Science.gov

Sample records for a1 heterogeneous nuclear

  1. Heterogeneous nuclear ribonucleoproteins A1 and A2 modulate expression of Tid1 isoforms and EGFR signaling in non-small cell lung cancer.

    PubMed

    Chen, Chi-Yuan; Jan, Chia-Ing; Pi, Wen-Chieh; Wang, Wen-Lung; Yang, Pan-Chyr; Wang, Tong-Hong; Karni, Rotem; Wang, Tzu-Chien V

    2016-03-29

    The Tid1 protein is a DnaJ co-chaperone that has two alternative splicing isoforms: Tid1 long form (Tid1-L) and Tid1 short form (Tid1-S). Recent studies have shown that Tid1-L functions as a tumor suppressor by decreasing EGFR signaling in various cancers, including head and neck cancer and non-small cell lung cancer (NSCLC). However, the molecular mechanism responsible for regulating the alternative splicing of Tid1 is not yet known. Two splicing factors, heterogeneous nuclear ribonucleoproteins (hnRNP) A1 and A2, participate in alternative splicing and are known to be overexpressed in lung cancers. In this work, we examined if hnRNP A1 and A2 could regulate the alternative splicing of Tid1 to modulate tumorigenesis in NSCLC. We report that RNAi-mediated depletion of both hnRNP A1/A2 (but not single depletion of either) increased Tid1-L expression, inhibited cell proliferation and attenuated EGFR signaling. Analyses of the expression levels of hnRNP A1, hnRNP A2, EGFR and Tid1-L in NSCLC tissues revealed that hnRNP A1 and A2 are positively correlated with EGFR, but negatively correlated with Tid1-L. NSCLC patients with high-level expression of hnRNP A1, hnRNP A2 and EGFR combined with low-level expression of Tid1-L were associated with poor overall survival. Taken together, our results suggest that hnRNP A1 or A2 are both capable of facilitating the alternative splicing of exon 11 in the Tid1 pre-mRNA, thereby suppressing the expression of Tid1-L and allowing EGFR-related signaling to facilitate NSCLC tumorigenesis. PMID:26919236

  2. Heterogeneous nuclear ribonucleoproteins A1 and A2 modulate expression of Tid1 isoforms and EGFR signaling in non-small cell lung cancer

    PubMed Central

    Chen, Chi-Yuan; Jan, Chia-Ing; Pi, Wen-Chieh; Wang, Wen-Lung; Yang, Pan-Chyr; Wang, Tong-Hong; Karni, Rotem; Wang, Tzu-Chien V.

    2016-01-01

    The Tid1 protein is a DnaJ co-chaperone that has two alternative splicing isoforms: Tid1 long form (Tid1-L) and Tid1 short form (Tid1-S). Recent studies have shown that Tid1-L functions as a tumor suppressor by decreasing EGFR signaling in various cancers, including head and neck cancer and non-small cell lung cancer (NSCLC). However, the molecular mechanism responsible for regulating the alternative splicing of Tid1 is not yet known. Two splicing factors, heterogeneous nuclear ribonucleoproteins (hnRNP) A1 and A2, participate in alternative splicing and are known to be overexpressed in lung cancers. In this work, we examined if hnRNP A1 and A2 could regulate the alternative splicing of Tid1 to modulate tumorigenesis in NSCLC. We report that RNAi-mediated depletion of both hnRNP A1/A2 (but not single depletion of either) increased Tid1-L expression, inhibited cell proliferation and attenuated EGFR signaling. Analyses of the expression levels of hnRNP A1, hnRNP A2, EGFR and Tid1-L in NSCLC tissues revealed that hnRNP A1 and A2 are positively correlated with EGFR, but negatively correlated with Tid1-L. NSCLC patients with high-level expression of hnRNP A1, hnRNP A2 and EGFR combined with low-level expression of Tid1-L were associated with poor overall survival. Taken together, our results suggest that hnRNP A1 or A2 are both capable of facilitating the alternative splicing of exon 11 in the Tid1 pre-mRNA, thereby suppressing the expression of Tid1-L and allowing EGFR-related signaling to facilitate NSCLC tumorigenesis. PMID:26919236

  3. Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1.

    PubMed

    Jain, Niyati; Morgan, Christopher E; Rife, Brittany D; Salemi, Marco; Tolbert, Blanton S

    2016-01-29

    Splicing patterns in human immunodeficiency virus type 1 (HIV-1) are maintained through cis regulatory elements that recruit antagonistic host RNA-binding proteins. The activity of the 3' acceptor site A7 is tightly regulated through a complex network of an intronic splicing silencer (ISS), a bipartite exonic splicing silencer (ESS3a/b), and an exonic splicing enhancer (ESE3). Because HIV-1 splicing depends on protein-RNA interactions, it is important to know the tertiary structures surrounding the splice sites. Herein, we present the NMR solution structure of the phylogenetically conserved ISS stem loop. ISS adopts a stable structure consisting of conserved UG wobble pairs, a folded 2X2 (GU/UA) internal loop, a UU bulge, and a flexible AGUGA apical loop. Calorimetric and biochemical titrations indicate that the UP1 domain of heterogeneous nuclear ribonucleoprotein A1 binds the ISS apical loop site-specifically and with nanomolar affinity. Collectively, this work provides additional insights into how HIV-1 uses a conserved RNA structure to commandeer a host RNA-binding protein. PMID:26607354

  4. Mechanistic Control of Carcinoembryonic Antigen-related Cell Adhesion Molecule-1 (CEACAM1) Splice Isoforms by the Heterogeneous Nuclear Ribonuclear Proteins hnRNP L, hnRNP A1, and hnRNP M*

    PubMed Central

    Dery, Kenneth J.; Gaur, Shikha; Gencheva, Marieta; Yen, Yun; Shively, John E.; Gaur, Rajesh K.

    2011-01-01

    Carcinoembryonic antigen-related cell adhesion molecule-1 (CEACAM1) is expressed in a variety of cell types and is implicated in carcinogenesis. Alternative splicing of CEACAM1 pre-mRNA generates two cytoplasmic domain splice variants characterized by the inclusion (L-isoform) or exclusion (S-isoform) of exon 7. Here we show that the alternative splicing of CEACAM1 pre-mRNA is regulated by novel cis elements residing in exon 7. We report the presence of three exon regulatory elements that lead to the inclusion or exclusion of exon 7 CEACAM1 mRNA in ZR75 breast cancer cells. Heterologous splicing reporter assays demonstrated that the maintenance of authentic alternative splicing mechanisms were independent of the CEACAM1 intron sequence context. We show that forced expression of these exon regulatory elements could alter CEACAM1 splicing in HEK-293 cells. Using RNA affinity chromatography, three members of the heterogeneous nuclear ribonucleoprotein family (hnRNP L, hnRNP A1, and hnRNP M) were identified. RNA immunoprecipitation of hnRNP L and hnRNP A1 revealed a binding motif located central and 3′ to exon 7, respectively. Depletion of hnRNP A1 or L by RNAi in HEK-293 cells promoted exon 7 inclusion, whereas overexpression led to exclusion of the variable exon. By contrast, overexpression of hnRNP M showed exon 7 inclusion and production of CEACAM1-L mRNA. Finally, stress-induced cytoplasmic accumulation of hnRNP A1 in MDA-MB-468 cells dynamically alters the CEACAM1-S:CEACAM1:L ratio in favor of the l-isoform. Thus, we have elucidated the molecular factors that control the mechanism of splice-site recognition in the alternative splicing regulation of CEACAM1. PMID:21398516

  5. Heterogeneous Nuclear Reactor Models for Optimal Xenon Control.

    NASA Astrophysics Data System (ADS)

    Gondal, Ishtiaq Ahmad

    Nuclear reactors are generally modeled as homogeneous mixtures of fuel, control, and other materials while in reality they are heterogeneous-homogeneous configurations comprised of fuel and control rods along with other materials. Similarly, for space-time studies of a nuclear reactor, homogeneous, usually one-group diffusion theory, models are used, and the system equations are solved by either nodal or modal expansion approximations. Study of xenon-induced problems has also been carried out using similar models and with the help of dynamic programming or classical calculus of variations or the minimum principle. In this study a thermal nuclear reactor is modeled as a two-dimensional lattice of fuel and control rods placed in an infinite-moderator in plane geometry. The two-group diffusion theory approximation is used for neutron transport. Space -time neutron balance equations are written for two groups and reduced to one space-time algebraic equation by using the two-dimensional Fourier transform. This equation is written at all fuel and control rod locations. Iodine -xenon and promethium-samarium dynamic equations are also written at fuel rod locations only. These equations are then linearized about an equilibrium point which is determined from the steady-state form of the original nonlinear system equations. After studying poisonless criticality, with and without control, and the stability of the open-loop system and after checking its controllability, a performance criterion is defined for the xenon-induced spatial flux oscillation problem in the form of a functional to be minimized. Linear -quadratic optimal control theory is then applied to solve the problem. To perform a variety of different additional useful studies, this formulation has potential for various extensions and variations; for example, different geometry of the problem, with possible extension to three dimensions, heterogeneous -homogeneous formulation to include, for example, homogeneously

  6. The presence of heterogeneous nuclear ribonucleoproteins in frontotemporal lobar degeneration with FUS-positive inclusions.

    PubMed

    Gami-Patel, Priya; Bandopadhyay, Rina; Brelstaff, Jack; Revesz, Tamas; Lashley, Tammaryn

    2016-10-01

    Frontotemporal lobar degeneration with fused in sarcoma-positive inclusions (FTLD-FUS) is a disease with unknown cause. Transportin 1 is abundantly found in FUS-positive inclusions and responsible for the nuclear import of the FET proteins of which FUS is a member. The presence of all FET proteins in pathological inclusions suggests a disturbance of transportin 1-mediated nuclear import. FUS also belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) protein family. We investigated whether hnRNP proteins are associated with FUS pathology implicating dysfunctional nuclear export in the pathogenesis of FTLD-FUS. hnRNP proteins were investigated in affected brain regions in FTLD-FUS using immunohistochemistry, biochemical analysis, and the expression analysis. We demonstrated the presence of several hnRNP proteins in pathological inclusions including neuronal cytoplasmic inclusions and dystrophic neurites. The biochemical analysis revealed a shift in the location of hnRNP A1 from the nucleus to the cytoplasm. The expression analysis revealed an increase in several hnRNP proteins in FTLD-FUS. These results implicate a wider dysregulation of movement between intracellular compartments, than mechanisms only affecting the nuclear import of FUS proteins. PMID:27500866

  7. The presence of heterogeneous nuclear ribonucleoproteins in frontotemporal lobar degeneration with FUS-positive inclusions.

    PubMed

    Gami-Patel, Priya; Bandopadhyay, Rina; Brelstaff, Jack; Revesz, Tamas; Lashley, Tammaryn

    2016-10-01

    Frontotemporal lobar degeneration with fused in sarcoma-positive inclusions (FTLD-FUS) is a disease with unknown cause. Transportin 1 is abundantly found in FUS-positive inclusions and responsible for the nuclear import of the FET proteins of which FUS is a member. The presence of all FET proteins in pathological inclusions suggests a disturbance of transportin 1-mediated nuclear import. FUS also belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) protein family. We investigated whether hnRNP proteins are associated with FUS pathology implicating dysfunctional nuclear export in the pathogenesis of FTLD-FUS. hnRNP proteins were investigated in affected brain regions in FTLD-FUS using immunohistochemistry, biochemical analysis, and the expression analysis. We demonstrated the presence of several hnRNP proteins in pathological inclusions including neuronal cytoplasmic inclusions and dystrophic neurites. The biochemical analysis revealed a shift in the location of hnRNP A1 from the nucleus to the cytoplasm. The expression analysis revealed an increase in several hnRNP proteins in FTLD-FUS. These results implicate a wider dysregulation of movement between intracellular compartments, than mechanisms only affecting the nuclear import of FUS proteins.

  8. Stickler syndrome: further mutations in COL11A1 and evidence for additional locus heterogeneity.

    PubMed

    Martin, S; Richards, A J; Yates, J R; Scott, J D; Pope, M; Snead, M P

    1999-01-01

    Stickler syndrome (hereditary arthro-ophthalmopathy) is a dominantly inherited connective tissue disorder with ocular, oro-facial, auditory and skeletal manifestations. It is genetically and phenotypically heterogeneous with the majority of families having mutations in the gene encoding type II collagen (COL2A1) and exhibiting a characteristic 'membranous' or type 1 vitreous phenotype. More recently a novel mutation in the gene encoding the alpha1 chain of type XI collagen (COL11A1) was reported in a Stickler syndrome pedigree with a different 'beaded' or type 2 vitreous phenotype. In the present study five more families with the type 2 vitreous phenotype were examined for linkage to four candidate genes: COL2A1, COL5A2, COL11A1 and COL11A2. Two families were linked to COL11A1 and sequencing identified mutations resulting in shortened alphal(XI) collagen chains, one via exon skipping and the other via a multiexon deletion. One of the families showed weak linkage to COL5A2 but sequencing the open reading frame failed to identify a mutation. In the remaining two families all four loci were excluded by linkage analysis. These data confirm that mutations in COL11A1 cause Stickler syndrome with the type2 vitreous phenotype and also reveal further locus heterogeneity.

  9. Higher Expression of the Heterogeneous Nuclear Ribonucleoprotein K in Melanoma

    PubMed Central

    Wen, Fushi; Shen, Alex; Shanas, Reneé; Bhattacharyya, Achyut; Lian, Fangru; Hostetter, Galen; Shi, Jiaqi

    2010-01-01

    Background The heterogeneous nuclear ribonucleoprotein (hnRNP) K is an essential RNA and DNA binding protein involved in gene expression and signal transduction. The role of hnRNP K in cancer is relatively understudied. However, several cellular functions strongly indicate that hnRNP K is involved in tumorigenesis. Oncogenes c-Src, c-myc, and eIF4E are regulated by hnRNP K. We have shown an increased cytoplasmic hnRNP K in pancreatic cancer. In the present study, we investigated the altered expression of hnRNP K protein and its correlation with p-ERK in melanoma using human melanoma cell lines and tissue microarray. Materials and Methods The protein levels of hnRNP K and p-ERK in 8 human melanoma cell lines and a melanoma progression tissue microarray containing 80 melanoma, 23 dysplastic nevi, and 14 benign nevi specimens were analyzed using Western blot and immunohistochemistry analysis. hnRNP K was knocked down by siRNA, and its effect on melanoma cells was assessed. Results We showed a higher hnRNP K protein level in both melanoma cell lines and melanoma tissue specimens, which correlated with a higher c-myc expression. An increase in the cytoplasmic hnRNP K and eIF4E protein levels in melanoma cells is also seen. p-ERK level was also higher in dysplastic nevi and melanoma tissues, but did not correlate with hnRNP K protein level. We then demonstrated that knocking down of hnRNP K by siRNA inhibited melanoma cell growth and colony formation, as well as c-myc expression. Conclusions hnRNP K expression correlated with melanoma and may play a role in melanoma tumorigenesis. PMID:20499280

  10. Nuclear estrogen receptor molecular heterogeneity in the mouse uterus.

    PubMed Central

    Golding, T S; Korach, K S

    1988-01-01

    Holomeric estrogen receptor (ER) prepared from ovariectomized mouse uteri displays heterogeneous electrophoretic mobility when analyzed by NaDodSO4/PAGE. ER derived from nuclei (ERn) appears as a closely spaced doublet having apparent molecular masses of 66.4 and 65 kDa, while ER from the cytosolic compartment (ERc) has a single band of 65 kDa. Both partially purified ERc and the 8S form of unactivated ERc show only the 65-kDa band. The appearance of the ERn doublet is hormonally inducible, and the relative proportions of the two doublet bands are influenced by the type of hormone treatment, with weakly estrogenic compounds yielding the lower band as predominant while potent estrogens increase the proportion of the upper band. Steroid binding of the ERn doublet was determined by [3H]tamoxifen aziridine affinity labeling of both the 66.4- and the 65-kDa peptides; binding to the 65-kDa peptide was predominant. The ERn doublet displays a time dependency after estrogen administration with maximal amounts occurring in a bimodal fashion at 1 and 8 hr. Images PMID:3422428

  11. Inferring Diffusion Dynamics from FCS in Heterogeneous Nuclear Environments

    PubMed Central

    Tsekouras, Konstantinos; Siegel, Amanda P.; Day, Richard N.; Pressé, Steve

    2015-01-01

    Fluorescence correlation spectroscopy (FCS) is a noninvasive technique that probes the diffusion dynamics of proteins down to single-molecule sensitivity in living cells. Critical mechanistic insight is often drawn from FCS experiments by fitting the resulting time-intensity correlation function, G(t), to known diffusion models. When simple models fail, the complex diffusion dynamics of proteins within heterogeneous cellular environments can be fit to anomalous diffusion models with adjustable anomalous exponents. Here, we take a different approach. We use the maximum entropy method to show—first using synthetic data—that a model for proteins diffusing while stochastically binding/unbinding to various affinity sites in living cells gives rise to a G(t) that could otherwise be equally well fit using anomalous diffusion models. We explain the mechanistic insight derived from our method. In particular, using real FCS data, we describe how the effects of cell crowding and binding to affinity sites manifest themselves in the behavior of G(t). Our focus is on the diffusive behavior of an engineered protein in 1) the heterochromatin region of the cell’s nucleus as well as 2) in the cell’s cytoplasm and 3) in solution. The protein consists of the basic region-leucine zipper (BZip) domain of the CCAAT/enhancer-binding protein (C/EBP) fused to fluorescent proteins. PMID:26153697

  12. Nuclear estrogen receptor molecular heterogeneity in the mouse uterus

    SciTech Connect

    Golding, T.S.; Korach, K.S.

    1988-01-01

    Holomeric estrogen receptor (ER) prepared from ovariectomized mouse uteri displays heterogeneous electrophoretic mobility when analyzed by NaDodSO/sub 4//PAGE. ER derived from nuclei (ER/sub n/) appears as a closely spaced doublet having apparent molecular masses of 66.4 and 65 kDa, while ER from the cytosolic compartment (ER/sub c/) has a single band of 65 kDa. Both partially purified ER/sub c/ and the 8S form of unactivated ER/sub c/ show only the 65-kDa band. The appearance of the ER/sub n/ doublet is hormonally inducible, and the relative proportions of the two doublet bands are influenced by the type of hormone treatment, with weakly estrogenic compounds yielding the lower band as predominant while potent estrogens increase the proportion of the upper band. Steroid binding of the ER/sub n/ doublet was determined by (/sup 3/H)tamoxifen aziridine affinity labeling of both the 66.4- and the 65-kDa peptides; binding to the 65-kDa peptide was predominant. The ER/sub n/ doublet displays a time dependency after estrogen administration with maximal amounts occurring in a bimodal fashion at 1 and 8 hr.

  13. SNM-DAT: Simulation of a heterogeneous network for nuclear border security

    NASA Astrophysics Data System (ADS)

    Nemzek, R.; Kenyon, G.; Koehler, A.; Lee, D. M.; Priedhorsky, W.; Raby, E. Y.

    2007-08-01

    We approach the problem of detecting Special Nuclear Material (SNM) smuggling across open borders by modeling a heterogeneous sensor network using an agent-based simulation. Our simulation SNM Data Analysis Tool (SNM-DAT) combines fixed seismic, metal, and radiation detectors with a mobile gamma spectrometer. Decision making within the simulation determines threat levels by combined signatures. The spectrometer is a limited-availability asset, and is only deployed for substantial threats. "Crossers" can be benign or carrying shielded SNM. Signatures and sensors are physics based, allowing us to model realistic sensor networks. The heterogeneous network provides great gains in detection efficiency compared to a radiation-only system. We can improve the simulation through better sensor and terrain models, additional signatures, and crossers that mimic actual trans-border traffic. We expect further gains in our ability to design sensor networks as we learn the emergent properties of heterogeneous detection, and potential adversary responses.

  14. Heat transfer analysis of fuel assemblies in a heterogeneous gas core nuclear rocket

    NASA Technical Reports Server (NTRS)

    Watanabe, Yoichi; Appelbaum, Jacob; Diaz, Nils; Maya, Isaac

    1991-01-01

    Heat transfer problems of a heterogeneous gaseous core nuclear rocket were studied. The reactor core consists of 1.5-m long hexagonal fuel assemblies filled with pressurized uranium tetrafluoride (UF4) gas. The fuel gas temperature ranges from 3500 to 7000 K at a nominal operating condition of 40 atm. Each fuel assembly has seven coolant tubes, through which hydrogen propellant flows. The propellant temperature is not constrained by the fuel temperature but by the maximum temperature of the graphite coolant tube. For a core achieving a fission power density of 1000 MW/cu m, the propellant core exit temperature can be as high as 3200 K. The physical size of a 1250 MW gaseous core nuclear rocket is comparable with that of a NERVA-type solid core nuclear rocket. The engine can deliver a specific impulse of 1020 seconds and a thrust of 330 kN.

  15. Recognition of subsets of the mammalian A/B-type core heterogeneous nuclear ribonucleoprotein polypeptides by novel autoantibodies.

    PubMed Central

    Dangli, A; Plomaritoglou, A; Boutou, E; Vassiliadou, N; Moutsopoulos, H M; Guialis, A

    1996-01-01

    The structurally related A/B-type core heterogeneous nuclear ribonucleoprotein (hnRNP) polypeptides of 34-39 kDa (A1, A2, B1 and B2) belong to a family of RNA-binding proteins that are major components of 40 S hnRNP complexes. By two-dimensional gel electrophoresis and peptide mapping analysis we compared each member of the A/B-type core proteins in the human and rat liver cells. This comparison revealed the unique presence in rat cells of major protein species, referred to as mBx polypeptides, that appeared as three charge isoforms at a position corresponding to the minor HeLa B1b protein spot. In addition, clear differences in the ratios of the A1 polypeptide to the A1b isoform were observed. The detection, in sera of patients with rheumatic autoimmune diseases, of two novel autoantibody specificities, one recognizing solely B2 protein and the second both the B2 and mBx polypeptides, helped to identify mBx proteins as new A/B-type hnRNP components, immunologically related to B2 protein. A common immunoreactive V8 protease peptide of approx. 17 kDa has been identified in B2 and mBx hnRNP polypeptides. mBx protein species are identified in cells of murine origin, and have a ubiquitous tissue distribution and developmental appearance. PMID:9003360

  16. Spatio-temporal anomalous diffusion in heterogeneous media by nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Palombo, M.; Gabrielli, A.; De Santis, S.; Cametti, C.; Ruocco, G.; Capuani, S.

    2011-07-01

    In this paper, we describe nuclear magnetic resonance measurements of water diffusion in highly confined and heterogeneous colloidal systems using an anomalous diffusion model. For the first time, temporal and spatial fractional exponents, α and μ, introduced within the framework of continuous time random walk, are simultaneously measured by pulsed gradient spin-echo NMR technique in samples of micro-beads dispersed in aqueous solution. In order to mimic media with low and high level of disorder, mono-dispersed and poly-dispersed samples are used. We find that the exponent α depends on the disorder degree of the system. Conversely, the exponent μ depends on both bead sizes and magnetic susceptibility differences within samples. The new procedure proposed here may be a useful tool to probe porous materials and microstructural features of biological tissue.

  17. Spatio-temporal anomalous diffusion in heterogeneous media by nuclear magnetic resonance.

    PubMed

    Palombo, M; Gabrielli, A; De Santis, S; Cametti, C; Ruocco, G; Capuani, S

    2011-07-21

    In this paper, we describe nuclear magnetic resonance measurements of water diffusion in highly confined and heterogeneous colloidal systems using an anomalous diffusion model. For the first time, temporal and spatial fractional exponents, α and μ, introduced within the framework of continuous time random walk, are simultaneously measured by pulsed gradient spin-echo NMR technique in samples of micro-beads dispersed in aqueous solution. In order to mimic media with low and high level of disorder, mono-dispersed and poly-dispersed samples are used. We find that the exponent α depends on the disorder degree of the system. Conversely, the exponent μ depends on both bead sizes and magnetic susceptibility differences within samples. The new procedure proposed here may be a useful tool to probe porous materials and microstructural features of biological tissue.

  18. Insulin alters heterogeneous nuclear ribonucleoprotein K protein binding to DNA and RNA

    PubMed Central

    Ostrowski, J.; Kawata, Y.; Schullery, D. S.; Denisenko, O. N.; Higaki, Y.; Abrass, C. K.; Bomsztyk, K.

    2001-01-01

    The interaction of the multimodular heterogeneous nuclear ribonucleoprotein (hnRNP) K protein with many of its protein and nucleic acid partners is regulated by extracellular signals. Acting as a docking platform, K protein could link signal-transduction pathways to DNA- and RNA-directed processes such as transcription, mRNA processing, transport, and translation. Treatment of hepatocyte culture with insulin increased K protein tyrosine phosphorylation. Insulin altered K protein interaction with RNA and DNA in vitro. Administration of insulin into mice had similar effects on K protein in liver. Coimmunoprecipitations of RNA with K protein revealed preferential in vivo K protein binding of a subset of transcripts, including the insulin-inducible c-fos mRNA. These results suggest a class of insulin pathways that signal nucleic acid-directed processes that involve K protein. PMID:11470915

  19. Classification and purification of proteins of heterogeneous nuclear ribonucleoprotein particles by RNA-binding specificities

    SciTech Connect

    Swanson, M.S.; Dreyfuss, G.

    1988-05-01

    Several proteins of heterogeneous nuclear ribonucleoprotein (hnRNP) particles display very high binding affinities for different ribonucleotide homopolymers. The specificity of some of these proteins at high salt concentrations and in the presence of heparin allows for their rapid one-step purification from HeLa nucleoplasm. The authors show that the hnRNP proteins are poly(U)-binding proteins and compare their specificity to that of the previously described cytoplasmic poly(A)-binding protein. These findings provide a useful tool for the classification and purification of hnRNP proteins from various tissues and organisms and indicate that different hnRNP proteins have different RNA-binding specificities.

  20. Nuclear receptor 4A1 (NR4A1) as a drug target for treating rhabdomyosarcoma (RMS)

    PubMed Central

    Lacey, Alexandra; Hedrick, Erik; Li, Xi; Patel, Ketan; Doddapaneni, Ravi; Singh, Mandip; Safe, Stephen

    2016-01-01

    The orphan nuclear receptor NR4A1 is expressed in tumors from rhabdomyosarcoma (RMS) patients and Rh30 and RD RMS cell lines, and we used RNA interference (RNAi) to investigate the role of this receptor in RMS cells. Knockdown of NR4A1 in Rh30 cells decreased cell proliferation, induced Annexin V staining and induced polyADPribose polymerase (PARP) cleavage and these results were similar to those observed in other solid tumors. Previous studies show that NR4A1 regulates expression of growth promoting/pro-survival genes with GC-rich promoters, activates mTOR through suppression of p53, and maintains low oxidative stress by regulating expression of isocitrate dehydrogenase 1 (IDH1) and thioredoxin domain containing 5 (TXNDC5). Results of RNAi studies demonstrated that NR4A1 also regulates these pathways and associated genes in RMS cells and thereby exhibits pro-oncogenic activity. 1,1-Bis(3-indolyl)-1-(p-substituted phenyl)methane (C-DIM) analogs containing p-hydroxyl (DIM-C-pPhOH) and p-carboxymethyl (DIM-C-pPhCO2Me) substituents are NR4A1 ligands that decreased NR4A1-dependent transactivation in RMS cells and inhibited RMS cell and tumor growth and induced apoptosis. Moreover, the effects of NR4A1 knockdown and the C-DIM/NR4A1 antagonists were comparable as inhibitors of NR4A1-dependent genes/pathways. Both NR4A1 knockdown and treatment with DIM-C-pPhOH and DIM-C-pPhCO2Me also induced ROS which activated stress genes and induced sestrin 2 which activated AMPK and inhibited mTOR in the mutant p53 RMS cells. Since NR4A1 regulates several growth-promoting/pro-survival pathways in RMS, the C-DIM/NR4A1 antagonists represent a novel mechanism-based approach for treating this disease alone or in combination and thereby reducing the adverse effects of current cytotoxic therapies. PMID:27144436

  1. N-methylation of the heterogeneous nuclear ribonucleoproteins in HeLa cells

    SciTech Connect

    Rieker, J.P.

    1984-01-01

    Several of the core proteins on the 40S heterogeneous nuclear ribonucleoprotein particles (hnRNP) from HeLa cells contain N/sup G/,N/sup G/-dimethyl-L-arginine (uDMA). 3-deazaadenosine (c/sup 3/Ado), an inhibitor of and substrate for s-adenosyl-L-homocysteine hydrolase, has been used to study the methylation patterns of the individual polypeptides. Trimethyllysine and uDMA formation in total cellular protein were inhibited in the presence of the drug while other methylated basic amino acids were unaffected. This inhibition was reversed within 60 min after removal of the drug from the medium. Monolayer HeLa cultures were incubated with (methyl-/sup 3/H)-L-methoinine for 12 hours in the presence of 50 uM c/sup 3/Ado. Purified particles were obtained by centrifugation of nuclear extracts on sucrose density gradients. The core proteins were isolated by two-dimensional gel electrophoresis, acid hydrolyzed and analyzed for radioactivity incorporated into methionine and methylated basic amino acids. The ratio of radioactivity incorporated into uDMA relative to that into methionine for the two major particle proteins with molecular weights of 31,000 (A/sub 1/) and 43,000 (A/sub 2/) was about 2.0 and 0.2 in control cultures. In the presence of c/sup 3/Ado, these ratios were depressed 60 to 80%. Results of pulse-chase experiments suggested that A/sub 1/ and A/sub 2/ are metabolically stable proteins (t/sub 0.5/ > 75 hr), whether or not the proteins were undermethylated. Monomethyl-L-arginine may be a precursor in the formation of u-DMA.

  2. An association between RBMX, a heterogeneous nuclear ribonucleoprotein, and ARTS-1 regulates extracellular TNFR1 release

    SciTech Connect

    Adamik, Barbara; Islam, Aminul; Rouhani, Farshid N.; Hawari, Feras I.; Zhang Jing; Levine, Stewart J.

    2008-07-04

    The type I, 55-kDa tumor necrosis factor receptor (TNFR1) is released to the extracellular space by two mechanisms, the constitutive release of TNFR1 exosome-like vesicles and the inducible proteolytic cleavage of TNFR1 ectodomains. Both pathways appear to be regulated by an interaction between TNFR1 and ARTS-1 (aminopeptidase regulator of TNFR1 shedding). Here, we sought to identify ARTS-1-interacting proteins that modulate TNFR1 release. Co-immunoprecipitation identified an association between ARTS-1 and RBMX (RNA-binding motif gene, X chromosome), a 43-kDa heterogeneous nuclear ribonucleoprotein. RNA interference attenuated RBMX expression, which reduced both the constitutive release of TNFR1 exosome-like vesicles and the IL-1{beta}-mediated inducible proteolytic cleavage of soluble TNFR1 ectodomains. Reciprocally, over-expression of RBMX increased TNFR1 exosome-like vesicle release and the IL-1{beta}-mediated inducible shedding of TNFR1 ectodomains. This identifies RBMX as an ARTS-1-associated protein that regulates both the constitutive release of TNFR1 exosome-like vesicles and the inducible proteolytic cleavage of TNFR1 ectodomains.

  3. Role and molecular mechanism of heterogeneous nuclear ribonucleoprotein K in tumor development and progression

    PubMed Central

    LU, JING; GAO, FENG-HOU

    2016-01-01

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a member of the hnRNP family, which exists in the nucleus and the cytoplasm simultaneously. It is a multifunctional protein that can participate in a variety of regulatory progressions of gene expression and signal transduction, such as chromatin remodeling, transcription, RNA alternative splicing and translation. hnRNP K not only directly binds to the kinases, but also recruits the associated factors regarding transcription, splicing and translation to control gene expression, and therefore, it serves as a docking platform for integrating transduction pathways to nucleic acid-directed processes. Numerous studies also show that abnormal expression of hnRNP K is closely associated with the tumor formation. This protein is overexpressed in numerous types of cancer and its aberrant cytoplasmic localization is also associated with a worse prognosis for patients. These results consistently indicate that hnRNP K has a key role in cancer progression. To understand the hnRNP K pathophysiological process in tumor disease, the previous research results regarding the association between hnRNP K and tumors were reviewed. PMID:27284403

  4. Functions of Heterogeneous Nuclear Ribonucleoproteins in Stem Cell Potency and Differentiation

    PubMed Central

    Chen, Qishan; Jin, Min; Zhu, Jianhua; Zhang, Li

    2013-01-01

    Stem cells possess huge importance in developmental biology, disease modelling, cell replacement therapy, and tissue engineering in regenerative medicine because they have the remarkable potential for self-renewal and to differentiate into almost all the cell types in the human body. Elucidation of molecular mechanisms regulating stem cell potency and differentiation is essential and critical for extensive application. Heterogeneous nuclear ribonucleoproteins (hnRNPs) are modular proteins consisting of RNA-binding motifs and auxiliary domains characterized by extensive and divergent functions in nucleic acid metabolism. Multiple roles of hnRNPs in transcriptional and posttranscriptional regulation enable them to be effective gene expression regulators. More recent findings show that hnRNP proteins are crucial factors implicated in maintenance of stem cell self-renewal and pluripotency and cell differentiation. The hnRNPs interact with certain sequences in target gene promoter regions to initiate transcription. In addition, they recognize 3′UTR or 5′UTR of specific gene mRNA forming mRNP complex to regulate mRNA stability and translation. Both of these regulatory pathways lead to modulation of gene expression that is associated with stem cell proliferation, cell cycle control, pluripotency, and committed differentiation. PMID:23984388

  5. Basal and hydrogen peroxide stimulated sites of phosphorylation in heterogeneous nuclear ribonucleoprotein C1/C2.

    PubMed

    Stone, James R; Maki, Jenny L; Collins, Tucker

    2003-02-11

    Hydrogen peroxide (H2O2) is a recently recognized second messenger, which regulates mammalian cell proliferation and migration. The biochemical mechanisms by which mammalian cells sense and respond to low concentrations of H2O2 are poorly understood. Recently, heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNP-C1/C2) was found to be rapidly phosphorylated in response to the application of low concentrations of H2O2 to human endothelial cells. Here, using tandem mass spectrometry, four sites of phosphorylation are identified in hnRNP-C1/C2, all of which are in the acidic C-terminal domain of the protein. Under resting conditions, the protein is phosphorylated at S247 and S286. In response to low concentrations of H2O2, there is increased phosphorylation at S240 and at one of the four contiguous serine residues from S225-S228. Studies using a recombinant acidic C-terminal domain of hnRNP-C overexpressed in Escherichia coli demonstrate that protein kinase CK2 phosphorylates hnRNP-C1/C2 at S247, while protein kinase A and several protein kinase C isoforms fail to phosphorylate the isolated domain. These findings demonstrate that the acidic C-terminal domain of hnRNP-C1/C2 serves as the site for both basal and stimulated phosphorylation, indicating that this domain may play an important role in the regulation of mRNA binding by hnRNP-C1/C2.

  6. Protein and gene expression characteristics of heterogeneous nuclear ribonucleoprotein H1 in esophageal squamous cell carcinoma

    PubMed Central

    Sun, Yu-Lin; Liu, Fei; Liu, Fang; Zhao, Xiao-Hang

    2016-01-01

    AIM To investigate the expression characteristics of heterogeneous nuclear ribonucleoprotein H1 (HNRNPH1) mRNA and protein in cell lines and tissues of esophageal squamous cell carcinoma (ESCC). METHODS Western blotting was used to assess the expression of HNRNPH1 protein in seven ESCC cell lines and 30 paired fresh tissue specimens. The subcellular localization of HNRNPH1 was determined by immunofluorescence in ESCC cells. The RNA sequencing data from 87 patients with ESCC were obtained from the cancer genome atlas (TCGA), and the expression and clinical characteristics analysis of different transcript variants of HNRNPH1 were evaluated in this dataset. In addition, immunohistochemistry was carried out to detect the expression of HNRNPH1 protein in 125 patients. RESULTS The expression of HNRNPH1 protein varied across different ESCC cell lines. It was exclusively restricted to the nucleus of the ESCC cells. There are two transcript variants of the HNRNPH1 gene. Variant 1 was constitutively expressed, and its expression did not change during tumorigenesis. In contrast, levels of variant 2 were low in non-tumorous tissues and were dramatically increased in ESCC (P = 0.0026). The high levels of variant 2 were associated with poorer differentiated tumors (P = 0.0287). Furthermore, in paired fresh tissue specimens, HNRNPH1 protein was overexpressed in 73.3% (22/30) of neoplastic tissues. HNRNPH1 was significantly upregulated in ESCC, with strong staining in 43.2% (54/125) of tumor tissues and 22.4% (28/125) of matched non-cancerous tissues (P = 0.0005). Positive HNRNPH1 expression was significantly associated with poor tumor differentiation degree (P = 0.0337). CONCLUSION The different alternative transcript variants of HNRNPH1 exhibited different expression changes during tumorigenesis. Its mRNA and protein were overexpressed in ESCC and associated with poorer differentiation of tumor cells. These findings highlight the potential of HNRNPH1 in the therapy and diagnosis

  7. Protein and gene expression characteristics of heterogeneous nuclear ribonucleoprotein H1 in esophageal squamous cell carcinoma

    PubMed Central

    Sun, Yu-Lin; Liu, Fei; Liu, Fang; Zhao, Xiao-Hang

    2016-01-01

    AIM To investigate the expression characteristics of heterogeneous nuclear ribonucleoprotein H1 (HNRNPH1) mRNA and protein in cell lines and tissues of esophageal squamous cell carcinoma (ESCC). METHODS Western blotting was used to assess the expression of HNRNPH1 protein in seven ESCC cell lines and 30 paired fresh tissue specimens. The subcellular localization of HNRNPH1 was determined by immunofluorescence in ESCC cells. The RNA sequencing data from 87 patients with ESCC were obtained from the cancer genome atlas (TCGA), and the expression and clinical characteristics analysis of different transcript variants of HNRNPH1 were evaluated in this dataset. In addition, immunohistochemistry was carried out to detect the expression of HNRNPH1 protein in 125 patients. RESULTS The expression of HNRNPH1 protein varied across different ESCC cell lines. It was exclusively restricted to the nucleus of the ESCC cells. There are two transcript variants of the HNRNPH1 gene. Variant 1 was constitutively expressed, and its expression did not change during tumorigenesis. In contrast, levels of variant 2 were low in non-tumorous tissues and were dramatically increased in ESCC (P = 0.0026). The high levels of variant 2 were associated with poorer differentiated tumors (P = 0.0287). Furthermore, in paired fresh tissue specimens, HNRNPH1 protein was overexpressed in 73.3% (22/30) of neoplastic tissues. HNRNPH1 was significantly upregulated in ESCC, with strong staining in 43.2% (54/125) of tumor tissues and 22.4% (28/125) of matched non-cancerous tissues (P = 0.0005). Positive HNRNPH1 expression was significantly associated with poor tumor differentiation degree (P = 0.0337). CONCLUSION The different alternative transcript variants of HNRNPH1 exhibited different expression changes during tumorigenesis. Its mRNA and protein were overexpressed in ESCC and associated with poorer differentiation of tumor cells. These findings highlight the potential of HNRNPH1 in the therapy and diagnosis

  8. Homogenized moment tensor and the effect of near-field heterogeneities on nonisotropic radiation in nuclear explosion

    NASA Astrophysics Data System (ADS)

    Burgos, Gaël.; Capdeville, Yann; Guillot, Laurent

    2016-06-01

    We investigate the effect of small-scale heterogeneities close to a seismic explosive source, at intermediate periods (20-50 s), with an emphasis on the resulting nonisotropic far-field radiation. First, using a direct numerical approach, we show that small-scale elastic heterogeneities located in the near-field of an explosive source, generate unexpected phases (i.e., long period S waves). We then demonstrate that the nonperiodic homogenization theory applied to 2-D and 3-D elastic models, with various pattern of small-scale heterogeneities near the source, leads to accurate waveforms at a reduced computational cost compared to direct modeling. Further, it gives an interpretation of how nearby small-scale features interact with the source at low frequencies, through an explicit correction to the seismic moment tensor. In 2-D simulations, we find a deviatoric contribution to the moment tensor, as high as 21% for near-source heterogeneities showing a 25% contrast of elastic values (relative to a homogeneous background medium). In 3-D this nonisotropic contribution reaches 27%. Second, we analyze intermediate-periods regional seismic waveforms associated with some underground nuclear explosions conducted at the Nevada National Security Site and invert for the full moment tensor, in order to quantify the relative contribution of the isotropic and deviatoric components of the tensor. The average value of the deviatoric part is about 35%. We conclude that the interactions between an explosive source and small-scale local heterogeneities of moderate amplitude may lead to a deviatoric contribution to the seismic moment, close to what is observed using regional data from nuclear test explosions.

  9. In Silico Adoption of an Orphan Nuclear Receptor NR4A1

    PubMed Central

    Lanig, Harald; Reisen, Felix; Whitley, David; Schneider, Gisbert; Banting, Lee; Clark, Timothy

    2015-01-01

    A 4.1μs molecular dynamics simulation of the NR4A1 (hNur77) apo-protein has been undertaken and a previously undetected druggable pocket has become apparent that is located remotely from the ‘traditional’ nuclear receptor ligand-binding site. A NR4A1/bis-indole ligand complex at this novel site has been found to be stable over 1 μs of simulation and to result in an interesting conformational transmission to a remote loop that has the capacity to communicate with a NBRE within a RXR-α/NR4A1 heterodimer. Several features of the simulations undertaken indicate how NR4A1 can be affected by alternate-site modulators. PMID:26270486

  10. The detection of linkage and heterogeneity in nuclear families for complex disorders: one versus two marker loci.

    PubMed

    Martinez, M M; Goldin, L R

    1989-04-01

    Using exact expected likelihoods, we have computed the average number of phase-unknown nuclear families needed to detect linkage and heterogeneity. We have examined the case of both dominant and recessive inheritance with reduced penetrance and phenocopies. Most of our calculations have been carried out under the assumption that 50% of families are linked to a marker locus. We have varied both the number of offspring per family and the sampling scheme. We have also investigated the increased power when the disease locus is midway between two marker loci 10 cM apart. For recessive inheritance, both linkage and heterogeneity can be detected in clinically feasible sample sizes. For dominant inheritance, linkage can be detected but heterogeneity cannot be detected unless larger sibships (four offspring) are sampled or two linked markers are available. As expected, if penetrance is reduced, sampling families with all sibs affected is most efficient. Our results provide a basis for estimating the amount of resources needed to find genes for complex disorders under conditions of heterogeneity. PMID:2929598

  11. Relaxation Nuclear Magnetic Resonance Imaging Investigation of Heterogeneous Aging in a Hydroxy-Terminated Polybutadiene-Based Elastomer

    SciTech Connect

    Alam, Todd M.; Cherry, Brian R.; Minard, Kevin R.; Celina, Mat C.

    2005-12-27

    Relaxation nuclear magnetic resonance imaging (R-NMRI) was employed to investigate the effects of thermo-oxidative aging in a hydroxy-terminated polybutadiene (HTPB) based elastomer. A series of three-dimensional (3D) Hahn-echo weighted single point images (SPI) of the elastomer were utilized to generate a 3D parameter map of the aged material. NMR spin-spin relaxation times (T2) were measured for each voxel producing a 3D NMR parameter (T2) map of the aged polymer. These T2 maps reveal a dramatic reduction of local polymer mobility near the aging surface with the degree of T2 heterogeneity varying as a function of aging. Using correlations between NMR T2 and material modulus, the impact of this heterogeneous thermo-oxidative aging on the material properties is discussed.

  12. Nanoscale nuclear magnetic resonance with a 1.9-nm-deep nitrogen-vacancy sensor

    SciTech Connect

    Loretz, M.; Degen, C. L.; Pezzagna, S.; Meijer, J.

    2014-01-20

    We present nanoscale nuclear magnetic resonance (NMR) measurements performed with nitrogen-vacancy (NV) centers located down to about 2 nm from the diamond surface. NV centers were created by shallow ion implantation followed by a slow, nanometer-by-nanometer removal of diamond material using oxidative etching in air. The close proximity of NV centers to the surface yielded large {sup 1}H NMR signals of up to 3.4 μT-rms, corresponding to ∼330 statistically polarized or ∼10 fully polarized proton spins in a (1.8 nm){sup 3} detection volume.

  13. Patterns of cyto-nuclear linkage disequilibrium in Silene latifolia: genomic heterogeneity and temporal stability

    PubMed Central

    Fields, P D; McCauley, D E; McAssey, E V; Taylor, D R

    2014-01-01

    Non-random association of alleles in the nucleus and cytoplasmic organelles, or cyto-nuclear linkage disequilibrium (LD), is both an important component of a number of evolutionary processes and a statistical indicator of others. The evolutionary significance of cyto-nuclear LD will depend on both its magnitude and how stable those associations are through time. Here, we use a longitudinal population genetic data set to explore the magnitude and temporal dynamics of cyto-nuclear disequilibria through time. We genotyped 135 and 170 individuals from 16 and 17 patches of the plant species Silene latifolia in Southwestern VA, sampled in 1993 and 2008, respectively. Individuals were genotyped at 14 highly polymorphic microsatellite markers and a single-nucleotide polymorphism (SNP) in the mitochondrial gene, atp1. Normalized LD (D′) between nuclear and cytoplasmic loci varied considerably depending on which nuclear locus was considered (ranging from 0.005–0.632). Four of the 14 cyto-nuclear associations showed a statistically significant shift over approximately seven generations. However, the overall magnitude of this disequilibrium was largely stable over time. The observed origin and stability of cyto-nuclear LD is most likely caused by the slow admixture between anciently diverged lineages within the species' newly invaded range, and the local spatial structure and metapopulation dynamics that are known to structure genetic variation in this system. PMID:24002238

  14. Dynamic nuclear polarization solid-state NMR in heterogeneous catalysis research

    SciTech Connect

    Kobayashi, Takeshi; Perras, Frédéric A.; Slowing, Igor I.; Sadow, Aaron D.; Pruski, Marek

    2015-10-20

    In this study, a revolution in solid-state nuclear magnetic resonance (SSNMR) spectroscopy is taking place, attributable to the rapid development of high-field dynamic nuclear polarization (DNP), a technique yielding sensitivity improvements of 2–3 orders of magnitude. This higher sensitivity in SSNMR has already impacted materials research, and the implications of new methods on catalytic sciences are expected to be profound.

  15. Dynamic nuclear polarization solid-state NMR in heterogeneous catalysis research

    DOE PAGES

    Kobayashi, Takeshi; Perras, Frédéric A.; Slowing, Igor I.; Sadow, Aaron D.; Pruski, Marek

    2015-10-20

    In this study, a revolution in solid-state nuclear magnetic resonance (SSNMR) spectroscopy is taking place, attributable to the rapid development of high-field dynamic nuclear polarization (DNP), a technique yielding sensitivity improvements of 2–3 orders of magnitude. This higher sensitivity in SSNMR has already impacted materials research, and the implications of new methods on catalytic sciences are expected to be profound.

  16. Heterogeneous nuclear ribonucleoprotein K represses transcription from a cytosine/thymidine-rich element in the osteocalcin promoter

    PubMed Central

    2004-01-01

    HnRNP K (heterogeneous nuclear ribonucleoprotein K) was biochemically purified from a screen of proteins co-purifying with binding activity to the osteocalcin promoter. We identify hnRNP K as a novel repressor of osteocalcin gene transcription. Overexpression of hnRNP K lowers the expression of osteocalcin mRNA by 5-fold. Furthermore, luciferase reporter assays demonstrate that overexpression of hnRNP K represses osteocalcin transcription from a CT (cytosine/thymidine)-rich element in the proximal promoter. Electrophoretic mobility-shift analysis reveals that recombinant hnRNP K binds to the CT-rich element, but binds ss (single-stranded), rather than ds (double-stranded) oligonucleotide probes. Accordingly, hnRNP K antibody can supershift a binding activity present in nuclear extracts using ss sense, but not antisense or ds oligonucleotides corresponding to the CT-rich −95 to −47 osteocalcin promoter. Importantly, addition of recombinant hnRNP K to ROS 17/2.8 nuclear extract disrupts formation of a DNA–protein complex on ds CT element oligonucleotides. This action is mutually exclusive with hnRNP K's ability to bind ss DNA. These results demonstrate that hnRNPK, although co-purified with a dsDNA-binding activity, does not itself bind dsDNA. Rather, hnRNP K represses osteocalcin gene transcription by inhibiting the formation of a transcriptional complex on the CT element of the osteocalcin promoter. PMID:15361071

  17. Nuclear analysis of the chornobyl fuel containing masses with heterogeneous fuel distribution.

    SciTech Connect

    Turski, R. B.

    1998-10-14

    Although significant data has been obtained on the condition and composition of the fuel containing masses (FCM) located in the concrete chambers under the Chernobyl Unit 4 reactor cavity, there is still uncertainty regarding the possible recriticality of this material. The high radiation levels make access extremely difficult, and most of the samples are from the FCM surface regions. There is little information on the interior regions of the FCM, and one cannot assume with confidence that the surface measurements are representative of the interior regions. Therefore, reasonable assumptions on the key parameters such as fuel concentration, the concentrations of impurities and neutron poisons (especially boron), the void fraction of the FCM due to its known porosity, and the degrees of fuel heterogeneity, are necessary to evaluate the possibility of recriticality. The void fraction is important since it introduces the possibility of water moderator being distributed throughout the FCM. Calculations indicate that the addition of 10 to 30 volume percent (v/o) water to the FCM has a significant impact on the calculated reactivity of the FCM. Therefore, water addition must be considered carefully. The other possible moderators are graphite and silicone dioxide. As discussed later in this paper, silicone dioxide moderation does not represent a criticality threat. For graphite, both heterogeneous fuel arrangements and very large volume fractions of graphite are necessary for a graphite moderated system to go critical. Based on the observations and measurements of the FCM compositions, these conditions do not appear creditable for the Chernobyl FCM. Therefore, the focus of the analysis reported in this paper will be on reasonable heterogeneous fuel arrangements and water moderation. The analysis will evaluate a range of fuel and diluent compositions.

  18. HETEROGENEOUS NUCLEAR REACTOR EMPLOYING SMALL UNCLAD BODIES OF FISSIONABLE MATERIAL AS FUEL

    DOEpatents

    Hyman, H.H.; Katz, J.J.

    1961-05-01

    A nuclear reactor in which fuel pellets are continuously dissolved in a moderator liquid is described. The fuel pellets are fed into the top of elongated baskets which are submerged in moderator liquid, and a portion of the moderator liquid is continuously withdrawn and processed to recove r reaction products.

  19. Multiscale Thermohydrologic Model Analyses of Heterogeneity and Thermal-Loading Factors for a Proposed Nuclear Waste Repository

    SciTech Connect

    Lee, K; Buscheck, T A; Gansemer, J; Glascoe, L G; Sun, Y

    2004-01-06

    The MultiScale ThermoHydrologic Model is used to predict thermal-hydrologic conditions in emplacement drifts and the adjoining host-rock throughout a proposed nuclear waste repository. The presented modeling effort simulates a lower temperature operation mode with a different panel loading than the repository currently being considered for the Yucca Mountain license application. Simulations address the influence of repository-scale thermal-conductivity heterogeneity and the influence of pre-closure operational factors on thermal-loading conditions. MSTHM can accommodate a complex repository layout, a development that, along with other improvements, enables more rigorous analyses of preclosure operational factors. Differences in MSTHM output occurring with these new capabilities are noted for a new sequential waste-package loading technique compared to a standard simultaneous loading technique. Alternative approaches to modeling repository-scale thermal-conductivity heterogeneity in the host-rock units are investigated, and study incorporating geostatistically-varied host-rock thermal conductivity is discussed.

