Smith, H.D.

    1995-09-01

    Simulants for the Hanford Waste Vitrification Plant feed containing the major non-radioactive components Al, Cd, Fe, Mn, Nd, Ni, Si, Zr, Na, CO{sub 3}{sup 2}-, NO{sub 3}-, and NO{sub 2}- were used to study reactions of formic acid at 90{degrees}C catalyzed by the noble metals Ru, Rh, and/or Pd found in significant quantities in uranium fission products. Such reactions were monitored using gas chromatography to analyze the CO{sub 2}, H{sub 2}, NO, and N{sub 2}O in the gas phase and a microammonia electrode to analyze the NH{sub 4}+/NH{sub 3} in the liquid phase as a function of time. The following reactions have been studied in these systems since they are undesirable side reactions in nuclear waste processing: (1) Decomposition of formic acid to CO{sub 2} + H{sub 2} is undesirable because of the potential fire and explosion hazard of H{sub 2}. Rhodium, which was introduced as soluble RhCl{sub 3}-3H{sub 2}O, was found to be the most active catalyst for H{sub 2} generation from formic acid above {approximately} 80{degrees}C in the presence of nitrite ion. The H{sub 2} production rate has an approximate pseudo first-order dependence on the Rh concentration, (2) Generation of NH{sub 3} from the formic acid reduction of nitrate and/or nitrite is undesirable because of a possible explosion hazard from NH{sub 4}NO{sub 3} accumulation in a waste processing plant off-gas system. The Rh-catalyzed reduction of nitrogen-oxygen compounds to ammonia by formic acid was found to exhibit the following features: (a) Nitrate rather than nitrite is the principal source of NH{sub 3}. (b) Ammonia production occurs at the expense of hydrogen production. (c) Supported rhodium metal catalysts are more active than rhodium in any other form, suggesting that ammonia production involves heterogeneous rather than homogeneous catalysis.

  15. High expression of orphan nuclear receptor NR4A1 in a subset of ovarian tumors with worse outcome.

    PubMed

    Delgado, Evan; Boisen, Michelle M; Laskey, Robin; Chen, Rui; Song, Chi; Sallit, Jad; Yochum, Zachary A; Andersen, Courtney L; Sikora, Matthew J; Wagner, Jacob; Safe, Stephen; Elishaev, Esther; Lee, Adrian; Edwards, Robert P; Haluska, Paul; Tseng, George; Schurdak, Mark; Oesterreich, Steffi

    2016-05-01

    Nuclear receptors (NRs) play a vital role in the development and progression of several cancers including breast and prostate. Using TCGA data, we sought to identify critical nuclear receptors in high grade serous ovarian cancers (HGSOC) and to confirm these findings using in vitro approaches. In silico analysis of TCGA data was performed to identify relevant NRs in HGSOC. Ovarian cancer cell lines were screened for NR expression and functional studies were performed to determine the significance of these NRs in ovarian cancers. NR expression was analyzed in ovarian cancer tissue samples using immunohistochemistry to identify correlations with histology and stage of disease. The NR4A family of NRs was identified as a potential driver of ovarian cancer pathogenesis. Overexpression of NR4A1 in particular correlated with worse progression free survival. Endogenous expression of NR4A1 in normal ovarian samples was relatively high compared to that of other tissue types, suggesting a unique role for this orphan receptor in the ovary. Expression of NR4A1 in HGSOC cell lines as well as in patient samples was variable. NR4A1 primarily localized to the nucleus in normal ovarian tissue while co-localization within the cytoplasm and nucleus was noted in ovarian cancer cell lines and patient tissues. NR4A1 is highly expressed in a subset of HGSOC samples from patients that have a worse progression free survival. Studies to target NR4A1 for therapeutic intervention should include HGSOC. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Hyporheic Exchange in a Stream Dammed by Beaver: A 1D Simulation with Spatial Energy Head Gradients and Heterogeneous Hydraulic Conductivity as Drivers

    NASA Astrophysics Data System (ADS)

    Fairfax, E. J.; Small, E. E.

    2016-12-01

    Hyporheic exchange, the exchange of water between streams and adjacent subsurface sediments, is an important process connecting groundwater and surface water. Knowing the location and magnitude of hyporheic exchange is useful in evaluating fish spawning habitats, biogeochemical processes, and capacity for aquifer recharge of a given stream. Hyporheic exchange through the streambed is driven by variations in longitudinal head gradient and spatial heterogeneity in hydraulic conductivity. Beaver damming directly effects these two drivers. Beaver dams are efficient flow obstructions that cause significant upstream ponding. Both the flow obstruction itself (the beaver dam) and the pool of deeper water (the beaver pond) increase streambed pressure. Increased streambed pressure alters the energy head gradients within the stream and drives enhanced hyporheic exchange. Additionally, several studies in the literature have found increased sedimentation rates within beaver ponds, particularly of finer particles and organic material that otherwise might not settle out of a faster-moving, undammed stream. This means sediment aggradation along the longitudinal profile of a stream-dam-pond system varies in both volume and type. Nonuniform volume of aggraded sediment further changes streambed topography, and in turn energy head gradients. Nonuniform sediment type results in heterogeneous hydraulic conductivity - the other driver of enhanced hyporheic exchange. We use a 1D model of hyporheic exchange based on Laplace's Equation and Darcy's Equation for a system at steady-state. We utilize observed and theoretical streambed profiles in streams dammed by beaver to explore how the hyporheic exchange in a stream might change through time after a beaver dam is built. The model produces a series of steady-state snapshots of the stream-dam-pond system through time. The simulations demonstrate that on relatively short timescales (months-years) beaver damming can lead to more pronounced

  17. Heterogeneous behavior of lipids according to HbA1c levels undermines the plausibility of metabolic syndrome in type 1 diabetes: data from a nationwide multicenter survey.

    PubMed

    Giuffrida, Fernando M A; Guedes, Alexis D; Rocco, Eloa R; Mory, Denise B; Dualib, Patricia; Matos, Odelisa S; Chaves-Fonseca, Reine M; Cobas, Roberta A; Negrato, Carlos Antonio; Gomes, Marilia B; Dib, Sergio A

    2012-12-27

    Cardiovascular risk factors (CVRF) may cluster in type 1 diabetes, analogously to the metabolic syndrome described in type 2 diabetes. The threshold of HbA1c above which lipid variables start changing behavior is unclear. This study aims to 1) assess the behavior of dyslipidemia according to HbA1c values; 2) detect a threshold of HbA1c beyond which lipids start to change and 3) compare the clustering of lipids and other non-lipid CVRF among strata of HbA1c individuals with type 1 diabetes. Effects of HbA1c quintiles (1st: ≤7.4%; 2nd: 7.5-8.5%; 3rd: 8.6-9.6%; 4th: 9.7-11.3%; and 5th: >11.5%) and covariates (gender, BMI, blood pressure, insulin daily dose, lipids, statin use, diabetes duration) on dyslipidemia were studied in 1275 individuals from the Brazilian multi-centre type 1 diabetes study and 171 normal controls. Body size and blood pressure were not correlated to lipids and glycemic control. OR (99% CI) for high-LDL were 2.07 (1.21-3.54) and 2.51 (1.46-4.31), in the 4th and 5th HbA1c quintiles, respectively. Hypertriglyceridemia increased in the 5th quintile of HbA1c, OR 2.76 (1.20-6.37). OR of low-HDL-cholesterol were 0.48 (0.24-0.98) and 0.41 (0.19-0.85) in the 3rd and 4th HbA1c quintiles, respectively. HDL-cholesterol correlated positively (0.437) with HbA1c in the 3rd quintile. HDL-cholesterol and insulin dose correlated inversely in all levels of glycemic control. Correlation of serum lipids with HbA1c is heterogeneous across the spectrum of glycemic control in type 1 diabetes individuals. LDL-cholesterol and triglycerides worsened alongside HbA1c with distinct thresholds. Association of lower HDL-cholesterol with higher daily insulin dose is consistent and it points out to a role of exogenous hyperinsulinemia in the pathophysiology of the CVRF clustering. These data suggest diverse pathophysiological processes depending on HbA1c, refuting a unified explanation for cardiovascular risk in type 1 diabetes.

  18. Heterogeneous behavior of lipids according to HbA1c levels undermines the plausibility of metabolic syndrome in type 1 diabetes: data from a nationwide multicenter survey

    PubMed Central

    2012-01-01

    Background Cardiovascular risk factors (CVRF) may cluster in type 1 diabetes, analogously to the metabolic syndrome described in type 2 diabetes. The threshold of HbA1c above which lipid variables start changing behavior is unclear. This study aims to 1) assess the behavior of dyslipidemia according to HbA1c values; 2) detect a threshold of HbA1c beyond which lipids start to change and 3) compare the clustering of lipids and other non-lipid CVRF among strata of HbA1c individuals with type 1 diabetes. Methods Effects of HbA1c quintiles (1st: ≤7.4%; 2nd: 7.5-8.5%; 3rd: 8.6-9.6%; 4th: 9.7-11.3%; and 5th: >11.5%) and covariates (gender, BMI, blood pressure, insulin daily dose, lipids, statin use, diabetes duration) on dyslipidemia were studied in 1275 individuals from the Brazilian multi-centre type 1 diabetes study and 171 normal controls. Results Body size and blood pressure were not correlated to lipids and glycemic control. OR (99% CI) for high-LDL were 2.07 (1.21-3.54) and 2.51 (1.46-4.31), in the 4th and 5th HbA1c quintiles, respectively. Hypertriglyceridemia increased in the 5th quintile of HbA1c, OR 2.76 (1.20-6.37). OR of low-HDL-cholesterol were 0.48 (0.24-0.98) and 0.41 (0.19-0.85) in the 3rd and 4th HbA1c quintiles, respectively. HDL-cholesterol correlated positively (0.437) with HbA1c in the 3rd quintile. HDL-cholesterol and insulin dose correlated inversely in all levels of glycemic control. Conclusions Correlation of serum lipids with HbA1c is heterogeneous across the spectrum of glycemic control in type 1 diabetes individuals. LDL-cholesterol and triglycerides worsened alongside HbA1c with distinct thresholds. Association of lower HDL-cholesterol with higher daily insulin dose is consistent and it points out to a role of exogenous hyperinsulinemia in the pathophysiology of the CVRF clustering. These data suggest diverse pathophysiological processes depending on HbA1c, refuting a unified explanation for cardiovascular risk in type 1 diabetes. PMID

  19. Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes.

    PubMed

    Amemiya-Kudo, Michiyo; Shimano, Hitoshi; Hasty, Alyssa H; Yahagi, Naoya; Yoshikawa, Tomohiro; Matsuzaka, Takashi; Okazaki, Hiroaki; Tamura, Yoshiaki; Iizuka, Yoko; Ohashi, Ken; Osuga, Jun-ichi; Harada, Kenji; Gotoda, Takanari; Sato, Ryuichiro; Kimura, Satoshi; Ishibashi, Shun; Yamada, Nobuhiro

    2002-08-01

    Recent studies on the in vivo roles of the sterol regulatory element binding protein (SREBP) family indicate that SREBP-2 is more specific to cholesterogenic gene expression whereas SREBP-1 targets lipogenic genes. To define the molecular mechanism involved in this differential regulation, luciferase-reporter gene assays were performed in HepG2 cells to compare the transactivities of nuclear SREBP-1a, -1c, and -2 on a battery of SREBP-target promoters containing sterol regulatory element (SRE), SRE-like, or E-box sequences. The results show first that cholesterogenic genes containing classic SREs in their promoters are strongly and efficiently activated by both SREBP-1a and SREBP-2, but not by SREBP-1c. Second, an E-box containing reporter gene is much less efficiently activated by SREBP-1a and -1c, and SREBP-2 was inactive in spite of its ability to bind to the E-box. Third, promoters of lipogenic enzymes containing variations of SRE (SRE-like sequences) are strongly activated by SREBP-1a, and only modestly and equally by both SREBP-1c and -2. Finally, substitution of the unique tyrosine residue within the basic helix-loop-helix (bHLH) portion of nuclear SREBPs with arginine, the conserved residue found in all other bHLH proteins, abolishes the transactivity of all SREBPs for SRE, and conversely results in markedly increased activity of SREBP-1 but not activity of SREBP-2 for E-boxes. These data demonstrate the different specificity and affinity of nuclear SREBP-1 and -2 for different target DNAs, explaining a part of the mechanism behind the differential in vivo regulation of cholesterogenic and lipogenic enzymes by SREBP-1 and -2, respectively.

  20. Characterization of the Interfacial Regions of Heterogeneous Blends of Immiscible Polymers by Dynamic Nuclear Polarization (13)C NMR

    DTIC Science & Technology

    1990-10-31

    a stable free radical, we can generate a dynamic nuclear polarization ( DNP ) enhanced 13C NMR signal from chains of the undoped component which are...within 100 A of the interface. DNP - enhanced NMR relaxation experiments performed on polycarbonate/free-radical-doped- polystyrene blends show that...perform DNP -selected, NMR relaxation experiments on a variety of polycarbonate-polystyrene blends with known thermal histories and solvent exposure. The

  1. Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa histone deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1.

    PubMed

    Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania; Bertini, Enrico; Zanni, Ginevra

    2015-04-03

    Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin-myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify a new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Nuclear magnetic resonance spectra for l > 1 spins in dynamically heterogeneous systems with chemical exchange among environments.

    PubMed

    Zhang, H; Bryant, R G

    1995-06-01

    Nuclear magnetic resonance spectra for nuclei with spin l > 1 are considered in cases in which the observed nucleus may sample a rotationally immobilized and an isotropic environment that are coupled by a chemical exchange process. Spectra are simulated for the central (1/2, -1/2) transition for a 3/2 nucleus as a function of the concentrations of the two environments and as a function of the exchange rate between them. It is shown that a crucial feature determining the shape of the observable spectra is the spatial extent or the local order in the immobilized phase. In the case for which all rotationally immobilized sites sampled by the exchanging nucleus are identically oriented but where there is a distribution of these microdomain orientations with respect to the magnetic field direction, a powder pattern for the central transition is observed that carries whatever dynamic information may be derived from it. In the fast exchange limit, the width of the powder pattern scales inversely with the concentration of the isotropic environment as usual. In the intermediate exchange regimes, a complex line shape results that may mask the anisotropic character of the spectrum. In the slow exchange limit, superposition of the spectral contributions results; however, if the isotropic environment concentration is significantly larger than the anisotropic environment concentration, the anisotropic contribution is very difficult to detect because of the dynamic range problem and the possibly large difference in the effective line widths. In the case for which the exchanging nucleus samples a considerable distribution of rotationally immobilized site orientations, the anisotropic character of the spectrum is lost and a super-Lorentzian line shape results. These effects are demonstrated experimentally by 35Cl nuclear magnetic resonance spectra obtained on a lamellar liquid crystal that is modified with the addition of a thiolmercurate to provide a site of large quadrupole

  3. Heterogeneous nuclear transfer embryos reconstructed by bovine oocytes and camel (Camelus bactrianus) skin fibroblasts and their subsequent development.

    PubMed

    Zhou, Huanmin; Guo, Zhenhua

    2006-01-01

    This study reconstructed heterogeneous embryos using camel skin fibroblast cells as donor karyoplasts and the bovine oocytes as recipient cytoplasts to investigate the reprogramming of camel somatic cell nuclei in bovine oocyte cytoplasm and the developmental potential of the reconstructed embryos. Serum-starved skin fibroblast cells, obtained from adult camel, were electrically fused into enucleated bovine metaphase II (MII) oocytes that were matured in vitro. The fused eggs were activated by Inomycin with 2 mM/ml 6-dimethylaminopurine. The activated reconstructed embryos were cocultured with bovine cumulus cells in synthetic oviduct fluid supplemented with amino acid (SOFaa) and 10% fetal calf serum for 168 h. Results showed that 53% of the injected oocytes were successfully fused, 34% of the fused eggs underwent the first egg cleavage, and 100% of them developed to four- or 16-cell embryo stages. The first completed cleavage of xenonuclear transfer camel embryos occurred between 22 and 48 h following activation. This study demonstrated that the reconstructed embryos underwent the first embryonic division and that the reprogramming of camel fibroblast nuclei can be initiated in enucleated bovine MII oocytes.

  4. Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa Histone Deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1

    SciTech Connect

    Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania; Bertini, Enrico; Zanni, Ginevra

    2015-04-03

    Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin–myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify a new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. - Highlights: • ROCK regulates nucleocytoplasmic shuttling of HDAC7 via phosphorylation of MYPT1. • Nuclear export of HDAC7 and upregulation of NR4A1 occurs with low ROCK activity. • High levels of ROCK activity due to OPHN1 loss of function downregulate NR4A1.

  5. Molecular definition of heterogeneous nuclear ribonucleoprotein R (hnRNP R) using autoimmune antibody: immunological relationship with hnRNP P.

    PubMed

    Hassfeld, W; Chan, E K; Mathison, D A; Portman, D; Dreyfuss, G; Steiner, G; Tan, E M

    1998-01-15

    Serum from a patient showing symptoms related to autoimmunity was found to contain autoantibodies to the nuclear mitotic apparatus (NuMA) protein and to several novel nuclear antigens with estimated molecular weights of 40, 43, 72, 74 and 82 kDa. Using this serum for screening a human cDNA expression library a 2.5 kb cDNA clone was isolated which encoded the complete sequence of a protein of 633 amino acids. Sequence analysis revealed a modular structure of the protein: an acidic N-terminal region of approximately 150 amino acids was followed by three adjacent consensus sequence RNA binding domains located in the central part of the protein. In the C-terminal portion a nuclear localization signal and an octapeptide (PPPRMPPP) with similarity to a major B cell epitope of the snRNP core protein B were identified. This was followed by a glycine- and arginine-rich section of approximately 120 amino acids forming another type of RNA binding motif, a RGG box. Interestingly, three copies of a tyrosine-rich decapeptide were found interspersed in the RGG box region. The major in vitro translation product of the cDNA co-migrated in SDS-PAGE with the 82 kDa polypeptide that was recognized by autoantibodies. The structural motifs as well as the immunofluorescence pattern generated by anti-82 kDa antibodies suggested that the antigen was one of the proteins of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. Subsequently the 82 kDa antigen was identified as hnRNP R protein by its presence in immunoprecipitated hnRNP complexes and co-migration of the recombinant protein with this hitherto uncharacterized hnRNP constituent in two-dimensional gel electrophoresis. The concomitant autoimmune response to a hnRNP component of the pre-mRNA processing machinery and to NuMA, a protein engaged in mitotic events and reported to be associated with mRNA splicing complexes in interphase, may indicate physical and functional association of these antigens. Support for this notion

  6. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    SciTech Connect

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  7. Engagement of heterogeneous nuclear ribonucleoprotein M with listeriolysin O induces type I interferon expression and restricts Listeria monocytogenes growth in host cells.

    PubMed

    Luo, Zheng; Li, Zhonghua; Chen, Kun; Liu, Ruochen; Li, Xiaoqi; Cao, Hong; Zheng, Shijun J

    2012-10-01

    Listeriolysin O (LLO) is a key virulence factor secreted by the Gram-positive, facultative intracellular pathogen Listeria monocytogenes (LM). Its role in host cell response is still not very clear. Using pull-down assay, mass spectrometry analysis and immunoprecipitation approaches, we found that LLO interacted with heterogeneous nuclear ribonucleoprotein M (hnRNPM), a member of RNA splicing complex apparatus, and the binding domain of LLO for hnRNP M was located between amino acids 26 and 176. Knockdown of hnRNP M inhibited LLO-induced activation of IFN-α, IFN-β and AP-1 promoters and enhanced LM growth in host cells. Thus, engagement of hnRNP M with LLO induces type I interferon expression and restricts LM growth in host cells, suggesting a critical role of hnRNP M in LLO-induced immune responses in host cells. These findings will contribute to further understandings of the molecular mechanisms underlying the host defense against LM infection. Crown Copyright © 2012. Published by Elsevier GmbH. All rights reserved.

  8. HRP-2, the Caenorhabditis elegans homolog of mammalian heterogeneous nuclear ribonucleoproteins Q and R, is an alternative splicing factor that binds to UCUAUC splicing regulatory elements.

    PubMed

    Kabat, Jennifer L; Barberan-Soler, Sergio; Zahler, Alan M

    2009-10-16

    Alternative splicing is regulated by cis sequences in the pre-mRNA that serve as binding sites for trans-acting alternative splicing factors. In a previous study, we used bioinformatics and molecular biology to identify and confirm that the intronic hexamer sequence UCUAUC is a nematode alternative splicing regulatory element. In this study, we used RNA affinity chromatography to identify trans factors that bind to this sequence. HRP-2, the Caenorhabditis elegans homolog of human heterogeneous nuclear ribonucleoproteins Q and R, binds to UCUAUC in the context of unc-52 intronic regulatory sequences as well as to RNAs containing tandem repeats of this sequence. The three Us in the hexamer are the most important determinants of this binding specificity. We demonstrate, using RNA interference, that HRP-2 regulates the alternative splicing of two genes, unc-52 and lin-10, both of which have cassette exons flanked by an intronic UCUAUC motif. We propose that HRP-2 is a protein responsible for regulating alternative splicing through binding interactions with the UCUAUC sequence.

  9. The heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a host factor required for dengue virus and Junín virus multiplication.

    PubMed

    Brunetti, Jesús E; Scolaro, Luis A; Castilla, Viviana

    2015-05-04

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) are cellular factors involved in the replication of several viruses. In this study we analyzed the expression and intracellular localization of hnRNP A2 and hnRNP K in cell cultures infected with two viruses that cause human hemorrhagic fevers: dengue virus type 2 (DENV-2) and Junín virus (JUNV). We determined that DENV-2 promoted the cytoplasmic translocation of hnRNP K and to a lesser extent of hnRNP A2, meanwhile, JUNV infection induced an increase in hnRNP K cytoplasmic localization whereas hnRNP A2 remained mainly in the nucleus of infected cells. Both hnRNP K and hnRNP A2 were localized predominantly in the nucleus of JUNV persistently-infected cells even after superinfection with JUNV indicating that persistent infection does not alter nucleo-cytoplasmic transport of these hnRNPs. Total levels of hnRNP K expression were unaffected by DENV-2 or JUNV infection. In addition we determined, using small interfering RNAs, that hnRNP K knockout inhibits DENV-2 and JUNV multiplication. Our results indicate that DENV-2 and JUNV induce hnRNP K cytoplasmic translocation to favor viral multiplication. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Ocean dynamic processes causing spatially heterogeneous distribution of sedimentary caesium-137 massively released from the Fukushima Dai-ichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Higashi, H.; Morino, Y.; Furuichi, N.; Ohara, T.

    2015-08-01

    Massive amounts of anthropogenic radiocaesium 137Cs that was released into the environment by the Fukushima Dai-ichi Nuclear Power Plant accident on March 2011 are widely known to have extensively migrated to Pacific oceanic sediment off of east Japan. Several recent reports have stated that the sedimentary 137Cs is now stable with a remarkably heterogeneous distribution. The present study elucidates ocean dynamic processes causing this heterogeneous sedimentary 137Cs distribution in and around the shelf off Fukushima and adjacent prefectures. We performed a numerical simulation of oceanic 137Cs behaviour for about 10 months after the accident, using a comprehensive dynamic model involving advection-diffusion transport in seawater, adsorption and desorption to and from particulate matter, sedimentation and suspension on and from the bottom, and vertical diffusion transport in the sediment. A notable simulated result was that the sedimentary 137Cs significantly accumulated in a swath just offshore of the shelf break (along the 50-100 m isobath) as in recent observations, although the seabed in the entire simulation domain was assumed to have ideal properties such as identical bulk density, uniform porosity, and aggregation of particles with a single grain diameter. This result indicated that the heterogeneous sedimentary 137Cs distribution was not necessarily a result of the spatial distribution of 137Cs sediment adsorptivity. The present simulation suggests that the shape of the swath is mainly associated with spatiotemporal variation between bottom shear stress in the shallow shelf (< 50 m depths) and that offshore of the shelf break. In a large part of the shallow shelf, the simulation indicated that strong bottom friction suspending particulate matter from the seabed frequently occurred via a periodic spring tide about every 2 weeks and via occasional strong wind. The sedimentary 137Cs thereby could hardly stay on the surface of the seabed with the result that

  11. β-Cell deletion of Nr4a1 and Nr4a3 nuclear receptors impedes mitochondrial respiration and insulin secretion.

    PubMed

    Reynolds, Merrick S; Hancock, Chad R; Ray, Jason D; Kener, Kyle B; Draney, Carrie; Garland, Kevin; Hardman, Jeremy; Bikman, Benjamin T; Tessem, Jeffery S

    2016-07-01

    β-Cell insulin secretion is dependent on proper mitochondrial function. Various studies have clearly shown that the Nr4a family of orphan nuclear receptors is essential for fuel utilization and mitochondrial function in liver, muscle, and adipose. Previously, we have demonstrated that overexpression of Nr4a1 or Nr4a3 is sufficient to induce proliferation of pancreatic β-cells. In this study, we examined whether Nr4a expression impacts pancreatic β-cell mitochondrial function. Here, we show that β-cell mitochondrial respiration is dependent on the nuclear receptors Nr4a1 and Nr4a3. Mitochondrial respiration in permeabilized cells was significantly decreased in β-cells lacking Nr4a1 or Nr4a3. Furthermore, respiration rates of intact cells deficient for Nr4a1 or Nr4a3 in the presence of 16 mM glucose resulted in decreased glucose mediated oxygen consumption. Consistent with this reduction in respiration, a significant decrease in glucose-stimulated insulin secretion rates is observed with deletion of Nr4a1 or Nr4a3. Interestingly, the changes in respiration and insulin secretion occur without a reduction in mitochondrial content, suggesting decreased mitochondrial function. We establish that knockdown of Nr4a1 and Nr4a3 results in decreased expression of the mitochondrial dehydrogenase subunits Idh3g and Sdhb. We demonstrate that loss of Nr4a1 and Nr4a3 impedes production of ATP and ultimately inhibits glucose-stimulated insulin secretion. These data demonstrate for the first time that the orphan nuclear receptors Nr4a1 and Nr4a3 are critical for β-cell mitochondrial function and insulin secretion. Copyright © 2016 the American Physiological Society.

  12. Discovery of non-spherical heterogeneous radiocesium-bearing particles not derived from Unit 1 of the Fukushima Dai-ichi Nuclear Power Plant, in residences five years after the accident.

    PubMed

    Higaki, Shogo; Kurihara, Yuichi; Yoshida, Hiroko; Takahashi, Yoshio; Shinohara, Naohide

    2017-10-01

    Non-spherical heterogeneous radiocesium-bearing particles were found on masks worn during cleaning work in residences near the Fukushima Dai-ichi Nuclear Power Plant (FDNPP), from which residents had evacuated. Three slightly larger (6.6-12 μm) non-spherical radiocesium-bearing particles were found in a residence in Futaba Town, a straight distance of 2.11 km west-northwest from the FDNPP. These were collected on October 25, 2016, 5 years and 7 months after the Fukushima Dai-ichi nuclear disaster and were presumed to originate from the Plant's Unit 2 based on the measured radioactivity ratio of (134)Cs/(137)Cs. The main elemental composition was similar to particles already reported in other studies. However, this is the first time that such particles had a clearly heterogeneous distribution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Production of Viral mRNA in Adenovirus-Transformed Cells by the Post-Transcriptional Processing of Heterogeneous Nuclear RNA Containing Viral and Cell Sequences

    PubMed Central

    Wall, R.; Weber, J.; Gage, Z.; Darnell, J. E.

    1973-01-01

    Adenovirus 2-transformed cells contain virus-specific sequences which are covalently linked to cell-specific RNA sequences in heterogeneous nuclear RNA (HnRNA) molecules larger than 45S. Virus sequences are identified by hybridization to viral DNA, and the cell sequences are detected by hybridization to cellular DNA under conditions where hybridization only occurs to reiterated sites in cell DNA. Such large composite viral-cell HnRNA molecules presumably arise through the uninterrupted transcription of host sequences and integrated viral DNA. Adenovirus-specific polysomal RNA from these cells sediments as three discrete species at 16, 20, and 26S. These specific classes of viral mRNA do not contain rapidly hybridizing host-specific RNA sequences. Both virus-specific HnRNA and mRNA contain polyadenylic acid sequences since they bind to polyU columns at levels characteristics of other polyA-terminated HnRNA and mRNA. Thus, the discrete species of virus-specific mRNA in adenovirus 2 transformed cells appear to be derived from high-molecular-weight virus-specific HnRNA through a series of post-transcriptional modifications involving polyA addition. Subsequently the HnRNA is cleaved so that the cell-specific RNA sequences that originate from the reiterated sites in cell DNA do not accompany the adenovirus mRNA to the cytoplasm. These events for the adenovirus-specific mRNA appear, therefore, to be similar to the stages in the biogenesis of the majority of mRNA in eukaryotic cells. PMID:4736534

  14. Radiosensitization and downregulation of heterogeneous nuclear ribonucleoprotein K (hnRNP K) upon inhibition of mitogen/extracellular signal-regulated kinase (MEK) in malignant melanoma cells

    PubMed Central

    Eder, Stefan; Lamkowski, Andreas; Priller, Markus; Port, Matthias; Steinestel, Konrad

    2015-01-01

    Background Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is an important cofactor in the p53-mediated DNA damage response pathway upon ionizing radiation (IR) and exerts anti-apoptotic effects also independent of p53 pathway activation. Furthermore, hnRNP K is overexpressed in various neoplasms including malignant melanoma (MM). Here, we investigate the role of hnRNP K in the radioresistance of MM cells. Methods and results Our results show cytoplasmic expression of hnRNP K in human MM surgical specimens, but not in benign nevi, and a quick dose- and time-dependent upregulation in response to IR accompanied by cytoplasmic redistribution of the protein in the IPC-298 cellular tumor model carrying an activating NRAS mutation (p.Q61L). SiRNA-based knockdown of hnRNP K induced a delayed decline in γH2AX/53BP1-positive DNA repair foci upon IR. Pharmacological interference with MAPK signaling abrogated ERK phosphorylation, diminished cellular hnRNP K levels, impaired γH2AX/53BP1-foci repair and proliferative capability and increased apoptosis comparable to the observed hnRNP K knockdown phenotype in IPC-298 cells. Conclusion Our results indicate that pharmacological interference with MAPK signaling increases vulnerability of NRAS-mutant malignant melanoma cells to ionizing radiation along with downregulation of endogenous hnRNP K and point towards a possible use for combined MEK inhibition and localized radiation therapy of MM in the NRAS-mutant setting where BRAF inhibitors offer no clinical benefit. PMID:26136337

  15. Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a tissue biomarker for detection of early hepatocellular carcinoma in patients with cirrhosis.

    PubMed

    Guo, Yantong; Zhao, Jingming; Bi, Jingtao; Wu, Quan; Wang, Xin; Lai, Quanyou

    2012-07-03

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors occurring mainly in patients with chronic liver disease. Detection of early HCC is critically important for treatment of these patients. We employed a proteomic profiling approach to identify potential biomarker for early HCC detection. Based on Barcelona Clinic Liver Cancer (BCLC) staging classification, 15 early HCC and 25 late HCC tissue samples from post-operative HCC patients and their clinicopathological data were used for the discovery of biomarkers specific for the detection of early HCC. Differential proteins among cirrhotic, early, and late tissue samples were separated by two-dimensional gel electrophoresis (2-DE) and subsequently identified by mass spectrometry (MS). Receiver operating characteristic (ROC) curves analysis were performed to find potential biomarkers associated with early HCC. Diagnosis performance of the biomarker was obtained from diagnosis test. Protein spot SSP2215 was found to be significantly overexpressed in HCC, particularly in early HCC, and identified as heterogeneous nuclear ribonucleoprotein K (hnRNP K) by tandem mass spectrometry (MALDI TOF/TOF). The overexpression in HCC was subsequently validated by western blot and immunohistochemistry. ROC curve analysis showed that hnRNP K intensity could detect early HCC at 66.67 % sensitivity and 84 % specificity, which was superior to serum α-fetoprotein (AFP) in detection of early HCC. Furthermore, the diagnosis test demonstrated, when combined with hnRNP K and serum AFP as biomarker panel to detect early HCC at different cut-off value, the sensitivity and specificity could be enhanced to 93.33 % and 96 %, respectively. hnRNP K is a potential tissue biomarker, either alone or in combination with serum AFP, for detection of early HCC. High expression of hnRNP K could be helpful to discriminate early HCC from a nonmalignant nodule, especially for patients with liver cirrhosis.

  16. In vivo nuclear Overhauser effect in sup 31 P-(1H) double-resonance experiments in a 1. 5-T whole-body MR system

    SciTech Connect

    Bachert-Baumann, P.; Ermark, F.; Zabel, H.J.; Sauter, R.; Semmler, W.; Lorenz, W.J. )

    1990-07-01

    In {sup 31}P-(1H) MR experiments of humans in a 1.5-T whole-body system, signal intensity enhancements of {sup 31}P resonances of up to 68 +/- 4% (for phosphocreatine of the calf muscle) have been observed upon irradiation at proton frequency. This observation is explained as a nuclear Overhauser effect due to the dipolar coupling between {sup 1}H and {sup 31}P spins.

  17. Orphan nuclear receptor oestrogen-related receptor γ (ERRγ) plays a key role in hepatic cannabinoid receptor type 1-mediated induction of CYP7A1 gene expression

    PubMed Central

    Zhang, Yaochen; Kim, Don-Kyu; Lee, Ji-Min; Park, Seung Bum; Jeong, Won-IL; Kim, Seong Heon; Lee, In-Kyu; Lee, Chul-Ho; Chiang, John Y.L.; Choi, Hueng-Sik

    2017-01-01

    Bile acids are primarily synthesized from cholesterol in the liver and have important roles in dietary lipid absorption and cholesterol homoeostasis. Detailed roles of the orphan nuclear receptors regulating cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme in bile acid synthesis, have not yet been fully elucidated. In the present study, we report that oestrogen-related receptor γ (ERRγ) is a novel transcriptional regulator of CYP7A1 expression. Activation of cannabinoid receptor type 1 (CB1 receptor) signalling induced ERRγ-mediated transcription of the CYP7A1 gene. Overexpression of ERRγ increased CYP7A1 expression in vitro and in vivo, whereas knockdown of ERRγ attenuated CYP7A1 expression. Deletion analysis of the CYP7A1 gene promoter and a ChIP assay revealed an ERRγ -binding site on the CYP7A1 gene promoter. Small heterodimer partner (SHP) inhibited the transcriptional activity of ERRγ and thus regulated CYP7A1 expression. Overexpression of ERRγ led to increased bile acid levels, whereas an inverse agonist of ERRγ, GSK5182, reduced CYP7A1 expression and bile acid synthesis. Finally, GSK5182 significantly reduced hepatic CB1 receptor-mediated induction of CYP7A1 expression and bile acid synthesis in alcohol-treated mice. These results provide the molecular mechanism linking ERRγ and bile acid metabolism. PMID:26348907

  18. Orphan nuclear receptor oestrogen-related receptor γ (ERRγ) plays a key role in hepatic cannabinoid receptor type 1-mediated induction of CYP7A1 gene expression.

    PubMed

    Zhang, Yaochen; Kim, Don-Kyu; Lee, Ji-Min; Park, Seung Bum; Jeong, Won-Il; Kim, Seong Heon; Lee, In-Kyu; Lee, Chul-Ho; Chiang, John Y L; Choi, Hueng-Sik

    2015-09-01

    Bile acids are primarily synthesized from cholesterol in the liver and have important roles in dietary lipid absorption and cholesterol homoeostasis. Detailed roles of the orphan nuclear receptors regulating cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme in bile acid synthesis, have not yet been fully elucidated. In the present study, we report that oestrogen-related receptor γ (ERRγ) is a novel transcriptional regulator of CYP7A1 expression. Activation of cannabinoid receptor type 1 (CB1 receptor) signalling induced ERRγ-mediated transcription of the CYP7A1 gene. Overexpression of ERRγ increased CYP7A1 expression in vitro and in vivo, whereas knockdown of ERRγ attenuated CYP7A1 expression. Deletion analysis of the CYP7A1 gene promoter and a ChIP assay revealed an ERRγ-binding site on the CYP7A1 gene promoter. Small heterodimer partner (SHP) inhibited the transcriptional activity of ERRγ and thus regulated CYP7A1 expression. Overexpression of ERRγ led to increased bile acid levels, whereas an inverse agonist of ERRγ, GSK5182, reduced CYP7A1 expression and bile acid synthesis. Finally, GSK5182 significantly reduced hepatic CB1 receptor-mediated induction of CYP7A1 expression and bile acid synthesis in alcohol-treated mice. These results provide the molecular mechanism linking ERRγ and bile acid metabolism. © 2015 Authors; published by Portland Press Limited.

  19. Nuclear transcription factor Oct-1 binds to the 5'-upstream region of CYP1A1 and negatively regulates its expression.

    PubMed

    Bhat, R; Weaver, J A; Sterling, K M; Bresnick, E

    1996-02-01

    The cytochrome P450-dependent monooxygenases, which represent an extended superfamily, catalyze the biotransformation of many endogenous and exogenous substances. One of these hemoproteins, cytochrome P4501A1, is most closely associated with the bioactivation of polycyclic aromatic hydrocarbons such as benzo[a]pyrene, which may play a role in environmental carcinogenesis. A negative regulatory element (NRE) has been localized in the 5'-upstream region of the cytochrome P4501A1 gene (CYP1A1) at -843 to -746 base pairs from the site of transcription. The purpose of this research was to define any interactions of trans-acting proteins with this cis element. Rat liver nuclei were used as the source of trans-acting proteins and a biotinylated NRE-bearing fragment (-782 to -843 bp) from a plasmid which contained the CYP1A1 was prepared by the polymerase chain reaction technique. Gel mobility shift assays were used to demonstrate interactions between this NRE fragment and nuclear proteins. The specific binding to an octamer-containing motif in the 5'-upstream region of CYP1A1 was demonstrated; this was used as a step in the partial purification from rat liver of the transcription factor, Oct-1. Conventional chromatographic procedures and DNA recognition site affinity chromatography were also used. HepG2 human hepatoma cells were transfected with both pMCoLUC+ which contains the luciferase gene as a reporter gene driven by the CYP1A1 promoter (including the NRE), and an Oct-1 expression vector. Luciferase activity/mg protein in the doubly-transfected cells was significantly lower than in cells containing only pMCoLUC+. A nuclear transcription factor Oct-1 interacts with a portion of the NRE of the rat CYP1A1, suppressing the expression of this gene. These findings may help to explain the low level of basal expression of CYP1A1 in mammalian systems.

  20. The orphan nuclear receptor NR4A1 specifies a distinct subpopulation of quiescent myeloid-biased long-term HSCs

    PubMed Central

    Land, Ruben H.; Rayne, Anna K.; Vanderbeck, Ashley N.; Barlowe, Trevor S.; Manjunath, Shwetha; Gross, Matthew; Eiger, Sophie; Klein, Peter S.; Cunningham, Nicole R.; Huang, Jian; Emerson, Stephen G.; Punt, Jennifer A.

    2014-01-01

    Hematopoiesis is maintained throughout life by self-renewing hematopoietic stem cells (HSCs) that differentiate to produce both myeloid and lymphoid cells. The NR4A family of orphan nuclear receptors, which regulates cell fate in many tissues, appears to play a key role in HSC proliferation and differentiation. Using a NR4A1GFP BAC transgenic reporter mouse we have investigated NR4A1 expression and its regulation in early hematopoiesis. We show that NR4A1 is most highly expressed in a subset of Lin−Sca-1+c-Kit+ CD48−CD150+ long-term (LT) HSCs, and its expression is tightly associated with HSC quiescence. We also show that NR4A1 expression in HSCs is induced by PGE2, a known enhancer of stem cell engraftment potential. Finally, we find that both NR4A1GFP+ and NR4A1GFP− HSCs successfully engraft primary and secondary irradiated hosts; however, NR4A1GFP+ HSCs are distinctly myeloid-biased. These results show that NR4A1 expression identifies a highly quiescent and distinct population of myeloid-biased LT-HSCs. PMID:25284014

  1. Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

    SciTech Connect

    Primorac, D.; Stover, M.L.; McKinstry, M.B.

    1994-09-01

    Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or the donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.

  2. The C-protein tetramer binds 230 to 240 nucleotides of pre-mRNA and nucleates the assembly of 40S heterogeneous nuclear ribonucleoprotein particles.

    PubMed Central

    Huang, M; Rech, J E; Northington, S J; Flicker, P F; Mayeda, A; Krainer, A R; LeStourgeon, W M

    1994-01-01

    A series of in vitro protein-RNA binding studies using purified native (C1)3C2 and (A2)3B1 tetramers, total soluble heterogeneous nuclear ribonucleoprotein (hnRNP), and pre-mRNA molecules differing in length and sequence have revealed that a single C-protein tetramer has an RNA site size of 230 to 240 nucleotides (nt). Two tetramers bind twice this RNA length, and three tetramers fold monoparticle lengths of RNA (700 nt) into a unique 19S triangular complex. In the absence of this unique structure, the basic A- and B-group proteins bind RNA to form several different artifactual structures which are not present in preparations of native hnRNP and which do not function in hnRNP assembly. Three (A2)3B1 tetramers bind the 19S complex to form a 35S assembly intermediate. Following UV irradiation to immobilize the C proteins on the packaged RNA, the 19S triangular complex is recovered as a remnant structure from both native and reconstituted hnRNP particles. C protein-RNA complexes composed of three, six, or nine tetramers (one, two, or three triangular complexes) nucleate the stoichiometric assembly of monomer, dimer, and trimer hnRNP particles. The binding of C-protein tetramers to RNAs longer than 230 nt is through a self-cooperative combinatorial mode. RNA packaged in the 19S complex and in 40S hnRNP particles is efficiently spliced in vitro. These findings demonstrate that formation of the triangular C protein-RNA complex is an obligate first event in the in vitro and probably the in vivo assembly the 40S hnRNP core particle, and they provide insight into the mechanism through which the core proteins package 700-nt increments of RNA. These findings also demonstrate that unless excluded by other factors, the C proteins are likely to be located along the length of nascent transcripts. Images PMID:8264621

  3. Transcriptomic Analysis Shows Decreased Cortical Expression of NR4A1, NR4A2 and RXRB in Schizophrenia and Provides Evidence for Nuclear Receptor Dysregulation

    PubMed Central

    Corley, Susan M.; Wilkins, Marc R.; Shannon Weickert, Cynthia

    2016-01-01

    Many genes are differentially expressed in the cortex of people with schizophrenia, implicating factors that control transcription more generally. Hormone nuclear receptors dimerize to coordinate context-dependent changes in gene expression. We hypothesized that members of two families of nuclear receptors (NR4As), and retinoid receptors (RARs and RXRs), are altered in the dorsal lateral prefrontal cortex (DLPFC) of people with schizophrenia. We used next generation sequencing and then qPCR analysis to test for changes in mRNA levels for transcripts encoding nuclear receptors: orphan nuclear receptors (3 in the NR4A, 3 in the RAR, 3 in the RXR families and KLF4) in total RNA extracted from the DLPFC from people with schizophrenia compared to controls (n = 74). We also correlated mRNA levels with demographic factors and with estimates of antipsychotic drug exposure (schizophrenia group only). We tested for correlations between levels of transcription factor family members and levels of genes putatively regulated by these transcription factors. We found significantly down regulated expression of NR4A1 (Nurr 77) and KLF4 mRNAs in people with schizophrenia compared to controls, by both NGS and qPCR (p = or <0.01). We also detected decreases in NR4A2 (Nurr1) and RXRB mRNAs by using qPCR in the larger cohort (p<0.05 and p<0.01, respectively). We detected decreased expression of RARG and NR4A2 mRNAs in females with schizophrenia (p<0.05). The mRNA levels of NR4A1, NR4A2 and NR4A3 were all negative correlated with lifetime estimates of antipsychotic exposure. These novel findings, which may be influenced by antipsychotic drug exposure, implicate the orphan and retinoid nuclear receptors in the cortical pathology found in schizophrenia. Genes down stream of these receptors can be dysregulated as well, but the direction of change is not immediately predictable based on the putative transcription factor changes. PMID:27992436

  4. Transcriptomic Analysis Shows Decreased Cortical Expression of NR4A1, NR4A2 and RXRB in Schizophrenia and Provides Evidence for Nuclear Receptor Dysregulation.

    PubMed

    Corley, Susan M; Tsai, Shan-Yuan; Wilkins, Marc R; Shannon Weickert, Cynthia

    2016-01-01

    Many genes are differentially expressed in the cortex of people with schizophrenia, implicating factors that control transcription more generally. Hormone nuclear receptors dimerize to coordinate context-dependent changes in gene expression. We hypothesized that members of two families of nuclear receptors (NR4As), and retinoid receptors (RARs and RXRs), are altered in the dorsal lateral prefrontal cortex (DLPFC) of people with schizophrenia. We used next generation sequencing and then qPCR analysis to test for changes in mRNA levels for transcripts encoding nuclear receptors: orphan nuclear receptors (3 in the NR4A, 3 in the RAR, 3 in the RXR families and KLF4) in total RNA extracted from the DLPFC from people with schizophrenia compared to controls (n = 74). We also correlated mRNA levels with demographic factors and with estimates of antipsychotic drug exposure (schizophrenia group only). We tested for correlations between levels of transcription factor family members and levels of genes putatively regulated by these transcription factors. We found significantly down regulated expression of NR4A1 (Nurr 77) and KLF4 mRNAs in people with schizophrenia compared to controls, by both NGS and qPCR (p = or <0.01). We also detected decreases in NR4A2 (Nurr1) and RXRB mRNAs by using qPCR in the larger cohort (p<0.05 and p<0.01, respectively). We detected decreased expression of RARG and NR4A2 mRNAs in females with schizophrenia (p<0.05). The mRNA levels of NR4A1, NR4A2 and NR4A3 were all negative correlated with lifetime estimates of antipsychotic exposure. These novel findings, which may be influenced by antipsychotic drug exposure, implicate the orphan and retinoid nuclear receptors in the cortical pathology found in schizophrenia. Genes down stream of these receptors can be dysregulated as well, but the direction of change is not immediately predictable based on the putative transcription factor changes.

  5. Heterogeneity of mast cells and expression of Annexin A1 protein in a second degree burn model with silver sulfadiazine treatment

    PubMed Central

    Souza, Helena Ribeiro; de Azevedo, Lucas Ribeiro; Possebon, Lucas; Costa, Sara de Souza; Iyomasa-Pilon, Melina Mizusaki; Oliani, Sonia Maria; Girol, Ana Paula

    2017-01-01

    Mast cells (MCs) participate in all stages of skin healing and one of their mediators is the Annexin A1 protein (AnxA1), linked to inflammation, proliferation, migration and apoptosis processes, but not studied in thermal burns yet. Therefore, our objectives were to evaluate the behavior of MCs and AnxA1 in a second degree burn model, treated or not with silver sulfadiazine 1% (SDP 1%) and associated to macrophages quantification and cytokines dosages. MCs counts showed few cells in the early stages of repair but increased MCs in the final phases in the untreated group. The normal skin presented numerous tryptase-positive MCs that were reduced after burning in all analyzed periods. Differently, few chymase-positive MCs were observed in the early stages of healing, however, increased chymase-positive MCs were found at the final phase in the untreated group. MCs also showed high immunoreactivity for AnxA1 on day 3 in both groups. In the tissue there was a strong protein expression in the early stages of healing, but in the final phases only in the SDP treated animals. TNF-α, IL-1β, IL-6, IL-10 and MCP-1 levels and macrophages quantification were increased in inflammation and reepithelialization phases. Reduced IL-1β, IL-6 and IL-10 levels and numerous macrophages occurred in the treated animals during tissue repair. Our results indicate modulation in the profile of MCs and AnxA1expression during healing by the treatment with SDP 1%, pointing them as targets for therapeutic interventions on skin burns. PMID:28278234

  6. The nuclear orphan receptor NR4A1 regulates β1-integrin expression in pancreatic and colon cancer cells and can be targeted by NR4A1 antagonists.