  20. Prediction of the micro-thermo-mechanical behaviors in dispersion nuclear fuel plates with heterogeneous particle distributions

    NASA Astrophysics Data System (ADS)

    Jiang, Yijie; Wang, Qiming; Cui, Yi; Huo, Yongzhong; Ding, Shurong; Zhang, Lin; Li, Yuanming

    2011-11-01

    Dispersion nuclear fuel elements have promising prospects to be used in advanced nuclear reactors and disposal of nuclear wastes. They consist of fuel meat and cladding, and the fuel meat is a kind of composite fuel in which the fuel particles are embedded in the non-fissile matrix. Prediction of the micro-thermo-mechanical behaviors in dispersion nuclear plates is of importance to their irradiation safety and optimal design. In this study, the heterogeneity of the fuel particles along the thickness direction in the fuel meat is considered. The 3D finite element models have been developed respectively for two cases: (1) variation of fuel particle-particle (PP) distances for the particles near the mid-plane of the fuel meat; (2) variation of the particle-cladding (PC) distances for the fuel particles near the interface between the fuel meat and the cladding. The respective finite strain constitutive relations are developed for the fuel particle, metal matrix and cladding. The developed virtual temperature method is used to simulate irradiation swelling of the fuel particles and irradiation growth of the metal cladding. Effects of the heterogeneous distributions of the fuel particles on the micro temperature fields and the micro stress-strain fields are investigated. The obtained results indicate that: (1) as a whole, the maximum Mises stress, equivalent plastic strain and first principal stress at the matrix between the two closest particles increase with decreasing the particle-particle (PP) distance; existence of large first principal stresses there may be the main factor that induces the matrix failure; (2) variation of the particle-cladding (PC) distance has remarkable effects on the interfacial normal stress and shear stress at the interface between the fuel meat and the cladding; the first principal stress at the cladding near the interface increases dramatically when the fuel particle is closer and closer to the cladding. Thus, the proper distance between the

  1. 26 CFR 1.468A-1T - Nuclear decommissioning costs; general rules (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 6 2010-04-01 2010-04-01 false Nuclear decommissioning costs; general rules...-1T Nuclear decommissioning costs; general rules (temporary). (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income...

  2. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 6 2014-04-01 2014-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In...

  3. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 6 2013-04-01 2013-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In...

  4. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In...

  5. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 6 2012-04-01 2012-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In...

  6. Osteogenesis imperfecta type I: Molecular heterogeneity for COL1A1 null alleles of type I collagen

    SciTech Connect

    Willing, M.C.; Deschenes, S.P.; Pitts, S.H.; Arikat, H.; Roberts, E.J.; Scott, D.A.; Slayton, R.L.; Byers, P.H.

    1994-10-01

    Osteogenesis imperfecta (OI) type I is the mildest form of inherited brittle-bone disease. Dermal fibroblasts from most affected individuals produce about half the usual amount of type I procollagen, as a result of a COL1A1 {open_quotes}null{close_quotes} allele. Using PCR amplification of genomic DNA from affected individuals, followed by denaturing gradient gel electrophoresis (DGGE) and SSCP, we identified seven different COL1A1 gene mutations in eight unrelated families with OI type I. Three families have single nucleotide substitutions that alter 5{prime} donor splice sites; two of these unrelated families have the same mutation. One family has a point mutation, in an exon, that creates a premature termination codon, and four have small deletions or insertions, within exons, that create translational frameshifts and new termination codons downstream of the mutation sites. Each mutation leads to both marked reduction in steady-state levels of mRNA from the mutant allele and a quantitative decrease in type I procollagen production. Our data demonstrate that different molecular mechanisms that have the same effect on type I collagen production result in the same clinical phenotype. 58 refs., 4 figs., 1 tab.

  7. An investigation into heterogeneity in a single vein-type uranium ore deposit: Implications for nuclear forensics.

    PubMed

    Keatley, A C; Scott, T B; Davis, S; Jones, C P; Turner, P

    2015-12-01

    Minor element composition and rare earth element (REE) concentrations in nuclear materials are important as they are used within the field of nuclear forensics as an indicator of sample origin. However recent studies into uranium ores and uranium ore concentrates (UOCs) have shown significant elemental and isotopic heterogeneity from a single mine site such that some sites have shown higher variation within the mine site than that seen between multiple sites. The elemental composition of both uranium and gangue minerals within ore samples taken along a single mineral vein in South West England have been measured and reported here. The analysis of the samples was undertaken to determine the extent of the localised variation in key elements. Energy Dispersive X-ray spectroscopy (EDS) was used to analyse the gangue mineralogy and measure major element composition. Minor element composition and rare earth element (REE) concentrations were measured by Electron Probe Microanalysis (EPMA). The results confirm that a number of key elements, REE concentrations and patterns used for origin location do show significant variation within mine. Furthermore significant variation is also visible on a meter scale. In addition three separate uranium phases were identified within the vein which indicates multiple uranium mineralisation events. In light of these localised elemental variations it is recommended that representative sampling for an area is undertaken prior to establishing the REE pattern that may be used to identify the originating mine for an unknown ore sample and prior to investigating impact of ore processing on any arising REE patterns. PMID:26301831

  8. An investigation into heterogeneity in a single vein-type uranium ore deposit: Implications for nuclear forensics.

    PubMed

    Keatley, A C; Scott, T B; Davis, S; Jones, C P; Turner, P

    2015-12-01

    Minor element composition and rare earth element (REE) concentrations in nuclear materials are important as they are used within the field of nuclear forensics as an indicator of sample origin. However recent studies into uranium ores and uranium ore concentrates (UOCs) have shown significant elemental and isotopic heterogeneity from a single mine site such that some sites have shown higher variation within the mine site than that seen between multiple sites. The elemental composition of both uranium and gangue minerals within ore samples taken along a single mineral vein in South West England have been measured and reported here. The analysis of the samples was undertaken to determine the extent of the localised variation in key elements. Energy Dispersive X-ray spectroscopy (EDS) was used to analyse the gangue mineralogy and measure major element composition. Minor element composition and rare earth element (REE) concentrations were measured by Electron Probe Microanalysis (EPMA). The results confirm that a number of key elements, REE concentrations and patterns used for origin location do show significant variation within mine. Furthermore significant variation is also visible on a meter scale. In addition three separate uranium phases were identified within the vein which indicates multiple uranium mineralisation events. In light of these localised elemental variations it is recommended that representative sampling for an area is undertaken prior to establishing the REE pattern that may be used to identify the originating mine for an unknown ore sample and prior to investigating impact of ore processing on any arising REE patterns.

  9. Comparison of Different Upscaling Methods for Predicting Thermal Conductivity of Complex Heterogeneous Materials System: Application on Nuclear Waste Forms

    SciTech Connect

    Li, Dongsheng; Sun, Xin; Khaleel, Mohammad A.

    2012-06-16

    To develop a strategy in thermal conductivity prediction of a complex heterogeneous materials system, loaded nuclear waste forms, the computational efficiency and accuracy of different upscaling methods have been evaluated. The effective thermal conductivity, obtained from microstructure information and local thermal conductivity of different components, is critical in predicting the life and performance of waste form during storage. Several methods, including the Taylor model, Sachs model, self-consistent model, and statistical upscaling method, were developed and implemented. Microstructure based finite element method (FEM) prediction results were used to as benchmark to determine the accuracy of the different upscaling methods. Micrographs from waste forms with varying waste loadings were used in the prediction of thermal conductivity in FEM and homogenization methods. Prediction results demonstrated that in term of efficiency, boundary models (e.g., Taylor model and Sachs model) are stronger than the self-consistent model, statistical upscaling method, and finite element method. However, when balancing computational efficiency and accuracy, statistical upscaling is a useful method in predicting effective thermal conductivity for nuclear waste forms.

  10. Identification of heterogeneous nuclear ribonucleoprotein K (hnRNP K) as a repressor of C/EBPbeta-mediated gene activation.

    PubMed

    Miau, L H; Chang, C J; Shen, B J; Tsai, W H; Lee, S C

    1998-04-24

    Transcription factor C/EBPbeta has been known to regulate a wide array of genes including those involved in the acute-phase response. One of the molecular mechanisms underlying transcription activation by C/EBPbeta is through protein-protein interaction with other transcription factors. Here we report the identification and characterization of physical and functional interactions between C/EBPbeta and heterogeneous nuclear ribonucleoprotein (hnRNP) K. This interaction results in the repression of C/EBPbeta-dependent trans-activation of the agp gene. Footprinting assays indicate that hnRNP K cannot bind to the promoter region of agp gene or interfere with the binding of C/EBPbeta to its cognate DNA site. Furthermore, agp gene activation by the synergistic interaction of Nopp140 and C/EBPbeta is abolished by hnRNP K. The kinetics of appearance of C/EBPbeta-hnRNP K complex in the nuclear extract after initiation of acute-phase reaction indicates that hnRNP K functions as a negative regulator of C/EBPbeta-mediated activation of agp gene.

  11. Targeted Identification of Short Interspersed Nuclear Element Families Shows Their Widespread Existence and Extreme Heterogeneity in Plant Genomes[W

    PubMed Central

    Wenke, Torsten; Döbel, Thomas; Sörensen, Thomas Rosleff; Junghans, Holger; Weisshaar, Bernd; Schmidt, Thomas

    2011-01-01

    Short interspersed nuclear elements (SINEs) are non-long terminal repeat retrotransposons that are highly abundant, heterogeneous, and mostly not annotated in eukaryotic genomes. We developed a tool designated SINE-Finder for the targeted discovery of tRNA-derived SINEs. We analyzed sequence data of 16 plant genomes, including 13 angiosperms and three gymnosperms and identified 17,829 full-length and truncated SINEs falling into 31 families showing the widespread occurrence of SINEs in higher plants. The investigation focused on potato (Solanum tuberosum), resulting in the detection of seven different SolS SINE families consisting of 1489 full-length and 870 5′ truncated copies. Consensus sequences of full-length members range in size from 106 to 244 bp depending on the SINE family. SolS SINEs populated related species and evolved separately, which led to some distinct subfamilies. Solanaceae SINEs are dispersed along chromosomes and distributed without clustering but with preferred integration into short A-rich motifs. They emerged more than 23 million years ago and were species specifically amplified during the radiation of potato, tomato (Solanum lycopersicum), and tobacco (Nicotiana tabacum). We show that tobacco TS retrotransposons are composite SINEs consisting of the 3′ end of a long interspersed nuclear element integrated downstream of a nonhomologous SINE family followed by successfully colonization of the genome. We propose an evolutionary scenario for the formation of TS as a spontaneous event, which could be typical for the emergence of SINE families. PMID:21908723

  12. Reconstruction of the isotope activity content of heterogeneous nuclear waste drums.

    PubMed

    Krings, Thomas; Mauerhofer, Eric

    2012-07-01

    Radioactive waste must be characterized in order to verify its conformance with national regulations for intermediate storage or its disposal. Segmented gamma scanning (SGS) is a most widely applied non-destructive analytical technique for the characterization of radioactive waste drums. The isotope specific activity content is generally calculated assuming a homogeneous matrix and activity distribution for each measured drum segment. However, real radioactive waste drums exhibit non-uniform isotope and density distributions most affecting the reliability and accuracy of activities reconstruction in SGS. The presence of internal shielding structures in the waste drum contributes generally to a strong underestimation of the activity and this in particular for radioactive sources emitting low energy gamma-rays independently of their spatial distribution. In this work we present an improved method to quantify the activity of spatially concentrated gamma-emitting isotopes (point sources or hot spots) in heterogeneous waste drums with internal shielding structures. The isotope activity is reconstructed by numerical simulations and fits of the angular dependent count rate distribution recorded during the drum rotation in SGS using an analytical expression derived from a geometric model. First results of the improved method and enhancements of this method are shown and are compared to each other as well as to the conventional method which assumes a homogeneous matrix and activity distribution. It is shown that the new model improves the accuracy and the reliability of the activity reconstruction in SGS and that the presented algorithm is suitable with respect to the framework requirement of industrial application.

  13. Reconstruction of the isotope activity content of heterogeneous nuclear waste drums.

    PubMed

    Krings, Thomas; Mauerhofer, Eric

    2012-07-01

    Radioactive waste must be characterized in order to verify its conformance with national regulations for intermediate storage or its disposal. Segmented gamma scanning (SGS) is a most widely applied non-destructive analytical technique for the characterization of radioactive waste drums. The isotope specific activity content is generally calculated assuming a homogeneous matrix and activity distribution for each measured drum segment. However, real radioactive waste drums exhibit non-uniform isotope and density distributions most affecting the reliability and accuracy of activities reconstruction in SGS. The presence of internal shielding structures in the waste drum contributes generally to a strong underestimation of the activity and this in particular for radioactive sources emitting low energy gamma-rays independently of their spatial distribution. In this work we present an improved method to quantify the activity of spatially concentrated gamma-emitting isotopes (point sources or hot spots) in heterogeneous waste drums with internal shielding structures. The isotope activity is reconstructed by numerical simulations and fits of the angular dependent count rate distribution recorded during the drum rotation in SGS using an analytical expression derived from a geometric model. First results of the improved method and enhancements of this method are shown and are compared to each other as well as to the conventional method which assumes a homogeneous matrix and activity distribution. It is shown that the new model improves the accuracy and the reliability of the activity reconstruction in SGS and that the presented algorithm is suitable with respect to the framework requirement of industrial application. PMID:22134026

  14. Experimental results from pressure testing a 1:6-scale nuclear power plant containment

    SciTech Connect

    Horschel, D.S.

    1992-01-01

    This report discusses the testing of a 1:6-scale, reinforced-concrete containment building at Sandia National Laboratories, in Albuquerque, New Mexico. The scale-model, Light Water Reactor (LWR) containment building was designed and built to the American Society of Mechanical Engineers (ASME) code by United Engineers and Constructors, Inc., and was instrumented with over 1200 transducers to prepare for the test. The containment model was tested to failure to determine its response to static internal overpressurization. As part of the US Nuclear Regulatory Commission`s program on containment integrity, the test results will be used to assess the capability of analytical methods to predict the performance of containments under severe-accident loads. The scaled dimensions of the cylindrical wall and hemispherical dome were typical of a full-size containment. Other typical features included in the heavily reinforced model were equipment hatches, personnel air locks, several small piping penetrations, and a ihin steel liner that was attached to the concrete by headed studs. In addition to the transducers attached to the model, an acoustic detection system and several video and still cameras were used during testing to gather data and to aid in the conduct of the test. The model and its instrumentation are briefly discussed, and is followed by the testing procedures and measured response of the containment model. A summary discussion is included to aid in understanding the significance of the test as it applies to real world reinforced concrete containment structures. The data gathered during SIT and overpressure testing are included as an appendix.

  15. Ocean dynamic processes causing spatially heterogeneous distribution of sedimentary caesium-137 massively released from the Fukushima Daiichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Higashi, H.; Morino, Y.; Furuichi, N.; Ohara, T.

    2015-12-01

    Massive amounts of anthropogenic radiocaesium 137Cs that were released into the environment by the Fukushima Daiichi Nuclear Power Plant accident in March 2011 are widely known to have extensively migrated to Pacific Ocean sediment off of eastern Japan. Several recent reports have stated that the sedimentary 137Cs is now stable with a remarkably heterogeneous distribution. The present study elucidates ocean dynamic processes causing this heterogeneous sedimentary 137Cs distribution in and around the shelf off Fukushima and adjacent prefectures. We performed a numerical simulation of oceanic 137Cs behaviour for about 10 months after the accident, using a comprehensive dynamic model involving advection-diffusion transport in seawater, adsorption and desorption to and from particulate matter, sedimentation and suspension on and from the bottom, and vertical diffusion transport in the sediment. A notable simulated result was that the sedimentary 137Cs significantly accumulated in a swath just offshore of the shelf break (along the 50-100 m isobath) as in recent observations, although the seabed in the entire simulation domain was assumed to have ideal properties such as identical bulk density, uniform porosity, and aggregation of particles with a single grain diameter. This result indicated that the heterogeneous sedimentary 137Cs distribution was not necessarily a result of the spatial distribution of 137Cs sediment adsorptivity. The present simulation suggests that the shape of the swath is mainly associated with spatiotemporal variation between bottom shear stress in the shallow shelf (< 50 m depths) and that offshore of the shelf break. In a large part of the shallow shelf, the simulation indicated that strong bottom friction suspending particulate matter from the seabed frequently occurred via a periodic spring tide about every 2 weeks and via occasional strong wind. The sedimentary 137Cs thereby could hardly stay on the surface of the seabed with the result that

  16. Heterogeneous nuclear expression of the promyelocytic leukemia (PML) protein in normal and neoplastic human tissues.

    PubMed Central

    Gambacorta, M.; Flenghi, L.; Fagioli, M.; Pileri, S.; Leoncini, L.; Bigerna, B.; Pacini, R.; Tanci, L. N.; Pasqualucci, L.; Ascani, S.; Mencarelli, A.; Liso, A.; Pelicci, P. G.; Falini, B.

    1996-01-01

    The RING-finger promyelocytic leukemia (PML) protein is the product of the PML gene that fuses with the retinoic acid receptor-alpha gene in the t(15; 17) translocation of acute promyelocytic leukemia. Wild-type PML localizes in the nucleus with a typical speckled pattern that is a consequence of the concentration of the protein within discrete subnuclear domains known as nuclear bodies. Delocalization of PML from nuclear bodies has been documented in acute promyelocytic leukemia cells and suggested to contribute to leukemogenesis. In an attempt to get new insights into the function of the wild-type PML protein and to investigate whether it displays an altered expression pattern in neoplasms other than acute promyelocytic leukemia, we stained a large number of normal and neoplastic human tissues with a new murine monoclonal antibody (PG-M3) directed against the amino-terminal region of PML. As the PG-M3 epitope is partially resistant to fixatives, only cells that overexpress PML are detected by the antibody in microwave-heated paraffin sections. Among normal tissues, PML was characteristically up-regulated in activated epithelioid histiocytes and fibroblasts in a variety of pathological conditions, columnar epithelium in small active thyroid follicles, well differentiated foamy cells in the center of sebaceous glands, and hypersecretory endometria (Arias-Stella). Interferons, the PML of which is a primary target gene, and estrogens are likely to represent some of the cytokines and/or hormones that may be involved in the up-regulation of PML under these circumstances. In keeping with this concept, we found that PML is frequently overexpressed in Hodgkin and Reed-Sternberg cells of Hodgkin's disease, a tumor of cytokine-producing cells. Among solid tumors, overexpression of PML was frequently found in carcinomas of larynx and thyroid (papillary), epithelial thymomas, and Kaposi's sarcoma, whereas carcinomas of the lung, thyroid (follicular), breast, and colon were

  17. Characterisation of heterogeneous molybdate and chromate phase assemblages in model nuclear waste glasses by multinuclear magnetic resonance spectroscopy.

    PubMed

    Greer, Brandon J; Kroeker, Scott

    2012-05-28

    A series of sodium borosilicate glasses containing cesium, molybdenum, and chromium was prepared to investigate the partitioning of chromium amongst the glass and phase-separated crystalline molybdates. The precipitates were examined by (133)Cs, (23)Na, and (95)Mo MAS NMR, revealing a phase assemblage consisting of Na(2)MoO(4), Na(2)MoO(4)·2H(2)O, Cs(2)MoO(4), Cs(2)CrO(4), CsNaMoO(4)·2H(2)O, and Cs(3)Na(MoO(4))(2). (133)Cs MAS NMR indicates random substitution of Cr into the Mo sites of Cs(3)Na(MoO(4))(2) and provides a quantitative assessment of Cr incorporation. The sample compositions were verified by various analytical techniques and highlight the centrality of NMR in the identification and quantification of heterogeneous crystalline composites, including sensitivity to cationic substitution. The observation and facile interconversion of hydrated phases invites careful consideration of these materials for nuclear waste disposal.

  18. Heterogeneous Nuclear Ribonucleoprotein L is required for the survival and functional integrity of murine hematopoietic stem cells.

    PubMed

    Gaudreau, Marie-Claude; Grapton, Damien; Helness, Anne; Vadnais, Charles; Fraszczak, Jennifer; Shooshtarizadeh, Peiman; Wilhelm, Brian; Robert, François; Heyd, Florian; Möröy, Tarik

    2016-01-01

    The proliferation and survival of hematopoietic stem cells (HSCs) has to be strictly coordinated to ensure the timely production of all blood cells. Here we report that the splice factor and RNA binding protein hnRNP L (heterogeneous nuclear ribonucleoprotein L) is required for hematopoiesis, since its genetic ablation in mice reduces almost all blood cell lineages and causes premature death of the animals. In agreement with this, we observed that hnRNP L deficient HSCs lack both the ability to self-renew and foster hematopoietic differentiation in transplanted hosts. They also display mitochondrial dysfunction, elevated levels of γH2AX, are Annexin V positive and incorporate propidium iodide indicating that they undergo cell death. Lin(-)c-Kit(+) fetal liver cells from hnRNP L deficient mice show high p53 protein levels and up-regulation of p53 target genes. In addition, cells lacking hnRNP L up-regulated the expression of the death receptors TrailR2 and CD95/Fas and show Caspase-3, Caspase-8 and Parp cleavage. Treatment with the pan-caspase inhibitor Z-VAD-fmk, but not the deletion of p53, restored cell survival in hnRNP L deficient cells. Our data suggest that hnRNP L is critical for the survival and functional integrity of HSCs by restricting the activation of caspase-dependent death receptor pathways. PMID:27271479

  19. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    SciTech Connect

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo . E-mail: sueokae@post.saga-med.ac.jp

    2005-08-05

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression.

  20. Heterogeneous Nuclear Ribonucleoprotein L is required for the survival and functional integrity of murine hematopoietic stem cells

    PubMed Central

    Gaudreau, Marie-Claude; Grapton, Damien; Helness, Anne; Vadnais, Charles; Fraszczak, Jennifer; Shooshtarizadeh, Peiman; Wilhelm, Brian; Robert, François; Heyd, Florian; Möröy, Tarik

    2016-01-01

    The proliferation and survival of hematopoietic stem cells (HSCs) has to be strictly coordinated to ensure the timely production of all blood cells. Here we report that the splice factor and RNA binding protein hnRNP L (heterogeneous nuclear ribonucleoprotein L) is required for hematopoiesis, since its genetic ablation in mice reduces almost all blood cell lineages and causes premature death of the animals. In agreement with this, we observed that hnRNP L deficient HSCs lack both the ability to self-renew and foster hematopoietic differentiation in transplanted hosts. They also display mitochondrial dysfunction, elevated levels of γH2AX, are Annexin V positive and incorporate propidium iodide indicating that they undergo cell death. Lin-c-Kit+ fetal liver cells from hnRNP L deficient mice show high p53 protein levels and up-regulation of p53 target genes. In addition, cells lacking hnRNP L up-regulated the expression of the death receptors TrailR2 and CD95/Fas and show Caspase-3, Caspase-8 and Parp cleavage. Treatment with the pan-caspase inhibitor Z-VAD-fmk, but not the deletion of p53, restored cell survival in hnRNP L deficient cells. Our data suggest that hnRNP L is critical for the survival and functional integrity of HSCs by restricting the activation of caspase-dependent death receptor pathways. PMID:27271479

  1. Isolation and characterization of the heterogeneous nuclear RNA-ribonucleoprotein complex

    SciTech Connect

    Choi, Y.D.

    1985-01-01

    Exposure of cells to UV light of sufficient intensity brings about crosslinking of RNA to proteins which are in direct contact with it in vivo. The major (/sup 35/S)methionine-labeled proteins which become crosslinked to poly(A)/sup +/hnRNA in HeLa cells are of 120K, 68K, 53K, 43K, 41K, 38K, and 36K (K = kilodaltons). By immunizing mice with UV crosslinked complexes two monoclonal antibodies (2B12 and 4F4) against the C proteins (41K and 43K) and one (3G6) against the 120K protein of the hnRNP complex were obtained. Immunofluorescence microscopy demonstrates that the C proteins and 120K are segregated to the nucleus and are not associated with nucleoli or chromatin. The two C proteins are highly related to each other antigenically. Monoclonal antibody 4F4 identifies the C proteins of the hnRNP complex in widely divergent species from human to lizard. The C proteins are phosphorylated and are in contact with hnRNA in vivo. The hnRNP complex was isolated from vertebrate cell nuclei by immunoprecipitation with these monoclonal antibodies. This complex contains proteins and hnRNA of up to approx.10 kb. The major steady state labeled (/sup 35/S)methionine labeled proteins of the isolated complex from HeLa cells are of 34K, 36K, 36K (A1 and A2), 37K, 38K (B1 and B2), 41K, 43K (C1 and C2) and doublets at 68K and at 120K. These proteins are organized into a 30S particle. Large hnRNP complexes are composed of multiples of 30S particles which are connected by highly nuclease sensitive stretches of hnRNA. It it concluded that the hnRNP structure is an integral component of the mRNA formation pathway in the eukaryotic cell.

  2. Protein Kinase C-{delta} mediates down-regulation of heterogeneous nuclear ribonucleoprotein K protein: involvement in apoptosis induction

    SciTech Connect

    Gao, Feng-Hou; Wu, Ying-Li; Zhao, Meng; Chen, Guo-Qiang

    2009-11-15

    We reported previously that NSC606985, a camptothecin analogue, induces apoptosis of acute myeloid leukemia (AML) cells through proteolytic activation of protein kinase C delta ({Delta}PKC-{delta}). By subcellular proteome analysis, heterogeneous nuclear ribonucleoprotein K (hnRNP K) was identified as being significantly down-regulated in NSC606985-treated leukemic NB4 cells. HnRNP K, a docking protein for DNA, RNA, and transcriptional or translational molecules, is implicated in a host of processes involving the regulation of gene expression. However, the molecular mechanisms of hnRNP K reduction and its roles during apoptosis are still not understood. In the present study, we found that, following the appearance of the {Delta}PKC-{delta}, hnRNP K protein was significantly down-regulated in NSC606985, doxorubicin, arsenic trioxide and ultraviolet-induced apoptosis. We further provided evidence that {Delta}PKC-{delta} mediated the down-regulation of hnRNP K protein during apoptosis: PKC-{delta} inhibitor could rescue the reduction of hnRNP K; hnRNP K failed to be decreased in PKC-{delta}-deficient apoptotic KG1a cells; conditional induction of {Delta}PKC-{delta} in U937T cells directly down-regulated hnRNP K protein. Moreover, the proteasome inhibitor also inhibited the down-regulation of hnRNP K protein by apoptosis inducer and the conditional expression of {Delta}PKC-{delta}. More intriguingly, the suppression of hnRNP K with siRNA transfection significantly induced apoptosis. To our knowledge, this is the first demonstration that proteolytically activated PKC-{delta} down-regulates hnRNP K protein in a proteasome-dependent manner, which plays an important role in apoptosis induction.

  3. A novel SDS-stable dimer of a heterogeneous nuclear ribonucleoprotein at presynaptic terminals of squid neurons.

    PubMed

    Lico, D T P; Lopes, G S; Brusco, J; Rosa, J C; Gould, R M; De Giorgis, J A; Larson, R E

    2015-08-01

    The presence of mRNAs in synaptic terminals and their regulated translation are important factors in neuronal communication and plasticity. Heterogeneous nuclear ribonucleoprotein (hnRNP) complexes are involved in the translocation, stability, and subcellular localization of mRNA and the regulation of its translation. Defects in these processes and mutations in components of the hnRNP complexes have been related to the formation of cytoplasmic inclusion bodies and neurodegenerative diseases. Despite much data on mRNA localization and evidence for protein synthesis, as well as the presence of translation machinery, in axons and presynaptic terminals, the identity of RNA-binding proteins involved in RNA transport and function in presynaptic regions is lacking. We previously characterized a strongly basic RNA-binding protein (p65), member of the hnRNPA/B subfamily, in squid presynaptic terminals. Intriguingly, in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), p65 migrated as a 65-kDa protein, whereas members of the hnRNPA/B family typically have molecular masses ranging from 35 to 42kDa. In this report we present further biochemical and molecular characterization that shows endogenous p65 to be an SDS-stable dimer composed of ∼37-kDa hnRNPA/B-like subunits. We cloned and expressed a recombinant protein corresponding to squid hnRNPA/B-like protein and showed its propensity to aggregate and form SDS-stable dimers in vitro. Our data suggest that this unique hnRNPA/B-like protein co-localizes with synaptic vesicle protein 2 and RNA-binding protein ELAV and thus may serve as a link between local mRNA processing and presynaptic function and regulation.

  4. Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

    SciTech Connect

    Sugimasa, Hironobu; Taniue, Kenzui; Kurimoto, Akiko; Takeda, Yasuko; Kawasaki, Yoshihiro; Akiyama, Tetsu

    2015-03-27

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells.

  5. The nuclear orphan receptor NR4A1 and NR4A3 as tumor suppressors in hematologic neoplasms.

    PubMed

    Wenzl, Kerstin; Troppan, Katharina; Neumeister, Peter; Deutsch, Alexander J A

    2015-01-01

    NR4A1 (Nur77) belongs together with NR4A2 (Nurr1) and NR4A3 (NOR-1) to the nuclear orphan receptors of the NR4A-family. Their activation is generally short lived, the cellular outcome is a stimulus- and cell context-dependent differential activation of NR4A target genes that regulate cell cycle, apoptosis, inflammation, atherogenesis, metabolism, DNA repair and tumorigenesis. NR4A1 and NR4A3 were identified to function as tumor suppressors in acute myeloid leukemia (AML). Deletion of both nuclear receptors led to rapid development of AML in mice. Loss of NR4A1 and NR4A3 was a common feature in human AML patients. Additionally, NR4A1 and NR4A3 hypoallelic mice - mice with a reduced NR4A1 and NR4A3 expression - develop a chronic myeloid malignancy that recapitulates the pathological features of myelodysplastic/ myeloproliferative neoplasms with progression to AML in rare cases. Recently, a reduced NR4A1 and NR4A3 expression was described in aggressive lymphomas and low NR4A1 expression was associated with poor overall survival. Overexpression of NR4A1 in aggressive lymphoma cells led to induction of apoptosis and abrogated tumor growth in a xenograft mouse model. Recently, it was shown that NR4A inducing agents or NR4A agonist possess/induce apoptotic effects in AML and lymphoma cells. Due to this fact and the growing number of NR4A1 and NR4A3 inducing agents and NR4A agonists, both receptors represent new targets for anti tumor therapy.

  6. The autism-related gene SNRPN regulates cortical and spine development via controlling nuclear receptor Nr4a1.

    PubMed

    Li, Huiping; Zhao, Pingping; Xu, Qiong; Shan, Shifang; Hu, Chunchun; Qiu, Zilong; Xu, Xiu

    2016-01-01

    The small nuclear ribonucleoprotein polypeptide N (SNRPN) gene, encoding the RNA-associated SmN protein, duplications or deletions of which are strongly associated with neurodevelopmental disabilities. SNRPN-coding protein is highly expressed in the brain. However, the role of SNRPN protein in neural development remains largely unknown. Here we showed that the expression of SNRPN increased markedly during postnatal brain development. Overexpression or knockdown of SNRPN in cortical neurons impaired neurite outgrowth, neuron migration, and the distribution of dendritic spines. We found that SNRPN regulated the expression level of Nr4a1, a critical nuclear receptor during neural development, in cultured primary cortical neurons. The abnormal spine development caused by SNRPN overexpression could be fully rescued by Nr4a1 co-expression. Importantly, we found that either knockdown of Nr4a1 or 3, 3'- Diindolylmethane (DIM), an Nr4a1 antagonist, were able to rescue the effects of SNRPN knockdown on neurite outgrowth of embryonic cortical neurons, providing the potential therapeutic methods for SNRPN deletion disorders. We thus concluded that maintaining the proper level of SNRPN is critical in cortical neurodevelopment. Finally, Nr4a1 may serve as a potential drug target for SNRPN-related neurodevelopmental disabilities, including Prader-Willi syndrome (PWS) and autism spectrum disorders (ASDs). PMID:27430727

  7. The autism-related gene SNRPN regulates cortical and spine development via controlling nuclear receptor Nr4a1

    PubMed Central

    Li, Huiping; Zhao, Pingping; Xu, Qiong; Shan, Shifang; Hu, Chunchun; Qiu, Zilong; Xu, Xiu

    2016-01-01

    The small nuclear ribonucleoprotein polypeptide N (SNRPN) gene, encoding the RNA-associated SmN protein, duplications or deletions of which are strongly associated with neurodevelopmental disabilities. SNRPN-coding protein is highly expressed in the brain. However, the role of SNRPN protein in neural development remains largely unknown. Here we showed that the expression of SNRPN increased markedly during postnatal brain development. Overexpression or knockdown of SNRPN in cortical neurons impaired neurite outgrowth, neuron migration, and the distribution of dendritic spines. We found that SNRPN regulated the expression level of Nr4a1, a critical nuclear receptor during neural development, in cultured primary cortical neurons. The abnormal spine development caused by SNRPN overexpression could be fully rescued by Nr4a1 co-expression. Importantly, we found that either knockdown of Nr4a1 or 3, 3′- Diindolylmethane (DIM), an Nr4a1 antagonist, were able to rescue the effects of SNRPN knockdown on neurite outgrowth of embryonic cortical neurons, providing the potential therapeutic methods for SNRPN deletion disorders. We thus concluded that maintaining the proper level of SNRPN is critical in cortical neurodevelopment. Finally, Nr4a1 may serve as a potential drug target for SNRPN-related neurodevelopmental disabilities, including Prader-Willi syndrome (PWS) and autism spectrum disorders (ASDs). PMID:27430727

  8. Glucocorticoids antagonize cAMP-induced Star transcription in Leydig cells through the orphan nuclear receptor NR4A1.

    PubMed

    Martin, Luc J; Tremblay, Jacques J

    2008-09-01

    It is well established that stress, either physical or psychosocial, causes a decrease in testosterone production by Leydig cells. Glucocorticoids (Gc) are the main mediators of stress response and they convey their repressive effect on Leydig cells through the glucocorticoid receptor (GR). So far, various mechanisms have been proposed to explain the mechanism of action of Gc on Leydig cell steroidogenesis including repression of genes involved in testosterone biosynthesis. Several steroidogenic genes, including steroidogenic acute regulatory (STAR) protein, have been shown to be repressed by Gc in a GR-dependent manner but the underlying mechanisms remain to be fully elucidated. Here, we found that dexamethasone (Dex), a potent synthetic Gc, partly antagonizes the cAMP-dependent stimulation of the mouse Star promoter in MA-10 Leydig cells as revealed by transient transfection assays. This repression requires an element located at -95 bp previously implicated in the activation of the Star promoter by the nuclear receptors, NR4A1 and NR5A1. Dex was found to inhibit NR4A1-dependent transactivation of the Star promoter in Leydig cells by decreasing NR4A1, but not NR5A1, recruitment to the proximal Star promoter as determined by chromatin immunoprecipitation assay. Western blots revealed that Dex did not affect NR4A1 or NR5A1 expression in response to cAMP. These data suggest that NR4A1 would be associated with the GR in a transcriptionally inactive complex as previously demonstrated in pituitary corticotrope cells. Thus, our data provide new molecular insights into the stress-mediated suppression of testosterone production in testicular Leydig cells.

  9. The Nuclear Receptor NR4A1 Induces a Form of Cell Death Dependent on Autophagy in Mammalian Cells

    PubMed Central

    Bouzas-Rodríguez, Jimena; Zárraga-Granados, Gabriela; Sánchez-Carbente, Maria del Rayo; Rodríguez-Valentín, Rocío; Gracida, Xicotencatl; Anell-Rendón, Dámaris; Covarrubias, Luis; Castro-Obregón, Susana

    2012-01-01

    The control of cell death is a biological process essential for proper development, and for preventing devastating pathologies like cancer and neurodegeneration. On the other hand, autophagy regulation is essential for protein and organelle degradation, and its dysfunction is associated with overlapping pathologies like cancer and neurodegeneration, but also for microbial infection and aging. In the present report we show that two evolutionarily unrelated receptors—Neurokinin 1 Receptor (NK1R,) a G-protein coupled receptor, and Insulin-like Growth Factor 1 Receptor (IGF1R), a tyrosine kinase receptor—both induce non-apoptotic cell death with autophagic features and requiring the activity of the autophagic core machinery proteins PI3K-III, Beclin-1 and Atg7. Remarkably, this form of cell death occurs in apoptosis-competent cells. The signal transduction pathways engaged by these receptors both converged on the activation of the nuclear receptor NR4A1, which has previously been shown to play a critical role in some paradigms of apoptosis and in NK1R-induced cell death. The activity of NR4A1 was necessary for IGF1R-induced cell death, as well as for a canonical model of cell death by autophagy induced by the presence of a pan-caspase inhibitor, suggesting that NR4A1 is a general modulator of this kind of cell death. During cell death by autophagy, NR4A1 was transcriptionally competent, even though a fraction of it was present in the cytoplasm. Interestingly, NR4A1 interacts with the tumor suppressor p53 but not with Beclin-1 complex. Therefore the mechanism to promote cell death by autophagy might involve regulation of gene expression, as well as protein interactions. Understanding the molecular basis of autophagy and cell death mediation by NR4A1, should provide novel insights and targets for therapeutic intervention. PMID:23071566

  10. The rice RING finger E3 ligase, OsHCI1, drives nuclear export of multiple substrate proteins and its heterogeneous overexpression enhances acquired thermotolerance

    PubMed Central

    Lim, Sung Don; Cho, Hyun Yong; Park, Yong Chan; Ham, Deok Jae; Lee, Ju Kyong; Jang, Cheol Seong

    2013-01-01

    Thermotolerance is very important for plant survival when plants are subjected to lethally high temperature. However, thus far little is known about the functions of RING E3 ligase in response to heat shock in plants. This study found that one rice gene encoding the RING finger protein was specifically induced by heat and cold stress treatments but not by salinity or dehydration and named it OsHCI1 (Oryza sativa heat and cold induced 1). Subcellular localization results showed that OsHCI1 was mainly associated with the Golgi apparatus and moved rapidly and extensively along the cytoskeleton. In contrast, OsHCI1 may have accumulated in the nucleus under high temperatures. OsHCI1 physically interacted with nuclear substrate proteins including a basic helix-loop-helix transcription factor. Transient co-overexpression of OsHCI1 and each of three nuclear proteins showed that their fluorescent signals moved into the cytoplasm as punctuate formations. Heterogeneous overexpression of OsHCI1 in Arabidopsis highly increased survival rate through acquired thermotolerance. It is proposed that OsHCI1 mediates nuclear–cytoplasmic trafficking of nuclear substrate proteins via monoubiquitination and drives an inactivation device for the nuclear proteins under heat shock. PMID:23698632

  11. A heterogeneous population of nuclear-encoded mitochondrial mRNAs is present in the axons of primary sympathetic neurons.

    PubMed

    Aschrafi, Armaz; Kar, Amar N; Gale, Jenna R; Elkahloun, Abdel G; Vargas, Jose Noberto S; Sales, Naomi; Wilson, Gabriel; Tompkins, Miranda; Gioio, Anthony E; Kaplan, Barry B

    2016-09-01

    Mitochondria are enriched in subcellular regions of high energy consumption, such as axons and pre-synaptic nerve endings. Accumulating evidence suggests that mitochondrial maintenance in these distal structural/functional domains of the neuron depends on the "in-situ" translation of nuclear-encoded mitochondrial mRNAs. In support of this notion, we recently provided evidence for the axonal targeting of several nuclear-encoded mRNAs, such as cytochrome c oxidase, subunit 4 (COXIV) and ATP synthase, H+ transporting and mitochondrial Fo complex, subunit C1 (ATP5G1). Furthermore, we showed that axonal trafficking and local translation of these mRNAs plays a critical role in the generation of axonal ATP. Using a global gene expression analysis, this study identified a highly diverse population of nuclear-encoded mRNAs that were enriched in the axon and presynaptic nerve terminals. Among this population of mRNAs, fifty seven were found to be at least two-fold more abundant in distal axons, as compared with the parental cell bodies. Gene ontology analysis of the nuclear-encoded mitochondrial mRNAs suggested functions for these gene products in molecular and biological processes, including but not limited to oxidoreductase and electron carrier activity and proton transport. Based on these results, we postulate that local translation of nuclear-encoded mitochondrial mRNAs present in the axons may play an essential role in local energy production and maintenance of mitochondrial function.

  12. Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa histone deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1.

    PubMed

    Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania; Bertini, Enrico; Zanni, Ginevra

    2015-04-01

    Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin-myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify a new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK.

  13. Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa Histone Deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1

    SciTech Connect

    Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania; Bertini, Enrico; Zanni, Ginevra

    2015-04-03

    Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin–myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify a new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. - Highlights: • ROCK regulates nucleocytoplasmic shuttling of HDAC7 via phosphorylation of MYPT1. • Nuclear export of HDAC7 and upregulation of NR4A1 occurs with low ROCK activity. • High levels of ROCK activity due to OPHN1 loss of function downregulate NR4A1.

  14. Heterogeneous nuclear ribonucleoprotein K represses the production of pro-apoptotic Bcl-xS splice isoform.

    PubMed

    Revil, Timothée; Pelletier, Jordan; Toutant, Johanne; Cloutier, Alexandre; Chabot, Benoit

    2009-08-01

    The Bcl-x pre-mRNA is alternatively spliced to produce the anti-apoptotic Bcl-x(L) and the pro-apoptotic Bcl-x(S) isoforms. By performing deletion mutagenesis on a human Bcl-x minigene, we have identified a novel exonic element that controls the use of the 5' splice site of Bcl-x(S). The proximal portion of this element acts as a repressor and is located downstream of an enhancer. Further mutational analysis provided a detailed topological map of the regulatory activities revealing a sharp transition between enhancer and repressor sequences. Portions of the enhancer can function when transplanted in another alternative splicing unit. Chromatography and immunoprecipitation assays indicate that the silencer element interacts with heterogeneous ribonucleoprotein particle (hnRNP) K, consistent with the presence of putative high affinity sites for this protein. Finally, down-regulation of hnRNP K by RNA interference enhanced splicing to Bcl-x(S), an effect seen only when the sequences bound by hnRNP K are present. Our results therefore document a clear role for hnRNP K in preventing the production of the pro-apoptotic Bcl-x(S) splice isoform.

  15. Nuclear factor XIIIa staining (clone AC-1A1 mouse monoclonal) is a sensitive and specific marker to discriminate sebaceous proliferations from other cutaneous clear cell neoplasms.

    PubMed

    Uhlenhake, Elizabeth E; Clark, Lindsey N; Smoller, Bruce R; Shalin, Sara C; Gardner, Jerad M

    2016-08-01

    Sebaceous carcinoma is a rare but serious malignancy that may be difficult to diagnose when poorly differentiated. Other epithelial tumors with clear cell change may mimic sebaceous carcinoma. Few useful or specific immunohistochemical markers for sebaceous differentiation are available. Nuclear staining with factor XIIIa (clone AC-1A1) was recently found to be a highly sensitive marker of sebaceous differentiation. We evaluated nuclear factor XIIIa (AC-1A1) staining in sebaceous neoplasms vs. other cutaneous clear cell tumors. We stained 27 sebaceous proliferations: sebaceous hyperplasia (7), sebaceous adenoma (8), sebaceoma (5), sebaceous carcinoma (7). We also stained 67 tumors with clear cell change: basal cell carcinoma (8), squamous cell carcinoma (8), hidradenoma (7), desmoplastic trichilemmoma (2), trichilemmoma (10), trichilemmal carcinoma (3), clear cell acanthoma (9), atypical fibroxanthoma (1), syringoma (8), trichoepithelioma (1), metastatic renal cell carcinoma (2), and nevi with balloon cell change (8). Nuclear factor XIIIa (AC-1A1) staining was present in 100% of sebaceous proliferations; 96% displayed strong staining. Non-sebaceous clear cell tumors were negative or only weakly positive with factor XIIIa (AC-1A1) in 95.5%; only 4.5% showed strong staining. This suggests that strong nuclear factor XIIIa (AC-1A1) staining is a sensitive and specific marker of sebaceous neoplasms vs. other clear cell tumors.

  16. Aberrantly glycosylated IgA1 in IgA nephropathy patients is recognized by IgG antibodies with restricted heterogeneity.

    PubMed

    Suzuki, Hitoshi; Fan, Run; Zhang, Zhixin; Brown, Rhubell; Hall, Stacy; Julian, Bruce A; Chatham, W Winn; Suzuki, Yusuke; Wyatt, Robert J; Moldoveanu, Zina; Lee, Jeannette Y; Robinson, James; Tomana, Milan; Tomino, Yasuhiko; Mestecky, Jiri; Novak, Jan

    2009-06-01

    IgA nephropathy (IgAN) is characterized by circulating immune complexes composed of galactose-deficient IgA1 and a glycan-specific IgG antibody. These immune complexes deposit in the glomerular mesangium and induce the mesangioproliferative glomerulonephritis characteristic of IgAN. To define the precise specificities and molecular properties of the IgG antibodies, we generated EBV-immortalized IgG-secreting lymphocytes from patients with IgAN and found that the secreted IgG formed complexes with galactose-deficient IgA1 in a glycan-dependent manner. We cloned and sequenced the heavy- and light-chain antigen-binding domains of IgG specific for galactose-deficient IgA1 and identified an A to S substitution in the complementarity-determining region 3 of the variable region of the gene encoding the IgG heavy chain in IgAN patients. Furthermore, site-directed mutagenesis that reverted the residue to alanine reduced the binding of recombinant IgG to galactose-deficient IgA1. Finally, we developed a dot-blot assay for the glycan-specific IgG antibody that differentiated patients with IgAN from healthy and disease controls with 88% specificity and 95% sensitivity and found that elevated levels of this antibody in the sera of patients with IgAN correlated with proteinuria. Collectively, these findings indicate that glycan-specific antibodies are associated with the development of IgAN and may represent a disease-specific marker and potential therapeutic target.

  17. Aberrantly glycosylated IgA1 in IgA nephropathy patients is recognized by IgG antibodies with restricted heterogeneity

    PubMed Central

    Suzuki, Hitoshi; Fan, Run; Zhang, Zhixin; Brown, Rhubell; Hall, Stacy; Julian, Bruce A.; Chatham, W. Winn; Suzuki, Yusuke; Wyatt, Robert J.; Moldoveanu, Zina; Lee, Jeannette Y.; Robinson, James; Tomana, Milan; Tomino, Yasuhiko; Mestecky, Jiri; Novak, Jan

    2009-01-01

    IgA nephropathy (IgAN) is characterized by circulating immune complexes composed of galactose-deficient IgA1 and a glycan-specific IgG antibody. These immune complexes deposit in the glomerular mesangium and induce the mesangioproliferative glomerulonephritis characteristic of IgAN. To define the precise specificities and molecular properties of the IgG antibodies, we generated EBV-immortalized IgG-secreting lymphocytes from patients with IgAN and found that the secreted IgG formed complexes with galactose-deficient IgA1 in a glycan-dependent manner. We cloned and sequenced the heavy- and light-chain antigen-binding domains of IgG specific for galactose-deficient IgA1 and identified an A to S substitution in the complementarity-determining region 3 of the variable region of the gene encoding the IgG heavy chain in IgAN patients. Furthermore, site-directed mutagenesis that reverted the residue to alanine reduced the binding of recombinant IgG to galactose-deficient IgA1. Finally, we developed a dot-blot assay for the glycan-specific IgG antibody that differentiated patients with IgAN from healthy and disease controls with 88% specificity and 95% sensitivity and found that elevated levels of this antibody in the sera of patients with IgAN correlated with proteinuria. Collectively, these findings indicate that glycan-specific antibodies are associated with the development of IgAN and may represent a disease-specific marker and potential therapeutic target. PMID:19478457

  18. Identification of two RNA-binding proteins in Balbiani ring premessenger ribonucleoprotein granules and presence of these proteins in specific subsets of heterogeneous nuclear ribonucleoprotein particles.

    PubMed Central

    Wurtz-T; Kiseleva, E; Nacheva, G; Alzhanova-Ericcson, A; Rosén, A; Daneholt, B

    1996-01-01

    Balbiani ring (BR) granules are premessenger ribonucleoprotein particles (RNPs) generated in giant chromosomal puffs, the BRs, in the larval salivary glands of the dipteran chironomus tentans. Monoclonal antibodies were raised against nuclear proteins collected on a single-stranded-DNA-agarose affinity column, and two of them were used to identify RNA-binding proteins in BR granules. First, in Western blots (immunoblots), one of the antibodies recognized a 36-kDa protein and the other recognized a 45-KDa protein. Second, both antibodies bound to the BRs in immunocytological experiments. It was shown in cross-linking experiments that the two proteins are associated with heterogeneous nuclear RNP (hnRNP) complexes extracted from C. tentans nuclei. By immunoelectron microscopy of isolated and partly unfolded BR RNPs, it was specifically demonstrated that the BR granules contain the two proteins and, in addition, that both proteins are distributed frequently along the RNP fiber of the particles. Thus, the 36- and 45-KDa proteins are likely to be abundant, RNA-binding proteins in the BR particles. To elucidate to what extent the two proteins are also present in other hnRNPs, we studied the binding of the antibodies to chromosomal puffs in general. It was observed that many puffs in addition to the BRs harbor the two proteins, but there are also puffs containing only one of the components, either the 36- or the 45-kDa protein. We conclude that the two proteins are not randomly bound to all hnRNPs but that each of them seems to be linked to a specific subset of the particles. PMID:8657116

  19. Ocean dynamic processes causing spatially heterogeneous distribution of sedimentary caesium-137 massively released from the Fukushima Dai-ichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Higashi, H.; Morino, Y.; Furuichi, N.; Ohara, T.

    2015-08-01

    Massive amounts of anthropogenic radiocaesium 137Cs that was released into the environment by the Fukushima Dai-ichi Nuclear Power Plant accident on March 2011 are widely known to have extensively migrated to Pacific oceanic sediment off of east Japan. Several recent reports have stated that the sedimentary 137Cs is now stable with a remarkably heterogeneous distribution. The present study elucidates ocean dynamic processes causing this heterogeneous sedimentary 137Cs distribution in and around the shelf off Fukushima and adjacent prefectures. We performed a numerical simulation of oceanic 137Cs behaviour for about 10 months after the accident, using a comprehensive dynamic model involving advection-diffusion transport in seawater, adsorption and desorption to and from particulate matter, sedimentation and suspension on and from the bottom, and vertical diffusion transport in the sediment. A notable simulated result was that the sedimentary 137Cs significantly accumulated in a swath just offshore of the shelf break (along the 50-100 m isobath) as in recent observations, although the seabed in the entire simulation domain was assumed to have ideal properties such as identical bulk density, uniform porosity, and aggregation of particles with a single grain diameter. This result indicated that the heterogeneous sedimentary 137Cs distribution was not necessarily a result of the spatial distribution of 137Cs sediment adsorptivity. The present simulation suggests that the shape of the swath is mainly associated with spatiotemporal variation between bottom shear stress in the shallow shelf (< 50 m depths) and that offshore of the shelf break. In a large part of the shallow shelf, the simulation indicated that strong bottom friction suspending particulate matter from the seabed frequently occurred via a periodic spring tide about every 2 weeks and via occasional strong wind. The sedimentary 137Cs thereby could hardly stay on the surface of the seabed with the result that

  20. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu

    2011-01-01

    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  1. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses.

    PubMed

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. PMID:26923071

  2. β-Cell deletion of Nr4a1 and Nr4a3 nuclear receptors impedes mitochondrial respiration and insulin secretion.

    PubMed

    Reynolds, Merrick S; Hancock, Chad R; Ray, Jason D; Kener, Kyle B; Draney, Carrie; Garland, Kevin; Hardman, Jeremy; Bikman, Benjamin T; Tessem, Jeffery S

    2016-07-01

    β-Cell insulin secretion is dependent on proper mitochondrial function. Various studies have clearly shown that the Nr4a family of orphan nuclear receptors is essential for fuel utilization and mitochondrial function in liver, muscle, and adipose. Previously, we have demonstrated that overexpression of Nr4a1 or Nr4a3 is sufficient to induce proliferation of pancreatic β-cells. In this study, we examined whether Nr4a expression impacts pancreatic β-cell mitochondrial function. Here, we show that β-cell mitochondrial respiration is dependent on the nuclear receptors Nr4a1 and Nr4a3. Mitochondrial respiration in permeabilized cells was significantly decreased in β-cells lacking Nr4a1 or Nr4a3. Furthermore, respiration rates of intact cells deficient for Nr4a1 or Nr4a3 in the presence of 16 mM glucose resulted in decreased glucose mediated oxygen consumption. Consistent with this reduction in respiration, a significant decrease in glucose-stimulated insulin secretion rates is observed with deletion of Nr4a1 or Nr4a3. Interestingly, the changes in respiration and insulin secretion occur without a reduction in mitochondrial content, suggesting decreased mitochondrial function. We establish that knockdown of Nr4a1 and Nr4a3 results in decreased expression of the mitochondrial dehydrogenase subunits Idh3g and Sdhb. We demonstrate that loss of Nr4a1 and Nr4a3 impedes production of ATP and ultimately inhibits glucose-stimulated insulin secretion. These data demonstrate for the first time that the orphan nuclear receptors Nr4a1 and Nr4a3 are critical for β-cell mitochondrial function and insulin secretion.

  3. β-Cell deletion of Nr4a1 and Nr4a3 nuclear receptors impedes mitochondrial respiration and insulin secretion.

    PubMed

    Reynolds, Merrick S; Hancock, Chad R; Ray, Jason D; Kener, Kyle B; Draney, Carrie; Garland, Kevin; Hardman, Jeremy; Bikman, Benjamin T; Tessem, Jeffery S

    2016-07-01

    β-Cell insulin secretion is dependent on proper mitochondrial function. Various studies have clearly shown that the Nr4a family of orphan nuclear receptors is essential for fuel utilization and mitochondrial function in liver, muscle, and adipose. Previously, we have demonstrated that overexpression of Nr4a1 or Nr4a3 is sufficient to induce proliferation of pancreatic β-cells. In this study, we examined whether Nr4a expression impacts pancreatic β-cell mitochondrial function. Here, we show that β-cell mitochondrial respiration is dependent on the nuclear receptors Nr4a1 and Nr4a3. Mitochondrial respiration in permeabilized cells was significantly decreased in β-cells lacking Nr4a1 or Nr4a3. Furthermore, respiration rates of intact cells deficient for Nr4a1 or Nr4a3 in the presence of 16 mM glucose resulted in decreased glucose mediated oxygen consumption. Consistent with this reduction in respiration, a significant decrease in glucose-stimulated insulin secretion rates is observed with deletion of Nr4a1 or Nr4a3. Interestingly, the changes in respiration and insulin secretion occur without a reduction in mitochondrial content, suggesting decreased mitochondrial function. We establish that knockdown of Nr4a1 and Nr4a3 results in decreased expression of the mitochondrial dehydrogenase subunits Idh3g and Sdhb. We demonstrate that loss of Nr4a1 and Nr4a3 impedes production of ATP and ultimately inhibits glucose-stimulated insulin secretion. These data demonstrate for the first time that the orphan nuclear receptors Nr4a1 and Nr4a3 are critical for β-cell mitochondrial function and insulin secretion. PMID:27221116

  4. Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a tissue biomarker for detection of early Hepatocellular carcinoma in patients with cirrhosis

    PubMed Central

    2012-01-01

    Background Hepatocellular carcinoma (HCC) is one of the most common malignant tumors occurring mainly in patients with chronic liver disease. Detection of early HCC is critically important for treatment of these patients. Methods We employed a proteomic profiling approach to identify potential biomarker for early HCC detection. Based on Barcelona Clinic Liver Cancer (BCLC) staging classification, 15 early HCC and 25 late HCC tissue samples from post-operative HCC patients and their clinicopathological data were used for the discovery of biomarkers specific for the detection of early HCC. Differential proteins among cirrhotic, early, and late tissue samples were separated by two-dimensional gel electrophoresis (2-DE) and subsequently identified by mass spectrometry (MS). Receiver operating characteristic (ROC) curves analysis were performed to find potential biomarkers associated with early HCC. Diagnosis performance of the biomarker was obtained from diagnosis test. Results Protein spot SSP2215 was found to be significantly overexpressed in HCC, particularly in early HCC, and identified as heterogeneous nuclear ribonucleoprotein K (hnRNP K) by tandem mass spectrometry (MALDI TOF/TOF). The overexpression in HCC was subsequently validated by western blot and immunohistochemistry. ROC curve analysis showed that hnRNP K intensity could detect early HCC at 66.67 % sensitivity and 84 % specificity, which was superior to serum α-fetoprotein (AFP) in detection of early HCC. Furthermore, the diagnosis test demonstrated, when combined with hnRNP K and serum AFP as biomarker panel to detect early HCC at different cut-off value, the sensitivity and specificity could be enhanced to 93.33 % and 96 %, respectively. Conclusions hnRNP K is a potential tissue biomarker, either alone or in combination with serum AFP, for detection of early HCC. High expression of hnRNP K could be helpful to discriminate early HCC from a nonmalignant nodule, especially for patients with liver

  5. Radiosensitization and downregulation of heterogeneous nuclear ribonucleoprotein K (hnRNP K) upon inhibition of mitogen/extracellular signal-regulated kinase (MEK) in malignant melanoma cells

    PubMed Central

    Eder, Stefan; Lamkowski, Andreas; Priller, Markus; Port, Matthias; Steinestel, Konrad

    2015-01-01

    Background Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is an important cofactor in the p53-mediated DNA damage response pathway upon ionizing radiation (IR) and exerts anti-apoptotic effects also independent of p53 pathway activation. Furthermore, hnRNP K is overexpressed in various neoplasms including malignant melanoma (MM). Here, we investigate the role of hnRNP K in the radioresistance of MM cells. Methods and results Our results show cytoplasmic expression of hnRNP K in human MM surgical specimens, but not in benign nevi, and a quick dose- and time-dependent upregulation in response to IR accompanied by cytoplasmic redistribution of the protein in the IPC-298 cellular tumor model carrying an activating NRAS mutation (p.Q61L). SiRNA-based knockdown of hnRNP K induced a delayed decline in γH2AX/53BP1-positive DNA repair foci upon IR. Pharmacological interference with MAPK signaling abrogated ERK phosphorylation, diminished cellular hnRNP K levels, impaired γH2AX/53BP1-foci repair and proliferative capability and increased apoptosis comparable to the observed hnRNP K knockdown phenotype in IPC-298 cells. Conclusion Our results indicate that pharmacological interference with MAPK signaling increases vulnerability of NRAS-mutant malignant melanoma cells to ionizing radiation along with downregulation of endogenous hnRNP K and point towards a possible use for combined MEK inhibition and localized radiation therapy of MM in the NRAS-mutant setting where BRAF inhibitors offer no clinical benefit. PMID:26136337

  6. Heterogeneous Catalysis.

    ERIC Educational Resources Information Center

    Miranda, R.

    1989-01-01

    Described is a heterogeneous catalysis course which has elements of materials processing embedded in the classical format of catalytic mechanisms and surface chemistry. A course outline and list of examples of recent review papers written by students are provided. (MVL)

  7. Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

    SciTech Connect

    Primorac, D.; Stover, M.L.; McKinstry, M.B.

    1994-09-01

    Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or the donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.

  8. Nkx6.1 regulates islet β-cell proliferation via Nr4a1 and Nr4a3 nuclear receptors.

    PubMed

    Tessem, Jeffery S; Moss, Larry G; Chao, Lily C; Arlotto, Michelle; Lu, Danhong; Jensen, Mette V; Stephens, Samuel B; Tontonoz, Peter; Hohmeier, Hans E; Newgard, Christopher B

    2014-04-01

    Loss of functional β-cell mass is a hallmark of type 1 and type 2 diabetes, and methods for restoring these cells are needed. We have previously reported that overexpression of the homeodomain transcription factor NK6 homeobox 1 (Nkx6.1) in rat pancreatic islets induces β-cell proliferation and enhances glucose-stimulated insulin secretion, but the pathway by which Nkx6.1 activates β-cell expansion has not been defined. Here, we demonstrate that Nkx6.1 induces expression of the nuclear receptor subfamily 4, group A, members 1 and 3 (Nr4a1 and Nr4a3) orphan nuclear receptors, and that these factors are both necessary and sufficient for Nkx6.1-mediated β-cell proliferation. Consistent with this finding, global knockout of Nr4a1 results in a decrease in β-cell area in neonatal and young mice. Overexpression of Nkx6.1 and the Nr4a receptors results in increased expression of key cell cycle inducers E2F transcription factor 1 and cyclin E1. Furthermore, Nkx6.1 and Nr4a receptors induce components of the anaphase-promoting complex, including ubiquitin-conjugating enzyme E2C, resulting in degradation of the cell cycle inhibitor p21. These studies identify a unique bipartite pathway for activation of β-cell proliferation, suggesting several unique targets for expansion of functional β-cell mass.

  9. Hydrogen Sulfide Up-Regulates the Expression of ATP-Binding Cassette Transporter A1 via Promoting Nuclear Translocation of PPARα

    PubMed Central

    Li, Dong; Xiong, Qinghui; Peng, Jin; Hu, Bin; Li, Wanzhen; Zhu, Yizhun; Shen, Xiaoyan

    2016-01-01

    ATP binding cassette transporter A1 (ABCA1) plays a key role in atherogenesis. Hydrogen sulfide (H2S), a gasotransmitter, has been reported to play an anti-atherosclerotic role. However, the underlying mechanisms are largely unknown. In this study we examined whether and how H2S regulates ABCA1 expression. The effect of H2S on ABCA1 expression and lipid metabolism were assessed in vitro by cultured human hepatoma cell line HepG2, and in vivo by ApoE−/− mice with a high-cholesterol diet. NaHS (an exogenous H2S donor) treatment significantly increased the expression of ABCA1, ApoA1, and ApoA2 and ameliorated intracellular lipid accumulation in HepG2 cells. Depletion of the endogenous H2S generator cystathionine γ-lyase (CSE) by small RNA interference (siRNA) significantly decreased the expression of ABCA1 and resulted in the accumulation of lipids in HepG2 cells. In vivo NaHS treatment significantly reduced the serum levels of total cholesterol (TC), triglycerides (TG), and low-density lipoproteins (LDL), diminished atherosclerotic plaque size, and increased hepatic ABCA1 expression in fat-fed ApoE−/− mice. Further study revealed that NaHS upregulated ABCA1 expression by promoting peroxisome proliferator-activated receptor α (PPARα) nuclear translocation. H2S up-regulates the expression of ABCA1 by promoting the nuclear translocation of PPARα, providing a fundamental mechanism for the anti-atherogenic activity of H2S. H2S may be a promising potential drug candidate for the treatment of atherosclerosis. PMID:27136542

  10. Hydrogen Sulfide Up-Regulates the Expression of ATP-Binding Cassette Transporter A1 via Promoting Nuclear Translocation of PPARα.

    PubMed

    Li, Dong; Xiong, Qinghui; Peng, Jin; Hu, Bin; Li, Wanzhen; Zhu, Yizhun; Shen, Xiaoyan

    2016-04-29

    ATP binding cassette transporter A1 (ABCA1) plays a key role in atherogenesis. Hydrogen sulfide (H₂S), a gasotransmitter, has been reported to play an anti-atherosclerotic role. However, the underlying mechanisms are largely unknown. In this study we examined whether and how H₂S regulates ABCA1 expression. The effect of H₂S on ABCA1 expression and lipid metabolism were assessed in vitro by cultured human hepatoma cell line HepG2, and in vivo by ApoE(-/-) mice with a high-cholesterol diet. NaHS (an exogenous H₂S donor) treatment significantly increased the expression of ABCA1, ApoA1, and ApoA2 and ameliorated intracellular lipid accumulation in HepG2 cells. Depletion of the endogenous H₂S generator cystathionine γ-lyase (CSE) by small RNA interference (siRNA) significantly decreased the expression of ABCA1 and resulted in the accumulation of lipids in HepG2 cells. In vivo NaHS treatment significantly reduced the serum levels of total cholesterol (TC), triglycerides (TG), and low-density lipoproteins (LDL), diminished atherosclerotic plaque size, and increased hepatic ABCA1 expression in fat-fed ApoE(-/-) mice. Further study revealed that NaHS upregulated ABCA1 expression by promoting peroxisome proliferator-activated receptor α (PPARα) nuclear translocation. H₂S up-regulates the expression of ABCA1 by promoting the nuclear translocation of PPARα, providing a fundamental mechanism for the anti-atherogenic activity of H₂S. H₂S may be a promising potential drug candidate for the treatment of atherosclerosis.

  11. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  12. Association of the 72/74-kDa proteins, members of the heterogeneous nuclear ribonucleoprotein M group, with the pre-mRNA at early stages of spliceosome assembly.

    PubMed Central

    Kafasla, Panayiota; Patrinou-Georgoula, Meropi; Lewis, Joe D; Guialis, Apostolia

    2002-01-01

    We have investigated the role played in precursor mRNA (pre-mRNA) splicing by the protein pair of molecular size 72/74 kDa, which are integral components of a discrete subset of heterogeneous nuclear (hn) ribonucleoproteins (RNPs) named large heterogeneous nuclear RNP (LH-nRNP). This 72/74 kDa pair of proteins has been shown to belong to the hnRNP M group, and are referred to as 72/74(M). By applying specific immunoprecipitation assays in a consecutive series of splicing reactions in vitro, the antigenic 72/74(M) protein species were found to associate with the pre-mRNA and not the intermediate or final products of splicing. Kinetic studies, combined with isolation of pre-spliceosomal and spliceosomal complexes from the splicing reaction, indicated a loose association of 72/74(M) with both the initially formed H assembly and the first splicing-committed E complex. Stable binding was seen at a later stage of the reaction, well in advance of the appearance of the first intermediate products of RNA splicing. Evidence is provided that supports the almost exclusive association of 72/74(M) with pre-mRNA within the pre-spliceosomal A complex. This dynamic binding appeared to involve pre-mRNA sites similar to those of spliceosomal U1 and U2 small nuclear RNP complexes. Moreover, a preferential binding to a truncated RNA containing the 5' exon-intron part, rather than the intron-3' exon part, of pre-mRNA was observed. PMID:11964181

  13. The influence of standardized Valeriana officinalis extract on the CYP3A1 gene expression by nuclear receptors in in vivo model.

    PubMed

    Bogacz, Anna; Mrozikiewicz, Przemyslaw M; Karasiewicz, Monika; Bartkowiak-Wieczorek, Joanna; Majchrzycki, Marian; Mikolajczak, Przemyslaw L; Ozarowski, Marcin; Grzeskowiak, Edmund

    2014-01-01

    Valeriana officinalis is one of the most popular medicinal plants commonly used as a sedative and sleep aid. It is suggested that its pharmacologically active compounds derived from the root may modulate the CYP3A4 gene expression by activation of pregnane X receptor (PXR) or constitutive androstane receptor (CAR) and lead to pharmacokinetic herb-drug interactions. The aim of the study was to determine the influence of valerian on the expression level of CYP3A1 (homologue to human CYP3A4) as well as nuclear receptors PXR, CAR, RXR, GR, and HNF-4α. Male Wistar rats were given standardized valerian extract (300 mg/kg/day, p.o.) for 3 and 10 days. The expression in liver tissue was analyzed by using real-time PCR. Our result showed a decrease of CYP3A1 expression level by 35% (P = 0.248) and 37% (P < 0.001), respectively. Moreover, Valeriana exhibited statistically significant reduction in RXR (approximately 28%) only after 3-day treatment. We also demonstrated a decrease in the amount HNF-4α by 22% (P = 0.005) and 32% (P = 0.012), respectively. In case of CAR, the increase of expression level by 46% (P = 0.023) was noted. These findings suggest that Valeriana officinalis extract can decrease the CYP3A4 expression and therefore may lead to interactions with synthetic drugs metabolized by this enzyme. PMID:25302309

  14. Age-Related Nuclear Translocation of P2X6 Subunit Modifies Splicing Activity Interacting with Splicing Factor 3A1

    PubMed Central

    Díaz-Hernández, Juan Ignacio; Sebastián-Serrano, Álvaro; Gómez-Villafuertes, Rosa

    2015-01-01

    P2X receptors are ligand-gated ion channels sensitive to extracellular nucleotides formed by the assembling of three equal or different P2X subunits. In this work we report, for the first time, the accumulation of the P2X6 subunit inside the nucleus of hippocampal neurons in an age-dependent way. This location is favored by its anchorage to endoplasmic reticulum through its N-terminal domain. The extracellular domain of P2X6 subunit is the key to reach the nucleus, where it presents a speckled distribution pattern and is retained by interaction with the nuclear envelope protein spectrin α2. The in vivo results showed that, once inside the nucleus, P2X6 subunit interacts with the splicing factor 3A1, which ultimately results in a reduction of the mRNA splicing activity. Our data provide new insights into post-transcriptional regulation of mRNA splicing, describing a novel mechanism that could explain why this process is sensitive to changes that occur with age. PMID:25874565

  15. Fractal heterogeneity in minimal matrix models of scars modulates stiff-niche stem-cell responses via nuclear exit of a mechanorepressor

    NASA Astrophysics Data System (ADS)

    Dingal, P. C. Dave P.; Bradshaw, Andrew M.; Cho, Sangkyun; Raab, Matthew; Buxboim, Amnon; Swift, Joe; Discher, Dennis E.

    2015-09-01

    Scarring is a long-lasting problem in higher animals, and reductionist approaches could aid in developing treatments. Here, we show that copolymerization of collagen I with polyacrylamide produces minimal matrix models of scars (MMMS), in which fractal-fibre bundles segregate heterogeneously to the hydrogel subsurface. Matrix stiffens locally--as in scars--while allowing separate control over adhesive-ligand density. The MMMS elicits scar-like phenotypes from mesenchymal stem cells (MSCs): cells spread and polarize quickly, increasing nucleoskeletal lamin-A yet expressing the `scar marker' smooth muscle actin (SMA) more slowly. Surprisingly, expression responses to MMMS exhibit less cell-to-cell noise than homogeneously stiff gels. Such differences from bulk-average responses arise because a strong SMA repressor, NKX2.5, slowly exits the nucleus on rigid matrices. NKX2.5 overexpression overrides rigid phenotypes, inhibiting SMA and cell spreading, whereas cytoplasm-localized NKX2.5 mutants degrade in well-spread cells. MSCs thus form a `mechanical memory' of rigidity by progressively suppressing NKX2.5, thereby elevating SMA in a scar-like state.

  16. Fractal heterogeneity in minimal matrix models of scars modulates stiff-niche stem-cell responses via the nuclear exit of a mechanorepressor

    PubMed Central

    P. Dingal, P. C. Dave; Bradshaw, Andrew M.; Cho, Sangkyun; Raab, Matthew; Buxboim, Amnon; Swift, Joe; Discher, Dennis E.

    2015-01-01

    Scarring is a long-lasting problem in higher animals, and reductionist approaches could aid in developing treatments. Here, we show that co-polymerization of collagen-I with polyacrylamide produces minimal matrix models of scars (MMMS), in which fractal-fiber bundles segregate heterogeneously to the hydrogel subsurface. Matrix stiffens locally – as in scars – while allowing separate control over adhesive-ligand density. The MMMS elicits scar-like phenotypes from mesenchymal stem cells (MSCs): cells spread and polarize quickly, increasing nucleoskeletal lamin-A yet expressing the ‘scar marker’, smooth muscle actin (SMA) more slowly. Surprisingly, expression responses to MMMS exhibit less cell-to-cell noise than homogeneously stiff gels. Such differences from bulk-average responses arise because a strong SMA repressor, NKX2.5, slowly exits the nucleus on rigid matrices. NKX2.5 overexpression overrides rigid phenotypes, inhibiting SMA and cell spreading, while cytoplasm-localized NKX2.5 mutants degrade in well-spread cells. MSCs thus form a ‘mechanical memory’ of rigidity by progressively suppressing NKX2.5, thereby elevating SMA in a scar-like state. PMID:26168347

  17. Greater-than-Class C low-level radioactive waste characterization. Appendix A-1: Nuclear utility data outputs from the GNUPS database

    SciTech Connect

    1994-09-01

    The Greater-Than-Class C Nuclear Utility Projections System (GNUPS) was developed as a database for the GTCC LLW Program to estimate future volumes and radionuclide activities of nuclear utility GTCC LLW. Detailed printouts from the GNUPS database are presented in this appendix. The GNUPS projects nuclear utility volumes and activities for three cases: low, base, and high. In addition, the projections can be adjusted to account for the effects of packaging, concentration averaging, and plant operating lifetime. A brief description of how the GNUPS performs calculations of volumes and activities is given.

  18. Heterogeneous Nuclear Ribonucleoprotein (HnRNP) K Genome-wide Binding Survey Reveals Its Role in Regulating 3′-End RNA Processing and Transcription Termination at the Early Growth Response 1 (EGR1) Gene through XRN2 Exonuclease*

    PubMed Central

    Mikula, Michal; Bomsztyk, Karol; Goryca, Krzysztof; Chojnowski, Krzysztof; Ostrowski, Jerzy

    2013-01-01

    The heterogeneous nuclear ribonucleoprotein K (hnRNPK) is a nucleic acid-binding protein that acts as a docking platform integrating signal transduction pathways to nucleic acid-related processes. Given that hnRNPK could be involved in other steps that compose gene expression the definition of its genome-wide occupancy is important to better understand its role in transcription and co-transcriptional processes. Here, we used chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) to analyze the genome-wide hnRNPK-DNA interaction in colon cancer cell line HCT116. 9.1/3.6 and 7.0/3.4 million tags were sequenced/mapped, then 1809 and 642 hnRNPK binding sites were detected in quiescent and 30-min serum-stimulated cells, respectively. The inspection of sequencing tracks revealed inducible hnRNPK recruitment along a number of immediate early gene loci, including EGR1 and ZFP36, with the highest densities present at the transcription termination sites. Strikingly, hnRNPK knockdown with siRNA resulted in increased pre-RNA levels transcribed downstream of the EGR1 polyadenylation (A) site suggesting altered 3′-end pre-RNA degradation. Further ChIP survey of hnRNPK knockdown uncovered decreased recruitment of the 5′-3′ exonuclease XRN2 along EGR1 and downstream of the poly(A) signal without altering RNA polymerase II density at these sites. Immunoprecipitation of hnRNPK and XRN2 from intact and RNase A-treated nuclear extracts followed by shotgun mass spectrometry revealed the presence of hnRNPK and XRN2 in the same complexes along with other spliceosome-related proteins. Our data suggest that hnRNPK may play a role in recruitment of XRN2 to gene loci thus regulating coupling 3′-end pre-mRNA processing to transcription termination. PMID:23857582

  19. NUCLEAR REACTOR CONTROL SYSTEM

    DOEpatents

    Epler, E.P.; Hanauer, S.H.; Oakes, L.C.

    1959-11-01

    A control system is described for a nuclear reactor using enriched uranium fuel of the type of the swimming pool and other heterogeneous nuclear reactors. Circuits are included for automatically removing and inserting the control rods during the course of normal operation. Appropriate safety circuits close down the nuclear reactor in the event of emergency.

  20. The orphan nuclear receptor Nr4a1 couples sympathetic and inflammatory cues in CNS-recruited macrophages to limit neuroinflammation

    PubMed Central

    Shaked, Iftach; Hanna, Richard N.; Shaked, Helena; Chodaczek, Grzegorz; Nowyhed, Heba N.; Tweet, George; Tacke, Robert; Basat, Alp Bugra; Mikulski, Zbigniew; Togher, Susan; Miller, Jacqueline; Blatchley, Amy; Salek-Ardakani, Shahram; Darvas, Martin; Kaikkonen, Minna U.; Thomas, Graham; Lai-Wing-Sun, Sonia; Rezk, Ayman; Bar-Or, Amit; Glass, Christopher K.; Bandukwala, Hozefa; Hedrick, Catherine C.

    2016-01-01

    Molecular mechanisms linking the sympathetic stress response and inflammation remain enigmatic. Here we demonstrate that the transcription factor Nr4a1 regulates production of norepinephrine (NE) in macrophages, thereby limiting experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis. Lack of Nr4a1 in myeloid cells led to enhanced NE production, accelerated leukocyte infiltration to the central nervous system (CNS) and disease exacerbation in vivo. In contrast, myeloid-specific deletion of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, protected against EAE. Further, we found that Nr4a1 repressed autocrine NE production in macrophages by recruiting the corepressor CoREST to the Th promoter. Our data reveal a new role for macrophages in neuroinflammation and identify Nr4a1 as a key regulator of macrophage catecholamine production. PMID:26523867

  1. Single cell heterogeneity

    PubMed Central

    Abdallah, Batoul Y; Horne, Steven D; Stevens, Joshua B; Liu, Guo; Ying, Andrew Y; Vanderhyden, Barbara; Krawetz, Stephen A; Gorelick, Root; Heng, Henry HQ

    2013-01-01

    Multi-level heterogeneity is a fundamental but underappreciated feature of cancer. Most technical and analytical methods either completely ignore heterogeneity or do not fully account for it, as heterogeneity has been considered noise that needs to be eliminated. We have used single-cell and population-based assays to describe an instability-mediated mechanism where genome heterogeneity drastically affects cell growth and cannot be accurately measured using conventional averages. First, we show that most unstable cancer cell populations exhibit high levels of karyotype heterogeneity, where it is difficult, if not impossible, to karyotypically clone cells. Second, by comparing stable and unstable cell populations, we show that instability-mediated karyotype heterogeneity leads to growth heterogeneity, where outliers dominantly contribute to population growth and exhibit shorter cell cycles. Predictability of population growth is more difficult for heterogeneous cell populations than for homogenous cell populations. Since “outliers” play an important role in cancer evolution, where genome instability is the key feature, averaging methods used to characterize cell populations are misleading. Variances quantify heterogeneity; means (averages) smooth heterogeneity, invariably hiding it. Cell populations of pathological conditions with high genome instability, like cancer, behave differently than karyotypically homogeneous cell populations. Single-cell analysis is thus needed when cells are not genomically identical. Despite increased attention given to single-cell variation mediated heterogeneity of cancer cells, continued use of average-based methods is not only inaccurate but deceptive, as the “average” cancer cell clearly does not exist. Genome-level heterogeneity also may explain population heterogeneity, drug resistance, and cancer evolution. PMID:24091732

  2. Beta-hairpin formation in aqueous solution and in the presence of trifluoroethanol: a (1)H and (13)C nuclear magnetic resonance conformational study of designed peptides.

    PubMed

    Santiveri, Clara M; Pantoja-Uceda, David; Rico, Manuel; Jiménez, M Angeles

    2005-10-15

    In order to check our current knowledge on the principles involved in beta-hairpin formation, we have modified the sequence of a 3:5 beta-hairpin forming peptide with two different purposes, first to increase the stability of the formed 3:5 beta-hairpin, and second to convert the 3:5 beta-hairpin into a 2:2 beta-hairpin. The conformational behavior of the designed peptides was investigated in aqueous solution and in 30% trifluoroethanol (TFE) by analysis of the following nuclear magnetic resonance (NMR) parameters: nuclear Overhauser effect (NOE) data, and C(alpha)H, (13)C(alpha), and (13)C(beta) conformational shifts. From the differences in the ability to adopt beta-hairpin structures in these peptides, we have arrived to the following conclusions: (i) beta-Hairpin population increases with the statistical propensity of residues to occupy each turn position. (ii) The loop length, and in turn, the beta-hairpin type, can be modified as a function of the type of turn favored by the loop sequence. These two conclusions reinforce previous results about the importance of beta-turn sequence in beta-hairpin folding. (iii) Side-chain packing on each face of the beta-sheet may play a major role in beta-hairpin stability; hence simplified analysis in terms of isolated pair interactions and intrinsic beta-sheet propensities is insufficient. (iv) Contributions to beta-hairpin stability of turn and strand sequences are not completely independent. (v) The burial of hydrophobic surface upon beta-hairpin formation that, in turn, depends on side-chain packing also contributes to beta-hairpin stability. (vi) As previously observed, TFE stabilizes beta-hairpin structures, but the extent of the contribution of different factors to beta-hairpin formation is sometimes different in aqueous solution and in 30% TFE.

  3. Phenotypically heterogeneous populations in spatially heterogeneous environments

    NASA Astrophysics Data System (ADS)

    Patra, Pintu; Klumpp, Stefan

    2014-03-01

    The spatial expansion of a population in a nonuniform environment may benefit from phenotypic heterogeneity with interconverting subpopulations using different survival strategies. We analyze the crossing of an antibiotic-containing environment by a bacterial population consisting of rapidly growing normal cells and slow-growing, but antibiotic-tolerant persister cells. The dynamics of crossing is characterized by mean first arrival times and is found to be surprisingly complex. It displays three distinct regimes with different scaling behavior that can be understood based on an analytical approximation. Our results suggest that a phenotypically heterogeneous population has a fitness advantage in nonuniform environments and can spread more rapidly than a homogeneous population.

  4. Patterns of Emphysema Heterogeneity

    PubMed Central

    Valipour, Arschang; Shah, Pallav L.; Gesierich, Wolfgang; Eberhardt, Ralf; Snell, Greg; Strange, Charlie; Barry, Robert; Gupta, Avina; Henne, Erik; Bandyopadhyay, Sourish; Raffy, Philippe; Yin, Youbing; Tschirren, Juerg; Herth, Felix J.F.

    2016-01-01

    Background Although lobar patterns of emphysema heterogeneity are indicative of optimal target sites for lung volume reduction (LVR) strategies, the presence of segmental, or sublobar, heterogeneity is often underappreciated. Objective The aim of this study was to understand lobar and segmental patterns of emphysema heterogeneity, which may more precisely indicate optimal target sites for LVR procedures. Methods Patterns of emphysema heterogeneity were evaluated in a representative cohort of 150 severe (GOLD stage III/IV) chronic obstructive pulmonary disease (COPD) patients from the COPDGene study. High-resolution computerized tomography analysis software was used to measure tissue destruction throughout the lungs to compute heterogeneity (≥ 15% difference in tissue destruction) between (inter-) and within (intra-) lobes for each patient. Emphysema tissue destruction was characterized segmentally to define patterns of heterogeneity. Results Segmental tissue destruction revealed interlobar heterogeneity in the left lung (57%) and right lung (52%). Intralobar heterogeneity was observed in at least one lobe of all patients. No patient presented true homogeneity at a segmental level. There was true homogeneity across both lungs in 3% of the cohort when defining heterogeneity as ≥ 30% difference in tissue destruction. Conclusion Many LVR technologies for treatment of emphysema have focused on interlobar heterogeneity and target an entire lobe per procedure. Our observations suggest that a high proportion of patients with emphysema are affected by interlobar as well as intralobar heterogeneity. These findings prompt the need for a segmental approach to LVR in the majority of patients to treat only the most diseased segments and preserve healthier ones. PMID:26430783

  5. Tumour Cell Heterogeneity

    PubMed Central

    Gay, Laura; Baker, Ann-Marie; Graham, Trevor A.

    2016-01-01

    The population of cells that make up a cancer are manifestly heterogeneous at the genetic, epigenetic, and phenotypic levels. In this mini-review, we summarise the extent of intra-tumour heterogeneity (ITH) across human malignancies, review the mechanisms that are responsible for generating and maintaining ITH, and discuss the ramifications and opportunities that ITH presents for cancer prognostication and treatment. PMID:26973786

  6. hnRNP A1: the Swiss army knife of gene expression.

    PubMed

    Jean-Philippe, Jacques; Paz, Sean; Caputi, Massimo

    2013-09-16

    Eukaryotic cells express a large variety of RNA binding proteins (RBPs), with diverse affinities and specificities towards target RNAs. These proteins play a crucial role in almost every aspect of RNA biogenesis, expression and function. The heterogeneous nuclear ribonucleoproteins (hnRNPs) are a complex and diverse family of RNA binding proteins. hnRNPs display multiple functions in the processing of heterogeneous nuclear RNAs into mature messenger RNAs. hnRNP A1 is one of the most abundant and ubiquitously expressed members of this protein family. hnRNP A1 plays multiple roles in gene expression by regulating major steps in the processing of nascent RNA transcripts. The transcription, splicing, stability, export through nuclear pores and translation of cellular and viral transcripts are all mechanisms modulated by this protein. The diverse functions played by hnRNP A1 are not limited to mRNA biogenesis, but extend to the processing of microRNAs, telomere maintenance and the regulation of transcription factor activity. Genomic approaches have recently uncovered the extent of hnRNP A1 roles in the development and differentiation of living organisms. The aim of this review is to highlight recent developments in the study of this protein and to describe its functions in cellular and viral gene expression and its role in human pathologies.

  7. hnRNP A1: the Swiss army knife of gene expression.

    PubMed

    Jean-Philippe, Jacques; Paz, Sean; Caputi, Massimo

    2013-01-01

    Eukaryotic cells express a large variety of RNA binding proteins (RBPs), with diverse affinities and specificities towards target RNAs. These proteins play a crucial role in almost every aspect of RNA biogenesis, expression and function. The heterogeneous nuclear ribonucleoproteins (hnRNPs) are a complex and diverse family of RNA binding proteins. hnRNPs display multiple functions in the processing of heterogeneous nuclear RNAs into mature messenger RNAs. hnRNP A1 is one of the most abundant and ubiquitously expressed members of this protein family. hnRNP A1 plays multiple roles in gene expression by regulating major steps in the processing of nascent RNA transcripts. The transcription, splicing, stability, export through nuclear pores and translation of cellular and viral transcripts are all mechanisms modulated by this protein. The diverse functions played by hnRNP A1 are not limited to mRNA biogenesis, but extend to the processing of microRNAs, telomere maintenance and the regulation of transcription factor activity. Genomic approaches have recently uncovered the extent of hnRNP A1 roles in the development and differentiation of living organisms. The aim of this review is to highlight recent developments in the study of this protein and to describe its functions in cellular and viral gene expression and its role in human pathologies. PMID:24065100

  8. Heterogeneous atmospheric chemistry

    NASA Technical Reports Server (NTRS)

    Schryer, D. R.

    1982-01-01

    The present conference on heterogeneous atmospheric chemistry considers such topics concerning clusters, particles and microparticles as common problems in nucleation and growth, chemical kinetics, and catalysis, chemical reactions with aerosols, electron beam studies of natural and anthropogenic microparticles, and structural studies employing molecular beam techniques, as well as such gas-solid interaction topics as photoassisted reactions, catalyzed photolysis, and heterogeneous catalysis. Also discussed are sulfur dioxide absorption, oxidation, and oxidation inhibition in falling drops, sulfur dioxide/water equilibria, the evidence for heterogeneous catalysis in the atmosphere, the importance of heterogeneous processes to tropospheric chemistry, soot-catalyzed atmospheric reactions, and the concentrations and mechanisms of formation of sulfate in the atmospheric boundary layer.

  9. Teaching Heterogeneous Classes.

    ERIC Educational Resources Information Center

    Millrood, Radislav

    2002-01-01

    Discusses an approach to teaching heterogeneous English-as-a-Second/Foreign-Language classes. Draws on classroom research data to describe the features of a success-building lesson context. (Author/VWL)

  10. Characterization of Paper Heterogeneity

    NASA Astrophysics Data System (ADS)

    Considine, John M.

    Paper and paperboard are the most widely-used green materials in the world because they are renewable, recyclable, reusable, and compostable. Continued and expanded use of these materials and their potential use in new products requires a comprehensive understanding of the variability of their mechanical properties. This work develops new methods to characterize the mechanical properties of heterogeneous materials through a combination of techniques in experimental mechanics, materials science and numerical analysis. Current methods to analyze heterogeneous materials focus on crystalline materials or polymer-crystalline composites, where material boundaries are usually distinct. This work creates a methodology to analyze small, continuously-varying stiffness gradients in 100% polymer systems and is especially relevant to paper materials where factors influencing heterogeneity include local mass, fiber orientation, individual pulp fiber properties, local density, and drying restraint. A unique approach was used to understand the effect of heterogeneity on paper tensile strength. Additional variation was intentionally introduced, in the form of different size holes, and their effect on strength was measured. By modifying two strength criteria, an estimate of strength in the absence of heterogeneity was determined. In order to characterize stiffness heterogeneity, a novel load fixture was developed to excite full-field normal and shear strains for anisotropic stiffness determination. Surface strains were measured with digital image correlation and were analyzed with the VFM (Virtual Fields Method). This approach led to VFM-identified stiffnesses that were similar to values determined by conventional tests. The load fixture and VFM analyses were used to measure local stiffness and local stiffness variation on heterogeneous anisotropic materials. The approach was validated on simulated heterogeneous materials and was applied experimentally to three different paperboards

  11. Managing Power Heterogeneity

    NASA Astrophysics Data System (ADS)

    Pruhs, Kirk

    A particularly important emergent technology is heterogeneous processors (or cores), which many computer architects believe will be the dominant architectural design in the future. The main advantage of a heterogeneous architecture, relative to an architecture of identical processors, is that it allows for the inclusion of processors whose design is specialized for particular types of jobs, and for jobs to be assigned to a processor best suited for that job. Most notably, it is envisioned that these heterogeneous architectures will consist of a small number of high-power high-performance processors for critical jobs, and a larger number of lower-power lower-performance processors for less critical jobs. Naturally, the lower-power processors would be more energy efficient in terms of the computation performed per unit of energy expended, and would generate less heat per unit of computation. For a given area and power budget, heterogeneous designs can give significantly better performance for standard workloads. Moreover, even processors that were designed to be homogeneous, are increasingly likely to be heterogeneous at run time: the dominant underlying cause is the increasing variability in the fabrication process as the feature size is scaled down (although run time faults will also play a role). Since manufacturing yields would be unacceptably low if every processor/core was required to be perfect, and since there would be significant performance loss from derating the entire chip to the functioning of the least functional processor (which is what would be required in order to attain processor homogeneity), some processor heterogeneity seems inevitable in chips with many processors/cores.

  12. Heterogeneous waste processing

    DOEpatents

    Vanderberg, Laura A.; Sauer, Nancy N.; Brainard, James R.; Foreman, Trudi M.; Hanners, John L.

    2000-01-01

    A combination of treatment methods are provided for treatment of heterogeneous waste including: (1) treatment for any organic compounds present; (2) removal of metals from the waste; and, (3) bulk volume reduction, with at least two of the three treatment methods employed and all three treatment methods emplyed where suitable.

  13. Scales of mantle heterogeneity

    NASA Astrophysics Data System (ADS)

    Moore, J. C.; Akber-Knutson, S.; Konter, J.; Kellogg, J.; Hart, S.; Kellogg, L. H.; Romanowicz, B.

    2004-12-01

    A long-standing question in mantle dynamics concerns the scale of heterogeneity in the mantle. Mantle convection tends to both destroy (through stirring) and create (through melt extraction and subduction) heterogeneity in bulk and trace element composition. Over time, these competing processes create variations in geochemical composition along mid-oceanic ridges and among oceanic islands, spanning a range of scales from extremely long wavelength (for example, the DUPAL anomaly) to very small scale (for example, variations amongst melt inclusions). While geochemical data and seismic observations can be used to constrain the length scales of mantle heterogeneity, dynamical mixing calculations can illustrate the processes and timescales involved in stirring and mixing. At the Summer 2004 CIDER workshop on Relating Geochemical and Seismological Heterogeneity in the Earth's Mantle, an interdisciplinary group evaluated scales of heterogeneity in the Earth's mantle using a combined analysis of geochemical data, seismological data and results of numerical models of mixing. We mined the PetDB database for isotopic data from glass and whole rock analyses for the Mid-Atlantic Ridge (MAR) and the East Pacific Rise (EPR), projecting them along the ridge length. We examined Sr isotope variability along the East Pacific rise by looking at the difference in Sr ratio between adjacent samples as a function of distance between the samples. The East Pacific Rise exhibits an overall bowl shape of normal MORB characteristics, with higher values in the higher latitudes (there is, however, an unfortunate gap in sampling, roughly 2000 km long). These background characteristics are punctuated with spikes in values at various locations, some, but not all of which are associated with off-axis volcanism. A Lomb-Scargle periodogram for unevenly spaced data was utilized to construct a power spectrum of the scale lengths of heterogeneity along both ridges. Using the same isotopic systems (Sr, Nd

  14. Heterogeneous voter models

    NASA Astrophysics Data System (ADS)

    Masuda, Naoki; Gibert, N.; Redner, S.

    2010-07-01

    We introduce the heterogeneous voter model (HVM), in which each agent has its own intrinsic rate to change state, reflective of the heterogeneity of real people, and the partisan voter model (PVM), in which each agent has an innate and fixed preference for one of two possible opinion states. For the HVM, the time until consensus is reached is much longer than in the classic voter model. For the PVM in the mean-field limit, a population evolves to a preference-based state, where each agent tends to be aligned with its internal preference. For finite populations, discrete fluctuations ultimately lead to consensus being reached in a time that scales exponentially with population size.

  15. Atmospheric Heterogeneous Stereochemistry

    NASA Astrophysics Data System (ADS)

    Stokes, G. Y.; Buchbinder, A. M.; Geiger, F. M.

    2009-12-01

    This paper addresses the timescale and mechanism of heterogeneous interactions of laboratory models of organic-coated mineral dust and ozone. We are particularly interested in investigating the role of stereochemistry in heterogeneous oxidation reactions involving chiral biogenic VOCs. Using the surface-specific nonlinear optical spectroscopy, sum frequency generation, we tracked terpene diastereomers during exposure to 10^11 to 10^13 molecules of ozone per cm^3 in 1 atm helium to model ozone-limited and ozone-rich tropospheric conditions. Our kinetic data indicate that the diastereomers which orient their reactive C=C double bonds towards the gas phase exhibit heterogeneous ozonolysis rate constants that are two times faster than diastereomers that orient their C=C double bonds away from the gas phase. Insofar as our laboratory model studies are representative of real world environments, our studies suggest that the propensity of aerosol particles coated with chiral semivolatile organic compounds to react with ozone may depend on stereochemistry. Implications of these results for chiral markers that would allow for source appointment of anthropogenic versus biogenic carbon emissions will be discussed.

  16. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  17. Intratumor Heterogeneity in Breast Cancer.

    PubMed

    Beca, Francisco; Polyak, Kornelia

    2016-01-01

    Intratumor heterogeneity is the main obstacle to effective cancer treatment and personalized medicine. Both genetic and epigenetic sources of intratumor heterogeneity are well recognized and several technologies have been developed for their characterization. With the technological advances in recent years, investigators are now elucidating intratumor heterogeneity at the single cell level and in situ. However, translating the accumulated knowledge about intratumor heterogeneity to clinical practice has been slow. We are certain that better understanding of the composition and evolution of tumors during disease progression and treatment will improve cancer diagnosis and the design of therapies. Here we review some of the most important considerations related to intratumor heterogeneity. We discuss both genetic and epigenetic sources of intratumor heterogeneity and review experimental approaches that are commonly used to quantify it. We also discuss the impact of intratumor heterogeneity on cancer diagnosis and treatment and share our perspectives on the future of this field. PMID:26987535

  18. Unravelling mononuclear phagocyte heterogeneity

    PubMed Central

    Geissmann, Frédéric; Gordon, Siamon; Hume, David A.; Mowat, Allan M.; Randolph, Gwendalyn J.

    2011-01-01

    When Ralph Steinman and Zanvil Cohn first described dendritic cells (DCs) in 1973 it took many years to convince the immunology community that these cells were truly distinct from macrophages. Almost four decades later, the DC is regarded as the key initiator of adaptive immune responses; however, distinguishing DCs from macrophages still leads to confusion and debate in the field. Here, Nature Reviews Immunology asks five experts to discuss the issue of heterogeneity in the mononuclear phagocyte system and to give their opinion on the importance of defining these cells for future research. PMID:20467425

  19. Heterogeneous broadband network

    NASA Astrophysics Data System (ADS)

    Dittmann, Lars

    1995-11-01

    Although the vision for the future Integrated Broadband Communication Network (IBCN) is an all optical network, it is certain that for a long period to come, the network will remain very heterogeneous, with a mixture of different physical media (fiber, coax and twisted pair), transmission systems (PDH, SDH, ADSL) and transport protocols (TCP/IP, AAL/ATM, frame relay). In the current work towards the IBCN, the ATM concept is considered the generic network protocol for both public and private network, with the ability to use different underlying transmission protocols and, through adaptation protocols, provide the appropriate services (old as well as new) to the customer. One of the major difficulties of heterogeneous network is the restriction that is usually given by the lowest common denominator, e.g. in terms of single channel capacity. A possible way to overcome these limitations is by extending the ATM concept with a multilink capability, that allows us to use separate resources as one common. The improved flexibility obtained by this protocol extension further allows a real time optimization of network and call configuration, without any impact on the quality of service seen from the user. This paper describes an example of an ATM based multilink protocol that has been experimentally implemented within the RACE project 'STRATOSPHERIC'. The paper outlines the complexity of introducing an extra network functionality compared with the added value, such as an improved ability to recover an error due to a malfunctioning network component.

  20. Large epidemic thresholds emerge in heterogeneous networks of heterogeneous nodes

    NASA Astrophysics Data System (ADS)

    Yang, Hui; Tang, Ming; Gross, Thilo

    2015-08-01

    One of the famous results of network science states that networks with heterogeneous connectivity are more susceptible to epidemic spreading than their more homogeneous counterparts. In particular, in networks of identical nodes it has been shown that network heterogeneity, i.e. a broad degree distribution, can lower the epidemic threshold at which epidemics can invade the system. Network heterogeneity can thus allow diseases with lower transmission probabilities to persist and spread. However, it has been pointed out that networks in which the properties of nodes are intrinsically heterogeneous can be very resilient to disease spreading. Heterogeneity in structure can enhance or diminish the resilience of networks with heterogeneous nodes, depending on the correlations between the topological and intrinsic properties. Here, we consider a plausible scenario where people have intrinsic differences in susceptibility and adapt their social network structure to the presence of the disease. We show that the resilience of networks with heterogeneous connectivity can surpass those of networks with homogeneous connectivity. For epidemiology, this implies that network heterogeneity should not be studied in isolation, it is instead the heterogeneity of infection risk that determines the likelihood of outbreaks.

  1. {sup 48}Ca HETEROGENEITY IN DIFFERENTIATED METEORITES

    SciTech Connect

    Chen, Hsin-Wei; Lee, Typhoon; Lee, Der-Chuen; Shen, Jason Jiun-San; Chen, Jiang-Chang

    2011-12-10

    Isotopic heterogeneities of {sup 48}Ca have been found in numerous bulk meteorites that are correlated with {sup 50}Ti and {sup 54}Cr anomalies among differentiated planetary bodies, and the results suggest that a rare subset of neutron-rich Type Ia supernova (nSN Ia) was responsible for contributing these neutron-rich iron-group isotopes into the solar system (SS). The heterogeneity of these isotopes found in differentiated meteorites indicates that the isotopic compositions of the bulk SS are not uniform, and there are significant amounts of nSNe Ia dust incompletely mixed with the rest of SS materials during planetary formation. Combined with the data of now-extinct short-lived nuclide {sup 60}Fe, which can be produced more efficiently from an nSN Ia than a Type II supernova ejecta, the observed planetary-scale isotopic heterogeneity probably reflects a late input of stellar dust grains with neutron-rich nuclear statistical equilibrium nuclides into the early SS.

  2. Disordered hyperuniform heterogeneous materials

    NASA Astrophysics Data System (ADS)

    Torquato, Salvatore

    2016-10-01

    Disordered hyperuniform many-body systems are distinguishable states of matter that lie between a crystal and liquid: they are like perfect crystals in the way they suppress large-scale density fluctuations and yet are like liquids or glasses in that they are statistically isotropic with no Bragg peaks. These systems play a vital role in a number of fundamental and applied problems: glass formation, jamming, rigidity, photonic and electronic band structure, localization of waves and excitations, self-organization, fluid dynamics, quantum systems, and pure mathematics. Much of what we know theoretically about disordered hyperuniform states of matter involves many-particle systems. In this paper, we derive new rigorous criteria that disordered hyperuniform two-phase heterogeneous materials must obey and explore their consequences. Two-phase heterogeneous media are ubiquitous; examples include composites and porous media, biological media, foams, polymer blends, granular media, cellular solids, and colloids. We begin by obtaining some results that apply to hyperuniform two-phase media in which one phase is a sphere packing in d-dimensional Euclidean space {{{R}}d} . Among other results, we rigorously establish the requirements for packings of spheres of different sizes to be ‘multihyperuniform’. We then consider hyperuniformity for general two-phase media in {{{R}}d} . Here we apply realizability conditions for an autocovariance function and its associated spectral density of a two-phase medium, and then incorporate hyperuniformity as a constraint in order to derive new conditions. We show that some functional forms can immediately be eliminated from consideration and identify other forms that are allowable. Specific examples and counterexamples are described. Contact is made with well-known microstructural models (e.g. overlapping spheres and checkerboards) as well as irregular phase-separation and Turing-type patterns. We also ascertain a family of

  3. Disordered hyperuniform heterogeneous materials.

    PubMed

    Torquato, Salvatore

    2016-10-19

    Disordered hyperuniform many-body systems are distinguishable states of matter that lie between a crystal and liquid: they are like perfect crystals in the way they suppress large-scale density fluctuations and yet are like liquids or glasses in that they are statistically isotropic with no Bragg peaks. These systems play a vital role in a number of fundamental and applied problems: glass formation, jamming, rigidity, photonic and electronic band structure, localization of waves and excitations, self-organization, fluid dynamics, quantum systems, and pure mathematics. Much of what we know theoretically about disordered hyperuniform states of matter involves many-particle systems. In this paper, we derive new rigorous criteria that disordered hyperuniform two-phase heterogeneous materials must obey and explore their consequences. Two-phase heterogeneous media are ubiquitous; examples include composites and porous media, biological media, foams, polymer blends, granular media, cellular solids, and colloids. We begin by obtaining some results that apply to hyperuniform two-phase media in which one phase is a sphere packing in d-dimensional Euclidean space [Formula: see text]. Among other results, we rigorously establish the requirements for packings of spheres of different sizes to be 'multihyperuniform'. We then consider hyperuniformity for general two-phase media in [Formula: see text]. Here we apply realizability conditions for an autocovariance function and its associated spectral density of a two-phase medium, and then incorporate hyperuniformity as a constraint in order to derive new conditions. We show that some functional forms can immediately be eliminated from consideration and identify other forms that are allowable. Specific examples and counterexamples are described. Contact is made with well-known microstructural models (e.g. overlapping spheres and checkerboards) as well as irregular phase-separation and Turing-type patterns. We also ascertain a family

  4. Heterogeneity in Waardenburg syndrome.

    PubMed Central

    Hageman, M J; Delleman, J W

    1977-01-01

    Heterogeneity of Waardenburg syndrome is demonstrated in a review of 1,285 patients from the literature and 34 previously unreported patients in five families in the Netherlands. The syndrome seems to consist of two genetically distinct entities that can be differentiated clinically: type I, Waardenburg syndrome with dystopia canthorum; and type II, Waardenburg syndrome without dystopia canthorum. Both types have an autosomal dominant mode of inheritance. The incidence of bilateral deafness in the two types of the syndrome was found in one-fourth with type I and about half of the patients with type II. This difference has important consequences for genetic counseling. Images Fig. 7 Fig. 8 Fig. 9 PMID:331943

  5. Multipartite entanglement in heterogeneous systems

    NASA Astrophysics Data System (ADS)

    Goyeneche, Dardo; Bielawski, Jakub; Życzkowski, Karol

    2016-07-01

    Heterogeneous bipartite quantum pure states, composed of two subsystems with a different number of levels, cannot have both reductions maximally mixed. In this work, we demonstrate the existence of a wide range of highly entangled states of heterogeneous multipartite systems consisting of N >2 parties such that every reduction to one and two parties is maximally mixed. Two constructions of generating genuinely multipartite maximally entangled states of heterogeneous systems for an arbitrary number of subsystems are presented. Such states are related to quantum error correction codes over mixed alphabets and mixed orthogonal arrays. Additionally, we show the advantages of considering heterogeneous systems in practical implementations of multipartite steering.