    PubMed

    Hedrick, Erik; Lee, Syng-Ook; Safe, Stephen

    2017-09-01

    β1-Integrin is highly expressed and is a negative prognostic factor for colon and pancreatic cancer patients and the gene plays a functional role in cell migration and invasion. In this study, we demonstrate that β1-integrin expression is regulated in pancreatic and colon cancer cells by the pro-oncogenic orphan nuclear receptor 4A1 (NR4A1, Nur77, TR3) and knockdown of this receptor by RNA interference decreases β1-integrin protein and mRNA expression, α5-integrin, and also expression of β1-integrin-dependent phosphorylation of FAK (pFak). Knockdown of NR4A1 also decreased migration and fibronectin-induced adhesion in pancreatic (Panc1, L3.6 pL, and MiaPaCa2) and colon (RKO and SW480) cancer cells. 1,1-Bis(3'-indolyl)-1-(p-substituted phenyl)methane (C-DIM) compounds containing p-hydroxy (DIM-C-pPhOH) and p-carbomethoxy (DIM-C-pPhCO2 Me) groups are NR4A1 ligands that act as antagonists for this receptor. Treatment of pancreatic and colon cancer cells with DIM-C-pPhOH or DIM-C-pPhCO2 Me mimics the effects of NR4A1 knockdown and decreases β1-integrin expression, β1-integrin regulated genes and responses including migration and adhesion. The results demonstrate a novel method for targeting β1-integrin in colon and pancreatic cancer cells and indicate possible clinical applications for C-DIM/NR4A1 antagonists for pancreatic and colon cancer therapy. © 2017 Wiley Periodicals, Inc.

  7. Aberrantly glycosylated IgA1 in IgA nephropathy patients is recognized by IgG antibodies with restricted heterogeneity

    PubMed Central

    Suzuki, Hitoshi; Fan, Run; Zhang, Zhixin; Brown, Rhubell; Hall, Stacy; Julian, Bruce A.; Chatham, W. Winn; Suzuki, Yusuke; Wyatt, Robert J.; Moldoveanu, Zina; Lee, Jeannette Y.; Robinson, James; Tomana, Milan; Tomino, Yasuhiko; Mestecky, Jiri; Novak, Jan

    2009-01-01

    IgA nephropathy (IgAN) is characterized by circulating immune complexes composed of galactose-deficient IgA1 and a glycan-specific IgG antibody. These immune complexes deposit in the glomerular mesangium and induce the mesangioproliferative glomerulonephritis characteristic of IgAN. To define the precise specificities and molecular properties of the IgG antibodies, we generated EBV-immortalized IgG-secreting lymphocytes from patients with IgAN and found that the secreted IgG formed complexes with galactose-deficient IgA1 in a glycan-dependent manner. We cloned and sequenced the heavy- and light-chain antigen-binding domains of IgG specific for galactose-deficient IgA1 and identified an A to S substitution in the complementarity-determining region 3 of the variable region of the gene encoding the IgG heavy chain in IgAN patients. Furthermore, site-directed mutagenesis that reverted the residue to alanine reduced the binding of recombinant IgG to galactose-deficient IgA1. Finally, we developed a dot-blot assay for the glycan-specific IgG antibody that differentiated patients with IgAN from healthy and disease controls with 88% specificity and 95% sensitivity and found that elevated levels of this antibody in the sera of patients with IgAN correlated with proteinuria. Collectively, these findings indicate that glycan-specific antibodies are associated with the development of IgAN and may represent a disease-specific marker and potential therapeutic target. PMID:19478457

  8. Nkx6.1 regulates islet β-cell proliferation via Nr4a1 and Nr4a3 nuclear receptors.

    PubMed

    Tessem, Jeffery S; Moss, Larry G; Chao, Lily C; Arlotto, Michelle; Lu, Danhong; Jensen, Mette V; Stephens, Samuel B; Tontonoz, Peter; Hohmeier, Hans E; Newgard, Christopher B

    2014-04-08

    Loss of functional β-cell mass is a hallmark of type 1 and type 2 diabetes, and methods for restoring these cells are needed. We have previously reported that overexpression of the homeodomain transcription factor NK6 homeobox 1 (Nkx6.1) in rat pancreatic islets induces β-cell proliferation and enhances glucose-stimulated insulin secretion, but the pathway by which Nkx6.1 activates β-cell expansion has not been defined. Here, we demonstrate that Nkx6.1 induces expression of the nuclear receptor subfamily 4, group A, members 1 and 3 (Nr4a1 and Nr4a3) orphan nuclear receptors, and that these factors are both necessary and sufficient for Nkx6.1-mediated β-cell proliferation. Consistent with this finding, global knockout of Nr4a1 results in a decrease in β-cell area in neonatal and young mice. Overexpression of Nkx6.1 and the Nr4a receptors results in increased expression of key cell cycle inducers E2F transcription factor 1 and cyclin E1. Furthermore, Nkx6.1 and Nr4a receptors induce components of the anaphase-promoting complex, including ubiquitin-conjugating enzyme E2C, resulting in degradation of the cell cycle inhibitor p21. These studies identify a unique bipartite pathway for activation of β-cell proliferation, suggesting several unique targets for expansion of functional β-cell mass.

  9. The Nuclear Receptor Nr4a1 Acts as a Microglia Rheostat and Serves as a Therapeutic Target in Autoimmune-Driven Central Nervous System Inflammation.

    PubMed

    Rothe, Tobias; Ipseiz, Natacha; Faas, Maria; Lang, Stefanie; Perez-Branguli, Francesc; Metzger, Daniel; Ichinose, Hiroshi; Winner, Beate; Schett, Georg; Krönke, Gerhard

    2017-05-15

    Microglia cells fulfill key homeostatic functions and essentially contribute to host defense within the CNS. Altered activation of microglia, in turn, has been implicated in neuroinflammatory and neurodegenerative diseases. In this study, we identify the nuclear receptor (NR) Nr4a1 as key rheostat controlling the activation threshold and polarization of microglia. In steady-state microglia, ubiquitous neuronal-derived stress signals such as ATP induced expression of this NR, which contributed to the maintenance of a resting and noninflammatory microglia phenotype. Global and microglia-specific deletion of Nr4a1 triggered the spontaneous and overwhelming activation of microglia and resulted in increased cytokine and NO production as well as in an accelerated and exacerbated form of experimental autoimmune encephalomyelitis. Ligand-induced activation of Nr4a1 accordingly ameliorated the course of this disease. Our current data thus identify Nr4a1 as regulator of microglia activation and potentially new target for the treatment of inflammatory CNS diseases such as multiple sclerosis. Copyright © 2017 by The American Association of Immunologists, Inc.

  10. Mimicking the membrane-mediated conformation of dynorphin A-(1-13)-peptide: Circular dichroism and nuclear magnetic resonance studies in methanolic solution

    SciTech Connect

    Lancaster, C.R.D.; Hughes, D.W.; Epand, R.M. ); Mishra, P.K.; Bothner-By, A.A. ); St.Pierre, S.A. )

    1991-05-14

    The structural requirements for the binding of dynorphin to the {kappa}-opioid receptor are of profound clinical interest in the search for a powerful nonaddictive analgesic. These requirements are thought to be met by the membrane-mediated conformation of the opioid peptide dynorphin A-(1-13)-peptide, Tyr{sup 1}-Gly{sup 2}-Gly{sup 3}-Phe{sup 4}-Leu{sup 5}-Arg{sup 6}-Arg{sup 7}-Ile{sup 8}-Arg{sup 9}-Pro{sup 10}-Lys{sup 11}-Leu{sup 12}-Lys{sup 13}. Schwyzer has proposed an essentially {alpha}-helical membrane-mediated conformation of the 13 amino acid peptide. In the present study, circular dichroism (CD) studies on dynorphin A-(1-13)-peptide bound to an anionic phospholipid signified negligible helical content of the peptide. CD studies also demonstrated that the aqueous-membraneous interphase may be mimicked by methanol. The 500- and 620-MHz {sup 1}H nuclear magnetic resonance (NMR) spectra of dynorphin A-(1-13)-peptide in methanolic solution were sequence-specifically assigned with the aid of correlated spectroscopy (COSY), double-quantum filtered phase-sensitive COSY (DQF-COSY), relayed COSY (RELAY), and nuclear Overhauser enhancement spectroscopy (NOESY). 2-D CAMELSPIN/ROESY experiments indicated that at least the part of the molecule from Arg{sup 7} to Arg{sup 9} was in an extended or {beta}-strand conformation, which agreed with deuterium-exchange and temperature-dependence studies of the amide protons and analysis of the vicinal spin-spin coupling constants {sup 3}J{sub HN{alpha}}. The results clearly demonstrated the absence of extensive {alpha}-helix formation. {chi}{sub 1} rotamer analysis of the {sup 3}J{sub {alpha}{beta}} demonstrated no preferred side-chain conformations.

  11. Annexin A1 nuclear translocation induces retinal ganglion cell apoptosis after ischemia-reperfusion injury through the p65/IL-1β pathway.

    PubMed

    Zhao, Yin; Li, Xing; Gong, Jieling; Li, Lu; Chen, Liwen; Zheng, Lu; Chen, Zhiqi; Shi, Jing; Zhang, Hong

    2017-04-04

    The degeneration of retinal ganglion cells (RGCs) has been identified as a major problem in glaucoma. Previous studies have indicated an association between annexin A1 (ANXA1) and neuronal cell apoptosis, and RGCs apoptosis in acute ischemia-reperfusion was attributed to an increased production of IL-1β. We found that the expression and nuclear translocation of ANXA1 were upregulated in models of acute ischemia-reperfusion in RGCs in vivo. ANXA1 was found to have a promoting effect on the expression of IL-1β in primary cultured RGCs, which could be inhibited by treatment with ANXA1 shRNA or the p65 inhibitor BAY 11-7082. ANXA1 interacted with p65, and recruited it into the nucleus. Chromatin immunoprecipitation assay revealed that ANXA1 accumulated at the IL-1β gene promoter. The reduction of p65 nuclear translocation using a membrane-permeable ANXA1 peptide containing a Ser5Ala mutation led to a decrease in the expression of IL-1β, and acute ischemia-reperfusion induced RGCs apoptosis in vivo. These results indicate that in RGCs, ANXA1 increases IL-1β expression by recruiting p65 to the nucleus, which induces cell apoptosis. The obtained results may help the development of a novel treatment strategy against RGCs apoptosis in acute ischemia-reperfusion injury.

  12. c-Cbl mediates the degradation of tumorigenic nuclear β-catenin contributing to the heterogeneity in Wnt activity in colorectal tumors

    PubMed Central

    Shashar, Moshe; Siwak, Jamaica; Tapan, Umit; Lee, Shin Yin; Meyer, Rosana D.; Parrack, Paige; Tan, Josenia; Khatami, Fatemeh; Francis, Jean; Zhao, Qing; Hartshorn, Kevan; Kolachalama, Vijaya B.; Rahimi, Nader; Chitalia, Vipul

    2016-01-01

    Despite the loss of Adenomatous Polyposis Coli (APC) in a majority of colorectal cancers (CRC), not all CRCs bear hallmarks of Wnt activation, such as nuclear β-catenin. This underscores the presence of other Wnt regulators that are important to define, given the pathogenic and prognostic roles of nuclear β-catenin in human CRC. Herein, we investigated the effect of Casitas B-lineage lymphoma (c-Cbl) on nuclear β-catenin, which is an oncoprotein upregulated in CRC due to loss-of-function APC or gain-of-function CTNNB1 mutations. Despite mechanistic rationale and recent discoveries of c-Cbl's mutations in solid tumors, little is known about its functional importance in CRC. Our study in a cohort of human CRC patients demonstrated an inverse correlation between nuclear β-catenin and c-Cbl. Further investigation showed that the loss of c-Cbl activity significantly enhanced nuclear β-catenin and CRC tumor growth in cell culture and a mouse xenograft model. c-Cbl interacted with and downregulated β-catenin in a manner that was independent of CTNNB1 or APC mutation status. This study demonstrates a previously unrecognized function of c-Cbl as a negative regulator of CRC. PMID:27661103

  13. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  14. Serum under-O-glycosylated IgA1 level is not correlated with glomerular IgA deposition based upon heterogeneity in the composition of immune complexes in IgA nephropathy

    PubMed Central

    2014-01-01

    Serum under-O-glycosylated IgA1 levels are not correlated with glomerular IgA deposition based upon heterogeneity in the composition of glomerular immune complexes in IgAN patients. PMID:24928472

  15. Heterogeneous Catalysis.

    ERIC Educational Resources Information Center

    Miranda, R.

    1989-01-01

    Described is a heterogeneous catalysis course which has elements of materials processing embedded in the classical format of catalytic mechanisms and surface chemistry. A course outline and list of examples of recent review papers written by students are provided. (MVL)

  16. Heterogeneous Catalysis.

    ERIC Educational Resources Information Center

    Miranda, R.

    1989-01-01

    Described is a heterogeneous catalysis course which has elements of materials processing embedded in the classical format of catalytic mechanisms and surface chemistry. A course outline and list of examples of recent review papers written by students are provided. (MVL)

  17. Heterogeneous catalysis.

    PubMed

    Schlögl, Robert

    2015-03-09

    A heterogeneous catalyst is a functional material that continually creates active sites with its reactants under reaction conditions. These sites change the rates of chemical reactions of the reactants localized on them without changing the thermodynamic equilibrium between the materials.

  18. The Influence of Standardized Valeriana officinalis Extract on the CYP3A1 Gene Expression by Nuclear Receptors in In Vivo Model

    PubMed Central

    Mrozikiewicz, Przemyslaw M.; Karasiewicz, Monika; Mikolajczak, Przemyslaw L.; Ozarowski, Marcin; Grzeskowiak, Edmund

    2014-01-01

    Valeriana officinalis is one of the most popular medicinal plants commonly used as a sedative and sleep aid. It is suggested that its pharmacologically active compounds derived from the root may modulate the CYP3A4 gene expression by activation of pregnane X receptor (PXR) or constitutive androstane receptor (CAR) and lead to pharmacokinetic herb-drug interactions. The aim of the study was to determine the influence of valerian on the expression level of CYP3A1 (homologue to human CYP3A4) as well as nuclear receptors PXR, CAR, RXR, GR, and HNF-4α. Male Wistar rats were given standardized valerian extract (300 mg/kg/day, p.o.) for 3 and 10 days. The expression in liver tissue was analyzed by using real-time PCR. Our result showed a decrease of CYP3A1 expression level by 35% (P = 0.248) and 37% (P < 0.001), respectively. Moreover, Valeriana exhibited statistically significant reduction in RXR (approximately 28%) only after 3-day treatment. We also demonstrated a decrease in the amount HNF-4α by 22% (P = 0.005) and 32% (P = 0.012), respectively. In case of CAR, the increase of expression level by 46% (P = 0.023) was noted. These findings suggest that Valeriana officinalis extract can decrease the CYP3A4 expression and therefore may lead to interactions with synthetic drugs metabolized by this enzyme. PMID:25302309

  19. NUCLEAR REACTOR CONTROL SYSTEM

    DOEpatents

    Epler, E.P.; Hanauer, S.H.; Oakes, L.C.

    1959-11-01

    A control system is described for a nuclear reactor using enriched uranium fuel of the type of the swimming pool and other heterogeneous nuclear reactors. Circuits are included for automatically removing and inserting the control rods during the course of normal operation. Appropriate safety circuits close down the nuclear reactor in the event of emergency.

  20. Age-Related Nuclear Translocation of P2X6 Subunit Modifies Splicing Activity Interacting with Splicing Factor 3A1

    PubMed Central

    Díaz-Hernández, Juan Ignacio; Sebastián-Serrano, Álvaro; Gómez-Villafuertes, Rosa

    2015-01-01

    P2X receptors are ligand-gated ion channels sensitive to extracellular nucleotides formed by the assembling of three equal or different P2X subunits. In this work we report, for the first time, the accumulation of the P2X6 subunit inside the nucleus of hippocampal neurons in an age-dependent way. This location is favored by its anchorage to endoplasmic reticulum through its N-terminal domain. The extracellular domain of P2X6 subunit is the key to reach the nucleus, where it presents a speckled distribution pattern and is retained by interaction with the nuclear envelope protein spectrin α2. The in vivo results showed that, once inside the nucleus, P2X6 subunit interacts with the splicing factor 3A1, which ultimately results in a reduction of the mRNA splicing activity. Our data provide new insights into post-transcriptional regulation of mRNA splicing, describing a novel mechanism that could explain why this process is sensitive to changes that occur with age. PMID:25874565

  1. Purification and characterization of a simple ribonucleoprotein particle containing small nucleoplasmic RNAs (snRNP) as a subset of RNP containing heterogenous nuclear RNA (hnRNP) from HeLa cells.

    PubMed

    Brunel, C; Widada, J S; Lelay, M N; Jeanteur, P; Liautard, J P

    1981-02-25

    A ribonucleoprotein complex whose RNA complement consists exclusively of small nuclear RNA species (snRNA) has been purified from particles containing heterogenous nuclear RNA (hnRNP) from HeLa cells. This was accomplished by taking advantage of their ability to band at a density of about 1.43 g/cm3 in plain cesium chloride as well as in cesium chloride gradients containing 0.5% sarkosyl without prior aldehyde fixation. After these two steps of equilibrium density centrifugation, these snRNPs were still largely contaminated by free proteins (and especially phosphoproteins). A final step of purification by velocity sedimentation in a sucrose gradient containing 0.5 M cesium chloride and 0.5% sarkosyl was efficient in completely eliminating all free proteins. U1, U2, U4, U5 and U6 species according to the nomenclature of Lerner et al. (Nature, (1980) 283, 220-224) were found in these purified snRNPs, while a significant part of U6 and a small amount of U2 were found in the bottom fraction. 5S species behaved entirely as free RNA and is presumably a contaminant of cytoplasmic origin. Electrophoresis of proteins from snRNP labeled in vivo with (35S) methionine, revealed four bands with migrations corresponding to molecular weights ranging between 10,000 and 14,000 daltons.

  2. The proximal region of the 3'-untranslated region of cyclooxygenase-2 is recognized by a multimeric protein complex containing HuR, TIA-1, TIAR, and the heterogeneous nuclear ribonucleoprotein U.

    PubMed

    Cok, Steven J; Acton, Stephen J; Morrison, Aubrey R

    2003-09-19

    Cyclooxygenase-2 (COX-2) is an early response gene induced in renal mesangial cells by interleukin-1beta (IL-1beta). The 3'-untranslated region (3'-UTR) of COX-2 mRNA plays an important role in IL-1beta induction by regulating message stability and translational efficiency. The first 60 nucleotides of the 3'-UTR of COX-2 are highly conserved and contain multiple copies of the regulatory sequence AUUUA. Introduction of the 60-nucleotide sequence into the 3'-UTR of a heterologous reporter gene resulted in a 70% decrease in reporter gene expression. Electrophoretic mobility shift assays (EMSAs) demonstrated that mesangial cell nuclear fractions contain a multimeric protein complex that bound this region of COX-2 mRNA in a sequence-specific manner. We identified four members of the protein-RNA complex as HuR, TIA-1, TIAR, and the heterogeneous nuclear ribonucleoprotein U (hnRNP U). Treatment of mesangial cells with IL-1beta caused an increase in cytosolic HuR, which was accompanied by an increase in COX-2 mRNA that co-immunoprecipitated with cytosolic HuR. Therefore, we propose that HuR binds to the proximal region of the 3'-UTR of COX-2 following stimulation by IL-1beta and increases the expression of COX-2 mRNA by facilitating its transport out of the nucleus.

  3. Purification and characterization of a simple ribonucleoprotein particle containing small nucleoplasmic RNAs (snRNP) as a subset of RNP containing heterogenous nuclear RNA (hnRNP) from HeLa cells.

    PubMed Central

    Brunel, C; Widada, J S; Lelay, M N; Jeanteur, P; Liautard, J P

    1981-01-01

    A ribonucleoprotein complex whose RNA complement consists exclusively of small nuclear RNA species (snRNA) has been purified from particles containing heterogenous nuclear RNA (hnRNP) from HeLa cells. This was accomplished by taking advantage of their ability to band at a density of about 1.43 g/cm3 in plain cesium chloride as well as in cesium chloride gradients containing 0.5% sarkosyl without prior aldehyde fixation. After these two steps of equilibrium density centrifugation, these snRNPs were still largely contaminated by free proteins (and especially phosphoproteins). A final step of purification by velocity sedimentation in a sucrose gradient containing 0.5 M cesium chloride and 0.5% sarkosyl was efficient in completely eliminating all free proteins. U1, U2, U4, U5 and U6 species according to the nomenclature of Lerner et al. (Nature, (1980) 283, 220-224) were found in these purified snRNPs, while a significant part of U6 and a small amount of U2 were found in the bottom fraction. 5S species behaved entirely as free RNA and is presumably a contaminant of cytoplasmic origin. Electrophoresis of proteins from snRNP labeled in vivo with (35S) methionine, revealed four bands with migrations corresponding to molecular weights ranging between 10,000 and 14,000 daltons. Images PMID:6164981

  4. Fractal heterogeneity in minimal matrix models of scars modulates stiff-niche stem-cell responses via nuclear exit of a mechanorepressor

    NASA Astrophysics Data System (ADS)

    Dingal, P. C. Dave P.; Bradshaw, Andrew M.; Cho, Sangkyun; Raab, Matthew; Buxboim, Amnon; Swift, Joe; Discher, Dennis E.

    2015-09-01

    Scarring is a long-lasting problem in higher animals, and reductionist approaches could aid in developing treatments. Here, we show that copolymerization of collagen I with polyacrylamide produces minimal matrix models of scars (MMMS), in which fractal-fibre bundles segregate heterogeneously to the hydrogel subsurface. Matrix stiffens locally--as in scars--while allowing separate control over adhesive-ligand density. The MMMS elicits scar-like phenotypes from mesenchymal stem cells (MSCs): cells spread and polarize quickly, increasing nucleoskeletal lamin-A yet expressing the `scar marker' smooth muscle actin (SMA) more slowly. Surprisingly, expression responses to MMMS exhibit less cell-to-cell noise than homogeneously stiff gels. Such differences from bulk-average responses arise because a strong SMA repressor, NKX2.5, slowly exits the nucleus on rigid matrices. NKX2.5 overexpression overrides rigid phenotypes, inhibiting SMA and cell spreading, whereas cytoplasm-localized NKX2.5 mutants degrade in well-spread cells. MSCs thus form a `mechanical memory' of rigidity by progressively suppressing NKX2.5, thereby elevating SMA in a scar-like state.

  5. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A

    2013-06-07

    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  6. Greater-than-Class C low-level radioactive waste characterization. Appendix A-1: Nuclear utility data outputs from the GNUPS database

    SciTech Connect

    1994-09-01

    The Greater-Than-Class C Nuclear Utility Projections System (GNUPS) was developed as a database for the GTCC LLW Program to estimate future volumes and radionuclide activities of nuclear utility GTCC LLW. Detailed printouts from the GNUPS database are presented in this appendix. The GNUPS projects nuclear utility volumes and activities for three cases: low, base, and high. In addition, the projections can be adjusted to account for the effects of packaging, concentration averaging, and plant operating lifetime. A brief description of how the GNUPS performs calculations of volumes and activities is given.

  7. Reconstructing species phylogeny of the carabid beetles Ohomopterus using multiple nuclear DNA sequences: heterogeneous information content and the performance of simultaneous analyses.

    PubMed

    Sota, Teiji; Vogler, Alfried P

    2003-01-01

    We attempted a phylogenetic reconstruction for the carabid subgenus Ohomopterus (genus Carabus), a notable case of radiation with mitochondrial introgression across species. Sequence data from five nuclear single copy loci were used, including wingless (Wg), phosphoenolpyruvate carboxykinase (PepCK), cytochrome c (Cytc), elongation factor-1alpha (EF-1alpha), and an anonymous single copy locus (Carab1). Sequences of Cytc, EF-1alpha, and Carab1 included intron or intron-like parts with length variation. The analysis of individual loci resulted in low resolution of the phylogenetic relationships, and the monophyly of several morphologically recognized species for which multiple specimens were analyzed was not revealed. Several specimens were heterozygous, with non-monophyletic alleles observed in three of the five loci at which alleles in heterozygotes were separated. In a simultaneous analysis of the five loci with ambiguously aligned parts eliminated and heterozygotic sites treated as missing, the resulting tree was well resolved, but the branch support was generally weak because of conflicting phylogenetic signals from different loci. We also attempted to incorporate allelic sequence data plus the ambiguously aligned parts in the analysis, by using all possible combinations of alleles from different loci in heterozygotic individuals, but the resultant tree was not supported more strongly. Nonetheless, these simultaneous analyses provided support for the monophyly of several species and species groups, and revealed the basic evolutionary trend of OHOMOPTERUS: initial widespread groups with simpler genitalia and the origination of exaggerated genitalia in a derived clade. This study exemplifies problems inherent in the phylogenetic reconstruction of closely related organisms where low levels of variation limit the information content from each locus, while heterozygosity, different phylogenetic history of multiple loci, and alignment ambiguity further hamper

  8. A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication

    PubMed Central

    Wang, Dai; Parrish, Colin R.

    1999-01-01

    Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

  9. Purification, cloning, and expression of a murine phosphoprotein that binds the kappa B motif in vitro identifies it as the homolog of the human heterogeneous nuclear ribonucleoprotein K protein. Description of a novel DNA-dependent phosphorylation process.

    PubMed

    Ostrowski, J; Van Seuningen, I; Seger, R; Rauch, C T; Sleath, P R; McMullen, B A; Bomsztyk, K

    1994-07-01

    The kappa B enhancer element regulates expression of many genes involved in immune responses and other processes. kappa B motif binds a number of proteins, some but not all, are related to the NF-kappa B family of transcription factors. We have previously identified a 65-kDa phosphoprotein that is specifically recognized by the kappa B motif (Ostrowski, J., Sims, J. E., Sibley, C. H., Valentine, M. A., Dower, S. K., Meier, K. E., and Bomsztyk, K. (1991) J. Biol. Chem. 266, 12722-12733). This protein is closely associated with a serine/threonine kinase that is responsive to treatment of cells with interleukin-1 and other agents. We report here purification, cloning, and expression of this kappa B motif-binding phosphoprotein. The primary structure deduced from the isolated murine cDNA, identifies the protein as the homolog of the human heterogeneous nuclear ribonucleoprotein K protein. Antipeptide antibodies and expression of the cloned cDNA in Escherichia coli, demonstrated that the K protein is the authentic phosphoprotein that binds the kappa B motif in vitro. We also demonstrate that the in vitro phosphorylation of the natural and the recombinant K proteins by the associated kinase is stimulated by the kappa B motif.

  10. Interaction of ApoA-IV with NR4A1 and NR1D1 Represses G6Pase and PEPCK Transcription: Nuclear Receptor-Mediated Downregulation of Hepatic Gluconeogenesis in Mice and a Human Hepatocyte Cell Line

    PubMed Central

    Li, Xiaoming; Xu, Min; Wang, Fei; Ji, Yong; DavidsoN, W. Sean; Li, Zongfang; Tso, Patrick

    2015-01-01

    We have previously shown that the nuclear receptor, NR1D1, is a cofactor in ApoA-IV-mediated downregulation of gluconeogenesis. Nuclear receptor, NR4A1, is involved in the transcriptional regulation of various genes involved in inflammation, apoptosis, and glucose metabolism. We investigated whether NR4A1 influences the effect of ApoA-IV on hepatic glucose metabolism. Our in situ proximity ligation assays and coimmunoprecipitation experiments indicated that ApoA-IV colocalized with NR4A1 in human liver (HepG2) and kidney (HEK-293) cell lines. The chromatin immunoprecipitation experiments and luciferase reporter assays indicated that the ApoA-IV and NR4A1 colocalized at the RORα response element of the human G6Pase promoter, reducing its transcriptional activity. Our RNA interference experiments showed that knocking down the expression of NR4A1 in primary mouse hepatocytes treated with ApoA-IV increased the expression of NR1D1, G6Pase, and PEPCK, and that knocking down NR1D1 expression increased the level of NR4A1. We also found that ApoA-IV induced the expression of endogenous NR4A1 in both cultured primary mouse hepatocytes and in the mouse liver, and decreased glucose production in primary mouse hepatocytes. Our findings showed that ApoA-IV colocalizes with NR4A1, which suppresses G6Pase and PEPCK gene expression at the transcriptional level, reducing hepatic glucose output and lowering blood glucose. The ApoA-IV-induced increase in NR4A1 expression in hepatocytes mediates further repression of gluconeogenesis. Our findings suggest that NR1D1 and NR4A1 serve similar or complementary functions in the ApoA-IV-mediated regulation of gluconeogenesis. PMID:26556724

  11. Interaction of ApoA-IV with NR4A1 and NR1D1 Represses G6Pase and PEPCK Transcription: Nuclear Receptor-Mediated Downregulation of Hepatic Gluconeogenesis in Mice and a Human Hepatocyte Cell Line.

    PubMed

    Li, Xiaoming; Xu, Min; Wang, Fei; Ji, Yong; DavidsoN, W Sean; Li, Zongfang; Tso, Patrick

    2015-01-01

    We have previously shown that the nuclear receptor, NR1D1, is a cofactor in ApoA-IV-mediated downregulation of gluconeogenesis. Nuclear receptor, NR4A1, is involved in the transcriptional regulation of various genes involved in inflammation, apoptosis, and glucose metabolism. We investigated whether NR4A1 influences the effect of ApoA-IV on hepatic glucose metabolism. Our in situ proximity ligation assays and coimmunoprecipitation experiments indicated that ApoA-IV colocalized with NR4A1 in human liver (HepG2) and kidney (HEK-293) cell lines. The chromatin immunoprecipitation experiments and luciferase reporter assays indicated that the ApoA-IV and NR4A1 colocalized at the RORα response element of the human G6Pase promoter, reducing its transcriptional activity. Our RNA interference experiments showed that knocking down the expression of NR4A1 in primary mouse hepatocytes treated with ApoA-IV increased the expression of NR1D1, G6Pase, and PEPCK, and that knocking down NR1D1 expression increased the level of NR4A1. We also found that ApoA-IV induced the expression of endogenous NR4A1 in both cultured primary mouse hepatocytes and in the mouse liver, and decreased glucose production in primary mouse hepatocytes. Our findings showed that ApoA-IV colocalizes with NR4A1, which suppresses G6Pase and PEPCK gene expression at the transcriptional level, reducing hepatic glucose output and lowering blood glucose. The ApoA-IV-induced increase in NR4A1 expression in hepatocytes mediates further repression of gluconeogenesis. Our findings suggest that NR1D1 and NR4A1 serve similar or complementary functions in the ApoA-IV-mediated regulation of gluconeogenesis.

  12. Calcium-aluminum-rich inclusions with fractionation and unidentified nuclear effects (FUN CAIs): II. Heterogeneities of magnesium isotopes and 26Al in the early Solar System inferred from in situ high-precision magnesium-isotope measurements

    NASA Astrophysics Data System (ADS)

    Park, Changkun; Nagashima, Kazuhide; Krot, Alexander N.; Huss, Gary R.; Davis, Andrew M.; Bizzarro, Martin

    2017-03-01

    Calcium-aluminum-rich inclusions with isotopic mass fractionation effects and unidentified nuclear isotopic anomalies (FUN CAIs) have been studied for more than 40 years, but their origins remain enigmatic. Here we report in situ high precision measurements of aluminum-magnesium isotope systematics of FUN CAIs by secondary ion mass spectrometry (SIMS). Individual minerals were analyzed in six FUN CAIs from the oxidized CV3 carbonaceous chondrites Axtell (compact Type A CAI Axtell 2271) and Allende (Type B CAIs C1 and EK1-4-1, and forsterite-bearing Type B CAIs BG82DH8, CG-14, and TE). Most of these CAIs show evidence for excess 26Mg due to the decay of 26Al. The inferred initial 26Al/27Al ratios [(26Al/27Al)0] and the initial magnesium isotopic compositions (δ26Mg0) calculated using an exponential law with an exponent β of 0.5128 are (3.1 ± 1.6) × 10-6 and 0.60 ± 0.10‰ (Axtell 2271), (3.7 ± 1.5) × 10-6 and -0.20 ± 0.05‰ (BG82DH8), (2.2 ± 1.1) × 10-6 and -0.18 ± 0.05‰ (C1), (2.3 ± 2.4) × 10-5 and -2.23 ± 0.37‰ (EK1-4-1), (1.5 ± 1.1) × 10-5 and -0.42 ± 0.08‰ (CG-14), and (5.3 ± 0.9) × 10-5 and -0.05 ± 0.08‰ (TE) with 2σ uncertainties. We infer that FUN CAIs recorded heterogeneities of magnesium isotopes and 26Al in the CAI-forming region(s). Comparison of 26Al-26Mg systematics, stable isotope (oxygen, magnesium, calcium, and titanium) and trace element studies of FUN and non-FUN igneous CAIs indicates that there is a continuum among these CAI types. Based on these observations and evaporation experiments on CAI-like melts, we propose a generic scenario for the origin of igneous (FUN and non-FUN) CAIs: (i) condensation of isotopically normal solids in an 16O-rich gas of approximately solar composition; (ii) formation of CAI precursors by aggregation of these solids together with variable abundances of isotopically anomalous grains-possible carriers of unidentified nuclear (UN) effects; and (iii) melt evaporation of these precursors

  13. The orphan nuclear receptor Nr4a1 couples sympathetic and inflammatory cues in CNS-recruited macrophages to limit neuroinflammation

    PubMed Central

    Shaked, Iftach; Hanna, Richard N.; Shaked, Helena; Chodaczek, Grzegorz; Nowyhed, Heba N.; Tweet, George; Tacke, Robert; Basat, Alp Bugra; Mikulski, Zbigniew; Togher, Susan; Miller, Jacqueline; Blatchley, Amy; Salek-Ardakani, Shahram; Darvas, Martin; Kaikkonen, Minna U.; Thomas, Graham; Lai-Wing-Sun, Sonia; Rezk, Ayman; Bar-Or, Amit; Glass, Christopher K.; Bandukwala, Hozefa; Hedrick, Catherine C.

    2016-01-01

    Molecular mechanisms linking the sympathetic stress response and inflammation remain enigmatic. Here we demonstrate that the transcription factor Nr4a1 regulates production of norepinephrine (NE) in macrophages, thereby limiting experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis. Lack of Nr4a1 in myeloid cells led to enhanced NE production, accelerated leukocyte infiltration to the central nervous system (CNS) and disease exacerbation in vivo. In contrast, myeloid-specific deletion of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, protected against EAE. Further, we found that Nr4a1 repressed autocrine NE production in macrophages by recruiting the corepressor CoREST to the Th promoter. Our data reveal a new role for macrophages in neuroinflammation and identify Nr4a1 as a key regulator of macrophage catecholamine production. PMID:26523867

  14. Beta-hairpin formation in aqueous solution and in the presence of trifluoroethanol: a (1)H and (13)C nuclear magnetic resonance conformational study of designed peptides.

    PubMed

    Santiveri, Clara M; Pantoja-Uceda, David; Rico, Manuel; Jiménez, M Angeles

    2005-10-15

    In order to check our current knowledge on the principles involved in beta-hairpin formation, we have modified the sequence of a 3:5 beta-hairpin forming peptide with two different purposes, first to increase the stability of the formed 3:5 beta-hairpin, and second to convert the 3:5 beta-hairpin into a 2:2 beta-hairpin. The conformational behavior of the designed peptides was investigated in aqueous solution and in 30% trifluoroethanol (TFE) by analysis of the following nuclear magnetic resonance (NMR) parameters: nuclear Overhauser effect (NOE) data, and C(alpha)H, (13)C(alpha), and (13)C(beta) conformational shifts. From the differences in the ability to adopt beta-hairpin structures in these peptides, we have arrived to the following conclusions: (i) beta-Hairpin population increases with the statistical propensity of residues to occupy each turn position. (ii) The loop length, and in turn, the beta-hairpin type, can be modified as a function of the type of turn favored by the loop sequence. These two conclusions reinforce previous results about the importance of beta-turn sequence in beta-hairpin folding. (iii) Side-chain packing on each face of the beta-sheet may play a major role in beta-hairpin stability; hence simplified analysis in terms of isolated pair interactions and intrinsic beta-sheet propensities is insufficient. (iv) Contributions to beta-hairpin stability of turn and strand sequences are not completely independent. (v) The burial of hydrophobic surface upon beta-hairpin formation that, in turn, depends on side-chain packing also contributes to beta-hairpin stability. (vi) As previously observed, TFE stabilizes beta-hairpin structures, but the extent of the contribution of different factors to beta-hairpin formation is sometimes different in aqueous solution and in 30% TFE. (c) 2005 Wiley Periodicals, Inc. Biopolymers 79: 150-162, 2005.

  15. A laparoscopic applicator probe for real-time en-face mapping of near-surface optical sources of heterogeneity over a 1cm instrument-tip-size field-of-view

    NASA Astrophysics Data System (ADS)

    Piao, Daqing; Bartels, Kenneth E.; Holyoak, G. Reed; Patel, Sanjay

    2017-02-01

    Surgeons operating laparoscopically often have to rely upon subjective visual cues for complete oncological control and avoiding tumor violation or iatrogenic injury to critical tissues. A laparoscopic imaging tool to allow assessment of tumor margin or identification of anatomical structures buried under the layer of tissue being dissected is desirable to probe tissue contrast at a few millimeters depth, visualize over the lateral view for resection guidance, have a non-microscopic field-of-view (FOV) adequate for rapid survey of the resection site, and form the image in real-time. Probing light diffusely propagated through tissue provides sub-surface sensitivity, but the image formation generally involves intense computation that may be costly to intraoperative time-frame. Projecting these modalities laparoscopically to sample subsurface tissue heterogeneity over a non-microscopic FOV for rapid site-survey has been challenging. We demonstrate a laparoscopic applicator probe and a method thereof for real-time en-face mapping of near-surface heterogeneity for potential use towards intraoperative margin assessment. The probe fits a 12mm port and houses at 128 copper-coated 750μm fibers that form radially alternating illumination (70 fibers) and detection (58 fibers) channels. By simultaneously illuminating the 70 source channels of the laparoscopic probe that is in contact with a scattering medium and concurrently measuring the light diffusely propagated to the 58 detector channels, the presence of near-surface optical heterogeneities can be resolved in an en-face 9.5mm field-of-view in real-time. Visualization of subsurface margin of strong attenuation contrast at a depth up to 3mm is demonstrated at a frame rate of 1.25Hz.

  16. Orphan Nuclear Receptor NR4A1 Binds a Novel Protein Interaction Site on Anti-apoptotic B Cell Lymphoma Gene 2 Family Proteins.

    PubMed

    Godoi, Paulo H C; Wilkie-Grantham, Rachel P; Hishiki, Asami; Sano, Renata; Matsuzawa, Yasuko; Yanagi, Hiroko; Munte, Claudia E; Chen, Ya; Yao, Yong; Marassi, Francesca M; Kalbitzer, Hans R; Matsuzawa, Shu-Ichi; Reed, John C

    2016-07-01

    B cell lymphoma gene 2 (Bcl-2) family proteins are key regulators of programmed cell death and important targets for drug discovery. Pro-apoptotic and anti-apoptotic Bcl-2 family proteins reciprocally modulate their activities in large part through protein interactions involving a motif known as BH3 (Bcl-2 homology 3). Nur77 is an orphan member of the nuclear receptor family that lacks a BH3 domain but nevertheless binds certain anti-apoptotic Bcl-2 family proteins (Bcl-2, Bfl-1, and Bcl-B), modulating their effects on apoptosis and autophagy. We used a combination of NMR spectroscopy-based methods, mutagenesis, and functional studies to define the interaction site of a Nur77 peptide on anti-apoptotic Bcl-2 family proteins and reveal a novel interaction surface. Nur77 binds adjacent to the BH3 peptide-binding crevice, suggesting the possibility of cross-talk between these discrete binding sites. Mutagenesis of residues lining the identified interaction site on Bcl-B negated the interaction with Nur77 protein in cells and prevented Nur77-mediated modulation of apoptosis and autophagy. The findings establish a new protein interaction site with the potential to modulate the apoptosis and autophagy mechanisms governed by Bcl-2 family proteins.

  17. Interactions between Carbon and Nitrogen Metabolism in Fibrobacter succinogenes S85: a 1H and 13C Nuclear Magnetic Resonance and Enzymatic Study

    PubMed Central

    Matheron, Christelle; Delort, Anne-Marie; Gaudet, Genevieve; Liptaj, Tibor; Forano, Evelyne

    1999-01-01

    The effect of the presence of ammonia on [1-13C]glucose metabolism in the rumen fibrolytic bacterium Fibrobacter succinogenes S85 was studied by 13C and 1H nuclear magnetic resonance (NMR). Ammonia halved the level of glycogen storage and increased the rate of glucose conversion into acetate and succinate 2.2-fold and 1.4-fold, respectively, reducing the succinate-to-acetate ratio. The 13C enrichment of succinate and acetate was precisely quantified by 13C-filtered spin-echo difference 1H-NMR spectroscopy. The presence of ammonia did not modify the 13C enrichment of succinate C-2 (without ammonia, 20.8%, and with ammonia, 21.6%), indicating that the isotopic dilution of metabolites due to utilization of endogenous glycogen was not affected. In contrast, the presence of ammonia markedly decreased the 13C enrichment of acetate C-2 (from 40 to 31%), reflecting enhanced reversal of the succinate synthesis pathway. The reversal of glycolysis was unaffected by the presence of ammonia as shown by 13C-NMR analysis. Study of cell extracts showed that the main pathways of ammonia assimilation in F. succinogenes were glutamate dehydrogenase and alanine dehydrogenase. Glutamine synthetase activity was not detected. Glutamate dehydrogenase was active with both NAD and NADP as cofactors and was not repressed under ammonia limitation in the culture. Glutamate-pyruvate and glutamate-oxaloacetate transaminase activities were evidenced by spectrophotometry and 1H NMR. When cells were incubated in vivo with [1-13C]glucose, only 13C-labeled aspartate, glutamate, alanine, and valine were detected. Their labelings were consistent with the proposed amino acid synthesis pathway and with the reversal of the succinate synthesis pathway. PMID:10223984

  18. Interactions between carbon and nitrogen metabolism in Fibrobacter succinogenes S85: a 1H and 13C nuclear magnetic resonance and enzymatic study.

    PubMed

    Matheron, C; Delort, A M; Gaudet, G; Liptaj, T; Forano, E

    1999-05-01

    The effect of the presence of ammonia on [1-13C]glucose metabolism in the rumen fibrolytic bacterium Fibrobacter succinogenes S85 was studied by 13C and 1H nuclear magnetic resonance (NMR). Ammonia halved the level of glycogen storage and increased the rate of glucose conversion into acetate and succinate 2.2-fold and 1.4-fold, respectively, reducing the succinate-to-acetate ratio. The 13C enrichment of succinate and acetate was precisely quantified by 13C-filtered spin-echo difference 1H-NMR spectroscopy. The presence of ammonia did not modify the 13C enrichment of succinate C-2 (without ammonia, 20.8%, and with ammonia, 21.6%), indicating that the isotopic dilution of metabolites due to utilization of endogenous glycogen was not affected. In contrast, the presence of ammonia markedly decreased the 13C enrichment of acetate C-2 (from 40 to 31%), reflecting enhanced reversal of the succinate synthesis pathway. The reversal of glycolysis was unaffected by the presence of ammonia as shown by 13C-NMR analysis. Study of cell extracts showed that the main pathways of ammonia assimilation in F. succinogenes were glutamate dehydrogenase and alanine dehydrogenase. Glutamine synthetase activity was not detected. Glutamate dehydrogenase was active with both NAD and NADP as cofactors and was not repressed under ammonia limitation in the culture. Glutamate-pyruvate and glutamate-oxaloacetate transaminase activities were evidenced by spectrophotometry and 1H NMR. When cells were incubated in vivo with [1-13C]glucose, only 13C-labeled aspartate, glutamate, alanine, and valine were detected. Their labelings were consistent with the proposed amino acid synthesis pathway and with the reversal of the succinate synthesis pathway.

  19. The negative effects of bile acids and tumor necrosis factor-alpha on the transcription of cholesterol 7alpha-hydroxylase gene (CYP7A1) converge to hepatic nuclear factor-4: a novel mechanism of feedback regulation of bile acid synthesis mediated by nuclear receptors.

    PubMed

    De Fabiani, E; Mitro, N; Anzulovich, A C; Pinelli, A; Galli, G; Crestani, M

    2001-08-17

    Bile acids regulate the cholesterol 7alpha-hydroxylase gene (CYP7A1), which encodes the rate-limiting enzyme in the classical pathway of bile acid synthesis. Here we report a novel mechanism whereby bile acid feedback regulates CYP7A1 transcription through the nuclear receptor hepatocyte nuclear factor-4 (HNF-4), which binds to the bile acid response element (BARE) at nt -149/-118 relative to the transcription start site. Using transient transfection assays of HepG2 cells with Gal4-HNF-4 fusion proteins, we show that chenodeoxycholic acid (CDCA) dampened the transactivation potential of HNF-4. Overexpression of a constitutive active form of MEKK1, an upstream mitogen-activated protein kinase (MAPK) module triggered by stress signals, strongly repressed the promoter activity of CYP7A1 via the consensus sequence for HNF-4 embedded in the BARE. Similarly, MEKK1 inhibited the activity of HNF-4 in the Gal4-based assay. The involvement of the MEKK1-dependent pathway in the bile acid-mediated repression of CYP7A1 was confirmed by co-transfecting a dominant negative form of the stress-activated protein kinase kinase, SEK, which abolished the effect of CDCA upon CYP7A1 transcription. Treatment of transfected HepG2 cells with tumor necrosis factor alpha (TNF-alpha), an activator of the MEKK1 pathway, led to the repression of CYP7A1 via the HNF-4 site in the BARE. TNF-alpha also inhibited the transactivation potential of HNF-4. Collectively, our results demonstrate for the first time that HNF-4, in combination with a MAPK signaling pathway, acts as a bile acid sensor in the liver. Furthermore, the effects of CDCA and TNF-alpha converge to HNF-4, which binds to the BARE of CYP7A1, suggesting a link between the cascades elicited by bile acids and pro-inflammatory stimuli in the liver.