  6. Nuclear structures in Tribolium castaneum oocytes.

    PubMed

    Bogolyubov, Dmitry S; Batalova, Florina M; Kiselyov, Artyom M; Stepanova, Irina S

    2013-10-01

    The first ultrastructural and immunomorphological characteristics of the karyosphere (karyosome) and extrachromosomal nuclear bodies in the red flour beetle, Tribolium castaneum, are presented. The karyosphere forms early in the diplotene stage of meiotic prophase by the gathering of all oocyte chromosomes in a limited nuclear volume. Using the BrUTP assay, T. castaneum oocyte chromosomes united in the karyosphere maintain their transcriptional activity until the end of oocyte growth. Hyperphosphorylated RNA polymerase II and basal transcription factors (TFIID and TFIIH) were detected in the perichromatin region of the karyosphere. The T. castaneum karyosphere has an extrachromosomal capsule that separates chromosomes from the rest of the nucleoplasm. Certain structural proteins (F-actin, lamin B) were found in the capsule. Unexpectedly, the karyosphere capsule in T. castaneum oocytes was found to be enriched in TMG-capped snRNAs, which suggests that the capsule is not only a structural support for the karyosphere, but may be involved in biogenesis of snRNPs. We also identified the counterparts of 'universal' extrachromosomal nuclear domains, Cajal bodies (CBs) and interchromatin granule clusters (IGCs). Nuclear bodies containing IGC marker protein SC35 display some features unusual for typical IGCs. SC35 domains in T. castaneum oocytes are predominantly fibrillar complex bodies that do not contain trimethyl guanosine (TMG)-capped small nuclear (sn) RNAs. Microinjections of 2'-O-methyl (U)22 probes into the oocytes allowed revealing poly(A)+ RNAs in these nuclear domains. Several proteins related to mRNA export (heterogeneous ribonucleoprotein core protein A1, export adapters Y14 and Aly and export receptor NXF1) were also detected there. We believe that unusual SC35 nuclear domains of T. castaneum oocytes are possibly involved in mRNP but not snRNP biogenesis.

  7. Heterogeneity and timing of translocation and membrane-mediated assembly of different annexins

    SciTech Connect

    Skrahina, Tatsiana; Piljic, Alen; Schultz, Carsten

    2008-03-10

    Many cell types, including neurons and epithelial cells, express a variety of annexins. Although the overall function has only been partially unravelled, a dominant feature is the formation of two-dimensional assemblies under the plasma membrane in a calcium-dependent manner. Here we show that fluorescently tagged annexins A1, A2, A4, A5, and A6 translocate and assemble at the plasma membrane and the nuclear envelope, except annexin A2, which only attaches to the plasma membrane. All annexins have different response times to elevated calcium levels as was shown by the translocation of co-expressed proteins. Fluorescence recovery after photobleaching revealed the static nature of all annexin assemblies. Analysis of the assemblies by Foerster resonance energy transfer (FRET) using acceptor bleaching demonstrated mostly annexin-specific self-assembly. Heterogeneous assembly formation was shown between annexins A5 and A1, and A5 and A2. The formation of homo- and heterogeneous annexin assemblies may play an important role when high increases in calcium occur, such as after disruption of the plasma membrane.

  8. Political Jurisdictions in Heterogeneous Communities.

    ERIC Educational Resources Information Center

    Alesina, Alberto; Baqir, Reza; Hoxby, Caroline

    2004-01-01

    We investigate whether political jurisdictions form in response to the trade-off between economies of scale and the costs of a heterogeneous population. We consider heterogeneity in income, race, ethnicity, and religion, and we test the model using American school districts, school attendance areas, municipalities, and special districts. We find…

  9. Query Expansion Using Heterogeneous Thesauri.

    ERIC Educational Resources Information Center

    Mandala, Rila; Tokunaga, Takenobu; Tanaka, Hozumi

    2000-01-01

    Proposes a method to improve the performance of information retrieval systems by expanding queries using heterogeneous thesauri. Experiments show that using heterogeneous thesauri with an appropriate weighting method results in better retrieval performance than using only one type of thesaurus. (Author/LRW)

  10. Distinct patterns of ALDH1A1 expression predict metastasis and poor outcome of colorectal carcinoma

    PubMed Central

    Xu, Sen-Lin; Zeng, Dong-Zu; Dong, Wei-Guo; Ding, Yan-Qing; Rao, Jun; Duan, Jiang-Jie; Liu, Qing; Yang, Jing; Zhan, Na; Liu, Ying; Hu, Qi-Ping; Zhang, Xia; Cui, You-Hong; Kung, Hsiang-Fu; Yu, Shi-Cang; Bian, Xiu-Wu

    2014-01-01

    Purpose: Aldehyde dehydrogenase 1A1 (ALDH1A1) has been proposed as a candidate biomarker for colorectal carcinoma (CRC). However, the heterogeneity of its expression makes it difficult to predict the outcome of CRC. The aim of this study was to evaluate the diagnostic and prognostic value of this molecule in CRC. Methods and Results: In this study, we examined ALDH1A1 expression by immunohistochemistry including 406 cases of primary CRC with corresponding adjacent mucosa, with confirmation of real-time PCR and Western blotting. We found that the expression patterns of ALDH1A1 were heterogeneous in the CRC and corresponding adjacent tissues. We defined the ratio of ALDH1A1 level in adjacent mucosa to that in tumor tissues as RA/C and found that the capabilities of tumor invasion and metastasis in the tumors with RA/C < 1 were significantly higher than those with RA/C ≥ 1. Follow-up data showed the worse prognoses in the CRC patients with RA/C < 1. For understanding the underlying mechanism, the localization of β-catenin was detected in the CRC tissues with different patterns of ALDH1A1 expression from 221 patients and β-catenin was found preferentially expressed in cell nuclei of the tumors with RA/C < 1 and ALDH1A1high expression of HT29 cell line, indicating that nuclear translocation of β-catenin might contribute to the increased potentials of invasion and metastasis. Conclusion: Our results indicate that RA/C is a novel biomarker to reflect the distinct expression patterns of ALDH1A1 for predicting metastasis and prognosis of CRC. PMID:25031716

  11. Reference Point Heterogeneity.

    PubMed

    Terzi, Ayse; Koedijk, Kees; Noussair, Charles N; Pownall, Rachel

    2016-01-01

    It is well-established that, when confronted with a decision to be taken under risk, individuals use reference payoff levels as important inputs. The purpose of this paper is to study which reference points characterize decisions in a setting in which there are several plausible reference levels of payoff. We report an experiment, in which we investigate which of four potential reference points: (1) a population average payoff level, (2) the announced expected payoff of peers in a similar decision situation, (3) a historical average level of earnings that others have received in the same task, and (4) an announced anticipated individual payoff level, best describes decisions in a decontextualized risky decision making task. We find heterogeneity among individuals in the reference points they employ. The population average payoff level is the modal reference point, followed by experimenter's stated expectation of a participant's individual earnings, followed in turn by the average earnings of other participants in previous sessions of the same experiment. A sizeable share of individuals show multiple reference points simultaneously. The reference point that best fits the choices of the individual is not affected by a shock to her income. PMID:27672374

  12. Reference Point Heterogeneity

    PubMed Central

    Terzi, Ayse; Koedijk, Kees; Noussair, Charles N.; Pownall, Rachel

    2016-01-01

    It is well-established that, when confronted with a decision to be taken under risk, individuals use reference payoff levels as important inputs. The purpose of this paper is to study which reference points characterize decisions in a setting in which there are several plausible reference levels of payoff. We report an experiment, in which we investigate which of four potential reference points: (1) a population average payoff level, (2) the announced expected payoff of peers in a similar decision situation, (3) a historical average level of earnings that others have received in the same task, and (4) an announced anticipated individual payoff level, best describes decisions in a decontextualized risky decision making task. We find heterogeneity among individuals in the reference points they employ. The population average payoff level is the modal reference point, followed by experimenter's stated expectation of a participant's individual earnings, followed in turn by the average earnings of other participants in previous sessions of the same experiment. A sizeable share of individuals show multiple reference points simultaneously. The reference point that best fits the choices of the individual is not affected by a shock to her income. PMID:27672374

  13. Heterogeneous recording media

    NASA Astrophysics Data System (ADS)

    Sukhanov, Vitaly I.

    1991-02-01

    The paper summarizes the results of investigations performed to obtain deep 3-D holograms with 102 i0 mkm physical thickness allowing the postexposure amplification and the a posteriori changing of the grating parameters. This aim has been achieved by developing heterogeneous systems on the basis of porous glass with light-sensitive compositions introduced into it. 1. INTRODUCTION. LIGHT-SENSITIVE MEDIA FOR 3-D HOLOGRAMS RECORDING. The 3-D holograms have many useful properties: very high diffraction efficiency angular and spectral selectivity but low level of noise. It shoud be noted that in this case deep 3-D holograms are dealt with whose physical thickness is as high as 102 -i mkm. Such hologram recording is usually done using homogeneous light-sensitive media for example dyed acid-halide and electrooptical crystals photochrome glass photostructurized polimer compositions and so on. The nature of photophisical and photochemical processes responsible for the light sensitivity of these materials exclude the possibility of post-exposure treatment. This does not allow to enhance the recorded holograms and considerably hampers their fixing or makes it practically impossible. The object of our work is to create the media which are quite suitable for two-stage processes of the deep hologram formation with post-exposure processing. Such material must satisfy the following requirements: a)they must have high permeability for the developing substances in order to make the development duration suitable for practical applications b)they must be shrinkproof to prevent deformation of the

  14. On Heterogeneous Covert Networks

    NASA Astrophysics Data System (ADS)

    Lindelauf, Roy; Borm, Peter; Hamers, Herbert

    Covert organizations are constantly faced with a tradeoff between secrecy and operational efficiency. Lindelauf, Borm and Hamers [13] developed a theoretical framework to determine optimal homogeneous networks taking the above mentioned considerations explicitly into account. In this paper this framework is put to the test by applying it to the 2002 Jemaah Islamiyah Bali bombing. It is found that most aspects of this covert network can be explained by the theoretical framework. Some interactions however provide a higher risk to the network than others. The theoretical framework on covert networks is extended to accommodate for such heterogeneous interactions. Given a network structure the optimal location of one risky interaction is established. It is shown that the pair of individuals in the organization that should conduct the interaction that presents the highest risk to the organization, is the pair that is the least connected to the remainder of the network. Furthermore, optimal networks given a single risky interaction are approximated and compared. When choosing among a path, star and ring graph it is found that for low order graphs the path graph is best. When increasing the order of graphs under consideration a transition occurs such that the star graph becomes best. It is found that the higher the risk a single interaction presents to the covert network the later this transition from path to star graph occurs.

  15. Reference Point Heterogeneity

    PubMed Central

    Terzi, Ayse; Koedijk, Kees; Noussair, Charles N.; Pownall, Rachel

    2016-01-01

    It is well-established that, when confronted with a decision to be taken under risk, individuals use reference payoff levels as important inputs. The purpose of this paper is to study which reference points characterize decisions in a setting in which there are several plausible reference levels of payoff. We report an experiment, in which we investigate which of four potential reference points: (1) a population average payoff level, (2) the announced expected payoff of peers in a similar decision situation, (3) a historical average level of earnings that others have received in the same task, and (4) an announced anticipated individual payoff level, best describes decisions in a decontextualized risky decision making task. We find heterogeneity among individuals in the reference points they employ. The population average payoff level is the modal reference point, followed by experimenter's stated expectation of a participant's individual earnings, followed in turn by the average earnings of other participants in previous sessions of the same experiment. A sizeable share of individuals show multiple reference points simultaneously. The reference point that best fits the choices of the individual is not affected by a shock to her income.

  16. Angiotensin II receptor heterogeneity

    SciTech Connect

    Herblin, W.F.; Chiu, A.T.; McCall, D.E.; Ardecky, R.J.; Carini, D.J.; Duncia, J.V.; Pease, L.J.; Wong, P.C.; Wexler, R.R.; Johnson, A.L. )

    1991-04-01

    The possibility of receptor heterogeneity in the angiotensin II (AII) system has been suggested previously, based on differences in Kd values or sensitivity to thiol reagents. One of the authors earliest indications was the frequent observation of incomplete inhibition of the binding of AII to adrenal cortical membranes. Autoradiographic studies demonstrated that all of the labeling of the rat adrenal was blocked by unlabeled AII or saralasin, but not by DuP 753. The predominant receptor in the rat adrenal cortex (80%) is sensitive to dithiothreitol (DTT) and DuP 753, and is designated AII-1. The residual sites in the adrenal cortex and almost all of the sites in the rat adrenal medulla are insensitive to both DTT and DuP 753, but were blocked by EXP655. These sites have been confirmed by ligand binding studies and are designated AII-2. The rabbit adrenal cortex is unique in yielding a nonuniform distribution of AII-2 sites around the outer layer of glomerulosa cells. In the rabbit kidney, the sites on the glomeruli are AII-1, but the sites on the kidney capsule are AII-2. Angiotensin III appears to have a higher affinity for AII-2 sites since it inhibits the binding to the rabbit kidney capsule but not the glomeruli. Elucidation of the distribution and function of these diverse sites should permit the development of more selective and specific therapeutic strategies.

  17. Nuclear Medicine

    MedlinePlus

    ... Parents/Teachers Resource Links for Students Glossary Nuclear Medicine What is nuclear medicine? What are radioactive tracers? ... funded researchers advancing nuclear medicine? What is nuclear medicine? Nuclear medicine is a medical specialty that uses ...

  18. A truncated hnRNP A1 isoform, lacking the RGG-box RNA binding domain, can efficiently regulate HIV-1 splicing and replication.

    PubMed

    Jean-Philippe, Jacques; Paz, Sean; Lu, Michael L; Caputi, Massimo

    2014-01-01

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is one of the most abundant RNA binding proteins. hnRNP A1 is localized prevalently in the nucleus but it can relocate to the cytoplasm in response to specific stimuli shuttling between nuclear and cytoplasmic compartments. The cellular localization of this protein is regulated by a short C-terminus motif (M9) and other less defined sequences. The RNA binding specificity of this protein is dependent on multiple RNA binding domains (RBDs), which regulate its role in RNA processing and expression. hnRNP A1 plays multiple roles in gene expression by regulating the biogenesis and translation of messengers RNAs, the processing of miRNAs, affecting transcription and controlling telomere maintenance. The multiple functions of this protein correlate with diverse roles in genetic disease, cancer and the replication of viral pathogens. Utilizing a tagged hnRNP A1 deletion library we have shown that the three hnRNP A1 RBDs contribute to the prevalent nuclear distribution of the protein. Our data also indicate that a truncated form of the protein, lacking one of the RBDs, the RGG-box, can regulate splicing of a splicing reporter minigene and down-regulate replication of the HIV-1 virus with efficiency comparable to the wild-type protein. This functional hnRNP A1 deletion mutant is similar to a predicted hnRNP A1 isoform, which had not been previously experimentally characterized. PMID:24530421

  19. Node assignment in heterogeneous computing

    NASA Technical Reports Server (NTRS)

    Som, Sukhamoy

    1993-01-01

    A number of node assignment schemes, both static and dynamic, are explored for the Algorithm to Architecture Mapping Model (ATAMM). The architecture under consideration consists of heterogeneous processors and implements dataflow models of real-time applications. Terminology is developed for heterogeneous computing. New definitions are added to the ATAMM for token and assignment classifications. It is proved that a periodic execution is possible for dataflow graphs. Assignment algorithms are developed and proved. A design procedure is described for satisfying an objective function in an heterogeneous architecture. Several examples are provided for illustration.

  20. Heterogeneous Oxidation of Catechol.

    PubMed

    Pillar, Elizabeth A; Zhou, Ruixin; Guzman, Marcelo I

    2015-10-15

    Natural and anthropogenic emissions of aromatic hydrocarbons from biomass burning, agro-industrial settings, and fossil fuel combustion contribute precursors to secondary aerosol formation (SOA). How these compounds are processed under humid tropospheric conditions is the focus of current attention to understand their environmental fate. This work shows how catechol thin films, a model for oxygenated aromatic hydrocarbons present in biomass burning and combustion aerosols, undergo heterogeneous oxidation at the air-solid interface under variable relative humidity (RH = 0-90%). The maximum reactive uptake coefficient of O3(g) by catechol γO3 = (7.49 ± 0.35) × 10(-6) occurs for 90% RH. Upon exposure of ca. 104-μm thick catechol films to O3(g) mixing ratios between 230 ppbv and 25 ppmv, three main reaction pathways are observed. (1) The cleavage of the 1,2 carbon-carbon bond at the air-solid interface resulting in the formation of cis,cis-muconic acid via primary ozonide and hydroperoxide intermediates. Further direct ozonolysis of cis,cis-muconic yields glyoxylic, oxalic, crotonic, and maleic acids. (2) A second pathway is evidenced by the presence of Baeyer-Villiger oxidation products including glutaconic 4-hydroxy-2-butenoic and 5-oxo-2-pentenoic acids during electrospray ionization mass spectrometry (MS) and ion chromatography MS analyses. (3) Finally, indirect oxidation by in situ produced hydroxyl radical (HO(•)) results in the generation of semiquinone radical intermediates toward the synthesis of polyhydoxylated aromatic rings such as tri-, tetra-, and penta-hydroxybenzene. Remarkably, heavier polyhydroxylated biphenyl and terphenyl products present in the extracted oxidized films result from coupling reactions of semiquinones of catechol and its polyhydroxylated rings. The direct ozonolysis of 1,2,3- and 1,2,4-trihydroxybenezene yields 2- and 3-hydroxy-cis,cis-muconic acid, respectively. The production of 2,4- or 3,4-dihdroxyhex-2-enedioic acid is

  1. Homogeneous, Heterogeneous, and Enzymatic Catalysis.

    ERIC Educational Resources Information Center

    Oyama, S. Ted; Somorjai, Gabor A.

    1988-01-01

    Discusses three areas of catalysis: homegeneous, heterogeneous, and enzymatic. Explains fundamentals and economic impact of catalysis. Lists and discusses common industrial catalysts. Provides a list of 107 references. (MVL)

  2. Heterogeneity in motor driven transport

    NASA Astrophysics Data System (ADS)

    Tabei, Ali

    2015-03-01

    I will discuss quantitative analysis of particle tracking data for motor driven vesicles inside an insulin secreting cell. We use this method to study the dynamical and structural heterogeneity inside the cell. I will discuss our effort to explain the origin of observed heterogeneity in intracellular transport. Finally, I will explain how analyzing directional correlations in transport trajectories reveals self-similarity in the diffusion media.

  3. EIYMNVPV Motif is Essential for A1CF Nucleus Localization and A1CF (-8aa) Promotes Proliferation of MDA-MB-231 Cells via Up-Regulation of IL-6

    PubMed Central

    Zhou, Li; Hao, Jin; Yuan, Yue; Peng, Rui; Wang, Honglian; Ni, Dongsheng; Gu, Yuping; Huang, Liyuan; Mao, Zhaomin; Lyu, Zhongshi; Du, Yao; Liu, Zhicheng; Li, Yiman; Ju, Pan; Long, Yaoshui; Liu, Jianing; Zhou, Qin

    2016-01-01

    Apobec-1 complementation factor (A1CF) is a heterogeneous nuclear ribonuceloprotein (hnRNP) and mediates apolipoprotein-B mRNA editing. A1CF can promote the regeneration of the liver by post-transcriptionally stabilizing Interleukin-6 (IL-6) mRNA. It also contains two transcriptional variants-A1CF64 and A1CF65, distinguished by the appearance of a 24-nucleotide motif which contributes to the corresponding eight-amino acid motif of EIYMNVPV. For the first time, we demonstrated that the EIYMNVPV motif was essential for A1CF nucleus localization, A1CF deficient of the EIYMNVPV motif, A1CF (-8aa) showed cytoplasm distribution. More importantly, we found that A1CF (-8aa), but not its full-length counterpart, can promote proliferation of MDA-MB-231 cells accompanied with increased level of IL-6 mRNA. Furthermore, silencing of IL-6 attenuated A1CF (-8aa)-induced proliferation in MDA-MB-231 cells. In conclusion, notably, these findings suggest that A1CF (-8aa) promoted proliferation of MDA-MB-231 cells in vitro viewing IL-6 as a target. Thus, the EIYMNVPV motif could be developed as a potential target for basal-like breast cancer therapy. PMID:27231908

  4. Scaling of Waves in Heterogeneous Materials

    NASA Astrophysics Data System (ADS)

    Vogler, Tracy

    2011-06-01

    The fourth power scaling of strain rate with stress described by Swegle and Grady describes steady waves in many homogeneous materials, but heterogeneous materials can display different scaling relationships. In particular, layered materials exhibit a second power scaling of strain rate with stress, while first power scaling has been observed in granular materials. To better understand these scaling behaviors, numerical simulations of wave propagation in layered and granular materials are performed. The simulations demonstrate that the heterogeneous nature of these materials can cause behavior similar to what has historically been termed viscosity when observed in homogeneous materials. From these simulations, non-dimensional groups that control the scaling of the waves are identified. These groups collapse the available experimental data reasonably well onto a single curve. Finally, a simple model for the first power scaling in granular materials is proposed that illustrates the importance of void space between particles to the wave structure. Sandia National Laboratories is a multi-program laboratory operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin company, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  5. PUNCH: Population Characterization of Heterogeneity.

    PubMed

    Tunc, Birkan; Ghanbari, Yasser; Smith, Alex R; Pandey, Juhi; Browne, Aaron; Schultz, Robert T; Verma, Ragini

    2014-09-01

    Neuropsychiatric disorders are notoriously heterogeneous in their presentation, which precludes straightforward and objective description of the differences between affected and typical populations that therefore makes finding reliable biomarkers a challenge. This difficulty underlines the need for reliable methods to capture sample characteristics of heterogeneity using a single continuous measure, incorporating the multitude of scores used to describe different aspects of functioning. This study addresses this challenge by proposing a general method of identifying and quantifying the heterogeneity of any clinical population using a severity measure called the PUNCH (Population Characterization of Heterogeneity). PUNCH is a decision level fusion technique to incorporate decisions of various phenotypic scores, while providing interpretable weights for scores. We provide applications of our framework to simulated datasets and to a large sample of youth with Autism Spectrum Disorder (ASD). Next we stratify PUNCH scores in our ASD sample and show how severity moderates findings of group differences in diffusion weighted brain imaging data; more severely affected subgroups of ASD show expanded differences compared to age and gender matched healthy controls. Results demonstrate the ability of our measure in quantifying the underlying heterogeneity of the clinical samples, and suggest its utility in providing researchers with reliable severity assessments incorporating population heterogeneity.

  6. Analysis of active renin heterogeneity.

    PubMed

    Katz, S A; Malvin, R L; Lee, J; Kim, S H; Murray, R D; Opsahl, J A; Abraham, P A

    1991-09-01

    Active renin is a heterogeneous enzyme that can be separated into multiple forms with high-resolution isoelectric focusing. The isoelectric heterogeneity may result from differences in glycosylation between the different forms. In order to determine the relationship between active renin heterogeneity and differences in composition or attachment of oligosaccharides, two separate experiments were performed: (i) Tunicamycin, which interferes with normal glycosylation processing, increased the proportion of relatively basic renin forms secreted into the incubation media by rat renal cortical slices. (ii) Endoglycosidase F, which enzymatically removes carbohydrate from some classes of glycoprotein, similarly increased the proportion of relatively basic forms when incubated with active human recombinant renin. In addition, further studies with inhibitors of human renin activity revealed that the heterogeneous renin forms were similarly inhibited by two separate renin inhibitors. These results are consistent with the hypothesis that renin isoelectric heterogeneity is due in part to differences in carbohydrate moiety attachment and that the heterogeneity of renin does not influence access of direct renin inhibitors to the active site of renin.

  7. Analysis of active renin heterogeneity.

    PubMed

    Katz, S A; Malvin, R L; Lee, J; Kim, S H; Murray, R D; Opsahl, J A; Abraham, P A

    1991-09-01

    Active renin is a heterogeneous enzyme that can be separated into multiple forms with high-resolution isoelectric focusing. The isoelectric heterogeneity may result from differences in glycosylation between the different forms. In order to determine the relationship between active renin heterogeneity and differences in composition or attachment of oligosaccharides, two separate experiments were performed: (i) Tunicamycin, which interferes with normal glycosylation processing, increased the proportion of relatively basic renin forms secreted into the incubation media by rat renal cortical slices. (ii) Endoglycosidase F, which enzymatically removes carbohydrate from some classes of glycoprotein, similarly increased the proportion of relatively basic forms when incubated with active human recombinant renin. In addition, further studies with inhibitors of human renin activity revealed that the heterogeneous renin forms were similarly inhibited by two separate renin inhibitors. These results are consistent with the hypothesis that renin isoelectric heterogeneity is due in part to differences in carbohydrate moiety attachment and that the heterogeneity of renin does not influence access of direct renin inhibitors to the active site of renin. PMID:1908097

  8. Dealing with spatial heterogeneity

    NASA Astrophysics Data System (ADS)

    Marsily, Gh.; Delay, F.; Gonçalvès, J.; Renard, Ph.; Teles, V.; Violette, S.

    2005-03-01

    Heterogeneity can be dealt with by defining homogeneous equivalent properties, known as averaging, or by trying to describe the spatial variability of the rock properties from geologic observations and local measurements. The techniques available for these descriptions are mostly continuous Geostatistical models, or discontinuous facies models such as the Boolean, Indicator or Gaussian-Threshold models and the Markov chain model. These facies models are better suited to treating issues of rock strata connectivity, e.g. buried high permeability channels or low permeability barriers, which greatly affect flow and, above all, transport in aquifers. Genetic models provide new ways to incorporate more geology into the facies description, an approach that has been well developed in the oil industry, but not enough in hydrogeology. The conclusion is that future work should be focused on improving the facies models, comparing them, and designing new in situ testing procedures (including geophysics) that would help identify the facies geometry and properties. A world-wide catalog of aquifer facies geometry and properties, which could combine site genesis and description with methods used to assess the system, would be of great value for practical applications. On peut aborder le problème de l'hétérogénéité en s'efforçant de définir une perméabilité équivalente homogène, par prise de moyenne, ou au contraire en décrivant la variation dans l'espace des propriétés des roches à partir des observations géologiques et des mesures locales. Les techniques disponibles pour une telle description sont soit continues, comme l'approche Géostatistique, soit discontinues, comme les modèles de faciès, Booléens, ou bien par Indicatrices ou Gaussiennes Seuillées, ou enfin Markoviens. Ces modèles de faciès sont mieux capables de prendre en compte la connectivité des strates géologiques, telles que les chenaux enfouis à forte perméabilité, ou au contraire les faci

  9. Dealing with spatial heterogeneity

    NASA Astrophysics Data System (ADS)

    Marsily, Gh.; Delay, F.; Gonçalvès, J.; Renard, Ph.; Teles, V.; Violette, S.

    2005-03-01

    Heterogeneity can be dealt with by defining homogeneous equivalent properties, known as averaging, or by trying to describe the spatial variability of the rock properties from geologic observations and local measurements. The techniques available for these descriptions are mostly continuous Geostatistical models, or discontinuous facies models such as the Boolean, Indicator or Gaussian-Threshold models and the Markov chain model. These facies models are better suited to treating issues of rock strata connectivity, e.g. buried high permeability channels or low permeability barriers, which greatly affect flow and, above all, transport in aquifers. Genetic models provide new ways to incorporate more geology into the facies description, an approach that has been well developed in the oil industry, but not enough in hydrogeology. The conclusion is that future work should be focused on improving the facies models, comparing them, and designing new in situ testing procedures (including geophysics) that would help identify the facies geometry and properties. A world-wide catalog of aquifer facies geometry and properties, which could combine site genesis and description with methods used to assess the system, would be of great value for practical applications. On peut aborder le problème de l'hétérogénéité en s'efforçant de définir une perméabilité équivalente homogène, par prise de moyenne, ou au contraire en décrivant la variation dans l'espace des propriétés des roches à partir des observations géologiques et des mesures locales. Les techniques disponibles pour une telle description sont soit continues, comme l'approche Géostatistique, soit discontinues, comme les modèles de faciès, Booléens, ou bien par Indicatrices ou Gaussiennes Seuillées, ou enfin Markoviens. Ces modèles de faciès sont mieux capables de prendre en compte la connectivité des strates géologiques, telles que les chenaux enfouis à forte perméabilité, ou au contraire les faci

  10. Reaction Selectivity in Heterogeneous Catalysis

    SciTech Connect

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  11. Resource heterogeneity can facilitate cooperation.

    PubMed

    Kun, Ádám; Dieckmann, Ulf

    2013-01-01

    Although social structure is known to promote cooperation, by locally exposing selfish agents to their own deeds, studies to date assumed that all agents have access to the same level of resources. This is clearly unrealistic. Here we find that cooperation can be maintained when some agents have access to more resources than others. Cooperation can then emerge even in populations in which the temptation to defect is so strong that players would act fully selfishly if their resources were distributed uniformly. Resource heterogeneity can thus be crucial for the emergence and maintenance of cooperation. We also show that resource heterogeneity can hinder cooperation once the temptation to defect is significantly lowered. In all cases, the level of cooperation can be maximized by managing resource heterogeneity.

  12. Static heterogeneities in liquid water

    NASA Astrophysics Data System (ADS)

    Stanley, H. Eugene; Buldyrev, Sergey V.; Giovambattista, Nicolas

    2004-10-01

    The thermodynamic behavior of water seems to be closely related to static heterogeneities. These static heterogeneities are related to the local structure of water molecules, and when properly characterized, may offer an economical explanation of thermodynamic data. The key feature of liquid water is not so much that the existence of hydrogen bonds, first pointed out by Linus Pauling, but rather the local geometry of the liquid molecules is not spherical or oblong but tetrahedral. In the consideration of static heterogeneities, this local geometry is critical. Recent experiments suggested more than one phase of amorphous solid water, while simulations suggest that one of these phases is metastable with respect to another, so that in fact there are only two stable phases.

  13. Simulator for heterogeneous dataflow architectures

    NASA Technical Reports Server (NTRS)

    Malekpour, Mahyar R.

    1993-01-01

    A new simulator is developed to simulate the execution of an algorithm graph in accordance with the Algorithm to Architecture Mapping Model (ATAMM) rules. ATAMM is a Petri Net model which describes the periodic execution of large-grained, data-independent dataflow graphs and which provides predictable steady state time-optimized performance. This simulator extends the ATAMM simulation capability from a heterogenous set of resources, or functional units, to a more general heterogenous architecture. Simulation test cases show that the simulator accurately executes the ATAMM rules for both a heterogenous architecture and a homogenous architecture, which is the special case for only one processor type. The simulator forms one tool in an ATAMM Integrated Environment which contains other tools for graph entry, graph modification for performance optimization, and playback of simulations for analysis.

  14. Nuclear rights - nuclear wrongs

    SciTech Connect

    Paul, E.F.; Miller, F.D.; Paul, J.; Ahrens, J.

    1986-01-01

    This book contains 11 selections. The titles are: Three Ways to Kill Innocent Bystanders: Some Conundrums Concerning the Morality of War; The International Defense of Liberty; Two Concepts of Deterrence; Nuclear Deterrence and Arms Control; Ethical Issues for the 1980s; The Moral Status of Nuclear Deterrent Threats; Optimal Deterrence; Morality and Paradoxical Deterrence; Immoral Risks: A Deontological Critique of Nuclear Deterrence; No War Without Dictatorship, No Peace Without Democracy: Foreign Policy as Domestic Politics; Marxism-Leninism and its Strategic Implications for the United States; Tocqueveille War.

  15. A1C test

    MedlinePlus

    HbA1C test; Glycated hemoglobin test; Glycosylated hemoglobin test; Hemoglobin glycosylated test; Glycohemoglobin test ... have recently eaten does not affect the A1C test, so you do not need to fast to ...

  16. Nuclear heterogeneity in conidial populations of Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus is a major producer of aflatoxin and an opportunistic pathogen for a wide range of hosts. Understanding genotypic and phenotypic variations within strains of A. flavus is important for controlling disease and reducing aflatoxin contamination. A. flavus is multinucleate and predomi...

  17. Upstream reciprocity in heterogeneous networks.

    PubMed

    Iwagami, Akio; Masuda, Naoki

    2010-08-01

    Many mechanisms for the emergence and maintenance of altruistic behavior in social dilemma situations have been proposed. Indirect reciprocity is one such mechanism, where other-regarding actions of a player are eventually rewarded by other players with whom the original player has not interacted. The upstream reciprocity (also called generalized indirect reciprocity) is a type of indirect reciprocity and represents the concept that those helped by somebody will help other unspecified players. In spite of the evidence for the enhancement of helping behavior by upstream reciprocity in rats and humans, theoretical support for this mechanism is not strong. In the present study, we numerically investigate upstream reciprocity in heterogeneous contact networks, in which the players generally have different number of neighbors. We show that heterogeneous networks considerably enhance cooperation in a game of upstream reciprocity. In heterogeneous networks, the most generous strategy, by which a player helps a neighbor on being helped and in addition initiates helping behavior, first occupies hubs in a network and then disseminates to other players. The scenario to achieve enhanced altruism resembles that seen in the case of the Prisoner's Dilemma game in heterogeneous networks.

  18. Heterogeneous catalytic alcoholysis of benzonitrile

    SciTech Connect

    Kagarlitskii, A.D.; Dmumakaev, K.Kh.; Bekova, N.S.

    1986-04-01

    The authors investigate the possibility of the direct heterogeneous catalytic synthesis of ethylbenzoate from benzonitrile. The catalysts tested were oxides of aluminium, titanium, and vanadium. The main conversion product detected chromatographically was ethylbenzoate; benzaldehyde, benzamide, and benzanilide were also identified. Aluminium oxide was found to be the most effective catalyst.

  19. Heterogeneity in the gingival fibromatoses.

    PubMed

    Takagi, M; Yamamoto, H; Mega, H; Hsieh, K J; Shioda, S; Enomoto, S

    1991-11-15

    Forty-nine cases of isolated familial and idiopathic gingival fibromatoses, consisting of 12 cases from six families and 37 cases of idiopathic gingival fibromatosis, were reviewed. Pedigrees of five families revealed various penetrances and genetic heterogeneity as suggested by the presence of both autosomal dominant and autosomal recessive inheritances. Ultrastructurally, the lesions were composed of fibroblast-like cells and myofibroblast-like cells, with the former being the predominant cell type. The 267 cases of familial and idiopathic gingival fibromatoses were analyzed, and they with or without hypertrichosis, mental retardation, and/or epilepsy. These included 49 cases seen by the authors, 50 cases from the Japanese literature, and 168 cases from non-Japanese literature. Isolated gingival fibromatosis occurred more frequently after age of 12 years (P less than 0.0074). There was no significant difference in age of onset between generalized and localized forms of the idiopathic gingival fibromatosis. Gingival fibromatosis with hypertrichosis and mental retardation and/or epilepsy occurred frequently before 12 years (P less than 0.069). It has been shown that heterogeneity of the gingival fibromatosis is a result of either histologic heterogeneity, genetic heterogeneity, or a combination with other systemic disorders.

  20. Social Capital and Community Heterogeneity

    ERIC Educational Resources Information Center

    Coffe, Hilde

    2009-01-01

    Recent findings indicate that more pronounced community heterogeneity is associated with lower levels of social capital. These studies, however, concentrate on specific aspects in which people differ (such as income inequality or ethnic diversity). In the present paper, we introduce the number of parties in the local party system as a more…

  1. Teaching about Heterogeneous Response Models

    ERIC Educational Resources Information Center

    Murray, Michael P.

    2014-01-01

    Individuals vary in their responses to incentives and opportunities. For example, additional education will affect one person differently than another. In recent years, econometricians have given increased attention to such heterogeneous responses and to the consequences of such responses for interpreting regression estimates, especially…

  2. Flammability of Heterogeneously Combusting Metals

    NASA Technical Reports Server (NTRS)

    Jones, Peter D.

    1998-01-01

    Most engineering materials, including some metals, most notably aluminum, burn in homogeneous combustion. 'Homogeneous' refers to both the fuel and the oxidizer being in the same phase, which is usually gaseous. The fuel and oxidizer are well mixed in the combustion reaction zone, and heat is released according to some relation like q(sub c) = delta H(sub c)c[((rho/rho(sub 0))]exp a)(exp -E(sub c)/RT), Eq. (1) where the pressure exponent a is usually close to unity. As long as there is enough heat released, combustion is sustained. It is useful to conceive of a threshold pressure beyond which there is sufficient heat to keep the temperature high enough to sustain combustion, and beneath which the heat is so low that temperature drains away and the combustion is extinguished. Some materials burn in heterogeneous combustion, in which the fuel and oxidizer are in different phases. These include iron and nickel based alloys, which burn in the liquid phase with gaseous oxygen. Heterogeneous combustion takes place on the surface of the material (fuel). Products of combustion may appear as a solid slag (oxide) which progressively covers the fuel. Propagation of the combustion melts and exposes fresh fuel. Heterogeneous combustion heat release also follows the general form of Eq.(1), except that the pressure exponent a tends to be much less than 1. Therefore, the increase in heat release with increasing pressure is not as dramatic as it is in homogeneous combustion. Although the concept of a threshold pressure still holds in heterogeneous combustion, the threshold is more difficult to identify experimentally, and pressure itself becomes less important relative to the heat transfer paths extant in any specific application. However, the constants C, a, and E(sub c) may still be identified by suitable data reduction from heterogeneous combustion experiments, and may be applied in a heat transfer model to judge the flammability of a material in any particular actual

  3. Magnetic heterogeneity of biological systems.

    PubMed

    Piruzyan, L A; Kuznetsov, A A; Chikov, V M

    1980-01-01

    In biological systems nonuniformity of magnetic susceptibility, magnetic heterogeneity, is a reflection of their physical-chemical and morphological heterogeneity, A characteristic value of heterogeneity is delta K approximately 10(-6)-10(-7) CGS units, a quantitative measurement of susceptibility of cells and other small objects, may give qualitatively new information about their life processes. Patterns and features of movement of small biological objects and liquids affected by magnetic forces were studied. A method was developed for measuring magnetic susceptibility of single microobjects based on observation of movement of the objects in a strong heterogeneous field with parameters (formula: see text) grad H2/2 approximately 10(9)-10(10) Oe2/cm. This method does not require knowing the distribution of the field along the path of movement of the particles, and does not require preliminary calibration. Movement of human erythrocytes, rat hepatocytes, and starch granules in liquids at a point of entry into a gap with the field was observed experimentally. With sufficiently large fields Ho approximately (1-2) x 10(4) Oe, the value of the magnetic force was enough to change the rate of sedimentation movement of the objects appreciably (up to stopping it). This made it possible to compute the value delta K for cells approximately 10(-7)-10(-8) CGS units and to obtain the value of K for starch granules (-0.80 x 10(-6) cGS units). In connection with the fact that sensitivity to gravity in plants is coupled with a disturbance of the intracellular starch granules under the influence of gravity, certain problems of stimulating the effect of gravity on plants by magnetic forces were studied. Noncontact force effect on magnetically heterogeneous biological objects is a promising instrument for biophysical studies.

  4. Advanced reactor physics methods for heterogeneous reactor cores

    NASA Astrophysics Data System (ADS)

    Thompson, Steven A.

    To maintain the economic viability of nuclear power the industry has begun to emphasize maximizing the efficiency and output of existing nuclear power plants by using longer fuel cycles, stretch power uprates, shorter outage lengths, mixed-oxide (MOX) fuel and more aggressive operating strategies. In order to accommodate these changes, while still satisfying the peaking factor and power envelope requirements necessary to maintain safe operation, more complexity in commercial core designs have been implemented, such as an increase in the number of sub-batches and an increase in the use of both discrete and integral burnable poisons. A consequence of the increased complexity of core designs, as well as the use of MOX fuel, is an increase in the neutronic heterogeneity of the core. Such heterogeneous cores introduce challenges for the current methods that are used for reactor analysis. New methods must be developed to address these deficiencies while still maintaining the computational efficiency of existing reactor analysis methods. In this thesis, advanced core design methodologies are developed to be able to adequately analyze the highly heterogeneous core designs which are currently in use in commercial power reactors. These methodological improvements are being pursued with the goal of not sacrificing the computational efficiency which core designers require. More specifically, the PSU nodal code NEM is being updated to include an SP3 solution option, an advanced transverse leakage option, and a semi-analytical NEM solution option.

  5. Temporal Heterogeneity in Apoptosis Determined by Imaging Flow Cytometry.

    PubMed

    Vorobjev, Ivan A; Barteneva, Natasha S

    2016-01-01

    Apoptotic process is highly heterogeneous, and a long-standing question is how many parameters define time and reversibility of the apoptotic response at a population and single-cell levels. Cell death analysis applications have greatly expanded since the introduction of flow cytometry. Classical approach for evaluation of apoptosis is en masse analysis of cells treated with different stimuli, but these methods cannot demonstrate heterogeneity in the population. Single-cell heterogeneity is now usually assessed by multicolor fluorescence microscopy; however obtaining reasonable statistics is time consuming and laborious. Therefore we combined flow cytometry, imaging flow cytometry, and fluorescent microscopy to characterize at a single-cell and population level sequence of apoptotic events induced by a variety of treatments (Vorobjev, Barteneva, J Histochem Cytochem 63:494-510, 2015). We show that simultaneous use of membrane potential dye TMRE, caspases 3/7 sensor, Annexin V and nuclear staining along with morphological parameters demonstrate heterogeneity of the whole process and is a valuable method for quantitative study of the apoptosis execution. Imaging flow cytometry allowed us to analyze correlation between TMRE, caspases 3/7, and Annexin V staining and morphological characteristics providing valuable information on the process of apoptotic execution. Importantly, comparisons of different data sets obtained by three methods allowed us to achieve temporal resolution of the whole process superior to that had been obtained by only one method. PMID:27460249

  6. Temporal Heterogeneity in Apoptosis Determined by Imaging Flow Cytometry.

    PubMed

    Vorobjev, Ivan A; Barteneva, Natasha S

    2016-01-01

    Apoptotic process is highly heterogeneous, and a long-standing question is how many parameters define time and reversibility of the apoptotic response at a population and single-cell levels. Cell death analysis applications have greatly expanded since the introduction of flow cytometry. Classical approach for evaluation of apoptosis is en masse analysis of cells treated with different stimuli, but these methods cannot demonstrate heterogeneity in the population. Single-cell heterogeneity is now usually assessed by multicolor fluorescence microscopy; however obtaining reasonable statistics is time consuming and laborious. Therefore we combined flow cytometry, imaging flow cytometry, and fluorescent microscopy to characterize at a single-cell and population level sequence of apoptotic events induced by a variety of treatments (Vorobjev, Barteneva, J Histochem Cytochem 63:494-510, 2015). We show that simultaneous use of membrane potential dye TMRE, caspases 3/7 sensor, Annexin V and nuclear staining along with morphological parameters demonstrate heterogeneity of the whole process and is a valuable method for quantitative study of the apoptosis execution. Imaging flow cytometry allowed us to analyze correlation between TMRE, caspases 3/7, and Annexin V staining and morphological characteristics providing valuable information on the process of apoptotic execution. Importantly, comparisons of different data sets obtained by three methods allowed us to achieve temporal resolution of the whole process superior to that had been obtained by only one method.

  7. The dangers of heterogeneous network computing: heterogeneous networks considered harmful

    SciTech Connect

    Demmel, J.; Stanley, K.; Dongarra, J.; Hammarling, S.; Osstrouchov, S.

    1996-12-31

    This report addresses the issue of writing reliable numerical software for networks of heterogeneous computers. Much software has been written for distributed memory parallel computers and in principal such software could readily be ported to networks of machines, such as a collection of workstations connected by Ethernet, but if such a network is not homogeneous there are special challenges that need to be addressed. The symptoms can range from erroneous results returned without warning to deadlock. Some of the problems are straightforward to solve, but for others the solutions are not so obvious and indeed in some cases, such as the method of bisection which we shall discuss in the report, we have not yet decided upon a satisfactory solution that does not incur an unacceptable overhead. Making software robust on heterogeneous systems often requires additional communication. In this report we describe and illustrate the problems and, where possible, suggest solutions so that others may be aware of the potential pitfalls and either avoid them or, if that is not possible, ensure that their software is not used on heterogeneous networks.

  8. Nuclear ventriculography

    MedlinePlus

    ... ventriculography (RNV); Multiple gate acquisition scan (MUGA); Nuclear cardiology; Cardiomyopathy - nuclear ventriculography ... 56. Udelson JE, Dilsizian V, Bonow RO. Nuclear cardiology. In: Bonow RO, Mann DL, Zipes DP, Libby ...

  9. Nuclear Medicine.

    ERIC Educational Resources Information Center

    Badawi, Ramsey D.

    2001-01-01

    Describes the use of nuclear medicine techniques in diagnosis and therapy. Describes instrumentation in diagnostic nuclear medicine and predicts future trends in nuclear medicine imaging technology. (Author/MM)

  10. Heterogeneous, weakly coupled map lattices

    NASA Astrophysics Data System (ADS)

    Sotelo Herrera, M.a. Dolores; San Martín, Jesús; Porter, Mason A.

    2016-07-01

    Coupled map lattices (CMLs) are often used to study emergent phenomena in nature. It is typically assumed (unrealistically) that each component is described by the same map, and it is important to relax this assumption. In this paper, we characterize periodic orbits and the laminar regime of type-I intermittency in heterogeneous weakly coupled map lattices (HWCMLs). We show that the period of a cycle in an HWCML is preserved for arbitrarily small coupling strengths even when an associated uncoupled oscillator would experience a period-doubling cascade. Our results characterize periodic orbits both near and far from saddle-node bifurcations, and we thereby provide a key step for examining the bifurcation structure of heterogeneous CMLs.

  11. A1C

    MedlinePlus

    A1C is a blood test for type 2 diabetes and prediabetes. It measures your average blood glucose, or blood sugar, level over the past 3 ... A1C alone or in combination with other diabetes tests to make a diagnosis. They also use the ...

  12. NASA GSFC Perspective on Heterogeneous Processing

    NASA Technical Reports Server (NTRS)

    Powell, Wesley A.

    2016-01-01

    This presentation provides an overview of NASA GSFC, our onboard processing applications, the applicability heterogeneous processing to these applications, and necessary developments to enable heterogeneous processing to be infused into our missions.

  13. Temperature chaos and quenched heterogeneities

    NASA Astrophysics Data System (ADS)

    Barucca, Paolo; Parisi, Giorgio; Rizzo, Tommaso

    2014-03-01

    We present a treatable generalization of the Sherrington-Kirkpatrick (SK) model which introduces correlations in the elements of the coupling matrix through multiplicative disorder on the single variables and investigate the consequences on the phase diagram. We define a generalized qEA parameter and test the structural stability of the SK results in this correlated case evaluating the de Almeida-Thouless line of the model. As a main result we demonstrate the increase of temperature chaos effects due to heterogeneities.

  14. Analyzing and modeling heterogeneous behavior

    NASA Astrophysics Data System (ADS)

    Lin, Zhiting; Wu, Xiaoqing; He, Dongyue; Zhu, Qiang; Ni, Jixiang

    2016-05-01

    Recently, it was pointed out that the non-Poisson statistics with heavy tail existed in many scenarios of human behaviors. But most of these studies claimed that power-law characterized diverse aspects of human mobility patterns. In this paper, we suggest that human behavior may not be driven by identical mechanisms and can be modeled as a Semi-Markov Modulated Process. To verify our suggestion and model, we analyzed a total of 1,619,934 records of library visitations (including undergraduate and graduate students). It is found that the distribution of visitation intervals is well fitted with three sections of lines instead of the traditional power law distribution in log-log scale. The results confirm that some human behaviors cannot be simply expressed as power law or any other simple functions. At the same time, we divided the data into groups and extracted period bursty events. Through careful analysis in different groups, we drew a conclusion that aggregate behavior might be composed of heterogeneous behaviors, and even the behaviors of the same type tended to be different in different period. The aggregate behavior is supposed to be formed by "heterogeneous groups". We performed a series of experiments. Simulation results showed that we just needed to set up two states Semi-Markov Modulated Process to construct proper representation of heterogeneous behavior.

  15. Heterogeneous nucleation or homogeneous nucleation?

    NASA Astrophysics Data System (ADS)

    Liu, X. Y.

    2000-06-01

    The generic heterogeneous effect of foreign particles on three dimensional nucleation was examined both theoretically and experimentally. It shows that the nucleation observed under normal conditions includes a sequence of progressive heterogeneous processes, characterized by different interfacial correlation function f(m,x)s. At low supersaturations, nucleation will be controlled by the process with a small interfacial correlation function f(m,x), which results from a strong interaction and good structural match between the foreign bodies and the crystallizing phase. At high supersaturations, nucleation on foreign particles having a weak interaction and poor structural match with the crystallizing phase (f(m,x)→1) will govern the kinetics. This frequently leads to the false identification of homogeneous nucleation. Genuine homogeneous nucleation, which is the up-limit of heterogeneous nucleation, may not be easily achievable under gravity. In order to check these results, the prediction is confronted with nucleation experiments of some organic and inorganic crystals. The results are in excellent agreement with the theory.

  16. Genetic heterogeneity in multiple epiphyseal dysplasia

    SciTech Connect

    Deere, M.; Blanton, S.H.; Scott, C.I.

    1994-09-01

    Multiple epiphyseal dysplasia (MED) is generally an autosomal dominant hereditary chondrodystrophy characterized by abnormal epiphyseal centers of the long bones. There are at least two clinical and radiographical MED phenotypes, Fairbank and Ribbing forms, with the former having been better characterized. While less frequent, there are also reports of an autosomal recessive type which does not differ radiographically from the autosomal dominant type. Recently, a family with MED has been shown to map to the pericentromeric region of chromosome 19. We have tested linkage to six short tandem repeat markers from chromosome 19 in three multigenerational families with Fairbank MED and another MED family in which there were three of seven affected siblings with unaffected parents. The three families with autosomal dominant MED were linked to D19S215 with a maximum lod score of 3.82 at {theta} = 0.0. Linkage to chromosome 19 was excluded in the fourth family under autosomal recessive and autosomal dominant models with either reduced penetrance or germline mosaicism. Lod scores were -{infinity} and -2.37 at {theta} = 0.0 for D19S215, respectively. Linkage to candidate genes, Col9A1, Col9A2, and Col11A1 was tested and excluded for both models in this family. Col11A1 was excluded under a recessive model. We have confirmed linkage of MED, Fairbank, to chromosome 19 and demonstrated that MED is genetically heterogeneous.

  17. Investigating Population Heterogeneity With Factor Mixture Models

    ERIC Educational Resources Information Center

    Lubke, Gitta H.; Muthen, Bengt

    2005-01-01

    Sources of population heterogeneity may or may not be observed. If the sources of heterogeneity are observed (e.g., gender), the sample can be split into groups and the data analyzed with methods for multiple groups. If the sources of population heterogeneity are unobserved, the data can be analyzed with latent class models. Factor mixture models…

  18. Nuclear weapons and nuclear war

    SciTech Connect

    Cassel, C.; McCally, M.; Abraham, H.

    1984-01-01

    This book examines the potential radiation hazards and environmental impacts of nuclear weapons. Topics considered include medical responsibility and thermonuclear war, the threat of nuclear war, nuclear weaponry, biological effects, radiation injury, decontamination, long-term effects, ecological effects, psychological aspects, the economic implications of nuclear weapons and war, ethics, civil defense, arms control, nuclear winter, and long-term biological consequences of nuclear war.

  19. Nuclear Theory - Nuclear Power

    NASA Astrophysics Data System (ADS)

    Svenne, J. P.; Canton, L.; Kozier, K. S.

    2008-01-01

    The results from modern nuclear theory are accurate and reliable enough to be used for practical applications, in particular for scattering that involves few-nucleon systems of importance to nuclear power. Using well-established nucleon-nucleon (NN) interactions that fit well the NN scattering data, and the AGS form of the three-body theory, we have performed precise calculations of low-energy neutron-deuteron (n+d) scattering. We show that three-nucleon force effects that have impact on the low-energy vector analyzing powers have no practical effects on the angular distribution of the n+d cross-section. There appear to be problems for this scattering in the evaluated nuclear data file (ENDF) libraries, at the incident neutron energies less than 3.2 MeV. Supporting experimental data in this energy region are rather old (>25 years), sparse and often inconsistent. Our three-body results at low energies, 50 keV to 10.0 MeV, are compared to the ENDF/B-VII.0 and JENDL (Japanese Evaluated Nuclear Data Library) -3.3 evaluated angular distributions. The impact of these results on the calculated reactivity for various critical systems involving heavy water is shown.

  20. A1C Test

    MedlinePlus

    ... to minimize the complications caused by chronically elevated glucose levels, such as progressive damage to body organs like the kidneys, eyes, cardiovascular system, and nerves. The A1c test result ...

  1. Nuclear choices

    SciTech Connect

    Wolfson, R.

    1991-01-01

    This book contains part of the series New Liberal Arts, which is intended to make science and technology more accessible to students of the liberal arts. Volume in hand provides a comprehensive, multifaceted examination of nuclear energy, in nontechnical terms. Wolfson explains the basics of nuclear energy and radiation, nuclear power..., and nuclear weapons..., and he invites readers to make their own judgments on controversial nuclear issues. Illustrated with photos and diagrams. Each chapter contains suggestions for additional reading and a glossary. For policy, science, and general collections in all libraries. (ES) Topics contained include Atoms and nuclei. Effects and uses of radiation. Energy and People. Reactor safety. Nuclear strategy. Defense in the nuclear age. Nuclear power, nuclear weapons, and nuclear futures.

  2. Root Patterns in Heterogeneous Soils

    NASA Astrophysics Data System (ADS)

    Dara, A.; Moradi, A. B.; Carminati, A.; Oswald, S. E.

    2010-12-01

    Heterogeneous water availability is a typical characteristic of soils in which plant roots grow. Despite the intrinsic heterogeneity of soil-plant water relations, we know little about the ways how plants respond to local environmental quality. Furthermore, increasing use of soil amendments as partial water reservoirs in agriculture calls for a better understanding of plant response to soil heterogeneity. Neutron radiography is a non-invasive imaging that is highly sensitive to water and root distribution and that has high capability for monitoring spatial and temporal soil-plant water relations in heterogeneous systems. Maize plants were grown in 25 x 30 x 1 cm aluminum slabs filled with sandy soil. On the right side of the compartments a commercial water absorbent (Geohumus) was mixed with the soil. Geohumus was distributed with two patterns: mixed homogeneously with the soil, and arranged as 1-cm diameter aggregates (Fig. 1). Two irrigation treatments were applied: sufficient water irrigation and moderate water stress. Neutron radiography started 10 days after planting and has been performed twice a day for one week. At the end of the experiment, the containers were opened, the root were removed and dry root weight in different soil segments were measured. Neutron radiography showed root growth tendency towards Geohumus treated parts and preferential water uptake from Geohumus aggregates. Number and length of fine lateral roots were lower in treated areas compared to the non-treated zone and to control soil. Although corn plants showed an overall high proliferation towards the soil water sources, they decreased production of branches and fine root when water was more available near the main root parts. However there was 50% higher C allocation in roots grown in Geohumus compartments, as derived by the relative dry weight of root. The preferential C allocation in treated regions was higher when plants grew under water stress. We conclude that in addition to the

  3. Synchronization in growing heterogeneous media

    NASA Astrophysics Data System (ADS)

    Chen, W.; Cheng, S. C.; Avalos, E.; Drugova, O.; Osipov, G.; Lai, Pik-Yin; Chan, C. K.

    2009-04-01

    Synchronization of heterogeneous systems that consist of oscillatory and passive elements are studied in cardiac myocytes/fibroblasts co-cultures. It is found that beating clusters of cardiac myocytes surrounded by fibroblasts will be formed. The beatings of the cardiac myocyte clusters are not correlated at early times, but get synchronized as the cultures mature. This synchronization can be understood by a Kuramoto model with a time-increasing coupling strength. Our findings show that the growth of the coupling strength between clusters is linear, while the overall wave dynamics of the system is controlled by the passive fibroblast in the system which presumably is growing exponentially.

  4. A Heterogeneous Medium Analytical Benchmark

    SciTech Connect

    Ganapol, B.D.

    1999-09-27

    A benchmark, called benchmark BLUE, has been developed for one-group neutral particle (neutron or photon) transport in a one-dimensional sub-critical heterogeneous plane parallel medium with surface illumination. General anisotropic scattering is accommodated through the Green's Function Method (GFM). Numerical Fourier transform inversion is used to generate the required Green's functions which are kernels to coupled integral equations that give the exiting angular fluxes. The interior scalar flux is then obtained through quadrature. A compound iterative procedure for quadrature order and slab surface source convergence provides highly accurate benchmark qualities (4- to 5- places of accuracy) results.

  5. Cellulose conversion under heterogeneous catalysis.

    PubMed

    Dhepe, Paresh L; Fukuoka, Atsushi

    2008-01-01

    In view of current problems such as global warming, high oil prices, food crisis, stricter environmental laws, and other geopolitical scenarios surrounding the use of fossil feedstocks and edible resources, the efficient conversion of cellulose, a non-food biomass, into energy, fuels, and chemicals has received much attention. The application of heterogeneous catalysis could allow researchers to develop environmentally benign processes that lead to selective formation of value-added products from cellulose under relatively mild conditions. This Minireview gives insight into the importance of biomass utilization, the current status of cellulose conversion, and further transformation of the primary products obtained.

  6. A dynamic fuel cycle analysis for a heterogeneous thorium-DUPIC recycle in CANDU reactors

    SciTech Connect

    Jeong, C. J.; Park, C. J.; Choi, H.

    2006-07-01

    A heterogeneous thorium fuel recycle scenario in a Canada deuterium uranium (CANDU) reactor has been analyzed by the dynamic analysis method. The thorium recycling is performed through a dry process which has a strong proliferation resistance. In the fuel cycle model, the existing nuclear power plant construction plan was considered up to 2016, while the nuclear demand growth rate from the year 2016 was assumed to be 0%. In this analysis, the spent fuel inventory as well as the amount of plutonium, minor actinides, and fission products of a multiple thorium recycling fuel cycle were estimated and compared to those of the once-through fuel cycle. The analysis results have shown that the heterogeneous thorium fuel cycle can be constructed through the dry process technology. It is also shown that the heterogeneous thorium fuel cycle can reduce the spent fuel inventory and save on the natural uranium resources when compared with the once-through cycle. (authors)

  7. Genetic heterogeneity in multiple epiphyseal dysplasia

    SciTech Connect

    Deere, M.; Hecht, J.T.; Blanton, S.H.; Scott, C.I.; Langer, L.O.; Pauli, R.M.

    1995-03-01

    Multiple epiphyseal dysplasia (MED) comprises a group of hereditary chondrodysplasias in which there are major anatomic abnormalities of the long tubular bones. The Fairbank and Ribbing types are the most frequently cited types of MED. They are primarily defined radiographically and are autosomal dominant conditions. Recently, MED in one family was shown to map to the pericentromeric region of chromosome 19 and is probably allelic to pseudoachondroplasa. We have tested linkage with six short tandem repeat markers from chromosome 19 to autosomal dominant MED in one four-generation family and to MED in a unique family with three of seven siblings affected and with unaffected parents. Autosomal dominant MED in family 1 was linked with a maximum LOD score, at D19S212, of 3.22 at a recombination fraction ({theta}) of .00. Linkage to chromosome 19 was excluded with MED in the other family, under both autosomal recessive and autosomal dominant, with either reduced-penetrance or germ line-mosaicism models. Linkage to candidate genes COL9A1, COL9A2, and COL11A2 was tested and excluded for both genetic models in this family. COL11A1 was excluded under a recessive model. We have confirmed linkage of autosomal dominant Fairbank MED to chromosome 19 and have demonstrated that MED is genetically heterogeneous. 16 refs., 9 figs., 3 tabs.

  8. Dispersivity in heterogeneous permeable media

    SciTech Connect

    Chesnut, D.A.

    1994-01-01

    When one fluid displaces another through a one-dimensional porous medium, the composition changes from pure displacing fluid at the inlet to pure displaced fluid some distance downstream. The distance over which an arbitrary percentage of this change occurs is defined as the mixing zone length, which increases with increasing average distance traveled by the displacement front. For continuous injection, the mixing zone size can be determined from a breakthrough curve as the time required for the effluent displacing fluid concentration to change from, say, 10% to 90%. In classical dispersion theory, the mixing zone grows in proportion to the square root of the mean distance traveled, or, equivalently, to the square root of the mean breakthrough time. In a multi-dimensional heterogeneous medium, especially at field scales, the size of the mixing zone grows almost linearly with mean distance or travel time. If an observed breakthrough curve is forced to fit the, clinical theory, the resulting effective dispersivity, instead of being constant, also increases almost linearly with the spatial or temporal scale of the problem. This occurs because the heterogeneity in flow properties creates a corresponding velocity distribution along the different flow pathways from the inlet to the outlet of the system. Mixing occurs mostly at the outlet, or wherever the fluid is sampled, rather than within the medium. In this paper, we consider the effects. of this behavior on radionuclide or other contaminant migration.

  9. Shock Initiation of Heterogeneous Explosives

    SciTech Connect

    Reaugh, J E

    2004-05-10

    The fundamental picture that shock initiation in heterogeneous explosives is caused by the linking of hot spots formed at inhomogeneities was put forward by several researchers in the 1950's and 1960's, and more recently. Our work uses the computer hardware and software developed in the Advanced Simulation and Computing (ASC) program of the U.S. Department of Energy to explicitly include heterogeneities at the scale of the explosive grains and to calculate the consequences of realistic although approximate models of explosive behavior. Our simulations are performed with ALE-3D, a three-dimensional, elastic-plastic-hydrodynamic Arbitrary Lagrange-Euler finite-difference program, which includes chemical kinetics and heat transfer, and which is under development at this laboratory. We developed the parameter values for a reactive-flow model to describe the non-ideal detonation behavior of an HMX-based explosive from the results of grain-scale simulations. In doing so, we reduced the number of free parameters that are inferred from comparison with experiment to a single one - the characteristic defect dimension. We also performed simulations of the run to detonation in small volumes of explosive. These simulations illustrate the development of the reaction zone and the acceleration of the shock front as the flame fronts start from hot spots, grow, and interact behind the shock front. In this way, our grain-scale simulations can also connect to continuum experiments directly.

  10. Socially Aware Heterogeneous Wireless Networks

    PubMed Central

    Kosmides, Pavlos; Adamopoulou, Evgenia; Demestichas, Konstantinos; Theologou, Michael; Anagnostou, Miltiades; Rouskas, Angelos

    2015-01-01

    The development of smart cities has been the epicentre of many researchers’ efforts during the past decade. One of the key requirements for smart city networks is mobility and this is the reason stable, reliable and high-quality wireless communications are needed in order to connect people and devices. Most research efforts so far, have used different kinds of wireless and sensor networks, making interoperability rather difficult to accomplish in smart cities. One common solution proposed in the recent literature is the use of software defined networks (SDNs), in order to enhance interoperability among the various heterogeneous wireless networks. In addition, SDNs can take advantage of the data retrieved from available sensors and use them as part of the intelligent decision making process contacted during the resource allocation procedure. In this paper, we propose an architecture combining heterogeneous wireless networks with social networks using SDNs. Specifically, we exploit the information retrieved from location based social networks regarding users’ locations and we attempt to predict areas that will be crowded by using specially-designed machine learning techniques. By recognizing possible crowded areas, we can provide mobile operators with recommendations about areas requiring datacell activation or deactivation. PMID:26110402

  11. Groundwater pumping by heterogeneous users

    NASA Astrophysics Data System (ADS)

    Saak, Alexander E.; Peterson, Jeffrey M.

    2012-08-01

    Farm size is a significant determinant of both groundwater-irrigated farm acreage and groundwater-irrigation-application rates per unit land area. This paper analyzes the patterns of groundwater exploitation when resource users in the area overlying a common aquifer are heterogeneous. In the presence of user heterogeneity, the common resource problem consists of inefficient dynamic and spatial allocation of groundwater because it impacts income distribution not only across periods but also across farmers. Under competitive allocation, smaller farmers pump groundwater faster if farmers have a constant marginal periodic utility of income. However, it is possible that larger farmers pump faster if the Arrow-Pratt coefficient of relative risk-aversion is sufficiently decreasing in income. A greater farm-size inequality may either moderate or amplify income inequality among farmers. Its effect on welfare depends on the curvature properties of the agricultural output function and the farmer utility of income. Also, it is shown that a flat-rate quota policy that limits the quantity of groundwater extraction per unit land area may have unintended consequences for the income distribution among farmers.

  12. Socially Aware Heterogeneous Wireless Networks.

    PubMed

    Kosmides, Pavlos; Adamopoulou, Evgenia; Demestichas, Konstantinos; Theologou, Michael; Anagnostou, Miltiades; Rouskas, Angelos

    2015-06-11

    The development of smart cities has been the epicentre of many researchers' efforts during the past decade. One of the key requirements for smart city networks is mobility and this is the reason stable, reliable and high-quality wireless communications are needed in order to connect people and devices. Most research efforts so far, have used different kinds of wireless and sensor networks, making interoperability rather difficult to accomplish in smart cities. One common solution proposed in the recent literature is the use of software defined networks (SDNs), in order to enhance interoperability among the various heterogeneous wireless networks. In addition, SDNs can take advantage of the data retrieved from available sensors and use them as part of the intelligent decision making process contacted during the resource allocation procedure. In this paper, we propose an architecture combining heterogeneous wireless networks with social networks using SDNs. Specifically, we exploit the information retrieved from location based social networks regarding users' locations and we attempt to predict areas that will be crowded by using specially-designed machine learning techniques. By recognizing possible crowded areas, we can provide mobile operators with recommendations about areas requiring datacell activation or deactivation.

  13. Heterogeneous Transmutation Sodium Fast Reactor

    SciTech Connect

    S. E. Bays

    2007-09-01

    The threshold-fission (fertile) nature of Am-241 is used to destroy this minor actinide by capitalizing upon neutron capture instead of fission within a sodium fast reactor. This neutron-capture and its subsequent decay chain leads to the breeding of even neutron number plutonium isotopes. A slightly moderated target design is proposed for breeding plutonium in an axial blanket located above the active “fast reactor” driver fuel region. A parametric study on the core height and fuel pin diameter-to-pitch ratio is used to explore the reactor and fuel cycle aspects of this design. This study resulted in both non-flattened and flattened core geometries. Both of these designs demonstrated a high capacity for removing americium from the fuel cycle. A reactivity coefficient analysis revealed that this heterogeneous design will have comparable safety aspects to a homogeneous reactor of comparable size. A mass balance analysis revealed that the heterogeneous design may reduce the number of fast reactors needed to close the current once-through light water reactor fuel cycle.

  14. Socially Aware Heterogeneous Wireless Networks.

    PubMed

    Kosmides, Pavlos; Adamopoulou, Evgenia; Demestichas, Konstantinos; Theologou, Michael; Anagnostou, Miltiades; Rouskas, Angelos

    2015-01-01

    The development of smart cities has been the epicentre of many researchers' efforts during the past decade. One of the key requirements for smart city networks is mobility and this is the reason stable, reliable and high-quality wireless communications are needed in order to connect people and devices. Most research efforts so far, have used different kinds of wireless and sensor networks, making interoperability rather difficult to accomplish in smart cities. One common solution proposed in the recent literature is the use of software defined networks (SDNs), in order to enhance interoperability among the various heterogeneous wireless networks. In addition, SDNs can take advantage of the data retrieved from available sensors and use them as part of the intelligent decision making process contacted during the resource allocation procedure. In this paper, we propose an architecture combining heterogeneous wireless networks with social networks using SDNs. Specifically, we exploit the information retrieved from location based social networks regarding users' locations and we attempt to predict areas that will be crowded by using specially-designed machine learning techniques. By recognizing possible crowded areas, we can provide mobile operators with recommendations about areas requiring datacell activation or deactivation. PMID:26110402

  15. Dynamic Heterogeneity in Lipid Structures

    NASA Astrophysics Data System (ADS)

    Othon, Christina; Dadashvand, Neda

    2015-03-01

    We have characterized the temperature and pressure dependent scaling of dynamic heterogeneity in a homogenous liquid phase of a lipid monolayer using time-resolved fluorescence anisotropy (TRFA) microscopy. Rotational diffusion is far more sensitive to highly correlated motions than translational diffusion due to the enhanced influence of nearest neighbor interactions. Highly correlated motion results in regions of high-density, low mobility lipids, and low-density, high mobility lipids; and are observed as the bimodal distribution of rotational correlation times. For biological lipid membranes the presence of highly correlated motion will greatly influence the rates of protein sorting and self-assembly, as particles suspended in the fluid can become kinetically trapped. Rotational diffusion timescales (~ ns) are far shorter than the lifetime of dynamic clusters and lipid raft-like structures (~ 10 μs), and thus the distribution of rotational correlation times can provide critical insight into the presence of these structures. We have characterized rotational dynamic distributions for a variety of phosphocholine moieties, and found dynamics consistent with highly correlated motion. Using the proximity to the phase transition, and the scaling of the temperature dependence of the heterogeneity we apply theoretical models developed for other condensed matter systems help us define limits on the size and lifetime of dynamic clusters in lipid structures. corresponding author

  16. Thermal properties of heterogeneous grains

    NASA Technical Reports Server (NTRS)

    Lien, David J.

    1988-01-01

    Cometary dust is not spherical nor homogeneous, yet these are the assumptions used to model its thermal, optical, and dynamical properties. To better understand the effects of heterogeneity on the thermal and optical properties of dust grains, the effective dielectric constant for an admixture of magnetite and a silicate were calculated using two different effective medium theories: the Maxwell-Garnett theory and the Bruggeman theory. In concept, the MG theory describes the effective dielectric constant of a matrix material into which is embedded a large number of very small inclusions of a second material. The Bruggeman theory describes the dielectric constant of a well mixed aggregate of two or more types of materials. Both theories assume that the individual particles are much smaller than the wavelength of the incident radiation. The refractivity for a heterogeneous grain using the MG theory is very similar to the refractivity of the matrix material, even for large volume fractions of the inclusion. The equilibrium grain temperature for spherical particles sized from .001 to 100 microns in radius at 1 astronomical unit from the sun was calculated. Further explanation is given.

  17. Nuclear Winter.

    ERIC Educational Resources Information Center

    Ehrlich, Anne

    1984-01-01

    "Nuclear Winter" was recently coined to describe the climatic and biological effects of a nuclear war. These effects are discussed based on models, simulations, scenarios, and projections. Effects on human populations are also considered. (JN)

  18. Nuclear Chemistry.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1979

    1979-01-01

    Provides a brief review of the latest developments in nuclear chemistry. Nuclear research today is directed toward increased activity in radiopharmaceuticals and formation of new isotopes by high-energy, heavy-ion collisions. (Author/BB)

  19. Nuclear Scans

    MedlinePlus

    Nuclear scans use radioactive substances to see structures and functions inside your body. They use a special ... images. Most scans take 20 to 45 minutes. Nuclear scans can help doctors diagnose many conditions, including ...

  20. Weakly bound states in heterogeneous waveguides

    NASA Astrophysics Data System (ADS)

    Amore, Paolo; Fernández, Francisco M.; Hofmann, Christoph P.

    2016-07-01

    We study the spectrum of the Helmholtz equation in a two-dimensional infinite waveguide, containing a weak heterogeneity localized at an internal point, and obeying Dirichlet boundary conditions at its border. We use the variational theorem to derive the condition for which the lowest eigenvalue of the spectrum falls below the continuum threshold and a bound state appears, localized at the heterogeneity. We devise a rigorous perturbation scheme and derive the exact expression for the energy to third order in the heterogeneity.

  1. Data Integration for Heterogenous Datasets

    PubMed Central

    2014-01-01

    Abstract More and more, the needs of data analysts are requiring the use of data outside the control of their own organizations. The increasing amount of data available on the Web, the new technologies for linking data across datasets, and the increasing need to integrate structured and unstructured data are all driving this trend. In this article, we provide a technical overview of the emerging “broad data” area, in which the variety of heterogeneous data being used, rather than the scale of the data being analyzed, is the limiting factor in data analysis efforts. The article explores some of the emerging themes in data discovery, data integration, linked data, and the combination of structured and unstructured data. PMID:25553272

  2. Genetic heterogeneity of hepatocellular carcinoma

    SciTech Connect

    Unsal, H.; Isselbacher, K.J. ); Yakicier, C.; Marcais, C.; Ozturk, M. ); Kew, M. ); Volkmann, M. ); Zentgraf, H. )

    1994-01-18

    The authors studied 80 hepatocellular carcinomas from three continents for p53 gene (TP53) mutations and hepatitis B virus (HBV) sequences. p53 mutations were frequent in tumors from Mozambique but not in tumors from South Africa, China, and Germany. Independent of geographic origin, most tumors were positive for HBV sequences. X gene coding sequences of HBV were detected in 78% of tumors, whereas viral sequences in the surface antigen- and core antigen-encoding regions were present in less than 35% of tumors. These observations indicate that hepatocellular carcinomas are genetically heterogeneous. Mozambican-types of hepatocellular carcinomas are characterized by a high incidence of p53 mutations related to aflatoxins. In other tumors, the rarity of p53 mutations combined with the frequent presence of viral X gene coding sequences suggests a possible interference of HBV with the wild-type p53 function.

  3. Mesoscale poroelasticity of heterogeneous media

    NASA Astrophysics Data System (ADS)

    Monfared, Siavash; Laubie, Hadrien; Radjai, Farhang; Pellenq, Roland; Ulm, Franz-Josef

    Poroelastic behavior of heterogeneous media is revisited. Lattice Element Method (LEM) is used to model interaction between solid constituents due to a pressurized pore space. Exploring beyond mean-field based theories in continuum microporomechanics, local textural variations and its contribution to the global anisotropic poroelastic behavior of real multiphase porous media are captured. To this end, statistical distributions of mesoscale poroelastic coefficients from numerical simulations on X-ray microscopy scans of two different organic-rich shales with different microtextures are presented. The results are compared with predictions using mean-field based tools of continuum micromechanics. The textural dependency of strain localization and stress chain formation captured in this framework promises a powerful tool for modeling poroelastic response of complex porous composites and a path to incorporate local textural and elastic variations into a continuum description. Visiting Scientist, CNRS-MIT, MIT.

  4. HETEROGENEOUS REBURNING BY MIXED FUELS

    SciTech Connect

    Wei-Yin Chen; Benson B. Gathitu

    2005-01-14

    Recent studies of heterogeneous reburning, i.e., reburning involving a coal-derived char, have elucidated its variables, kinetics and mechanisms that are valuable to the development of a highly efficient reburning process. Young lignite chars contain catalysts that not only reduce NO, but they also reduce HCN that is an important intermediate that recycles to NO in the burnout zone. Gaseous CO scavenges the surface oxides that are formed during NO reduction, regenerating the active sites on the char surface. Based on this mechanistic information, cost-effective mixed fuels containing these multiple features has been designed and tested in a simulated reburning apparatus. Remarkably high reduction of NO and HCN has been observed and it is anticipated that mixed fuel will remove 85% of NO in a three-stage reburning process.

  5. Heterogeneous fuel for hybrid rocket

    NASA Technical Reports Server (NTRS)

    Stickler, David B. (Inventor)

    1996-01-01

    Heterogeneous fuel compositions suitable for use in hybrid rocket engines and solid-fuel ramjet engines, The compositions include mixtures of a continuous phase, which forms a solid matrix, and a dispersed phase permanently distributed therein. The dispersed phase or the matrix vaporizes (or melts) and disperses into the gas flow much more rapidly than the other, creating depressions, voids and bumps within and on the surface of the remaining bulk material that continuously roughen its surface, This effect substantially enhances heat transfer from the combusting gas flow to the fuel surface, producing a correspondingly high burning rate, The dispersed phase may include solid particles, entrained liquid droplets, or gas-phase voids having dimensions roughly similar to the displacement scale height of the gas-flow boundary layer generated during combustion.

  6. Heterogeneous Reburning By Mixed Fuels

    SciTech Connect

    Anderson Hall

    2009-03-31

    Recent studies of heterogeneous reburning, i.e., reburning involving a coal-derived char, have elucidated its variables, kinetics and mechanisms that are valuable to the development of a highly efficient reburning process. Young lignite chars contain catalysts that not only reduce NO, but they also reduce HCN that is an important intermediate that recycles to NO in the burnout zone. Gaseous CO scavenges the surface oxides that are formed during NO reduction, regenerating the active sites on the char surface. Based on this mechanistic information, cost-effective mixed fuels containing these multiple features has been designed and tested in a simulated reburning apparatus. Remarkably high reduction of NO and HCN has been observed and it is anticipated that mixed fuel will remove 85% of NO in a three-stage reburning process.

  7. Evaporation from heterogeneous soil surfaces

    NASA Astrophysics Data System (ADS)

    Lehmann, P.; Or, D.

    2009-04-01

    Evaporation rate is a key process of water exchange between soil surfaces and atmosphere and is controlled by both atmospheric demand and soil hydraulic properties. Initially high evaporation rates are sustained by capillary-induced water flow from receding drying front to evaporating surface. In heterogeneous soils air invades preferentially coarse-textured regions whereas fine textured surface regions remain water saturated. We investigated experimentally and numerically effects of hydraulic coupling on drying rate of heterogeneous porous media. Laboratory experiments with vertical contrasts between fine (0.1-0.5 mm) and coarse sand (0.3-0.9 mm) showed that the period of high drying rate was extended compared to evaporation from homogeneous materials. Water flow from coarse material to supply water evaporated from fine textured surface was monitored by neutron radiography imaging. Due to the high hydraulic conductivity of the coarse material the viscous head loss could be neglected for flow distances analyzed in the experiments (< 600 mm). We proposed a model to explore effects of hydraulic coupling on evaporation for a wide range of soil textural classes at plot scale. When the drying front in the coarse reaches a certain characteristic depth (defined by the pore size distribution) no water evaporates from the coarse surface, yet, subsurface flow from coarse to the fine textured inclusion persists and feeds enhanced evaporation rate. Assuming energy input was not limiting, evaporation from the fine textured inclusion may increase to compensate reduction of evaporating surface. For loam or silt as inclusion in sandy material, water was extracted from regions with more than 10 m in distance before flow was limited by viscous effects. In case of clay inclusions the radius of water extraction was smaller due to enhanced viscous resistance. The findings of the numerical study can be applied as well to assess the effect of shrubs or compacted trafficked zones on the

  8. Transmissivity of a heterogeneous formation

    NASA Astrophysics Data System (ADS)

    Dykaar, Bruce B.; Kitanidis, Peter K.

    1993-04-01

    The objective of this paper is to derive the transmissivity of an equivalent homogeneous medium having the same macroscopic flow behavior as the actual heterogeneous formation. We apply generalized Taylor-Ans moment analysis in order to determine the phenomenological coefficient of transmissivity for the case of saturated flow confined in a heterogeneous permeable formation with variable thickness. The generalized Taylor-Aris moment analysis yields a two-step procedure for determining the constant two-dimensional transmissivity tensor from the three-dimensional spatially variable conductivity tensor: solve a flow problem and then perform an integration. For the special case that the conductivity is locally isotropic and the impermeable confining surfaces are parallel, the equations governing transmissivity are discretized using a pseudospectral Fourier-Galerkin scheme. The resultant system of linear algebraic equations is solved efficiently, using preconditioned conjugate gradients, in order Nt In (Nt) operations, where Nt is the number of spatial discretization points. The numerical method is used in several examples to compute the transmissivity of lognormally distributed hydraulic conductivity, and the results are compared with the transmissivity found using the usual depth-averaging approach and another method suggested in the literature. The numerical results show that the averaging volume required to obtain an effective value of transmissivity is about 10 horizontal integral scales. When the flow field has a significant three-dimensional character, the standard method of finding transmissivities by depth averaging can lead to significant errors in the prediction of global scale flows. It is shown that depth averaging consistently overestimates transmissivities. An example illustrates how in the case of tilted strata, anisotropic transmissivities arise and how the degree of transmissivity anisotropy depends on the angle of the dip and the horizontal to

  9. Toward understanding and exploiting tumor heterogeneity

    PubMed Central

    Alizadeh, Ash A; Aranda, Victoria; Bardelli, Alberto; Blanpain, Cedric; Bock, Christoph; Borowski, Christine; Caldas, Carlos; Califano, Andrea; Doherty, Michael; Elsner, Markus; Esteller, Manel; Fitzgerald, Rebecca; Korbel, Jan O; Lichter, Peter; Mason, Christopher E; Navin, Nicholas; Pe’er, Dana; Polyak, Kornelia; Roberts, Charles W M; Siu, Lillian; Snyder, Alexandra; Stower, Hannah; Swanton, Charles; Verhaak, Roel G W; Zenklusen, Jean C; Zuber, Johannes; Zucman-Rossi, Jessica

    2016-01-01

    The extent of tumor heterogeneity is an emerging theme that researchers are only beginning to understand. How genetic and epigenetic heterogeneity affects tumor evolution and clinical progression is unknown. The precise nature of the environmental factors that influence this heterogeneity is also yet to be characterized. Nature Medicine, Nature Biotechnology and the Volkswagen Foundation organized a meeting focused on identifying the obstacles that need to be overcome to advance translational research in and tumor heterogeneity. Once these key questions were established, the attendees devised potential solutions. Their ideas are presented here. PMID:26248267

  10. Toward understanding and exploiting tumor heterogeneity.

    PubMed

    Alizadeh, Ash A; Aranda, Victoria; Bardelli, Alberto; Blanpain, Cedric; Bock, Christoph; Borowski, Christine; Caldas, Carlos; Califano, Andrea; Doherty, Michael; Elsner, Markus; Esteller, Manel; Fitzgerald, Rebecca; Korbel, Jan O; Lichter, Peter; Mason, Christopher E; Navin, Nicholas; Pe'er, Dana; Polyak, Kornelia; Roberts, Charles W M; Siu, Lillian; Snyder, Alexandra; Stower, Hannah; Swanton, Charles; Verhaak, Roel G W; Zenklusen, Jean C; Zuber, Johannes; Zucman-Rossi, Jessica

    2015-08-01

    The extent of tumor heterogeneity is an emerging theme that researchers are only beginning to understand. How genetic and epigenetic heterogeneity affects tumor evolution and clinical progression is unknown. The precise nature of the environmental factors that influence this heterogeneity is also yet to be characterized. Nature Medicine, Nature Biotechnology and the Volkswagen Foundation organized a meeting focused on identifying the obstacles that need to be overcome to advance translational research in and tumor heterogeneity. Once these key questions were established, the attendees devised potential solutions. Their ideas are presented here. PMID:26248267

  11. Learning Heterogeneous Hidden Markov Random Fields

    PubMed Central

    Liu, Jie; Zhang, Chunming; Burnside, Elizabeth; Page, David

    2014-01-01

    Hidden Markov random fields (HMRFs) are conventionally assumed to be homogeneous in the sense that the potential functions are invariant across different sites. However in some biological applications, it is desirable to make HMRFs heterogeneous, especially when there exists some background knowledge about how the potential functions vary. We formally define heterogeneous HMRFs and propose an EM algorithm whose M-step combines a contrastive divergence learner with a kernel smoothing step to incorporate the background knowledge. Simulations show that our algorithm is effective for learning heterogeneous HMRFs and outperforms alternative binning methods. We learn a heterogeneous HMRF in a real-world study. PMID:25404989

  12. Nuclear Fuels.

    ERIC Educational Resources Information Center

    Nash, J. Thomas

    1983-01-01

    Trends in and factors related to the nuclear industry and nuclear fuel production are discussed. Topics addressed include nuclear reactors, survival of the U.S. uranium industry, production costs, budget cuts by the Department of Energy and U.S. Geological survey for resource studies, mining, and research/development activities. (JN)

  13. MRI of Heterogeneous Hydrogenation Reactions Using Parahydrogen Polarization

    SciTech Connect

    Burt, Scott Russell

    2008-01-01

    The power of magnetic resonance imaging (MRI) is its ability to image the internal structure of optically opaque samples and provide detailed maps of a variety of important parameters, such as density, diffusion, velocity and temperature. However, one of the fundamental limitations of this technique is its inherent low sensitivity. For example, the low signal to noise ratio (SNR) is particularly problematic for imaging gases in porous materials due to the low density of the gas and the large volume occluded by the porous material. This is unfortunate, as many industrially relevant chemical reactions take place at gas-surface interfaces in porous media, such as packed catalyst beds. Because of this severe SNR problem, many techniques have been developed to directly increase the signal strength. These techniques work by manipulating the nuclear spin populations to produce polarized} (i.e., non-equilibrium) states with resulting signal strengths that are orders of magnitude larger than those available at thermal equilibrium. This dissertation is concerned with an extension of a polarization technique based on the properties of parahydrogen. Specifically, I report on the novel use of heterogeneous catalysis to produce parahydrogen induced polarization and applications of this new technique to gas phase MRI and the characterization of micro-reactors. First, I provide an overview of nuclear magnetic resonance (NMR) and how parahydrogen is used to improve the SNR of the NMR signal. I then present experimental results demonstrating that it is possible to use heterogeneous catalysis to produce parahydrogen-induced polarization. These results are extended to imaging void spaces using a parahydrogen polarized gas. In the second half of this dissertation, I demonstrate the use of parahydrogen-polarized gas-phase MRI for characterizing catalytic microreactors. Specifically, I show how the improved SNR allows one to map parameters important for characterizing the heat and mass

  14. Nuclear weapons, nuclear effects, nuclear war

    SciTech Connect

    Bing, G.F.

    1991-08-20

    This paper provides a brief and mostly non-technical description of the militarily important features of nuclear weapons, of the physical phenomena associated with individual explosions, and of the expected or possible results of the use of many weapons in a nuclear war. Most emphasis is on the effects of so-called ``strategic exchanges.``

  15. Heterogonous Nanofluids for Nuclear Power Plants

    NASA Astrophysics Data System (ADS)

    Alammar, Khalid

    2014-09-01

    Nuclear reactions can be associated with high heat energy release. Extracting such energy efficiently requires the use of high-rate heat exchangers. Conventional heat transfer fluids, such as water and oils are limited in their thermal conductivity, and hence nanofluids have been introduced lately to overcome such limitation. By suspending metal nanoparticles with high thermal conductivity in conventional heat transfer fluids, thermal conductivity of the resulting homogeneous nanofluid is increased. Heterogeneous nanofluids offer yet more potential for heat transfer enhancement. By stratifying nanoparticles within the boundary layer, thermal conductivity is increased where temperature gradients are highest, thereby increasing overall heat transfer of a flowing fluid. In order to test the merit of this novel technique, a numerical study of a laminar pipe flow of a heterogeneous nanofluid was conducted. Effect of Iron-Oxide distribution on flow and heat transfer characteristics was investigated. With Iron-Oxide volume concentration of 0.009 in water, up to 50% local heat transfer enhancement was predicted for the heterogeneous compared to homogeneous nanofluids. Increasing the Reynolds number is shown to increase enhancement while having negligible effect on pressure drop. Using permanent magnets attached externally to the pipe, an experimental investigation conducted at MIT nuclear reactor laboratory for similar flow characteristics of a heterogeneous nanofluid have shown upto 160% enhancement in heat transfer. Such results show that heterogeneous nanofluids are promising for augmenting heat transfer rates in nuclear power heat exchanger systems.

  16. Emergence of Collagen Orientation Heterogeneity in Healing Infarcts and an Agent-Based Model.

    PubMed

    Richardson, William J; Holmes, Jeffrey W

    2016-05-24

    Spatial heterogeneity of matrix structure can be an important determinant of tissue function. Although bulk properties of collagen structure in healing myocardial infarcts have been characterized previously, regional heterogeneity in infarct structure has received minimal attention. Herein, we quantified regional variations of collagen and nuclear orientations over the initial weeks of healing after infarction in rats, and employed a computational model of infarct remodeling to test potential explanations for the heterogeneity we observed in vivo. Fiber and cell orientation maps were generated from infarct samples acquired previously at 1, 2, 3, and 6 weeks postinfarction in a rat ligation model. We analyzed heterogeneity by calculating the dot product of each fiber or cell orientation vector with every other fiber or cell orientation vector, and plotting that dot product versus distance between the fibers or cells. This analysis revealed prominent regional heterogeneity, with alignment of both fibers and cell nuclei in local pockets far exceeding the global average. Using an agent-based model of fibroblast-mediated collagen remodeling, we found that similar levels of heterogeneity can spontaneously emerge from initially isotropic matrix via locally reinforcing cell-matrix interactions. Specifically, cells that sensed fiber orientation at a distance or remodeled fibers at a distance by traction-mediated reorientation or aligned deposition gave rise to regionally heterogeneous structures. However, only the simulations in which cells deposited collagen fibers aligned with their own orientation reproduced experimentally measured patterns of heterogeneity across all time points. These predictions warrant experimental follow-up to test the role of such mechanisms in vivo and identify opportunities to control heterogeneity for therapeutic benefit. PMID:27224491

  17. Functional conservation of the transportin nuclear import pathway in divergent organisms.

    PubMed

    Siomi, M C; Fromont, M; Rain, J C; Wan, L; Wang, F; Legrain, P; Dreyfuss, G

    1998-07-01

    Human transportin1 (hTRN1) is the nuclear import receptor for a group of pre-mRNA/mRNA-binding proteins (heterogeneous nuclear ribonucleoproteins [hnRNP]) represented by hnRNP A1, which shuttle continuously between the nucleus and the cytoplasm. hTRN1 interacts with the M9 region of hnRNP A1, a 38-amino-acid domain rich in Gly, Ser, and Asn, and mediates the nuclear import of M9-bearing proteins in vitro. Saccharomyces cerevisiae transportin (yTRN; also known as YBR017c or Kap104p) has been identified and cloned. To understanding the nuclear import mediated by yTRN, we searched with a yeast two-hybrid system for proteins that interact with it. In an exhaustive screen of the S. cerevisiae genome, the most frequently selected open reading frame was the nuclear mRNA-binding protein, Nab2p. We delineated a ca.-50-amino-acid region in Nab2p, termed NAB35, which specifically binds yTRN and is similar to the M9 motif. NAB35 also interacts with hTRN1 and functions as a nuclear localization signal in mammalian cells. Interestingly, yTRN can also mediate the import of NAB35-bearing proteins into mammalian nuclei in vitro. We also report on additional substrates for TRN as well as sequences of Drosophila melanogaster, Xenopus laevis, and Schizosaccharomyces pombe TRNs. Together, these findings demonstrate that both the M9 signal and the nuclear import machinery utilized by the transportin pathway are conserved in evolution.

  18. Fine scale heterogeneity in the Earth's mantle - observation and interpretation

    NASA Astrophysics Data System (ADS)

    Thybo, H.

    2008-05-01

    High resolution seismic data has over the last decade provided significant evidence for pronounced fine scale heterogeneity in the Earth's mantle at an unprecedented detail. The tremendous development of seismic tomography during the last 20-30 years has led to unprecedented results of the overall structure of the mantle which can be correlated to main plate tectonic features, such as oceanic spreading centres, continental rift zones and subducting slabs. Mantle research now may also focus on much finer scale heterogeneity (e.g. Hellfrich and Wood, 2001), which may be detected and imaged with high-resolution seismic data with dense station spacing and at high frequency, e.g. from the Russian Peaceful Nuclear Explosion (PNE) data set and array recordings of waves from natural seismic sources. Mantle body waves indicate pronounced heterogeneity at three depth levels whereas other depth intervals appear transparent, at least in the frequency band of 0.5-15 Hz: (1) The Mantle Low-Velocity Zone (LVZ) is a global feature which has been detected in more than 50 long-range seismic profiles. The data demonstrates that the top of the LVZ everywhere is at a depth of 100±20 km. A pronounced coda shows that the zone is highly heterogeneous at characteristic scale lengths of 5-15 by 2-6 km. We interpret that the rocks in the LVZ globally have a temperature close to the solidus or even may contain small fractions of partial melt. The solidus of mantle rocks is very low below a depth of ca. 90 km if volatiles are present. We suggest that the rocks are in a totally solid state below the LVZ, this depth being an indicator of the thermal state of the upper mantle (e.g. Thybo, 2006, Nielsen and Thybo 2006). (2) Significant scattering from around the top of the Mantle Transition Zone indicates the presence of highly heterogeneous depth intervals above and below the 410 km discontinuity at a characteristic scale length of 8-20 by 3-8 km. These observations may be explained by either (i

  19. Fine scale heterogeneity in the Earth's mantle - observation and interpretation

    NASA Astrophysics Data System (ADS)

    Thybo, H.

    2012-12-01

    High resolution seismic data has over the last decade provided significant evidence for pronounced fine scale heterogeneity in the Earth's mantle at an unprecedented detail. Seismic tomography developed tremendously during the last 20-30 years. The results show overall structure in the mantle which can be correlated to main plate tectonic features, such as oceanic spreading centres, continental rift zones and subducting slabs. Much seismological mantle research is now concentrated on imaging fine scale heterogeneity, which may be detected and imaged with high-resolution seismic data with dense station spacing and at high frequency, e.g. from the Russian Peaceful Nuclear Explosion (PNE) data set and array recordings of waves from natural seismic sources. Mantle body waves indicate pronounced heterogeneity at three depth levels whereas other depth intervals appear transparent, at least in the frequency band of 0.5-15 Hz: (1) The Mantle Low-Velocity Zone (LVZ) is a global feature which has been detected in more than 50 long-range seismic profiles (Thybo and Perchuc, Science, 1997). Since then numerous studies based on receiver functions, surface waves, and controlled source seismology have confirmed the presence of this zone. The data demonstrates that the top of the LVZ everywhere is at a depth of 100±20 km. A pronounced coda shows that the zone is highly heterogeneous at characteristic scale lengths of 5-15 by 2-6 km. We interpret that the rocks in the LVZ have a temperature close to the solidus or even may contain small fractions of partial melt. The solidus of mantle rocks is very low below a depth of ca. 90 km if volatiles are present due to a characteristic kink in the solidus which is much lower than for dry mantle rocks. We suggest that the rocks are in a totally solid state below the LVZ and that the depth to the interface to fully solid rocks is an indicator of the thermal state of the upper mantle. (2) Significant scattering from around the top of the

  20. Heterogeneous Factor Analysis Models: A Bayesian Approach.

    ERIC Educational Resources Information Center

    Ansari, Asim; Jedidi, Kamel; Dube, Laurette

    2002-01-01

    Developed Markov Chain Monte Carlo procedures to perform Bayesian inference, model checking, and model comparison in heterogeneous factor analysis. Tested the approach with synthetic data and data from a consumption emotion study involving 54 consumers. Results show that traditional psychometric methods cannot fully capture the heterogeneity in…

  1. Understanding the Executive Functioning Heterogeneity in Schizophrenia

    ERIC Educational Resources Information Center

    Raffard, Stephane; Bayard, Sophie

    2012-01-01

    Schizophrenia is characterized by heterogeneous brain abnormalities involving cerebral regions implied in the executive functioning. The dysexecutive syndrome is one of the most prominent and functionally cognitive features of schizophrenia. Nevertheless, it is not clear to what extend executive deficits are heterogeneous in schizophrenia…

  2. Improving tumour heterogeneity MRI assessment with histograms

    PubMed Central

    Just, N

    2014-01-01

    By definition, tumours are heterogeneous. They are defined by marked differences in cells, microenvironmental factors (oxygenation levels, pH, VEGF, VPF and TGF-α) metabolism, vasculature, structure and function that in turn translate into heterogeneous drug delivery and therapeutic outcome. Ways to estimate quantitatively tumour heterogeneity can improve drug discovery, treatment planning and therapeutic responses. It is therefore of paramount importance to have reliable and reproducible biomarkers of cancerous lesions' heterogeneity. During the past decade, the number of studies using histogram approaches increased drastically with various magnetic resonance imaging (MRI) techniques (DCE-MRI, DWI, SWI etc.) although information on tumour heterogeneity remains poorly exploited. This fact can be attributed to a poor knowledge of the available metrics and of their specific meaning as well as to the lack of literature references to standardised histogram methods with which surrogate markers of heterogeneity can be compared. This review highlights the current knowledge and critical advances needed to investigate and quantify tumour heterogeneity. The key role of imaging techniques and in particular the key role of MRI for an accurate investigation of tumour heterogeneity is reviewed with a particular emphasis on histogram approaches and derived methods. PMID:25268373

  3. Characterizing heterogeneous cellular responses to perturbations.

    PubMed

    Slack, Michael D; Martinez, Elisabeth D; Wu, Lani F; Altschuler, Steven J

    2008-12-01

    Cellular populations have been widely observed to respond heterogeneously to perturbation. However, interpreting the observed heterogeneity is an extremely challenging problem because of the complexity of possible cellular phenotypes, the large dimension of potential perturbations, and the lack of methods for separating meaningful biological information from noise. Here, we develop an image-based approach to characterize cellular phenotypes based on patterns of signaling marker colocalization. Heterogeneous cellular populations are characterized as mixtures of phenotypically distinct subpopulations, and responses to perturbations are summarized succinctly as probabilistic redistributions of these mixtures. We apply our method to characterize the heterogeneous responses of cancer cells to a panel of drugs. We find that cells treated with drugs of (dis-)similar mechanism exhibit (dis-)similar patterns of heterogeneity. Despite the observed phenotypic diversity of cells observed within our data, low-complexity models of heterogeneity were sufficient to distinguish most classes of drug mechanism. Our approach offers a computational framework for assessing the complexity of cellular heterogeneity, investigating the degree to which perturbations induce redistributions of a limited, but nontrivial, repertoire of underlying states and revealing functional significance contained within distinct patterns of heterogeneous responses.

  4. Heterogeneity in Health Care Computing Environments

    PubMed Central

    Sengupta, Soumitra

    1989-01-01

    This paper discusses issues of heterogeneity in computer systems, networks, databases, and presentation techniques, and the problems it creates in developing integrated medical information systems. The need for institutional, comprehensive goals are emphasized. Using the Columbia-Presbyterian Medical Center's computing environment as the case study, various steps to solve the heterogeneity problem are presented.

  5. Functional Heterogeneity and Senior Management Team Effectiveness

    ERIC Educational Resources Information Center

    Benoliel, Pascale; Somech, Anit

    2016-01-01

    Purpose: There has been an increasing trend toward the creation of senior management teams (SMTs) which are characterized by a high degree of functional heterogeneity. Although such teams may create better linkages to information, along with the benefits of functional heterogeneity comes the potential for conflicts that stem from the value…

  6. TERRA, hnRNP A1, and DNA-PKcs Interactions at Human Telomeres.

    PubMed

    Le, Phuong N; Maranon, David G; Altina, Noelia H; Battaglia, Christine L R; Bailey, Susan M

    2013-01-01

    Maintenance of telomeres, repetitive elements at eukaryotic chromosomal termini, and the end-capping structure and function they provide, are imperative for preserving genome integrity and stability. The discovery that telomeres are transcribed into telomere repeat containing RNA (TERRA) has revolutionized our view of this repetitive, rather unappreciated region of the genome. We have previously shown that the non-homologous end-joining, shelterin associated DNA dependent protein kinase catalytic subunit (DNA-PKcs) participates in mammalian telomeric end-capping, exclusively at telomeres created by leading-strand synthesis. Here, we explore potential roles of DNA-PKcs and its phosphorylation target heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) in the localization of TERRA at human telomeres. Evaluation of co-localized foci utilizing RNA-FISH and three-dimensional (3D) reconstruction strategies provided evidence that both inhibition of DNA-PKcs kinase activity and siRNA depletion of hnRNP A1 result in accumulation of TERRA at individual telomeres; depletion of hnRNP A1 also resulted in increased frequencies of fragile telomeres. These observations are consistent with previous demonstrations that decreased levels of the nonsense RNA-mediated decay factors SMG1 and UPF1 increase TERRA at telomeres and interfere with replication of leading-strand telomeres. We propose that hTR mediated stimulation of DNA-PKcs and subsequent phosphorylation of hnRNP A1 influences the cell cycle dependent distribution of TERRA at telomeres by contributing to the removal of TERRA from telomeres, an action important for progression of S-phase, and thereby facilitating efficient telomere replication and end-capping.

  7. ARCHER, a New Monte Carlo Software Tool for Emerging Heterogeneous Computing Environments

    NASA Astrophysics Data System (ADS)

    Xu, X. George; Liu, Tianyu; Su, Lin; Du, Xining; Riblett, Matthew; Ji, Wei; Gu, Deyang; Carothers, Christopher D.; Shephard, Mark S.; Brown, Forrest B.; Kalra, Mannudeep K.; Liu, Bob

    2014-06-01

    The Monte Carlo radiation transport community faces a number of challenges associated with peta- and exa-scale computing systems that rely increasingly on heterogeneous architectures involving hardware accelerators such as GPUs. Existing Monte Carlo codes and methods must be strategically upgraded to meet emerging hardware and software needs. In this paper, we describe the development of a software, called ARCHER (Accelerated Radiation-transport Computations in Heterogeneous EnviRonments), which is designed as a versatile testbed for future Monte Carlo codes. Preliminary results from five projects in nuclear engineering and medical physics are presented.

  8. Thermodynamic equilibrium at heterogeneous pressure

    NASA Astrophysics Data System (ADS)

    Vrijmoed, J. C.; Podladchikov, Y. Y.

    2015-07-01

    Recent advances in metamorphic petrology point out the importance of grain-scale pressure variations in high-temperature metamorphic rocks. Pressure derived from chemical zonation using unconventional geobarometry based on equal chemical potentials fits mechanically feasible pressure variations. Here, a thermodynamic equilibrium method is presented that predicts chemical zoning as a result of pressure variations by Gibbs energy minimization. Equilibrium thermodynamic prediction of the chemical zoning in the case of pressure heterogeneity is done by constrained Gibbs minimization using linear programming techniques. In addition to constraining the system composition, a certain proportion of the system is constrained at a specified pressure. Input pressure variations need to be discretized, and each discrete pressure defines an additional constraint for the minimization. The Gibbs minimization method provides identical results to a geobarometry approach based on chemical potentials, thus validating the inferred pressure gradient. The thermodynamic consistency of the calculation is supported by the similar result obtained from two different approaches. In addition, the method can be used for multi-component, multi-phase systems of which several applications are given. A good fit to natural observations in multi-phase, multi-component systems demonstrates the possibility to explain phase assemblages and zoning by spatial pressure variations at equilibrium as an alternative to pressure variation in time due to disequilibrium.

  9. Anatomical heterogeneity of Alzheimer disease

    PubMed Central

    Noh, Young; Jeon, Seun; Seo, Sang Won; Kim, Geon Ha; Cho, Hanna; Ye, Byoung Seok; Yoon, Cindy W.; Kim, Hee Jin; Chin, Juhee; Park, Kee Hyung; Heilman, Kenneth M.

    2014-01-01

    Objective: Because the signs associated with dementia due to Alzheimer disease (AD) can be heterogeneous, the goal of this study was to use 3-dimensional MRI to examine the various patterns of cortical atrophy that can be associated with dementia of AD type, and to investigate whether AD dementia can be categorized into anatomical subtypes. Methods: High-resolution T1-weighted volumetric MRIs were taken of 152 patients in their earlier stages of AD dementia. The images were processed to measure cortical thickness, and hierarchical agglomerative cluster analysis was performed using Ward's clustering linkage. The identified clusters of patients were compared with an age- and sex-matched control group using a general linear model. Results: There were several distinct patterns of cortical atrophy and the number of patterns varied according to the level of cluster analyses. At the 3-cluster level, patients were divided into (1) bilateral medial temporal–dominant atrophy subtype (n = 52, ∼34.2%), (2) parietal-dominant subtype (n = 28, ∼18.4%) in which the bilateral parietal lobes, the precuneus, along with bilateral dorsolateral frontal lobes, were atrophic, and (3) diffuse atrophy subtype (n = 72, ∼47.4%) in which nearly all association cortices revealed atrophy. These 3 subtypes also differed in their demographic and clinical features. Conclusions: This cluster analysis of cortical thickness of the entire brain showed that AD dementia in the earlier stages can be categorized into various anatomical subtypes, with distinct clinical features. PMID:25344382

  10. NMR Measures of Heterogeneity Length

    NASA Astrophysics Data System (ADS)

    Spiess, Hans W.