  20. Elucidating heterogeneity of IgA1 hinge-region O-glycosylation by use of MALDI-TOF/TOF mass spectrometry: role of cysteine alkylation during sample processing

    PubMed Central

    Franc, Vojtěch; Řehulka, Pavel; Raus, Martin; Stulík, Jiří; Novak, Jan; Renfrow, Matthew B.; Šebela, Marek

    2013-01-01

    Determining disease-associated changes in protein glycosylation provides a better understanding of pathogenesis. This work focuses on human immunoglobulin A1 (IgA1), where aberrant O-glycosylation plays a key role in the pathogenesis of IgA nephropathy (IgAN). Normal IgA1 hinge region carries 3 to 6 O-glycans consisting of N-acetylgalactosamine (GalNAc) and galactose (Gal); both sugars may be sialylated. In IgAN patients, some O-glycans on a fraction of IgA1 molecules are Gal-deficient. Here we describe a sample preparation protocol with optimized cysteine alkylation of a Gal-deficient polymeric IgA1 myeloma protein prior to in-gel digestion and analysis of the digest by MALDI-TOF/TOF mass spectrometry (MS). Following a novel strategy, IgA1 hinge-region O-glycopeptides were fractionated by reversed-phase liquid chromatography using a microgradient device and identified by MALDI-TOF/TOF tandem MS (MS/MS). The acquired MS/MS spectra were interpreted manually and by means of our own software. This allowed assigning up to six O-glycosylation sites and demonstration, for the first time, of the distribution of isomeric O-glycoforms having the same molecular mass, but a different glycosylation pattern. The most abundant Gal-deficient O-glycoforms were GalNAc4Gal3 and GalNAc5Gal4 with one Gal-deficient site and GalNAc5Gal3 and GalNAc4Gal2 with two Gal-deficient sites. The most frequent Gal-deficient sites were at Ser230 and/or Thr236. PMID:23891555

  1. Mutation in type II procollagen (COL2A1) that substitutes aspartate for glycine alpha 1-67 and that causes cataracts and retinal detachment: evidence for molecular heterogeneity in the Wagner syndrome and the Stickler syndrome (arthro-ophthalmopathy)

    PubMed Central

    Körkkö, J; Ritvaniemi, P; Haataja, L; Kääriäinen, H; Kivirikko, K I; Prockop, D J; Ala-Kokko, L

    1993-01-01

    A search for mutations in the gene for type II procollagen (COL2A1) was carried out in affected members of a family with early-onset cataracts, lattice degeneration of the retina, and retinal detachment. They had no symptoms suggestive of involvement of nonocular tissues, as is typically found in the Stickler syndrome. The COL2A1 gene was amplified with PCR, and the products were analyzed by denaturing gradient gel electrophoresis. The results suggested a mutation in one allele for exon 10. Sequencing of the fragment demonstrated a single-base mutation that converted the codon for glycine at position alpha 1-67 to aspartate. The mutation was found in three affected members of the family available for study but not in unaffected members or 100 unrelated individuals. Comparison with previously reported mutations suggested that mutations introducing premature termination codons in the COL2A1 gene are a frequent cause of the Stickler syndrome, but mutations in the COL2A1 gene that replace glycine codons with codons for bulkier amino acid can produce a broad spectrum of disorders that range from lethal chondrodysplasias to a syndrome involving only ocular tissues, similar to the syndrome in the family originally described by Wagner in 1938. Images Figure 2 Figure 3 Figure 4 PMID:8317498

  2. Functional interaction of hepatic nuclear factor-4 and peroxisome proliferator-activated receptor-gamma coactivator 1alpha in CYP7A1 regulation is inhibited by a key lipogenic activator, sterol regulatory element-binding protein-1c.

    PubMed

    Ponugoti, Bhaskar; Fang, Sungsoon; Kemper, Jongsook Kim

    2007-11-01

    Insulin inhibits transcription of cholesterol 7alpha-hydroxylase (Cyp7a1), a key gene in bile acid synthesis, and the hepatic nuclear factor-4 (HNF-4) site in the promoter was identified as a negative insulin response sequence. Using a fasting/feeding protocol in mice and insulin treatment in HepG2 cells, we explored the inhibition mechanisms. Expression of sterol regulatory element-binding protein-1c (SREBP-1c), an insulin-induced lipogenic factor, inversely correlated with Cyp7a1 expression in mouse liver. Interaction of HNF-4 with its coactivator, peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha), was observed in livers of fasted mice and was reduced after feeding. Conversely, HNF-4 interaction with SREBP-1c was increased after feeding. In vitro studies suggested that SREBP-1c competed with PGC-1alpha for direct interaction with the AF2 domain of HNF-4. Reporter assays showed that SREBP-1c, but not of a SREBP-1c mutant lacking the HNF-4 interacting domain, inhibited HNF-4/PGC-1alpha transactivation of Cyp7a1. SREBP-1c also inhibited PGC-1alpha-coactivation of estrogen receptor, constitutive androstane receptor, pregnane X receptor, and farnesoid X receptor, implying inhibition of HNF-4 by SREBP-1c could extend to other nuclear receptors. In chromatin immunoprecipitation studies, HNF-4 binding to the promoter was not altered, but PGC-1alpha was dissociated, SREBP-1c and histone deacetylase-2 (HDAC2) were recruited, and acetylation of histone H3 was decreased upon feeding. Adenovirus-mediated expression of a SREBP-1c dominant-negative mutant, which blocks the interaction of SREBP-1c and HNF-4, partially but significantly reversed the inhibition of Cyp7a1 after feeding. Our data show that SREBP-1c functions as a non-DNA-binding inhibitor and mediates, in part, suppression of Cyp7a1 by blocking functional interaction of HNF-4 and PGC-1alpha. This mechanism may be relevant to known repression of many other HNF-4 target genes upon

  3. Etiologic heterogeneity in alcoholism.

    PubMed

    Gilligan, S B; Reich, T; Cloninger, C R

    1987-01-01

    Etiologic heterogeneity in alcohol abuse was evaluated in 195 extended pedigrees, comprising 288 nuclear families of 140 male and 55 female Caucasian American hospitalized alcoholics. Previous adoption studies in Sweden demonstrated differential heritability of two patterns of alcohol abuse in men: type-2 alcoholism exhibited early onset of abuse associated with criminal behavior, while type-1 abuse began at a later age, uncomplicated by antisocial traits. Alcohol abuse in female Swedish adoptees was relatively homogeneous and similar to the late-onset, type-1 abuse. The notion of etiologic heterogeneity, as suggested by the Stockholm Adoption Studies, was examined in the American pedigrees by contrasting the models of familial transmission of susceptibility to alcoholism obtained via segregation analyses of families of male versus female probands. Families of male probands demonstrated significant familial resemblance, accounted for by a multifactorial-polygenic background in addition to a major (gene) effect. In contrast, familial resemblance in the pedigrees of female probands was attributed solely to a multifactorial-polygenic effect. We considered whether some families of male alcoholics were similar to families of female probands, who expressed type-1 abuse predominantly. Pedigrees of male probands were separated in two groups: (1) "female-like" families had a better likelihood for the model obtained for families of female probands than the one for families of all male probands, (2) "male-like" families had a better likelihood for the model of familial transmission describing families of all male probands. A statistically significant difference in the pattern of familial transmission was observed between the "male-like" and "female-like" groups. Discriminant function analysis of alcohol-related symptoms showed that the familial subtypes differed in clinical features as well. Alcohol abuse by male relatives in "male-like" families was characterized by the

  4. Heterogeneity of nuclear estrogen-binding sites in the rat uterus: a simple method for the quantitation of type I and type II sites by (3H)estradiol exchange

    SciTech Connect

    Markaverich, B.M.; Williams, M.; Upchurch, S.; Clark, J.H.

    1981-07-01

    Estrogen administration to mature-ovariectomized rats causes the activation or stimulation of secondary nuclear estrogen-binding sites (type II) in the uterus which can interfere with estrogen receptor (type I) measurement. Earlier reports from our laboratory have shown that quantitation of type I sites in the presence of the type II site is very difficult and can only be achieved by graphic analysis of saturation curves which employ a wide range (0.4-40 NM) of (/sup 3/H)estradiol concentrations in nuclear exchange assay. The studies presented in this manuscript describe simple methods which can be used to separately quantitate both nuclear estrogen-binding sites using a single concentration of (/sup 3/H)estradiol. Since the nuclear type II site does not bind (/sup 3/H)estradiol in the presence of reducing agent, type I sites can be easily quantitated by incubating nuclei (37 C for 30 min) in Tris-EDTA buffer containing 0.1-1.00 mM dithiothreitol using a single saturating concentration of (/sup 3/H)estradiol. Conversely, a single concentration of (/sup 3/H)estradiol (40-80 nM) can be used to quantitate the nuclear type II site by incubating nuclei in Tris-EDTA buffer under conditions (4 C for 60 min) which do not measure occupied nuclear estrogen receptor. Therefore, by using the appropriate buffer system, type I and type II sites can be easily separated in mixed binding systems. In addition, we also demonstrate that Nafoxidine does not bind to the nuclear type II site. Therefore, it can be used as a competitive inhibitor of (/sup 3/H)estradiol binding to type I sites and permit the measurement of type II sites without interference from type I sites. These techniques should be applicable to autoradiographic or fluorescence studies which cannot discriminate between steroid binding to these two classes of nuclear estrogen-binding sites.

  5. Relative Expression of Vitamin D Hydroxylases, CYP27B1 and CYP24A1, and of Cyclooxygenase-2 and Heterogeneity of Human Colorectal Cancer in Relation to Age, Gender, Tumor Location, and Malignancy: Results from Factor and Cluster Analysis.

    PubMed

    Brozek, Wolfgang; Manhardt, Teresa; Kállay, Enikö; Peterlik, Meinrad; Cross, Heide S

    2012-07-26

    Previous studies on the significance of vitamin D insufficiency and chronic inflammation in colorectal cancer development clearly indicated that maintenance of cellular homeostasis in the large intestinal epithelium requires balanced interaction of 1,25-(OH)2D3 and prostaglandin cellular signaling networks. The present study addresses the question how colorectal cancer pathogenesis depends on alterations of activities of vitamin D hydroxylases, i.e., CYP27B1-encoded 25-hydroxyvitamin D-1a-hydroxylase and CYP24A1-encoded 25-hydroxyvitamin D-24-hydroxylase, and inflammation-induced cyclooxygenase-2 (COX-2). Data from 105 cancer patients on CYP27B1, VDR, CYP24A1, and COX-2 mRNA expression in relation to tumor grade, anatomical location, gender and age were fit into a multivariate model of exploratory factor analysis. Nearly identical results were obtained by the principal factor and the maximum likelihood method, and these were confirmed by hierarchical cluster analysis: Within the eight mutually dependent variables studied four independent constellations were found that identify different features of colorectal cancer pathogenesis: (i) Escape of COX-2 activity from restraints by the CYP27B1/VDR system can initiate cancer growth anywhere in the colorectum regardless of age and gender; (ii) variations in COX-2 expression are mainly responsible for differences in cancer incidence in relation to tumor location; (iii) advancing age has a strong gender-specific influence on cancer incidence; (iv) progression from well differentiated to undifferentiated cancer is solely associated with a rise in CYP24A1 expression.

  6. Relative Expression of Vitamin D Hydroxylases, CYP27B1 and CYP24A1, and of Cyclooxygenase-2 and Heterogeneity of Human Colorectal Cancer in Relation to Age, Gender, Tumor Location, and Malignancy: Results from Factor and Cluster Analysis

    PubMed Central

    Brozek, Wolfgang; Manhardt, Teresa; Kállay, Enikö; Peterlik, Meinrad; Cross, Heide S.

    2012-01-01

    Previous studies on the significance of vitamin D insufficiency and chronic inflammation in colorectal cancer development clearly indicated that maintenance of cellular homeostasis in the large intestinal epithelium requires balanced interaction of 1,25-(OH)2D3 and prostaglandin cellular signaling networks. The present study addresses the question how colorectal cancer pathogenesis depends on alterations of activities of vitamin D hydroxylases, i.e., CYP27B1-encoded 25-hydroxyvitamin D-1α-hydroxylase and CYP24A1-encoded 25-hydroxyvitamin D-24-hydroxylase, and inflammation-induced cyclooxygenase-2 (COX-2). Data from 105 cancer patients on CYP27B1, VDR, CYP24A1, and COX-2 mRNA expression in relation to tumor grade, anatomical location, gender and age were fit into a multivariate model of exploratory factor analysis. Nearly identical results were obtained by the principal factor and the maximum likelihood method, and these were confirmed by hierarchical cluster analysis: Within the eight mutually dependent variables studied four independent constellations were found that identify different features of colorectal cancer pathogenesis: (i) Escape of COX-2 activity from restraints by the CYP27B1/VDR system can initiate cancer growth anywhere in the colorectum regardless of age and gender; (ii) variations in COX-2 expression are mainly responsible for differences in cancer incidence in relation to tumor location; (iii) advancing age has a strong gender-specific influence on cancer incidence; (iv) progression from well differentiated to undifferentiated cancer is solely associated with a rise in CYP24A1 expression. PMID:24213465

  7. Ligand-dependent regulation of the activity of the orphan nuclear receptor, small heterodimer partner (SHP), in the repression of bile acid biosynthetic CYP7A1 and CYP8B1 genes.

    PubMed

    Miao, Ji; Choi, Sung-E; Seok, Sun Mi; Yang, Linda; Zuercher, William J; Xu, Yong; Willson, Timothy M; Xu, H Eric; Kemper, Jongsook Kim

    2011-07-01

    Small heterodimer partner (SHP) plays important roles in diverse biological processes by directly interacting with transcription factors and inhibiting their activities. SHP has been designated an orphan nuclear receptor, but whether its activity can be modulated by ligands has been a long-standing question. Recently, retinoid-related molecules, including 4-[3-(1-adamantyl)-4-hydroxyphenyl]-3-chlorocinnamic acid (3Cl-AHPC), were shown to bind to SHP and enhance apoptosis. We have examined whether 3Cl-AHPC acts as an agonist and increases SHP activity in the repression of bile acid biosynthetic CYP7A1 and CYP8B1 genes and delineated the underlying mechanisms. Contrary to this expectation, micromolar concentrations of 3Cl-AHPC increased CYP7A1 expression but indirectly via p38 kinase signaling. Nanomolar concentrations, however, repressed CYP7A1 expression and decreased bile acid levels in HepG2 cells, and little repression was observed when SHP was down-regulated by small hairpin RNA. Mechanistic studies revealed that 3Cl-AHPC bound to SHP, increased the interaction of SHP with liver receptor homologue (LRH)-1, a hepatic activator for CYP7A1 and CYP8B1 genes, and with repressive cofactors, Brahma, mammalian Sin3a, and histone deacetylase-1, and, subsequently, increased the occupancy of SHP and these cofactors at the promoters. Mutation of Leu-100, predicted to contact 3Cl-AHPC within the SHP ligand binding pocket by molecular modeling, severely impaired the increased interaction with LRH-1, and repression of LRH-1 activity mediated by 3Cl-AHPC. 3Cl-AHPC repressed SHP metabolic target genes in a gene-specific manner in human primary hepatocytes and HepG2 cells. These data suggest that SHP may act as a ligand-regulated receptor in metabolic pathways. Modulation of SHP activity by synthetic ligands may be a useful therapeutic strategy.

  8. Phenotypically heterogeneous populations in spatially heterogeneous environments

    NASA Astrophysics Data System (ADS)

    Patra, Pintu; Klumpp, Stefan

    2014-03-01

    The spatial expansion of a population in a nonuniform environment may benefit from phenotypic heterogeneity with interconverting subpopulations using different survival strategies. We analyze the crossing of an antibiotic-containing environment by a bacterial population consisting of rapidly growing normal cells and slow-growing, but antibiotic-tolerant persister cells. The dynamics of crossing is characterized by mean first arrival times and is found to be surprisingly complex. It displays three distinct regimes with different scaling behavior that can be understood based on an analytical approximation. Our results suggest that a phenotypically heterogeneous population has a fitness advantage in nonuniform environments and can spread more rapidly than a homogeneous population.

  9. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis

    USDA-ARS?s Scientific Manuscript database

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  10. Nuclear power and nuclear weapons

    SciTech Connect

    Vaughen, V.C.A.

    1983-01-01

    The proliferation of nuclear weapons and the expanded use of nuclear energy for the production of electricity and other peaceful uses are compared. The difference in technologies associated with nuclear weapons and nuclear power plants are described.

  11. Nuclear rights - nuclear wrongs

    SciTech Connect

    Paul, E.F.; Miller, F.D.; Paul, J.; Ahrens, J.

    1986-01-01

    This book contains 11 selections. The titles are: Three Ways to Kill Innocent Bystanders: Some Conundrums Concerning the Morality of War; The International Defense of Liberty; Two Concepts of Deterrence; Nuclear Deterrence and Arms Control; Ethical Issues for the 1980s; The Moral Status of Nuclear Deterrent Threats; Optimal Deterrence; Morality and Paradoxical Deterrence; Immoral Risks: A Deontological Critique of Nuclear Deterrence; No War Without Dictatorship, No Peace Without Democracy: Foreign Policy as Domestic Politics; Marxism-Leninism and its Strategic Implications for the United States; Tocqueveille War.

  12. Tumour Cell Heterogeneity

    PubMed Central

    Gay, Laura; Baker, Ann-Marie; Graham, Trevor A.

    2016-01-01

    The population of cells that make up a cancer are manifestly heterogeneous at the genetic, epigenetic, and phenotypic levels. In this mini-review, we summarise the extent of intra-tumour heterogeneity (ITH) across human malignancies, review the mechanisms that are responsible for generating and maintaining ITH, and discuss the ramifications and opportunities that ITH presents for cancer prognostication and treatment. PMID:26973786

  13. Tertiary-butylhydroquinone upregulates expression of ATP-binding cassette transporter A1 via nuclear factor E2-related factor 2/heme oxygenase-1 signaling in THP-1 macrophage-derived foam cells.

    PubMed

    Lu, Qian; Tang, Shi-Lin; Liu, Xiao-Yan; Zhao, Guo-Jun; Ouyang, Xin-Ping; Lv, Yun-Cheng; He, Ping-Ping; Yao, Feng; Chen, Wu-Jun; Tang, Yan-Yan; Zhang, Min; Zhang, Da-Wei; Yin, Kai; Tang, Chao-Ke

    2013-01-01

    Tert-butylhydroquinone (tBHQ), a synthetic phenolic antioxidant, is commonly used as a food preservative because of its potent antilipid peroxidation activity. Several lines of evidence have demonstrated that dietary supplementation with antioxidants has an antiatherogenic function through reducing cholesterol uptake or promoting reverse cholesterol transport. In this study, we investigated whether tBHQ affects expression of ATP-binding cassette transporter A1 (ABCA1) and the potential subsequent effect on cellular cholesterol homeostasis. tBHQ increased ABCA1 protein levels and markedly enhanced cholesterol efflux from THP-1 macrophage-derived foam cells. Furthermore, tBHQ reduced calpain-mediated ABCA1 proteolysis via activation of nuclear factor E2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1). Inhibition of HO-1 with a pharmacological inhibitor or siRNA and knockdown of Nrf2 suppressed the stimulatory effects of tBHQ on ABCA1 expression and calpain activity. Nrf2/HO-1 signaling is required for the regulation by tBHQ of ABCA1 expression and cholesterol efflux in macrophage-derived foam cells and an antiatherogenic role of tBHQ is suggested.

  14. Sorting the nuclear proteome

    PubMed Central

    Bauer, Denis C.; Willadsen, Kai; Buske, Fabian A.; Lê Cao, Kim-Anh; Bailey, Timothy L.; Dellaire, Graham; Bodén, Mikael

    2011-01-01

    Motivation: Quantitative experimental analyses of the nuclear interior reveal a morphologically structured yet dynamic mix of membraneless compartments. Major nuclear events depend on the functional integrity and timely assembly of these intra-nuclear compartments. Yet, unknown drivers of protein mobility ensure that they are in the right place at the time when they are needed. Results: This study investigates determinants of associations between eight intra-nuclear compartments and their proteins in heterogeneous genome-wide data. We develop a model based on a range of candidate determinants, capable of mapping the intra-nuclear organization of proteins. The model integrates protein interactions, protein domains, post-translational modification sites and protein sequence data. The predictions of our model are accurate with a mean AUC (over all compartments) of 0.71. We present a complete map of the association of 3567 mouse nuclear proteins with intra-nuclear compartments. Each decision is explained in terms of essential interactions and domains, and qualified with a false discovery assessment. Using this resource, we uncover the collective role of transcription factors in each of the compartments. We create diagrams illustrating the outcomes of a Gene Ontology enrichment analysis. Associated with an extensive range of transcription factors, the analysis suggests that PML bodies coordinate regulatory immune responses. Contact: m.boden@uq.edu.au Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21685104

  15. Heterogeneous Atmospheric Chemistry

    NASA Astrophysics Data System (ADS)

    Schryer, David R.

    In the past few years it has become increasingly clear that heterogeneous, or multiphase, processes play an important role in the atmosphere. Unfortunately the literature on the subject, although now fairly extensive, is still rather dispersed. Furthermore, much of the expertise regarding heterogeneous processes lies in fields not directly related to atmospheric science. Therefore, it seemed desirable to bring together for an exchange of ideas, information, and methodologies the various atmospheric scientists who are actively studying heterogeneous processes as well as other researchers studying similar processes in the context of other fields.

  16. Nuclear Medicine.

    ERIC Educational Resources Information Center

    Badawi, Ramsey D.

    2001-01-01

    Describes the use of nuclear medicine techniques in diagnosis and therapy. Describes instrumentation in diagnostic nuclear medicine and predicts future trends in nuclear medicine imaging technology. (Author/MM)

  17. Nuclear ventriculography

    MedlinePlus

    ... ventriculography (RNV); Multiple gate acquisition scan (MUGA); Nuclear cardiology; Cardiomyopathy - nuclear ventriculography ... 56. Udelson JE, Dilsizian V, Bonow RO. Nuclear cardiology. In: Bonow RO, Mann DL, Zipes DP, Libby ...

  18. Nuclear Medicine.

    ERIC Educational Resources Information Center

    Badawi, Ramsey D.

    2001-01-01

    Describes the use of nuclear medicine techniques in diagnosis and therapy. Describes instrumentation in diagnostic nuclear medicine and predicts future trends in nuclear medicine imaging technology. (Author/MM)

  19. NERVA Reactor Based on NRX A1

    NASA Technical Reports Server (NTRS)

    1963-01-01

    This artist's concept from 1963 shows a proposed NERVA (Nuclear Engine for Rocket Vehicle Application) incorporating the NRX-A1, the first NERVA-type cold flow reactor. The NERVA engine, based on Kiwi nuclear reactor technology, was intended to power a RIFT (Reactor-In-Flight-Test) nuclear stage, for which Marshall Space Flight Center had development responsibility.

  20. Nuclear data for nuclear transmutation

    SciTech Connect

    Harada, Hideo

    2009-05-04

    Current status on nuclear data for the study of nuclear transmutation of radioactive wastes is reviewed, mainly focusing on neutron capture reactions. It is stressed that the highest-precision frontier research in nuclear data measurements should be a key to satisfy the target accuracies on the nuclear data requested for realizing the nuclear transmutation.

  1. Nuclear data for nuclear transmutation

    NASA Astrophysics Data System (ADS)

    Harada, Hideo

    2009-05-01

    Current status on nuclear data for the study of nuclear transmutation of radioactive wastes is reviewed, mainly focusing on neutron capture reactions. It is stressed that the highest-precision frontier research in nuclear data measurements should be a key to satisfy the target accuracies on the nuclear data requested for realizing the nuclear transmutation.

  2. Heterogeneous atmospheric chemistry

    NASA Technical Reports Server (NTRS)

    Schryer, D. R.

    1982-01-01

    The present conference on heterogeneous atmospheric chemistry considers such topics concerning clusters, particles and microparticles as common problems in nucleation and growth, chemical kinetics, and catalysis, chemical reactions with aerosols, electron beam studies of natural and anthropogenic microparticles, and structural studies employing molecular beam techniques, as well as such gas-solid interaction topics as photoassisted reactions, catalyzed photolysis, and heterogeneous catalysis. Also discussed are sulfur dioxide absorption, oxidation, and oxidation inhibition in falling drops, sulfur dioxide/water equilibria, the evidence for heterogeneous catalysis in the atmosphere, the importance of heterogeneous processes to tropospheric chemistry, soot-catalyzed atmospheric reactions, and the concentrations and mechanisms of formation of sulfate in the atmospheric boundary layer.

  3. Stability of Heterogeneous Ecosystem

    NASA Astrophysics Data System (ADS)

    Liu, Yang-Yu; Yan, Gang; Barabasi, Alber-Laszlo

    2014-03-01

    Stability of ecosystem measures the tendency of a community to return to equilibrium after environmental perturbation, which is severely constrained by the underlying network structure. Despite significant advances in uncovering the relationship between stability and network structure, little attention has been paid to the impact of the degree heterogeneity that exists in real ecosystems. Here we show that for networks with mixed interactions of competition and mutualism the degree heterogeneity always destabilizes the ecosystem. Surprisingly, for predator-prey interactions (e.g., food webs) high heterogeneity is destabilizing yet moderate heterogeneity is stabilizing. These findings deepen our understanding of the stability of real ecosystems and may also have implications in studying the stability of more general complex dynamical systems.

  4. Heterogeneous atmospheric chemistry

    NASA Technical Reports Server (NTRS)

    Schryer, D. R.

    1982-01-01

    The present conference on heterogeneous atmospheric chemistry considers such topics concerning clusters, particles and microparticles as common problems in nucleation and growth, chemical kinetics, and catalysis, chemical reactions with aerosols, electron beam studies of natural and anthropogenic microparticles, and structural studies employing molecular beam techniques, as well as such gas-solid interaction topics as photoassisted reactions, catalyzed photolysis, and heterogeneous catalysis. Also discussed are sulfur dioxide absorption, oxidation, and oxidation inhibition in falling drops, sulfur dioxide/water equilibria, the evidence for heterogeneous catalysis in the atmosphere, the importance of heterogeneous processes to tropospheric chemistry, soot-catalyzed atmospheric reactions, and the concentrations and mechanisms of formation of sulfate in the atmospheric boundary layer.

  5. Towards heterogeneous distributed debugging

    SciTech Connect

    Damodaran-Kamal, S.K.

    1995-04-01

    Several years of research and development in parallel debugger design have given up several techniques, though implemented in a wide range of tools for an equally wide range of systems. This paper is an evaluation of these myriad techniques as applied to the design of a heterogeneous distributed debugger. The evaluation is based on what features users perceive as useful, as well as the ease of implementation of the features using the available technology. A preliminary architecture for such a heterogeneous tool is proposed. Our effort in this paper is significantly different from the other efforts at creating portable and heterogeneous distributed debuggers in that we concentrate on support for all the important issues in parallel debugging, instead of simply concentrating on portability and heterogeneity.

  6. Heterogeneous basic catalysis

    SciTech Connect

    Hattori, Hideshi

    1995-05-01

    Heterogeneous acid catalysis attracted much attention primarily because heterogeneous acidic catalysts act as catalysts in petroleum refinery and are known as a main catalyst in the cracking process which is the largest process among the industrial chemical processes. In contrast to these extensive studies of heterogeneous acidic catalysts, fewer efforts have been given to the study of heterogeneous basic catalysts. The types of heterogeneous basic catalysts are listed in Table 1. Except for non-oxide catalysts, the basic sites are believed to be surface O atoms. The studies of heterogeneous catalysis have been continuous and progressed steadily. They have never been reviewed in the chemical Reviews before. It is more useful and informative to describe the studies of heterogeneous basic catalysis performed for a long period. In the present article, therefore, the cited papers are not restricted to those published recently, but include those published for the last 25 years. The paper first describes the generation of basic sites before describing methods used in the characterization of basic surfaces. These are indicator methods, temperature programmed desorption (TPD) of CO{sub 2}, UV absorption and luminescence spectroscopies, TPD of H{sub 2}, XPS, IR of CO{sub 2}, IR of pyrrole, and oxygen exchange between CO{sub 2} and the surface. The paper then discusses studies on the catalysis by heterogeneous basic catalysts. Some of these reactions are dehydration, dehydrogenation, hydrogenation, amination, alkylation, ring transformation, and reactions of organosilanes. Catalysts discussed are single component metal oxides, zeolites, non-oxide types, and superbasic catalysts. 141 refs.

  7. Characterization of Paper Heterogeneity

    NASA Astrophysics Data System (ADS)

    Considine, John M.

    Paper and paperboard are the most widely-used green materials in the world because they are renewable, recyclable, reusable, and compostable. Continued and expanded use of these materials and their potential use in new products requires a comprehensive understanding of the variability of their mechanical properties. This work develops new methods to characterize the mechanical properties of heterogeneous materials through a combination of techniques in experimental mechanics, materials science and numerical analysis. Current methods to analyze heterogeneous materials focus on crystalline materials or polymer-crystalline composites, where material boundaries are usually distinct. This work creates a methodology to analyze small, continuously-varying stiffness gradients in 100% polymer systems and is especially relevant to paper materials where factors influencing heterogeneity include local mass, fiber orientation, individual pulp fiber properties, local density, and drying restraint. A unique approach was used to understand the effect of heterogeneity on paper tensile strength. Additional variation was intentionally introduced, in the form of different size holes, and their effect on strength was measured. By modifying two strength criteria, an estimate of strength in the absence of heterogeneity was determined. In order to characterize stiffness heterogeneity, a novel load fixture was developed to excite full-field normal and shear strains for anisotropic stiffness determination. Surface strains were measured with digital image correlation and were analyzed with the VFM (Virtual Fields Method). This approach led to VFM-identified stiffnesses that were similar to values determined by conventional tests. The load fixture and VFM analyses were used to measure local stiffness and local stiffness variation on heterogeneous anisotropic materials. The approach was validated on simulated heterogeneous materials and was applied experimentally to three different paperboards

  8. Heterogeneity in breast cancer.

    PubMed

    Polyak, Kornelia

    2011-10-01

    Breast cancer is a heterogeneous disease. There is a high degree of diversity between and within tumors as well as among cancer-bearing individuals, and all of these factors together determine the risk of disease progression and therapeutic resistance. Advances in technologies such as whole-genome sequencing and functional viability screens now allow us to analyze tumors at unprecedented depths. However, translating this increasing knowledge into clinical practice remains a challenge in part due to tumor evolution driven by the diversity of cancer cell populations and their microenvironment. The articles in this Review series discuss recent advances in our understanding of breast tumor heterogeneity, therapies tailored based on this knowledge, and future ways of assessing and treating heterogeneous tumors.

  9. Monocyte and macrophage heterogeneity.

    PubMed

    Gordon, Siamon; Taylor, Philip R

    2005-12-01

    Heterogeneity of the macrophage lineage has long been recognized and, in part, is a result of the specialization of tissue macrophages in particular microenvironments. Circulating monocytes give rise to mature macrophages and are also heterogeneous themselves, although the physiological relevance of this is not completely understood. However, as we discuss here, recent studies have shown that monocyte heterogeneity is conserved in humans and mice, allowing dissection of its functional relevance: the different monocyte subsets seem to reflect developmental stages with distinct physiological roles, such as recruitment to inflammatory lesions or entry to normal tissues. These advances in our understanding have implications for the development of therapeutic strategies that are targeted to modify particular subpopulations of monocytes.

  10. Spatial heterogeneity in medulloblastoma.

    PubMed

    Morrissy, A Sorana; Cavalli, Florence M G; Remke, Marc; Ramaswamy, Vijay; Shih, David J H; Holgado, Borja L; Farooq, Hamza; Donovan, Laura K; Garzia, Livia; Agnihotri, Sameer; Kiehna, Erin N; Mercier, Eloi; Mayoh, Chelsea; Papillon-Cavanagh, Simon; Nikbakht, Hamid; Gayden, Tenzin; Torchia, Jonathon; Picard, Daniel; Merino, Diana M; Vladoiu, Maria; Luu, Betty; Wu, Xiaochong; Daniels, Craig; Horswell, Stuart; Thompson, Yuan Yao; Hovestadt, Volker; Northcott, Paul A; Jones, David T W; Peacock, John; Wang, Xin; Mack, Stephen C; Reimand, Jüri; Albrecht, Steffen; Fontebasso, Adam M; Thiessen, Nina; Li, Yisu; Schein, Jacqueline E; Lee, Darlene; Carlsen, Rebecca; Mayo, Michael; Tse, Kane; Tam, Angela; Dhalla, Noreen; Ally, Adrian; Chuah, Eric; Cheng, Young; Plettner, Patrick; Li, Haiyan I; Corbett, Richard D; Wong, Tina; Long, William; Loukides, James; Buczkowicz, Pawel; Hawkins, Cynthia E; Tabori, Uri; Rood, Brian R; Myseros, John S; Packer, Roger J; Korshunov, Andrey; Lichter, Peter; Kool, Marcel; Pfister, Stefan M; Schüller, Ulrich; Dirks, Peter; Huang, Annie; Bouffet, Eric; Rutka, James T; Bader, Gary D; Swanton, Charles; Ma, Yusanne; Moore, Richard A; Mungall, Andrew J; Majewski, Jacek; Jones, Steven J M; Das, Sunit; Malkin, David; Jabado, Nada; Marra, Marco A; Taylor, Michael D

    2017-04-10

    Spatial heterogeneity of transcriptional and genetic markers between physically isolated biopsies of a single tumor poses major barriers to the identification of biomarkers and the development of targeted therapies that will be effective against the entire tumor. We analyzed the spatial heterogeneity of multiregional biopsies from 35 patients, using a combination of transcriptomic and genomic profiles. Medulloblastomas (MBs), but not high-grade gliomas (HGGs), demonstrated spatially homogeneous transcriptomes, which allowed for accurate subgrouping of tumors from a single biopsy. Conversely, somatic mutations that affect genes suitable for targeted therapeutics demonstrated high levels of spatial heterogeneity in MB, malignant glioma, and renal cell carcinoma (RCC). Actionable targets found in a single MB biopsy were seldom clonal across the entire tumor, which brings the efficacy of monotherapies against a single target into question. Clinical trials of targeted therapies for MB should first ensure the spatially ubiquitous nature of the target mutation.

  11. Cancer heterogeneity and imaging.

    PubMed

    O'Connor, James P B

    2016-10-04

    There is interest in identifying and quantifying tumor heterogeneity at the genomic, tissue pathology and clinical imaging scales, as this may help better understand tumor biology and may yield useful biomarkers for guiding therapy-based decision making. This review focuses on the role and value of using x-ray, CT, MRI and PET based imaging methods that identify, measure and map tumor heterogeneity. In particular we highlight the potential value of these techniques and the key challenges required to validate and qualify these biomarkers for clinical use.

  12. Why does heterogeneity matter?

    Treesearch

    K.B. Pierce

    2007-01-01

    This is a review of the book "Ecosystem function in heterogeneous landscapes" published in 2005. The authors are G. Lovett, C. Jones, M.G. Turner, and K.C. Weathers. It was published by Springer, New York. The book is a synthesis of the 10th Gary conference held at the Institute of Ecosystem Studies in Millbrook, New York, in 2003.

  13. Heterogeneous waste processing

    DOEpatents

    Vanderberg, Laura A.; Sauer, Nancy N.; Brainard, James R.; Foreman, Trudi M.; Hanners, John L.

    2000-01-01

    A combination of treatment methods are provided for treatment of heterogeneous waste including: (1) treatment for any organic compounds present; (2) removal of metals from the waste; and, (3) bulk volume reduction, with at least two of the three treatment methods employed and all three treatment methods emplyed where suitable.

  14. Heterogeneous Uncertainty Management

    DTIC Science & Technology

    2008-03-08

    probabilistic ( HTP ) agents, the concept of probabilistic version of XML and RDF, and probabilistic methods to reason about collections of moving objects. S...heterogeneous temporal probabilistic ( HTP ) agents, the concept of probabilistic version of XML and RDF, and probabilistic methods to reason about...temporal probabilistic ( HTP ) agent. HTP agents can build temporal probabilistic reasoning capabilities on top of multiple databases and software

  15. Nuclear targeting peptide scaffolds for lipofection of nondividing mammalian cells.

    PubMed

    Subramanian, A; Ranganathan, P; Diamond, S L

    1999-09-01

    Lipofection of nondividing cells is inefficient because much of the transfected DNA is retained in endosomes, and that which escapes to the cytoplasm enters the nucleus at low rates. To improve the final rate-limiting step of nuclear import, we conjugated a nonclassical nuclear localization signal (NLS) containing the M9 sequence of heterogeneous nuclear ribonucleoprotein (hnRNP) A1, to a cationic peptide scaffold derived from a scrambled sequence of the SV40 T-antigen consensus NLS (ScT). The ScT was added to improve DNA binding of the M9 sequence. Lipofection of confluent endothelium with plasmid complexed with the M9-ScT conjugate resulted in 83% transfection and a 63-fold increase in marker gene expression. The M9-ScT conjugate localized fluorescent plasmid into the nucleus of permeabilized cells, and addition of the nuclear pore blocker wheat germ agglutinin prevented nuclear import. This method of gene transfer may lead to viral- and lipid-free transfection of nondividing cells.

  16. Scales of mantle heterogeneity

    NASA Astrophysics Data System (ADS)

    Moore, J. C.; Akber-Knutson, S.; Konter, J.; Kellogg, J.; Hart, S.; Kellogg, L. H.; Romanowicz, B.

    2004-12-01

    A long-standing question in mantle dynamics concerns the scale of heterogeneity in the mantle. Mantle convection tends to both destroy (through stirring) and create (through melt extraction and subduction) heterogeneity in bulk and trace element composition. Over time, these competing processes create variations in geochemical composition along mid-oceanic ridges and among oceanic islands, spanning a range of scales from extremely long wavelength (for example, the DUPAL anomaly) to very small scale (for example, variations amongst melt inclusions). While geochemical data and seismic observations can be used to constrain the length scales of mantle heterogeneity, dynamical mixing calculations can illustrate the processes and timescales involved in stirring and mixing. At the Summer 2004 CIDER workshop on Relating Geochemical and Seismological Heterogeneity in the Earth's Mantle, an interdisciplinary group evaluated scales of heterogeneity in the Earth's mantle using a combined analysis of geochemical data, seismological data and results of numerical models of mixing. We mined the PetDB database for isotopic data from glass and whole rock analyses for the Mid-Atlantic Ridge (MAR) and the East Pacific Rise (EPR), projecting them along the ridge length. We examined Sr isotope variability along the East Pacific rise by looking at the difference in Sr ratio between adjacent samples as a function of distance between the samples. The East Pacific Rise exhibits an overall bowl shape of normal MORB characteristics, with higher values in the higher latitudes (there is, however, an unfortunate gap in sampling, roughly 2000 km long). These background characteristics are punctuated with spikes in values at various locations, some, but not all of which are associated with off-axis volcanism. A Lomb-Scargle periodogram for unevenly spaced data was utilized to construct a power spectrum of the scale lengths of heterogeneity along both ridges. Using the same isotopic systems (Sr, Nd

  17. Inferring biological dynamics in heterogeneous cellular environments

    NASA Astrophysics Data System (ADS)

    Pressé, Steve

    In complex environments, it often appears that biomolecules such as proteins do not diffuse normally. That is, their mean square displacement does not scale linearly with time. This anomalous diffusion happens for multiple reasons: proteins can bind to structures and other proteins; fluorophores used to label proteins may flicker or blink making it appear that the labeled protein is diffusing anomalously; and proteins can diffuse in differently crowded environments. Here we describe methods for learning about such processes from imaging data collected inside the heterogeneous environment of the living cell. Refs.: ''Inferring Diffusional Dynamics from FCS in Heterogeneous Nuclear Environments'' Konstantinos Tsekouras, Amanda Siegel, Richard N. Day, Steve Pressé*, Biophys. J. , 109, 7 (2015). ''A data-driven alternative to the fractional Fokker-Planck equation'' Steve Pressé*, J. Stat. Phys.: Th. and Expmt. , P07009 (2015).

  18. Nuclear Chemistry.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1979

    1979-01-01

    Provides a brief review of the latest developments in nuclear chemistry. Nuclear research today is directed toward increased activity in radiopharmaceuticals and formation of new isotopes by high-energy, heavy-ion collisions. (Author/BB)

  19. Nuclear Scans

    MedlinePlus

    Nuclear scans use radioactive substances to see structures and functions inside your body. They use a special ... images. Most scans take 20 to 45 minutes. Nuclear scans can help doctors diagnose many conditions, including ...

  20. Nuclear Winter.

    ERIC Educational Resources Information Center

    Ehrlich, Anne

    1984-01-01

    "Nuclear Winter" was recently coined to describe the climatic and biological effects of a nuclear war. These effects are discussed based on models, simulations, scenarios, and projections. Effects on human populations are also considered. (JN)

  1. Nuclear Medicine

    MedlinePlus

    ... Home » Science Education » Science Topics » Nuclear Medicine SCIENCE EDUCATION SCIENCE EDUCATION Science Topics Resource Links for General Public Resource ... Related Documents: Nuclear Medicine Fact Sheet.pdf SCIENCE EDUCATION Science Topics Resource Links for General Public Resource ...

  2. Nuclear Chemistry.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1979

    1979-01-01

    Provides a brief review of the latest developments in nuclear chemistry. Nuclear research today is directed toward increased activity in radiopharmaceuticals and formation of new isotopes by high-energy, heavy-ion collisions. (Author/BB)

  3. Nuclear Winter.

    ERIC Educational Resources Information Center

    Ehrlich, Anne

    1984-01-01

    "Nuclear Winter" was recently coined to describe the climatic and biological effects of a nuclear war. These effects are discussed based on models, simulations, scenarios, and projections. Effects on human populations are also considered. (JN)

  4. Nuclear weapons, nuclear effects, nuclear war

    SciTech Connect

    Bing, G.F.

    1991-08-20

    This paper provides a brief and mostly non-technical description of the militarily important features of nuclear weapons, of the physical phenomena associated with individual explosions, and of the expected or possible results of the use of many weapons in a nuclear war. Most emphasis is on the effects of so-called ``strategic exchanges.``

  5. Nuclear Fuels.

    ERIC Educational Resources Information Center

    Nash, J. Thomas

    1983-01-01

    Trends in and factors related to the nuclear industry and nuclear fuel production are discussed. Topics addressed include nuclear reactors, survival of the U.S. uranium industry, production costs, budget cuts by the Department of Energy and U.S. Geological survey for resource studies, mining, and research/development activities. (JN)

  6. Nuclear Fuels.

    ERIC Educational Resources Information Center

    Nash, J. Thomas

    1983-01-01

    Trends in and factors related to the nuclear industry and nuclear fuel production are discussed. Topics addressed include nuclear reactors, survival of the U.S. uranium industry, production costs, budget cuts by the Department of Energy and U.S. Geological survey for resource studies, mining, and research/development activities. (JN)

  7. Heterogeneity of monoclonal antibodies.

    PubMed

    Liu, Hongcheng; Gaza-Bulseco, Georgeen; Faldu, Dinesh; Chumsae, Chris; Sun, Joanne

    2008-07-01

    Heterogeneity of monoclonal antibodies is common due to the various modifications introduced over the lifespan of the molecules from the point of synthesis to the point of complete clearance from the subjects. The vast number of modifications presents great challenge to the thorough characterization of the molecules. This article reviews the current knowledge of enzymatic and nonenzymatic modifications of monoclonal antibodies including the common ones such as incomplete disulfide bond formation, glycosylation, N-terminal pyroglutamine cyclization, C-terminal lysine processing, deamidation, isomerization, and oxidation, and less common ones such as modification of the N-terminal amino acids by maleuric acid and amidation of the C-terminal amino acid. In addition, noncovalent associations with other molecules, conformational diversity and aggregation of monoclonal antibodies are also discussed. Through a complete understanding of the heterogeneity of monoclonal antibodies, strategies can be employed to better identify the potential modifications and thoroughly characterize the molecules.

  8. Heterogeneities in granular dynamics

    PubMed Central

    Mehta, A.; Barker, G. C.; Luck, J. M.

    2008-01-01

    The absence of Brownian motion in granular media is a source of much complexity, including the prevalence of heterogeneity, whether static or dynamic, within a given system. Such strong heterogeneities can exist as a function of depth in a box of grains; this is the system we study here. First, we present results from three-dimensional, cooperative and stochastic Monte Carlo shaking simulations of spheres on heterogeneous density fluctuations. Next, we juxtapose these with results obtained from a theoretical model of a column of grains under gravity; frustration via competing local fields is included in our model, whereas the effect of gravity is to slow down the dynamics of successively deeper layers. The combined conclusions suggest that the dynamics of a real granular column can be divided into different phases—ballistic, logarithmic, activated, and glassy—as a function of depth. The nature of the ground states and their retrieval (under zero-temperature dynamics) is analyzed; the glassy phase shows clear evidence of its intrinsic (“crystalline”) states, which lie below a band of approximately degenerate ground states. In the other three phases, by contrast, the system jams into a state chosen randomly from this upper band of metastable states. PMID:18541918

  9. Nuclear Pasta

    NASA Astrophysics Data System (ADS)

    da Silva Schneider, Andre; Horowitz, Charles; Berry, Don; Briggs, Christian

    2014-03-01

    For decades it has been theorized that just below nuclear saturation density matter undergoes a series of phase transitions. These phases, which are expected to exist in core-collapse supernovae and neutron stars, involve a range of exotic nuclear shapes collectively known as nuclear pasta. Recently, Jose Pons and collaborators suggested that ``the maximum period of isolated X-ray pulsars may be the first observational evidence for an amorphous inner crust, ..., possibly owing to the existence of a nuclear pasta phase.'' In this talk we present results of semi-classical molecular dynamics simulations of nuclear pasta and discuss how each phase might contribute to neutron star crust properties.

  10. Nuclear orientation and nuclear structure

    SciTech Connect

    Krane, K.S.

    1988-01-01

    The present generation of on-line nuclear orientation facilities promises to revolutionize the gathering of nuclear structure information, especially for the hitherto poorly known and understood nuclei far from stability. Following a brief review of the technological developments that have facilitated these experiments, the nuclear spectroscopic information that can be obtained is summarized. Applications to understanding nuclear structure are reviewed, and challenges for future studies are discussed. 14 refs., 4 figs., 3 tabs.

  11. Nuclear networking.

    PubMed

    Xie, Wei; Burke, Brian

    2017-07-04

    Nuclear lamins are intermediate filament proteins that represent important structural components of metazoan nuclear envelopes (NEs). By combining proteomics and superresolution microscopy, we recently reported that both A- and B-type nuclear lamins form spatially distinct filament networks at the nuclear periphery of mouse fibroblasts. In particular, A-type lamins exhibit differential association with nuclear pore complexes (NPCs). Our studies reveal that the nuclear lamina network in mammalian somatic cells is less ordered and more complex than that of amphibian oocytes, the only other system in which the lamina has been visualized at high resolution. In addition, the NPC component Tpr likely links NPCs to the A-type lamin network, an association that appears to be regulated by C-terminal modification of various A-type lamin isoforms. Many questions remain, however, concerning the structure and assembly of lamin filaments, as well as with their mode of association with other nuclear components such as peripheral chromatin.

  12. Unravelling mononuclear phagocyte heterogeneity

    PubMed Central

    Geissmann, Frédéric; Gordon, Siamon; Hume, David A.; Mowat, Allan M.; Randolph, Gwendalyn J.