    2002-03-01

    Advanced solid state NMR spectroscopy provides a wealth of information about structure and dynamics of complex systems. On a local scale, multidimensional solid state NMR has elucidated the geometry and the time scale of segmental motions at the glass transition. The higher order correlation functions which are provided by this technique led to the notion of dynamic heterogeneities, which have been characterized in detail with respect to their rate memory and length scale. In polymeric and low molar mass glass formers of different fragility, length scales in the range 2 to 4 nm are observed. In polymeric systems, incompatibility of backbone and side groups as in polyalkylmethacrylates leads to heteogeneities on the nm scale, which manifest themselves in unusual chain dynamics at the glass transition involving extended chain conformations. References: K. Schmidt-Rohr and H.W. Spiess, Multidimensional Solid-State NMR and Polymers,Academic Press, London (1994). U. Tracht, M. Wilhelm, A. Heuer, H. Feng, K. Schmidt-Rohr, H.W. Spiess, Phys. Rev. Lett. 81, 2727 (1998). S.A. Reinsberg, X.H. Qiu, M. Wilhelm, M.D. Ediger, H.W. Spiess, J.Chem.Phys. 114, 7299 (2001). S.A. Reinsberg, A. Heuer, B. Doliwa, H. Zimmermann, H.W. Spiess, J. Non-Crystal. Solids, in press (2002)

  11. Genetic heterogeneity in osteogenesis imperfecta.

    PubMed Central

    Sillence, D O; Senn, A; Danks, D M

    1979-01-01

    An epidemiological and genetical study of osteogenesis imperfecta (OI) in Victoria, Australia confirmed that there are at least four distinct syndromes at present called OI. The largest group of patients showed autosomal dominant inheritance of osteoporosis leading to fractures and distinctly blue sclerae. A large proportion of adults had presenile deafness or a family history of presenile conductive hearing loss. A second group, who comprised the majority of newborns with neonatal fractures, all died before or soon after birth. These had characteristic broad, crumpled femora and beaded ribs in skeletal x-rays. Autosomal recessive inheritance was likely for some, if not all, of these cases. A third group, two thirds of whom had fractures at birth, showed severe progressive deformity of limbs and spine. The density of scleral blueness appeared less than that seen in the first group of patients and approximated that seen in normal children and adults. Moreover, the blueness appeared to decrease with age. All patients in this group were sporadic cases. The mode of inheritance was not resolved by the study, but it is likely that the group is heterogeneous with both dominant and recessive genotypes responsible for the syndrome. The fourth group of patients showed dominant inheritance of osteoporosis leading to fractures, with variable deformity of long bones, but normal sclerae. Images PMID:458828

  12. Distributional Scaling in Heterogeneous Aquifers

    NASA Astrophysics Data System (ADS)

    Polsinelli, J. F.

    2015-12-01

    An investigation is undertaken into the fractal scaling properties of the piezometric head in a heterogeneous unconfined aquifer. The governing equations for the unconfined flow are derived from conservation of mass and the Darcy law. The Dupuit approximation will be used to model the dynamics. The spatially varying nature of the tendency to conduct flow (e.g. the hydraulic conductivity) is represented as a stochastic process. Experimental studies in the literature have indicated that the conductivity belongs to a class of non-stationary stochastic fields, called H-ss fields. The uncertainty in the soil parameters is imparted onto the flow variables; in groundwater investigations the potentiometric head will be a random function. The structure of the head field will be analyzed with an emphasis on the scaling properties. The scaling scheme for the modeling equations and the simulation procedure for the saturated hydraulic conductivity process will be explained, then the method will be validated through numerical experimentation using the USGS Modflow-2005 software. The results of the numerical simulations demonstrate that the head will exhibit multi-fractal scaling if the hydraulic conductivity exhibits multi-fractal scaling and the differential equations for the groundwater equation satisfy a particular set of scale invariance conditions.

  13. Bedload sheets in heterogeneous sediment

    SciTech Connect

    Whiting, P.J.; Dietrich, W.E.; Leopold, L.B.; Drake, T.G.; Shreve, R.L.

    1988-02-01

    Field observations in streams with beds of coarse sand and fine gravel have revealed that bedload moves primarily as thin, migrating accumulations of sediment, and coarse grains cluster at their leading edge. These accumulations are one or two coarse grains high and are much longer (0.2-0.6 m long in sand; 0.5-2.0 m in fine gravel) than their height. The authors propose the term bedload sheet for these features, and the authors argue that they result from an instability inherent to bedload movement of moderately and poorly sorted sediment. In essence, coarse particles in the bedload slow or stop each other, trap finer particles in their interstices, and thus cause the coarse particles to become mobile again. Bedload sheets develop on the stoss side of dunes, causing the dune to advance incrementally with the arrival of each sheet. Successive deposition of coarse sediment from the leading edge followed by fine sediment may generate the grain-size sorting that distinguishes cross-bedding. Available flume experiments and field observations indicate that bedload sheets are a common, but generally unrecognized, feature of heterogeneous sediment transport.

  14. Collective foraging in heterogeneous landscapes

    PubMed Central

    Bhattacharya, Kunal; Vicsek, Tamás

    2014-01-01

    Animals foraging alone are hypothesized to optimize the encounter rates with resources through Lévy walks. However, the issue of how the interactions between multiple foragers influence their search efficiency is still not completely understood. To address this, we consider a model to study the optimal strategy for a group of foragers searching for targets distributed heterogeneously. In our model, foragers move on a square lattice containing immobile but regenerative targets. At any instant, a forager is able to detect only those targets that happen to be in the same site. However, we allow the foragers to have information about the state of other foragers. A forager who has not detected any target walks towards the nearest location, where another forager has detected a target, with a probability exp(−αd), where d is the distance between the foragers and α is a parameter characterizing the propensity of the foragers to aggregate. The model reveals that neither overcrowding (α → 0) nor independent searching (α → ∞) is beneficial for the foragers. For a patchy distribution of targets, the efficiency is maximum for intermediate values of α. In addition, in the limit α → 0, the length of the walks can become scale-free. PMID:25165596

  15. Adaptation Driven by Spatial Heterogeneities

    NASA Astrophysics Data System (ADS)

    Hermsen, Rutger

    2011-03-01

    Biological evolution and ecology are intimately linked, because the reproductive success or ``fitness'' of an organism depends crucially on its ecosystem. Yet, most models of evolution (or population genetics) consider homogeneous, fixed-size populations subjected to a constant selection pressure. To move one step beyond such ``mean field'' descriptions, we discuss stochastic models of evolution driven by spatial heterogeneity. We imagine a population whose range is limited by a spatially varying environmental parameter, such as a temperature or the concentration of an antibiotic drug. Individuals in the population replicate, die and migrate stochastically. Also, by mutation, they can adapt to the environmental stress and expand their range. This way, adaptation and niche expansion go hand in hand. This mode of evolution is qualitatively different from the usual notion of a population climbing a fitness gradient. We analytically calculate the rate of adaptation by solving a first passage time problem. Interestingly, the joint effects of reproduction, death, mutation and migration result in two distinct parameter regimes depending on the relative time scales of mutation and migration. We argue that the proposed scenario may be relevant for the rapid evolution of antibiotic resistance. This work was supported by the Center for Theoretical Biological Physics sponsored by the National Science Foundation (NSF) (Grant PHY-0822283).

  16. Aggregation of Heterogeneously Charged Colloids.

    PubMed

    Dempster, Joshua M; Olvera de la Cruz, Monica

    2016-06-28

    Patchy colloids are attractive as programmable building blocks for metamaterials. Inverse patchy colloids, in which a charged surface is decorated with patches of the opposite charge, are additionally noteworthy as models for heterogeneously charged biological materials such as proteins. We study the phases and aggregation behavior of a single charged patch in an oppositely charged colloid with a single-site model. This single-patch inverse patchy colloid model shows a large number of phases when varying patch size. For large patch sizes we find ferroelectric crystals, while small patch sizes produce cross-linked gels. Intermediate values produce monodisperse clusters and unusual worm structures that preserve finite ratios of area to volume. The polarization observed at large patch sizes is robust under extreme disorder in patch size and shape. We examine phase-temperature dependence and coexistence curves and find that large patch sizes produce polarized liquids, in contrast to mean-field predictions. Finally, we introduce small numbers of unpatched charged colloids. These can either suppress or encourage aggregation depending on their concentration and the size of the patches on the patched colloids. These effects can be exploited to control aggregation and to measure effective patch size.

  17. The Heterogeneity of Juvenile Myositis

    PubMed Central

    Rider, Lisa G.

    2007-01-01

    Juvenile myositis is a heterogeneous group of systemic autoimmune diseases, in which clinical and serologic subgroups result in subsets of patients with distinct clinical manifestations, disease courses, immunogenetic associations, responses to therapy, and prognoses. A newly identified autoantibody of unknown specificity, anti-p155, is myositis-associated and seen in up to 20 – 30% of juvenile and adult DM patients. HLA DRB1*0301 and its linked allele DQA1*0501 have been identified as the major immunogenetic risk factor for juvenile and adult DM in both European- and African- American patients, and DQA1*0301 is an additional risk factor in European American patients. Several DQA1 alleles also are protective for juvenile DM. Environmental risk factors are poorly understood, but growing evidence suggests a role for infectious agents and ultraviolet radiation. The current therapy of juvenile DM consists of corticosteroids and other immunosuppressive agents, with the adjunctive treatment of cutaneous manifestations and rehabilitation. Therapeutic trials of biologic agents, including anti-TNFα and anti-CD20, may aid in developing promising new therapies for these disorders. PMID:17317616

  18. Genetic heterogeneity in juvenile NCL

    SciTech Connect

    Hart, Y.M.; Andermann, E.; Mitchison, H.M.

    1994-09-01

    The neuronal ceroid lipofuscinoses (NCL) are a group of related lysosomal storage diseases classified according to the age of onset, clinical syndrome, and pathology. The clinical syndromes include myoclonus, visual failure, progressive dementia, ataxia and generalized tonic clonic seizures in varying combinations depending on the age of onset and pathology. The mode of inheritance is autosomal recessive in most cases, except for several families with the adult form (Kufs` disease) which have autosomal dominant inheritance. Linkage for the infantile (Halatia-Santavuori) form (CLN1), characterized ultrastructurally by lysosomal granular osmiophilic deposits (GROD), has been demonstrated with markers on chromosome lp, while the gene for the typical juvenile (Spielmeyer-Vogt) form (CLN3), characterized by fingerprint-profile inclusions, has been linked to chromosome 16p. The gene locations of the late infantile (Jansky-Bielschowsky) and adult (Kufs` disease) forms are unknown, although it has recently been shown that the late infantile form does not link to chromosome 16p. We describe three siblings, including a pair of monozygotic twins, with juvenile onset NCL with GROD in whom linkage to the CLN3 region of chromsome 16p has been excluded. This would suggest that there is genetic heterogeneity not only among the different clinical syndromes, but also among identical clinical syndromes with different ultrastructural characteristics. Preliminary studies of linkage to chromosome 1p employing the microsatellite marker HY-TM1 have been uninformative. Further studies with other chromosome 1 markers are underway.

  19. Quantification of heterogeneity observed in medical images

    PubMed Central

    2013-01-01

    Background There has been much recent interest in the quantification of visually evident heterogeneity within functional grayscale medical images, such as those obtained via magnetic resonance or positron emission tomography. In the case of images of cancerous tumors, variations in grayscale intensity imply variations in crucial tumor biology. Despite these considerable clinical implications, there is as yet no standardized method for measuring the heterogeneity observed via these imaging modalities. Methods In this work, we motivate and derive a statistical measure of image heterogeneity. This statistic measures the distance-dependent average deviation from the smoothest intensity gradation feasible. We show how this statistic may be used to automatically rank images of in vivo human tumors in order of increasing heterogeneity. We test this method against the current practice of ranking images via expert visual inspection. Results We find that this statistic provides a means of heterogeneity quantification beyond that given by other statistics traditionally used for the same purpose. We demonstrate the effect of tumor shape upon our ranking method and find the method applicable to a wide variety of clinically relevant tumor images. We find that the automated heterogeneity rankings agree very closely with those performed visually by experts. Conclusions These results indicate that our automated method may be used reliably to rank, in order of increasing heterogeneity, tumor images whether or not object shape is considered to contribute to that heterogeneity. Automated heterogeneity ranking yields objective results which are more consistent than visual rankings. Reducing variability in image interpretation will enable more researchers to better study potential clinical implications of observed tumor heterogeneity. PMID:23453000

  20. Plasma filtering techniques for nuclear waste remediation.

    PubMed

    Gueroult, Renaud; Hobbs, David T; Fisch, Nathaniel J

    2015-10-30

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. This advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste.

  1. Plasma filtering techniques for nuclear waste remediation

    DOE PAGES

    Gueroult, Renaud; Hobbs, David T.; Fisch, Nathaniel J.

    2015-04-24

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. As a result, this advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste.

  2. Plasma filtering techniques for nuclear waste remediation.

    PubMed

    Gueroult, Renaud; Hobbs, David T; Fisch, Nathaniel J

    2015-10-30

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. This advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste. PMID:25956646

  3. Nuclear mortality

    SciTech Connect

    Krauthammer, C.

    1983-10-01

    The author notes that the anti-nuclear movement is shifting its focus from bodily harm to concern for the impact on our souls from building and threatening the use of nuclear weapons. Two aspects of nuclear deterrence receiving the most public attention are the freeze effort to halt weapons modernization and the no-first-use effort to take down the nuclear umbrella. Opponents attack both the countervalue and the counterforce approach, but the arguments of the Catholic bishops, Jonathan Schell, and others stop short of unilateral disarmament, which would be the greatest threat to our survival. Mr. Krauthammer observes that nuclear deterrence has worked, however, and will continue to be useful only if potential adversaries believe we have the will to use nuclear weapons. 2 references. (DCK)

  4. Nuclear astrophysics

    SciTech Connect

    Haxton, W.C.

    1992-01-01

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized.

  5. Nuclear astrophysics

    SciTech Connect

    Haxton, W.C.

    1992-12-31

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized.

  6. Frictional Heterogeneities Along Carbonate Faults

    NASA Astrophysics Data System (ADS)

    Collettini, C.; Carpenter, B. M.; Scuderi, M.; Tesei, T.

    2014-12-01

    The understanding of fault-slip behaviour in carbonates has an important societal impact as a) a significant number of earthquakes nucleate within or propagate through these rocks, and b) half of the known petroleum reserves occur within carbonate reservoirs, which likely contain faults that experience fluid pressure fluctuations. Field studies on carbonate-bearing faults that are exhumed analogues of currently active structures of the seismogenic crust, show that fault rock types are systematically controlled by the lithology of the faulted protolith: localization associated with cataclasis, thermal decomposition and plastic deformation commonly affect fault rocks in massive limestone, whereas distributed deformation, pressure-solution and frictional sliding along phyllosilicates are observed in marly rocks. In addition, hydraulic fractures, indicating cyclic fluid pressure build-ups during the fault activity, are widespread. Standard double direct friction experiments on fault rocks from massive limestones show high friction, velocity neutral/weakening behaviour and significant re-strengthening during hold periods, on the contrary, phyllosilicate-rich shear zones are characterized by low friction, significant velocity strengthening behavior and no healing. We are currently running friction experiments on large rock samples (20x20 cm) in order to reproduce and characterize the interaction of fault rock frictional heterogeneities observed in the field. In addition we have been performing experiments at near lithostatic fluid pressure in the double direct shear configuration within a pressure vessel to test the Rate and State friction stability under these conditions. Our combination of structural observations and mechanical data have been revealing the processes and structures that are at the base of the broad spectrum of fault slip behaviors recently documented by high-resolution geodetic and seismological data.

  7. Graphene-Si heterogeneous nanotechnology

    NASA Astrophysics Data System (ADS)

    Akinwande, Deji; Tao, Li

    2013-05-01

    It is widely envisioned that graphene, an atomic sheet of carbon that has generated very broad interest has the largest prospects for flexible smart systems and for integrated graphene-silicon (G-Si) heterogeneous very large-scale integrated (VLSI) nanoelectronics. In this work, we focus on the latter and elucidate the research progress that has been achieved for integration of graphene with Si-CMOS including: wafer-scale graphene growth by chemical vapor deposition on Cu/SiO2/Si substrates, wafer-scale graphene transfer that afforded the fabrication of over 10,000 devices, wafer-scalable mitigation strategies to restore graphene's device characteristics via fluoropolymer interaction, and demonstrations of graphene integrated with commercial Si- CMOS chips for hybrid nanoelectronics and sensors. Metrology at the wafer-scale has led to the development of custom Raman processing software (GRISP) now available on the nanohub portal. The metrology reveals that graphene grown on 4-in substrates have monolayer quality comparable to exfoliated flakes. At room temperature, the high-performance passivated graphene devices on SiO2/Si can afford average mobilities 3000cm2/V-s and gate modulation that exceeds an order of magnitude. The latest growth research has yielded graphene with high mobilities greater than 10,000cm2/V-s on oxidized silicon. Further progress requires track compatible graphene-Si integration via wafer bonding in order to translate graphene research from basic to applied research in commercial R and D laboratories to ultimately yield a viable nanotechnology.

  8. Interoperability of heterogeneous distributed systems

    NASA Astrophysics Data System (ADS)

    Zaschke, C.; Essendorfer, B.; Kerth, C.

    2016-05-01

    To achieve knowledge superiority in today's operations interoperability is the key. Budget restrictions as well as the complexity and multiplicity of threats combined with the fact that not single nations but whole areas are subject to attacks force nations to collaborate and share information as appropriate. Multiple data and information sources produce different kinds of data, real time and non-real time, in different formats that are disseminated to the respective command and control level for further distribution. The data is most of the time highly sensitive and restricted in terms of sharing. The question is how to make this data available to the right people at the right time with the right granularity. The Coalition Shared Data concept aims to provide a solution to these questions. It has been developed within several multinational projects and evolved over time. A continuous improvement process was established and resulted in the adaptation of the architecture as well as the technical solution and the processes it supports. Coming from the idea of making use of existing standards and basing the concept on sharing of data through standardized interfaces and formats and enabling metadata based query the concept merged with a more sophisticated service based approach. The paper addresses concepts for information sharing to facilitate interoperability between heterogeneous distributed systems. It introduces the methods that were used and the challenges that had to be overcome. Furthermore, the paper gives a perspective how the concept could be used in the future and what measures have to be taken to successfully bring it into operations.

  9. Mechanical heterogeneities and lithospheric extension

    NASA Astrophysics Data System (ADS)

    Duretz, Thibault; Petri, Benoit; Mohn, Geoffroy; Schenker, Filippo L.; Schmalholz, Stefan

    2016-04-01

    Detailed geological and geophysical studies of passive margins have highlighted the multi-stage and depth-dependent aspect of lithospheric thinning. Lithospheric thinning involves a variety of structures (normal faults, low angle detachments, extensional shear zones, extraction faults) and leads to a complex architecture of passive margins (with e.g. necking zone, mantle exhumation, continental allochthons). The processes controlling the generation and evolution of these structures as well as the impact of pre-rift inheritance are so far incompletely understood. In this study, we investigate the impact of pre-rift inheritance on the development of rifted margins using two-dimensional thermo-mechanical models of lithospheric thinning. To first order, we represent the pre-rift mechanical heterogeneities with lithological layering. The rheologies are kept simple (visco-plastic) and do not involve any strain softening mechanism. Our models show that mechanical layering causes multi-stage and depth-dependent extension. In the initial rifting phase, lithospheric extension is decoupled: as the crust undergoes thinning by brittle (frictional-plastic) faults, the lithospheric mantle accommodates extension by symmetric ductile necking. In a second rifting phase, deformation in the crust and lithospheric mantle is coupled and marks the beginning of an asymmetric extension stage. Low angle extensional shear zones develop across the lithosphere and exhume subcontinental mantle. Furthemore, crustal allochthons and adjacent basins develop coevally. We describe as well the thermal evolution predicted by the numerical models and discuss the first-order implications of our results in the context of the Alpine geological history.

  10. Neural Field Dynamics with Heterogeneous Connection Topology

    NASA Astrophysics Data System (ADS)

    Qubbaj, Murad R.; Jirsa, Viktor K.

    2007-06-01

    Neural fields receive inputs from local and nonlocal sources. Notably in a biologically realistic architecture the latter vary under spatial translations (heterogeneous), the former do not (homogeneous). To understand the mutual effects of homogeneous and heterogeneous connectivity, we study the stability of the steady state activity of a neural field as a function of its connectivity and transmission speed. We show that myelination, a developmentally relevant change of the heterogeneous connectivity, always results in the stabilization of the steady state via oscillatory instabilities, independent of the local connectivity. Nonoscillatory instabilities are shown to be independent of any influences of time delay.

  11. A heterogeneous graph-based recommendation simulator

    SciTech Connect

    Yeonchan, Ahn; Sungchan, Park; Lee, Matt Sangkeun; Sang-goo, Lee

    2013-01-01

    Heterogeneous graph-based recommendation frameworks have flexibility in that they can incorporate various recommendation algorithms and various kinds of information to produce better results. In this demonstration, we present a heterogeneous graph-based recommendation simulator which enables participants to experience the flexibility of a heterogeneous graph-based recommendation method. With our system, participants can simulate various recommendation semantics by expressing the semantics via meaningful paths like User Movie User Movie. The simulator then returns the recommendation results on the fly based on the user-customized semantics using a fast Monte Carlo algorithm.

  12. Increasing selection response by Bayesian modeling of heterogeneous environmental variances

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Heterogeneity of environmental variance among genotypes reduces selection response because genotypes with higher variance are more likely to be selected than low-variance genotypes. Modeling heterogeneous variances to obtain weighted means corrected for heterogeneous variances is difficult in likel...

  13. Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    Drago, Alessandro

    2005-04-01

    The activity of the Italian nuclear physicists community in the field of Nuclear Astrophysics is reported. The researches here described have been performed within the project "Fisica teorica del nucleo e dei sistemi a multi corpi", supported by the Ministero dell'Istruzione, dell'Università e della Ricerca.

  14. Nuclear safety

    NASA Technical Reports Server (NTRS)

    Buden, D.

    1991-01-01

    Topics dealing with nuclear safety are addressed which include the following: general safety requirements; safety design requirements; terrestrial safety; SP-100 Flight System key safety requirements; potential mission accidents and hazards; key safety features; ground operations; launch operations; flight operations; disposal; safety concerns; licensing; the nuclear engine for rocket vehicle application (NERVA) design philosophy; the NERVA flight safety program; and the NERVA safety plan.

  15. NMR CHARACTERIZATIONS OF PROPERTIES OF HETEROGENEOUS MEDIA

    SciTech Connect

    C.T. Philip Chang; Changho Choi; Jeromy T. Hollenshead; Rudi Michalak; Jack Phan; Ramon Saavedra; John C. Slattery; Jinsoo Uh; Randi Valestrand; A. Ted Watson; Song Xue

    2005-01-01

    A critical and long-standing need within the petroleum industry is the specification of suitable petrophysical properties for mathematical simulation of fluid flow in petroleum reservoirs (i.e., reservoir characterization). The development of accurate reservoir characterizations is extremely challenging. Property variations may be described on many scales, and the information available from measurements reflect different scales. In fact, experiments on laboratory core samples, well-log data, well-test data, and reservoir-production data all represent information potentially valuable to reservoir characterization, yet they all reflect information about spatial variations of properties at different scales. Nuclear magnetic resonance (NMR) spectroscopy and imaging (MRI) provide enormous potential for developing new descriptions and understandings of heterogeneous media. NMR has the rare capability to probe permeable media non-invasively, with spatial resolution, and it provides unique information about molecular motions and interactions that are sensitive to morphology. NMR well-logging provides the best opportunity ever to resolve permeability distributions within petroleum reservoirs. We develop MRI methods to determine, for the first time, spatially resolved distributions of porosity and permeability within permeable media samples that approach the intrinsic scale: the finest resolution of these macroscopic properties possible. To our knowledge, this is the first time that the permeability is actually resolved at a scale smaller than the sample. In order to do this, we have developed a robust method to determine of relaxation distributions from NMR experiments and a novel implementation and analysis of MRI experiments to determine the amount of fluid corresponding to imaging regions, which are in turn used to determine porosity and saturation distributions. We have developed a novel MRI experiment to determine velocity distributions within flowing experiments, and

  16. Heterogeneous reactions of epoxides in acidic media.

    PubMed

    Lal, Vinita; Khalizov, Alexei F; Lin, Yun; Galvan, Maria D; Connell, Brian T; Zhang, Renyi

    2012-06-21

    Epoxides have recently been identified as important intermediates in the gas phase oxidation of hydrocarbons, and their hydrolysis products have been observed in ambient aerosols. To evaluate the role of epoxides in the formation of secondary organic aerosols (SOA), the kinetics and mechanism of heterogeneous reactions of two model epoxides, isoprene oxide and α-pinene oxide, with sulfuric acid, ammonium bisulfate, and ammonium sulfate have been investigated using complementary experimental techniques. Kinetic experiments using a fast flow reactor coupled to an ion drift-chemical ionization mass spectrometer (ID-CIMS) show a fast irreversible loss of the epoxides with the uptake coefficients (γ) of (1.7 ± 0.1) × 10(-2) and (4.6 ± 0.3) × 10(-2) for isoprene oxide and α-pinene oxide, respectively, for 90 wt % H(2)SO(4) and at room temperature. Experiments using attenuated total reflection-Fourier transform infrared spectroscopy (ATR-FTIR) reveal that diols are the major products in ammonium bisulfate and dilute H(2)SO(4) (<25 wt %) solutions for both epoxides. In concentrated H(2)SO(4) (>65 wt %), acetals are formed from isoprene oxide, whereas organosulfates are produced from α-pinene oxide. The reaction of the epoxides with ammonium sulfate is slow and no products are observed. The epoxide reactions using bulk samples and Nuclear Magnetic Resonance (NMR) spectroscopy reveal the presence of diols as the major products for isoprene oxide, accompanied by aldehyde formation. For α-pinene oxide, organosulfate formation is observed with a yield increasing with the acidity. Large yields of organosulfates in all NMR experiments with α-pinene oxide are attributed to the kinetic isotope effect (KIE) from the use of deuterated sulfuric acid and water. Our results suggest that acid-catalyzed hydrolysis of epoxides results in the formation of a wide range of products, and some of the products have low volatility and contribute to SOA growth under ambient conditions

  17. Nuclear hostages

    SciTech Connect

    O'Keefe, B.J.

    1983-01-01

    Classical physics since Roentgen's discovery of X-rays led quickly to work on atomic structure and the Nuclear Age. The author traces the history of decisions to pursue nuclear fission, the organization of the Manhattan Project, the compromises of the 1963 test ban treaty, and the dilemma of nuclear weapons development and deployment that now hold mankind hostage. He reviews the rationale for limited nuclear war, first strike, massive retaliation, non-proliferation, and the Strategic Arms Limitation Talks (SALT) treaties. He argues that the concepts of mobile MX weapons, fratricide, and population dispersal for civil defense are unworkable, suggesting a program of unilaterally withdrawing tactical nuclear weapons from Europe and strengthening intelligence and law-enforcement powers to withstand terrorist activity. Economic cooperation and political reconciliation may take a generation to achieve, but should be our national goal.

  18. Computational Mechanics for Heterogeneous Materials

    SciTech Connect

    Lechman, Jeremy B.; Baczewski, Andrew David; Stephen Bond; Erikson, William W.; Lehoucq, Richard B.; Mondy, Lisa Ann; Noble, David R.; Pierce, Flint; Roberts, Christine; van Swol, Frank B.; Yarrington, Cole

    2013-11-01

    The subject of this work is the development of models for the numerical simulation of matter, momentum, and energy balance in heterogeneous materials. These are materials that consist of multiple phases or species or that are structured on some (perhaps many) scale(s). By computational mechanics we mean to refer generally to the standard type of modeling that is done at the level of macroscopic balance laws (mass, momentum, energy). We will refer to the flow or flux of these quantities in a generalized sense as transport. At issue here are the forms of the governing equations in these complex materials which are potentially strongly inhomogeneous below some correlation length scale and are yet homogeneous on larger length scales. The question then becomes one of how to model this behavior and what are the proper multi-scale equations to capture the transport mechanisms across scales. To address this we look to the area of generalized stochastic process that underlie the transport processes in homogeneous materials. The archetypal example being the relationship between a random walk or Brownian motion stochastic processes and the associated Fokker-Planck or diffusion equation. Here we are interested in how this classical setting changes when inhomogeneities or correlations in structure are introduced into the problem. Aspects of non-classical behavior need to be addressed, such as non-Fickian behavior of the mean-squared-displacement (MSD) and non-Gaussian behavior of the underlying probability distribution of jumps. We present an experimental technique and apparatus built to investigate some of these issues. We also discuss diffusive processes in inhomogeneous systems, and the role of the chemical potential in diffusion of hard spheres is considered. Also, the relevance to liquid metal solutions is considered. Finally we present an example of how inhomogeneities in material microstructure introduce fluctuations at the meso-scale for a thermal conduction problem

  19. Topographic heterogeneity in cholesterol biosynthesis.

    PubMed

    Lange, Y; Muraski, M F

    1988-07-01

    of 1.08 g/cm3. We conclude that 1) cholesterol biosynthesis may be topographically heterogeneous and 2) newly synthesized squalene 2,3-oxide resides in a buoyant membrane fraction distinct from markers for the major organelles.

  20. Heterogeneous photocatalytic oxidation of atmospheric trace contaminants

    NASA Technical Reports Server (NTRS)

    Ollis, David F.

    1993-01-01

    Work performed during the period 1 May - 31 Oct. 1992 on heterogeneous photocatalytic oxidation of atmospheric trace contaminants is presented. Topics discussed include photoreactor monolith fundamental studies and monolith reactor operation: batch recirculation system.

  1. Lipid rafts: heterogeneity on the high seas.

    PubMed Central

    Pike, Linda J

    2004-01-01

    Lipid rafts are membrane microdomains that are enriched in cholesterol and glycosphingolipids. They have been implicated in processes as diverse as signal transduction, endocytosis and cholesterol trafficking. Recent evidence suggests that this diversity of function is accompanied by a diversity in the composition of lipid rafts. The rafts in cells appear to be heterogeneous both in terms of their protein and their lipid content, and can be localized to different regions of the cell. This review summarizes the data supporting the concept of heterogeneity among lipid rafts and outlines the evidence for cross-talk between raft components. Based on differences in the ways in which proteins interact with rafts, the Induced-Fit Model of Raft Heterogeneity is proposed to explain the establishment and maintenance of heterogeneity within raft populations. PMID:14662007

  2. Dehydrogenation of Formic Acid by Heterogeneous Catalysts.

    PubMed

    Li, Jun; Zhu, Qi-Long; Xu, Qiang

    2015-01-01

    Formic acid has recently been considered as one of the most promising hydrogen storage materials. The basic concept is briefly discussed and the research progress is detailledly reviewed on the dehydrogenation of aqueous formic acid by heterogeneous catalysts. PMID:26507481

  3. Heterogeneity and Risk Sharing in Village Economies*

    PubMed Central

    Chiappori, Pierre-André; Samphantharak, Krislert; Schulhofer-Wohl, Sam; Townsend, Robert M.

    2013-01-01

    We show how to use panel data on household consumption to directly estimate households’ risk preferences. Specifically, we measure heterogeneity in risk aversion among households in Thai villages using a full risk-sharing model, which we then test allowing for this heterogeneity. There is substantial, statistically significant heterogeneity in estimated risk preferences. Full insurance cannot be rejected. As the risk sharing, as-if-complete-markets theory might predict, estimated risk preferences are unrelated to wealth or other characteristics. The heterogeneity matters for policy: Although the average household would benefit from eliminating village-level risk, less-risk-averse households who are paid to absorb that risk would be worse off by several percent of household consumption. PMID:24932226

  4. Exploring heterogeneous market hypothesis using realized volatility

    NASA Astrophysics Data System (ADS)

    Chin, Wen Cheong; Isa, Zaidi; Mohd Nor, Abu Hassan Shaari

    2013-04-01

    This study investigates the heterogeneous market hypothesis using high frequency data. The cascaded heterogeneous trading activities with different time durations are modelled by the heterogeneous autoregressive framework. The empirical study indicated the presence of long memory behaviour and predictability elements in the financial time series which supported heterogeneous market hypothesis. Besides the common sum-of-square intraday realized volatility, we also advocated two power variation realized volatilities in forecast evaluation and risk measurement in order to overcome the possible abrupt jumps during the credit crisis. Finally, the empirical results are used in determining the market risk using the value-at-risk approach. The findings of this study have implications for informationally market efficiency analysis, portfolio strategies and risk managements.

  5. Eradication of infectious diseases in heterogeneous populations

    SciTech Connect

    Travis, C.C.; Lenhart, S.M.

    1987-04-01

    A model is presented of infectious disease in heterogeneous populations, which allows for variable intra- to intergroup contact ratios. The authors give necessary and sufficient conditions for disease eradication by means of vaccination. Smallpox is used as an illustrative example.

  6. Heterogeneous treatment in the variational nodal method

    SciTech Connect

    Fanning, T.H.; Palmiotti, G.

    1995-06-01

    The variational nodal transport method is reduced to its diffusion form and generalized for the treatment of heterogeneous nodes while maintaining nodal balances. Adapting variational methods to heterogeneous nodes requires the ability to integrate over a node with discontinuous cross sections. In this work, integrals are evaluated using composite gaussian quadrature rules, which permit accurate integration while minimizing computing time. Allowing structure within a nodal solution scheme avoids some of the necessity of cross section homogenization, and more accurately defines the intra-nodal flux shape. Ideally, any desired heterogeneity can be constructed within the node; but in reality, the finite set of basis functions limits the practical resolution to which fine detail can be defined within the node. Preliminary comparison tests show that the heterogeneous variational nodal method provides satisfactory results even if some improvements are needed for very difficult, configurations.

  7. Heterogeneous expression of apolipoprotein-E by human macrophages.

    PubMed

    Tedla, Nicodemus; Glaros, Elias N; Brunk, Ulf T; Jessup, Wendy; Garner, Brett

    2004-11-01

    Apolipoprotein-E (apoE) is expressed at high levels by macrophages. In addition to its role in lipid transport, macrophage-derived apoE plays an important role in immunoregulation. Previous studies have identified macrophage subpopulations that differ substantially in their ability to synthesize specific cytokines and enzymes, however, potential heterogeneous macrophage apoE expression has not been studied. Here we examined apoE expression in human THP-1 macrophages and monocyte-derived macrophages (MDM). Using immunocytochemistry and flow cytometry methods we reveal a striking heterogeneity in macrophage apoE expression in both cell types. In phorbol-ester-differentiated THP-1 macrophages, 5% of the cells over-expressed apoE at levels more than 50-fold higher than the rest of the population. ApoE over-expressing THP-1 macrophages contained condensed/fragmented nuclei and increased levels of activated caspase-3 indicating induction of apoptosis. In MDM, 3-5% of the cells also highly over-expressed apoE, up to 50-fold higher than the rest of the population; however, this was not associated with obvious nuclear alterations. The apoE over-expressing MDM were larger, more granular, and more autofluorescent than the majority of cells and they contained numerous vesicle-like structures that appeared to be coated by apoE. Flow cytometry experiments indicated that the apoE over-expressing subpopulation of MDM were positive for CD14, CD11b/Mac-1 and CD68. These observations suggest that specific macrophage subpopulations may be important for apoE-mediated immunoregulation and clearly indicate that subpopulation heterogeneity should be taken into account when investigating macrophage apoE expression.

  8. Heterogeneous expression of apolipoprotein-E by human macrophages

    PubMed Central

    Tedla, Nicodemus; Glaros, Elias N; Brunk, Ulf T; Jessup, Wendy; Garner, Brett

    2004-01-01

    Apolipoprotein-E (apoE) is expressed at high levels by macrophages. In addition to its role in lipid transport, macrophage-derived apoE plays an important role in immunoregulation. Previous studies have identified macrophage subpopulations that differ substantially in their ability to synthesize specific cytokines and enzymes, however, potential heterogeneous macrophage apoE expression has not been studied. Here we examined apoE expression in human THP-1 macrophages and monocyte-derived macrophages (MDM). Using immunocytochemistry and flow cytometry methods we reveal a striking heterogeneity in macrophage apoE expression in both cell types. In phorbol-ester-differentiated THP-1 macrophages, 5% of the cells over-expressed apoE at levels more than 50-fold higher than the rest of the population. ApoE over-expressing THP-1 macrophages contained condensed/fragmented nuclei and increased levels of activated caspase-3 indicating induction of apoptosis. In MDM, 3–5% of the cells also highly over-expressed apoE, up to 50-fold higher than the rest of the population; however, this was not associated with obvious nuclear alterations. The apoE over-expressing MDM were larger, more granular, and more autofluorescent than the majority of cells and they contained numerous vesicle-like structures that appeared to be coated by apoE. Flow cytometry experiments indicated that the apoE over-expressing subpopulation of MDM were positive for CD14, CD11b/Mac-1 and CD68. These observations suggest that specific macrophage subpopulations may be important for apoE-mediated immunoregulation and clearly indicate that subpopulation heterogeneity should be taken into account when investigating macrophage apoE expression. PMID:15500620

  9. Multipoint linkage detection in the presence of heterogeneity.

    PubMed

    Chiu, Yen-Feng; Liang, Kung-Yee; Beaty, Terri H

    2002-06-01

    Linkage heterogeneity is common for complex diseases. It is well known that loss of statistical power for detecting linkage will result if one assumes complete homogeneity in the presence of linkage heterogeneity. To this end, Smith (1963, Annals of Human Genetics 27, 175-182) proposed an admixture model to account for linkage heterogeneity. It is well known that for this model, the conventional chi-squared approximation to the likelihood ratio test for no linkage does not apply even when the sample size is large. By dealing with nuclear families and one marker at a time for genetic diseases with simple modes of inheritance, score-based test statistics (Liang and Rathouz, 1999, Biometrics 55, 65-74) and likelihood-ratio-based test statistics (Lemdani and Pons, 1995, Biometrics 51, 1033-1041) have been proposed which have a simple large-sample distribution under the null hypothesis of linkage. In this paper, we extend their work to more practical situations that include information from multiple markers and multi-generational pedigrees while allowing for a class of general genetic models. Three different approaches are proposed to eliminate the nuisance parameters in these test statistics. We show that all three approaches lead to the same asymptotic distribution under the null hypothesis of no linkage. Simulation results show that the proposed test statistics have adequate power to detect linkage and that the performances of these two classes of test statistics are quite comparable. We have applied the proposed method to a family study of asthma (Barnes et al., 1996), in which the score-based test shows evidence of linkage with p-value <0.0001 in the region of interest on chromosome 12. Additionally, we have implemented this score-based test within the frequently used computer package GENEHUNTER.

  10. Inverse problems in heterogeneous and fractured media using peridynamics

    SciTech Connect

    Turner, Daniel Z.; van Bloemen Waanders, Bart G.; Parks, Michael L.

    2015-12-10

    The following work presents an adjoint-based methodology for solving inverse problems in heterogeneous and fractured media using state-based peridynamics. We show that the inner product involving the peridynamic operators is self-adjoint. The proposed method is illustrated for several numerical examples with constant and spatially varying material parameters as well as in the context of fractures. We also present a framework for obtaining material parameters by integrating digital image correlation (DIC) with inverse analysis. This framework is demonstrated by evaluating the bulk and shear moduli for a sample of nuclear graphite using digital photographs taken during the experiment. The resulting measured values correspond well with other results reported in the literature. Lastly, we show that this framework can be used to determine the load state given observed measurements of a crack opening. Furthermore, this type of analysis has many applications in characterizing subsurface stress-state conditions given fracture patterns in cores of geologic material.

  11. Heterogeneities in gelatin film formation using single-sided NMR.

    PubMed

    Ghoshal, Sushanta; Mattea, Carlos; Denner, Paul; Stapf, Siegfried

    2010-12-16

    Gelatin solutions were prepared in D(2)O. The drying process of cast solutions was followed with a single-sided nuclear magnetic resonance (NMR) scanner until complete solidification occurred. Spin-spin relaxation times (T(2)) were measured at different layers with microscopic resolution and were correlated with the drying process during film formation. Additionally, the evaporation of the gelatin solution was observed optically from the reduction of the sample thickness, revealing that at the macroscopic level, the rate of evaporation is not uniform throughout the experiment. A crossover in the spatial evolution of the drying process is observed from the NMR results. At the early stages, the gel appears to be drier in the upper layers near the evaporation front, while this tendency is inverted at the later stages, when drying is faster from the bottom. XRD (X-ray diffraction) data showed that a structural heterogeneity persists in the final film.

  12. Heterogeneity of Calcium Channel/cAMP-Dependent Transcriptional Activation.

    PubMed

    Kobrinsky, Evgeny

    2015-01-01

    The major function of the voltage-gated calcium channels is to provide the Ca(2+) flux into the cell. L-type voltage-gated calcium channels (Cav1) serve as voltage sensors that couple membrane depolarization to many intracellular processes. Electrical activity in excitable cells affects gene expression through signaling pathways involved in the excitation-transcription (E-T) coupling. E-T coupling starts with activation of the Cav1 channel and results in initiation of the cAMP-response element binding protein (CREB)-dependent transcription. In this review we discuss the new quantitative approaches to measuring E-T signaling events. We describe the use of wavelet transform to detect heterogeneity of transcriptional activation in nuclei. Furthermore, we discuss the properties of discovered microdomains of nuclear signaling associated with the E-T coupling and the basis of the frequency-dependent transcriptional regulation.

  13. Targeted exome sequencing for mitochondrial disorders reveals high genetic heterogeneity

    PubMed Central

    2013-01-01

    Background Mitochondrial disorders are difficult to diagnose due to extreme genetic and phenotypic heterogeneities. Methods We explored the utility of targeted next-generation sequencing for the diagnosis of mitochondrial disorders in 148 patients submitted for clinical testing. A panel of 447 nuclear genes encoding mitochondrial respiratory chain complexes, and other genes inducing secondary mitochondrial dysfunction or that cause diseases which mimic mitochondrial disorders were tested. Results We identified variants considered to be possibly disease-causing based on family segregation data and/or variants already known to cause disease in twelve genes in thirteen patients. Rare or novel variants of unknown significance were identified in 45 additional genes for various metabolic, genetic or neurogenetic disorders. Conclusions Primary mitochondrial defects were confirmed only in four patients indicating that majority of patients with suspected mitochondrial disorders are presumably not the result of direct impairment of energy production. Our results support that clinical and routine laboratory ascertainment for mitochondrial disorders are challenging due to significant overlapping non-specific clinical symptoms and lack of specific biomarkers. While next-generation sequencing shows promise for diagnosing suspected mitochondrial disorders, the challenges remain as the underlying genetic heterogeneity may be greater than suspected and it is further confounded by the similarity of symptoms with other conditions as we report here. PMID:24215330

  14. Tumor heterogeneity and circulating tumor cells.

    PubMed

    Zhang, Chufeng; Guan, Yan; Sun, Yulan; Ai, Dan; Guo, Qisen

    2016-05-01

    In patients with cancer, individualized treatment strategies are generally guided by an analysis of molecular biomarkers. However, genetic instability allows tumor cells to lose monoclonality and acquire genetic heterogeneity, an important characteristic of tumors, during disease progression. Researchers have found that there is tumor heterogeneity between the primary tumor and metastatic lesions, between different metastatic lesions, and even within a single tumor (either primary or metastatic). Tumor heterogeneity is associated with heterogeneous protein functions, which lowers diagnostic precision and consequently becomes an obstacle to determining the appropriate therapeutic strategies for individual cancer patients. With the development of novel testing technologies, an increasing number of studies have attempted to explore tumor heterogeneity by examining circulating tumor cells (CTCs), with the expectation that CTCs may comprehensively represent the full spectrum of mutations and/or protein expression alterations present in the cancer. In addition, this strategy represents a minimally invasive approach compared to traditional tissue biopsies that can be used to dynamically monitor tumor evolution. The present article reviews the potential efficacy of using CTCs to identify both spatial and temporal tumor heterogeneity. This review also highlights current issues in this field and provides an outlook toward future applications of CTCs.

  15. The Computational Modeling of Alloys:From ab initio and thermodynamics to heterogeneous precipitation.

    SciTech Connect

    Caro, A

    2007-10-09

    In this lecture we presented a methodology to obtain free energies from empirical potentials and applied it to the study of the phase diagram of FeCr. Subsequently, we used Metropolis Monte Carlo to analyze homogeneous and heterogeneous precipitation of the Cr rich solid solution {alpha}{prime}. These examples are part of our work in the area of steels for nuclear applications and can be found in several publications of our group cited as References.

  16. Regional Heterogenity In Ceres' Subsurface

    NASA Astrophysics Data System (ADS)

    Raymond, Carol A.; Marchi, Simone; Bland, Michael T.; Castillo-Rogez, Julie C.; Park, Ryan S.; Russell, Christopher T.; Hughson, Kynan G.; Scully, Jennifer E. C.

    2016-04-01

    subdued or degraded rims. Regional-scale variations in roughness and cratering could be caused by varia-bility in the viscosity of the volatile-rich shell, or could reflect a resurfacing process. However, these two processes would yield differences that would help to distinguish them. In the case of relaxation, the degree of crater obilitera-tion would be a function of crater size and age, and possibly would vary with latitude (temperature). If caused by resurfacing, the crater size frequency distribution would be similar to but offset with respect to that of the surround-ing terrains. Some correlation is seen between variations in the visible spectrum and the areas of smooth terrain. In either case, relaxation or resurfacing would indicate an internal process that resulted in primordial heterogeneity in the volatile-rich shell, or subsequent convective processes that drove regional resurfacing.

  17. Apobec-1 Complementation Factor (A1CF) Inhibits Epithelial-Mesenchymal Transition and Migration of Normal Rat Kidney Proximal Tubular Epithelial Cells

    PubMed Central

    Huang, Liyuan; Wang, Honglian; Zhou, Yuru; Ni, Dongsheng; Hu, Yanxia; Long, Yaoshui; Liu, Jianing; Peng, Rui; Zhou, Li; Liu, Zhicheng; Lyu, Zhongshi; Mao, Zhaomin; Hao, Jin; Li, Yiman; Zhou, Qin

    2016-01-01

    Apobec-1 complementation factor (A1CF) is a member of the heterogeneous nuclear ribonucleoproteins (hnRNP) family, which participates in site-specific posttranscriptional RNA editing of apolipoprotein B (apoB) transcript. The posttranscriptional editing of apoB mRNA by A1CF in the small intestine is required for lipid absorption. Apart from the intestine, A1CF mRNA is also reported to be highly expressed in the kidneys. However, it is remained unknown about the functions of A1CF in the kidneys. The aim of this paper is to explore the potential functions of A1CF in the kidneys. Our results demonstrated that in C57BL/6 mice A1CF was weakly expressed in embryonic kidneys from E15.5dpc while strongly expressed in mature kidneys after birth, and it mainly existed in the tubules of inner cortex. More importantly, we identified A1CF negatively regulated the process of epithelial-mesenchymal transition (EMT) in kidney tubular epithelial cells. Our results found ectopic expression of A1CF up-regulated the epithelial markers E-cadherin, and down-regulated the mesenchymal markers vimentin and α-smooth muscle actin (α-SMA) in NRK52e cells. In addition, knockdown of A1CF enhanced EMT contrary to the overexpression effect. Notably, the two A1CF variants led to the similar trend in the EMT process. Taken together, these data suggest that A1CF may be an antagonistic factor to the EMT process of kidney tubular epithelial cells. PMID:26848653

  18. Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    Bombaci, Ignazio

    2003-04-01

    In this report I will try to illustrate some of the main research themes and "hot topics" in nuclear astrophysics. The particular aim of the present report is to briefly illustrate the research activities, in the field of nuclear astrophysics, performed by the Italian nuclear physicist community within the "Programma di Interesse Nazionale su Fisica Teorica del Nucleo e dei Sistemi a Molti Corpi" (National Research Program on Theoretical Physics of Nuclei and Many Body Systems) supported by the "Ministero dell'Istruzione dell'Università e della Ricerca".

  19. Nuclear Speckles

    PubMed Central

    Spector, David L.; Lamond, Angus I.

    2011-01-01

    Nuclear speckles, also known as interchromatin granule clusters, are nuclear domains enriched in pre-mRNA splicing factors, located in the interchromatin regions of the nucleoplasm of mammalian cells. When observed by immunofluorescence microscopy, they usually appear as 20–50 irregularly shaped structures that vary in size. Speckles are dynamic structures, and their constituents can exchange continuously with the nucleoplasm and other nuclear locations, including active transcription sites. Studies on the composition, structure, and dynamics of speckles have provided an important paradigm for understanding the functional organization of the nucleus and the dynamics of the gene expression machinery. PMID:20926517

  20. (Nuclear theory). [Research in nuclear physics

    SciTech Connect

    Haxton, W.

    1990-01-01

    This report discusses research in nuclear physics. Topics covered in this paper are: symmetry principles; nuclear astrophysics; nuclear structure; quark-gluon plasma; quantum chromodynamics; symmetry breaking; nuclear deformation; and cold fusion. (LSP)

  1. Nuclear Systems Kilopower Overview

    NASA Technical Reports Server (NTRS)

    Palac, Don; Gibson, Marc; Mason, Lee; Houts, Michael; McClure, Patrick; Robinson, Ross

    2016-01-01

    The Nuclear Systems Kilopower Project was initiated by NASAs Space Technology Mission Directorate Game Changing Development Program in fiscal year 2015 to demonstrate subsystem-level technology readiness of small space fission power in a relevant environment (Technology Readiness Level 5) for space science and human exploration power needs. The Nuclear Systems Kilopower Project consists of two elements. The primary element is the Kilopower Prototype Test, also called the Kilopower Reactor Using Stirling Technology(KRUSTY) Test. This element consists of the development and testing of a fission ground technology demonstrator of a 1 kWe fission power system. A 1 kWe system matches requirements for some robotic precursor exploration systems and future potential deep space science missions, and also allows a nuclear ground technology demonstration in existing nuclear test facilities at low cost. The second element, the Mars Kilopower Scalability Study, consists of the analysis and design of a scaled-up version of the 1 kWe reference concept to 10 kWe for Mars surface power projected requirements, and validation of the applicability of the KRUSTY experiment to key technology challenges for a 10 kWe system. If successful, these two elements will lead to initiation of planning for a technology demonstration of a 10 kWe fission power capability for Mars surface outpost power.

  2. Nuclear forces

    SciTech Connect

    Machleidt, R.

    2013-06-10

    These lectures present an introduction into the theory of nuclear forces. We focus mainly on the modern approach, in which the forces between nucleons emerge from low-energy QCD via chiral effective field theory.

  3. Nuclear Disarmament.

    ERIC Educational Resources Information Center

    Johnson, Christopher

    1982-01-01

    Material about nuclear disarmament and the arms race should be included in secondary school curricula. Teachers can present this technical, controversial, and frightening material in a balanced and comprehensible way. Resources for instructional materials are listed. (PP)

  4. Nuclear battlefields

    SciTech Connect

    Arkin, W.M.; Fieldhouse, R.W.

    1985-01-01

    This book provides complete data on the nuclear operations and research facilities in the U.S.A., the U.S.S.R., France, China and the U.K. It describes detailed estimates on the U.S.S.R.'s nuclear stockpile for over 500 locations. It shows how non-nuclear countries cooperate with the world-wide war machine. And it maps the U.S. nuclear facilities from Little America, WY, and Charleston, SC, to the battleships patroling the world's oceans and subs stalking under the sea. The data were gathered from unclassified sources through the Freedom of Information Act, from data supplied to military installations, and from weapons source books. It provides guidance for policymakers, government and corporate officials.

  5. NUCLEAR REACTOR

    DOEpatents

    Sherman, J.; Sharbaugh, J.E.; Fauth, W.L. Jr.; Palladino, N.J.; DeHuff, P.G.