    2011-01-01

    When Ralph Steinman and Zanvil Cohn first described dendritic cells (DCs) in 1973 it took many years to convince the immunology community that these cells were truly distinct from macrophages. Almost four decades later, the DC is regarded as the key initiator of adaptive immune responses; however, distinguishing DCs from macrophages still leads to confusion and debate in the field. Here, Nature Reviews Immunology asks five experts to discuss the issue of heterogeneity in the mononuclear phagocyte system and to give their opinion on the importance of defining these cells for future research. PMID:20467425

  13. Intratumor Heterogeneity in Breast Cancer.

    PubMed

    Beca, Francisco; Polyak, Kornelia

    2016-01-01

    Intratumor heterogeneity is the main obstacle to effective cancer treatment and personalized medicine. Both genetic and epigenetic sources of intratumor heterogeneity are well recognized and several technologies have been developed for their characterization. With the technological advances in recent years, investigators are now elucidating intratumor heterogeneity at the single cell level and in situ. However, translating the accumulated knowledge about intratumor heterogeneity to clinical practice has been slow. We are certain that better understanding of the composition and evolution of tumors during disease progression and treatment will improve cancer diagnosis and the design of therapies. Here we review some of the most important considerations related to intratumor heterogeneity. We discuss both genetic and epigenetic sources of intratumor heterogeneity and review experimental approaches that are commonly used to quantify it. We also discuss the impact of intratumor heterogeneity on cancer diagnosis and treatment and share our perspectives on the future of this field.

  14. {sup 48}Ca HETEROGENEITY IN DIFFERENTIATED METEORITES

    SciTech Connect

    Chen, Hsin-Wei; Lee, Typhoon; Lee, Der-Chuen; Shen, Jason Jiun-San; Chen, Jiang-Chang

    2011-12-10

    Isotopic heterogeneities of {sup 48}Ca have been found in numerous bulk meteorites that are correlated with {sup 50}Ti and {sup 54}Cr anomalies among differentiated planetary bodies, and the results suggest that a rare subset of neutron-rich Type Ia supernova (nSN Ia) was responsible for contributing these neutron-rich iron-group isotopes into the solar system (SS). The heterogeneity of these isotopes found in differentiated meteorites indicates that the isotopic compositions of the bulk SS are not uniform, and there are significant amounts of nSNe Ia dust incompletely mixed with the rest of SS materials during planetary formation. Combined with the data of now-extinct short-lived nuclide {sup 60}Fe, which can be produced more efficiently from an nSN Ia than a Type II supernova ejecta, the observed planetary-scale isotopic heterogeneity probably reflects a late input of stellar dust grains with neutron-rich nuclear statistical equilibrium nuclides into the early SS.

  15. Nuclear Halos

    SciTech Connect

    Vogt, Erich

    2010-07-27

    We show that extreme nuclear halos are caused only by pairs of s-wave neutrons (or single s-wave neutrons) and that such states occur much more frequently in the periodic table than previously believed. Besides lingering long near zero neutron separation energy such extreme halos have very remarkable properties: they can contribute significantly to the nuclear density at more than twice the normal nuclear radius and their spreading width can be very narrow. The properties of these states are primarily determined by the ''thickness'' of the nuclear surface in the mean-free nuclear potential and thus their importance increases greatly as we approach the neutron drip line. We discuss what such extreme halos are, where they occur, what their properties are and some of their impact on nuclear observations.

  16. Nuclear astrophysics

    SciTech Connect

    Haxton, W.C.

    1992-01-01

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized.

  17. Nuclear astrophysics

    SciTech Connect

    Haxton, W.C.

    1992-12-31

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized.

  18. Nuclear Fission

    NASA Astrophysics Data System (ADS)

    Denschlag, J. O.

    This chapter first gives a survey on the history of the discovery of nuclear fission. It briefly presents the liquid-drop and shell models and their application to the fission process. The most important quantities accessible to experimental determination such as mass yields, nuclear charge distribution, prompt neutron emission, kinetic energy distribution, ternary fragment yields, angular distributions, and properties of fission isomers are presented as well as the instrumentation and techniques used for their measurement. The contribution concentrates on the fundamental aspects of nuclear fission. The practical aspects of nuclear fission are discussed in http://dx.doi.org/10.1007/978-1-4419-0720-2_57 of Vol. 6.

  19. Nuclear Safety

    SciTech Connect

    Silver, E G

    1989-01-01

    This document is a review journal that covers significant developments in the field of nuclear safety. Its scope includes the analysis and control of hazards associated with nuclear energy, operations involving fissionable materials, and the products of nuclear fission and their effects on the environment. Primary emphasis is on safety in reactor design, construction, and operation; however, the safety aspects of the entire fuel cycle, including fuel fabrication, spent-fuel processing, nuclear waste disposal, handling of radioisotopes, and environmental effects of these operations, are also treated.

  20. Heterogeneity in tuberculosis.

    PubMed

    Cadena, Anthony M; Fortune, Sarah M; Flynn, JoAnne L

    2017-07-24

    Infection with Mycobacterium tuberculosis, the causative agent of tuberculosis (TB), results in a range of clinical presentations in humans. Most infections manifest as a clinically asymptomatic, contained state that is termed latent TB infection (LTBI); a smaller subset of infected individuals present with symptomatic, active TB. Within these two seemingly binary states, there is a spectrum of host outcomes that have varying symptoms, microbiologies, immune responses and pathologies. Recently, it has become apparent that there is diversity of infection even within a single individual. A good understanding of the heterogeneity that is intrinsic to TB - at both the population level and the individual level - is crucial to inform the development of intervention strategies that account for and target the unique, complex and independent nature of the local host-pathogen interactions that occur in this infection. In this Review, we draw on model systems and human data to discuss multiple facets of TB biology and their relationship to the overall heterogeneity observed in the human disease.

  1. Heterogeneity of reactive astrocytes

    PubMed Central

    Anderson, Mark A.; Ao, Yan; Sofroniew, Michael V.

    2014-01-01

    Astrocytes respond to injury and disease in the central nervous system (CNS) with a process referred to as reactive astrogliosis. Recent progress demonstrates that reactive astrogliosis is not a simple all-or-none phenomenon, but is a finely gradated continuum of changes that range from reversible alterations in gene expression and cell hypertrophy, to scar formation with permanent tissue rearrangement. There is now compelling evidence that reactive astrocytes exhibit a substantial potential for heterogeneity at multiple levels, including gene expression, cell morphology, topography (distance from lesions), CNS regions, local (among neighboring cells), cell signaling and cell function. Structural and functional changes are regulated in reactive astrocytes by many different potential signaling events that occur in a context dependent manner. It is noteworthy that different stimuli of astrocyte reactivity can lead to similar degrees of GFAP upregulation while causing substantially different changes in transcriptome profiles and cell function. Thus, it is not possible to equate simple and uniform measures such as cell hypertrophy and upregulation of GFAP expression with a single, uniform concept of astrocyte reactivity. Instead, it is necessary to recognize the considerable potential for heterogeneity and determine the functional implications of astrocyte reactivity in a context specific manner as regulated by specific signaling events. PMID:24361547

  2. Heterogeneous photonic integrated circuits

    NASA Astrophysics Data System (ADS)

    Fang, Alexander W.; Fish, Gregory; Hall, Eric

    2012-01-01

    Photonic Integrated Circuits (PICs) have been dichotomized into circuits with high passive content (silica and silicon PLCs) and high active content (InP tunable lasers and transceivers) due to the trade-off in material characteristics used within these two classes. This has led to restrictions in the adoption of PICs to systems in which only one of the two classes of circuits are required to be made on a singular chip. Much work has been done to create convergence in these two classes by either engineering the materials to achieve the functionality of both device types on a single platform, or in epitaxial growth techniques to transfer one material to the next, but have yet to demonstrate performance equal to that of components fabricated in their native substrates. Advances in waferbonding techniques have led to a new class of heterogeneously integrated photonic circuits that allow for the concurrent use of active and passive materials within a photonic circuit, realizing components on a transferred substrate that have equivalent performance as their native substrate. In this talk, we review and compare advances made in heterogeneous integration along with demonstrations of components and circuits enabled by this technology.

  3. Disordered hyperuniform heterogeneous materials.

    PubMed

    Torquato, Salvatore

    2016-10-19

    Disordered hyperuniform many-body systems are distinguishable states of matter that lie between a crystal and liquid: they are like perfect crystals in the way they suppress large-scale density fluctuations and yet are like liquids or glasses in that they are statistically isotropic with no Bragg peaks. These systems play a vital role in a number of fundamental and applied problems: glass formation, jamming, rigidity, photonic and electronic band structure, localization of waves and excitations, self-organization, fluid dynamics, quantum systems, and pure mathematics. Much of what we know theoretically about disordered hyperuniform states of matter involves many-particle systems. In this paper, we derive new rigorous criteria that disordered hyperuniform two-phase heterogeneous materials must obey and explore their consequences. Two-phase heterogeneous media are ubiquitous; examples include composites and porous media, biological media, foams, polymer blends, granular media, cellular solids, and colloids. We begin by obtaining some results that apply to hyperuniform two-phase media in which one phase is a sphere packing in d-dimensional Euclidean space [Formula: see text]. Among other results, we rigorously establish the requirements for packings of spheres of different sizes to be 'multihyperuniform'. We then consider hyperuniformity for general two-phase media in [Formula: see text]. Here we apply realizability conditions for an autocovariance function and its associated spectral density of a two-phase medium, and then incorporate hyperuniformity as a constraint in order to derive new conditions. We show that some functional forms can immediately be eliminated from consideration and identify other forms that are allowable. Specific examples and counterexamples are described. Contact is made with well-known microstructural models (e.g. overlapping spheres and checkerboards) as well as irregular phase-separation and Turing-type patterns. We also ascertain a family

  4. Disordered hyperuniform heterogeneous materials

    NASA Astrophysics Data System (ADS)

    Torquato, Salvatore

    2016-10-01

    Disordered hyperuniform many-body systems are distinguishable states of matter that lie between a crystal and liquid: they are like perfect crystals in the way they suppress large-scale density fluctuations and yet are like liquids or glasses in that they are statistically isotropic with no Bragg peaks. These systems play a vital role in a number of fundamental and applied problems: glass formation, jamming, rigidity, photonic and electronic band structure, localization of waves and excitations, self-organization, fluid dynamics, quantum systems, and pure mathematics. Much of what we know theoretically about disordered hyperuniform states of matter involves many-particle systems. In this paper, we derive new rigorous criteria that disordered hyperuniform two-phase heterogeneous materials must obey and explore their consequences. Two-phase heterogeneous media are ubiquitous; examples include composites and porous media, biological media, foams, polymer blends, granular media, cellular solids, and colloids. We begin by obtaining some results that apply to hyperuniform two-phase media in which one phase is a sphere packing in d-dimensional Euclidean space {{{R}}d} . Among other results, we rigorously establish the requirements for packings of spheres of different sizes to be ‘multihyperuniform’. We then consider hyperuniformity for general two-phase media in {{{R}}d} . Here we apply realizability conditions for an autocovariance function and its associated spectral density of a two-phase medium, and then incorporate hyperuniformity as a constraint in order to derive new conditions. We show that some functional forms can immediately be eliminated from consideration and identify other forms that are allowable. Specific examples and counterexamples are described. Contact is made with well-known microstructural models (e.g. overlapping spheres and checkerboards) as well as irregular phase-separation and Turing-type patterns. We also ascertain a family of

  5. Nuclear heterogeneity in conidial populations of Aspergillus flavus

    USDA-ARS?s Scientific Manuscript database

    Aspergillus flavus is a major producer of aflatoxin and an opportunistic pathogen for a wide range of hosts. Understanding genotypic and phenotypic variations within strains of A. flavus is important for controlling disease and reducing aflatoxin contamination. A. flavus is multinucleate and predomi...

  6. Nuclear safety

    NASA Technical Reports Server (NTRS)

    Buden, D.

    1991-01-01

    Topics dealing with nuclear safety are addressed which include the following: general safety requirements; safety design requirements; terrestrial safety; SP-100 Flight System key safety requirements; potential mission accidents and hazards; key safety features; ground operations; launch operations; flight operations; disposal; safety concerns; licensing; the nuclear engine for rocket vehicle application (NERVA) design philosophy; the NERVA flight safety program; and the NERVA safety plan.

  7. Nuclear privatization

    SciTech Connect

    Jeffs, E.

    1995-11-01

    The United Kingdom government announced in May 1995 plans to privatize the country`s two nuclear generating companies, Nuclear Electric and Scottish Nuclear. Under the plan, the two companies will become operating divisions of a unified holding company, to be called British Electric, with headquarters in Scotland. Britain`s nuclear plants were left out of the initial privatization in 1989 because the government believed the financial community would be unwilling to accept the open-ended liability of decommissioning the original nine stations based on the Magnox gas-cooled reactor. Six years later, the government has found a way around this by retaining these power stations in state ownership, leaving the new nuclear company with the eight Advanced Gas-cooled Reactor (AGR) stations and the recently completed Sizewell B PWR stations. The operating Magnox stations are to be transferred to BNFL, which operates two Magnox stations of their own at Calder Hall and Chapelcross.

  8. Nuclear materials

    SciTech Connect

    Not Available

    1992-08-01

    The Department of Energy (DOE) processes plutonium for use in nuclear weapons. This fact sheet responds to your September 6, 1991, request, that we describe the methods and facilities for DOE's plutonium processing. Plutonium, which is used to make nuclear weapons, does not exist in nature and has to be produced. However, DOE no longer produces plutonium for use in nuclear weapons. Instead, DOE processes and recycles the plutonium from retired nuclear weapons and the plutonium that remains as scrap or residue from plutonium processing. This paper reports that DOE recovers plutonium through two basic processes-aqueous and pyrochemical-at four processing sites-Rocky Flats, Savannah River, Hanford, and Los Alamos. However, because of environmental and safety concerns and reductions in nuclear weapons, DOE has closed or may close most of the processing facilities. Only Los Alamos' processing facilities are currently operating.

  9. Population heterogeneity and causal inference.

    PubMed

    Xie, Yu

    2013-04-16

    Population heterogeneity is ubiquitous in social science. The very objective of social science research is not to discover abstract and universal laws but to understand population heterogeneity. Due to population heterogeneity, causal inference with observational data in social science is impossible without strong assumptions. Researchers have long been concerned with two potential sources of bias. The first is bias in unobserved pretreatment factors affecting the outcome even in the absence of treatment. The second is bias due to heterogeneity in treatment effects. In this article, I show how "composition bias" due to population heterogeneity evolves over time when treatment propensity is systematically associated with heterogeneous treatment effects. A form of selection bias, composition bias, arises dynamically at the aggregate level even when the classic assumption of ignorability holds true at the microlevel.

  10. Population heterogeneity and causal inference

    PubMed Central

    Xie, Yu

    2013-01-01

    Population heterogeneity is ubiquitous in social science. The very objective of social science research is not to discover abstract and universal laws but to understand population heterogeneity. Due to population heterogeneity, causal inference with observational data in social science is impossible without strong assumptions. Researchers have long been concerned with two potential sources of bias. The first is bias in unobserved pretreatment factors affecting the outcome even in the absence of treatment. The second is bias due to heterogeneity in treatment effects. In this article, I show how “composition bias” due to population heterogeneity evolves over time when treatment propensity is systematically associated with heterogeneous treatment effects. A form of selection bias, composition bias, arises dynamically at the aggregate level even when the classic assumption of ignorability holds true at the microlevel. PMID:23530202

  11. Heterogeneity in Waardenburg syndrome.

    PubMed Central

    Hageman, M J; Delleman, J W

    1977-01-01

    Heterogeneity of Waardenburg syndrome is demonstrated in a review of 1,285 patients from the literature and 34 previously unreported patients in five families in the Netherlands. The syndrome seems to consist of two genetically distinct entities that can be differentiated clinically: type I, Waardenburg syndrome with dystopia canthorum; and type II, Waardenburg syndrome without dystopia canthorum. Both types have an autosomal dominant mode of inheritance. The incidence of bilateral deafness in the two types of the syndrome was found in one-fourth with type I and about half of the patients with type II. This difference has important consequences for genetic counseling. Images Fig. 7 Fig. 8 Fig. 9 PMID:331943

  12. Ventilation heterogeneity in obesity.

    PubMed

    Pellegrino, Riccardo; Gobbi, Alessandro; Antonelli, Andrea; Torchio, Roberto; Gulotta, Carlo; Pellegrino, Giulia Michela; Dellacà, Raffaele; Hyatt, Robert E; Brusasco, Vito

    2014-05-01

    Obesity is associated with important decrements in lung volumes. Despite this, ventilation remains normally or near normally distributed at least for moderate decrements in functional residual capacity (FRC). We tested the hypothesis that this is because maximum flow increases presumably as a result of an increased lung elastic recoil. Forced expiratory flows corrected for thoracic gas compression volume, lung volumes, and forced oscillation technique at 5-11-19 Hz were measured in 133 healthy subjects with a body mass index (BMI) ranging from 18 to 50 kg/m(2). Short-term temporal variability of ventilation heterogeneity was estimated from the interquartile range of the frequency distribution of the difference in inspiratory resistance between 5 and 19 Hz (R5-19_IQR). FRC % predicted negatively correlated with BMI (r = -0.72, P < 0.001) and with an increase in slope of either maximal (r = -0.34, P < 0.01) or partial flow-volume curves (r = -0.30, P < 0.01). Together with a slight decrease in residual volume, this suggests an increased lung elastic recoil. Regression analysis of R5-19_IQR against FRC % predicted and expiratory reserve volume (ERV) yielded significantly higher correlation coefficients by nonlinear than linear fitting models (r(2) = 0.40 vs. 0.30 for FRC % predicted and r(2) = 0.28 vs. 0.19 for ERV). In conclusion, temporal variability of ventilation heterogeneities increases in obesity only when FRC falls approximately below 65% of predicted or ERV below 0.6 liters. Above these thresholds distribution is quite well preserved presumably as a result of an increase in lung recoil.

  13. Heterogeneity and timing of translocation and membrane-mediated assembly of different annexins

    SciTech Connect

    Skrahina, Tatsiana; Piljic, Alen; Schultz, Carsten

    2008-03-10

    Many cell types, including neurons and epithelial cells, express a variety of annexins. Although the overall function has only been partially unravelled, a dominant feature is the formation of two-dimensional assemblies under the plasma membrane in a calcium-dependent manner. Here we show that fluorescently tagged annexins A1, A2, A4, A5, and A6 translocate and assemble at the plasma membrane and the nuclear envelope, except annexin A2, which only attaches to the plasma membrane. All annexins have different response times to elevated calcium levels as was shown by the translocation of co-expressed proteins. Fluorescence recovery after photobleaching revealed the static nature of all annexin assemblies. Analysis of the assemblies by Foerster resonance energy transfer (FRET) using acceptor bleaching demonstrated mostly annexin-specific self-assembly. Heterogeneous assembly formation was shown between annexins A5 and A1, and A5 and A2. The formation of homo- and heterogeneous annexin assemblies may play an important role when high increases in calcium occur, such as after disruption of the plasma membrane.

  14. Interconnecting heterogeneous database management systems

    NASA Technical Reports Server (NTRS)

    Gligor, V. D.; Luckenbaugh, G. L.

    1984-01-01

    It is pointed out that there is still a great need for the development of improved communication between remote, heterogeneous database management systems (DBMS). Problems regarding the effective communication between distributed DBMSs are primarily related to significant differences between local data managers, local data models and representations, and local transaction managers. A system of interconnected DBMSs which exhibit such differences is called a network of distributed, heterogeneous DBMSs. In order to achieve effective interconnection of remote, heterogeneous DBMSs, the users must have uniform, integrated access to the different DBMs. The present investigation is mainly concerned with an analysis of the existing approaches to interconnecting heterogeneous DBMSs, taking into account four experimental DBMS projects.

  15. Nuclear Speckles

    PubMed Central

    Spector, David L.; Lamond, Angus I.

    2011-01-01

    Nuclear speckles, also known as interchromatin granule clusters, are nuclear domains enriched in pre-mRNA splicing factors, located in the interchromatin regions of the nucleoplasm of mammalian cells. When observed by immunofluorescence microscopy, they usually appear as 20–50 irregularly shaped structures that vary in size. Speckles are dynamic structures, and their constituents can exchange continuously with the nucleoplasm and other nuclear locations, including active transcription sites. Studies on the composition, structure, and dynamics of speckles have provided an important paradigm for understanding the functional organization of the nucleus and the dynamics of the gene expression machinery. PMID:20926517

  16. Nuclear reprogramming.

    PubMed

    Halley-Stott, Richard P; Pasque, Vincent; Gurdon, J B

    2013-06-01

    There is currently particular interest in the field of nuclear reprogramming, a process by which the identity of specialised cells may be changed, typically to an embryonic-like state. Reprogramming procedures provide insight into many mechanisms of fundamental cell biology and have several promising applications, most notably in healthcare through the development of human disease models and patient-specific tissue-replacement therapies. Here, we introduce the field of nuclear reprogramming and briefly discuss six of the procedures by which reprogramming may be experimentally performed: nuclear transfer to eggs or oocytes, cell fusion, extract treatment, direct reprogramming to pluripotency and transdifferentiation.

  17. (Nuclear theory). [Research in nuclear physics

    SciTech Connect

    Haxton, W.

    1990-01-01

    This report discusses research in nuclear physics. Topics covered in this paper are: symmetry principles; nuclear astrophysics; nuclear structure; quark-gluon plasma; quantum chromodynamics; symmetry breaking; nuclear deformation; and cold fusion. (LSP)

  18. Shock initiation in heterogeneous explosives

    SciTech Connect

    Nunziato, J.W.; Kipp, M.E.; Setchell, R.E.; Walsh, E.K.

    1982-09-01

    It is generally accepted that the shock initiation of heterogeneous explosives begins with the formation of hot spots in the vicinity of microstructural defects such as voids, grain boundaries, and phase boundaries where there can be significant localized deformation as a result of material viscosity, plastic work, and intergranular friction. In this report, we describe this phenomenon in the context of a recently developed theory of chemically reacting, multiphase mixtures. In particular, we consider a granular explosive with an energetic binder (e.g. PBX-9404) and represent it as a three-phase, saturated mixture consisting of the granular reactant, the binder phase, and the product gases. Under dynamic loading, viscous dissipation results in high temperatures in the binder phase which subsequently thermally explodes to form product gases. Decomposition of the granular reactant is achieved by laminar grain burning. This model has been incorporated into a 1-D Lagrangian finite-difference code (WONDY) and the evolution of compressive shock and acceleration (ramp) waves have been calculated for PBX-9404. The calculated wave growth at the front, as well as the reaction-induced pressure wave behind the front, are shown to be in good agreement with experimental observations.

  19. Interference Management in Heterogeneous Networks

    DTIC Science & Technology

    2013-06-01

    INTERFERENCE MANAGEMENT IN HETEROGENEOUS NETWORKS UNIVERSITY OF MARYLAND JUNE 2013 FINAL TECHNICAL REPORT APPROVED...3. DATES COVERED (From - To) AUG 2011 – FEB 2013 4. TITLE AND SUBTITLE INTERFERENCE MANAGEMENT IN HETEROGENEOUS NETWORKS 5a. CONTRACT NUMBER...However, such deployments require efficient frequency allocation schemes for managing interference from the pico- and macro base stations that are

  20. Data manipulation in heterogeneous databases

    SciTech Connect

    Chatterjee, A.; Segev, A.

    1991-10-01

    Many important information systems applications require access to data stored in multiple heterogeneous databases. This paper examines a problem in inter-database data manipulation within a heterogeneous environment, where conventional techniques are no longer useful. To solve the problem, a broader definition for join operator is proposed. Also, a method to probabilistically estimate the accuracy of the join is discussed.

  1. Nuclear battlefields

    SciTech Connect

    Arkin, W.M.; Fieldhouse, R.W.

    1985-01-01

    This book provides complete data on the nuclear operations and research facilities in the U.S.A., the U.S.S.R., France, China and the U.K. It describes detailed estimates on the U.S.S.R.'s nuclear stockpile for over 500 locations. It shows how non-nuclear countries cooperate with the world-wide war machine. And it maps the U.S. nuclear facilities from Little America, WY, and Charleston, SC, to the battleships patroling the world's oceans and subs stalking under the sea. The data were gathered from unclassified sources through the Freedom of Information Act, from data supplied to military installations, and from weapons source books. It provides guidance for policymakers, government and corporate officials.

  2. NUCLEAR REACTOR

    DOEpatents

    Sherman, J.; Sharbaugh, J.E.; Fauth, W.L. Jr.; Palladino, N.J.; DeHuff, P.G.

    1962-10-23

    A nuclear reactor incorporating seed and blanket assemblies is designed. Means are provided for obtaining samples of the coolant from the blanket assemblies and for varying the flow of coolant through the blanket assemblies. (AEC)

  3. Nuclear Disarmament.

    ERIC Educational Resources Information Center

    Johnson, Christopher

    1982-01-01

    Material about nuclear disarmament and the arms race should be included in secondary school curricula. Teachers can present this technical, controversial, and frightening material in a balanced and comprehensible way. Resources for instructional materials are listed. (PP)

  4. Reference Point Heterogeneity

    PubMed Central

    Terzi, Ayse; Koedijk, Kees; Noussair, Charles N.; Pownall, Rachel

    2016-01-01

    It is well-established that, when confronted with a decision to be taken under risk, individuals use reference payoff levels as important inputs. The purpose of this paper is to study which reference points characterize decisions in a setting in which there are several plausible reference levels of payoff. We report an experiment, in which we investigate which of four potential reference points: (1) a population average payoff level, (2) the announced expected payoff of peers in a similar decision situation, (3) a historical average level of earnings that others have received in the same task, and (4) an announced anticipated individual payoff level, best describes decisions in a decontextualized risky decision making task. We find heterogeneity among individuals in the reference points they employ. The population average payoff level is the modal reference point, followed by experimenter's stated expectation of a participant's individual earnings, followed in turn by the average earnings of other participants in previous sessions of the same experiment. A sizeable share of individuals show multiple reference points simultaneously. The reference point that best fits the choices of the individual is not affected by a shock to her income. PMID:27672374

  5. Angiotensin II receptor heterogeneity

    SciTech Connect

    Herblin, W.F.; Chiu, A.T.; McCall, D.E.; Ardecky, R.J.; Carini, D.J.; Duncia, J.V.; Pease, L.J.; Wong, P.C.; Wexler, R.R.; Johnson, A.L. )

    1991-04-01

    The possibility of receptor heterogeneity in the angiotensin II (AII) system has been suggested previously, based on differences in Kd values or sensitivity to thiol reagents. One of the authors earliest indications was the frequent observation of incomplete inhibition of the binding of AII to adrenal cortical membranes. Autoradiographic studies demonstrated that all of the labeling of the rat adrenal was blocked by unlabeled AII or saralasin, but not by DuP 753. The predominant receptor in the rat adrenal cortex (80%) is sensitive to dithiothreitol (DTT) and DuP 753, and is designated AII-1. The residual sites in the adrenal cortex and almost all of the sites in the rat adrenal medulla are insensitive to both DTT and DuP 753, but were blocked by EXP655. These sites have been confirmed by ligand binding studies and are designated AII-2. The rabbit adrenal cortex is unique in yielding a nonuniform distribution of AII-2 sites around the outer layer of glomerulosa cells. In the rabbit kidney, the sites on the glomeruli are AII-1, but the sites on the kidney capsule are AII-2. Angiotensin III appears to have a higher affinity for AII-2 sites since it inhibits the binding to the rabbit kidney capsule but not the glomeruli. Elucidation of the distribution and function of these diverse sites should permit the development of more selective and specific therapeutic strategies.

  6. Heterogeneous recording media

    NASA Astrophysics Data System (ADS)

    Sukhanov, Vitaly I.

    1991-02-01

    The paper summarizes the results of investigations performed to obtain deep 3-D holograms with 102 i0 mkm physical thickness allowing the postexposure amplification and the a posteriori changing of the grating parameters. This aim has been achieved by developing heterogeneous systems on the basis of porous glass with light-sensitive compositions introduced into it. 1. INTRODUCTION. LIGHT-SENSITIVE MEDIA FOR 3-D HOLOGRAMS RECORDING. The 3-D holograms have many useful properties: very high diffraction efficiency angular and spectral selectivity but low level of noise. It shoud be noted that in this case deep 3-D holograms are dealt with whose physical thickness is as high as 102 -i mkm. Such hologram recording is usually done using homogeneous light-sensitive media for example dyed acid-halide and electrooptical crystals photochrome glass photostructurized polimer compositions and so on. The nature of photophisical and photochemical processes responsible for the light sensitivity of these materials exclude the possibility of post-exposure treatment. This does not allow to enhance the recorded holograms and considerably hampers their fixing or makes it practically impossible. The object of our work is to create the media which are quite suitable for two-stage processes of the deep hologram formation with post-exposure processing. Such material must satisfy the following requirements: a)they must have high permeability for the developing substances in order to make the development duration suitable for practical applications b)they must be shrinkproof to prevent deformation of the

  7. Reference Point Heterogeneity.

    PubMed

    Terzi, Ayse; Koedijk, Kees; Noussair, Charles N; Pownall, Rachel

    2016-01-01

    It is well-established that, when confronted with a decision to be taken under risk, individuals use reference payoff levels as important inputs. The purpose of this paper is to study which reference points characterize decisions in a setting in which there are several plausible reference levels of payoff. We report an experiment, in which we investigate which of four potential reference points: (1) a population average payoff level, (2) the announced expected payoff of peers in a similar decision situation, (3) a historical average level of earnings that others have received in the same task, and (4) an announced anticipated individual payoff level, best describes decisions in a decontextualized risky decision making task. We find heterogeneity among individuals in the reference points they employ. The population average payoff level is the modal reference point, followed by experimenter's stated expectation of a participant's individual earnings, followed in turn by the average earnings of other participants in previous sessions of the same experiment. A sizeable share of individuals show multiple reference points simultaneously. The reference point that best fits the choices of the individual is not affected by a shock to her income.

  8. Nuclear Nonproliferation

    SciTech Connect

    Atkins-Duffin, C E

    2008-12-10

    With an explosion equivalent of about 20kT of TNT, the Trinity test was the first demonstration of a nuclear weapon. Conducted on July 16, 1945 in Alamogordo, NM this site is now a Registered National Historic Landmark. The concept and applicability of nuclear power was demonstrated on December 20, 1951 with the Experimental Breeder Reactor Number One (EBR-1) lit four light bulbs. This reactor is now a Registered National Historic Landmark, located near Arco, ID. From that moment forward it had been clearly demonstrated that nuclear energy has both peaceful and military applications and that the civilian and military fuel cycles can overlap. For the more than fifty years since the Atoms for Peace program, a key objective of nuclear policy has been to enable the wider peaceful use of nuclear energy while preventing the spread of nuclear weapons. Volumes have been written on the impact of these two actions on the world by advocates and critics; pundits and practioners; politicians and technologists. The nations of the world have woven together a delicate balance of treaties, agreements, frameworks and handshakes that are representative of the timeframe in which they were constructed and how they have evolved in time. Collectively these vehicles attempt to keep political will, nuclear materials and technology in check. This paper captures only the briefest abstract of the more significant aspects on the Nonproliferation Regime. Of particular relevance to this discussion is the special nonproliferation sensitivity associated with the uranium isotope separation and spent fuel reprocessing aspects of the nuclear fuel cycle.

  9. Nuclear Data

    SciTech Connect

    White, Morgan C.

    2014-01-23

    PowerPoint presentation targeted for educational use. Nuclear data comes from a variety of sources and in many flavors. Understanding where the data you use comes from and what flavor it is can be essential to understand and interpret your results. This talk will discuss the nuclear data pipeline with particular emphasis on providing links to additional resources that can be used to explore the issues you will encounter.

  10. Nuclear cardiac

    SciTech Connect

    Slutsky, R.; Ashburn, W.L.

    1982-01-01

    The relationship between nuclear medicine and cardiology has continued to produce a surfeit of interesting, illuminating, and important reports involving the analysis of cardiac function, perfusion, and metabolism. To simplify the presentation, this review is broken down into three major subheadings: analysis of myocardial perfusion; imaging of the recent myocardial infarction; and the evaluation of myocardial function. There appears to be an increasingly important relationship between cardiology, particularly cardiac physiology, and nuclear imaging techniques. (KRM)

  11. Nuclear accidents

    SciTech Connect

    Mobley, J.A.

    1982-05-01

    A nuclear accident with radioactive contamination can happen anywhere in the world. Because expert nuclear emergency teams may take several hours to arrive at the scene, local authorities must have a plan of action for the hours immediately following an accident. The site should be left untouched except to remove casualties. Treatment of victims includes decontamination and meticulous wound debridement. Acute radiation syndrome may be an overwhelming sequela.

  12. Quinone-mediated induction of cytochrome P450 1A1 in HepG2 cells through increased interaction of aryl hydrocarbon receptor with aryl hydrocarbon receptor nuclear translocator.

    PubMed

    Abiko, Yumi; Lin, Fang-Yu; Lee, Hsinyu; Puga, Alvaro; Kumagai, Yoshito

    2016-01-01

    While it has long been believed that benzenes and naphthalenes are unable to activate the aryl hydrocarbon receptor (AhR) because they are poor ligands, we recently reported that these quinoid metabolites upregulated cytochrome P450 1A1 (CYP1A1) in Hepa1c1c7 cells (Abiko et al., 2015). In the current study, AhR activation, measured with a bioluminescence-based cell free assay, was induced by 1,2-naphthoquinone (1,2-NQ), a metabolite of naphthalene. Consistent with this, 1,4-benzoquinone (1,4-BQ), tert-butyl-1,4-BQ, and 1,4-NQ, as well as 1,2-NQ, all electrophilic mono- and bi-cyclic quinones, upregulated CYP1A1 mRNA and protein in HepG2 cells, whereas their parent aromatic hydrocarbons had little effect. Furthermore, immunofluorescence analysis confirmed that these quinones enhanced translocation of AhR to the nucleus.

  13. Nuclear telemedicine

    NASA Astrophysics Data System (ADS)

    Morrison, R. T.; Szasz, I. J.

    1990-06-01

    Diagnostic nuclear medicine patient images have been transniitted for 8 years from a regional conununity hospital to a university teaching hospital 700 kiloinetres away employing slow scan TV and telephone. Transruission and interpretation were done at the end of each working day or as circumstances required in cases of emergencies. Referring physicians received the nuclear medicine procedure report at the end of the completion day or within few minutes of completion in case of emergency procedures. To date more than 25 patient studies have been transmitted for interpretation. Blinded reinterpretation of the original hard copy data of 350 patient studies resulted in 100 agreement with the interpretation of transmitted data. This technique provides high quality diagnostic and therapeutic nuclear medicine services in remote hospitals where the services of an on-site nuclear physician is not available. 2. HISTORY Eight years ago when the nuclear medicine physician at Trail Regional Hospital left the Trail area and an other could not be recruited we examined the feasibility of image transmission by phone for interpretation since closing the department would have imposed unacceptable physical and financial hardship and medical constraints on the patient population the nearest nuclear medicine facility was at some 8 hours drive away. In hospital patients would have to be treated either based purely on physical findings or flown to Vancouver at considerable cost to the health care system (estimated cost $1500.

  14. Molecular Heterogeneity in Aldosterone-Producing Adenomas

    PubMed Central

    Nanba, Kazutaka; Chen, Andrew X.; Omata, Kei; Vinco, Michelle; Giordano, Thomas J.; Else, Tobias; Hammer, Gary D.

    2016-01-01

    Context: The use of next-generation sequencing has resulted in the identification of recurrent somatic mutations underlying primary aldosteronism (PA). However, significant gaps remain in our understanding of the relationship between tumor aldosterone synthase (CYP11B2) expression and somatic mutation status. Objective: The objective of the study was to investigate tumor CYP11B2 expression and somatic aldosterone-driver gene mutation heterogeneity. Methods: Fifty-one adrenals from 51 PA patients were studied. Immunohistochemistry for CYP11B2 was performed. Aldosterone-producing adenomas with intratumor CYP11B2 heterogeneity were analyzed for mutation status using targeted next-generation sequencing. DNA was isolated from CYP11B2-positive, CYP11B2-negative, and adjacent normal areas from formalin-fixed, paraffin-embedded sections. Results: Of 51 adrenals, seven (14 %) showed distinct heterogeneity in CYP11B2 by immunohistochemistry, including six adenomas with intratumor heterogeneity and one multinodular hyperplastic adrenal with both CYP11B2-positive and -negative nodules. Of the six adrenocortical adenomas with CYP11B2 heterogeneity, three had aldosterone-regulating mutations (CACNA1D p.F747C, KCNJ5 p.L168R, ATP1A1 p.L104R) only in CYP11B2-positive regions, and one had two different mutations localized to two histologically distinct CYP11B2-positive regions (ATP2B3 p.L424_V425del, KCNJ5 p.G151R). Lastly, one adrenal with multiple CYP11B2-expressing nodules showed different mutations in each (CACNA1D p.F747V and ATP1A1 p.L104R), and no mutations were identified in CYP11B2-negative nodule or adjacent normal adrenal. Conclusions: Adrenal tumors in patients with PA can demonstrate clear heterogeneity in CYP11B2 expression and somatic mutations in driver genes for aldosterone production. These findings suggest that aldosterone-producing adenoma tumorigenesis can occur within preexisting nodules through the acquisition of somatic mutations that drive aldosterone

  15. Heterogonous Nanofluids for Nuclear Power Plants

    NASA Astrophysics Data System (ADS)

    Alammar, Khalid

    2014-09-01

    Nuclear reactions can be associated with high heat energy release. Extracting such energy efficiently requires the use of high-rate heat exchangers. Conventional heat transfer fluids, such as water and oils are limited in their thermal conductivity, and hence nanofluids have been introduced lately to overcome such limitation. By suspending metal nanoparticles with high thermal conductivity in conventional heat transfer fluids, thermal conductivity of the resulting homogeneous nanofluid is increased. Heterogeneous nanofluids offer yet more potential for heat transfer enhancement. By stratifying nanoparticles within the boundary layer, thermal conductivity is increased where temperature gradients are highest, thereby increasing overall heat transfer of a flowing fluid. In order to test the merit of this novel technique, a numerical study of a laminar pipe flow of a heterogeneous nanofluid was conducted. Effect of Iron-Oxide distribution on flow and heat transfer characteristics was investigated. With Iron-Oxide volume concentration of 0.009 in water, up to 50% local heat transfer enhancement was predicted for the heterogeneous compared to homogeneous nanofluids. Increasing the Reynolds number is shown to increase enhancement while having negligible effect on pressure drop. Using permanent magnets attached externally to the pipe, an experimental investigation conducted at MIT nuclear reactor laboratory for similar flow characteristics of a heterogeneous nanofluid have shown upto 160% enhancement in heat transfer. Such results show that heterogeneous nanofluids are promising for augmenting heat transfer rates in nuclear power heat exchanger systems.

  16. Plasma filtering techniques for nuclear waste remediation

    DOE PAGES

    Gueroult, Renaud; Hobbs, David T.; Fisch, Nathaniel J.

    2015-04-24

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. As a result, this advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste.

  17. Plasma filtering techniques for nuclear waste remediation.

    PubMed

    Gueroult, Renaud; Hobbs, David T; Fisch, Nathaniel J

    2015-10-30

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. This advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Nuclear risk

    SciTech Connect

    Levenson, M.

    1989-01-01

    The title of our session, Nuclear Risk Versus Other Power Options, is provocative. It is also a title with different meanings to different people. To the utility chief executive officer, nuclear power is a high-risk financial undertaking because of political and economic barriers to cost recovery. To the utility dispatcher, it is a high-risk future power source since plant completion and start-up dates can be delayed for very long times due to uncertain legal and political issues. To the environmentalist, concerned about global effects such as greenhouse and acid rain, nuclear power is a relatively low risk energy source. To the financial people, nuclear power is a cash cow turned sour because of uncertainties as to what new plants will cost and whether they will even be allowed to operate. The statistics on risk are known and the results of probability risk assessment calculations of risks are known. The challenge is not to make nuclear power safer, it is already one of the safest, if not the safest, source of power currently available. The challenge is to find a way to communicate this to the public.

  19. Node assignment in heterogeneous computing

    NASA Technical Reports Server (NTRS)

    Som, Sukhamoy

    1993-01-01

    A number of node assignment schemes, both static and dynamic, are explored for the Algorithm to Architecture Mapping Model (ATAMM). The architecture under consideration consists of heterogeneous processors and implements dataflow models of real-time applications. Terminology is developed for heterogeneous computing. New definitions are added to the ATAMM for token and assignment classifications. It is proved that a periodic execution is possible for dataflow graphs. Assignment algorithms are developed and proved. A design procedure is described for satisfying an objective function in an heterogeneous architecture. Several examples are provided for illustration.

  20. Functional Conservation of the Transportin Nuclear Import Pathway in Divergent Organisms

    PubMed Central

    Siomi, Mikiko C.; Fromont, Micheline; Rain, Jean-Christophe; Wan, Lili; Wang, Fan; Legrain, Pierre; Dreyfuss, Gideon

    1998-01-01

    Human transportin1 (hTRN1) is the nuclear import receptor for a group of pre-mRNA/mRNA-binding proteins (heterogeneous nuclear ribonucleoproteins [hnRNP]) represented by hnRNP A1, which shuttle continuously between the nucleus and the cytoplasm. hTRN1 interacts with the M9 region of hnRNP A1, a 38-amino-acid domain rich in Gly, Ser, and Asn, and mediates the nuclear import of M9-bearing proteins in vitro. Saccharomyces cerevisiae transportin (yTRN; also known as YBR017c or Kap104p) has been identified and cloned. To understanding the nuclear import mediated by yTRN, we searched with a yeast two-hybrid system for proteins that interact with it. In an exhaustive screen of the S. cerevisiae genome, the most frequently selected open reading frame was the nuclear mRNA-binding protein, Nab2p. We delineated a ca.-50-amino-acid region in Nab2p, termed NAB35, which specifically binds yTRN and is similar to the M9 motif. NAB35 also interacts with hTRN1 and functions as a nuclear localization signal in mammalian cells. Interestingly, yTRN can also mediate the import of NAB35-bearing proteins into mammalian nuclei in vitro. We also report on additional substrates for TRN as well as sequences of Drosophila melanogaster, Xenopus laevis, and Schizosaccharomyces pombe TRNs. Together, these findings demonstrate that both the M9 signal and the nuclear import machinery utilized by the transportin pathway are conserved in evolution. PMID:9632798

  1. Nuclear scales

    SciTech Connect

    Friar, J.L.

    1998-12-01

    Nuclear scales are discussed from the nuclear physics viewpoint. The conventional nuclear potential is characterized as a black box that interpolates nucleon-nucleon (NN) data, while being constrained by the best possible theoretical input. The latter consists of the longer-range parts of the NN force (e.g., OPEP, TPEP, the {pi}-{gamma} force), which can be calculated using chiral perturbation theory and gauged using modern phase-shift analyses. The shorter-range parts of the force are effectively parameterized by moments of the interaction that are independent of the details of the force model, in analogy to chiral perturbation theory. Results of GFMC calculations in light nuclei are interpreted in terms of fundamental scales, which are in good agreement with expectations from chiral effective field theories. Problems with spin-orbit-type observables are noted.

  2. Nuclear astrophysics

    SciTech Connect

    Penionzhkevich, Yu. E.

    2010-08-15

    The International Year of Astronomy 2009 (IYA2009) was declared by the 62nd General Assembly of the United Nations and was also endorsed by UNESCO. Investigations in the realms of particle and nuclear physicsmake a large contribution in the development of our ideas of the properties of the Universe. The present article discusses some problems of the evolution of the Universe, nucleosyntheses, and cosmochronology from the point of view of nuclear and particle physics. Processes occurring in the Universe are compared with the mechanisms of the production and decay of nuclei, as well as with the mechanisms of their interaction at high energies. Examples that demonstrate the potential of nuclearphysics methods for studying cosmic objects and the properties of the Universe are given. The results that come from investigations into nuclear reactions induced by beams of radioactive nuclei and which make it possible to take a fresh look at the nucleosynthesis scenario in the range at light nuclei are presented.

  3. Nuclear waste

    SciTech Connect

    Not Available

    1988-05-01

    This paper discusses how, as part of the Department of Energy's implementation of the Nuclear Waste Policy Act of 1982, DOE is required to investigate a site at Yucca Mountain, Nevada and, if it determines that the site is suitable, recommend to the President its selection for a nuclear waste repository. The Nuclear Regulatory Commission, in considering development of the plan, issued five objections, one of which is DOE's failure to recognize the range of alternative conceptual models of the Yucca Mountain site that can be supported by the limited existing technical data. At the end of the quarter DOE directed its project offices in Washington and Texas to begin orderly phase-out of all site-specific repository activities. Costs for this phase-out are $53 million for the Deaf Smith site and $85 million for the Hanford site.

  4. Nuclear Systems Kilopower Overview

    NASA Technical Reports Server (NTRS)

    Palac, Don; Gibson, Marc; Mason, Lee; Houts, Michael; McClure, Patrick; Robinson, Ross

    2016-01-01

    The Nuclear Systems Kilopower Project was initiated by NASAs Space Technology Mission Directorate Game Changing Development Program in fiscal year 2015 to demonstrate subsystem-level technology readiness of small space fission power in a relevant environment (Technology Readiness Level 5) for space science and human exploration power needs. The Nuclear Systems Kilopower Project consists of two elements. The primary element is the Kilopower Prototype Test, also called the Kilopower Reactor Using Stirling Technology(KRUSTY) Test. This element consists of the development and testing of a fission ground technology demonstrator of a 1 kWe fission power system. A 1 kWe system matches requirements for some robotic precursor exploration systems and future potential deep space science missions, and also allows a nuclear ground technology demonstration in existing nuclear test facilities at low cost. The second element, the Mars Kilopower Scalability Study, consists of the analysis and design of a scaled-up version of the 1 kWe reference concept to 10 kWe for Mars surface power projected requirements, and validation of the applicability of the KRUSTY experiment to key technology challenges for a 10 kWe system. If successful, these two elements will lead to initiation of planning for a technology demonstration of a 10 kWe fission power capability for Mars surface outpost power.

  5. Nuclear Models

    NASA Astrophysics Data System (ADS)

    Fossión, Rubén

    2010-09-01

    The atomic nucleus is a typical example of a many-body problem. On the one hand, the number of nucleons (protons and neutrons) that constitute the nucleus is too large to allow for exact calculations. On the other hand, the number of constituent particles is too small for the individual nuclear excitation states to be explained by statistical methods. Another problem, particular for the atomic nucleus, is that the nucleon-nucleon (n-n) interaction is not one of the fundamental forces of Nature, and is hard to put in a single closed equation. The nucleon-nucleon interaction also behaves differently between two free nucleons (bare interaction) and between two nucleons in the nuclear medium (dressed interaction). Because of the above reasons, specific nuclear many-body models have been devised of which each one sheds light on some selected aspects of nuclear structure. Only combining the viewpoints of different models, a global insight of the atomic nucleus can be gained. In this chapter, we revise the the Nuclear Shell Model as an example of the microscopic approach, and the Collective Model as an example of the geometric approach. Finally, we study the statistical properties of nuclear spectra, basing on symmetry principles, to find out whether there is quantum chaos in the atomic nucleus. All three major approaches have been rewarded with the Nobel Prize of Physics. In the text, we will stress how each approach introduces its own series of approximations to reduce the prohibitingly large number of degrees of freedom of the full many-body problem to a smaller manageable number of effective degrees of freedom.

  6. Nuclear Models

    SciTech Connect

    Fossion, Ruben

    2010-09-10

    The atomic nucleus is a typical example of a many-body problem. On the one hand, the number of nucleons (protons and neutrons) that constitute the nucleus is too large to allow for exact calculations. On the other hand, the number of constituent particles is too small for the individual nuclear excitation states to be explained by statistical methods. Another problem, particular for the atomic nucleus, is that the nucleon-nucleon (n-n) interaction is not one of the fundamental forces of Nature, and is hard to put in a single closed equation. The nucleon-nucleon interaction also behaves differently between two free nucleons (bare interaction) and between two nucleons in the nuclear medium (dressed interaction).Because of the above reasons, specific nuclear many-body models have been devised of which each one sheds light on some selected aspects of nuclear structure. Only combining the viewpoints of different models, a global insight of the atomic nucleus can be gained. In this chapter, we revise the the Nuclear Shell Model as an example of the microscopic approach, and the Collective Model as an example of the geometric approach. Finally, we study the statistical properties of nuclear spectra, basing on symmetry principles, to find out whether there is quantum chaos in the atomic nucleus. All three major approaches have been rewarded with the Nobel Prize of Physics. In the text, we will stress how each approach introduces its own series of approximations to reduce the prohibitingly large number of degrees of freedom of the full many-body problem to a smaller manageable number of effective degrees of freedom.

  7. Nuclear pursuits

    SciTech Connect

    Not Available

    1993-05-01

    This table lists quantities of warheads (in stockpile, peak number per year, total number built, number of known test explosions), weapon development milestones (developers of the atomic bomb and hydrogen bomb, date of first operational ICBM, first nuclear-powered naval SSN in service, first MIRVed missile deployed), and testing milestones (first fission test, type of boosted fission weapon, multistage thermonuclear test, number of months from fission bomb to multistage thermonuclear bomb, etc.), and nuclear infrastructure (assembly plants, plutonium production reactors, uranium enrichment plants, etc.). Countries included in the tally are the United States, Soviet Union, Britain, France, and China.

  8. Homogeneous, Heterogeneous, and Enzymatic Catalysis.

    ERIC Educational Resources Information Center

    Oyama, S. Ted; Somorjai, Gabor A.

    1988-01-01

    Discusses three areas of catalysis: homegeneous, heterogeneous, and enzymatic. Explains fundamentals and economic impact of catalysis. Lists and discusses common industrial catalysts. Provides a list of 107 references. (MVL)

  9. Homogeneous, Heterogeneous, and Enzymatic Catalysis.

    ERIC Educational Resources Information Center

    Oyama, S. Ted; Somorjai, Gabor A.

    1988-01-01

    Discusses three areas of catalysis: homegeneous, heterogeneous, and enzymatic. Explains fundamentals and economic impact of catalysis. Lists and discusses common industrial catalysts. Provides a list of 107 references. (MVL)

  10. Parahydrogen-induced polarization in heterogeneous catalytic processes.

    PubMed

    Kovtunov, Kirill V; Zhivonitko, Vladimir V; Skovpin, Ivan V; Barskiy, Danila A; Koptyug, Igor V

    2013-01-01

    Parahydrogen-induced polarization of nuclear spins provides enhancements of NMR signals for various nuclei of up to four to five orders of magnitude in magnetic fields of modern NMR spectrometers and even higher enhancements in low and ultra-low magnetic fields. It is based on the use of parahydrogen in catalytic hydrogenation reactions which, upon pairwise addition of the two H atoms of parahydrogen, can strongly enhance the NMR signals of reaction intermediates and products in solution. A recent advance in this field is the demonstration that PHIP can be observed not only in homogeneous hydrogenations but also in heterogeneous catalytic reactions. The use of heterogeneous catalysts for generating PHIP provides a number of significant advantages over the homogeneous processes, including the possibility to produce hyperpolarized gases, better control over the hydrogenation process, and the ease of separation of hyperpolarized fluids from the catalyst. The latter advantage is of paramount importance in light of the recent tendency toward utilization of hyperpolarized substances in in vivo spectroscopic and imaging applications of NMR. In addition, PHIP demonstrates the potential to become a useful tool for studying mechanisms of heterogeneous catalytic processes and for in situ studies of operating catalytic reactors. Here, the known examples of PHIP observations in heterogeneous reactions over immobilized transition metal complexes, supported metals, and some other types of heterogeneous catalysts are discussed and the applications of the technique for hypersensitive NMR imaging studies are presented.

  11. Heterogeneity in motor driven transport

    NASA Astrophysics Data System (ADS)

    Tabei, Ali

    2015-03-01

    I will discuss quantitative analysis of particle tracking data for motor driven vesicles inside an insulin secreting cell. We use this method to study the dynamical and structural heterogeneity inside the cell. I will discuss our effort to explain the origin of observed heterogeneity in intracellular transport. Finally, I will explain how analyzing directional correlations in transport trajectories reveals self-similarity in the diffusion media.

  12. Nuclear winter or nuclear fall?

    NASA Astrophysics Data System (ADS)

    Berger, André

    Climate is universal. If a major modern nuclear war (i.e., with a large number of small-yield weapons) were to happen, it is not even necessary to have a specific part of the world directly involved for there to be cause to worry about the consequences for its inhabitants and their future. Indeed, smoke from fires ignited by the nuclear explosions would be transported by winds all over the world, causing dark and cold. According to the first study, by Turco et al. [1983], air surface temperature over continental areas of the northern mid-latitudes (assumed to be the nuclear war theatre) would fall to winter levels even in summer (hence the term “nuclear winter”) and induce drastic climatic conditions for several months at least. The devastating effects of a nuclear war would thus last much longer than was assumed initially. Discussing to what extent these estimations of long-term impacts on climate are reliable is the purpose of this article.

  13. Heterogeneity in schistosomiasis transmission dynamics.

    PubMed

    Mari, Lorenzo; Ciddio, Manuela; Casagrandi, Renato; Perez-Saez, Javier; Bertuzzo, Enrico; Rinaldo, Andrea; Sokolow, Susanne H; De Leo, Giulio A; Gatto, Marino

    2017-11-07

    Simple models of disease propagation often disregard the effects of transmission heterogeneity on the ecological and epidemiological dynamics associated with host-parasite interactions. However, for some diseases like schistosomiasis, a widespread parasitic infection caused by Schistosoma worms, accounting for heterogeneity is crucial to both characterize long-term dynamics and evaluate opportunities for disease control. Elaborating on the classic Macdonald model for macroparasite transmission, we analyze families of models including explicit descriptions of heterogeneity related to differential transmission risk within a community, water contact patterns, the distribution of the snail host population, human mobility, and the seasonal fluctuations of the environment. Through simple numerical examples, we show that heterogeneous multigroup communities may be more prone to schistosomiasis than homogeneous ones, that the availability of multiple water sources can hinder parasite transmission, and that both spatial and temporal heterogeneities may have nontrivial implications for disease endemicity. Finally, we discuss the implications of heterogeneity for disease control. Although focused on schistosomiasis, results from this study may apply as well to other parasitic infections with complex transmission cycles, such as cysticercosis, dracunculiasis and fasciolosis. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. PUNCH: Population Characterization of Heterogeneity

    PubMed Central

    Tunc, Birkan; Ghanbari, Yasser; Smith, Alex R.; Pandey, Juhi; Browne, Aaron; Schultz, Robert T.; Verma, Ragini

    2014-01-01

    Neuropsychiatric disorders are notoriously heterogeneous in their presentation, which precludes straightforward and objective description of the differences between affected and typical populations that therefore makes finding reliable biomarkers a challenge. This difficulty underlines the need for reliable methods to capture sample characteristics of heterogeneity using a single continuous measure, incorporating the multitude of scores used to describe different aspects of functioning. This study addresses this challenge by proposing a general method of identifying and quantifying the heterogeneity of any clinical population using a severity measure called the PUNCH (Population Characterization of Heterogeneity). PUNCH is a decision level fusion technique to incorporate decisions of various phenotypic scores, while providing interpretable weights for scores. We provide an application of our framework to a simulated dataset and to a large sample of youth with Autism Spectrum Disorder (ASD). Next we stratify PUNCH scores in our ASD sample and show how severity moderates findings of group differences in diffusion weighted brain imaging data; more severely affected subgroups of ASD show expanded differences compared to age and gender matched healthy controls. Results demonstrate the ability of our measure in quantifying the underlying heterogeneity of the clinical samples, and suggest its utility in providing researchers with reliable severity assessments incorporating population heterogeneity. PMID:24799135

  15. Nuclear Science.

    ERIC Educational Resources Information Center

    Pennsylvania State Dept. of Education, Harrisburg. Bureau of Curriculum Services.

    This document is a report on a course in nuclear science for the high school curriculum. The course is designed to provide a basic but comprehensive understanding of the atom in the light of modern knowledge, and to show how people attempt to harness the tremendous energy liberated through fission and fusion reactions. The course crosses what are…

  16. Nuclear Terrorism.

    SciTech Connect

    Hecker, Siegfried S.

    2001-01-01

    As pointed out by several speakers, the level of violence and destruction in terrorist attacks has increased significantly during the past decade. Fortunately, few have involved weapons of mass destruction, and none have achieved mass casualties. The Aum Shinrikyo release of lethal nerve agent, sarin, in the Tokyo subway on March 20, 1995 clearly broke new ground by crossing the threshold in attempting mass casualties with chemical weapons. However, of all weapons of mass destruction, nuclear weapons still represent the most frightening threat to humankind. Nuclear weapons possess an enormous destructive force. The immediacy and scale of destruction are unmatched. In addition to destruction, terrorism also aims to create fear among the public and governments. Here also, nuclear weapons are unmatched. The public's fear of nuclear weapons or, for that matter, of all radioactivity is intense. To some extent, this fear arises from a sense of unlimited vulnerability. That is, radioactivity is seen as unbounded in three dimensions - distance, it is viewed as having unlimited reach; quantity, it is viewed as having deadly consequences in the smallest doses (the public is often told - incorrectly, of course - that one atom of plutonium will kill); and time, if it does not kill you immediately, then it will cause cancer decades hence.

  17. Nuclear medicine

    SciTech Connect

    Wagner, H.N. Jr.

    1986-10-17

    In 1985 and 1986 nuclear medicine became more and more oriented toward in vov chemistry, chiefly as a result of advances in positron emission tomography (PET). The most important trend was the extension of PET technology into the care of patients with brain tumors, epilepsy, and heart disease. A second trend was the increasing use of single-photon emission computed tomography (SPECT).

  18. Nuclear Misinformation

    ERIC Educational Resources Information Center

    Ford, Daniel F.; Kendall, Henry W.

    1975-01-01

    Many scientists feel that research into nuclear safety has been diverted or distorted, and the results of the research concealed or inaccurately reported on a large number of occasions. Of particular concern have been the emergency cooling systems which have not, as yet, been adequately tested. (Author/MA)

  19. Nuclear Science.

    ERIC Educational Resources Information Center

    Pennsylvania State Dept. of Education, Harrisburg. Bureau of Curriculum Services.

    This document is a report on a course in nuclear science for the high school curriculum. The course is designed to provide a basic but comprehensive understanding of the atom in the light of modern knowledge, and to show how people attempt to harness the tremendous energy liberated through fission and fusion reactions. The course crosses what are…

  20. Nuclear orbiting

    SciTech Connect

    Shapira, D.

    1988-01-01

    Nuclear orbiting following collisions between sd and p shell nuclei is discussed. The dependence of this process on the real and imaginary parts of the nucleus-nucleus potential is discussed, as well as the evolution of the dinucleus toward a fully equilibrated fused system. 26 refs., 15 figs.

  1. Nuclear Misinformation

    ERIC Educational Resources Information Center

    Ford, Daniel F.; Kendall, Henry W.

    1975-01-01

    Many scientists feel that research into nuclear safety has been diverted or distorted, and the results of the research concealed or inaccurately reported on a large number of occasions. Of particular concern have been the emergency cooling systems which have not, as yet, been adequately tested. (Author/MA)

  2. Nuclear energy.

    PubMed

    Wilson, Peter D

    2010-01-01

    The technical principles and practices of the civil nuclear industry are described with particular reference to fission and its products, natural and artificial radioactivity elements principally concerned and their relationships, main types of reactor, safety issues, the fuel cycle, waste management, issues related to weapon proliferation, environmental considerations and possible future developments.

  3. NUCLEAR REACTOR

    DOEpatents

    Treshow, M.

    1961-09-01

    A boiling-water nuclear reactor is described wherein control is effected by varying the moderator-to-fuel ratio in the reactor core. This is accomplished by providing control tubes containing a liquid control moderator in the reactor core and providing means for varying the amount of control moderatcr within the control tubes.

  4. Modeling Cellular Noise Underlying Heterogeneous Cell Responses in the Epidermal Growth Factor Signaling Pathway

    PubMed Central

    Iwamoto, Kazunari; Shindo, Yuki; Takahashi, Koichi

    2016-01-01

    Cellular heterogeneity, which plays an essential role in biological phenomena, such as drug resistance and migration, is considered to arise from intrinsic (i.e., reaction kinetics) and extrinsic (i.e., protein variability) noise in the cell. However, the mechanistic effects of these types of noise to determine the heterogeneity of signal responses have not been elucidated. Here, we report that the output of epidermal growth factor (EGF) signaling activity is modulated by cellular noise, particularly by extrinsic noise of particular signaling components in the pathway. We developed a mathematical model of the EGF signaling pathway incorporating regulation between extracellular signal-regulated kinase (ERK) and nuclear pore complex (NPC), which is necessary for switch-like activation of the nuclear ERK response. As the threshold of switch-like behavior is more sensitive to perturbations than the graded response, the effect of biological noise is potentially critical for cell fate decision. Our simulation analysis indicated that extrinsic noise, but not intrinsic noise, contributes to cell-to-cell heterogeneity of nuclear ERK. In addition, we accurately estimated variations in abundance of the signal proteins between individual cells by direct comparison of experimental data with simulation results using Apparent Measurement Error (AME). AME was constant regardless of whether the protein levels varied in a correlated manner, while covariation among proteins influenced cell-to-cell heterogeneity of nuclear ERK, suppressing the variation. Simulations using the estimated protein abundances showed that each protein species has different effects on cell-to-cell variation in the nuclear ERK response. In particular, variability of EGF receptor, Ras, Raf, and MEK strongly influenced cellular heterogeneity, while others did not. Overall, our results indicated that cellular heterogeneity in response to EGF is strongly driven by extrinsic noise, and that such heterogeneity

  5. EIYMNVPV Motif is Essential for A1CF Nucleus Localization and A1CF (-8aa) Promotes Proliferation of MDA-MB-231 Cells via Up-Regulation of IL-6

    PubMed Central

    Zhou, Li; Hao, Jin; Yuan, Yue; Peng, Rui; Wang, Honglian; Ni, Dongsheng; Gu, Yuping; Huang, Liyuan; Mao, Zhaomin; Lyu, Zhongshi; Du, Yao; Liu, Zhicheng; Li, Yiman; Ju, Pan; Long, Yaoshui; Liu, Jianing; Zhou, Qin

    2016-01-01

    Apobec-1 complementation factor (A1CF) is a heterogeneous nuclear ribonuceloprotein (hnRNP) and mediates apolipoprotein-B mRNA editing. A1CF can promote the regeneration of the liver by post-transcriptionally stabilizing Interleukin-6 (IL-6) mRNA. It also contains two transcriptional variants-A1CF64 and A1CF65, distinguished by the appearance of a 24-nucleotide motif which contributes to the corresponding eight-amino acid motif of EIYMNVPV. For the first time, we demonstrated that the EIYMNVPV motif was essential for A1CF nucleus localization, A1CF deficient of the EIYMNVPV motif, A1CF (-8aa) showed cytoplasm distribution. More importantly, we found that A1CF (-8aa), but not its full-length counterpart, can promote proliferation of MDA-MB-231 cells accompanied with increased level of IL-6 mRNA. Furthermore, silencing of IL-6 attenuated A1CF (-8aa)-induced proliferation in MDA-MB-231 cells. In conclusion, notably, these findings suggest that A1CF (-8aa) promoted proliferation of MDA-MB-231 cells in vitro viewing IL-6 as a target. Thus, the EIYMNVPV motif could be developed as a potential target for basal-like breast cancer therapy. PMID:27231908

  6. The effect of O-GlcNAcylation on hnRNP A1 translocation and interaction with transportin1.

    PubMed

    Roth, Shira; Khalaila, Isam

    2017-01-01

    The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a major pre-mRNA binding protein involved in transcription and translation. Although predominantly nuclear, hnRNP A1 shuttles rapidly between the nucleus and the cytosol, delivering its anchored pre-mRNA for further processing. Translocation is important for hnRNP A1 to accomplish its transcriptional and translational roles. Transportin1 (Trn1), a translocation protein, facilitates the translocation of hnRNP A1 back to the nucleus. Moreover, phosphorylation of serine residues at hnRNP A1 C-terminal domain affects its translocation. In this study, we found that phosphorylation is not the only modification that hnRNP A1 undergoes, but also O-linked N-acetylglucosaminylation (O-GlcNAcylation) could occur. Several putative novel O-GlcNAcylation and phosphorylation sites in hnRNP A1 were mapped. Whereas enhanced O-GlcNAcylation increased hnRNP A1 interaction with Trn1, enhanced phosphorylation reduced the interaction between the proteins. In addition, elevated O-GlcNAcylation resulted in hnRNP A1 seclusion in the nucleus, whereas elevated phosphorylation resulted in its accumulation in the cytosol. These findings suggest that a new player, i.e., O-GlcNAcylation, regulates hnRNP A1 translocation and interaction with Trn1, possibly affecting its function. There is a need for further study, to elucidate the role of O-GlcNAcylation in the regulation of the specific activities of hnRNP A1 in transcription and translation.

  7. A1C test

    MedlinePlus

    HbA1C test; Glycated hemoglobin test; Glycohemoglobin test; Hemoglobin A1C; Diabetes - A1C; Diabetic - A1C ... gov/pubmed/26696680 . Chernecky CC, Berger BJ. Glycosylated hemoglobin (GHb, glycohemoglobin, glycated hemoglobin, HbA1a, HbA1b, HbA1c - blood. ...

  8. Dealing with spatial heterogeneity

    NASA Astrophysics Data System (ADS)

    Marsily, Gh.; Delay, F.; Gonçalvès, J.; Renard, Ph.; Teles, V.; Violette, S.

    2005-03-01

    Heterogeneity can be dealt with by defining homogeneous equivalent properties, known as averaging, or by trying to describe the spatial variability of the rock properties from geologic observations and local measurements. The techniques available for these descriptions are mostly continuous Geostatistical models, or discontinuous facies models such as the Boolean, Indicator or Gaussian-Threshold models and the Markov chain model. These facies models are better suited to treating issues of rock strata connectivity, e.g. buried high permeability channels or low permeability barriers, which greatly affect flow and, above all, transport in aquifers. Genetic models provide new ways to incorporate more geology into the facies description, an approach that has been well developed in the oil industry, but not enough in hydrogeology. The conclusion is that future work should be focused on improving the facies models, comparing them, and designing new in situ testing procedures (including geophysics) that would help identify the facies geometry and properties. A world-wide catalog of aquifer facies geometry and properties, which could combine site genesis and description with methods used to assess the system, would be of great value for practical applications. On peut aborder le problème de l'hétérogénéité en s'efforçant de définir une perméabilité équivalente homogène, par prise de moyenne, ou au contraire en décrivant la variation dans l'espace des propriétés des roches à partir des observations géologiques et des mesures locales. Les techniques disponibles pour une telle description sont soit continues, comme l'approche Géostatistique, soit discontinues, comme les modèles de faciès, Booléens, ou bien par Indicatrices ou Gaussiennes Seuillées, ou enfin Markoviens. Ces modèles de faciès sont mieux capables de prendre en compte la connectivité des strates géologiques, telles que les chenaux enfouis à forte perméabilité, ou au contraire les faci

  9. NUCLEAR REACTOR

    DOEpatents

    Moore, R.V.; Bowen, J.H.; Dent, K.H.

    1958-12-01

    A heterogeneous, natural uranium fueled, solid moderated, gas cooled reactor is described, in which the fuel elements are in the form of elongated rods and are dlsposed within vertical coolant channels ln the moderator symmetrically arranged as a regular lattice in groups. This reactor employs control rods which operate in vertical channels in the moderator so that each control rod is centered in one of the fuel element groups. The reactor is enclosed in a pressure vessel which ls provided with access holes at the top to facilitate loading and unloadlng of the fuel elements, control rods and control rod driving devices.

  10. River Meandering in Heterogeneous Floodplains

    NASA Astrophysics Data System (ADS)

    Guneralp, I.; Rhoads, B. L.

    2011-12-01

    Freely-meandering natural rivers typically evolve into complex planforms characterized by compound loops or multilobes or into irregular patterns. It is widely acknowledged that spatial heterogeneity in floodplain erodibility should affect the planform evolution of meandering rivers; however, past studies have not systematically explored the importance of this effect. In this study, we systematically analyze how the scale, magnitude, and stochasticity of floodplain erosional variability influence meander evolution and the emergence of bend complexity and planform irregularity. We employ a physically-based model of meander morphodynamics and stochastically-generated heterogeneous landscapes with a range of spatial scales that represent spatial heterogeneity (i.e., patchiness) in floodplain erosional resistance. The heterogeneous mosaics of differential resistance with different scales of patchiness are meant to represent spatial arrangements of factors influencing migration and varying with scale, such as sedimentological complexity, patches of floodplain vegetation, and human activities. We also evaluate the effects of stochasticity in bank erodibility on the spatial characteristics of planform evolution. The results show that both the spatial scale of heterogeneity and the magnitude of variability in erodibility have a strong influence on meander evolution. The planform morphologies generated by simulations with spatially-heterogeneous landscapes are remarkably similar, both visually and in their spectral signatures, to those of natural meandering rivers. Landscapes with patch sizes larger than the initial meander size promote the evolution of highly elongated, upstream-skewed meanders with high variability in amplitudes. As patch size becomes smaller than the initial meander size, bend complexity and planform irregularities increase, resulting in downstream-skewed bends and compound loops or multilobes. Fine-grained heterogeneity results in meanders similar to

  11. Reaction Selectivity in Heterogeneous Catalysis

    SciTech Connect

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  12. Organizational heterogeneity of vertebrate genomes.

    PubMed

    Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

    2012-01-01

    Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  13. Heterogeneity of vertebrate brain tubulins.

    PubMed Central

    Field, D J; Collins, R A; Lee, J C

    1984-01-01

    We have examined the extent of brain tubulin heterogeneity in six vertebrate species commonly used in tubulin research (rat, calf, pig, chicken, human, and lamb) using isoelectric focusing, two-dimensional electrophoresis, and peptide mapping procedures that provide higher resolution than previously available. The extent of heterogeneity is extremely similar in all of these organisms, as judged by number, range of isoelectric points, and distribution of the isotubulins. A minimum of 6 alpha and 12 beta tubulins was resolved from all sources. Even the pattern of spots on two-dimensional peptide maps is remarkably similar. These similarities suggest that the populations of tubulin in all of these brains should have similar overall physical properties. It is particularly interesting that chicken, which has only four or five beta-tubulin genes, contains approximately 12 beta tubulins. Thus, post-translational modification must generate at least some of the tubulin heterogeneity. Mammalian species, which contain 15-20 tubulin DNA sequences, do not show any more tubulin protein heterogeneity than does chicken. This suggests that expression of only a small number of the mammalian genes may be required to generate the observed tubulin heterogeneity. Images PMID:6588378

  14. Phenotypic heterogeneity promotes adaptive evolution

    PubMed Central

    Nevozhay, Dmitry; Kalapis, Dorottya; Lázár, Viktória; Csörgő, Bálint; Nyerges, Ákos; Szamecz, Béla; Fekete, Gergely; Papp, Balázs; Araújo, Hugo; Oliveira, José L.; Moura, Gabriela; Santos, Manuel A. S.; Székely Jr, Tamás; Balázsi, Gábor

    2017-01-01

    Genetically identical cells frequently display substantial heterogeneity in gene expression, cellular morphology and physiology. It has been suggested that by rapidly generating a subpopulation with novel phenotypic traits, phenotypic heterogeneity (or plasticity) accelerates the rate of adaptive evolution in populations facing extreme environmental challenges. This issue is important as cell-to-cell phenotypic heterogeneity may initiate key steps in microbial evolution of drug resistance and cancer progression. Here, we study how stochastic transitions between cellular states influence evolutionary adaptation to a stressful environment in yeast Saccharomyces cerevisiae. We developed inducible synthetic gene circuits that generate varying degrees of expression stochasticity of an antifungal resistance gene. We initiated laboratory evolutionary experiments with genotypes carrying different versions of the genetic circuit by exposing the corresponding populations to gradually increasing antifungal stress. Phenotypic heterogeneity altered the evolutionary dynamics by transforming the adaptive landscape that relates genotype to fitness. Specifically, it enhanced the adaptive value of beneficial mutations through synergism between cell-to-cell variability and genetic variation. Our work demonstrates that phenotypic heterogeneity is an evolving trait when populations face a chronic selection pressure. It shapes evolutionary trajectories at the genomic level and facilitates evolutionary rescue from a deteriorating environmental stress. PMID:28486496

  15. Nuclear Medicine

    PubMed Central

    Streek, Penny Vande; Carretta, Robert; Weiland, Frederick L.

    1994-01-01

    The Council on Scientific Affairs of the California Medical Association presents the following epitomes of progress in nuclear medicine. Each item, in the judgment of a panel of knowledgeable physicians, has recently become reasonably firmly established, both as to scientific fact and clinical importance. The items are presented in simple epitome, and an authoritative reference, both to the item itself and to the subject as a whole, is generally given for those who may be unfamiliar with a particular item. The purpose is to assist busy practitioners, students, researchers, and scholars to stay abreast of progress in medicine, whether in their own field of special interest or another. The epitomes included here were selected by the Advisory Panel to the Section on Nuclear Medicine of the California Medical Association, and the summaries were prepared under the direction of Dr Lyons and the panel. PMID:7529452

  16. A dosimetric model for the heterogeneous delivery of radioactive nanoparticles In vivo: a feasibility study.

    PubMed

    Satterlee, Andrew B; Attayek, Peter; Midkiff, Bentley; Huang, Leaf

    2017-03-17

    ᅟ: Accurate and quantitative dosimetry for internal radiation therapy can be especially challenging, given the heterogeneity of patient anatomy, tumor anatomy, and source deposition. Internal radiotherapy sources such as nanoparticles and monoclonal antibodies require high resolution imaging to accurately model the heterogeneous distribution of these sources in the tumor. The resolution of nuclear imaging modalities is not high enough to measure the heterogeneity of intratumoral nanoparticle deposition or intratumoral regions, and mathematical models do not represent the actual heterogeneous dose or dose response. To help answer questions at the interface of tumor dosimetry and tumor biology, we have modeled the actual 3-dimensional dose distribution of heterogeneously delivered radioactive nanoparticles in a tumor after systemic injection.

  17. NUCLEAR REACTOR

    DOEpatents

    Anderson, C.R.

    1962-07-24

    A fluidized bed nuclear reactor and a method of operating such a reactor are described. In the design means are provided for flowing a liquid moderator upwardly through the center of a bed of pellets of a nentron-fissionable material at such a rate as to obtain particulate fluidization while constraining the lower pontion of the bed into a conical shape. A smooth circulation of particles rising in the center and falling at the outside of the bed is thereby established. (AEC)

  18. NUCLEAR REACTORS

    DOEpatents

    Long, E.; Ashby, J.W.

    1958-09-16

    ABS>A graphite moderator structure is presented for a nuclear reactor compriscd of an assembly of similarly orientated prismatic graphite blocks arranged on spaced longitudinal axes lying in common planes wherein the planes of the walls of the blocks are positioned so as to be twisted reintive to the planes of said axes so thatthe unlmpeded dtrect paths in direction wholly across the walls of the blocks are limited to the width of the blocks plus spacing between the blocks.

  19. NUCLEAR REACTOR

    DOEpatents

    Grebe, J.J.

    1959-07-14

    High temperature reactors which are uniquely adapted to serve as the heat source for nuclear pcwered rockets are described. The reactor is comprised essentially of an outer tubular heat resistant casing which provides the main coolant passageway to and away from the reactor core within the casing and in which the working fluid is preferably hydrogen or helium gas which is permitted to vaporize from a liquid storage tank. The reactor core has a generally spherical shape formed entirely of an active material comprised of fissile material and a moderator material which serves as a diluent. The active material is fabricated as a gas permeable porous material and is interlaced in a random manner with very small inter-connecting bores or capillary tubes through which the coolant gas may flow. The entire reactor is divided into successive sections along the direction of the temperature gradient or coolant flow, each section utilizing materials of construction which are most advantageous from a nuclear standpoint and which at the same time can withstand the operating temperature of that particular zone. This design results in a nuclear reactor characterized simultaneously by a minimum critiral size and mass and by the ability to heat a working fluid to an extremely high temperature.

  20. Nuclear waste

    SciTech Connect

    Not Available

    1991-09-01

    Radioactive waste is mounting at U.S. nuclear power plants at a rate of more than 2,000 metric tons a year. Pursuant to statute and anticipating that a geologic repository would be available in 1998, the Department of Energy (DOE) entered into disposal contracts with nuclear utilities. Now, however, DOE does not expect the repository to be ready before 2010. For this reason, DOE does not want to develop a facility for monitored retrievable storage (MRS) by 1998. This book is concerned about how best to store the waste until a repository is available, congressional requesters asked GAO to review the alternatives of continued storage at utilities' reactor sites or transferring waste to an MRS facility, GAO assessed the likelihood of an MRSA facility operating by 1998, legal implications if DOE is not able to take delivery of wastes in 1998, propriety of using the Nuclear Waste Fund-from which DOE's waste program costs are paid-to pay utilities for on-site storage capacity added after 1998, ability of utilities to store their waste on-site until a repository is operating, and relative costs and safety of the two storage alternatives.

  1. Ly-6Chigh monocytes depend on Nr4a1 to balance both inflammatory and reparative phases in the infarcted myocardium.

    PubMed

    Hilgendorf, Ingo; Gerhardt, Louisa M S; Tan, Timothy C; Winter, Carla; Holderried, Tobias A W; Chousterman, Benjamin G; Iwamoto, Yoshiko; Liao, Ronglih; Zirlik, Andreas; Scherer-Crosbie, Marielle; Hedrick, Catherine C; Libby, Peter; Nahrendorf, Matthias; Weissleder, Ralph; Swirski, Filip K

    2014-05-09

    Healing after myocardial infarction involves the biphasic accumulation of inflammatory lymphocyte antigen 6C (Ly-6C)(high) and reparative Ly-6C(low) monocytes/macrophages (Mo/MΦ). According to 1 model, Mo/MΦ heterogeneity in the heart originates in the blood and involves the sequential recruitment of distinct monocyte subsets that differentiate to distinct macrophages. Alternatively, heterogeneity may arise in tissue from 1 circulating subset via local macrophage differentiation and polarization. The orphan nuclear hormone receptor, nuclear receptor subfamily 4, group a, member 1 (Nr4a1), is essential to Ly-6C(low) monocyte production but dispensable to Ly-6C(low) macrophage differentiation; dependence on Nr4a1 can thus discriminate between systemic and local origins of macrophage heterogeneity. This study tested the role of Nr4a1 in myocardial infarction in the context of the 2 Mo/MΦ accumulation scenarios. We show that Ly-6C(high) monocytes infiltrate the infarcted myocardium and, unlike Ly-6C(low) monocytes, differentiate to cardiac macrophages. In the early, inflammatory phase of acute myocardial ischemic injury, Ly-6C(high) monocytes accrue in response to a brief C-C chemokine ligand 2 burst. In the second, reparative phase, accumulated Ly-6C(high) monocytes give rise to reparative Ly-6C(low) F4/80(high) macrophages that proliferate locally. In the absence of Nr4a1, Ly-6C(high) monocytes express heightened levels of C-C chemokine receptor 2 on their surface, avidly infiltrate the myocardium, and differentiate to abnormally inflammatory macrophages, which results in defective healing and compromised heart function. Ly-6C(high) monocytes orchestrate both inflammatory and reparative phases during myocardial infarction and depend on Nr4a1 to limit their influx and inflammatory cytokine expression.

  2. Sumoylation of Heterogeneous Nuclear Ribonucleoproteins, Zinc Finger Proteins, and Nuclear Pore Complex Proteins: A Proteomic Analysis

    DTIC Science & Technology

    2004-06-08

    ProteomeX 2D LCMS workstation (Thermo Finnigan, San Jose, CA). The strong cation exchange ( SCX ) column was removed from the system, and the tubings...purified on Ni-NTA column (Qiagen, Valencia, CA). One liter equivalent of HeLa cell nuclei extract (Biovest) was re- sespended in lysis buffer B [50...Softlink avidin column (Promega) equilibrated with 50 mM Hepes (pH 7.5) containing 5 mM MgCl2 and 1 mM DTT. The column was washed with 10 volumes of 50 mM

  3. Advanced reactor physics methods for heterogeneous reactor cores

    NASA Astrophysics Data System (ADS)

    Thompson, Steven A.

    To maintain the economic viability of nuclear power the industry has begun to emphasize maximizing the efficiency and output of existing nuclear power plants by using longer fuel cycles, stretch power uprates, shorter outage lengths, mixed-oxide (MOX) fuel and more aggressive operating strategies. In order to accommodate these changes, while still satisfying the peaking factor and power envelope requirements necessary to maintain safe operation, more complexity in commercial core designs have been implemented, such as an increase in the number of sub-batches and an increase in the use of both discrete and integral burnable poisons. A consequence of the increased complexity of core designs, as well as the use of MOX fuel, is an increase in the neutronic heterogeneity of the core. Such heterogeneous cores introduce challenges for the current methods that are used for reactor analysis. New methods must be developed to address these deficiencies while still maintaining the computational efficiency of existing reactor analysis methods. In this thesis, advanced core design methodologies are developed to be able to adequately analyze the highly heterogeneous core designs which are currently in use in commercial power reactors. These methodological improvements are being pursued with the goal of not sacrificing the computational efficiency which core designers require. More specifically, the PSU nodal code NEM is being updated to include an SP3 solution option, an advanced transverse leakage option, and a semi-analytical NEM solution option.

  4. Static heterogeneities in liquid water

    NASA Astrophysics Data System (ADS)

    Stanley, H. Eugene; Buldyrev, Sergey V.; Giovambattista, Nicolas

    2004-10-01

    The thermodynamic behavior of water seems to be closely related to static heterogeneities. These static heterogeneities are related to the local structure of water molecules, and when properly characterized, may offer an economical explanation of thermodynamic data. The key feature of liquid water is not so much that the existence of hydrogen bonds, first pointed out by Linus Pauling, but rather the local geometry of the liquid molecules is not spherical or oblong but tetrahedral. In the consideration of static heterogeneities, this local geometry is critical. Recent experiments suggested more than one phase of amorphous solid water, while simulations suggest that one of these phases is metastable with respect to another, so that in fact there are only two stable phases.

  5. Resource heterogeneity can facilitate cooperation

    PubMed Central

    Kun, Ádám; Dieckmann, Ulf

    2013-01-01

    Although social structure is known to promote cooperation, by locally exposing selfish agents to their own deeds, studies to date assumed that all agents have access to the same level of resources. This is clearly unrealistic. Here we find that cooperation can be maintained when some agents have access to more resources than others. Cooperation can then emerge even in populations in which the temptation to defect is so strong that players would act fully selfishly if their resources were distributed uniformly. Resource heterogeneity can thus be crucial for the emergence and maintenance of cooperation. We also show that resource heterogeneity can hinder cooperation once the temptation to defect is significantly lowered. In all cases, the level of cooperation can be maximized by managing resource heterogeneity. PMID:24088665

  6. Quantifying tumour heterogeneity with CT

    PubMed Central

    Miles, Kenneth A.

    2013-01-01

    Abstract Heterogeneity is a key feature of malignancy associated with adverse tumour biology. Quantifying heterogeneity could provide a useful non-invasive imaging biomarker. Heterogeneity on computed tomography (CT) can be quantified using texture analysis which extracts spatial information from CT images (unenhanced, contrast-enhanced and derived images such as CT perfusion) that may not be perceptible to the naked eye. The main components of texture analysis can be categorized into image transformation and quantification. Image transformation filters the conventional image into its basic components (spatial, frequency, etc.) to produce derived subimages. Texture quantification techniques include structural-, model- (fractal dimensions), statistical- and frequency-based methods. The underlying tumour biology that CT texture analysis may reflect includes (but is not limited to) tumour hypoxia and angiogenesis. Emerging studies show that CT texture analysis has the potential to be a useful adjunct in clinical oncologic imaging, providing important information about tumour characterization, prognosis and treatment prediction and response. PMID:23545171

  7. Simulator for heterogeneous dataflow architectures

    NASA Technical Reports Server (NTRS)

    Malekpour, Mahyar R.

    1993-01-01

    A new simulator is developed to simulate the execution of an algorithm graph in accordance with the Algorithm to Architecture Mapping Model (ATAMM) rules. ATAMM is a Petri Net model which describes the periodic execution of large-grained, data-independent dataflow graphs and which provides predictable steady state time-optimized performance. This simulator extends the ATAMM simulation capability from a heterogenous set of resources, or functional units, to a more general heterogenous architecture. Simulation test cases show that the simulator accurately executes the ATAMM rules for both a heterogenous architecture and a homogenous architecture, which is the special case for only one processor type. The simulator forms one tool in an ATAMM Integrated Environment which contains other tools for graph entry, graph modification for performance optimization, and playback of simulations for analysis.

  8. Resource heterogeneity can facilitate cooperation.

    PubMed

    Kun, Ádám; Dieckmann, Ulf

    2013-01-01

    Although social structure is known to promote cooperation, by locally exposing selfish agents to their own deeds, studies to date assumed that all agents have access to the same level of resources. This is clearly unrealistic. Here we find that cooperation can be maintained when some agents have access to more resources than others. Cooperation can then emerge even in populations in which the temptation to defect is so strong that players would act fully selfishly if their resources were distributed uniformly. Resource heterogeneity can thus be crucial for the emergence and maintenance of cooperation. We also show that resource heterogeneity can hinder cooperation once the temptation to defect is significantly lowered. In all cases, the level of cooperation can be maximized by managing resource heterogeneity.

  9. Simulator for heterogeneous dataflow architectures

    NASA Astrophysics Data System (ADS)

    Malekpour, Mahyar R.

    1993-09-01

    A new simulator is developed to simulate the execution of an algorithm graph in accordance with the Algorithm to Architecture Mapping Model (ATAMM) rules. ATAMM is a Petri Net model which describes the periodic execution of large-grained, data-independent dataflow graphs and which provides predictable steady state time-optimized performance. This simulator extends the ATAMM simulation capability from a heterogenous set of resources, or functional units, to a more general heterogenous architecture. Simulation test cases show that the simulator accurately executes the ATAMM rules for both a heterogenous architecture and a homogenous architecture, which is the special case for only one processor type. The simulator forms one tool in an ATAMM Integrated Environment which contains other tools for graph entry, graph modification for performance optimization, and playback of simulations for analysis.

  10. Nuclear photonics

    NASA Astrophysics Data System (ADS)

    Habs, D.; Günther, M. M.; Jentschel, M.; Thirolf, P. G.

    2012-07-01

    With the planned new γ-beam facilities like MEGa-ray at LLNL (USA) or ELI-NP at Bucharest (Romania) with 1013 γ/s and a band width of ΔEγ/Eγ≈10-3, a new era of γ beams with energies up to 20MeV comes into operation, compared to the present world-leading HIγS facility at Duke University (USA) with 108 γ/s and ΔEγ/Eγ≈3ṡ10-2. In the long run even a seeded quantum FEL for γ beams may become possible, with much higher brilliance and spectral flux. At the same time new exciting possibilities open up for focused γ beams. Here we describe a new experiment at the γ beam of the ILL reactor (Grenoble, France), where we observed for the first time that the index of refraction for γ beams is determined by virtual pair creation. Using a combination of refractive and reflective optics, efficient monochromators for γ beams are being developed. Thus, we have to optimize the total system: the γ-beam facility, the γ-beam optics and γ detectors. We can trade γ intensity for band width, going down to ΔEγ/Eγ≈10-6 and address individual nuclear levels. The term "nuclear photonics" stresses the importance of nuclear applications. We can address with γ-beams individual nuclear isotopes and not just elements like with X-ray beams. Compared to X rays, γ beams can penetrate much deeper into big samples like radioactive waste barrels, motors or batteries. We can perform tomography and microscopy studies by focusing down to μm resolution using Nuclear Resonance Fluorescence (NRF) for detection with eV resolution and high spatial resolution at the same time. We discuss the dominating M1 and E1 excitations like the scissors mode, two-phonon quadrupole octupole excitations, pygmy dipole excitations or giant dipole excitations under the new facet of applications. We find many new applications in biomedicine, green energy, radioactive waste management or homeland security. Also more brilliant secondary beams of neutrons and positrons can be produced.

  11. Nuclear photonics

    SciTech Connect

    Habs, D.; Guenther, M. M.; Jentschel, M.; Thirolf, P. G.

    2012-07-09

    With the planned new {gamma}-beam facilities like MEGa-ray at LLNL (USA) or ELI-NP at Bucharest (Romania) with 10{sup 13}{gamma}/s and a band width of {Delta}E{gamma}/E{gamma} Almost-Equal-To 10{sup -3}, a new era of {gamma} beams with energies up to 20MeV comes into operation, compared to the present world-leading HI{gamma}S facility at Duke University (USA) with 10{sup 8}{gamma}/s and {Delta}E{gamma}/E{gamma} Almost-Equal-To 3 Dot-Operator 10{sup -2}. In the long run even a seeded quantum FEL for {gamma} beams may become possible, with much higher brilliance and spectral flux. At the same time new exciting possibilities open up for focused {gamma} beams. Here we describe a new experiment at the {gamma} beam of the ILL reactor (Grenoble, France), where we observed for the first time that the index of refraction for {gamma} beams is determined by virtual pair creation. Using a combination of refractive and reflective optics, efficient monochromators for {gamma} beams are being developed. Thus, we have to optimize the total system: the {gamma}-beam facility, the {gamma}-beam optics and {gamma} detectors. We can trade {gamma} intensity for band width, going down to {Delta}E{gamma}/E{gamma} Almost-Equal-To 10{sup -6} and address individual nuclear levels. The term 'nuclear photonics' stresses the importance of nuclear applications. We can address with {gamma}-beams individual nuclear isotopes and not just elements like with X-ray beams. Compared to X rays, {gamma} beams can penetrate much deeper into big samples like radioactive waste barrels, motors or batteries. We can perform tomography and microscopy studies by focusing down to {mu}m resolution using Nuclear Resonance Fluorescence (NRF) for detection with eV resolution and high spatial resolution at the same time. We discuss the dominating M1 and E1 excitations like the scissors mode, two-phonon quadrupole octupole excitations, pygmy dipole excitations or giant dipole excitations under the new facet of

  12. Dynamic fracture of heterogeneous materials

    SciTech Connect

    Stout, M.G.; Liu, C.; Addessio, F.L.; Williams, T.O.; Bennett, J.G.; Haberman, K.S.; Asay, B.W.

    1998-12-31

    This is the final report of a one-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The objective of this project was to investigate the fundamental aspects of the process of dynamic fracture propagation in heterogeneous materials. The work focused on three important, but poorly understood, aspects of dynamic fracture for materials with a heterogeneous microstructure. These were: the appropriateness of using a single-parameter asymptotic analysis to describe dynamic crack-tip deformation fields, the temperature rises at the tip and on the flanks of a running crack, and the constitutive modeling of damage initiation and accumulation.

  13. Nuclear Weapons Targeting, AP-550, CROM A1, Reference Manual.

    DTIC Science & Technology

    1979-06-01

    when the cal cu i1 t oJr i s r iii in inq g i CPWI memory. The RS ~T key il so ta-kes tire(’ CICula1ttor ou[t o ryilo p ro,; ramr and leaves the pointer...11OBmax = 2308 yl/ 3 exp(-AJVN/15) for P-targets HOBmax = the minimum of: 900Y1/3 epQ -targets 2308Y2 / 3 exp(-AJVN/15) 28 where AJVN = adjusted... RS MuI1 Yield (KT) HOB (ft) CEP (ft) Offset, PEH (ft) (ft) (if) of Safety PH(f SOURCE OF DATA: Defense Intelligence Agency, Physical Vulnerability

  14. Nuclear overlap functions

    SciTech Connect

    Eskola, K.J.; Vogt, R.; Wang, X.N.

    1995-07-01

    A three parameter Wood-Saxon shape is used to describe the nuclear density distribution, which R{sub A} is the nuclear radius, {approx} is the surface thickness, and {omega} allows for central irregularities. The electron scattering data is used where available for R{sub A}, z, and {omega}. When data is unavailable, the parameters {omega} = O, z = 0.54 fm and R{sub A} = 1.19 A{sup 1/3} - 1.61 A{sup -1/3} fm are used. The central density {rho}{sub 0} is found from the normalization {infinity} d{sup 3}r{rho}{sub A}(r) = A.

  15. The Nuclear Power/Nuclear Weapons Connection.

    ERIC Educational Resources Information Center

    Totten, Sam; Totten, Martha Wescoat

    1985-01-01

    Once they have nuclear power, most countries will divert nuclear materials from commercial to military programs. In excerpts from the book "Facing the Danger" (by Totten, S. and M. W., Crossing Press, 1984), five anti-nuclear activists explain how and why they have been addressing the nuclear connection. (RM)

  16. The Nuclear Power and Nuclear Weapons Connection.

    ERIC Educational Resources Information Center

    Leventhal, Paul

    1990-01-01

    Explains problems enforcing the Nuclear Non-Proliferation Treaty (NPT) of 1968. Provides factual charts and details concerning the production of nuclear energy and arms, the processing and disposal of waste products, and outlines the nuclear fuel cycle. Discusses safeguards, the risk of nuclear terrorism, and ways to deal with these problems. (NL)

  17. The Nuclear Power and Nuclear Weapons Connection.

    ERIC Educational Resources Information Center

    Leventhal, Paul

    1990-01-01

    Explains problems enforcing the Nuclear Non-Proliferation Treaty (NPT) of 1968. Provides factual charts and details concerning the production of nuclear energy and arms, the processing and disposal of waste products, and outlines the nuclear fuel cycle. Discusses safeguards, the risk of nuclear terrorism, and ways to deal with these problems. (NL)

  18. The Nuclear Power/Nuclear Weapons Connection.

    ERIC Educational Resources Information Center

    Totten, Sam; Totten, Martha Wescoat

    1985-01-01

    Once they have nuclear power, most countries will divert nuclear materials from commercial to military programs. In excerpts from the book "Facing the Danger" (by Totten, S. and M. W., Crossing Press, 1984), five anti-nuclear activists explain how and why they have been addressing the nuclear connection. (RM)

  19. NUCLEAR REACTOR

    DOEpatents

    Treshow, M.