    1962-10-23

    A nuclear reactor incorporating seed and blanket assemblies is designed. Means are provided for obtaining samples of the coolant from the blanket assemblies and for varying the flow of coolant through the blanket assemblies. (AEC)

  6. MNK1 expression increases during cellular senescence and modulates the subcellular localization of hnRNP A1

    SciTech Connect

    Ziaei, Samira; Shimada, Naoko; Kucharavy, Herman; Hubbard, Karen

    2012-03-10

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is an RNA-binding protein that modulates splice site usage, polyadenylation, and cleavage efficiency. This protein has also been implicated in mRNA stability and transport from the nucleus. We have previously demonstrated that hnRNP A1 had diminished protein levels and showed cytoplasmic accumulation in senescent human diploid fibroblasts. Furthermore, we have shown that inhibition of p38 MAPK, a key regulator of cellular senescence, elevated hnRNP A1 protein levels and inhibited hnRNP A1 cytoplasmic localization. In this study, we have explored the possible involvement of MNK1, one of the downstream effector of p38 MAPK, in the regulation of hnRNP A1. We have demonstrated that pharmacological inhibition of MNK1 by CGP 57380 decreased the phosphorylation levels of hnRNP A1 in young and senescent fibroblast cells and blocked the cytoplasmic accumulation of hnRNP A1 in senescent cells. In addition, MNK1 formed a complex with hnRNP A1 in vivo. The expression levels of MNK1, phospho-MNK1, and phospho-eIF4E proteins were found to be elevated in senescent cells. These data suggest that MNK1 regulates the phosphorylation and the subcellular distribution of hnRNP A1 and that MNK1 may play a role in the induction of senescence. -- Highlights: Black-Right-Pointing-Pointer MNK1 and not MAPKAPK2 phosphorylates hnRNP A1. Black-Right-Pointing-Pointer MNK1 has elevated levels in senescent cells, this has not been reported previously. Black-Right-Pointing-Pointer MNK1 activity induces cytoplasmic accumulation of hnRNP A1 in senescent cells. Black-Right-Pointing-Pointer Altered cytoplasmic localization of hnRNP A1 may alter gene expression patterns. Black-Right-Pointing-Pointer Our studies may increase our understanding of RNA metabolism during cellular aging.

  7. A quantitative measure for protein conformational heterogeneity

    PubMed Central

    Lyle, Nicholas; Das, Rahul K.; Pappu, Rohit V.

    2013-01-01

    Conformational heterogeneity is a defining characteristic of proteins. Intrinsically disordered proteins (IDPs) and denatured state ensembles are extreme manifestations of this heterogeneity. Inferences regarding globule versus coil formation can be drawn from analysis of polymeric properties such as average size, shape, and density fluctuations. Here we introduce a new parameter to quantify the degree of conformational heterogeneity within an ensemble to complement polymeric descriptors. The design of this parameter is guided by the need to distinguish between systems that couple their unfolding-folding transitions with coil-to-globule transitions and those systems that undergo coil-to-globule transitions with no evidence of acquiring a homogeneous ensemble of conformations upon collapse. The approach is as follows: Each conformation in an ensemble is converted into a conformational vector where the elements are inter-residue distances. Similarity between pairs of conformations is quantified using the projection between the corresponding conformational vectors. An ensemble of conformations yields a distribution of pairwise projections, which is converted into a distribution of pairwise conformational dissimilarities. The first moment of this dissimilarity distribution is normalized against the first moment of the distribution obtained by comparing conformations from the ensemble of interest to conformations drawn from a Flory random coil model. The latter sets an upper bound on conformational heterogeneity thus ensuring that the proposed measure for intra-ensemble heterogeneity is properly calibrated and can be used to compare ensembles for different sequences and across different temperatures. The new measure of conformational heterogeneity will be useful in quantitative studies of coupled folding and binding of IDPs and in de novo sequence design efforts that are geared toward controlling the degree of heterogeneity in unbound forms of IDPs. PMID:24089719

  8. Nuclear Data

    SciTech Connect

    White, Morgan C.

    2014-01-23

    PowerPoint presentation targeted for educational use. Nuclear data comes from a variety of sources and in many flavors. Understanding where the data you use comes from and what flavor it is can be essential to understand and interpret your results. This talk will discuss the nuclear data pipeline with particular emphasis on providing links to additional resources that can be used to explore the issues you will encounter.

  9. Nuclear Nonproliferation

    SciTech Connect

    Atkins-Duffin, C E

    2008-12-10

    With an explosion equivalent of about 20kT of TNT, the Trinity test was the first demonstration of a nuclear weapon. Conducted on July 16, 1945 in Alamogordo, NM this site is now a Registered National Historic Landmark. The concept and applicability of nuclear power was demonstrated on December 20, 1951 with the Experimental Breeder Reactor Number One (EBR-1) lit four light bulbs. This reactor is now a Registered National Historic Landmark, located near Arco, ID. From that moment forward it had been clearly demonstrated that nuclear energy has both peaceful and military applications and that the civilian and military fuel cycles can overlap. For the more than fifty years since the Atoms for Peace program, a key objective of nuclear policy has been to enable the wider peaceful use of nuclear energy while preventing the spread of nuclear weapons. Volumes have been written on the impact of these two actions on the world by advocates and critics; pundits and practioners; politicians and technologists. The nations of the world have woven together a delicate balance of treaties, agreements, frameworks and handshakes that are representative of the timeframe in which they were constructed and how they have evolved in time. Collectively these vehicles attempt to keep political will, nuclear materials and technology in check. This paper captures only the briefest abstract of the more significant aspects on the Nonproliferation Regime. Of particular relevance to this discussion is the special nonproliferation sensitivity associated with the uranium isotope separation and spent fuel reprocessing aspects of the nuclear fuel cycle.

  10. Nuclear Structure

    NASA Astrophysics Data System (ADS)

    Gargano, Angela

    2003-04-01

    An account of recent studies in the field of theoretical nuclear structure is reported. These studies concern essentially research activities performed under the Italian project "Fisica Teorica del Nucleo e dei Sistemi a Molti Corpi". Special attention is addressed to results obtained during the last two years as regards the development of new many-body techniques as well as the interpretation of new experimental aspects of nuclear structure.

  11. Nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    Arnould, M.; Takahashi, K.

    1999-03-01

    Nuclear astrophysics is that branch of astrophysics which helps understanding of the Universe, or at least some of its many faces, through the knowledge of the microcosm of the atomic nucleus. It attempts to find as many nuclear physics imprints as possible in the macrocosm, and to decipher what those messages are telling us about the varied constituent objects in the Universe at present and in the past. In the last decades much advance has been made in nuclear astrophysics thanks to the sometimes spectacular progress made in the modelling of the structure and evolution of the stars, in the quality and diversity of the astronomical observations, as well as in the experimental and theoretical understanding of the atomic nucleus and of its spontaneous or induced transformations. Developments in other subfields of physics and chemistry have also contributed to that advance. Notwithstanding the accomplishment, many long-standing problems remain to be solved, and the theoretical understanding of a large variety of observational facts needs to be put on safer grounds. In addition, new questions are continuously emerging, and new facts endangering old ideas. This review shows that astrophysics has been, and still is, highly demanding to nuclear physics in both its experimental and theoretical components. On top of the fact that large varieties of nuclei have to be dealt with, these nuclei are immersed in highly unusual environments which may have a significant impact on their static properties, the diversity of their transmutation modes, and on the probabilities of these modes. In order to have a chance of solving some of the problems nuclear astrophysics is facing, the astrophysicists and nuclear physicists are obviously bound to put their competence in common, and have sometimes to benefit from the help of other fields of physics, like particle physics, plasma physics or solid-state physics. Given the highly varied and complex aspects, we pick here some specific nuclear

  12. Nuclear telemedicine

    NASA Astrophysics Data System (ADS)

    Morrison, R. T.; Szasz, I. J.

    1990-06-01

    Diagnostic nuclear medicine patient images have been transniitted for 8 years from a regional conununity hospital to a university teaching hospital 700 kiloinetres away employing slow scan TV and telephone. Transruission and interpretation were done at the end of each working day or as circumstances required in cases of emergencies. Referring physicians received the nuclear medicine procedure report at the end of the completion day or within few minutes of completion in case of emergency procedures. To date more than 25 patient studies have been transmitted for interpretation. Blinded reinterpretation of the original hard copy data of 350 patient studies resulted in 100 agreement with the interpretation of transmitted data. This technique provides high quality diagnostic and therapeutic nuclear medicine services in remote hospitals where the services of an on-site nuclear physician is not available. 2. HISTORY Eight years ago when the nuclear medicine physician at Trail Regional Hospital left the Trail area and an other could not be recruited we examined the feasibility of image transmission by phone for interpretation since closing the department would have imposed unacceptable physical and financial hardship and medical constraints on the patient population the nearest nuclear medicine facility was at some 8 hours drive away. In hospital patients would have to be treated either based purely on physical findings or flown to Vancouver at considerable cost to the health care system (estimated cost $1500.

  13. Quantifying lateral tissue heterogeneities in hadron therapy

    SciTech Connect

    Pflugfelder, D.; Wilkens, J. J.; Szymanowski, H.; Oelfke, U.

    2007-04-15

    In radiotherapy with scanned particle beams, tissue heterogeneities lateral to the beam direction are problematic in two ways: they pose a challenge to dose calculation algorithms, and they lead to a high sensitivity to setup errors. In order to quantify and avoid these problems, a heterogeneity number H{sub i} as a method to quantify lateral tissue heterogeneities of single beam spot i is introduced. To evaluate this new concept, two kinds of potential errors were investigated for single beam spots: First, the dose calculation error has been obtained by comparing the dose distribution computed by a simple pencil beam algorithm to more accurate Monte Carlo simulations. The resulting error is clearly correlated with H{sub i}. Second, the analysis of the sensitivity to setup errors of single beam spots also showed a dependence on H{sub i}. From this data it is concluded that H{sub i} can be used as a criterion to assess the risks of a compromised delivered dose due to lateral tissue heterogeneities. Furthermore, a method how to incorporate this information into the inverse planning process for intensity modulated proton therapy is presented. By suppressing beam spots with a high value of H{sub i}, the unfavorable impact of lateral tissue heterogeneities can be reduced, leading to treatment plans which are more robust to dose calculation errors of the pencil beam algorithm. Additional possibilities to use the information of H{sub i} are outlined in the discussion.

  14. Computational model of heterogeneous heating in melanin

    NASA Astrophysics Data System (ADS)

    Kellicker, Jason; DiMarzio, Charles A.; Kowalski, Gregory J.

    2015-03-01

    Melanin particles often present as an aggregate of smaller melanin pigment granules and have a heterogeneous surface morphology. When irradiated with light within the absorption spectrum of melanin, these heterogeneities produce measurable concentrations of the electric field that result in temperature gradients from thermal effects that are not seen with spherical or ellipsoidal modeling of melanin. Modeling melanin without taking into consideration the heterogeneous surface morphology yields results that underestimate the strongest signals or over{estimate their spatial extent. We present a new technique to image phase changes induced by heating using a computational model of melanin that exhibits these surface heterogeneities. From this analysis, we demonstrate the heterogeneous energy absorption and resulting heating that occurs at the surface of the melanin granule that is consistent with three{photon absorption. Using the three{photon dluorescence as a beacon, we propose a method for detecting the extents of the melanin granule using photothermal microscopy to measure the phase changes resulting from the heating of the melanin.

  15. Implications of Heterogeneity in Multiple Myeloma

    PubMed Central

    de Mel, Sanjay; Lim, Su Hong; Tung, Moon Ley; Chng, Wee-Joo

    2014-01-01

    Multiple myeloma is the second most common hematologic malignancy in the world. Despite improvement in outcome, the disease is still incurable for most patients. However, not all myeloma are the same. With the same treatment, some patients can have very long survival whereas others can have very short survival. This suggests that there is underlying heterogeneity in myeloma. Studies over the years have revealed multiple layers of heterogeneity. First, clinical parameters such as age and tumor burden could significantly affect outcome. At the genetic level, there are also significant heterogeneity ranging for chromosome numbers, genetic translocations, and genetic mutations. At the clonal level, there appears to be significant clonal heterogeneity with multiple clones coexisting in the same patient. At the cell differentiation level, there appears to be a hierarchy of clonally related cells that have different clonogenic potential and sensitivity to therapies. These levels of complexities present challenges in terms of treatment and prognostication as well as monitoring of treatment. However, if we can clearly delineate and dissect this heterogeneity, we may also be presented with unique opportunities for precision and personalized treatment of myeloma. Some proof of concepts of such approaches has been demonstrated. PMID:25101266

  16. Heterogeneity of liver cancer and personalized therapy.

    PubMed

    Li, Liang; Wang, Hongyang

    2016-09-01

    Liver cancer is an extraordinarily heterogeneous malignant disease among the tumors that have so far been identified. Hepatocellular carcinoma (HCC) arises most frequently in the setting of chronic liver inflammation and fibrosis, and takes a variety of course in individual patients to process to tumor. The risk factors such as HBV and/or HCV infections, aflatoxin infection, abuse alcohol intake, metabolic syndrome, obesity and diabetes are closely related to the environmental and genetic susceptibilities to HCC. The consequent resulting genomic instability, molecular and signal transduction network disorders and microenvironmental discrepancies are characterized by the extraordinary heterogeneity of liver cancer. The histology-based definition of the morphological heterogeneity of liver cancer has been modified and refined to treat patients with targeted therapies, but this still cannot solve all the problems. Lack of consistent outcome for anticancer agents and conventional therapies in liver cancer treatment calls for assessing the benefits of new molecularly targeted drugs and combined therapy, under the heterogeneity condition of tumor. The present review article will provide the complex mechanism and phenotype of liver cancer heterogeneity, and help us to execute precision medicine in a really personalized manner.

  17. Molecular Heterogeneity Within the Clinical Diagnosis of Pericentral Retinal Degeneration

    PubMed Central

    Matsui, Rodrigo; Cideciyan, Artur V.; Schwartz, Sharon B.; Sumaroka, Alexander; Roman, Alejandro J.; Swider, Malgorzata; Huang, Wei Chieh; Sheplock, Rebecca; Jacobson, Samuel G.

    2015-01-01

    Purpose To characterize in detail the phenotype and genotype of patients with pericentral retinal degeneration (PRD). Methods Patients were screened for an annular ring scotoma ranging from 3° to 40° (n = 28, ages 24–71) with kinetic perimetry. All patients had pigmentary retinopathy in the region of the dysfunction. Further studies included cross-sectional and en face imaging, static chromatic perimetry, and electroretinography. Molecular screening was performed. Results Genotypes of 14 of 28 PRD patients were identified: There were mutations in eight different genes previously associated with autosomal dominant or autosomal recessive RDs. Kinetic fields monitored in some patients over years to more than a decade could be stable or show increased extent of the scotoma. Electroretinograms were recordable but with different severities of dysfunction. Patterns of photoreceptor outer nuclear layer (ONL) loss corresponded to the distribution of visual dysfunction. Outer nuclear layer thickness topography and en face imaging indicated that the greatest disease expression was in the area of known highest rod photoreceptor density. Conclusions Molecular heterogeneity was a feature of the PRD phenotype. Many of the molecular causes were also associated with other phenotypes, such as maculopathies, typical retinitis pigmentosa (RP) and cone–rod dystrophy. The pericentral pattern of retinal degeneration is thus confirmed to be an uncommon phenotype of many different genotypes rather than a distinct disease entity. PMID:26393467

  18. Wetting of a Chemically Heterogeneous Surface

    SciTech Connect

    Frink, L.J.D.; Salinger, A.G.

    1998-11-20

    Theories for inhomogeneous fluids have focused in recent years on wetting, capillary conden- sation, and solvation forces for model systems where the surface(s) is(are) smooth homogeneous parallel plates, cylinders, or spherical drops. Unfortunately natural systems are more likely to be hetaogeneous both in surt%ce shape and surface chemistry. In this paper we discuss the conse- quences of chemical heterogeneity on wetting. Specifically, a 2-dimensional implementation of a nonlocal density functional theory is solved for a striped surface model. Both the strength and range of the heterogeneity are varied. Contact angles are calculated, and phase transitions (both the wetting transition and a local layering transition) are located. The wetting properties of the surface ase shown to be strongly dependent on the nature of the surface heterogeneity. In addition highly ordered nanoscopic phases are found, and the operational limits for formation of ordered or crystalline phases of nanoscopic extent are discussed.

  19. Spatial Heterogeneity in the Tumor Microenvironment.

    PubMed

    Yuan, Yinyin

    2016-01-01

    Recent developments in studies of tumor heterogeneity have provoked new thoughts on cancer management. There is a desperate need to understand influence of the tumor microenvironment on cancer development and evolution. Applying principles and quantitative methods from ecology can suggest novel solutions to fulfil this need. We discuss spatial heterogeneity as a fundamental biological feature of the microenvironment, which has been largely ignored. Histological samples can provide spatial context of diverse cell types coexisting within the microenvironment. Advanced computer-vision techniques have been developed for spatial mapping of cells in histological samples. This has enabled the applications of experimental and analytical tools from ecology to cancer research, generating system-level knowledge of microenvironmental spatial heterogeneity. We focus on studies of immune infiltrate and tumor resource distribution, and highlight statistical approaches for addressing the emerging challenges based on these new approaches. PMID:27481837

  20. Impact of Aquifer Heterogeneities on Autotrophic Denitrification.

    NASA Astrophysics Data System (ADS)

    McCarthy, A.; Roques, C.; Selker, J. S.; Istok, J. D.; Pett-Ridge, J. C.

    2015-12-01

    Nitrate contamination in groundwater is a big challenge that will need to be addressed by hydrogeologists throughout the world. With a drinking water standard of 10mg/L of NO3-, innovative techniques will need to be pursued to ensure a decrease in drinking water nitrate concentration. At the pumping site scale, the influence and relationship between heterogeneous flow, mixing, and reactivity is not well understood. The purpose of this project is to incorporate both physical and chemical modeling techniques to better understand the effect of aquifer heterogeneities on autotrophic denitrification. We will investigate the link between heterogeneous hydraulic properties, transport, and the rate of autotrophic denitrification. Data collected in previous studies in laboratory experiments and pumping site scale experiments will be used to validate the models. The ultimate objective of this project is to develop a model in which such coupled processes are better understood resulting in best management practices of groundwater.

  1. Stretchable heterogeneous composites with extreme mechanical gradients

    NASA Astrophysics Data System (ADS)

    Libanori, Rafael; Erb, Randall M.; Reiser, Alain; Le Ferrand, Hortense; Süess, Martin J.; Spolenak, Ralph; Studart, André R.

    2012-12-01

    Heterogeneous composite materials with variable local stiffness are widespread in nature, but are far less explored in engineering structural applications. The development of heterogeneous synthetic composites with locally tuned elastic properties would allow us to extend the lifetime of functional devices with mechanically incompatible interfaces, and to create new enabling materials for applications ranging from flexible electronics to regenerative medicine. Here we show that heterogeneous composites with local elastic moduli tunable over five orders of magnitude can be prepared through the site-specific reinforcement of an entangled elastomeric matrix at progressively larger length scales. Using such a hierarchical reinforcement approach, we designed and produced composites exhibiting regions with extreme soft-to-hard transitions, while still being reversibly stretchable up to 350%. The implementation of the proposed methodology in a mechanically challenging application is illustrated here with the development of locally stiff and globally stretchable substrates for flexible electronics.

  2. A physical mechanism of cancer heterogeneity

    NASA Astrophysics Data System (ADS)

    Chen, Cong; Wang, Jin

    2016-02-01

    We studied a core cancer gene regulatory network motif to uncover possible source of cancer heterogeneity from epigenetic sources. When the time scale of the protein regulation to the gene is faster compared to the protein synthesis and degradation (adiabatic regime), normal state, cancer state and an intermediate premalignant state emerge. Due to the epigenetics such as DNA methylation and histone remodification, the time scale of the protein regulation to the gene can be slower or comparable to the protein synthesis and degradation (non-adiabatic regime). In this case, many more states emerge as possible phenotype alternations. This gives the origin of the heterogeneity. The cancer heterogeneity is reflected from the emergence of more phenotypic states, larger protein concentration fluctuations, wider kinetic distributions and multiplicity of kinetic paths from normal to cancer state, higher energy cost per gene switching, and weaker stability.

  3. A physical mechanism of cancer heterogeneity

    PubMed Central

    Chen, Cong; Wang, Jin

    2016-01-01

    We studied a core cancer gene regulatory network motif to uncover possible source of cancer heterogeneity from epigenetic sources. When the time scale of the protein regulation to the gene is faster compared to the protein synthesis and degradation (adiabatic regime), normal state, cancer state and an intermediate premalignant state emerge. Due to the epigenetics such as DNA methylation and histone remodification, the time scale of the protein regulation to the gene can be slower or comparable to the protein synthesis and degradation (non-adiabatic regime). In this case, many more states emerge as possible phenotype alternations. This gives the origin of the heterogeneity. The cancer heterogeneity is reflected from the emergence of more phenotypic states, larger protein concentration fluctuations, wider kinetic distributions and multiplicity of kinetic paths from normal to cancer state, higher energy cost per gene switching, and weaker stability. PMID:26854017

  4. Heterogeneity induces emergent functional networks for synchronization

    NASA Astrophysics Data System (ADS)

    Scafuti, Francesco; Aoki, Takaaki; di Bernardo, Mario

    2015-06-01

    We study the evolution of heterogeneous networks of oscillators subject to a state-dependent interconnection rule. We find that heterogeneity in the node dynamics is key in organizing the architecture of the functional emerging networks. We demonstrate that increasing heterogeneity among the nodes in state-dependent networks of phase oscillators causes a differentiation in the activation probabilities of the links when a distributed local network adaptation strategy is used in an evolutionary manner. This, in turn, yields the formation of hubs associated to nodes with larger distances from the average frequency of the ensemble. Our generic local evolutionary strategy can be used to solve a wide range of synchronization and control problems.

  5. Self-attracting walk on heterogeneous networks

    NASA Astrophysics Data System (ADS)

    Kim, Kanghun; Kyoung, Jaegu; Lee, D.-S.

    2016-05-01

    Understanding human mobility in cyberspace becomes increasingly important in this information era. While human mobility, memory-dependent and subdiffusive, is well understood in Euclidean space, it remains elusive in random heterogeneous networks like the World Wide Web. Here we study the diffusion characteristics of self-attracting walks, in which a walker is more likely to move to the locations visited previously than to unvisited ones, on scale-free networks. Under strong attraction, the number of distinct visited nodes grows linearly in time with larger coefficients in more heterogeneous networks. More interestingly, crossovers to sublinear growths occur in strongly heterogeneous networks. To understand these phenomena, we investigate the characteristic volumes and topology of the cluster of visited nodes and find that the reinforced attraction to hubs results in expediting exploration first but delaying later, as characterized by the scaling exponents that we derive. Our findings and analysis method can be useful for understanding various diffusion processes mediated by human.

  6. Dynamical robustness of coupled heterogeneous oscillators.

    PubMed

    Tanaka, Gouhei; Morino, Kai; Daido, Hiroaki; Aihara, Kazuyuki

    2014-05-01

    We study tolerance of dynamic behavior in networks of coupled heterogeneous oscillators to deterioration of the individual oscillator components. As the deterioration proceeds with reduction in dynamic behavior of the oscillators, an order parameter evaluating the level of global oscillation decreases and then vanishes at a certain critical point. We present a method to analytically derive a general formula for this critical point and an approximate formula for the order parameter in the vicinity of the critical point in networks of coupled Stuart-Landau oscillators. Using the critical point as a measure for dynamical robustness of oscillator networks, we show that the more heterogeneous the oscillator components are, the more robust the oscillatory behavior of the network is to the component deterioration. This property is confirmed also in networks of Morris-Lecar neuron models coupled through electrical synapses. Our approach could provide a useful framework for theoretically understanding the role of population heterogeneity in robustness of biological networks.

  7. Multiple roles of graphene in heterogeneous catalysis.

    PubMed

    Fan, Xiaobin; Zhang, Guoliang; Zhang, Fengbao

    2015-05-21

    Scientific interest in graphene as a catalyst and as a catalyst support in heterogeneous catalytic reactions has grown dramatically over the past several years. The present critical review summarizes the multiple roles of graphene in heterogeneous catalysis and highlights the influence of defects, heteroatom-containing functionalities, and graphene's two-dimensional structure on catalytic performance. We first discuss the role and advantages of graphene as a catalyst support, with emphasis on its interactions with the catalytic phases and the influence of mass transfer processes. We then clarify the origin of the intrinsic catalytic activity of graphene in heterogeneous catalytic reactions. Finally we suggest challenges and potential practical applications for graphene in industrial processes. PMID:25777748

  8. Characterizing hydrogeologic heterogeneity using lithologic data

    SciTech Connect

    Flach, G.; Hamm, LL.L.; Harris, M.K.; Thayer, P.A.; Haselow, J.S.; Smits, A.D.

    1997-06-13

    Large-scale (>1 m) variability in hydraulic conductivity is usually the main influence on field-scale groundwater flow patterns and dispersive transport. Incorporating realistic hydraulic conductivity heterogeneity into flow and transport models is paramount to accurate simulations, particularly for contaminant migration. Sediment lithologic descriptions and geophysical logs typically offer finer spatial resolution, and therefore more potential information about site-scale heterogeneity, than other site characterization data. In this study, a technique for generating a heterogeneous, three- dimensional hydraulic conductivity field from sediment lithologic descriptions is presented. The approach involves creating a three-dimensional, fine-scale representation of mud (silt and clay) percentage using a stratified interpolation algorithm. Mud percentage is then translated into horizontal and vertical conductivity using direct correlations derived from measured data and inverse groundwater flow modeling. Lastly, the fine-scale conductivity fields are averaged to create a coarser grid for use in groundwater flow and transport modeling.

  9. Self-attracting walk on heterogeneous networks.

    PubMed

    Kim, Kanghun; Kyoung, Jaegu; Lee, D-S

    2016-05-01

    Understanding human mobility in cyberspace becomes increasingly important in this information era. While human mobility, memory-dependent and subdiffusive, is well understood in Euclidean space, it remains elusive in random heterogeneous networks like the World Wide Web. Here we study the diffusion characteristics of self-attracting walks, in which a walker is more likely to move to the locations visited previously than to unvisited ones, on scale-free networks. Under strong attraction, the number of distinct visited nodes grows linearly in time with larger coefficients in more heterogeneous networks. More interestingly, crossovers to sublinear growths occur in strongly heterogeneous networks. To understand these phenomena, we investigate the characteristic volumes and topology of the cluster of visited nodes and find that the reinforced attraction to hubs results in expediting exploration first but delaying later, as characterized by the scaling exponents that we derive. Our findings and analysis method can be useful for understanding various diffusion processes mediated by human. PMID:27300913

  10. Seismoelectric effects due to mesoscopic heterogeneities

    NASA Astrophysics Data System (ADS)

    Jougnot, Damien; Rubino, J. GermáN.; Carbajal, Marina Rosas; Linde, Niklas; Holliger, Klaus

    2013-05-01

    While the seismic effects of wave-induced fluid flow due to mesoscopic heterogeneities have been studied for several decades, the role played by these types of heterogeneities on seismoelectric phenomena is largely unexplored. To address this issue, we have developed a novel methodological framework which allows for the coupling of wave-induced fluid flow, as inferred through numerical oscillatory compressibility tests, with the pertinent seismoelectric conversion mechanisms. Simulating the corresponding response of a water-saturated sandstone sample containing mesoscopic fractures, we demonstrate for the first time that these kinds of heterogeneities can produce measurable seismoelectric signals under typical laboratory conditions. Given that this phenomenon is sensitive to key hydraulic and mechanical properties, we expect that the results of this pilot study will stimulate further exploration on this topic in several domains of the Earth, environmental, and engineering sciences.

  11. Stretchable heterogeneous composites with extreme mechanical gradients.

    PubMed

    Libanori, Rafael; Erb, Randall M; Reiser, Alain; Le Ferrand, Hortense; Süess, Martin J; Spolenak, Ralph; Studart, André R

    2012-01-01

    Heterogeneous composite materials with variable local stiffness are widespread in nature, but are far less explored in engineering structural applications. The development of heterogeneous synthetic composites with locally tuned elastic properties would allow us to extend the lifetime of functional devices with mechanically incompatible interfaces, and to create new enabling materials for applications ranging from flexible electronics to regenerative medicine. Here we show that heterogeneous composites with local elastic moduli tunable over five orders of magnitude can be prepared through the site-specific reinforcement of an entangled elastomeric matrix at progressively larger length scales. Using such a hierarchical reinforcement approach, we designed and produced composites exhibiting regions with extreme soft-to-hard transitions, while still being reversibly stretchable up to 350%. The implementation of the proposed methodology in a mechanically challenging application is illustrated here with the development of locally stiff and globally stretchable substrates for flexible electronics. PMID:23232395

  12. Microswimmers in Complex Environments with Heterogeneous Microstructure

    NASA Astrophysics Data System (ADS)

    Hyon, Yunkyong; Fu, Henry

    2011-11-01

    We will discuss the swimming of microorganisms in complex and heterogeneous environments. Microswimmers in biological complex fluids, for instance, bacteria and sperm, are often greatly influenced by heterogeneous medium microstructure with length scales comparable to themselves. We characterize the interaction between the microswimmer and the medium microstructure using the model Golestanian three-sphere swimmer, treating the hydrodynamic interaction with the microstructure through the Oseen tensor. In this investigation, the microstructure of the heterogeneous environment is modeled by fixed spheres representing obstacles, or chains consisting of spheres connected with elastic springs. We find that the swimming speed of the swimmer depends on the force and deformation exerted on micro-structure. Furthermore, we find that while short freely suspended chains and short chains anchored at their ends interact with swimmer quite differently, long enough chains interact similarly, that is, a long mobile chain acts like a anchored chain. We discuss the implications for swimmer interactions with polymer solutions and compliant networks.

  13. Integrated Design and Analysis for Heterogeneous Objects

    NASA Astrophysics Data System (ADS)

    Qian, Xiaoping; Yang, Pinghai

    2008-02-01

    The recent advancement of solid freeform fabrication, design techniques and fundamental understanding of material properties in functionally graded material objects has made it possible to design and fabricate multifunctional heterogeneous objects. In this paper, we present an integrated design and analysis approach for heterogeneous object realization, which employs a unified design and analysis model based on B-splines and allows for direct interaction between the design and analysis model without a laborious meshing operation. In the design module, a new approach for intuitively modeling multi-material objects, termed heterogeneous lofting, is presented. In the analysis module, a novel graded B-spline finite element solution procedure is described, which gives orders of magnitude better convergence rate in comparison with current methods, as demonstrated in several case studies. Further advantages of this approach include simplified mesh construction, exact geometry/material composition representation and easy extraction of iso-material surface for manufacturing process planning.

  14. Circulating tumour cells: insights into tumour heterogeneity.

    PubMed

    Hayes, D F; Paoletti, C

    2013-08-01

    Tumour heterogeneity is a major barrier to cure breast cancer. It can exist between patients with different intrinsic subtypes of breast cancer or within an individual patient with breast cancer. In the latter case, heterogeneity has been observed between different metastatic sites, between metastatic sites and the original primary tumour, and even within a single tumour at either a metastatic or a primary site. Tumour heterogeneity is a function of two separate, although linked, processes. First, genetic instability is a hallmark of malignancy, and results in 'fixed' genetic changes that are almost certainly carried forward through progression of the cancer over time, with increasingly complex additional genetic changes in new metastases as they arise. The second type of heterogeneity is due to differential but 'plastic' expression of various genes important in the biology and response to various therapies. Together, these processes result in highly variable cancers with differential response, and resistance, to both targeted (e.g. endocrine or anti-human epithelial growth receptor type 2 (HER2) agents) and nontargeted therapies (e.g. chemotherapy). Ideally, tumour heterogeneity would be monitored over time, especially in relation to therapeutic strategies. However, biopsies of metastases require invasive and costly procedures, and biopsies of multiple metastases, or serially over time, are impractical. Circulating tumour cells (CTCs) represent a potential surrogate for tissue-based cancer and therefore might provide the opportunity to monitor serial changes in tumour biology. Recent advances have enabled accurate and reliable quantification and molecular characterization of CTCs with regard to a number of important biomarkers including oestrogen receptor alpha and HER2. Preliminary data have demonstrated that expression of these markers between CTCs in individual patients with metastatic breast cancer reflects the heterogeneity of the underlying tumours. Future

  15. Heterogeneity and Scaling in Geologic Media

    SciTech Connect

    Gregory N. Boitnott; Gilles Y. Bussod; Paul N. Hagin; Stephen R. Brown

    2005-04-18

    The accurate characterization and remediation of contaminated subsurface environments requires the detailed knowledge of subsurface structures and flow paths. Enormous resources are invested in scoping and characterizing sites using core sampling, 3-D geophysical surveys, well tests, etc.... Unfortunately, much of the information acquired is lost to compromises and simplifications made in constructing numerical grids for the simulators used to predict flow and transport from the contaminated area to the accessible environment. In rocks and soils, the bulk geophysical and transport properties of the matrix and of fracture systems are determined by the juxtaposition of geometric features at many length scales. In the interest of computational efficiency, recognized heterogeneities are simplified, averaged out, or entirely ignored in spite of recent studies that recognize that: (1) Structural and lithologic heterogeneities exist on all scales in rocks. (2) Small heterogeneities influence, and can control the physical and chemical properties of rocks. In this work we propose a physically based approach for the description and treatment of heterogeneities, that highlights the use of laboratory equipment designed to measure the effect on physical properties of fine scale heterogeneities observed in rocks and soils. We then discuss the development of an integration methodology that uses these measurements to develop and upscale flow and transport models. Predictive simulations are 'calibrated' to the measured heterogeneity data, and subsequently upscaled in a way that is consistent with the transport physics and the efficient use of environmental geophysics. This methodology provides a more accurate interpretation and representation of the subsurface for both environmental engineering and remediation. We show through examples, (i) the important influence of even subtle heterogeneity in the interpreting of geophysical data, and (ii) how physically based upscaling can lead

  16. Micro- and nanorobots swimming in heterogeneous liquids.

    PubMed

    Nelson, Bradley J; Peyer, Kathrin E

    2014-09-23

    Essentially all experimental investigations of swimming micro- and nanorobots have focused on swimming in homogeneous Newtonian liquids. In this issue of ACS Nano, Schamel et al. investigate the actuation of "nanopropellers" in a viscoelastic biological gel that illustrates the importance of the size of the nanostructure relative to the gel mesh size. In this Perspective, we shed further light on the swimming performance of larger microrobots swimming in heterogeneous liquids. One of the interesting results of our work is that earlier findings on the swimming performance of motile bacteria in heterogeneous liquids agree, in principle, with our results. We also discuss future research directions that should be pursued in this fascinating interdisciplinary field.

  17. Nuclear waste

    SciTech Connect

    Not Available

    1988-05-01

    This paper discusses how, as part of the Department of Energy's implementation of the Nuclear Waste Policy Act of 1982, DOE is required to investigate a site at Yucca Mountain, Nevada and, if it determines that the site is suitable, recommend to the President its selection for a nuclear waste repository. The Nuclear Regulatory Commission, in considering development of the plan, issued five objections, one of which is DOE's failure to recognize the range of alternative conceptual models of the Yucca Mountain site that can be supported by the limited existing technical data. At the end of the quarter DOE directed its project offices in Washington and Texas to begin orderly phase-out of all site-specific repository activities. Costs for this phase-out are $53 million for the Deaf Smith site and $85 million for the Hanford site.

  18. Nuclear scales

    SciTech Connect

    Friar, J.L.

    1998-12-01

    Nuclear scales are discussed from the nuclear physics viewpoint. The conventional nuclear potential is characterized as a black box that interpolates nucleon-nucleon (NN) data, while being constrained by the best possible theoretical input. The latter consists of the longer-range parts of the NN force (e.g., OPEP, TPEP, the {pi}-{gamma} force), which can be calculated using chiral perturbation theory and gauged using modern phase-shift analyses. The shorter-range parts of the force are effectively parameterized by moments of the interaction that are independent of the details of the force model, in analogy to chiral perturbation theory. Results of GFMC calculations in light nuclei are interpreted in terms of fundamental scales, which are in good agreement with expectations from chiral effective field theories. Problems with spin-orbit-type observables are noted.

  19. NUCLEAR REACTOR

    DOEpatents

    Moore, R.V.; Bowen, J.H.; Dent, K.H.

    1958-12-01

    A heterogeneous, natural uranium fueled, solid moderated, gas cooled reactor is described, in which the fuel elements are in the form of elongated rods and are dlsposed within vertical coolant channels ln the moderator symmetrically arranged as a regular lattice in groups. This reactor employs control rods which operate in vertical channels in the moderator so that each control rod is centered in one of the fuel element groups. The reactor is enclosed in a pressure vessel which ls provided with access holes at the top to facilitate loading and unloadlng of the fuel elements, control rods and control rod driving devices.

  20. Nuclear pursuits

    SciTech Connect

    Not Available

    1993-05-01

    This table lists quantities of warheads (in stockpile, peak number per year, total number built, number of known test explosions), weapon development milestones (developers of the atomic bomb and hydrogen bomb, date of first operational ICBM, first nuclear-powered naval SSN in service, first MIRVed missile deployed), and testing milestones (first fission test, type of boosted fission weapon, multistage thermonuclear test, number of months from fission bomb to multistage thermonuclear bomb, etc.), and nuclear infrastructure (assembly plants, plutonium production reactors, uranium enrichment plants, etc.). Countries included in the tally are the United States, Soviet Union, Britain, France, and China.

  1. Nuclear power: Fourth edition

    SciTech Connect

    Deutsch, R.W.

    1986-01-01

    This book describes the basics of nuclear power generation, explaining both the benefits and the real and imagined risks of nuclear power. It includes a discussion of the Three Mile Island accident and its effects. Nuclear Power has been used in the public information programs of more than 100 utilities. The contents discussed are: Nuclear Power and People; Why Nuclear Power. Electricity produced by coal; Electricity produced by nuclear fuel; Nuclear plant sites in the United States; Short History of Commercial Nuclear Power; U.S. nuclear submarines, Regulation of Nuclear Power Plants; Licensing process, Nuclear Power Plant Operator Training; Nuclear power plant simulator, Are Nuclear Plants Safe.; Containment structure, Nuclear Power Plant Insurance; Is Radiation Dangerous.; Man-made radiation, What is Nuclear Fuel.; Fuel cycle for commercial nuclear power plants; Warm Water Discharge; Cooling tower; Protection of Radioactive Materials; Plutonium and Proliferation; Disposal of Radioactive Wastes; Are Alternate Energy Sources Available.; Nuclear Opposition; and Nuclear Power in the Future.

  2. Induction of cytochromes P450 1A1 and 1A2 by tanshinones in human HepG2 hepatoma cell line

    SciTech Connect

    Zhang Rong; Sun Jianguo; Ma Liping; Wu Xiaolan; Pan Guoyu; Hao Haiping; Zhou Fang; Jiye, A; Liu Changhui; Ai Hua; Shang Lili; Gao Haiyan; Peng Ying; Wan Ping; Wu Hui; Wang Guangji

    2011-04-01

    Diterpenoid tanshinones including tanshinone IIA (TIIA), cryptotanshinone (CTS), tanshinone I (TI) and dihydrotanshinone I (DHTI) are the major bioactive components from Danshen. The major aim of our present study was to investigate the induction potential of these four main components of tanshinones (TIIA, CTS, TI, and DHTI) on the expression of CYP1A1 and CYP1A2 in HepG2 cells. Our results showed that all of these four tanshinones caused a significant time- and concentration-dependent increase in the amount of CYP1A1/2 expression in HepG2 cells. These induction effects were further characterized through transcriptional regulation: the induction of CYP1A1/2 mRNA level by tanshinones was completely blocked by the transcription inhibitor actinomycin D; the expression of CYP1A1/2 heterogeneous nuclear RNA was induced by tanshinone treatment; and CYP1A1 mRNA stability was not influenced by these tanshinones. Interestingly, tanshinones plus B[a]P produced additive/synergistic effect on CYP1A1/2 induction. In addition, the tanshinone-induced CYP1A1/2 expression was abolished by the aryl hydrocarbon receptor (AhR) antagonist resveratrol, suggesting an AhR dependent transcription mechanism. In the reporter gene assay, while TI and DHTI significantly induced AhR-dependent luciferase activity, TIIA and CTS failed to induce this activity. Collectively, the tanshinones could induce CYP1A1 and CYP1A2 expression through transcriptional activation mechanism and exert differential effects on activating AhR in HepG2 cells. Our findings suggest that rational administration of tanshinones should be considered with respect to their effect on AhR and CYP1A1/2 expression.

  3. Heterogeneous nucleation in hypermonotectic aluminum alloys

    NASA Astrophysics Data System (ADS)

    Köhler, M.; Ratke, L.; Kaban, I.; Hoyer, W.

    2012-01-01

    Simple casting experiments were set up to solve the question, if heterogeneous nucleation of the liquid-liquid decomposition in monotectic systems is possible. Al-Pb alloys with different inoculants were solidified, and the resulting microstructure was analysed by SEM and X-ray microtomography. Pronounced changes in the distribution of the lead precipitations indicate that it is possible to trigger the nucleation.

  4. Towards inverse modeling of intratumor heterogeneity

    NASA Astrophysics Data System (ADS)

    Brutovsky, Branislav; Horvath, Denis

    2015-08-01

    Development of resistance limits efficiency of present anticancer therapies and preventing it remains a big challenge in cancer research. It is accepted, at the intuitive level, that resistance emerges as a consequence of the heterogeneity of cancer cells at the molecular, genetic and cellular levels. Produced by many sources, tumor heterogeneity is extremely complex time dependent statistical characteristics which may be quantified by measures defined in many different ways, most of them coming from statistical mechanics. In this paper, we apply the Markovian framework to relate population heterogeneity to the statistics of the environment. As, from an evolutionary viewpoint, therapy corresponds to a purposeful modi- fication of the cells' fitness landscape, we assume that understanding general relationship between the spatiotemporal statistics of a tumor microenvironment and intratumor heterogeneity will allow to conceive the therapy as an inverse problem and to solve it by optimization techniques. To account for the inherent stochasticity of biological processes at cellular scale, the generalized distancebased concept was applied to express distances between probabilistically described cell states and environmental conditions, respectively.

  5. Detecting Heterogeneity in Logistic Regression Models

    ERIC Educational Resources Information Center

    Balazs, Katalin; Hidegkuti, Istvan; De Boeck, Paul

    2006-01-01

    In the context of item response theory, it is not uncommon that person-by-item data are correlated beyond the correlation that is captured by the model--in other words, there is extra binomial variation. Heterogeneity of the parameters can explain this variation. There is a need for proper statistical methods to indicate possible extra…

  6. Heterogeneous photocatalytic oxidation of atmospheric trace contaminants

    NASA Technical Reports Server (NTRS)

    Ollis, David F.

    1993-01-01

    The progress report on heterogeneous photocatalytic oxidation of atmospheric trace contaminants covering the period from 1 May - 31 Oct. 1992 is presented. The two topics discussed are photoreactor monolith fundamental studies and monolith reactor operation: batch recirculation system. Concentration profiles are shown.

  7. Multilingual Federated Searching Across Heterogeneous Collections.

    ERIC Educational Resources Information Center

    Powell, James; Fox, Edward A.

    1998-01-01

    Describes a scalable system for searching heterogeneous multilingual collections on the World Wide Web. Details Searchable Database Markup Language (SearchDB-ML) for describing the characteristics of a search engine and its interface, and a protocol for requesting word translations between languages. (Author)

  8. Heterogeneous OH oxidation of organic aerosols

    NASA Astrophysics Data System (ADS)

    Smith, J.; Kroll, J.; Cappa, C.; Che, D.; Ahmed, M.; Leone, S.; Worsnop, D.; Wilson, K.

    2008-12-01

    The hydroxyl radical (OH) is the most important reactive species in both clean and polluted atmospheres, and therefore gas-phase OH chemistry has been extensively studied for decades. Due to this enormous effort the rates and mechanism of OH reactions with gas phase organics are relatively well understood. However, it unclear whether these well established gas-phase chemical mechanisms apply to the more complex heterogeneous reactions of OH radicals with organic aerosols (OA). Although recent studies have begun to examine OH oxidation of OA, numerous outstanding questions still remain regarding both the rate and chemical mechanism of these reactions. Here we present an in depth investigation of the heterogeneous oxidation of organic squalane particles by OH radicals. By combining a photochemical aerosol flow reactor with a high-resolution aerosol mass spectrometer (AMS), with both electron impact and vacuum ultraviolet photoionization, we investigate OH heterogeneous chemistry in unprecedented detail. Employing elemental composition measurements with detailed kinetics we have arrived at a simple oxidation model which accurately accounts for the evolution of squalane and its" oxidation products. In addition, by exploring a large range of OH concentrations we are able to directly measure the role of secondary particle-phase chain chemistry which can significantly accelerate the oxidation of OA in the atmosphere. Based on these measurements we have arrived at an explicit chemical mechanism for heterogeneous OH oxidation of OA which accurately accounts for our observations over a wide range of reaction conditions.

  9. Heterogeneous catalysis: More than skimming the surface

    NASA Astrophysics Data System (ADS)

    (Feng) Tao, Franklin; Tang, Yu

    2016-10-01

    The high temperatures and pressures used in heterogeneous catalysis make it difficult to observe catalysts using conventional techniques. Now, adsorbed product molecules on the surface of a single-crystal model catalyst have been observed during catalysis using a custom-built scanning tunnelling microscope that can work in situ.

  10. Heterogeneous multidimensional scaling for complex networks

    NASA Astrophysics Data System (ADS)

    Xuan, Qi; Ma, Xiaodi; Fu, Chenbo; Dong, Hui; Zhang, Guijun; Yu, Li

    2015-07-01

    Many real-world networks are essentially heterogeneous, where the nodes have different abilities to gain connections. Such networks are difficult to be embedded into low-dimensional Euclidean space if we ignore the heterogeneity and treat all the nodes equally. In this paper, based on a newly defined heterogeneous distance and a generalized network distance under the constraints of network and triangle inequalities, respectively, we propose a new heterogeneous multidimensional scaling method (HMDS) to embed different networks into proper Euclidean spaces. We find that HMDS behaves much better than the traditional multidimensional scaling method (MDS) in embedding different artificial and real-world networks into Euclidean spaces. Besides, we also propose a method to estimate the appropriate dimensions of Euclidean spaces for different networks, and find that the estimated dimensions are quite close to the real dimensions for those geometrical networks under study. These methods thus can help to better understand the evolution of real-world networks, and have practical importance in network visualization, community detection, link prediction and localization of wireless sensors.

  11. Scale Reliability Evaluation with Heterogeneous Populations

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A latent variable modeling approach for scale reliability evaluation in heterogeneous populations is discussed. The method can be used for point and interval estimation of reliability of multicomponent measuring instruments in populations representing mixtures of an unknown number of latent classes or subpopulations. The procedure is helpful also…

  12. Heterogeneity: The key to failure forecasting

    PubMed Central

    Vasseur, Jérémie; Wadsworth, Fabian B.; Lavallée, Yan; Bell, Andrew F.; Main, Ian G.; Dingwell, Donald B.

    2015-01-01

    Elastic waves are generated when brittle materials are subjected to increasing strain. Their number and energy increase non-linearly, ending in a system-sized catastrophic failure event. Accelerating rates of geophysical signals (e.g., seismicity and deformation) preceding large-scale dynamic failure can serve as proxies for damage accumulation in the Failure Forecast Method (FFM). Here we test the hypothesis that the style and mechanisms of deformation, and the accuracy of the FFM, are both tightly controlled by the degree of microstructural heterogeneity of the material under stress. We generate a suite of synthetic samples with variable heterogeneity, controlled by the gas volume fraction. We experimentally demonstrate that the accuracy of failure prediction increases drastically with the degree of material heterogeneity. These results have significant implications in a broad range of material-based disciplines for which failure forecasting is of central importance. In particular, the FFM has been used with only variable success to forecast failure scenarios both in the field (volcanic eruptions and landslides) and in the laboratory (rock and magma failure). Our results show that this variability may be explained, and the reliability and accuracy of forecast quantified significantly improved, by accounting for material heterogeneity as a first-order control on forecasting power. PMID:26307196

  13. Heterogeneity: The key to failure forecasting.

    PubMed

    Vasseur, Jérémie; Wadsworth, Fabian B; Lavallée, Yan; Bell, Andrew F; Main, Ian G; Dingwell, Donald B

    2015-08-26

    Elastic waves are generated when brittle materials are subjected to increasing strain. Their number and energy increase non-linearly, ending in a system-sized catastrophic failure event. Accelerating rates of geophysical signals (e.g., seismicity and deformation) preceding large-scale dynamic failure can serve as proxies for damage accumulation in the Failure Forecast Method (FFM). Here we test the hypothesis that the style and mechanisms of deformation, and the accuracy of the FFM, are both tightly controlled by the degree of microstructural heterogeneity of the material under stress. We generate a suite of synthetic samples with variable heterogeneity, controlled by the gas volume fraction. We experimentally demonstrate that the accuracy of failure prediction increases drastically with the degree of material heterogeneity. These results have significant implications in a broad range of material-based disciplines for which failure forecasting is of central importance. In particular, the FFM has been used with only variable success to forecast failure scenarios both in the field (volcanic eruptions and landslides) and in the laboratory (rock and magma failure). Our results show that this variability may be explained, and the reliability and accuracy of forecast quantified significantly improved, by accounting for material heterogeneity as a first-order control on forecasting power.

  14. Fragmentation of metal particles during heterogeneous explosion

    NASA Astrophysics Data System (ADS)

    Ripley, R. C.; Donahue, L.; Zhang, F.

    2015-03-01

    Heterogeneous explosives contain a mixture of standard explosive material and reactive metal particles. The inclusion of metal particles alters the energy density and energy release timescales involved in the blast event. Available experimental evidence indicates that metal particles may be damaged or fragmented during heterogeneous blast, altering the distribution of particle sizes from their initial state. This paper discusses adaptation and application of fragmentation theory and physical models for particle damage during condensed matter detonation, aerodynamic breakup of molten particles, and particle impact fragmentation with nearby structures. The shock compression and impact fragmentation models are based on the energy methods for dynamic fragmentation by Grady and Kipp, while aerodynamic breakup is treated according to Weber number stability criteria for droplets. These particle fragmentation models are validated against fundamental test cases from the literature. The models are then applied to heterogeneous blast scenarios including free field and wall reflection in a semi-confined urban street. Comparison with experimental records of pressure shows good agreement despite challenges inherent in the complexity of heterogeneous blast measurement and multiphase simulation.

  15. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  16. Advancing Academic Achievement in the Heterogeneous Classroom.

    ERIC Educational Resources Information Center

    Casey, Linda; And Others

    This master's project analyzed the implementation of a program designed to address the academic needs of all students in a heterogeneous classroom. The targeted population consisted of secondary parochial school students from working and middle class backgrounds in or around a large midwestern metropolitan area. Problems of underachievement were…

  17. Accelerating Mathematics Achievement Using Heterogeneous Grouping

    ERIC Educational Resources Information Center

    Burris, Carol Corbett; Heubert, Jay P.; Levin, Henry M.

    2006-01-01

    This longitudinal study examined the effects of providing an accelerated mathematics curriculum in heterogeneously grouped middle school classes in a diverse suburban school district. A quasi-experimental cohort design was used to evaluate subsequent completion of advanced high school math courses as well as academic achievement. Results showed…

  18. Burning Fat Fuels Leukemic Stem Cell Heterogeneity.

    PubMed

    Thomas, Daniel; Majeti, Ravindra

    2016-07-01

    Obese leukemia patients exhibit reduced survival after chemotherapy, suggesting an important role of adipose tissue in disease progression. In this issue of Cell Stem Cell, Ye et al. (2016) reveal metabolic heterogeneity in leukemic stem cell (LSC) subpopulations and show that chemotherapy-resistant CD36+ LSCs co-opt gonadal adipose tissue to support their metabolism and survival. PMID:27392217

  19. Advances in selective conversions by heterogeneous photocatalysis.

    PubMed

    Palmisano, Giovanni; García-López, Elisa; Marcì, Giuseppe; Loddo, Vittorio; Yurdakal, Sedat; Augugliaro, Vincenzo; Palmisano, Leonardo

    2010-10-14

    Selective photocatalytic conversions are offering an alternative green route for replacing environmentally hazardous processes with safe and energy efficient routes. This paper reports the most recent advances in the application of heterogeneous photocatalysis to synthesize valuable compounds by selective oxidation and reduction.

  20. Heterogeneous nucleation of ice on carbon surfaces.

    PubMed

    Lupi, Laura; Hudait, Arpa; Molinero, Valeria

    2014-02-26

    Atmospheric aerosols can promote the heterogeneous nucleation of ice, impacting the radiative properties of clouds and Earth's climate. The experimental investigation of heterogeneous freezing of water droplets by carbonaceous particles reveals widespread ice freezing temperatures. It is not known which structural and chemical characteristics of soot account for the variability in ice nucleation efficiency. Here we use molecular dynamics simulations to investigate the nucleation of ice from liquid water in contact with graphitic surfaces. We find that atomically flat carbon surfaces promote heterogeneous nucleation of ice, while molecularly rough surfaces with the same hydrophobicity do not. Graphitic surfaces and other surfaces that promote ice nucleation induce layering in the interfacial water, suggesting that the order imposed by the surface on liquid water may play an important role in the heterogeneous nucleation mechanism. We investigate a large set of graphitic surfaces of various dimensions and radii of curvature and find that variations in nanostructures alone could account for the spread in the freezing temperatures of ice on soot in experiments. We conclude that a characterization of the nanostructure of soot is needed to predict its ice nucleation efficiency.