    1958-08-19

    A neuclear reactor is described of the heterogeneous type and employing replaceable tubular fuel elements and heavy water as a coolant and moderator. A pluraltty of fuel tubesa having their axes parallel, extend through a tank type pressure vessel which contatns the liquid moderator. The fuel elements are disposed within the fuel tubes in the reaetive portion of the pressure vessel during normal operation and the fuel tubes have removable plug members at each end to permit charging and discharging of the fuel elements. The fuel elements are cylindrical strands of jacketed fissionable material having helical exterior ribs. A bundle of fuel elements are held within each fuel tube with their longitudinal axes parallel, the ribs serving to space them apart along their lengths. Coolant liquid is circulated through the fuel tubes between the spaced fuel elements. Suitable control rod and monitoring means are provided for controlling the reactor.

  20. NUCLEAR REACTORS

    DOEpatents

    Long, E.; Ashley, J.W.

    1958-12-16

    A graphite moderator structure is described for a gas-cooled nuclear reactor having a vertical orlentation wherein the structure is physically stable with regard to dlmensional changes due to Wigner growth properties of the graphite, and leakage of coolant gas along spaces in the structure is reduced. The structure is comprised of stacks of unlform right prismatic graphite blocks positioned in layers extending in the direction of the lengths of the blocks, the adjacent end faces of the blocks being separated by pairs of tiles. The blocks and tiles have central bores which are in alignment when assembled and are provided with cooperatlng keys and keyways for physical stability.

  1. Nuclear energy.

    PubMed

    Grandin, Karl; Jagers, Peter; Kullander, Sven

    2010-01-01

    Nuclear energy can play a role in carbon free production of electrical energy, thus making it interesting for tomorrow's energy mix. However, several issues have to be addressed. In fission technology, the design of so-called fourth generation reactors show great promise, in particular in addressing materials efficiency and safety issues. If successfully developed, such reactors may have an important and sustainable part in future energy production. Working fusion reactors may be even more materials efficient and environmental friendly, but also need more development and research. The roadmap for development of fourth generation fission and fusion reactors, therefore, asks for attention and research in these fields must be strengthened.

  2. Nuclear security

    SciTech Connect

    Dingell, J.D.

    1991-02-01

    The Department of Energy's (DOE) Lawrence Livermore National Laboratory, located in Livermore, California, generates and controls large numbers of classified documents associated with the research and testing of nuclear weapons. Concern has been raised about the potential for espionage at the laboratory and the national security implications of classified documents being stolen. This paper determines the extent of missing classified documents at the laboratory and assesses the adequacy of accountability over classified documents in the laboratory's custody. Audit coverage was limited to the approximately 600,000 secret documents in the laboratory's custody. The adequacy of DOE's oversight of the laboratory's secret document control program was also assessed.

  3. Nuclear dualism.

    PubMed

    Karrer, Kathleen M

    2012-01-01

    Nuclear dualism is a characteristic feature of the ciliated protozoa. Tetrahymena have two different nuclei in each cell. The larger, polyploid, somatic macronucleus (MAC) is the site of transcriptional activity in the vegetatively growing cell. The smaller, diploid micronucleus (MIC) is transcriptionally inactive in vegetative cells, but is transcriptionally active in mating cells and responsible for the genetic continuity during sexual reproduction. Although the MICs and MACs develop from mitotic products of a common progenitor and reside in a common cytoplasm, they are different from one another in almost every respect. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Upstream reciprocity in heterogeneous networks.

    PubMed

    Iwagami, Akio; Masuda, Naoki

    2010-08-07

    Many mechanisms for the emergence and maintenance of altruistic behavior in social dilemma situations have been proposed. Indirect reciprocity is one such mechanism, where other-regarding actions of a player are eventually rewarded by other players with whom the original player has not interacted. The upstream reciprocity (also called generalized indirect reciprocity) is a type of indirect reciprocity and represents the concept that those helped by somebody will help other unspecified players. In spite of the evidence for the enhancement of helping behavior by upstream reciprocity in rats and humans, theoretical support for this mechanism is not strong. In the present study, we numerically investigate upstream reciprocity in heterogeneous contact networks, in which the players generally have different number of neighbors. We show that heterogeneous networks considerably enhance cooperation in a game of upstream reciprocity. In heterogeneous networks, the most generous strategy, by which a player helps a neighbor on being helped and in addition initiates helping behavior, first occupies hubs in a network and then disseminates to other players. The scenario to achieve enhanced altruism resembles that seen in the case of the Prisoner's Dilemma game in heterogeneous networks. Copyright 2010 Elsevier Ltd. All rights reserved.

  5. Floodplain heterogeneity and meander migration

    USDA-ARS?s Scientific Manuscript database

    The impact of horizontal heterogeneity of floodplain soils on rates and patterns of meander migration is analyzed with a Ikeda et al. (1981)-type model for hydrodynamics and bed morphodynamics, coupled with a physically-based bank erosion model according to the approach developed by Motta et al. (20...

  6. Modeling large heterogeneous RF structures

    SciTech Connect

    Li, Zenghai; Ko, Kwok; Srinivas, V.; Higo, Toshiyasu

    1996-11-01

    Large heterogeneous structures are difficult to model on a numerical grid because of the limitations on computing resources, so that alternate approaches such as equivalent circuits and mode-matching have been developed to treat this problem. This paper will describe the three methods and will analyze a structure representative of the SLAC and JLC detuned structures to compare the efficacy of each approach.

  7. Genetic heterogeneity in human disease.

    PubMed

    McClellan, Jon; King, Mary-Claire

    2010-04-16

    Strong evidence suggests that rare mutations of severe effect are responsible for a substantial portion of complex human disease. Evolutionary forces generate vast genetic heterogeneity in human illness by introducing many new variants in each generation. Current sequencing technologies offer the possibility of finding rare disease-causing mutations and the genes that harbor them. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Teaching about Heterogeneous Response Models

    ERIC Educational Resources Information Center

    Murray, Michael P.

    2014-01-01

    Individuals vary in their responses to incentives and opportunities. For example, additional education will affect one person differently than another. In recent years, econometricians have given increased attention to such heterogeneous responses and to the consequences of such responses for interpreting regression estimates, especially…

  9. Heterogeneous porous media in hydrology

    NASA Astrophysics Data System (ADS)

    Ababou, Rachid

    In natural geologic formations, flow and transport-related processes are perturbed by multidimensional and anisotropic material heterogeneities of diverse sizes, shapes, and origins (bedding, layering, inclusions, fractures, grains, for example). Heterogeneity tends to disperse and mix transported quantities and may initiate new transfer mechanisms not seen in ideally homogeneous porous media. Effective properties such as conductivity and dispersivity may not be simple averages of locally measured quantities.The special session, “Effective Constitutive Laws for Heterogeneous Porous Media,” convened at AGU's 1992 Fall Meeting in San Francisco, addressed these issue. Over forty-five contributions, both oral and poster, covering a broad range of physical phenomena were presented. The common theme was the macroscale characterization and modeling of flow and flow-related processes in geologic media that are heterogeneous at various scales (from grain size or fracture aperture, up to regional scales). The processes analyzed in the session included coupled hydro-mechanical processes; Darcy-type flow in the saturated, unsaturated, or two-phase regimes; tracer transport, dilution, and dispersion. These processes were studied for either continuous (porous) or discontinuous (fractured) media.

  10. Molecular ingredients of heterogeneous catalysis

    SciTech Connect

    Somorjai, G.A.

    1982-06-01

    The purpose of this paper is to present a review and status report to those in theoretical chemistry of the rapidly developing surface science of heterogeneous catalysis. The art of catalysis is developing into science. This profound change provides one with opportunities not only to understand the molecular ingredients of important catalytic systems but also to develop new and improved catalyst. The participation of theorists to find answers to important questions is sorely needed for the sound development of the field. It is the authors hope that some of the outstanding problems of heterogeneous catalysis that are identified in this paper will be investigated. For this purpose the paper is divided into several sections. The brief Introduction to the methodology and recent results of the surface science of heterogeneous catalysis is followed by a review of the concepts of heterogeneous catalysis. Then, the experimental results that identified the three molecular ingredients of catalysis, structure, carbonaceous deposit and the oxidation state of surface atoms are described. Each section is closed with a summary and a list of problems that require theoretical and experimental scrutiny. Finally attempts to build new catalyst systems and the theoretical and experimental problems that appeared in the course of this research are described.

  11. Heterogeneous catalytic alcoholysis of benzonitrile

    SciTech Connect

    Kagarlitskii, A.D.; Dmumakaev, K.Kh.; Bekova, N.S.

    1986-04-01

    The authors investigate the possibility of the direct heterogeneous catalytic synthesis of ethylbenzoate from benzonitrile. The catalysts tested were oxides of aluminium, titanium, and vanadium. The main conversion product detected chromatographically was ethylbenzoate; benzaldehyde, benzamide, and benzanilide were also identified. Aluminium oxide was found to be the most effective catalyst.

  12. Social Capital and Community Heterogeneity

    ERIC Educational Resources Information Center

    Coffe, Hilde

    2009-01-01

    Recent findings indicate that more pronounced community heterogeneity is associated with lower levels of social capital. These studies, however, concentrate on specific aspects in which people differ (such as income inequality or ethnic diversity). In the present paper, we introduce the number of parties in the local party system as a more…

  13. Surface science of heterogeneous reactions.

    PubMed

    White, J M

    1982-10-29

    Some of the present and future directions for surface science as a growing and naturally interdisciplinary subject are reviewed. Particular attention is given to surface reaction chemistry as it is related to heterogenous catalysis, a subject area where there are abundant opportunities for detailed measurements of structure and dynamics at the molecular level.

  14. Social Capital and Community Heterogeneity

    ERIC Educational Resources Information Center

    Coffe, Hilde

    2009-01-01

    Recent findings indicate that more pronounced community heterogeneity is associated with lower levels of social capital. These studies, however, concentrate on specific aspects in which people differ (such as income inequality or ethnic diversity). In the present paper, we introduce the number of parties in the local party system as a more…

  15. Flammability of Heterogeneously Combusting Metals

    NASA Technical Reports Server (NTRS)

    Jones, Peter D.

    1998-01-01

    Most engineering materials, including some metals, most notably aluminum, burn in homogeneous combustion. 'Homogeneous' refers to both the fuel and the oxidizer being in the same phase, which is usually gaseous. The fuel and oxidizer are well mixed in the combustion reaction zone, and heat is released according to some relation like q(sub c) = delta H(sub c)c[((rho/rho(sub 0))]exp a)(exp -E(sub c)/RT), Eq. (1) where the pressure exponent a is usually close to unity. As long as there is enough heat released, combustion is sustained. It is useful to conceive of a threshold pressure beyond which there is sufficient heat to keep the temperature high enough to sustain combustion, and beneath which the heat is so low that temperature drains away and the combustion is extinguished. Some materials burn in heterogeneous combustion, in which the fuel and oxidizer are in different phases. These include iron and nickel based alloys, which burn in the liquid phase with gaseous oxygen. Heterogeneous combustion takes place on the surface of the material (fuel). Products of combustion may appear as a solid slag (oxide) which progressively covers the fuel. Propagation of the combustion melts and exposes fresh fuel. Heterogeneous combustion heat release also follows the general form of Eq.(1), except that the pressure exponent a tends to be much less than 1. Therefore, the increase in heat release with increasing pressure is not as dramatic as it is in homogeneous combustion. Although the concept of a threshold pressure still holds in heterogeneous combustion, the threshold is more difficult to identify experimentally, and pressure itself becomes less important relative to the heat transfer paths extant in any specific application. However, the constants C, a, and E(sub c) may still be identified by suitable data reduction from heterogeneous combustion experiments, and may be applied in a heat transfer model to judge the flammability of a material in any particular actual

  16. Surface heterogeneity of small asteroids

    NASA Astrophysics Data System (ADS)

    Sasaki, Sho

    A rubble pile model of asteroid origin would predict averaged rather homogeneous surface of an asteroid. Previous spacecraft observations (mostly S-type asteroids) did not show large color/albedo variation on the surface. Vesta would be exceptional since HST observation suggested that its surface should be heterogeneous due to the impact excavation of the interior. As for a young asteroid (832) Karin (age being 5Ma), Sasaki et al. (2004) detected variation of infrared spectra which could be explained by the difference of the space weathering degree. They discussed the possibility of the survival of the old surface. However, the variation was not confirmed by later observation (Chapman et al., 2007; Vernazza et al., 2007). Recent observation of a small (550m) asteroid Itokawa by Hayabusa spacecraft revealed that Itokawa is heterogeneous in color and albedo although the overall rocky structure is considered as a rubble pile (Saito et al., 2006). The color difference can be explained by the difference of weathering degree (Ishiguro et al., 2008). The heterogeneity could be explained by mass movement caused by rapid rotation from YORP effect (Scheeres et al., 2007) or seismic shaking (Sasaki, 2006). Probably small silicate asteroids without significant regolith could have heterogeneous in color and albedo. On large asteroids (˜ a few 10km), regolith reaccumulation should have covered the underlying heterogeneity. References: Chapman, C. R. et al (2007) Icarus, 191, 323-329 Ishiguro, M. et al. (2008) MAPS, in press. Saito, J. et al. (2006) Science, 312, 1341-1344 Sasaki, S. (2006) in Spacecraft Reconnaissance of Asteroid and Comet Interiors Sasaki, T. et al (2004) Astrophys. J. 615, L161-L164 Scheeres, D. J. (2007) Icarus 188, 425-429 Vernazza, P. et al. (2007) Icarus 191, 330-336.

  17. Hydrological heterogeneity in agricultural riparian buffer strips

    NASA Astrophysics Data System (ADS)

    Hénault-Ethier, Louise; Larocque, Marie; Perron, Rachel; Wiseman, Natalie; Labrecque, Michel

    2017-03-01

    Riparian buffer strips (RBS) may protect surface water and groundwater in agricultural settings, although their effectiveness, observed in field-scale studies, may not extend to a watershed scale. Hydrologically-controlled leaching plots have often shown RBS to be effective at buffering nutrients and pesticides, but uncontrolled field studies have sometimes suggested limited effectiveness. The limited RBS effectiveness may be explained by the spatiotemporal hydrological heterogeneity near non-irrigated fields. This hypothesis was tested in conventional corn and soy fields in the St. Lawrence Lowlands of southern Quebec (Canada), where spring melt brings heavy and rapid runoff, while summer months are hot and dry. One field with a mineral soil (Saint-Roch-de-l'Achigan) and another with an organic-rich soil (Boisbriand) were equipped with passive runoff collectors, suction cup lysimeters, and piezometers placed before and after a 3 m-wide RBS, and monitored from 2011 to 2014. Soil topography of the RBS was mapped to a 1 cm vertical precision and a 50 cm sampling grid. On average, surface runoff intersects the RBS perpendicularly, but is subject to substantial local heterogeneity. Groundwater saturates the root zones, but flows little at the time of snowmelt. Groundwater flow is not consistently perpendicular to the RBS, and may reverse, flowing from stream to field under low water flow regimes with stream-aquifer connectivity, thus affecting RBS effectiveness calculations. Groundwater flow direction can be influenced by stratigraphy, local soil hydraulic properties, and historical modification of the agricultural stream beds. Understanding the spatiotemporal heterogeneity of surface and groundwater flows is essential to correctly assess the effectiveness of RBS in intercepting agro-chemical pollution. The implicit assumption that water flows across vegetated RBS, from the field to the stream, should always be verified.

  18. Applications of nuclear physics

    DOE PAGES

    Hayes-Sterbenz, Anna Catherine

    2017-01-10

    Today the applications of nuclear physics span a very broad range of topics and fields. This review discusses a number of aspects of these applications, including selected topics and concepts in nuclear reactor physics, nuclear fusion, nuclear non-proliferation, nuclear-geophysics, and nuclear medicine. The review begins with a historic summary of the early years in applied nuclear physics, with an emphasis on the huge developments that took place around the time of World War II, and that underlie the physics involved in designs of nuclear explosions, controlled nuclear energy, and nuclear fusion. The review then moves to focus on modern applicationsmore » of these concepts, including the basic concepts and diagnostics developed for the forensics of nuclear explosions, the nuclear diagnostics at the National Ignition Facility, nuclear reactor safeguards, and the detection of nuclear material production and trafficking. The review also summarizes recent developments in nuclear geophysics and nuclear medicine. The nuclear geophysics areas discussed include geo-chronology, nuclear logging for industry, the Oklo reactor, and geo-neutrinos. The section on nuclear medicine summarizes the critical advances in nuclear imaging, including PET and SPECT imaging, targeted radionuclide therapy, and the nuclear physics of medical isotope production. Lastly, each subfield discussed requires a review article unto itself, which is not the intention of the current review; rather, the current review is intended for readers who wish to get a broad understanding of applied nuclear physics.« less

  19. Applications of nuclear physics.

    PubMed

    Hayes, A C

    2017-02-01

    Today the applications of nuclear physics span a very broad range of topics and fields. This review discusses a number of aspects of these applications, including selected topics and concepts in nuclear reactor physics, nuclear fusion, nuclear non-proliferation, nuclear-geophysics, and nuclear medicine. The review begins with a historic summary of the early years in applied nuclear physics, with an emphasis on the huge developments that took place around the time of World War II, and that underlie the physics involved in designs of nuclear explosions, controlled nuclear energy, and nuclear fusion. The review then moves to focus on modern applications of these concepts, including the basic concepts and diagnostics developed for the forensics of nuclear explosions, the nuclear diagnostics at the National Ignition Facility, nuclear reactor safeguards, and the detection of nuclear material production and trafficking. The review also summarizes recent developments in nuclear geophysics and nuclear medicine. The nuclear geophysics areas discussed include geo-chronology, nuclear logging for industry, the Oklo reactor, and geo-neutrinos. The section on nuclear medicine summarizes the critical advances in nuclear imaging, including PET and SPECT imaging, targeted radionuclide therapy, and the nuclear physics of medical isotope production. Each subfield discussed requires a review article unto itself, which is not the intention of the current review; rather, the current review is intended for readers who wish to get a broad understanding of applied nuclear physics.

  20. Applications of nuclear physics

    NASA Astrophysics Data System (ADS)

    Hayes, A. C.

    2017-02-01

    Today the applications of nuclear physics span a very broad range of topics and fields. This review discusses a number of aspects of these applications, including selected topics and concepts in nuclear reactor physics, nuclear fusion, nuclear non-proliferation, nuclear-geophysics, and nuclear medicine. The review begins with a historic summary of the early years in applied nuclear physics, with an emphasis on the huge developments that took place around the time of World War II, and that underlie the physics involved in designs of nuclear explosions, controlled nuclear energy, and nuclear fusion. The review then moves to focus on modern applications of these concepts, including the basic concepts and diagnostics developed for the forensics of nuclear explosions, the nuclear diagnostics at the National Ignition Facility, nuclear reactor safeguards, and the detection of nuclear material production and trafficking. The review also summarizes recent developments in nuclear geophysics and nuclear medicine. The nuclear geophysics areas discussed include geo-chronology, nuclear logging for industry, the Oklo reactor, and geo-neutrinos. The section on nuclear medicine summarizes the critical advances in nuclear imaging, including PET and SPECT imaging, targeted radionuclide therapy, and the nuclear physics of medical isotope production. Each subfield discussed requires a review article unto itself, which is not the intention of the current review; rather, the current review is intended for readers who wish to get a broad understanding of applied nuclear physics.

  1. A1C Test

    MedlinePlus

    ... AACC products and services. Advertising & Sponsorship: Policy | Opportunities Hemoglobin A1c Share this page: Was this page helpful? Also known as: A1c; HbA1c; Glycohemoglobin; Glycated Hemoglobin; Glycosylated Hemoglobin Formal name: Hemoglobin A1c Related tests: ...

  2. Nuclear "waffles"

    NASA Astrophysics Data System (ADS)

    Schneider, A. S.; Berry, D. K.; Briggs, C. M.; Caplan, M. E.; Horowitz, C. J.

    2014-11-01

    Background: The dense neutron-rich matter found in supernovae and inside neutron stars is expected to form complex nonuniform phases, often referred to as nuclear pasta. The pasta shapes depend on density, temperature and proton fraction and determine many transport properties in supernovae and neutron star crusts. Purpose: To characterize the topology and compute two observables, the radial distribution function (RDF) g (r ) and the structure factor S (q ) , for systems with proton fractions Yp=0.10 ,0.20 ,0.30 , and 0.40 at about one-third of nuclear saturation density, n =0.050 fm-3 , and temperatures near k T =1 MeV . Methods: We use two recently developed hybrid CPU/GPU codes to perform large scale molecular dynamics (MD) simulations with 51 200 and 409 600 nucleons. From the output of the MD simulations we obtain the two desired observables. Results: We compute and discuss the differences in topology and observables for each simulation. We observe that the two lowest proton fraction systems simulated, Yp=0.10 and 0.20 , equilibrate quickly and form liquidlike structures. Meanwhile, the two higher proton fraction systems, Yp=0.30 and 0.40 , take a longer time to equilibrate and organize themselves in solidlike periodic structures. Furthermore, the Yp=0.40 system is made up of slabs, lasagna phase, interconnected by defects while the Yp=0.30 systems consist of a stack of perforated plates, the nuclear waffle phase. Conclusions: The periodic configurations observed in our MD simulations for proton fractions Yp≥0.30 have important consequences for the structure factors S (q ) of protons and neutrons, which relate to many transport properties of supernovae and neutron star crust. A detailed study of the waffle phase and how its structure depends on temperature, size of the simulation, and the screening length showed that finite-size effects appear to be under control and, also, that the plates in the waffle phase merge at temperatures slightly above 1.0 MeV and

  3. A dynamic fuel cycle analysis for a heterogeneous thorium-DUPIC recycle in CANDU reactors

    SciTech Connect

    Jeong, C. J.; Park, C. J.; Choi, H.

    2006-07-01

    A heterogeneous thorium fuel recycle scenario in a Canada deuterium uranium (CANDU) reactor has been analyzed by the dynamic analysis method. The thorium recycling is performed through a dry process which has a strong proliferation resistance. In the fuel cycle model, the existing nuclear power plant construction plan was considered up to 2016, while the nuclear demand growth rate from the year 2016 was assumed to be 0%. In this analysis, the spent fuel inventory as well as the amount of plutonium, minor actinides, and fission products of a multiple thorium recycling fuel cycle were estimated and compared to those of the once-through fuel cycle. The analysis results have shown that the heterogeneous thorium fuel cycle can be constructed through the dry process technology. It is also shown that the heterogeneous thorium fuel cycle can reduce the spent fuel inventory and save on the natural uranium resources when compared with the once-through cycle. (authors)

  4. NUCLEAR REACTOR

    DOEpatents

    Grebe, J.J.

    1959-12-15

    A reactor which is particularly adapted tu serve as a heat source for a nuclear powered alrcraft or rocket is described. The core of this reactor consists of a porous refractory modera;or body which is impregnated with fissionable nuclei. The core is designed so that its surface forms tapered inlet and outlet ducts which are separated by the porous moderator body. In operation a gaseous working fluid is circulated through the inlet ducts to the surface of the moderator, enters and passes through the porous body, and is heated therein. The hot gas emerges into the outlet ducts and is available to provide thrust. The principle advantage is that tremendous quantities of gas can be quickly heated without suffering an excessive pressure drop.

  5. NUCLEAR REACTOR

    DOEpatents

    Christy, R.F.

    1958-07-15

    A nuclear reactor of the homogeneous liquid fuel type is described wherein the fissionable isotope is suspended or dissolved in a liquid moderator such as water. The reactor core is comprised essentially of a spherical vessel for containing the reactive composition surrounded by a reflector, preferably of beryllium oxide. The reactive composition may be an ordinary water solution of a soluble salt of uranium, the quantity of fissionable isotope in solution being sufficient to provide a critical mass in the vessel. The liquid fuel is stored in a tank of non-crtttcal geometry below the reactor vessel and outside of the reflector and is passed from the tank to the vessel through a pipe connecting the two by air pressure means. Neutron absorbing control and safety rods are operated within slots in the reflector adjacent to the vessel.

  6. Nuclear reactor

    DOEpatents

    Wade, Elman E.

    1979-01-01

    A nuclear reactor including two rotatable plugs and a positive top core holddown structure. The top core holddown structure is divided into two parts: a small core cover, and a large core cover. The small core cover, and the upper internals associated therewith, are attached to the small rotating plug, and the large core cover, with its associated upper internals, is attached to the large rotating plug. By so splitting the core holddown structures, under-the-plug refueling is accomplished without the necessity of enlarging the reactor pressure vessel to provide a storage space for the core holddown structure during refueling. Additionally, the small and large rotating plugs, and their associated core covers, are arranged such that the separation of the two core covers to permit rotation is accomplished without the installation of complex lifting mechanisms.

  7. NUCLEAR REACTOR

    DOEpatents

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  8. Nuclear exoticism

    NASA Astrophysics Data System (ADS)

    Penionzhkevich, Yu. E.

    2016-07-01

    Extreme states of nuclearmatter (such that feature high spins, large deformations, high density and temperature, or a large excess of neutrons and protons) play an important role in studying fundamental properties of nuclei and are helpful in solving the problem of constructing the equation of state for nuclear matter. The synthesis of neutron-rich nuclei near the nucleon drip lines and investigation of their properties permit drawing conclusions about the positions of these boundaries and deducing information about unusual states of such nuclei and about their decays. At the present time, experimental investigations along these lines can only be performed via the cooperation of leading research centers that possess powerful heavy-ion accelerators, such as the Large Hadron Collider (LHC) at CERN and the heavy-ion cyclotrons at the Joint Institute for Nuclear Research (JINR, Dubna), where respective experiments are being conducted by physicists from about 20 JINR member countries. The present article gives a survey of the most recent results in the realms of super neutron-rich nuclei. Implications of the change in the structure of such nuclei near the nucleon drip lines are discussed. Information about the results obtained by measuring the masses (binding energies) of exotic nuclei, the nucleon-distribution radii (neutron halo) and momentum distributions in them, and their deformations and quantum properties is presented. It is shown that the properties of nuclei lying near the stability boundaries differ strongly from the properties of other nuclei. The problem of the stability of nuclei that is associated with the magic numbers of 20 and 28 is discussed along with the effect of new magic numbers.

  9. Nuclear exoticism

    SciTech Connect

    Penionzhkevich, Yu. E.

    2016-07-15

    Extreme states of nuclearmatter (such that feature high spins, large deformations, high density and temperature, or a large excess of neutrons and protons) play an important role in studying fundamental properties of nuclei and are helpful in solving the problem of constructing the equation of state for nuclear matter. The synthesis of neutron-rich nuclei near the nucleon drip lines and investigation of their properties permit drawing conclusions about the positions of these boundaries and deducing information about unusual states of such nuclei and about their decays. At the present time, experimental investigations along these lines can only be performed via the cooperation of leading research centers that possess powerful heavy-ion accelerators, such as the Large Hadron Collider (LHC) at CERN and the heavy-ion cyclotrons at the Joint Institute for Nuclear Research (JINR, Dubna), where respective experiments are being conducted by physicists from about 20 JINR member countries. The present article gives a survey of the most recent results in the realms of super neutron-rich nuclei. Implications of the change in the structure of such nuclei near the nucleon drip lines are discussed. Information about the results obtained by measuring the masses (binding energies) of exotic nuclei, the nucleon-distribution radii (neutron halo) and momentum distributions in them, and their deformations and quantum properties is presented. It is shown that the properties of nuclei lying near the stability boundaries differ strongly from the properties of other nuclei. The problem of the stability of nuclei that is associated with the magic numbers of 20 and 28 is discussed along with the effect of new magic numbers.

  10. Biodiesel production using heterogeneous catalysts.

    PubMed

    Semwal, Surbhi; Arora, Ajay K; Badoni, Rajendra P; Tuli, Deepak K

    2011-02-01

    The production and use of biodiesel has seen a quantum jump in the recent past due to benefits associated with its ability to mitigate greenhouse gas (GHG). There are large number of commercial plants producing biodiesel by transesterification of vegetable oils and fats based on base catalyzed (caustic) homogeneous transesterification of oils. However, homogeneous process needs steps of glycerol separation, washings, very stringent and extremely low limits of Na, K, glycerides and moisture limits in biodiesel. Heterogeneous catalyzed production of biodiesel has emerged as a preferred route as it is environmentally benign needs no water washing and product separation is much easier. The present report is review of the progress made in development of heterogeneous catalysts suitable for biodiesel production. This review shall help in selection of suitable catalysts and the optimum conditions for biodiesel production.

  11. Nuclear Education Update.

    ERIC Educational Resources Information Center

    Winter, Metta L.

    1986-01-01

    Addresses the controversial issue of nuclear education in public schools. Highlights include resolutions passed by the National Congress of Parent Teacher Associations, what nuclear education is, distinction between nuclear education and education in the nuclear age, educational materials, a review of teaching materials, nuclear literacy, and…

  12. Nuclear Education Update.

    ERIC Educational Resources Information Center

    Winter, Metta L.

    1986-01-01

    Addresses the controversial issue of nuclear education in public schools. Highlights include resolutions passed by the National Congress of Parent Teacher Associations, what nuclear education is, distinction between nuclear education and education in the nuclear age, educational materials, a review of teaching materials, nuclear literacy, and…

  13. Temperature chaos and quenched heterogeneities

    NASA Astrophysics Data System (ADS)

    Barucca, Paolo; Parisi, Giorgio; Rizzo, Tommaso

    2014-03-01

    We present a treatable generalization of the Sherrington-Kirkpatrick (SK) model which introduces correlations in the elements of the coupling matrix through multiplicative disorder on the single variables and investigate the consequences on the phase diagram. We define a generalized qEA parameter and test the structural stability of the SK results in this correlated case evaluating the de Almeida-Thouless line of the model. As a main result we demonstrate the increase of temperature chaos effects due to heterogeneities.

  14. Measuring heterogeneous remanence in paleomagnetism

    NASA Astrophysics Data System (ADS)

    Borradaile, Graham J.; Geneviciene, Ieva

    2007-06-01

    Remanence directions of from the same block-sample may be inconsistent or unrepresentative due to orientation and location heterogeneity of their remanence-bearing minerals (RBM). Magnetization-heterogeneity is usually undetectable at the specimen-level but we replicated its effects by measuring 8 small specimens with stable magnetizations (8 or 5.2 cm3). These were assembled into a single large multi-specimen inside 125 cm3 containers that were measured in a Molspin ``BigSpin'' magnetometer. Large-specimen remanence directions deflect towards the direction of any strongly magnetized sub-specimen. Differences between the large-specimen remanence and that for the group of individually measured sub-specimens worsened when one sub-specimen was mis-oriented. These discrepancies were cancelled or reduced using larger numbers of specimen orientations in the magnetometer. Conventional schemes with 4 or 6 different measurement-orientations may fail to suppress heterogeneity-effects whereas our 12-orientation protocol may succeed. For most specimens, acceptable remanence-homogeneity is present where similar remanence-directions are recorded from 4, 6, and 12 different spin-orientations.

  15. On comparing heterogeneity across biomarkers.

    PubMed

    Steininger, Robert J; Rajaram, Satwik; Girard, Luc; Minna, John D; Wu, Lani F; Altschuler, Steven J

    2015-06-01

    Microscopy reveals complex patterns of cellular heterogeneity that can be biologically informative. However, a limitation of microscopy is that only a small number of biomarkers can typically be monitored simultaneously. Thus, a natural question is whether additional biomarkers provide a deeper characterization of the distribution of cellular states in a population. How much information about a cell's phenotypic state in one biomarker is gained by knowing its state in another biomarker? Here, we describe a framework for comparing phenotypic states across biomarkers. Our approach overcomes the current limitation of microscopy by not requiring costaining biomarkers on the same cells; instead, we require staining of biomarkers (possibly separately) on a common collection of phenotypically diverse cell lines. We evaluate our approach on two image datasets: 33 oncogenically diverse lung cancer cell lines stained with 7 biomarkers, and 49 less diverse subclones of one lung cancer cell line stained with 12 biomarkers. We first validate our method by comparing it to the "gold standard" of costaining. We then apply our approach to all pairs of biomarkers and use it to identify biomarkers that yield similar patterns of heterogeneity. The results presented in this work suggest that many biomarkers provide redundant information about heterogeneity. Thus, our approach provides a practical guide for selecting independently informative biomarkers and, more generally, will yield insights into both the connectivity of biological networks and the complexity of the state space of biological systems.

  16. Soft Dielectrics: Heterogeneity and Instabilities

    NASA Astrophysics Data System (ADS)

    Rudykh, Stephan; Debotton, Gal; Bhattacharya, Kaushik

    2012-02-01

    Dielectric Elastomers are capable of large deformations in response to electrical stimuli. Heterogeneous soft dielectrics with proper microstructures demonstrate much stronger electromechanical coupling than their homogeneous constituents. In turn, the heterogeneity is an origin for instability developments leading to drastic change in the composite microstructure. In this talk, the electromechanical instabilities are considered. Stability of anisotropic soft dielectrics is analyzed. Ways to achieve giant deformations and manipulating extreme material properties are discussed. 1. S. Rudykh and G. deBotton, ``Instabilities of Hyperelastic Fiber Composites: Micromechanical Versus Numerical Analyses.'' Journal of Elasticity, 2011. http://dx.doi.org/2010.1007/s10659-011-9313-x 2. S. Rudykh, K. Bhattacharya and G. deBotton, ``Snap-through actuation of thick-wall electroactive balloons.'' International Journal of Non-Linear Mechanics, 2011. http://dx.doi.org/10.1016/j.ijnonlinmec.2011.05.006 3. S. Rudykh and G. deBotton, ``Stability of Anisotropic Electroactive Polymers with Application to Layered Media.'' Zeitschrift f"ur angewandte Mathematik und Physik, 2011. http://dx.doi.org/10.1007/s00033-011-0136-1 4. S. Rudykh, A. Lewinstein, G. Uner and G. deBotton, ``Giant Enhancement of the Electromechanical Coupling in Soft Heterogeneous Dielectrics.'' 2011 http://arxiv.org/abs/1105.4217v1

  17. Analyzing and modeling heterogeneous behavior

    NASA Astrophysics Data System (ADS)

    Lin, Zhiting; Wu, Xiaoqing; He, Dongyue; Zhu, Qiang; Ni, Jixiang

    2016-05-01

    Recently, it was pointed out that the non-Poisson statistics with heavy tail existed in many scenarios of human behaviors. But most of these studies claimed that power-law characterized diverse aspects of human mobility patterns. In this paper, we suggest that human behavior may not be driven by identical mechanisms and can be modeled as a Semi-Markov Modulated Process. To verify our suggestion and model, we analyzed a total of 1,619,934 records of library visitations (including undergraduate and graduate students). It is found that the distribution of visitation intervals is well fitted with three sections of lines instead of the traditional power law distribution in log-log scale. The results confirm that some human behaviors cannot be simply expressed as power law or any other simple functions. At the same time, we divided the data into groups and extracted period bursty events. Through careful analysis in different groups, we drew a conclusion that aggregate behavior might be composed of heterogeneous behaviors, and even the behaviors of the same type tended to be different in different period. The aggregate behavior is supposed to be formed by "heterogeneous groups". We performed a series of experiments. Simulation results showed that we just needed to set up two states Semi-Markov Modulated Process to construct proper representation of heterogeneous behavior.

  18. Heterogeneity and Fluctuations in Electrochemical Sensors

    NASA Astrophysics Data System (ADS)

    Fraikin, Jean-Luc; Requa, Michael; Stanton, Michael; Cleland, Andrew

    2008-03-01

    Metal electrodes submerged in aqueous electrolytes biased with very small voltages frequently display a capacitive low-frequency electrical impedance, which is primarily imaginary but typically displays a 1/f ^α frequency dependence, with 0.7 <= α <= 1. This electrode-electrolyte interface is phenomenologically modeled as a constant phase element (CPE). There are a number of explanations for the observed frequency dependence, including geometric arguments based on the assumption of fractal surface geometries, but it is difficult to quantitatively match such models to experiment. We propose a new model to explain this phenomenon, as well as other low frequency electrical characteristics of the electrode-electrolyte interface, using a model that relies on microscopic heterogeneity, allowing for local variations in capacitance and diffusion coefficients. We will present the basic aspects of our model, and describe measurements under way to validate this model, using a combination of impedance measurements and electrochemical noise spectroscopy.

  19. NASA GSFC Perspective on Heterogeneous Processing

    NASA Technical Reports Server (NTRS)

    Powell, Wesley A.

    2016-01-01

    This presentation provides an overview of NASA GSFC, our onboard processing applications, the applicability heterogeneous processing to these applications, and necessary developments to enable heterogeneous processing to be infused into our missions.

  20. Nuclear analytical chemistry

    SciTech Connect

    Brune, D.; Forkman, B.; Persson, B.

    1984-01-01

    This book covers the general theories and techniques of nuclear chemical analysis, directed at applications in analytical chemistry, nuclear medicine, radiophysics, agriculture, environmental sciences, geological exploration, industrial process control, etc. The main principles of nuclear physics and nuclear detection on which the analysis is based are briefly outlined. An attempt is made to emphasise the fundamentals of activation analysis, detection and activation methods, as well as their applications. The book provides guidance in analytical chemistry, agriculture, environmental and biomedical sciences, etc. The contents include: the nuclear periodic system; nuclear decay; nuclear reactions; nuclear radiation sources; interaction of radiation with matter; principles of radiation detectors; nuclear electronics; statistical methods and spectral analysis; methods of radiation detection; neutron activation analysis; charged particle activation analysis; photon activation analysis; sample preparation and chemical separation; nuclear chemical analysis in biological and medical research; the use of nuclear chemical analysis in the field of criminology; nuclear chemical analysis in environmental sciences, geology and mineral exploration; and radiation protection.

  1. Nuclear war: Opposing viewpoints

    SciTech Connect

    Szumski, B.

    1985-01-01

    This book presents opposing viewpoints on nuclear war. Topics discussed include: how nuclear would begin; would humanity survive; would civil defense work; will an arms agreement work; and can space weapons reduce the risk of nuclear war.

  2. Nuclear Quadrupole Moments and Nuclear Shell Structure

    DOE R&D Accomplishments Database

    Townes, C. H.; Foley, H. M.; Low, W.

    1950-06-23

    Describes a simple model, based on nuclear shell considerations, which leads to the proper behavior of known nuclear quadrupole moments, although predictions of the magnitudes of some quadrupole moments are seriously in error.

  3. Nuclear thermal/nuclear electric hybrids

    NASA Technical Reports Server (NTRS)

    Reid, B. D.

    1991-01-01

    A description is given of the nuclear thermal and nuclear electric hybrid. The specifications are described along with its mission performance. Next, the technical status, development requirements, and some cost estimates are provided.

  4. Genetic heterogeneity in multiple epiphyseal dysplasia

    SciTech Connect

    Deere, M.; Blanton, S.H.; Scott, C.I.

    1994-09-01

    Multiple epiphyseal dysplasia (MED) is generally an autosomal dominant hereditary chondrodystrophy characterized by abnormal epiphyseal centers of the long bones. There are at least two clinical and radiographical MED phenotypes, Fairbank and Ribbing forms, with the former having been better characterized. While less frequent, there are also reports of an autosomal recessive type which does not differ radiographically from the autosomal dominant type. Recently, a family with MED has been shown to map to the pericentromeric region of chromosome 19. We have tested linkage to six short tandem repeat markers from chromosome 19 in three multigenerational families with Fairbank MED and another MED family in which there were three of seven affected siblings with unaffected parents. The three families with autosomal dominant MED were linked to D19S215 with a maximum lod score of 3.82 at {theta} = 0.0. Linkage to chromosome 19 was excluded in the fourth family under autosomal recessive and autosomal dominant models with either reduced penetrance or germline mosaicism. Lod scores were -{infinity} and -2.37 at {theta} = 0.0 for D19S215, respectively. Linkage to candidate genes, Col9A1, Col9A2, and Col11A1 was tested and excluded for both models in this family. Col11A1 was excluded under a recessive model. We have confirmed linkage of MED, Fairbank, to chromosome 19 and demonstrated that MED is genetically heterogeneous.

  5. Nuclear Fuel Cycle & Vulnerabilities

    SciTech Connect

    Boyer, Brian D.

    2012-06-18

    The objective of safeguards is the timely detection of diversion of significant quantities of nuclear material from peaceful nuclear activities to the manufacture of nuclear weapons or of other nuclear explosive devices or for purposes unknown, and deterrence of such diversion by the risk of early detection. The safeguards system should be designed to provide credible assurances that there has been no diversion of declared nuclear material and no undeclared nuclear material and activities.

  6. Nuclear South Asia

    DTIC Science & Technology

    2007-11-02

    inseparable from the history of nuclear developments in both India and Pakistan. The timing of India’s tests was determined by the pronuclear stance of the...Rawalpindi, 2001), 17-18. 53 3Robert Boardman, The Politics of Fading Dreams: Britain and the Nuclear Export Business, Nuclear Exports and World Politics (New...disasters of nuclear arms race. 61 BIBLIOGRAPHY Books Boardman, Robert. The Politics of Fading Dreams: Britain and the Nuclear Export Business, Nuclear

  7. Hollow nuclear matter

    NASA Astrophysics Data System (ADS)

    Yong, Gao-Chan

    2016-01-01

    It is generally considered that an atomic nucleus is always compact. Based on the isospin-dependent Boltzmann nuclear transport model, here I show that large block nuclear matter or excited nuclear matter may both be hollow. The size of the inner bubble in these matter is affected by the charge number of nuclear matter. The existence of hollow nuclear matter may have many implications in nuclear or atomic physics or astrophysics as well as some practical applications.

  8. Nuclear reactor

    DOEpatents

    Thomson, Wallace B.

    2004-03-16

    A nuclear reactor comprising a cylindrical pressure vessel, an elongated annular core centrally disposed within and spaced from the pressure vessel, and a plurality of ducts disposed longitudinally of the pressure vessel about the periphery thereof, said core comprising an annular active portion, an annular reflector just inside the active portion, and an annular reflector just outside the active a portion, said annular active portion comprising rectangular slab, porous fuel elements radially disposed around the inner reflector and extending the length of the active portion, wedge-shaped, porous moderator elements disposed adjacent one face of each fuel element and extending the length of the fuel element, the fuel and moderator elements being oriented so that the fuel elements face each other and the moderator elements do likewise, adjacent moderator elements being spaced to provide air inlet channels, and adjacent fuel elements being spaced to provide air outlet channels which communicate with the interior of the peripheral ducts, and means for introducing air into the air inlet channels which passes through the porous moderator elements and porous fuel elements to the outlet channel.

  9. Nuclear Proliferation: A Global Nuclear Strategy

    DTIC Science & Technology

    2007-03-30

    thinking about nuclear weapons as a “ Wild Card ” in this case. Finally, just as North Korea is using nuclear weapons as a “bargaining chip,” we...definite disadvantage for non-nuclear nations not to have a nuclear” Wild Card ”. So some misguided Japanese politicians are attracted to the “ Wild Card ” advantage

  10. Nuclear weapons modernizations

    NASA Astrophysics Data System (ADS)

    Kristensen, Hans M.

    2014-05-01

    This article reviews the nuclear weapons modernization programs underway in the world's nine nuclear weapons states. It concludes that despite significant reductions in overall weapons inventories since the end of the Cold War, the pace of reductions is slowing - four of the nuclear weapons states are even increasing their arsenals, and all the nuclear weapons states are busy modernizing their remaining arsenals in what appears to be a dynamic and counterproductive nuclear competition. The author questions whether perpetual modernization combined with no specific plan for the elimination of nuclear weapons is consistent with the nuclear Non-Proliferation Treaty and concludes that new limits on nuclear modernizations are needed.

  11. General Nuclear Medicine

    MedlinePlus

    ... Children's (Pediatric) Nuclear Medicine Radioactive Iodine (I-131) Therapy Biopsies - Overview Radioimmunotherapy (RIT) Alzheimer's Disease X-ray, Interventional Radiology and Nuclear Medicine ...

  12. Focused technology: Nuclear propulsion

    NASA Technical Reports Server (NTRS)

    Miller, Thomas J.

    1993-01-01

    Five viewgraphs are presented that outline the objectives and elements of the Nuclear Propulsion Program, mission considerations, propulsion technologies, and the logic flow path for nuclear propulsion development.

  13. Nuclear weapons modernizations

    SciTech Connect

    Kristensen, Hans M.

    2014-05-09

    This article reviews the nuclear weapons modernization programs underway in the world's nine nuclear weapons states. It concludes that despite significant reductions in overall weapons inventories since the end of the Cold War, the pace of reductions is slowing - four of the nuclear weapons states are even increasing their arsenals, and all the nuclear weapons states are busy modernizing their remaining arsenals in what appears to be a dynamic and counterproductive nuclear competition. The author questions whether perpetual modernization combined with no specific plan for the elimination of nuclear weapons is consistent with the nuclear Non-Proliferation Treaty and concludes that new limits on nuclear modernizations are needed.

  14. Cellular heterogeneity and molecular evolution in cancer.

    PubMed

    Almendro, Vanessa; Marusyk, Andriy; Polyak, Kornelia

    2013-01-24

    Intratumor heterogeneity represents a major obstacle to effective cancer treatment and personalized medicine. However, investigators are now elucidating intratumor heterogeneity at the single-cell level due to improvements in technologies. Better understanding of the composition of tumors, and monitoring changes in cell populations during disease progression and treatment, will improve cancer diagnosis and therapeutic design. Measurements of intratumor heterogeneity may also be used as biomarkers to predict the risk of progression and therapeutic resistance. We summarize important considerations related to intratumor heterogeneity during tumor evolution. We also discuss experimental approaches that are commonly used to infer intratumor heterogeneity and describe how these methodologies can be translated into clinical practice.

  15. Internal mass transport in heterogeneous biofilms: Recent advances

    SciTech Connect

    Lewandowski, Z.; Stoodley, P.; Roe, F.

    1995-12-01

    Aerobic biofilms were found to have a complex structure consisting of microbial cell clusters (discrete aggregates of densely packed cells) and interstitial voids. The authors used the Confocal Scanning Laser Microscope (CSLM) in conjunction with dissolved oxygen microelectrodes to examine the structural and chemical heterogeneity of fully hydrated, living biofilms in real time under flow conditions. The oxygen distribution within the biofilm was strongly correlated with these structures. The voids facilitated oxygen transport from the bulk liquid through the biofilm. Water could freely move through the channels within the biofilm inducing convective mass transfer of dissolved and particulate substrates. Nuclear Magnetic Resonance Imaging (NMRI), in which the phase of the nuclear spin depends on the spin velocity, was used to show how fluid velocity varied in a conduit colonized with biofilm. Spin-lattice relaxation time was used at the same time to obtain images of biofilm density. Structural and chemical heterogeneity may contribute to initiation of corrosion induce microbially influenced corrosion (MIC) on metal surfaces where biofilms have accumulated. The Scanning Vibrating Electrode (SVE) has been used to spatially and temporally map ion currents in solution above MIC anodic and cathodic sites.

  16. Cognitive heterogeneity in Williams syndrome.

    PubMed

    Porter, Melanie A; Coltheart, Max

    2005-01-01

    This study used the Woodcock-Johnson Tests of Cognitive Ability-Revised to investigate a wide range of cognitive abilities in people with Williams syndrome (WS). It involved a comparatively large sample of 31 people with WS, but took a case-series approach. The study addressed the widespread claims of a characteristic "WS cognitive profile" by looking for heterogeneity rather than homogeneity. People with WS showed a variety of preserved (significantly above mental age [MA]), expected (at MA), and significantly impaired (significantly below MA) levels of functioning. Such results provide clear evidence for heterogeneity in cognitive functions within WS. We found the most homogeneity on a test of phonological processing and a test of phonological short-term memory, with half of the WS sample performing at MA levels on these tests. Interestingly, no WS individual showed a weakness on a test of nonverbal reasoning, and only one WS individual showed a weakness on a test of verbal comprehension. In addition, we found that strengths on analysis-synthesis and verbal analogies occurred only for WS individuals with an MA less than 5.5 years (our sample median MA); people with an MA greater than 5.5 years performed at MA level on these 2 tests. Results also provided preliminary evidence for distinct subgroups of WS people based on their cognitive strengths and weaknesses on a broad range of cognitive functions. On the basis of the findings, caution should be made in declaring a single cognitive profile that is characteristic of all individuals with WS. Just as there is heterogeneity in genetic and physical anomalies within WS, not all WS individuals share the same cognitive strengths and weaknesses. Also, not all WS individuals show the profile of a strength in verbal abilities and a weakness in spatial functions.

  17. Heterogeneous photocatalysts in organic synthesis

    NASA Astrophysics Data System (ADS)

    Cherevatskaya, M.; König, B.

    2014-03-01

    The review deals with the application of inorganic semiconductors in organic synthesis. Although the majority of reported reactions still aim at the photocatalytic decomposition of organic compounds, the number of examples in synthetic applications is growing. The principal mechanisms of heterogeneous semiconductor photocatalysis are considered and examples illustrating the use of inorganic semiconductors in organic synthesis are given. The discussion is arranged according to the required excitation wavelength (UV or visible light) and to the new bond that is formed (carbon-carbon or carbon-heteroatom bond). The bibliography includes 47 references.

  18. Interregional equilibrium with heterogeneous labor.

    PubMed

    Michel, P; Perrot, A; Thisse J-f

    1996-02-01

    "The impact of labor migration on interregional equilibrium is studied when workers are heterogeneous in productivity and regional mobility. The skilled respond to market disequilibrium by moving into the most attractive region. The unskilled are immobile in the short-run and move with the skilled in the long-run. Both regions have a neoclassical production function affected by an externality depending on the number of skilled. Workers move according to the utility differential when regional amenities vary with population or according to the wage differential. The equilibrium pattern depends on the unskilled's mobility and on migration incentives. Typically, regional imbalance characterizes the equilibrium which is often suboptimal."

  19. A Heterogeneous Medium Analytical Benchmark

    SciTech Connect

    Ganapol, B.D.

    1999-09-27

    A benchmark, called benchmark BLUE, has been developed for one-group neutral particle (neutron or photon) transport in a one-dimensional sub-critical heterogeneous plane parallel medium with surface illumination. General anisotropic scattering is accommodated through the Green's Function Method (GFM). Numerical Fourier transform inversion is used to generate the required Green's functions which are kernels to coupled integral equations that give the exiting angular fluxes. The interior scalar flux is then obtained through quadrature. A compound iterative procedure for quadrature order and slab surface source convergence provides highly accurate benchmark qualities (4- to 5- places of accuracy) results.

  20. Stress relaxation in heterogeneous polymers

    NASA Astrophysics Data System (ADS)

    Witten, T. A.

    1992-05-01

    When heterogeneous polymers such as diblock copolymers form a microdomain phase, an imposed strain gives rise to stress from two sources, and several mechanisms of stress relaxation. The release of stress by disentanglement is strongly influenced by the effective confinement of the junction points to the domain boundaries and by the stretching of the chains. Using accepted notions of entangled chain kinetics, it is argued that the relaxation time for sliding stress is exponential in the chainlength to the 7/9 power. A method for calculating the frequency-dependent dynamic modulus is sketched. Despite the slow relaxation implied by these mechanisms, it appears possible to create domains of high energy.

  1. Nuclear reactor

    DOEpatents

    Yant, Howard W.; Stinebiser, Karl W.; Anzur, Gregory C.

    1977-01-01

    A nuclear reactor, particularly a liquid-metal breeder reactor, whose upper internals include outlet modules for channeling the liquid-metal coolant from selected areas of the outlet of the core vertically to the outlet plenum. The modules are composed of a highly-refractory, high corrosion-resistant alloy, for example, INCONEL-718. Each module is disposed to confine and channel generally vertically the coolant emitted from a subplurality of core-component assemblies. Each module has a grid with openings, each opening disposed to receive the coolant from an assembly of the subplurality. The grid in addition serves as a holdown for the assemblies of the corresponding subplurality preventing their excessive ejection upwardly from the core. In the region directly over the core the outlet modules are of such peripheral form that they nest forming a continuum over the core-component assemblies whose outlet coolant they confine. Each subassembly includes a chimney which confines the coolant emitted by its corresponding subassemblies to generally vertical flow between the outlet of the core and the outlet plenum. Each subplurality of assemblies whose emitted coolant is confined by an outlet module includes assemblies which emit lower-temperature coolant, for example, a control-rod assembly, or fertile assemblies, and assemblies which emit coolant of substantially higher temperature, for example, fuel-rod assemblies. The coolants of different temperatures are mixed in the chimneys reducing the effect of stripping (hot-cold temperature fluctuations) on the remainder of the upper internals which are composed typically of AISI-304 or AISI-316 stainless steel.

  2. Nuclear reactor

    DOEpatents

    Pennell, William E.; Rowan, William J.

    1977-01-01

    A nuclear reactor in which the core components, including fuel-rod assemblies, control-rod assemblies, fertile rod-assemblies, and removable shielding assemblies, are supported by a plurality of separate inlet modular units. These units are referred to as inlet module units to distinguish them from the modules of the upper internals of the reactor. The modular units are supported, each removable independently of the others, in liners in the supporting structure for the lower internals of the reactor. The core assemblies are removably supported in integral receptacles or sockets of the modular units. The liners, units, sockets and assmblies have inlet openings for entry of the fluid. The modular units are each removably mounted in the liners with fluid seals interposed between the opening in the liner and inlet module into which the fluid enters and the upper and lower portion of the liner. Each assembly is similarly mounted in a corresponding receptacle with fluid seals interposed between the openings where the fluid enters and the lower portion of the receptacle or fitting closely in these regions. As fluid flows along each core assembly a pressure drop is produced along the fluid so that the fluid which emerges from each core assembly is at a lower pressure than the fluid which enters the core assembly. However because of the seals interposed in the mountings of the units and assemblies the pressures above and below the units and assemblies are balanced and the units are held in the liners and the assemblies are held in the receptacles by their weights as they have a higher specific gravity than the fluid. The low-pressure spaces between each module and its liner and between each core assembly and its module is vented to the low-pressure regions of the vessel to assure that fluid which leaks through the seals does not accumulate and destroy the hydraulic balance.

  3. Nuclear Power in China

    NASA Astrophysics Data System (ADS)

    Zhou, Yun

    2012-02-01

    In response to the Fukushima accident, China is strengthening its nuclear safety at reactors in operation, under construction and in preparation, including efforts to improve nuclear safety regulations and guidelines based on lessons learned from the accident. Although China is one of the major contributors in the global nuclear expansion, China's nuclear power industry is relatively young. Its nuclear safety regulators are less experienced compared to those in other major nuclear power countries. To realize China's resolute commitment to rapid growth of safe nuclear energy, detailed analyses of its nuclear safety regulatory system are required. This talk explains China's nuclear energy program and policy at first. It also explores China's governmental activities and future nuclear development after Fukushima accidents. At last, an overview of China's nuclear safety regulations and practices are provided. Issues and challenges are also identified for police makers, regulators, and industry professionals.

  4. Thermal conductivity of heterogeneous LWR MOX fuels

    NASA Astrophysics Data System (ADS)

    Staicu, D.; Barker, M.

    2013-11-01

    view of the location where the thermograms are recorded: the temperature transients on the rear face of the samples are measured with a pyrometer and the system is provided with a lens assembly which enables a 1 mm diameter spot of the sample surface to be focused onto the signal collecting fibre. The thermograms are therefore averaged over a 1 mm diameter surface, which is much larger than the size of the heterogeneities (Pu rich agglomerates with a size of less than 200 μm).The impact of sample thickness on the measured thermal diffusivity was experimentally investigated for the MIMAS MOX with 7.0 wt.% Pu. For this purpose, discs of 0.5, 1, 2, and 3 mm thickness were cut and the thermal diffusivity was measured. The same investigation was done for standard UO2, in order to verify the accuracy of the inverse technique used for the identification of the thermal diffusivity from the thermograms. The inverse technique [39] explicitly takes into account the sample thickness in the calculation of the heat losses. The results for UO2 (Fig. 6) show that the measured thermal diffusivity does not depend on sample thickness, and is in good agreement with the recommendation of Fink [16]. The results for the heterogeneous MOX (Fig. 7) also show no dependence on sample thickness.

  5. Nuclear fuel in a reactor accident.

    PubMed

    Burns, Peter C; Ewing, Rodney C; Navrotsky, Alexandra

    2012-03-09

    Nuclear accidents that lead to melting of a reactor core create heterogeneous materials containing hundreds of radionuclides, many with short half-lives. The long-lived fission products and transuranium elements within damaged fuel remain a concern for millennia. Currently, accurate fundamental models for the prediction of release rates of radionuclides from fuel, especially in contact with water, after an accident remain limited. Relatively little is known about fuel corrosion and radionuclide release under the extreme chemical, radiation, and thermal conditions during and subsequent to a nuclear accident. We review the current understanding of nuclear fuel interactions with the environment, including studies over the relatively narrow range of geochemical, hydrological, and radiation environments relevant to geological repository performance, and discuss priorities for research needed to develop future predictive models.

  6. MRI of Heterogeneous Hydrogenation Reactions Using Parahydrogen Polarization

    SciTech Connect

    Burt, Scott Russell

    2008-01-01

    The power of magnetic resonance imaging (MRI) is its ability to image the internal structure of optically opaque samples and provide detailed maps of a variety of important parameters, such as density, diffusion, velocity and temperature. However, one of the fundamental limitations of this technique is its inherent low sensitivity. For example, the low signal to noise ratio (SNR) is particularly problematic for imaging gases in porous materials due to the low density of the gas and the large volume occluded by the porous material. This is unfortunate, as many industrially relevant chemical reactions take place at gas-surface interfaces in porous media, such as packed catalyst beds. Because of this severe SNR problem, many techniques have been developed to directly increase the signal strength. These techniques work by manipulating the nuclear spin populations to produce polarized} (i.e., non-equilibrium) states with resulting signal strengths that are orders of magnitude larger than those available at thermal equilibrium. This dissertation is concerned with an extension of a polarization technique based on the properties of parahydrogen. Specifically, I report on the novel use of heterogeneous catalysis to produce parahydrogen induced polarization and applications of this new technique to gas phase MRI and the characterization of micro-reactors. First, I provide an overview of nuclear magnetic resonance (NMR) and how parahydrogen is used to improve the SNR of the NMR signal. I then present experimental results demonstrating that it is possible to use heterogeneous catalysis to produce parahydrogen-induced polarization. These results are extended to imaging void spaces using a parahydrogen polarized gas. In the second half of this dissertation, I demonstrate the use of parahydrogen-polarized gas-phase MRI for characterizing catalytic microreactors. Specifically, I show how the improved SNR allows one to map parameters important for characterizing the heat and mass

  7. Lipid-sensors, enigmatic-orphan and orphan nuclear receptors as therapeutic targets in breast-cancer.

    PubMed

    Garattini, Enrico; Bolis, Marco; Gianni', Maurizio; Paroni, Gabriela; Fratelli, Maddalena; Terao, Mineko

    2016-07-05

    Breast-cancer is heterogeneous and consists of various groups with different biological characteristics. Innovative pharmacological approaches accounting for this heterogeneity are needed. The forty eight human Nuclear-Hormone-Receptors are ligand-dependent transcription-factors and are classified into Endocrine-Receptors, Adopted-Orphan-Receptors (Lipid-sensors and Enigmatic-Orphans) and Orphan-receptors. Nuclear-Receptors represent ideal targets for the design/synthesis of pharmacological ligands. We provide an overview of the literature available on the expression and potential role played by Lipid-sensors, Enigmatic-Orphans and Orphan-Receptors in breast-cancer. The data are complemented by an analysis of the expression levels of each selected Nuclear-Receptor in the PAM50 breast-cancer groups, following re-elaboration of the data publicly available. The major aim is to support the idea that some of the Nuclear-Receptors represent largely unexploited therapeutic-targets in breast-cancer treatment/chemo-prevention. On the basis of our analysis, we conclude that the Lipid-Sensors, NR1C3, NR1H2 and NR1H3 are likely to be onco-suppressors in breast-cancer. The Enigmatic-Orphans, NR1F1 NR2A1 and NR3B3 as well as the Orphan-Receptors, NR0B1, NR0B2, NR1D1, NR2F1, NR2F2 and NR4A3 exert a similar action. These Nuclear-Receptors represent candidates for the development of therapeutic strategies aimed at increasing their expression or activating them in tumor cells. The group of Nuclear-Receptors endowed with potential oncogenic properties consists of the Lipid-Sensors, NR1C2 and NR1I2, the Enigmatic-Orphans, NR1F3, NR3B1 and NR5A2, as well as the Orphan-Receptors, NR2E1, NR2E3 and NR6A1. These oncogenic Nuclear-Receptors should be targeted with selective antagonists, reverse-agonists or agents/strategies capable of reducing their expression in breast-cancer cells.

  8. Lipid-sensors, enigmatic-orphan and orphan nuclear receptors as therapeutic targets in breast-cancer

    PubMed Central

    Garattini, Enrico; Bolis, Marco; Gianni', Maurizio; Paroni, Gabriela; Fratelli, Maddalena; Terao, Mineko

    2016-01-01

    Breast-cancer is heterogeneous and consists of various groups with different biological characteristics. Innovative pharmacological approaches accounting for this heterogeneity are needed. The forty eight human Nuclear-Hormone-Receptors are ligand-dependent transcription-factors and are classified into Endocrine-Receptors, Adopted-Orphan-Receptors (Lipid-sensors and Enigmatic-Orphans) and Orphan-receptors. Nuclear-Receptors represent ideal targets for the design/synthesis of pharmacological ligands. We provide an overview of the literature available on the expression and potential role played by Lipid-sensors, Enigmatic-Orphans and Orphan-Receptors in breast-cancer. The data are complemented by an analysis of the expression levels of each selected Nuclear-Receptor in the PAM50 breast-cancer groups, following re-elaboration of the data publicly available. The major aim is to support the idea that some of the Nuclear-Receptors represent largely unexploited therapeutic-targets in breast-cancer treatment/chemo-prevention. On the basis of our analysis, we conclude that the Lipid-Sensors, NR1C3, NR1H2 and NR1H3 are likely to be onco-suppressors in breast-cancer. The Enigmatic-Orphans, NR1F1 NR2A1 and NR3B3 as well as the Orphan-Receptors, NR0B1, NR0B2, NR1D1, NR2F1, NR2F2 and NR4A3 exert a similar action. These Nuclear-Receptors represent candidates for the development of therapeutic strategies aimed at increasing their expression or activating them in tumor cells. The group of Nuclear-Receptors endowed with potential oncogenic properties consists of the Lipid-Sensors, NR1C2 and NR1I2, the Enigmatic-Orphans, NR1F3, NR3B1 and NR5A2, as well as the Orphan-Receptors, NR2E1, NR2E3 and NR6A1. These oncogenic Nuclear-Receptors should be targeted with selective antagonists, reverse-agonists or agents/strategies capable of reducing their expression in breast-cancer cells. PMID:26894976

  9. Shock Initiation of Heterogeneous Explosives

    SciTech Connect

    Reaugh, J E

    2004-05-10

    The fundamental picture that shock initiation in heterogeneous explosives is caused by the linking of hot spots formed at inhomogeneities was put forward by several researchers in the 1950's and 1960's, and more recently. Our work uses the computer hardware and software developed in the Advanced Simulation and Computing (ASC) program of the U.S. Department of Energy to explicitly include heterogeneities at the scale of the explosive grains and to calculate the consequences of realistic although approximate models of explosive behavior. Our simulations are performed with ALE-3D, a three-dimensional, elastic-plastic-hydrodynamic Arbitrary Lagrange-Euler finite-difference program, which includes chemical kinetics and heat transfer, and which is under development at this laboratory. We developed the parameter values for a reactive-flow model to describe the non-ideal detonation behavior of an HMX-based explosive from the results of grain-scale simulations. In doing so, we reduced the number of free parameters that are inferred from comparison with experiment to a single one - the characteristic defect dimension. We also performed simulations of the run to detonation in small volumes of explosive. These simulations illustrate the development of the reaction zone and the acceleration of the shock front as the flame fronts start from hot spots, grow, and interact behind the shock front. In this way, our grain-scale simulations can also connect to continuum experiments directly.

  10. Simulating Heterogeneous Tumor Cell Populations

    PubMed Central

    Bar-Sagi, Dafna; Mishra, Bud

    2016-01-01

    Certain tumor phenomena, like metabolic heterogeneity and local stable regions of chronic hypoxia, signify a tumor’s resistance to therapy. Although recent research has shed light on the intracellular mechanisms of cancer metabolic reprogramming, little is known about how tumors become metabolically heterogeneous or chronically hypoxic, namely the initial conditions and spatiotemporal dynamics that drive these cell population conditions. To study these aspects, we developed a minimal, spatially-resolved simulation framework for modeling tissue-scale mixed populations of cells based on diffusible particles the cells consume and release, the concentrations of which determine their behavior in arbitrarily complex ways, and on stochastic reproduction. We simulate cell populations that self-sort to facilitate metabolic symbiosis, that grow according to tumor-stroma signaling patterns, and that give rise to stable local regions of chronic hypoxia near blood vessels. We raise two novel questions in the context of these results: (1) How will two metabolically symbiotic cell subpopulations self-sort in the presence of glucose, oxygen, and lactate gradients? We observe a robust pattern of alternating striations. (2) What is the proper time scale to observe stable local regions of chronic hypoxia? We observe the stability is a function of the balance of three factors related to O2—diffusion rate, local vessel release rate, and viable and hypoxic tumor cell consumption rate. We anticipate our simulation framework will help researchers design better experiments and generate novel hypotheses to better understand dynamic, emergent whole-tumor behavior. PMID:28030620

  11. Heterogeneous Integration of Compound Semiconductors

    NASA Astrophysics Data System (ADS)

    Moutanabbir, Oussama; Gösele, Ulrich

    2010-08-01

    The ability to tailor compound semiconductors and to integrate them onto foreign substrates can lead to superior or novel functionalities with a potential impact on various areas in electronics, optoelectronics, spintronics, biosensing, and photovoltaics. This review provides a brief description of different approaches to achieve this heterogeneous integration, with an emphasis on the ion-cut process, also known commercially as the Smart-Cut™ process. This process combines semiconductor wafer bonding and undercutting using defect engineering by light ion implantation. Bulk-quality heterostructures frequently unattainable by direct epitaxial growth can be produced, provided that a list of technical criteria is fulfilled, thus offering an additional degree of freedom in the design and fabrication of heterogeneous and flexible devices. Ion cutting is a generic process that can be employed to split and transfer fine monocrystalline layers from various crystals. Materials and engineering issues as well as our current understanding of the underlying physics involved in its application to cleaving thin layers from freestanding GaN, InP, and GaAs wafers are presented.

  12. Socially Aware Heterogeneous Wireless Networks

    PubMed Central

    Kosmides, Pavlos; Adamopoulou, Evgenia; Demestichas, Konstantinos; Theologou, Michael; Anagnostou, Miltiades; Rouskas, Angelos

    2015-01-01

    The development of smart cities has been the epicentre of many researchers’ efforts during the past decade. One of the key requirements for smart city networks is mobility and this is the reason stable, reliable and high-quality wireless communications are needed in order to connect people and devices. Most research efforts so far, have used different kinds of wireless and sensor networks, making interoperability rather difficult to accomplish in smart cities. One common solution proposed in the recent literature is the use of software defined networks (SDNs), in order to enhance interoperability among the various heterogeneous wireless networks. In addition, SDNs can take advantage of the data retrieved from available sensors and use them as part of the intelligent decision making process contacted during the resource allocation procedure. In this paper, we propose an architecture combining heterogeneous wireless networks with social networks using SDNs. Specifically, we exploit the information retrieved from location based social networks regarding users’ locations and we attempt to predict areas that will be crowded by using specially-designed machine learning techniques. By recognizing possible crowded areas, we can provide mobile operators with recommendations about areas requiring datacell activation or deactivation. PMID:26110402

  13. Groundwater pumping by heterogeneous users

    NASA Astrophysics Data System (ADS)

    Saak, Alexander E.; Peterson, Jeffrey M.

    2012-08-01

    Farm size is a significant determinant of both groundwater-irrigated farm acreage and groundwater-irrigation-application rates per unit land area. This paper analyzes the patterns of groundwater exploitation when resource users in the area overlying a common aquifer are heterogeneous. In the presence of user heterogeneity, the common resource problem consists of inefficient dynamic and spatial allocation of groundwater because it impacts income distribution not only across periods but also across farmers. Under competitive allocation, smaller farmers pump groundwater faster if farmers have a constant marginal periodic utility of income. However, it is possible that larger farmers pump faster if the Arrow-Pratt coefficient of relative risk-aversion is sufficiently decreasing in income. A greater farm-size inequality may either moderate or amplify income inequality among farmers. Its effect on welfare depends on the curvature properties of the agricultural output function and the farmer utility of income. Also, it is shown that a flat-rate quota policy that limits the quantity of groundwater extraction per unit land area may have unintended consequences for the income distribution among farmers.

  14. Heterogeneous Transmutation Sodium Fast Reactor

    SciTech Connect

    S. E. Bays

    2007-09-01

    The threshold-fission (fertile) nature of Am-241 is used to destroy this minor actinide by capitalizing upon neutron capture instead of fission within a sodium fast reactor. This neutron-capture and its subsequent decay chain leads to the breeding of even neutron number plutonium isotopes. A slightly moderated target design is proposed for breeding plutonium in an axial blanket located above the active “fast reactor” driver fuel region. A parametric study on the core height and fuel pin diameter-to-pitch ratio is used to explore the reactor and fuel cycle aspects of this design. This study resulted in both non-flattened and flattened core geometries. Both of these designs demonstrated a high capacity for removing americium from the fuel cycle. A reactivity coefficient analysis revealed that this heterogeneous design will have comparable safety aspects to a homogeneous reactor of comparable size. A mass balance analysis revealed that the heterogeneous design may reduce the number of fast reactors needed to close the current once-through light water reactor fuel cycle.

  15. Dispersivity in heterogeneous permeable media

    SciTech Connect

    Chesnut, D.A.

    1994-01-01

    When one fluid displaces another through a one-dimensional porous medium, the composition changes from pure displacing fluid at the inlet to pure displaced fluid some distance downstream. The distance over which an arbitrary percentage of this change occurs is defined as the mixing zone length, which increases with increasing average distance traveled by the displacement front. For continuous injection, the mixing zone size can be determined from a breakthrough curve as the time required for the effluent displacing fluid concentration to change from, say, 10% to 90%. In classical dispersion theory, the mixing zone grows in proportion to the square root of the mean distance traveled, or, equivalently, to the square root of the mean breakthrough time. In a multi-dimensional heterogeneous medium, especially at field scales, the size of the mixing zone grows almost linearly with mean distance or travel time. If an observed breakthrough curve is forced to fit the, clinical theory, the resulting effective dispersivity, instead of being constant, also increases almost linearly with the spatial or temporal scale of the problem. This occurs because the heterogeneity in flow properties creates a corresponding velocity distribution along the different flow pathways from the inlet to the outlet of the system. Mixing occurs mostly at the outlet, or wherever the fluid is sampled, rather than within the medium. In this paper, we consider the effects. of this behavior on radionuclide or other contaminant migration.

  16. Thermal properties of heterogeneous grains

    NASA Technical Reports Server (NTRS)

    Lien, David J.

    1988-01-01

    Cometary dust is not spherical nor homogeneous, yet these are the assumptions used to model its thermal, optical, and dynamical properties. To better understand the effects of heterogeneity on the thermal and optical properties of dust grains, the effective dielectric constant for an admixture of magnetite and a silicate were calculated using two different effective medium theories: the Maxwell-Garnett theory and the Bruggeman theory. In concept, the MG theory describes the effective dielectric constant of a matrix material into which is embedded a large number of very small inclusions of a second material. The Bruggeman theory describes the dielectric constant of a well mixed aggregate of two or more types of materials. Both theories assume that the individual particles are much smaller than the wavelength of the incident radiation. The refractivity for a heterogeneous grain using the MG theory is very similar to the refractivity of the matrix material, even for large volume fractions of the inclusion. The equilibrium grain temperature for spherical particles sized from .001 to 100 microns in radius at 1 astronomical unit from the sun was calculated. Further explanation is given.

  17. Terrorists and Nuclear Technology

    ERIC Educational Resources Information Center

    Krieger, David

    1975-01-01

    This essay explores the ways terrorist groups may gain possession of nuclear materials; the way in which they may use nuclear weapons and other nuclear technologies to their benefit; and various courses of action designed to minimize the possibilities of terrorists utilizing nuclear technology to their benefit and society's detriment. (BT)

  18. Terrorists and Nuclear Technology

    ERIC Educational Resources Information Center

    Krieger, David

    1975-01-01

    This essay explores the ways terrorist groups may gain possession of nuclear materials; the way in which they may use nuclear weapons and other nuclear technologies to their benefit; and various courses of action designed to minimize the possibilities of terrorists utilizing nuclear technology to their benefit and society's detriment. (BT)

  19. Nuclear medicine annual, 1984

    SciTech Connect

    Freeman, L.M.; Weissmann, H.S.

    1984-01-01

    The following topics are reviewed in this work: nuclear physicians role in planning for and handling radiation accidents; the role of nuclear medicine in evaluating the hypertensive patient; studies of the heart with radionuclides; role of radionuclide imaging in the patient undergoing chemotherapy; hematologic nuclear medicine; the role of nuclear medicine in sports related injuries; radionuclide evaluation of hepatic function with emphasis on cholestatis.

  20. Frontiers of Nuclear Structure

    SciTech Connect

    Nazarewicz, Witold

    1997-12-31

    Current developments in nuclear structure at the `limits` are discussed. The studies of nuclear behavior at extreme conditions provide us with invaluable information about the nature of the nuclear interaction and nucleonic correlations at various energy-distance scales. In this talk frontiers of nuclear structure are briefly reviewed from a theoretical perspective, mainly concentrating on medium-mass and heavy nuclei.

  1. The New Nuclear Nations.

    ERIC Educational Resources Information Center

    Spector, Leonard S.

    1990-01-01

    Explores the issue of nuclear proliferation, noting that the countries with nuclear capability now include Israel, South Africa, India, and Pakistan. Describes the role and problems of the United States in halting nuclearization. Supplies charts, maps, and information concerning the state of nuclear capability in each country. (NL)

  2. Nuclear energy and security

    SciTech Connect

    BLEJWAS,THOMAS E.; SANDERS,THOMAS L.; EAGAN,ROBERT J.; BAKER,ARNOLD B.

    2000-01-01

    Nuclear power is an important and, the authors believe, essential component of a secure nuclear future. Although nuclear fuel cycles create materials that have some potential for use in nuclear weapons, with appropriate fuel cycles, nuclear power could reduce rather than increase real proliferation risk worldwide. Future fuel cycles could be designed to avoid plutonium production, generate minimal amounts of plutonium in proliferation-resistant amounts or configurations, and/or transparently and efficiently consume plutonium already created. Furthermore, a strong and viable US nuclear infrastructure, of which nuclear power is a large element, is essential if the US is to maintain a leadership or even participatory role in defining the global nuclear infrastructure and controlling the proliferation of nuclear weapons. By focusing on new fuel cycles and new reactor technologies, it is possible to advantageously burn and reduce nuclear materials that could be used for nuclear weapons rather than increase and/or dispose of these materials. Thus, the authors suggest that planners for a secure nuclear future use technology to design an ideal future. In this future, nuclear power creates large amounts of virtually atmospherically clean energy while significantly lowering the threat of proliferation through the thoughtful use, physical security, and agreed-upon transparency of nuclear materials. The authors must develop options for policy makers that bring them as close as practical to this ideal. Just as Atoms for Peace became the ideal for the first nuclear century, they see a potential nuclear future that contributes significantly to power for peace and prosperity.

  3. Nuclear air cushion vehicles

    NASA Technical Reports Server (NTRS)

    Anderson, J. L.

    1973-01-01

    The state-of-the-art of the still-conceptual nuclear air cushion vehicle, particularly the nuclear powerplant is identified. Using mission studies and cost estimates, some of the advantages of nuclear power for large air cushion vehicles are described. The technology studies on mobile nuclear powerplants and conceptual ACV systems/missions studies are summarized.

  4. Detection for Nuclear Nonproliferation

    DOE PAGES

    Pozzi, Sara A.; Hamel, Michael C.; Polack, J. Kyle; ...

    2016-11-13

    The detection and characterization of special nuclear materials is a high priority area for applications in nuclear safeguards and nonproliferation. We are developing new instruments based on organic scintillators to detect and characterize the emissions from special nuclear materials. This paper describes some of the gaps and challenges in nuclear safeguards and proposed approaches.

  5. The New Nuclear Nations.

    ERIC Educational Resources Information Center

    Spector, Leonard S.

    1990-01-01

    Explores the issue of nuclear proliferation, noting that the countries with nuclear capability now include Israel, South Africa, India, and Pakistan. Describes the role and problems of the United States in halting nuclearization. Supplies charts, maps, and information concerning the state of nuclear capability in each country. (NL)

  6. Genetic heterogeneity in multiple epiphyseal dysplasia

    SciTech Connect

    Deere, M.; Hecht, J.T.; Blanton, S.H.; Scott, C.I.; Langer, L.O.; Pauli, R.M.

    1995-03-01

    Multiple epiphyseal dysplasia (MED) comprises a group of hereditary chondrodysplasias in which there are major anatomic abnormalities of the long tubular bones. The Fairbank and Ribbing types are the most frequently cited types of MED. They are primarily defined radiographically and are autosomal dominant conditions. Recently, MED in one family was shown to map to the pericentromeric region of chromosome 19 and is probably allelic to pseudoachondroplasa. We have tested linkage with six short tandem repeat markers from chromosome 19 to autosomal dominant MED in one four-generation family and to MED in a unique family with three of seven siblings affected and with unaffected parents. Autosomal dominant MED in family 1 was linked with a maximum LOD score, at D19S212, of 3.22 at a recombination fraction ({theta}) of .00. Linkage to chromosome 19 was excluded with MED in the other family, under both autosomal recessive and autosomal dominant, with either reduced-penetrance or germ line-mosaicism models. Linkage to candidate genes COL9A1, COL9A2, and COL11A2 was tested and excluded for both genetic models in this family. COL11A1 was excluded under a recessive model. We have confirmed linkage of autosomal dominant Fairbank MED to chromosome 19 and have demonstrated that MED is genetically heterogeneous. 16 refs., 9 figs., 3 tabs.

  7. A1C

    MedlinePlus

    A1C is a blood test for type 2 diabetes and prediabetes. It measures your average blood glucose, or blood sugar, level over the past 3 ... A1C alone or in combination with other diabetes tests to make a diagnosis. They also use the ...

  8. [Chilean nuclear policy].

    PubMed

    Bobadilla, E

    1996-06-01

    This official document is statement of the President of the Chilean Nuclear Energy Commission, Dr. Eduardo Bobadilla, about the nuclear policy of the Chilean State, Thanks to the international policy adopted by presidents Aylwin (1990-1994) and his successor Frei Ruiz Tagle (1994-), a nuclear development plan, protected by the Chilean entrance to the nuclear weapons non proliferation treaty and Tlatelolco Denuclearization treaty, has started. Chile will be able to develop without interference, an autonomous nuclear electrical system and other pacific uses of nuclear energy. Chile also supports a new international treaty to ban nuclear weapon tests.

  9. Quantification of type I error probabilities for heterogeneity LOD scores.

    PubMed

    Abreu, Paula C; Hodge, Susan E; Greenberg, David A

    2002-02-01

    Locus heterogeneity is a major confounding factor in linkage analysis. When no prior knowledge of linkage exists, and one aims to detect linkage and heterogeneity simultaneously, classical distribution theory of log-likelihood ratios does not hold. Despite some theoretical work on this problem, no generally accepted practical guidelines exist. Nor has anyone rigorously examined the combined effect of testing for linkage and heterogeneity and simultaneously maximizing over two genetic models (dominant, recessive). The effect of linkage phase represents another uninvestigated issue. Using computer simulation, we investigated type I error (P value) of the "admixture" heterogeneity LOD (HLOD) score, i.e., the LOD score maximized over both recombination fraction theta and admixture parameter alpha and we compared this with the P values when one maximizes only with respect to theta (i.e., the standard LOD score). We generated datasets of phase-known and -unknown nuclear families, sizes k = 2, 4, and 6 children, under fully penetrant autosomal dominant inheritance. We analyzed these datasets (1) assuming a single genetic model, and maximizing the HLOD over theta and alpha; and (2) maximizing the HLOD additionally over two dominance models (dominant vs. recessive), then subtracting a 0.3 correction. For both (1) and (2), P values increased with family size k; rose less for phase-unknown families than for phase-known ones, with the former approaching the latter as k increased; and did not exceed the one-sided mixture distribution xi = (1/2) chi1(2) + (1/2) chi2(2). Thus, maximizing the HLOD over theta and alpha appears to add considerably less than an additional degree of freedom to the associated chi1(2) distribution. We conclude with practical guidelines for linkage investigators. Copyright 2002 Wiley-Liss, Inc.

  10. The nuclear freeze controversy

    SciTech Connect

    Payne, K.B.; Gray, C.S.

    1984-01-01

    This book presents papers on nuclear arms control. Topics considered include the background and rationale behind the nuclear freeze proposal, nuclear deterrence, national defense, arms races, arms buildup, warfare, the moral aspects of nuclear deterrence, treaty verification, the federal budget, the economy, a historical perspective on Soviet policy toward the freeze, the other side of the Soviet peace offensive, and making sense of the nuclear freeze debate.

  11. ARCHER, a New Monte Carlo Software Tool for Emerging Heterogeneous Computing Environments

    NASA Astrophysics Data System (ADS)

    Xu, X. George; Liu, Tianyu; Su, Lin; Du, Xining; Riblett, Matthew; Ji, Wei; Gu, Deyang; Carothers, Christopher D.; Shephard, Mark S.; Brown, Forrest B.; Kalra, Mannudeep K.; Liu, Bob

    2014-06-01

    The Monte Carlo radiation transport community faces a number of challenges associated with peta- and exa-scale computing systems that rely increasingly on heterogeneous architectures involving hardware accelerators such as GPUs. Existing Monte Carlo codes and methods must be strategically upgraded to meet emerging hardware and software needs. In this paper, we describe the development of a software, called ARCHER (Accelerated Radiation-transport Computations in Heterogeneous EnviRonments), which is designed as a versatile testbed for future Monte Carlo codes. Preliminary results from five projects in nuclear engineering and medical physics are presented.

  12. Data Integration for Heterogenous Datasets

    PubMed Central

    2014-01-01

    Abstract More and more, the needs of data analysts are requiring the use of data outside the control of their own organizations. The increasing amount of data available on the Web, the new technologies for linking data across datasets, and the increasing need to integrate structured and unstructured data are all driving this trend. In this article, we provide a technical overview of the emerging “broad data” area, in which the variety of heterogeneous data being used, rather than the scale of the data being analyzed, is the limiting factor in data analysis efforts. The article explores some of the emerging themes in data discovery, data integration, linked data, and the combination of structured and unstructured data. PMID:25553272

  13. Heterogeneous Antibody Responses in Tuberculosis

    PubMed Central

    Lyashchenko, Konstantin; Colangeli, Roberto; Houde, Michel; Al Jahdali, Hamdan; Menzies, Dick; Gennaro, Maria Laura

    1998-01-01

    Antibody responses during tuberculosis were analyzed by an enzyme-linked immunosorbent assay with a panel of 10 protein antigens of Mycobacterium tuberculosis. It was shown that serum immunoglobulin G antibodies were produced against a variety of M. tuberculosis antigens and that the vast majority of sera from tuberculosis patients contained antibodies against one or more M. tuberculosis antigens. The number and the species of serologically reactive antigens varied greatly from individual to individual. In a given serum, the level of specific antibodies also varied with the antigen irrespective of the total number of antigens recognized by that particular serum. These findings indicate that person-to-person heterogeneity of antigen recognition, rather than recognition of particular antigens, is a key attribute of the antibody response in tuberculosis. PMID:9673283

  14. Heterogeneous fuel for hybrid rocket

    NASA Technical Reports Server (NTRS)

    Stickler, David B. (Inventor)

    1996-01-01

    Heterogeneous fuel compositions suitable for use in hybrid rocket engines and solid-fuel ramjet engines, The compositions include mixtures of a continuous phase, which forms a solid matrix, and a dispersed phase permanently distributed therein. The dispersed phase or the matrix vaporizes (or melts) and disperses into the gas flow much more rapidly than the other, creating depressions, voids and bumps within and on the surface of the remaining bulk material that continuously roughen its surface, This effect substantially enhances heat transfer from the combusting gas flow to the fuel surface, producing a correspondingly high burning rate, The dispersed phase may include solid particles, entrained liquid droplets, or gas-phase voids having dimensions roughly similar to the displacement scale height of the gas-flow boundary layer generated during combustion.

  15. HETEROGENEOUS REBURNING BY MIXED FUELS

    SciTech Connect

    Wei-Yin Chen; Benson B. Gathitu

    2005-01-14

    Recent studies of heterogeneous reburning, i.e., reburning involving a coal-derived char, have elucidated its variables, kinetics and mechanisms that are valuable to the development of a highly efficient reburning process. Young lignite chars contain catalysts that not only reduce NO, but they also reduce HCN that is an important intermediate that recycles to NO in the burnout zone. Gaseous CO scavenges the surface oxides that are formed during NO reduction, regenerating the active sites on the char surface. Based on this mechanistic information, cost-effective mixed fuels containing these multiple features has been designed and tested in a simulated reburning apparatus. Remarkably high reduction of NO and HCN has been observed and it is anticipated that mixed fuel will remove 85% of NO in a three-stage reburning process.

  16. Genetic heterogeneity of hepatocellular carcinoma

    SciTech Connect

    Unsal, H.; Isselbacher, K.J. ); Yakicier, C.; Marcais, C.; Ozturk, M. ); Kew, M. ); Volkmann, M. ); Zentgraf, H. )

    1994-01-18

    The authors studied 80 hepatocellular carcinomas from three continents for p53 gene (TP53) mutations and hepatitis B virus (HBV) sequences. p53 mutations were frequent in tumors from Mozambique but not in tumors from South Africa, China, and Germany. Independent of geographic origin, most tumors were positive for HBV sequences. X gene coding sequences of HBV were detected in 78% of tumors, whereas viral sequences in the surface antigen- and core antigen-encoding regions were present in less than 35% of tumors. These observations indicate that hepatocellular carcinomas are genetically heterogeneous. Mozambican-types of hepatocellular carcinomas are characterized by a high incidence of p53 mutations related to aflatoxins. In other tumors, the rarity of p53 mutations combined with the frequent presence of viral X gene coding sequences suggests a possible interference of HBV with the wild-type p53 function.

  17. Surface science and heterogeneous catalysis

    SciTech Connect

    Somorjai, G.A.

    1980-05-01

    The catalytic reactions studied include hydrocarbon conversion over platinum, the transition metal-catalyzed hydrogenation of carbon monoxide, and the photocatalyzed dissociation of water over oxide surfaces. The method of combined surface science and catalytic studies is similar to those used in synthetic organic chemistry. The single-crystal models for the working catalyst are compared with real catalysts by comparing the rates of cyclopropane ring opening on platinum and the hydrogenation of carbon monoxide on rhodium single crystal surface with those on practical commercial catalyst systems. Excellent agreement was obtained for these reactions. This document reviews what was learned about heterogeneous catalysis from these surface science approaches over the past 15 years and present models of the active catalyst surface.

  18. Heterogeneous Reburning By Mixed Fuels

    SciTech Connect

    Anderson Hall

    2009-03-31

    Recent studies of heterogeneous reburning, i.e., reburning involving a coal-derived char, have elucidated its variables, kinetics and mechanisms that are valuable to the development of a highly efficient reburning process. Young lignite chars contain catalysts that not only reduce NO, but they also reduce HCN that is an important intermediate that recycles to NO in the burnout zone. Gaseous CO scavenges the surface oxides that are formed during NO reduction, regenerating the active sites on the char surface. Based on this mechanistic information, cost-effective mixed fuels containing these multiple features has been designed and tested in a simulated reburning apparatus. Remarkably high reduction of NO and HCN has been observed and it is anticipated that mixed fuel will remove 85% of NO in a three-stage reburning process.

  19. (90377) Sedna: Heterogeneous Surface Composition

    NASA Astrophysics Data System (ADS)

    Dalle Ore, Cristina M.; Barucci, M.; Alvarez-Candal, A.; de Bergh, C.; Merlin, F.; Dumas, C.; Cruikshank, D. P.

    2010-10-01

    The peculiar TNO (90377) Sedna is one of the most remote solar system objects accessible to investigations (current heliocentric distance 88AU). This dwarf planet is one of the reddest objects following the taxonomic group RR. To better constrain its surface composition and to investigate the possible heterogeneity of the surface of Sedna, several observations have been carried out at ESO-VLT with the powerful spectrometer SINFONI, which observes the H and K bands simultaneously. Even if Sedna, given its faintness, was at the limit of observations, the new analyzed spectra (obtained in 2005, 2007, and 2008) show a different behavior, particularly in the K band. Spectral modeling using the Shkuratov radiative transfer method has been performed using the various sets of data, including visible and Spitzer data, for a large wavelength range 0.4-4.5 microns, and the albedo value (0.21) estimated by Stansberry et al. (2008). We find that the surface of Sedna is not completely homogeneous. The visible and near-IR spectra can be modeled with organic materials (triton and titan tholin), serpentine, and H2O ice in fairly significant amounts, and CH4, N2 and C2H6 in varying trace amounts. One of the spectra, showing a different signature in the K-band, observed as part of the October 2005 group of data, is best modeled with CH3OH in place of CH4, with reduced amounts of serpentine and with the addition of olivine. The compositional surface heterogeneity can give clues to the origin and past history of this peculiar distant object.

  20. 75 FR 3497 - Entergy Nuclear Operations, Inc., Entergy Nuclear Indian Point 2, LLC, Entergy Nuclear Indian...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-01-21

    ..., ``Hybrid Hearing Procedures for Expansion of Spent Fuel Storage Capacity at Civilian Nuclear Power Reactors... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Entergy Nuclear Operations, Inc., Entergy Nuclear Indian Point 2, LLC, Entergy Nuclear...

  1. Quantum nuclear pasta and nuclear symmetry energy

    NASA Astrophysics Data System (ADS)

    Fattoyev, F. J.; Horowitz, C. J.; Schuetrumpf, B.

    2017-05-01

    Complex and exotic nuclear geometries, collectively referred to as "nuclear pasta," are expected to appear naturally in dense nuclear matter found in the crusts of neutron stars and supernovae environments. The pasta geometries depend on the average baryon density, proton fraction, and temperature and are critically important in the determination of many transport properties of matter in supernovae and the crusts of neutron stars. Using a set of self-consistent microscopic nuclear energy density functionals, we present the first results of large scale quantum simulations of pasta phases at baryon densities 0.03 ≤ρ ≤0.10 fm-3 , proton fractions 0.05 ≤Yp≤0.40 , and zero temperature. The full quantum simulations, in particular, allow us to thoroughly investigate the role and impact of the nuclear symmetry energy on pasta configurations. We use the Sky3D code that solves the Skyrme Hartree-Fock equations on a three-dimensional Cartesian grid. For the nuclear interaction we use the state-of-the-art UNEDF1 parametrization, which was introduced to study largely deformed nuclei, hence is suitable for studies of the nuclear pasta. Density dependence of the nuclear symmetry energy is simulated by tuning two purely isovector observables that are insensitive to the current available experimental data. We find that a minimum total number of nucleons A =2000 is necessary to prevent the results from containing spurious shell effects and to minimize finite size effects. We find that a variety of nuclear pasta geometries are present in the neutron star crust, and the result strongly depends on the nuclear symmetry energy. The impact of the nuclear symmetry energy is less pronounced as the proton fractions increase. Quantum nuclear pasta calculations at T =0 MeV are shown to get easily trapped in metastable states, and possible remedies to avoid metastable solutions are discussed.

  2. Improvement of Nuclear Heating Evaluation Inside the Core of the OSIRIS Material Testing Reactor

    NASA Astrophysics Data System (ADS)

    Péron, Arthur; Malouch, Fadhel; Diop, Cheikh M.

    2016-02-01

    In this paper we present a nuclear heating from neutron and photon rays calculation scheme mainly based on the Monte-Carlo neutral particle transport code TRIPOLI-4® which takes into account the axial distributions of fuel element compositions. This calculation scheme is applied to the OSIRIS reactor in order to evaluate the effect of using realistic axially heterogeneous compositions instead of uniform ones. After a description of nuclear heating evaluation, the calculation scheme is described. Numerical simulations and related results are detailed and analysed to determine the impact of axially heterogeneous compositions on fluxes, power and nuclear heating.

  3. Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution

    PubMed Central

    Jain, Niyati; Lin, Hsuan-Chun; Morgan, Christopher E.; Harris, Michael E.; Tolbert, Blanton S.

    2017-01-01

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a multipurpose RNA-binding protein (RBP) involved in normal and pathological RNA metabolism. Transcriptome-wide mapping and in vitro evolution identify consensus hnRNP A1 binding motifs; however, such data do not reveal how surrounding RNA sequence and structural context modulate affinity. We determined the affinity of hnRNP A1 for all possible sequence variants (n = 16,384) of the HIV exon splicing silencer 3 (ESS3) 7-nt apical loop. Analysis of the affinity distribution identifies the optimal motif 5′-YAG-3′ and shows how its copy number, position in the loop, and loop structure modulate affinity. For a subset of ESS3 variants, we show that specificity is determined by association rate constants and that variants lacking the minimal sequence motif bind competitively with consensus RNA. Thus, the results reveal general rules of specificity of hnRNP A1 and provide a quantitative framework for understanding how it discriminates between alternative competing RNA ligands in vivo. PMID:28193894

  4. Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution.

    PubMed

    Jain, Niyati; Lin, Hsuan-Chun; Morgan, Christopher E; Harris, Michael E; Tolbert, Blanton S

    2017-02-28

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is a multipurpose RNA-binding protein (RBP) involved in normal and pathological RNA metabolism. Transcriptome-wide mapping and in vitro evolution identify consensus hnRNP A1 binding motifs; however, such data do not reveal how surrounding RNA sequence and structural context modulate affinity. We determined the affinity of hnRNP A1 for all possible sequence variants (n = 16,384) of the HIV exon splicing silencer 3 (ESS3) 7-nt apical loop. Analysis of the affinity distribution identifies the optimal motif 5'-YAG-3' and shows how its copy number, position in the loop, and loop structure modulate affinity. For a subset of ESS3 variants, we show that specificity is determined by association rate constants and that variants lacking the minimal sequence motif bind competitively with consensus RNA. Thus, the results reveal general rules of specificity of hnRNP A1 and provide a quantitative framework for understanding how it discriminates between alternative competing RNA ligands in vivo.

  5. A Study on the Basic Criteria for Selecting Heterogeneity Parameters of F18-FDG PET Images.

    PubMed

    Forgacs, Attila; Pall Jonsson, Hermann; Dahlbom, Magnus; Daver, Freddie; D DiFranco, Matthew; Opposits, Gabor; K Krizsan, Aron; Garai, Ildiko; Czernin, Johannes; Varga, Jozsef; Tron, Lajos; Balkay, Laszlo

    2016-01-01

    Textural analysis might give new insights into the quantitative characterization of metabolically active tumors. More than thirty textural parameters have been investigated in former F18-FDG studies already. The purpose of the paper is to declare basic requirements as a selection strategy to identify the most appropriate heterogeneity parameters to measure textural features. Our predefined requirements were: a reliable heterogeneity parameter has to be volume independent, reproducible, and suitable for expressing quantitatively the degree of heterogeneity. Based on this criteria, we compared various suggested measures of homogeneity. A homogeneous cylindrical phantom was measured on three different PET/CT scanners using the commonly used protocol. In addition, a custom-made inhomogeneous tumor insert placed into the NEMA image quality phantom was imaged with a set of acquisition times and several different reconstruction protocols. PET data of 65 patients with proven lung lesions were retrospectively analyzed as well. Four heterogeneity parameters out of 27 were found as the most attractive ones to characterize the textural properties of metabolically active tumors in FDG PET images. These four parameters included Entropy, Contrast, Correlation, and Coefficient of Variation. These parameters were independent of delineated tumor volume (bigger than 25-30 ml), provided reproducible values (relative standard deviation< 10%), and showed high sensitivity to changes in heterogeneity. Phantom measurements are a viable way to test the reliability of heterogeneity parameters that would be of interest to nuclear imaging clinicians.

  6. A Study on the Basic Criteria for Selecting Heterogeneity Parameters of F18-FDG PET Images

    PubMed Central

    Forgacs, Attila; Pall Jonsson, Hermann; Dahlbom, Magnus; Daver, Freddie; D. DiFranco, Matthew; Opposits, Gabor; K. Krizsan, Aron; Garai, Ildiko; Czernin, Johannes; Varga, Jozsef; Tron, Lajos; Balkay, Laszlo

    2016-01-01

    Textural analysis might give new insights into the quantitative characterization of metabolically active tumors. More than thirty textural parameters have been investigated in former F18-FDG studies already. The purpose of the paper is to declare basic requirements as a selection strategy to identify the most appropriate heterogeneity parameters to measure textural features. Our predefined requirements were: a reliable heterogeneity parameter has to be volume independent, reproducible, and suitable for expressing quantitatively the degree of heterogeneity. Based on this criteria, we compared various suggested measures of homogeneity. A homogeneous cylindrical phantom was measured on three different PET/CT scanners using the commonly used protocol. In addition, a custom-made inhomogeneous tumor insert placed into the NEMA image quality phantom was imaged with a set of acquisition times and several different reconstruction protocols. PET data of 65 patients with proven lung lesions were retrospectively analyzed as well. Four heterogeneity parameters out of 27 were found as the most attractive ones to characterize the textural properties of metabolically active tumors in FDG PET images. These four parameters included Entropy, Contrast, Correlation, and Coefficient of Variation. These parameters were independent of delineated tumor volume (bigger than 25–30 ml), provided reproducible values (relative standard deviation< 10%), and showed high sensitivity to changes in heterogeneity. Phantom measurements are a viable way to test the reliability of heterogeneity parameters that would be of interest to nuclear imaging clinicians. PMID:27736888

  7. Nuclear Waste Disposal

    SciTech Connect

    Gee, Glendon W.; Meyer, Philip D.; Ward, Andy L.

    2005-01-12

    Nuclear wastes are by-products of nuclear weapons production and nuclear power generation, plus residuals of radioactive materials used by industry, medicine, agriculture, and academia. Their distinctive nature and potential hazard make nuclear wastes not only the most dangerous waste ever created by mankind, but also one of the most controversial and regulated with respect to disposal. Nuclear waste issues, related to uncertainties in geologic disposal and long-term protection, combined with potential misuse by terrorist groups, have created uneasiness and fear in the general public and remain stumbling blocks for further development of a nuclear industry in a world that may soon be facing a global energy crisis.

  8. Nuclear DNA helicase II/RNA helicase A binds to filamentous actin.

    PubMed

    Zhang, Suisheng; Buder, Katrin; Burkhardt, Carmen; Schlott, Bernhard; Görlach, Matthias; Grosse, Frank

    2002-01-04

    Nuclear DNA helicase II (NDH II), also designated RNA helicase A, is a multifunctional protein involved in transcription, RNA processing, and transport. Here we report that NDH II binds to F-actin. NDH II was partially purified from HeLa nuclear extracts by ion-exchange chromatography on Bio-Rex 70 and DEAE-Sepharose. Upon gel-filtration chromatography on Sepharose 4B, partially purified NDH II resolved into two distinct peaks. The first NDH II peak, corresponding to the void volume of Sepharose 4B, displayed coelution with an abundant 42-kDa protein that was subsequently identified as actin. Several nuclear proteins such as RNA polymerase II, the U5 small nuclear ribonucleoprotein (RNP)-associated WD40 protein, and heterogeneous nuclear RNPs (hnRNPs) copurified with NDH II. However, only hnRNPs A1 and C were found together with NDH II and actin polymers during gel filtration. NDH II and hnRNP C from the HeLa nuclear extract coeluted with F-actin on Sepharose 4B in an RNase-resistant manner, whereas hnRNP A1 was nearly completely removed from F-actin-associated hnRNP complexes following RNA digestion. The association of NDH II and hnRNP C with F-actin was abolished by gelsolin, an F-actin-depolymerizing protein that fragments actin polymers into oligomers or monomers. Furthermore, NDH II co-immunoprecipitated with F-actin and hnRNP C, respectively. In vitro translated NDH II coeluted with F-actin on Sepharose 4B, whereas no coelution with F-actin was observed for in vitro translated hnRNP A1 or C1. Binding to F-actin requires an intact C terminus of NDH II and most likely a native protein conformation. Electron microscopy indicated a close spatial proximity among NDH II, hnRNP C, and F-actin within the HeLa nucleus. These results suggest an important function of NDH II in mediating the attachment of hnRNP-mRPP RNP complexes to the actin nucleoskeleton for RNA processing, transport, or other actin-related processes.

  9. Molecular forensic science analysis of nuclear materials

    NASA Astrophysics Data System (ADS)

    Reilly, Dallas David

    Concerns over the proliferation and instances of nuclear material in the environment have increased interest in the expansion of nuclear forensics analysis and attribution programs. A new related field, molecular forensic science (MFS) has helped meet this expansion by applying common scientific analyses to nuclear forensics scenarios. In this work, MFS was applied to three scenarios related to nuclear forensics analysis. In the first, uranium dioxide was synthesized and aged at four sets of static environmental conditions and studied for changes in chemical speciation. The second highlighted the importance of bulk versus particle characterizations by analyzing a heterogeneous industrially prepared sample with similar techniques. In the third, mixed uranium/plutonium hot particles were collected from the McGuire Air Force Base BOMARC Site and analyzed for chemical speciation and elemental surface composition. This work has identified new signatures and has indicated unexpected chemical behavior under various conditions. These findings have lead to an expansion of basic actinide understanding, proof of MFS as a tool for nuclear forensic science, and new areas for expansion in these fields.

  10. Spent Nuclear Fuel Disposition

    SciTech Connect

    Wagner, John C.

    2016-05-22

    One interdisciplinary field devoted to achieving the end-state of used nuclear fuel (UNF) through reuse and/or permanent disposal. The reuse option aims to make use of the remaining energy content in UNF and reduce the amount of long-lived radioactive materials that require permanent disposal. The planned approach in the U.S., as well as in many other countries worldwide, is direct permanent disposal in a deep geologic repository. Used nuclear fuel is fuel that has been irradiated in a nuclear reactor to the point where it is no longer capable of sustaining operational objectives. The vast majority (by mass) of UNF is from electricity generation in commercial nuclear power reactors. Furthermore, the other main source of UNF in the U.S. is the Department of Energy’s (DOE) and other federal agencies’ operation of reactors in support of federal government missions, such as materials production, nuclear propulsion, research, testing, and training. Upon discharge from a reactor, UNF emits considerable heat from radioactive decay. Some period of active on-site cooling (e.g., 2 or more years) is typically required to facilitate efficient packaging and transportation to a disposition facility. Hence, the field of UNF disposition broadly includes storage, transportation and ultimate disposition. See also: Nuclear Fission (content/nuclear-fission/458400), Nuclear Fuels (/content/nuclear-fuels/458600), Nuclear Fuel Cycle (/content/nuclear-fuel-cycle/458500), Nuclear Fuels Reprocessing (/content/nuclear-fuels-reprocessing/458700), Nuclear Power (/content/nuclear-power/459600), Nuclear Reactor (/content/nuclear-reactor/460100), Radiation (/content/radiation/566300), and Radioactive Waste Management (/content/radioactive-waste-management/568900).

  11. Spent Nuclear Fuel Disposition

    DOE PAGES

    Wagner, John C.

    2016-05-22

    One interdisciplinary field devoted to achieving the end-state of used nuclear fuel (UNF) through reuse and/or permanent disposal. The reuse option aims to make use of the remaining energy content in UNF and reduce the amount of long-lived radioactive materials that require permanent disposal. The planned approach in the U.S., as well as in many other countries worldwide, is direct permanent disposal in a deep geologic repository. Used nuclear fuel is fuel that has been irradiated in a nuclear reactor to the point where it is no longer capable of sustaining operational objectives. The vast majority (by mass) of UNFmore » is from electricity generation in commercial nuclear power reactors. Furthermore, the other main source of UNF in the U.S. is the Department of Energy’s (DOE) and other federal agencies’ operation of reactors in support of federal government missions, such as materials production, nuclear propulsion, research, testing, and training. Upon discharge from a reactor, UNF emits considerable heat from radioactive decay. Some period of active on-site cooling (e.g., 2 or more years) is typically required to facilitate efficient packaging and transportation to a disposition facility. Hence, the field of UNF disposition broadly includes storage, transportation and ultimate disposition. See also: Nuclear Fission (content/nuclear-fission/458400), Nuclear Fuels (/content/nuclear-fuels/458600), Nuclear Fuel Cycle (/content/nuclear-fuel-cycle/458500), Nuclear Fuels Reprocessing (/content/nuclear-fuels-reprocessing/458700), Nuclear Power (/content/nuclear-power/459600), Nuclear Reactor (/content/nuclear-reactor/460100), Radiation (/content/radiation/566300), and Radioactive Waste Management (/content/radioactive-waste-management/568900).« less

  12. Nuclear Security for Floating Nuclear Power Plants

    SciTech Connect

    Skiba, James M.; Scherer, Carolynn P.

    2015-10-13

    Recently there has been a lot of interest in small modular reactors. A specific type of these small modular reactors (SMR,) are marine based power plants called floating nuclear power plants (FNPP). These FNPPs are typically built by countries with extensive knowledge of nuclear energy, such as Russia, France, China and the US. These FNPPs are built in one country and then sent to countries in need of power and/or seawater desalination. Fifteen countries have expressed interest in acquiring such power stations. Some designs for such power stations are briefly summarized. Several different avenues for cooperation in FNPP technology are proposed, including IAEA nuclear security (i.e. safeguards), multilateral or bilateral agreements, and working with Russian design that incorporates nuclear safeguards for IAEA inspections in non-nuclear weapons states

  13. Expanding the genetic heterogeneity of intellectual disability.

    PubMed

    Anazi, Shams; Maddirevula, Sateesh; Salpietro, Vincenzo; Asi, Yasmine T; Alsahli, Saud; Alhashem, Amal; Shamseldin, Hanan E; AlZahrani, Fatema; Patel, Nisha; Ibrahim, Niema; Abdulwahab, Firdous M; Hashem, Mais; Alhashmi, Nadia; Al Murshedi, Fathiya; Al Kindy, Adila; Alshaer, Ahmad; Rumayyan, Ahmed; Al Tala, Saeed; Kurdi, Wesam; Alsaman, Abdulaziz; Alasmari, Ali; Banu, Selina; Sultan, Tipu; Saleh, Mohammed M; Alkuraya, Hisham; Salih, Mustafa A; Aldhalaan, Hesham; Ben-Omran, Tawfeg; Al Musafri, Fatima; Ali, Rehab; Suleiman, Jehan; Tabarki, Brahim; El-Hattab, Ayman W; Bupp, Caleb; Alfadhel, Majid; Al Tassan, Nada; Monies, Dorota; Arold, Stefan T; Abouelhoda, Mohamed; Lashley, Tammaryn; Houlden, Henry; Faqeih, Eissa; Alkuraya, Fowzan S

    2017-09-22

    Intellectual disability (ID) is a common morbid condition with a wide range of etiologies. The list of monogenic forms of ID has increased rapidly in recent years thanks to the implementation of genomic sequencing techniques. In this study, we describe the phenotypic and genetic findings of 68 families (105 patients) all with novel ID-related variants. In addition to established ID genes, including ones for which we describe unusual mutational mechanism, some of these variants represent the first confirmatory disease-gene links following previous reports (TRAK1, GTF3C3, SPTBN4 and NKX6-2), some of which were based on single families. Furthermore, we describe novel variants in 14 genes that we propose as novel candidates (ANKHD1, ASTN2, ATP13A1, FMO4, MADD, MFSD11, NCKAP1, NFASC, PCDHGA10, PPP1R21, SLC12A2, SLK, STK32C and ZFAT). We highlight MADD and PCDHGA10 as particularly compelling candidates in which we identified biallelic likely deleterious variants in two independent ID families each. We also highlight NCKAP1 as another compelling candidate in a large family with autosomal dominant mild intellectual disability that fully segregates with a heterozygous truncating variant. The candidacy of NCKAP1 is further supported by its biological function, and our demonstration of relevant expression in human brain. Our study expands the locus and allelic heterogeneity of ID and demonstrates the power of positional mapping to reveal unusual mutational mechanisms.

  14. Hot-spot initiation of heterogeneous explosives

    SciTech Connect

    Kipp, M.E.; Nonziato, J.W.; Setchell, R.E.; Walsh, E.K.

    1981-01-01

    It is generally accepted that the shock initiation of heterogeneous explosives begins with the formation of hot spots in the vicinity of microstructural defects such as voids, grain boundaries, and phase boundaries where there can be significant localized deformation as a result of material viscosity, plastic work, and intergranular friction. This phenomenon is described in the context of a recently developed theory of chemically reacting, multiphase mixtures. In particular, we consider a granular explosive with an energetic binder (e.g. PBX-9404) and represent it as a three-phase, saturated mixture consisting of the granular reactant, the binder phase, and the product gases. Under dynamic loading, viscous dissipation results in high temperatures in the binder phase which subsequently thermally explodes to form product gases. Decomposition of the granular reactant is achieved by laminar grain burning. This model has been incorporated into a 1-D Lagrangian finite-difference code (WONDY) and the evolution of compressive shock and acceleration (ramp) waves have been calculated for PBX-9404. The calculated wave growth at the front, as well as the reaction-induced pressure wave behind the wave, are shown to be in good agreement with experimental observations.

  15. Understanding the Executive Functioning Heterogeneity in Schizophrenia

    ERIC Educational Resources Information Center

    Raffard, Stephane; Bayard, Sophie

    2012-01-01

    Schizophrenia is characterized by heterogeneous brain abnormalities involving cerebral regions implied in the executive functioning. The dysexecutive syndrome is one of the most prominent and functionally cognitive features of schizophrenia. Nevertheless, it is not clear to what extend executive deficits are heterogeneous in schizophrenia…

  16. The composition of heterogeneous control laws

    NASA Technical Reports Server (NTRS)

    Kuipers, Benjamin; Astrom, Karl

    1991-01-01

    The fuzzy control literature and industrial practice provide certain nonlinear methods for combining heterogeneous control laws, but these methods have been very difficult to analyze theoretically. An alternate formulation and extension of this approach is presented that has several practical and theoretical benefits. An example of heterogeneous control is given and two alternate analysis methods are presented.

  17. Functional Heterogeneity and Senior Management Team Effectiveness

    ERIC Educational Resources Information Center

    Benoliel, Pascale; Somech, Anit

    2016-01-01

    Purpose: There has been an increasing trend toward the creation of senior management teams (SMTs) which are characterized by a high degree of functional heterogeneity. Although such teams may create better linkages to information, along with the benefits of functional heterogeneity comes the potential for conflicts that stem from the value…

  18. Understanding the Executive Functioning Heterogeneity in Schizophrenia

    ERIC Educational Resources Information Center

    Raffard, Stephane; Bayard, Sophie

    2012-01-01

    Schizophrenia is characterized by heterogeneous brain abnormalities involving cerebral regions implied in the executive functioning. The dysexecutive syndrome is one of the most prominent and functionally cognitive features of schizophrenia. Nevertheless, it is not clear to what extend executive deficits are heterogeneous in schizophrenia…

  19. Heterogeneous Factor Analysis Models: A Bayesian Approach.

    ERIC Educational Resources Information Center

    Ansari, Asim; Jedidi, Kamel; Dube, Laurette

    2002-01-01

    Developed Markov Chain Monte Carlo procedures to perform Bayesian inference, model checking, and model comparison in heterogeneous factor analysis. Tested the approach with synthetic data and data from a consumption emotion study involving 54 consumers. Results show that traditional psychometric methods cannot fully capture the heterogeneity in…

  20. Chemical and seismological constraints on mantle heterogeneity.

    PubMed

    Helffrich, George

    2002-11-15

    Recent seismological studies that use scattered waves to detect heterogeneities in the mantle reveal the presence of a small, distributed elastic heterogeneity in the lower mantle which does not appear to be thermal in nature. The characteristic size of these heterogeneities appears to be ca. 8 km, suggesting that they represent subducted recycled oceanic crust. With this stimulus, old ideas that the mantle is heterogeneous in structure, rather than stratified, are reinterpreted and a simple, end-member model for the heterogeneity structure is proposed. The volumetrically largest components in the model are recycled oceanic crust, which contains the heat-producing elements, and mantle depleted of these and other incompatible trace elements. About 10% of the mantle's mass is made up of recycled oceanic crust, which is associated with the observed small-scale seismic heterogeneity. The way this heterogeneity is distributed is in convectively stretched and thinned bodies ranging downwards in size from 8 km. With the present techniques to detect small bodies through scattering, only ca. 55% of the mantle's small-scale heterogeneities are detectable seismically.

  1. Functional Heterogeneity and Senior Management Team Effectiveness

    ERIC Educational Resources Information Center

    Benoliel, Pascale; Somech, Anit

    2016-01-01

    Purpose: There has been an increasing trend toward the creation of senior management teams (SMTs) which are characterized by a high degree of functional heterogeneity. Although such teams may create better linkages to information, along with the benefits of functional heterogeneity comes the potential for conflicts that stem from the value…

  2. Distributional Scaling in Heterogeneous Aquifers

    NASA Astrophysics Data System (ADS)

    Polsinelli, J. F.

    2015-12-01

    An investigation is undertaken into the fractal scaling properties of the piezometric head in a heterogeneous unconfined aquifer. The governing equations for the unconfined flow are derived from conservation of mass and the Darcy law. The Dupuit approximation will be used to model the dynamics. The spatially varying nature of the tendency to conduct flow (e.g. the hydraulic conductivity) is represented as a stochastic process. Experimental studies in the literature have indicated that the conductivity belongs to a class of non-stationary stochastic fields, called H-ss fields. The uncertainty in the soil parameters is imparted onto the flow variables; in groundwater investigations the potentiometric head will be a random function. The structure of the head field will be analyzed with an emphasis on the scaling properties. The scaling scheme for the modeling equations and the simulation procedure for the saturated hydraulic conductivity process will be explained, then the method will be validated through numerical experimentation using the USGS Modflow-2005 software. The results of the numerical simulations demonstrate that the head will exhibit multi-fractal scaling if the hydraulic conductivity exhibits multi-fractal scaling and the differential equations for the groundwater equation satisfy a particular set of scale invariance conditions.

  3. Aggregation of Heterogeneously Charged Colloids.

    PubMed

    Dempster, Joshua M; Olvera de la Cruz, Monica

    2016-06-28

    Patchy colloids are attractive as programmable building blocks for metamaterials. Inverse patchy colloids, in which a charged surface is decorated with patches of the opposite charge, are additionally noteworthy as models for heterogeneously charged biological materials such as proteins. We study the phases and aggregation behavior of a single charged patch in an oppositely charged colloid with a single-site model. This single-patch inverse patchy colloid model shows a large number of phases when varying patch size. For large patch sizes we find ferroelectric crystals, while small patch sizes produce cross-linked gels. Intermediate values produce monodisperse clusters and unusual worm structures that preserve finite ratios of area to volume. The polarization observed at large patch sizes is robust under extreme disorder in patch size and shape. We examine phase-temperature dependence and coexistence curves and find that large patch sizes produce polarized liquids, in contrast to mean-field predictions. Finally, we introduce small numbers of unpatched charged colloids. These can either suppress or encourage aggregation depending on their concentration and the size of the patches on the patched colloids. These effects can be exploited to control aggregation and to measure effective patch size.

  4. Spectral heterogeneity of honeybee ommatidia

    NASA Astrophysics Data System (ADS)

    Wakakuwa, Motohiro; Kurasawa, Masumi; Giurfa, Martin; Arikawa, Kentaro

    2005-10-01

    The honeybee compound eye is equipped with ultraviolet, blue, and green receptors, which form the physiological basis of a trichromatic color vision system. We studied the distribution of the spectral receptors by localizing the three mRNAs encoding the opsins of the ultraviolet-, blue- and green-absorbing visual pigments. The expression patterns of the three opsin mRNAs demonstrated that three distinct types ommatidia exist, refuting the common assumption that the ommatidia composing the bee compound eye contain identical sets of spectral receptors. We found that type I ommatidia contain one ultraviolet and one blue receptor, type II ommatidia contain two ultraviolet receptors, and type III ommatidia have two blue receptors. All the three ommatidial types contain six green receptors. The ommatidia appear to be distributed rather randomly over the retina. The ratio of type I, II, and III ommatidia was about 44:46:10. Type III ommatidia appeared to be slightly more frequent (18%) in the anterior part of the ventral region of the eye. Retinal heterogeneity and ommatidial randomness, first clearly demonstrated in butterflies, seems to be a common design principle of the eyes of insects.

  5. Clinical significance of monocyte heterogeneity.

    PubMed

    Stansfield, Brian K; Ingram, David A

    2015-01-01

    Monocytes are primitive hematopoietic cells that primarily arise from the bone marrow, circulate in the peripheral blood and give rise to differentiated macrophages. Over the past two decades, considerable attention to monocyte diversity and macrophage polarization has provided contextual clues into the role of myelomonocytic derivatives in human disease. Until recently, human monocytes were subdivided based on expression of the surface marker CD16. "Classical" monocytes express surface markers denoted as CD14(++)CD16(-) and account for greater than 70% of total monocyte count, while "non-classical" monocytes express the CD16 antigen with low CD14 expression (CD14(+)CD16(++)). However, recognition of an intermediate population identified as CD14(++)CD16(+) supports the new paradigm that monocytes are a true heterogeneous population and careful identification of specific subpopulations is necessary for understanding monocyte function in human disease. Comparative studies of monocytes in mice have yielded more dichotomous results based on expression of the Ly6C antigen. In this review, we will discuss the use of monocyte subpopulations as biomarkers of human disease and summarize correlative studies in mice that may yield significant insight into the contribution of each subset to disease pathogenesis.

  6. Adaptation Driven by Spatial Heterogeneities

    NASA Astrophysics Data System (ADS)

    Hermsen, Rutger

    2011-03-01

    Biological evolution and ecology are intimately linked, because the reproductive success or ``fitness'' of an organism depends crucially on its ecosystem. Yet, most models of evolution (or population genetics) consider homogeneous, fixed-size populations subjected to a constant selection pressure. To move one step beyond such ``mean field'' descriptions, we discuss stochastic models of evolution driven by spatial heterogeneity. We imagine a population whose range is limited by a spatially varying environmental parameter, such as a temperature or the concentration of an antibiotic drug. Individuals in the population replicate, die and migrate stochastically. Also, by mutation, they can adapt to the environmental stress and expand their range. This way, adaptation and niche expansion go hand in hand. This mode of evolution is qualitatively different from the usual notion of a population climbing a fitness gradient. We analytically calculate the rate of adaptation by solving a first passage time problem. Interestingly, the joint effects of reproduction, death, mutation and migration result in two distinct parameter regimes depending on the relative time scales of mutation and migration. We argue that the proposed scenario may be relevant for the rapid evolution of antibiotic resistance. This work was supported by the Center for Theoretical Biological Physics sponsored by the National Science Foundation (NSF) (Grant PHY-0822283).

  7. Operating a heterogeneous telescope network

    NASA Astrophysics Data System (ADS)

    Allan, Alasdair; Bischoff, Karsten; Burgdorf, Martin; Cavanagh, Brad; Christian, Damien; Clay, Neil; Dickens, Rob; Economou, Frossie; Fadavi, Mehri; Frazer, Stephen; Granzer, Thomas; Grosvenor, Sandy; Hessman, Frederic V.; Jenness, Tim; Koratkar, Anuradha; Lehner, Matthew; Mottram, Chris; Naylor, Tim; Saunders, Eric S.; Solomos, Nikolaos; Steele, Iain A.; Tuparev, Georg; Vestrand, W. Thomas; White, Robert R.; Yost, Sarah

    2006-06-01

    In the last few years the ubiquitous availability of high bandwidth networks has changed the way both robotic and non-robotic telescopes operate, with single isolated telescopes being integrated into expanding "smart" telescope networks that can span continents and respond to transient events in seconds. The Heterogeneous Telescope Networks (HTN)* Consortium represents a number of major research groups in the field of robotic telescopes, and together we are proposing a standards based approach to providing interoperability between the existing proprietary telescope networks. We further propose standards for interoperability, and integration with, the emerging Virtual Observatory. We present the results of the first interoperability meeting held last year and discuss the protocol and transport standards agreed at the meeting, which deals with the complex issue of how to optimally schedule observations on geographically distributed resources. We discuss a free market approach to this scheduling problem, which must initially be based on ad-hoc agreements between the participants in the network, but which may eventually expand into a electronic market for the exchange of telescope time.

  8. Denaturation patterns in heterogeneous DNA.

    PubMed

    Zoli, Marco

    2010-05-01

    The thermodynamical properties of heterogeneous DNA sequences are computed by path-integral techniques applied to a nonlinear model Hamiltonian. The base pairs relative displacements are interpreted as time-dependent paths whose amplitudes are consistent with the model potential for the hydrogen bonds between complementary strands. The portion of configuration space contributing to the partition function is determined, at any temperature, by selecting the ensemble of paths which fulfill the second law of thermodynamics. For a short DNA fragment, the denaturation is signaled by a succession of peaks in the specific-heat plots while the entropy grows continuously versus T. Thus, the opening of the double strand with bubble formation appears as a smooth crossover due to base pair fluctuation effects which are accounted for by the path-integral method. The multistep transition is driven by the adenine-thymine- (AT) rich regions of the DNA fragment. The base pairs path ensemble shows an enhanced degree of cooperativity at about the same temperatures for which the specific-heat peaks occur. These findings establish a link between microscopic and macroscopic signatures of the transition. The fractions of mean base pair stretchings are computed by varying the AT base pairs content and taking some threshold values for the occurrence of the molecule denaturation.

  9. Anomalous transport in heterogeneous media

    NASA Astrophysics Data System (ADS)

    Horbach, Jürgen; Siboni, Nima H.; Schnyder, Simon K.

    2017-08-01

    The diffusion dynamics of particles in heterogeneous media is studied using particle-based simulation techniques. A special focus is placed on systems where the transport of particles at long times exhibits anomalies such as subdiffusive or superdiffusive behavior. First, a two-dimensional model system is considered containing gas particles (tracers) that diffuse through a random arrangement of pinned, disk-shaped particles. This system is similar to a classical Lorentz gas. However, different from the original Lorentz model, soft instead of hard interactions are considered and we also discuss the case where the tracer particles interact with each other. We show that the modification from hard to soft interactions strongly affects anomalous-diffusive transport at high obstacle densities. Second, non-linear active micro-rheology in a glass-forming binary Yukawa mixture is investigated, pulling single particles through a deeply supercooled state by applying a constant force. Here, we observe superdiffusion in force direction and analyze its origin. Finally, we consider the Brownian dynamics of a particle which is pulled through a two-dimensional random force field. We discuss the similarities of this model with the Lorentz gas as well as active micro-rheology in glass-forming systems.

  10. Genetic heterogeneity in juvenile NCL

    SciTech Connect

    Hart, Y.M.; Andermann, E.; Mitchison, H.M.

    1994-09-01

    The neuronal ceroid lipofuscinoses (NCL) are a group of related lysosomal storage diseases classified according to the age of onset, clinical syndrome, and pathology. The clinical syndromes include myoclonus, visual failure, progressive dementia, ataxia and generalized tonic clonic seizures in varying combinations depending on the age of onset and pathology. The mode of inheritance is autosomal recessive in most cases, except for several families with the adult form (Kufs` disease) which have autosomal dominant inheritance. Linkage for the infantile (Halatia-Santavuori) form (CLN1), characterized ultrastructurally by lysosomal granular osmiophilic deposits (GROD), has been demonstrated with markers on chromosome lp, while the gene for the typical juvenile (Spielmeyer-Vogt) form (CLN3), characterized by fingerprint-profile inclusions, has been linked to chromosome 16p. The gene locations of the late infantile (Jansky-Bielschowsky) and adult (Kufs` disease) forms are unknown, although it has recently been shown that the late infantile form does not link to chromosome 16p. We describe three siblings, including a pair of monozygotic twins, with juvenile onset NCL with GROD in whom linkage to the CLN3 region of chromsome 16p has been excluded. This would suggest that there is genetic heterogeneity not only among the different clinical syndromes, but also among identical clinical syndromes with different ultrastructural characteristics. Preliminary studies of linkage to chromosome 1p employing the microsatellite marker HY-TM1 have been uninformative. Further studies with other chromosome 1 markers are underway.

  11. RBC nuclear scan

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003835.htm RBC nuclear scan To use the sharing features on this page, please enable JavaScript. An RBC nuclear scan uses small amounts of radioactive material to ...

  12. Nuclear Thermal Propulsion (NTP)

    NASA Image and Video Library

    NASA's history with nuclear thermal propulsion (NTP) technology goes back to the earliest days of the Agency. The Manned Lunar Rover Vehicle and the Nuclear Engine for Rocket Vehicle Applications p...

  13. Teaching "The Nuclear Predicament."

    ERIC Educational Resources Information Center

    Carman, Philip; Kneeshaw, Stephen

    1987-01-01

    Contends that courses on nuclear war must help students examine the political, social, religious, philosophical, economic, and moral assumptions which characterized the dilemma of nuclear armament/disarmament. Describes the upper level undergraduate course taught by the authors. (JDH)

  14. Triangle Universities Nuclear Laboratory

    SciTech Connect

    Not Available

    1991-01-01

    This report contains brief papers that discusses the following topics: Fundamental Symmetries in the Nucleus; Internucleon Interactions; Dynamics of Very Light Nuclei; Facets of the Nuclear Many-Body Problem; and Nuclear Instruments and Methods.

  15. Teaching "The Nuclear Predicament."

    ERIC Educational Resources Information Center

    Carman, Philip; Kneeshaw, Stephen

    1987-01-01

    Contends that courses on nuclear war must help students examine the political, social, religious, philosophical, economic, and moral assumptions which characterized the dilemma of nuclear armament/disarmament. Describes the upper level undergraduate course taught by the authors. (JDH)

  16. Nuclear fear revisited

    NASA Astrophysics Data System (ADS)

    Crease, Robert P.

    2010-10-01

    In 1988 the science historian Spencer Weart published a groundbreaking book called Nuclear Fear: A History of Images, which examined visions of radiation damage and nuclear disaster in newspapers, television, film, literature, advertisements and popular culture.

  17. Nuclear disarmament verification

    SciTech Connect

    DeVolpi, A.

    1993-12-31

    Arms control treaties, unilateral actions, and cooperative activities -- reflecting the defusing of East-West tensions -- are causing nuclear weapons to be disarmed and dismantled worldwide. In order to provide for future reductions and to build confidence in the permanency of this disarmament, verification procedures and technologies would play an important role. This paper outlines arms-control objectives, treaty organization, and actions that could be undertaken. For the purposes of this Workshop on Verification, nuclear disarmament has been divided into five topical subareas: Converting nuclear-weapons production complexes, Eliminating and monitoring nuclear-weapons delivery systems, Disabling and destroying nuclear warheads, Demilitarizing or non-military utilization of special nuclear materials, and Inhibiting nuclear arms in non-nuclear-weapons states. This paper concludes with an overview of potential methods for verification.

  18. Nuclear radiation actuated valve

    DOEpatents

    Christiansen, David W.; Schively, Dixon P.

    1985-01-01

    A nuclear radiation actuated valve for a nuclear reactor. The valve has a valve first part (such as a valve rod with piston) and a valve second part (such as a valve tube surrounding the valve rod, with the valve tube having side slots surrounding the piston). Both valve parts have known nuclear radiation swelling characteristics. The valve's first part is positioned to receive nuclear radiation from the nuclear reactor's fuel region. The valve's second part is positioned so that its nuclear radiation induced swelling is different from that of the valve's first part. The valve's second part also is positioned so that the valve's first and second parts create a valve orifice which changes in size due to the different nuclear radiation caused swelling of the valve's first part compared to the valve's second part. The valve may be used in a nuclear reactor's core coolant system.

  19. Heterogeneity assessment of functional T cell avidity

    PubMed Central

    Ioannidou, Kalliopi; Baumgaertner, Petra; Gannon, Philippe O.; Speiser, Michel F.; Allard, Mathilde; Hebeisen, Michael; Rufer, Nathalie; Speiser, Daniel E.

    2017-01-01

    The potency of cellular immune responses strongly depends on T cell avidity to antigen. Yet, functional avidity measurements are rarely performed in patients, mainly due to the technical challenges of characterizing heterogeneous T cells. The mean functional T cell avidity can be determined by the IFN-γ Elispot assay, with titrated amounts of peptide. Using this assay, we developed a method revealing the heterogeneity of functional avidity, represented by the steepness/hillslope of the peptide titration curve, documented by proof of principle experiments and mathematical modeling. Our data show that not only natural polyclonal CD8 T cell populations from cancer patients, but also monoclonal T cells differ strongly in their heterogeneity of functional avidity. Interestingly, clones and polyclonal cells displayed comparable ranges of heterogeneity. We conclude that besides the mean functional avidity, it is feasible and useful to determine its heterogeneity (hillslope) for characterizing T cell responses in basic research and patient investigation. PMID:28287160

  20. Mapping small-scale mantle heterogeneities using seismic arrays

    NASA Astrophysics Data System (ADS)

    Bentham, H. L.; Rost, S.

    2012-12-01

    In recent years array seismology has been used extensively to detect and locate the small scale (~10 km) structure of the Earth. In the mantle, small scale structure likely represents chemical heterogeneity and is essential in our understanding of mechanical mixing processes within mantle convection. As subducted crust is chemically distinct from the background mantle, imaging the remains of the crust provides a tracer for convectional flow. Evidence for heterogeneities has been found in the lower mantle in previous seismology studies but the arrivals associated with such heterogeneities are difficult to detect in the seismic data as they are typically low amplitude and are often masked by a multitude of larger amplitude arrivals. In this study we find global and regional seismic heterogeneities in the mantle by processing teleseismic earthquake data through array seismology methods. We find global patterns of heterogeneity using a stacking approach. To locate regional heterogeneities, we target the "quiet" window prior to the PP arrival for earthquakes with epicentral distances of 90-110°. Within this time window, we enhance the weak coherent energy that arrives off great circle path by calculating the observed directivity (slowness and backazimuth) and using a semblance weighted beampower measure. We use the directivity and travel times of suitable precursors to back-trace the energy to the origin of P-to-P reflections, using a 1D raytracer. Most of the P-to-P reflections that we observe have reflection origins in the upper/mid mantle. Beneath the western Pacific subduction zones, such reflections show a good correlation with subduction zone contours that are derived from subduction zone seismicity, and correlate well with tomography gradients of 0.01-0.5% per degree, interpreted as the edge of the slab. Deep mantle reflections (>600 km) are also observed to depths of ~1900 km. The locations of these heterogeneities are combined with previous seismological

  1. Nuclear power browning out

    SciTech Connect

    Flavin, C.; Lenssen, N.

    1996-05-01

    When the sad history of nuclear power is written, April 26, 1986, will be recorded as the day the dream died. The explosion at the Chernobyl plant was a terrible human tragedy- and it delivered a stark verdict on the hope that nuclear power will one day replace fossil fuel-based energy systems. Nuclear advocates may soldier on, but a decade after Chernobyl it is clear that nuclear power is no longer a viable energy option for the twenty-first century.

  2. JPRS Report Nuclear Developments

    DTIC Science & Technology

    2007-11-02

    release; Distribution Unlimited | -—fb 40 Nuclear Developments JPRS-TND-88-016 CONTENTS 2 SEPTEMBER 1988 CHINA Nuclear Power Chief Seeks...Foreign Cooperation [Yuan Zhou; CHINA DAILY (BUSINESS WEEKLY) 1 Aug 88] 1 Nuclear Fusion Study Reaches Advanced Level [Xiao Longlian; Beijing...Government ’Welcomes’ Group [Beijing XINHUA 12 Aug 88] 4 No Decision on Disposal of Daya Nuclear Waste [Andy Ho; Hong Kong SOUTH CHINA MORNING POST

  3. Nuclear air cushion vehicles.

    NASA Technical Reports Server (NTRS)

    Anderson, J. L.

    1973-01-01

    This paper serves several functions. It identifies the 'state-of-the-art' of the still-conceptual nuclear air cushion vehicle, particularly the nuclear powerplant. Using mission studies and cost estimates, the report describes some of the advantages of nuclear power for large air cushion vehicles. The paper also summarizes the technology studies on mobile nuclear powerplants and conceptual ACV systems/missions studies that have been performed at NASA Lewis Research Center.

  4. 10 CFR 50.49 - Environmental qualification of electric equipment important to safety for nuclear power plants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... important to safety for nuclear power plants. 50.49 Section 50.49 Energy NUCLEAR REGULATORY COMMISSION... nuclear power plants. (a) Each holder of or an applicant for an operating license issued under this part... nuclear power plant for which the certifications required under § 50.82(a)(1) or § 52.110(a)(1) of...

  5. 10 CFR 50.49 - Environmental qualification of electric equipment important to safety for nuclear power plants.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... important to safety for nuclear power plants. 50.49 Section 50.49 Energy NUCLEAR REGULATORY COMMISSION... nuclear power plants. (a) Each holder of or an applicant for an operating license issued under this part... nuclear power plant for which the certifications required under § 50.82(a)(1) or § 52.110(a)(1) of this...

  6. 10 CFR 50.49 - Environmental qualification of electric equipment important to safety for nuclear power plants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... important to safety for nuclear power plants. 50.49 Section 50.49 Energy NUCLEAR REGULATORY COMMISSION... nuclear power plants. (a) Each holder of or an applicant for an operating license issued under this part... nuclear power plant for which the certifications required under § 50.82(a)(1) or § 52.110(a)(1) of this...

  7. 10 CFR 50.49 - Environmental qualification of electric equipment important to safety for nuclear power plants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... important to safety for nuclear power plants. 50.49 Section 50.49 Energy NUCLEAR REGULATORY COMMISSION... nuclear power plants. (a) Each holder of or an applicant for an operating license issued under this part... nuclear power plant for which the certifications required under § 50.82(a)(1) or § 52.110(a)(1) of this...

  8. 10 CFR 50.49 - Environmental qualification of electric equipment important to safety for nuclear power plants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... important to safety for nuclear power plants. 50.49 Section 50.49 Energy NUCLEAR REGULATORY COMMISSION... nuclear power plants. (a) Each holder of or an applicant for an operating license issued under this part... nuclear power plant for which the certifications required under § 50.82(a)(1) or § 52.110(a)(1) of this...

  9. Assessing Heterogeneity of Osteolytic Lesions in Multiple Myeloma by 1H HR-MAS NMR Metabolomics

    PubMed Central

    Tavel, Laurette; Fontana, Francesca; Garcia Manteiga, Josè Manuel; Mari, Silvia; Mariani, Elisabetta; Caneva, Enrico; Sitia, Roberto; Camnasio, Francesco; Marcatti, Magda; Cenci, Simone; Musco, Giovanna

    2016-01-01

    Multiple myeloma (MM) is a malignancy of plasma cells characterized by multifocal osteolytic bone lesions. Macroscopic and genetic heterogeneity has been documented within MM lesions. Understanding the bases of such heterogeneity may unveil relevant features of MM pathobiology. To this aim, we deployed unbiased 1H high-resolution magic-angle spinning (HR-MAS) nuclear magnetic resonance (NMR) metabolomics to analyze multiple biopsy specimens of osteolytic lesions from one case of pathological fracture caused by MM. Multivariate analyses on normalized metabolite peak integrals allowed clusterization of samples in accordance with a posteriori histological findings. We investigated the relationship between morphological and NMR features by merging morphological data and metabolite profiling into a single correlation matrix. Data-merging addressed tissue heterogeneity, and greatly facilitated the mapping of lesions and nearby healthy tissues. Our proof-of-principle study reveals integrated metabolomics and histomorphology as a promising approach for the targeted study of osteolytic lesions. PMID:27809247

  10. The Computational Modeling of Alloys:From ab initio and thermodynamics to heterogeneous precipitation.

    SciTech Connect

    Caro, A

    2007-10-09

    In this lecture we presented a methodology to obtain free energies from empirical potentials and applied it to the study of the phase diagram of FeCr. Subsequently, we used Metropolis Monte Carlo to analyze homogeneous and heterogeneous precipitation of the Cr rich solid solution {alpha}{prime}. These examples are part of our work in the area of steels for nuclear applications and can be found in several publications of our group cited as References.

  11. 10 CFR 71.97 - Advance notification of shipment of irradiated reactor fuel and nuclear waste.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... notification of shipment of irradiated reactor fuel and nuclear waste. (a)(1) As specified in paragraphs (b... shipment of irradiated reactor fuel or nuclear waste must contain the following information: (1) The name... nuclear waste shipment; (2) A description of the irradiated reactor fuel or nuclear waste contained in...

  12. 10 CFR 71.97 - Advance notification of shipment of irradiated reactor fuel and nuclear waste.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... notification of shipment of irradiated reactor fuel and nuclear waste. (a)(1) As specified in paragraphs (b... shipment of irradiated reactor fuel or nuclear waste must contain the following information: (1) The name... nuclear waste shipment; (2) A description of the irradiated reactor fuel or nuclear waste contained in...

  13. 10 CFR 50.65 - Requirements for monitoring the effectiveness of maintenance at nuclear power plants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... maintenance at nuclear power plants. 50.65 Section 50.65 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... Construction Permits § 50.65 Requirements for monitoring the effectiveness of maintenance at nuclear power..., including normal shutdown operations. (a)(1) Each holder of an operating license for a nuclear power plant...

  14. 10 CFR 50.65 - Requirements for monitoring the effectiveness of maintenance at nuclear power plants.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... maintenance at nuclear power plants. 50.65 Section 50.65 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... Construction Permits § 50.65 Requirements for monitoring the effectiveness of maintenance at nuclear power..., including normal shutdown operations. (a)(1) Each holder of an operating license for a nuclear power plant...

  15. 10 CFR 50.65 - Requirements for monitoring the effectiveness of maintenance at nuclear power plants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... maintenance at nuclear power plants. 50.65 Section 50.65 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... Construction Permits § 50.65 Requirements for monitoring the effectiveness of maintenance at nuclear power..., including normal shutdown operations. (a)(1) Each holder of an operating license for a nuclear power plant...

  16. 10 CFR 50.65 - Requirements for monitoring the effectiveness of maintenance at nuclear power plants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... maintenance at nuclear power plants. 50.65 Section 50.65 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... Construction Permits § 50.65 Requirements for monitoring the effectiveness of maintenance at nuclear power..., including normal shutdown operations. (a)(1) Each holder of an operating license for a nuclear power plant...

  17. 10 CFR 50.65 - Requirements for monitoring the effectiveness of maintenance at nuclear power plants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... maintenance at nuclear power plants. 50.65 Section 50.65 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC... Construction Permits § 50.65 Requirements for monitoring the effectiveness of maintenance at nuclear power..., including normal shutdown operations. (a)(1) Each holder of an operating license for a nuclear power plant...

  18. Inverse problems in heterogeneous and fractured media using peridynamics

    SciTech Connect

    Turner, Daniel Z.; van Bloemen Waanders, Bart G.; Parks, Michael L.

    2015-12-10

    The following work presents an adjoint-based methodology for solving inverse problems in heterogeneous and fractured media using state-based peridynamics. We show that the inner product involving the peridynamic operators is self-adjoint. The proposed method is illustrated for several numerical examples with constant and spatially varying material parameters as well as in the context of fractures. We also present a framework for obtaining material parameters by integrating digital image correlation (DIC) with inverse analysis. This framework is demonstrated by evaluating the bulk and shear moduli for a sample of nuclear graphite using digital photographs taken during the experiment. The resulting measured values correspond well with other results reported in the literature. Lastly, we show that this framework can be used to determine the load state given observed measurements of a crack opening. Furthermore, this type of analysis has many applications in characterizing subsurface stress-state conditions given fracture patterns in cores of geologic material.

  19. Heterogeneities in gelatin film formation using single-sided NMR.

    PubMed

    Ghoshal, Sushanta; Mattea, Carlos; Denner, Paul; Stapf, Siegfried

    2010-12-16

    Gelatin solutions were prepared in D(2)O. The drying process of cast solutions was followed with a single-sided nuclear magnetic resonance (NMR) scanner until complete solidification occurred. Spin-spin relaxation times (T(2)) were measured at different layers with microscopic resolution and were correlated with the drying process during film formation. Additionally, the evaporation of the gelatin solution was observed optically from the reduction of the sample thickness, revealing that at the macroscopic level, the rate of evaporation is not uniform throughout the experiment. A crossover in the spatial evolution of the drying process is observed from the NMR results. At the early stages, the gel appears to be drier in the upper layers near the evaporation front, while this tendency is inverted at the later stages, when drying is faster from the bottom. XRD (X-ray diffraction) data showed that a structural heterogeneity persists in the final film.

  20. Teaching Nuclear History.

    ERIC Educational Resources Information Center

    Holl, Jack M.; Convis, Sheila C.

    1991-01-01

    Presents results of a survey of the teaching about nuclear history at U.S. colleges and universities. Reports the existence of a well-established and extensive literature, a focus on nuclear weapons or warfare, and a concentration on nuclear citizenship, therapy, or eschatology for courses outside of history departments. Discusses individual…