  1. The Leftouts; Disadvantaged Children in Heterogeneous Schools.

    ERIC Educational Resources Information Center

    Warden, Sandra A.

    This work by a social psychologist is concerned with the consequences of the values, attitudes, and behavior of teachers and more advantaged peers for the educational experience of disadvantaged youngsters in heterogeneous schools. The academic, social, and emotional factors in these schools are interdependent and equally important for the…

  2. Heterogeneity: The key to failure forecasting.

    PubMed

    Vasseur, Jérémie; Wadsworth, Fabian B; Lavallée, Yan; Bell, Andrew F; Main, Ian G; Dingwell, Donald B

    2015-01-01

    Elastic waves are generated when brittle materials are subjected to increasing strain. Their number and energy increase non-linearly, ending in a system-sized catastrophic failure event. Accelerating rates of geophysical signals (e.g., seismicity and deformation) preceding large-scale dynamic failure can serve as proxies for damage accumulation in the Failure Forecast Method (FFM). Here we test the hypothesis that the style and mechanisms of deformation, and the accuracy of the FFM, are both tightly controlled by the degree of microstructural heterogeneity of the material under stress. We generate a suite of synthetic samples with variable heterogeneity, controlled by the gas volume fraction. We experimentally demonstrate that the accuracy of failure prediction increases drastically with the degree of material heterogeneity. These results have significant implications in a broad range of material-based disciplines for which failure forecasting is of central importance. In particular, the FFM has been used with only variable success to forecast failure scenarios both in the field (volcanic eruptions and landslides) and in the laboratory (rock and magma failure). Our results show that this variability may be explained, and the reliability and accuracy of forecast quantified significantly improved, by accounting for material heterogeneity as a first-order control on forecasting power. PMID:26307196

  3. Diffusion and Surface Reaction in Heterogeneous Catalysis

    ERIC Educational Resources Information Center

    Baiker, A.; Richarz, W.

    1978-01-01

    Ethylene hydrogenation on a platinum catalyst, electrolytically applied to a tube wall, is a good system for the study of the interactions between diffusion and surface reaction in heterogeneous catalysis. Theoretical background, apparatus, procedure, and student performance of this experiment are discussed. (BB)

  4. Dissecting cancer evolution at the macro-heterogeneity and micro-heterogeneity scale.

    PubMed

    Barber, Louise J; Davies, Matthew N; Gerlinger, Marco

    2015-02-01

    Intratumour heterogeneity complicates biomarker discovery and treatment personalization, and pervasive cancer evolution is a key mechanism leading to therapy failure and patient death. Thus, understanding subclonal heterogeneity architectures and cancer evolution processes is critical for the development of effective therapeutic approaches which can control or thwart cancer evolutionary plasticity. Current insights into heterogeneity are mainly limited to the macroheterogeneity level, established by cancer subclones that have undergone significant clonal expansion. Novel single cell sequencing and blood-based subclonal tracking technologies are enabling detailed insights into microheterogeneity and the dynamics of clonal evolution. We assess how this starts to delineate the rules governing cancer evolution and novel angles for more effective therapeutic intervention.

  5. Nuclear medicine

    SciTech Connect

    Wagner, H.N. Jr.

    1986-10-17

    In 1985 and 1986 nuclear medicine became more and more oriented toward in vov chemistry, chiefly as a result of advances in positron emission tomography (PET). The most important trend was the extension of PET technology into the care of patients with brain tumors, epilepsy, and heart disease. A second trend was the increasing use of single-photon emission computed tomography (SPECT).

  6. NUCLEAR REACTOR

    DOEpatents

    Treshow, M.

    1961-09-01

    A boiling-water nuclear reactor is described wherein control is effected by varying the moderator-to-fuel ratio in the reactor core. This is accomplished by providing control tubes containing a liquid control moderator in the reactor core and providing means for varying the amount of control moderatcr within the control tubes.

  7. Nuclear Science.

    ERIC Educational Resources Information Center

    Pennsylvania State Dept. of Education, Harrisburg. Bureau of Curriculum Services.

    This document is a report on a course in nuclear science for the high school curriculum. The course is designed to provide a basic but comprehensive understanding of the atom in the light of modern knowledge, and to show how people attempt to harness the tremendous energy liberated through fission and fusion reactions. The course crosses what are…

  8. Nuclear Misinformation

    ERIC Educational Resources Information Center

    Ford, Daniel F.; Kendall, Henry W.

    1975-01-01

    Many scientists feel that research into nuclear safety has been diverted or distorted, and the results of the research concealed or inaccurately reported on a large number of occasions. Of particular concern have been the emergency cooling systems which have not, as yet, been adequately tested. (Author/MA)

  9. Nuclear explosions

    SciTech Connect

    Broyles, A.A.

    1982-07-01

    A summary of the physics of a nuclear bomb explosion and its effects on human beings is presented at the level of a sophomore general physics course without calculus. It is designed to supplement a standard text for such a course and problems are included.

  10. Nuclear energy.

    PubMed

    Wilson, Peter D

    2010-01-01

    The technical principles and practices of the civil nuclear industry are described with particular reference to fission and its products, natural and artificial radioactivity elements principally concerned and their relationships, main types of reactor, safety issues, the fuel cycle, waste management, issues related to weapon proliferation, environmental considerations and possible future developments.

  11. Nuclear Terrorism.

    SciTech Connect

    Hecker, Siegfried S.

    2001-01-01

    As pointed out by several speakers, the level of violence and destruction in terrorist attacks has increased significantly during the past decade. Fortunately, few have involved weapons of mass destruction, and none have achieved mass casualties. The Aum Shinrikyo release of lethal nerve agent, sarin, in the Tokyo subway on March 20, 1995 clearly broke new ground by crossing the threshold in attempting mass casualties with chemical weapons. However, of all weapons of mass destruction, nuclear weapons still represent the most frightening threat to humankind. Nuclear weapons possess an enormous destructive force. The immediacy and scale of destruction are unmatched. In addition to destruction, terrorism also aims to create fear among the public and governments. Here also, nuclear weapons are unmatched. The public's fear of nuclear weapons or, for that matter, of all radioactivity is intense. To some extent, this fear arises from a sense of unlimited vulnerability. That is, radioactivity is seen as unbounded in three dimensions - distance, it is viewed as having unlimited reach; quantity, it is viewed as having deadly consequences in the smallest doses (the public is often told - incorrectly, of course - that one atom of plutonium will kill); and time, if it does not kill you immediately, then it will cause cancer decades hence.

  12. A method distinguishing expressed vs. null mutations of the Col1A1 gene in osteogenesis imperfecta

    SciTech Connect

    Redford-Badwal, D.A.; Stover, M.L.; McKinstry, M.

    1994-09-01

    Osteogenesis imperfecta (OI) is a heterogeneous group of heritable disorders of bone characterized by increased susceptibility to fracture. Most of the causative mutations were identified in patients with the lethal form of the disease. Attention is now shifting to the milder forms of OI where glycine substitutions and null producing mutations have been found. Single amino acid substitutions can be identified by RT/PCR of total cellular RNA, but this approach does not work well for null mutations since the defective transcript does not accumulate in the cytoplasm. We have altered our RNA extraction method to separate RNA from the nuclear and cytoplasmic compartments of cultured fibroblasts. Standard methods of mutation identification (RT/PCR followed by SSCP) is applied to each RNA fraction. DNA from an abnormal band on the SSCP gel is eluted and amplified by PCR for cloning and sequencing. Using this approach we have identified an Asp to Asn change in exon 50 (type II OI) and a Gly to Arg in exon 11 (type I OI) of the COL1A1 gene. These changes were found in both nuclear and cytoplasmic compartments. These putative mutations are currently being confirmed by protein studies. In contrast, three patients with mild OI associated with reduced {proportional_to}(I)mRNA, had distinguishing SSCP bands present in the nuclear but not the cytoplasmic compartment. In one case a frame shift mutation was observed, while the other two revealed polymorphisms. The compartmentalization of the mutant allele has directed us to look elsewhere in the transcript for the causative mutation. This approach to mutation identification is capable of distinguishing these fundamentally different types of mutations and allows for preferential cloning and sequencing of the abnormal allele.

  13. Characterization of oil and gas reservoir heterogeneity

    SciTech Connect

    Tyler, N.; Barton, M.D.; Bebout, D.G.; Fisher, R.S.; Grigsby, J.D.; Guevara, E.; Holtz, M.; Kerans, C.; Nance, H.S.; Levey, R.A.

    1992-10-01

    Research described In this report addresses the internal architecture of two specific reservoir types: restricted-platform carbonates and fluvial-deltaic sandstones. Together, these two reservoir types contain more than two-thirds of the unrecovered mobile oil remaining ill Texas. The approach followed in this study was to develop a strong understanding of the styles of heterogeneity of these reservoir types based on a detailed outcrop description and a translation of these findings into optimized recovery strategies in select subsurface analogs. Research targeted Grayburg Formation restricted-platform carbonate outcrops along the Algerita Escarpment and In Stone Canyon In southeastern New Mexico and Ferron deltaic sandstones in central Utah as analogs for the North Foster (Grayburg) and Lake Creek (Wilcox) units, respectively. In both settings, sequence-stratigraphic style profoundly influenced between-well architectural fabric and permeability structure. It is concluded that reservoirs of different depositional origins can therefore be categorized Into a heterogeneity matrix'' based on varying intensity of vertical and lateral heterogeneity. The utility of the matrix is that it allows prediction of the nature and location of remaining mobile oil. Highly stratified reservoirs such as the Grayburg, for example, will contain a large proportion of vertically bypassed oil; thus, an appropriate recovery strategy will be waterflood optimization and profile modification. Laterally heterogeneous reservoirs such as deltaic distributary systems would benefit from targeted infill drilling (possibly with horizontal wells) and improved areal sweep efficiency. Potential for advanced recovery of remaining mobile oil through heterogeneity-based advanced secondary recovery strategies In Texas is projected to be an Incremental 16 Bbbl. In the Lower 48 States this target may be as much as 45 Bbbl at low to moderate oil prices over the near- to mid-term.

  14. Forecasting the failure of heterogeneous magmas

    NASA Astrophysics Data System (ADS)

    Vasseur, J.; Wadsworth, F. B.; Lavallée, Y.; Bell, A. F.; Main, I. G.; Dingwell, D. B.

    2015-12-01

    Eruption prediction is a long-sought-after goal of volcanology. Yet applying existing techniques retrospectively (hindcasting), we fail to predict events more often than we success. As much of the seismicity associated with intermediate to silicic volcanic eruptions comes from the brittle response of the ascending magma itself, we clearly require a good understanding of the parameters that control the ability to forecast magma failure itself. Here, we present suites of controlled experiments at magmatic temperatures using a range of synthetic magmas to investigate the control of microstructures on the efficacy of forecast models for material failure. We find that the failure of magmas with very little microstructural heterogeneity - such as melts - is very challenging to predict; whereas, the failure of very heterogeneous magmas is always well-predicted. To shed further light on this issue, we provide a scaling law based on the relationship between the microstructural heterogeneity in a magma and the error in the prediction of its failure time. We propose this method be used to elucidate the variable success rate of predicting volcanic predictions. We discuss this scaling in the context of the birth, life and death of structural heterogeneity during magma ascent with specific emphasis on obsidian-forming eruptions such as Chaitèn, 2008. During such eruptions, the repetitive creation and destruction of fractures filled with granular magma, which are thought to be the in situ remnants of seismogenic fracturing itself, are expressions of the life-cycle of heterogeneity in an otherwise coherent, melt-rich magma. We conclude that the next generation of failure forecast tools available to monitoring teams should incorporate some acknowledgment of the magma microstructure and not be solely based on the geophysical signals prior to eruption.

  15. Numerical Model Sensitivity to Heterogeneous Satellite Derived Vegetation Roughness

    NASA Technical Reports Server (NTRS)

    Jasinski, Michael; Eastman, Joseph; Borak, Jordan

    2011-01-01

    The sensitivity of a mesoscale weather prediction model to a 1 km satellite-based vegetation roughness initialization is investigated for a domain within the south central United States. Three different roughness databases are employed: i) a control or standard lookup table roughness that is a function only of land cover type, ii) a spatially heterogeneous roughness database, specific to the domain, that was previously derived using a physically based procedure and Moderate Resolution Imaging Spectroradiometer (MODIS) imagery, and iii) a MODIS climatologic roughness database that like (i) is a function only of land cover type, but possesses domain specific mean values from (ii). The model used is the Weather Research and Forecast Model (WRF) coupled to the Community Land Model within the Land Information System (LIS). For each simulation, a statistical comparison is made between modeled results and ground observations within a domain including Oklahoma, Eastern Arkansas, and Northwest Louisiana during a 4-day period within IHOP 2002. Sensitivity analysis compares the impact the three roughness initializations on time-series temperature, precipitation probability of detection (POD), average wind speed, boundary layer height, and turbulent kinetic energy (TKE). Overall, the results indicate that, for the current investigation, replacement of the standard look-up table values with the satellite-derived values statistically improves model performance for most observed variables. Such natural roughness heterogeneity enhances the surface wind speed, PBL height and TKE production up to 10 percent, with a lesser effect over grassland, and greater effect over mixed land cover domains.

  16. Safety analysis report for the Hanford Critical Mass Laboratory: Supplement No. 2. Experiments with heterogeneous assemblies

    SciTech Connect

    Gore, B.F.; Davenport, L.C.

    1981-04-01

    Factors affecting the safety of criticality experiments using heterogeneous assemblies are described and assessed. It is concluded that there is no substantial change in safety from experiments already being routinely performed at the Critical Mass Laboratory (CML), and that laboratory and personnel safety are adequately provided by the combination of engineered and administrative safety limits enforced at the CML. This conclusion is based on the analysis of operational controls, potential hazards, and the consequences of accidents. Contingencies considered that could affect nuclear criticality include manual changes in fuel loadings, water flooding, fire, explosion, loss of services, earthquake, windstorm, and flood. Other potential hazards considered include radiation exposure to personnel, and potential releases within the Assembly Room and outside to the environment. It is concluded that the Maximum Credible Nuclear Burst of 3 x 10/sup 18/ fissions (which served as the design basis for the CML) is valid for heterogeneous assemblies as well as homogeneous assemblies. This is based upon examination of the results of reactor destructive tests and the results of the SL-1 reactor destructive accident. The production of blast effects which might jeopardize the CML critical assembly room (of thick reinforced concrete) is not considered credible due to the extreme circumstances required to produce blast effects in reactor destructive tests. Consequently, it is concluded that, for experiments with heterogeneous assemblies, the consequences of the Maximum Credible Burst are unchanged from those previously estimated for experiments with homogeneous systems.

  17. Nuclear overlap functions

    SciTech Connect

    Eskola, K.J.; Vogt, R.; Wang, X.N.

    1995-07-01

    A three parameter Wood-Saxon shape is used to describe the nuclear density distribution, which R{sub A} is the nuclear radius, {approx} is the surface thickness, and {omega} allows for central irregularities. The electron scattering data is used where available for R{sub A}, z, and {omega}. When data is unavailable, the parameters {omega} = O, z = 0.54 fm and R{sub A} = 1.19 A{sup 1/3} - 1.61 A{sup -1/3} fm are used. The central density {rho}{sub 0} is found from the normalization {infinity} d{sup 3}r{rho}{sub A}(r) = A.

  18. Drug-target interaction prediction by random walk on the heterogeneous network.

    PubMed

    Chen, Xing; Liu, Ming-Xi; Yan, Gui-Ying

    2012-07-01

    Predicting potential drug-target interactions from heterogeneous biological data is critical not only for better understanding of the various interactions and biological processes, but also for the development of novel drugs and the improvement of human medicines. In this paper, the method of Network-based Random Walk with Restart on the Heterogeneous network (NRWRH) is developed to predict potential drug-target interactions on a large scale under the hypothesis that similar drugs often target similar target proteins and the framework of Random Walk. Compared with traditional supervised or semi-supervised methods, NRWRH makes full use of the tool of the network for data integration to predict drug-target associations. It integrates three different networks (protein-protein similarity network, drug-drug similarity network, and known drug-target interaction networks) into a heterogeneous network by known drug-target interactions and implements the random walk on this heterogeneous network. When applied to four classes of important drug-target interactions including enzymes, ion channels, GPCRs and nuclear receptors, NRWRH significantly improves previous methods in terms of cross-validation and potential drug-target interaction prediction. Excellent performance enables us to suggest a number of new potential drug-target interactions for drug development.

  19. NUCLEAR REACTOR

    DOEpatents

    Treshow, M.

    1958-08-19

    A neuclear reactor is described of the heterogeneous type and employing replaceable tubular fuel elements and heavy water as a coolant and moderator. A pluraltty of fuel tubesa having their axes parallel, extend through a tank type pressure vessel which contatns the liquid moderator. The fuel elements are disposed within the fuel tubes in the reaetive portion of the pressure vessel during normal operation and the fuel tubes have removable plug members at each end to permit charging and discharging of the fuel elements. The fuel elements are cylindrical strands of jacketed fissionable material having helical exterior ribs. A bundle of fuel elements are held within each fuel tube with their longitudinal axes parallel, the ribs serving to space them apart along their lengths. Coolant liquid is circulated through the fuel tubes between the spaced fuel elements. Suitable control rod and monitoring means are provided for controlling the reactor.

  20. Nuclear politics

    NASA Astrophysics Data System (ADS)

    Ranson, John

    2009-04-01

    The sentiments expressed by Sidney Drell in his forum article "The nuclear threat: a new start" (February pp16-17) are laudable, but it was disappointing to find this almost entirely political story in isolation. The article, which outlined the prospects for reducing weapons stockpiles under the new US administration, would have been more pertinent as an introduction to a series describing the technology used in detecting nuclear-testing activity. It would have been interesting to discuss the specific equipment and methods used, together with the analysis and correlation techniques - along with an indication of how sensitive and reliable they are (if the information is not classified). It is far easier to detect an explosive event than it is to detect and quantify weapons stores, which is a key factor for any negotiated solution. Apart from deductions based on actual inspection and satellite surveillance, are there other techniques that can be applied to this issue?

  1. NUCLEAR REACTORS

    DOEpatents

    Long, E.; Ashby, J.W.

    1958-09-16

    ABS>A graphite moderator structure is presented for a nuclear reactor compriscd of an assembly of similarly orientated prismatic graphite blocks arranged on spaced longitudinal axes lying in common planes wherein the planes of the walls of the blocks are positioned so as to be twisted reintive to the planes of said axes so thatthe unlmpeded dtrect paths in direction wholly across the walls of the blocks are limited to the width of the blocks plus spacing between the blocks.

  2. NUCLEAR REACTOR

    DOEpatents

    Anderson, C.R.

    1962-07-24

    A fluidized bed nuclear reactor and a method of operating such a reactor are described. In the design means are provided for flowing a liquid moderator upwardly through the center of a bed of pellets of a nentron-fissionable material at such a rate as to obtain particulate fluidization while constraining the lower pontion of the bed into a conical shape. A smooth circulation of particles rising in the center and falling at the outside of the bed is thereby established. (AEC)

  3. Nuclear Chirality

    SciTech Connect

    Starosta, Krzysztof

    2005-04-05

    Nuclear chirality is a novel manifestation of spontaneous symmetry breaking resulting from an orthogonal coupling of angular momentum vectors in triaxial nuclei. Three perpendicular angular momenta can form two systems of opposite handedness; the time reversal operator, which reverses orientation of each of the angular momentum components, relates these two systems. The status of current experimental searches for chiral doubling of states, as well as recent progress on the theoretical side is reviewed.

  4. Nuclear waste

    SciTech Connect

    Not Available

    1991-09-01

    Radioactive waste is mounting at U.S. nuclear power plants at a rate of more than 2,000 metric tons a year. Pursuant to statute and anticipating that a geologic repository would be available in 1998, the Department of Energy (DOE) entered into disposal contracts with nuclear utilities. Now, however, DOE does not expect the repository to be ready before 2010. For this reason, DOE does not want to develop a facility for monitored retrievable storage (MRS) by 1998. This book is concerned about how best to store the waste until a repository is available, congressional requesters asked GAO to review the alternatives of continued storage at utilities' reactor sites or transferring waste to an MRS facility, GAO assessed the likelihood of an MRSA facility operating by 1998, legal implications if DOE is not able to take delivery of wastes in 1998, propriety of using the Nuclear Waste Fund-from which DOE's waste program costs are paid-to pay utilities for on-site storage capacity added after 1998, ability of utilities to store their waste on-site until a repository is operating, and relative costs and safety of the two storage alternatives.

  5. Nuclear terrorism.

    PubMed

    Hogan, David E; Kellison, Ted

    2002-06-01

    Recent events have heightened awareness of the potential for terrorist attacks employing nonconventional weaponry such as biological agents and radiation. Historically, the philosophy of nuclear risk has focused on global or strategic nuclear exchanges and the resulting damage from large-scale releases. Currently, nuclear accidents or terrorist attacks involving low-level or regional release of radiation are considered the most likely events. Thus far, there have been several regional radiation incidents exposing hundreds of thousands of people to radiation, but there have been only a limited number of significant contaminations resulting in death. There are several different types of radioactive particles that differ in mass, extent of radiation emitted, and the degree to which tissue penetration occurs. Radiation affects its toxicity on biological systems by ionization, which creates tissue damage by the generation of free radicals, disruption of chemical bonds, and directly damaging cellular DNA and enzymes. The extent of damage depends on the type of radioisotope and the radiation dose. Radiation doses exceeding 2 to 10 Gy are considered lethal. Optimal management of radiation casualties requires knowledge of the type and dose of radiation received, a recognition of the manifestations of radiation sickness, and the use of standard medical care, decontamination, and decorporation techniques. PMID:12074488

  6. NUCLEAR REACTOR

    DOEpatents

    Grebe, J.J.

    1959-07-14

    High temperature reactors which are uniquely adapted to serve as the heat source for nuclear pcwered rockets are described. The reactor is comprised essentially of an outer tubular heat resistant casing which provides the main coolant passageway to and away from the reactor core within the casing and in which the working fluid is preferably hydrogen or helium gas which is permitted to vaporize from a liquid storage tank. The reactor core has a generally spherical shape formed entirely of an active material comprised of fissile material and a moderator material which serves as a diluent. The active material is fabricated as a gas permeable porous material and is interlaced in a random manner with very small inter-connecting bores or capillary tubes through which the coolant gas may flow. The entire reactor is divided into successive sections along the direction of the temperature gradient or coolant flow, each section utilizing materials of construction which are most advantageous from a nuclear standpoint and which at the same time can withstand the operating temperature of that particular zone. This design results in a nuclear reactor characterized simultaneously by a minimum critiral size and mass and by the ability to heat a working fluid to an extremely high temperature.

  7. Beyond relationships between homogeneous and heterogeneous catalysis

    SciTech Connect

    Dixon, David A.; Katz, Alexander; Arslan, Ilke; Gates, Bruce C.

    2014-08-13

    Scientists who regard catalysis as a coherent field have been striving for decades to articulate the fundamental unifying principles. But because these principles seem to be broader than chemistry, chemical engineering, and materials science combined, catalytic scientists commonly interact within the sub-domains of homogeneous, heterogeneous, and bio-catalysis, and increasingly within even narrower domains such as organocatalysis, phase-transfer catalysis, acid-base catalysis, zeolite catalysis, etc. Attempts to unify catalysis have motivated researchers to find relationships between homogeneous and heterogeneous catalysis and to mimic enzymes. These themes have inspired vibrant international meetings and workshops, and we have benefited from the idea exchanges and have some thoughts about a path forward.

  8. Heterogeneous Initiators for Sustainable Polymerization Processes

    NASA Astrophysics Data System (ADS)

    Jones, Matthew D.

    One of the main challenges facing the twenty-first century is the need to produce chemicals from renewable resources. The dwindling supplies of fossil fuels coupled with instability in supply mean that technologies that were once deemed too expensive are now becoming more economically viable options. The majority of man-made polymers are derived from crude oil based monomers. However, in recent years a tremendous effort has been channeled into the preparation of polymers from sustainable chemicals. Two classic examples are polylactide (derived from corn starch) and polycarbonates (prepared directly from CO2). This chapter serves as an introduction into these two polymers and reviews the literature associated with heterogeneous catalyst for the polymerizations, concentrating on approaches describing the heterogenization of homogeneous catalysts.

  9. Genetic Linkage Heterogeneity in Myotubular Myopathy

    PubMed Central

    Samson, F.; Mesnard, L.; Heimburger, M.; Hanauer, A.; Chevallay, M.; Mercadier, J. J.; Pelissier, J. F.; Feingold, N.; Junien, C.; Mandel, J.-L.; Fardeau, M.

    1995-01-01

    Myotubular myopathy is a severe congenital disease inherited as an X-linked trait (MTM1; McKusick 31040). It has been mapped to the long arm of chromosome X, to the Xq27-28 region. Significant linkage has subsequently been established for the linkage group comprised of DXS304, DXS15, DXS52, and F8C in several studies. To date, published linkage studies have provided no evidence of genetic heterogeneity in severe neonatal myotubular myopathy (XLMTM). We have investigated a family with typical XLMTM in which no linkage to these markers was found. Our findings strongly suggest genetic heterogeneity in myotubular myopathy and indicate that great care should be taken when using Xq28 markers in linkage studies for prenatal diagnosis and genetic counseling. ImagesFigure 1Figure 2Figure 3Figure 5 PMID:7611280

  10. Satellite Cell Heterogeneity in Skeletal Muscle Homeostasis.

    PubMed

    Tierney, Matthew T; Sacco, Alessandra

    2016-06-01

    The cellular turnover required for skeletal muscle maintenance and repair is mediated by resident stem cells, also termed satellite cells. Satellite cells normally reside in a quiescent state, intermittently entering the cell cycle to fuse with neighboring myofibers and replenish the stem cell pool. However, the mechanisms by which satellite cells maintain the precise balance between self-renewal and differentiation necessary for long-term homeostasis remain unclear. Recent work has supported a previously unappreciated heterogeneity in the satellite cell compartment that may underlie the observed variability in cell fate and function. In this review, we examine the work supporting this notion as well as the potential governing principles, developmental origins, and principal determinants of satellite cell heterogeneity.

  11. The lunar seismic tomography and internal heterogeneity

    NASA Astrophysics Data System (ADS)

    Zhao, N.; Zhu, P.; Yuan, Y.; Zhang, J.

    2012-12-01

    A seismic tomography is presented to show the internal lateral heterogeneities of moon. The lunar seismic tomography is made from the moonquake arrival-time data acquired by the Apollo program during 1971 to 1977. The seismic records obtained from the four seismic station of Apollo Lunar Surface Experiments Package on the moon. The research target covers the surround of Apollo-12, 14, 15 and 16 landing sites. A preliminary image of three-dimensional P- and S-wave velocity structures of lunar interior have been calculated using hundreds of arrival-times of moonquake events from surface to deep mantle. These results show that some evidences of lateral heterogeneities in the lunar mantle and crust, which implies the existence of complex structure inside the moon.

  12. Modeling vaccination in a heterogeneous metapopulation system

    NASA Astrophysics Data System (ADS)

    Lachiany, Menachem

    2016-09-01

    We present here a multicity SIS epidemic model with vaccination. The model describes the dynamics of heterogeneous metapopulations that contain imperfectly vaccinated individuals. The effect of vaccination on heterogeneous multicity models has not been previously studied. We show that under very generic conditions, the epidemic threshold does not depend on the diffusion coefficient of the vaccinated individuals, but it does depend on the diffusion coefficient of the infected population. We then show, using a novel methodology, that the reproduction number is determined by the homogeneous model parameters and by the maximal number of neighbors a city can have, when the diffusion coefficient of the infected population is low. Finally, we present numerical simulations to support the analytical results.

  13. Psoriatic arthritis: embracing pathogenetic and clinical heterogeneity?

    PubMed

    McInnes, Iain B

    2016-01-01

    Psoriatic arthritis (PsA) is a clinically heterogeneous condition of skin, joint, enthesis and bone that provides considerable unmet therapeutic need. Recent treatment advances have offered new opportunities to improve quality of life and long term well being for afflicted patients. It is timely therefore, to consider the underlying heterogeneity inherent in the disease from a pathologic aspect so as to best optimise the choice and order of therapeutic application over time. Herein I will discuss the various contributions made by immune pathways to discrete tissue compartments that in turn might allow a more targeted approach to the management of PsA in which different tissues express variable severity of involvement. PMID:27586796

  14. Sparse covariance estimation in heterogeneous samples*

    PubMed Central

    Rodríguez, Abel; Lenkoski, Alex; Dobra, Adrian

    2015-01-01

    Standard Gaussian graphical models implicitly assume that the conditional independence among variables is common to all observations in the sample. However, in practice, observations are usually collected from heterogeneous populations where such an assumption is not satisfied, leading in turn to nonlinear relationships among variables. To address such situations we explore mixtures of Gaussian graphical models; in particular, we consider both infinite mixtures and infinite hidden Markov models where the emission distributions correspond to Gaussian graphical models. Such models allow us to divide a heterogeneous population into homogenous groups, with each cluster having its own conditional independence structure. As an illustration, we study the trends in foreign exchange rate fluctuations in the pre-Euro era. PMID:26925189

  15. Heterogeneous concurrent computing with exportable services

    NASA Technical Reports Server (NTRS)

    Sunderam, Vaidy

    1995-01-01

    Heterogeneous concurrent computing, based on the traditional process-oriented model, is approaching its functionality and performance limits. An alternative paradigm, based on the concept of services, supporting data driven computation, and built on a lightweight process infrastructure, is proposed to enhance the functional capabilities and the operational efficiency of heterogeneous network-based concurrent computing. TPVM is an experimental prototype system supporting exportable services, thread-based computation, and remote memory operations that is built as an extension of and an enhancement to the PVM concurrent computing system. TPVM offers a significantly different computing paradigm for network-based computing, while maintaining a close resemblance to the conventional PVM model in the interest of compatibility and ease of transition Preliminary experiences have demonstrated that the TPVM framework presents a natural yet powerful concurrent programming interface, while being capable of delivering performance improvements of upto thirty percent.

  16. Fluorescence lifetime measurements in heterogeneous scattering medium

    NASA Astrophysics Data System (ADS)

    Nishimura, Goro; Awasthi, Kamlesh; Furukawa, Daisuke

    2016-07-01

    Fluorescence lifetime in heterogeneous multiple light scattering systems is analyzed by an algorithm without solving the diffusion or radiative transfer equations. The algorithm assumes that the optical properties of medium are constant in the excitation and emission wavelength regions. If the assumption is correct and the fluorophore is a single species, the fluorescence lifetime can be determined by a set of measurements of temporal point-spread function of the excitation light and fluorescence at two different concentrations of the fluorophore. This method is not dependent on the heterogeneity of the optical properties of the medium as well as the geometry of the excitation-detection on an arbitrary shape of the sample. The algorithm was validated by an indocyanine green fluorescence in phantom measurements and demonstrated by an in vivo measurement.

  17. Heterogeneous propellant internal ballistics: criticism and regeneration

    NASA Astrophysics Data System (ADS)

    Glick, R. L.

    2011-10-01

    Although heterogeneous propellant and its innately nondeterministic, chemically discrete morphology dominates applications, ballisticcharacterization deterministic time-mean burning rate and acoustic admittance measures' absence of explicit, nondeterministic information requires homogeneous propellant with a smooth, uniformly regressing burning surface: inadequate boundary conditions for heterogeneous propellant grained applications. The past age overcame this dichotomy with one-dimensional (1D) models and empirical knowledge from numerous, adequately supported motor developments and supplementary experiments. However, current cost and risk constraints inhibit this approach. Moreover, its fundamental science approach is more sensitive to incomplete boundary condition information (garbage-in still equals garbage-out) and more is expected. This work critiques this situation and sketches a path forward based on enhanced ballistic and motor characterizations in the workplace and approximate model and apparatus developments mentored by CSAR DNS capabilities (or equivalent).

  18. Slow crack propagation in heterogeneous materials.

    PubMed

    Kierfeld, J; Vinokur, V M

    2006-05-01

    Statistics and thermally activated dynamics of crack nucleation and propagation in a two-dimensional heterogeneous material containing quenched randomly distributed defects are studied theoretically. Using the generalized Griffith criterion we derive the equation of motion for the crack tip position accounting for dissipation, thermal noise, and the random forces arising from the defects. We find that aggregations of defects generating long-range interaction forces (e.g., clouds of dislocations) lead to anomalously slow creep of the crack tip or even to its complete arrest. We demonstrate that heterogeneous materials with frozen defects contain a large number of arrested microcracks and that their fracture toughness is enhanced to the experimentally accessible time scales.

  19. Trophic mismatch requires seasonal heterogeneity of warming.

    PubMed

    Straile, Dietmar; Kerimoglu, Onur; Peeters, Frank

    2015-10-01

    Climate warming has been shown to advance the phenology of species. Asynchronous changes in phenology between interacting species may disrupt feeding interactions (phenological mismatch), which could have tremendous consequences for ecosystem functioning. Long-term field observations have suggested asynchronous shifts in phenology with warming, whereas experimental studies have not been conclusive. Using proxy-based modeling of three trophic levels (algae, herbivores, and fish), we .show that asynchronous changes in phenology only occur if warming is seasonally heterogeneous, but not if warming is constant throughout the year. If warming is seasonally heterogeneous, the degree and even direction of asynchrony depends on the specific seasonality of the warming. Conclusions about phenological mismatches in food web interactions may therefore produce controversial results if the analyses do not distinguish between seasonally constant and seasonal specific warming. Furthermore, our results suggest that predicting asynchrony between interacting species requires reliable warming predictions that resolve sub-seasonal time scales. PMID:26649399

  20. Modeling heterogeneous polymer-grafted nanoparticle networks

    NASA Astrophysics Data System (ADS)

    Zhang, Tao; Mbanga, Badel; Yashin, Victor; Balazs, Anna

    Via a dynamic 3D computational approach, we simulate the heterogeneous polymer-grafted nanoparticle networks. The nanoparticles rigid cores are decorated with a corona of grafted polymers, which contain reactive functional groups at the chain ends. With the overlap of grafted polymers, these reactive groups can form weak labile bonds, which can reform after breakage, or stronger bonds, which rupture irreversibly and thus, the nanoparticles are interconnected by dual cross-links. Previous work has been done on homogeneous networks, while we introduce the heterogeneity by considering two types of particles having different reactive functional groups, so that the labile bond energy varies depending on types of the two end reactive groups. We study the effect of tensile and rotational deformations on the network morphology, and observe, in particular, the phase separation of two types of particles. Our results will provide guidelines for designing transformable material that can controllably change structure under mechanical action.

  1. Microgrids and Heterogeneous Power Quality and Reliability

    SciTech Connect

    LaCommare, Kristina; Marnay, Chris

    2007-10-01

    This paper describes two stylized alternative visions of how the power system might evolve to meet future requirements for the high quality electricity service that modern digital economies demand, a supergrids paradigm and a dispersed paradigm. Some of the economics of the dispersed vision are explored, and perspectives are presented on both the choice of homogeneous universal power quality upstream in the electricity supply chain and on the extremely heterogeneous requirements of end-use loads. It is argued that meeting the demanding requirements of sensitive loads by local provision of high quality power may be more cost effective than increasing the quality of universal homogeneous supply upstream in the legacy grid. Finally, the potential role of microgrids in delivering heterogeneous power quality is demonstrated by reference to two ongoing microgrid tests in the U.S. and Japan.

  2. Heterogeneous and homogeneous robot group behavior

    SciTech Connect

    Goldberg, D.

    1996-12-31

    When working with groups of robots it may be very difficult to determine what characteristics the group requires in order to perform a task most efficiently-i.e., in the least time. Some researchers have used groups of behaviorally differentiated robots-where the robots do not perform the same actions-and others have used behaviorally homogeneous groups. None of this research, however, explicitly compares the behavior of heterogeneous and homogeneous groups of robots to determine which performs a task more efficiently. The research described here makes such a comparison and aims at developing guidelines to aid in the design of the heterogeneous/homogeneous characteristics that will allow a group of robots to perform a task efficiently.

  3. Population dynamics on heterogeneous bacterial substrates

    NASA Astrophysics Data System (ADS)

    Mobius, Wolfram; Murray, Andrew W.; Nelson, David R.

    2012-02-01

    How species invade new territories and how these range expansions influence the population's genotypes are important questions in the field of population genetics. The majority of work addressing these questions focuses on homogeneous environments. Much less is known about the population dynamics and population genetics when the environmental conditions are heterogeneous in space. To better understand range expansions in two-dimensional heterogeneous environments, we employ a system of bacteria and bacteriophage, the viruses of bacteria. Thereby, the bacteria constitute the environment in which a population of bacteriophages expands. The spread of phage constitutes itself in lysis of bacteria and thus formation of clear regions on bacterial lawns, called plaques. We study the population dynamics and genetics of the expanding page for various patterns of environments.

  4. Heterogeneous physicochemistry of the polar ozone hole

    NASA Technical Reports Server (NTRS)

    Turco, Richard P.; Toon, Owen B.; Hamill, Patrick

    1989-01-01

    Processes occurring in the polar winter stratosphere, which involve polar stratospheric clouds (PSCs), are investigated using observations from the Airborne Antarctic Ozone Experiment. In particular, data on the properties of PSCs and their physical chemistry, the microphysical processes and time constants for cloud processes, the heterogeneous chemical processes and their time constants, and nonlinearities in the long-term ozone trend associated with physical and chemical processes are examined. The chemical reactions leading to the depletion of the inert chlorine reservoir in a presence of type I PSCs are established, and it is shown that type II PSCs contribute to chemical processing that sustains the chemical imbalance of the polar stratosphere. It is shown that, using a simple model, the decadal evolution of the Antarctic ozone hole may be understood through nonlinearities in the heterogeneous chemistry, with possible contributing effects of variations in stratospheric temperatures and water vapor concentrations.

  5. Integrating CLIPS applications into heterogeneous distributed systems

    NASA Technical Reports Server (NTRS)

    Adler, Richard M.

    1991-01-01

    SOCIAL is an advanced, object-oriented development tool for integrating intelligent and conventional applications across heterogeneous hardware and software platforms. SOCIAL defines a family of 'wrapper' objects called agents, which incorporate predefined capabilities for distributed communication and control. Developers embed applications within agents and establish interactions between distributed agents via non-intrusive message-based interfaces. This paper describes a predefined SOCIAL agent that is specialized for integrating C Language Integrated Production System (CLIPS)-based applications. The agent's high-level Application Programming Interface supports bidirectional flow of data, knowledge, and commands to other agents, enabling CLIPS applications to initiate interactions autonomously, and respond to requests and results from heterogeneous remote systems. The design and operation of CLIPS agents are illustrated with two distributed applications that integrate CLIPS-based expert systems with other intelligent systems for isolating and mapping problems in the Space Shuttle Launch Processing System at the NASA Kennedy Space Center.

  6. Multiparametric imaging with heterogeneous radiofrequency fields

    PubMed Central

    Cloos, Martijn A.; Knoll, Florian; Zhao, Tiejun; Block, Kai T.; Bruno, Mary; Wiggins, Graham C.; Sodickson, Daniel K.

    2016-01-01

    Magnetic resonance imaging (MRI) has become an unrivalled medical diagnostic technique able to map tissue anatomy and physiology non-invasively. MRI measurements are meticulously engineered to control experimental conditions across the sample. However, residual radiofrequency (RF) field inhomogeneities are often unavoidable, leading to artefacts that degrade the diagnostic and scientific value of the images. Here we show that, paradoxically, these artefacts can be eliminated by deliberately interweaving freely varying heterogeneous RF fields into a magnetic resonance fingerprinting data-acquisition process. Observations made based on simulations are experimentally confirmed at 7 Tesla (T), and the clinical implications of this new paradigm are illustrated with in vivo measurements near an orthopaedic implant at 3T. These results show that it is possible to perform quantitative multiparametric imaging with heterogeneous RF fields, and to liberate MRI from the traditional struggle for control over the RF field uniformity. PMID:27526996

  7. Dedicated heterogeneous node scheduling including backfill scheduling

    DOEpatents

    Wood, Robert R.; Eckert, Philip D.; Hommes, Gregg

    2006-07-25

    A method and system for job backfill scheduling dedicated heterogeneous nodes in a multi-node computing environment. Heterogeneous nodes are grouped into homogeneous node sub-pools. For each sub-pool, a free node schedule (FNS) is created so that the number of to chart the free nodes over time. For each prioritized job, using the FNS of sub-pools having nodes useable by a particular job, to determine the earliest time range (ETR) capable of running the job. Once determined for a particular job, scheduling the job to run in that ETR. If the ETR determined for a lower priority job (LPJ) has a start time earlier than a higher priority job (HPJ), then the LPJ is scheduled in that ETR if it would not disturb the anticipated start times of any HPJ previously scheduled for a future time. Thus, efficient utilization and throughput of such computing environments may be increased by utilizing resources otherwise remaining idle.

  8. Multiparametric imaging with heterogeneous radiofrequency fields.

    PubMed

    Cloos, Martijn A; Knoll, Florian; Zhao, Tiejun; Block, Kai T; Bruno, Mary; Wiggins, Graham C; Sodickson, Daniel K

    2016-01-01

    Magnetic resonance imaging (MRI) has become an unrivalled medical diagnostic technique able to map tissue anatomy and physiology non-invasively. MRI measurements are meticulously engineered to control experimental conditions across the sample. However, residual radiofrequency (RF) field inhomogeneities are often unavoidable, leading to artefacts that degrade the diagnostic and scientific value of the images. Here we show that, paradoxically, these artefacts can be eliminated by deliberately interweaving freely varying heterogeneous RF fields into a magnetic resonance fingerprinting data-acquisition process. Observations made based on simulations are experimentally confirmed at 7 Tesla (T), and the clinical implications of this new paradigm are illustrated with in vivo measurements near an orthopaedic implant at 3T. These results show that it is possible to perform quantitative multiparametric imaging with heterogeneous RF fields, and to liberate MRI from the traditional struggle for control over the RF field uniformity. PMID:27526996

  9. Blind and myopic ants in heterogeneous networks

    NASA Astrophysics Data System (ADS)

    Hwang, S.; Lee, D.-S.; Kahng, B.

    2014-11-01

    The diffusion processes on complex networks may be described by different Laplacian matrices due to heterogeneous connectivity. Here we investigate the random walks of blind ants and myopic ants on heterogeneous networks: While a myopic ant hops to a neighbor node every step, a blind ant may stay or hop with probabilities that depend on node connectivity. By analyzing the trajectories of blind ants, we show that the asymptotic behaviors of both random walks are related by rescaling time and probability with node connectivity. Using this result, we show how the small eigenvalues of the Laplacian matrices generating the two random walks are related. As an application, we show how the return-to-origin probability of a myopic ant can be used to compute the scaling behaviors of the Edwards-Wilkinson model, a representative model of load balancing on networks.

  10. Scroll waves pinned to moving heterogeneities

    NASA Astrophysics Data System (ADS)

    Ke, Hua; Zhang, Zhihui; Steinbock, Oliver

    2015-03-01

    Three-dimensional excitable systems can self-organize vortex patterns that rotate around one-dimensional phase singularities called filaments. In experiments with the Belousov-Zhabotinsky reaction and numerical simulations, we pin these scroll waves to translating inert cylinders and demonstrate the controlled repositioning of their rotation centers. If the pinning site extends only along a portion of the filament, the phase singularity is stretched out along the trajectory of the heterogeneity, which effectively writes the singularity into the system. Its trailing end point follows the heterogeneity with a lower velocity. This velocity, its dependence on the placement of the anchor, and the shape of the filament are explained by a curvature flow model.

  11. Heterogeneously-Catalyzed Conversion of Carbohydrates

    NASA Astrophysics Data System (ADS)

    Vigier, Karine De Oliveira; Jérôme, François

    Polyfunctionality of carbohydrates and their low solubility in conventional organic solvents make rather complex their conversion to higher value added chemicals. Therefore, innovative processes are now strongly needed in order to increase the selectivity of these reactions. Here, we report an overview of the different heterogeneously-catalyzed processes described in the literature. In particular, hydrolysis, dehydration, oxidation, esterification, and etherification of carbohydrates are presented. We shall discuss the main structural parameters that need to be controlled and that permit the conversion of carbohydrates to bioproducts with good selectivity. The conversion of monosaccharides and disaccharides over solid catalysts, as well as recent advances in the heterogeneously-catalyzed conversion of cellulose, will be presented.

  12. Multiparametric imaging with heterogeneous radiofrequency fields

    NASA Astrophysics Data System (ADS)

    Cloos, Martijn A.; Knoll, Florian; Zhao, Tiejun; Block, Kai T.; Bruno, Mary; Wiggins, Graham C.; Sodickson, Daniel K.

    2016-08-01

    Magnetic resonance imaging (MRI) has become an unrivalled medical diagnostic technique able to map tissue anatomy and physiology non-invasively. MRI measurements are meticulously engineered to control experimental conditions across the sample. However, residual radiofrequency (RF) field inhomogeneities are often unavoidable, leading to artefacts that degrade the diagnostic and scientific value of the images. Here we show that, paradoxically, these artefacts can be eliminated by deliberately interweaving freely varying heterogeneous RF fields into a magnetic resonance fingerprinting data-acquisition process. Observations made based on simulations are experimentally confirmed at 7 Tesla (T), and the clinical implications of this new paradigm are illustrated with in vivo measurements near an orthopaedic implant at 3T. These results show that it is possible to perform quantitative multiparametric imaging with heterogeneous RF fields, and to liberate MRI from the traditional struggle for control over the RF field uniformity.

  13. Micromechanical modeling of heterogeneous energetic materials

    SciTech Connect

    Baer, M.R.; Kipp, M.E.; Swol, F. van

    1998-09-01

    In this work, the mesoscale processes of consolidation, deformation and reaction of shocked porous energetic materials are studied using shock physics analysis of impact on a collection of discrete HMX crystals. High resolution three-dimensional CTH simulations indicate that rapid deformation occurs at material contact points causing large amplitude fluctuations of stress states having wavelengths of the order of several particle diameters. Localization of energy produces hot-spots due to shock focusing and plastic work near grain boundaries as material flows to interstitial regions. These numerical experiments demonstrate that hot-spots are strongly influenced by multiple crystal interactions. Chemical reaction processes also produce multiple wave structures associated with particle distribution effects. This study provides new insights into the micromechanical behavior of heterogeneous energetic materials strongly suggesting that initiation and reaction of shocked heterogeneous materials involves states distinctly different than single jump state descriptions.

  14. MICROSITE AND HERBACEOUS VEGETATION HETEROGENEITY AFTER BURNING ARTEMISIA TRIDENTATA STEPPE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Woody vegetation can create distinct subcanopy and interspace microsites, which often results in resource islands in subcanopies compared to interspaces. This heterogeneity in soil resources contributes to herbaceous vegetation heterogeneity in plant communities. However, information detailing the...

  15. Constructing Scientific Applications from Heterogeneous Resources

    NASA Technical Reports Server (NTRS)

    Schichting, Richard D.

    1995-01-01

    A new model for high-performance scientific applications in which such applications are implemented as heterogeneous distributed programs or, equivalently, meta-computations, is investigated. The specific focus of this grant was a collaborative effort with researchers at NASA and the University of Toledo to test and improve Schooner, a software interconnection system, and to explore the benefits of increased user interaction with existing scientific applications.

  16. Cellular heterogeneity and live cell arrays.

    PubMed

    Walling, Maureen A; Shepard, Jason R E

    2011-07-01

    In the past decade, the tendency to move from a global, one-size-fits-all treatment philosophy to personalized medicine is based, in part, on the nuanced differences and sub-classifications of disease states. Our knowledge of these varied states stems from not only the ability to diagnose, classify, and perform experiments on cell populations as a whole, but also from new technologies that allow interrogation of cell populations at the individual cell level. Such departures from conventional thinking are driven by the recognition that clonal cell populations have numerous activities that manifest as significant levels of non-genetic heterogeneity. Clonal populations by definition originate from a single genetic origin so are regarded as having a high level of homogeneity as compared to genetically distinct cell populations. However, analysis at the single cell level has revealed a different phenomenon; cells and organisms require an inherent level of non-genetic heterogeneity to function properly, and in some cases, to survive. The growing understanding of this occurrence has lead to the development of methods to monitor, analyze, and better characterize the heterogeneity in cell populations. Following the trend of DNA- and protein microarrays, platforms capable of simultaneously monitoring each cell in a population have been developed. These cellular microarray platforms and other related formats allow for continuous monitoring of single live cells and simultaneously generate individual cell and average population data that are more descriptive and information-rich than traditional bulk methods. These technological advances have helped develop a better understanding of the intricacies associated with biological processes and afforded greater insight into complex biological systems. The associated instruments, techniques, and reagents now allow for highly multiplexed analyses, which enable multiple cellular activities, processes, or pathways to be monitored

  17. Evidence for surface heterogeneity on Titan

    NASA Astrophysics Data System (ADS)

    Griffith, C. A.

    1993-08-01

    Observational results are presented for two rotational periods of Titan which exhibit the albedo difference noted by Lemmon et al. (1993) between this moon's positions at eastern and western elongation relative to Saturn. The persistence of this difference indicates that this heterogeneity is unlikely to be associated with transient features, and must be intrinsic to the surface. The results presented also indicate that Titan is locked in a synchronous orbit around Saturn.

  18. Phenotype heterogeneity in cancer cell populations

    NASA Astrophysics Data System (ADS)

    Almeida, Luis; Chisholm, Rebecca; Clairambault, Jean; Escargueil, Alexandre; Lorenzi, Tommaso; Lorz, Alexander; Trélat, Emmanuel

    2016-06-01

    Phenotype heterogeneity in cancer cell populations, be it of genetic, epigenetic or stochastic origin, has been identified as a main source of resistance to drug treatments and a major source of therapeutic failures in cancers. The molecular mechanisms of drug resistance are partly understood at the single cell level (e.g., overexpression of ABC transporters or of detoxication enzymes), but poorly predictable in tumours, where they are hypothesised to rely on heterogeneity at the cell population scale, which is thus the right level to describe cancer growth and optimise its control by therapeutic strategies in the clinic. We review a few results from the biological literature on the subject, and from mathematical models that have been published to predict and control evolution towards drug resistance in cancer cell populations. We propose, based on the latter, optimisation strategies of combined treatments to limit emergence of drug resistance to cytotoxic drugs in cancer cell populations, in the monoclonal situation, which limited as it is still retains consistent features of cell population heterogeneity. The polyclonal situation, that may be understood as "bet hedging" of the tumour, thus protecting itself from different sources of drug insults, may lie beyond such strategies and will need further developments. In the monoclonal situation, we have designed an optimised therapeutic strategy relying on a scheduled combination of cytotoxic and cytostatic treatments that can be adapted to different situations of cancer treatments. Finally, we review arguments for biological theoretical frameworks proposed at different time and development scales, the so-called atavistic model (diachronic view relying on Darwinian genotype selection in the coursof billions of years) and the Waddington-like epigenetic landscape endowed with evolutionary quasi-potential (synchronic view relying on Lamarckian phenotype instruction of a given genome by reversible mechanisms), to

  19. Heterogeneous processes: Laboratory, field, and modeling studies

    NASA Technical Reports Server (NTRS)

    Poole, Lamont R.; Kurylo, Michael J.; Jones, Rod L.; Wahner, Andreas; Calvert, Jack G.; Leu, M.-T.; Fried, A.; Molina, Mario J.; Hampson, Robert F.; Pitts, M. C.

    1991-01-01

    The efficiencies of chemical families such as ClO(x) and NO(x) for altering the total abundance and distribution of stratospheric ozone are controlled by a partitioning between reactive (active) and nonreactive (reservoir) compounds within each family. Gas phase thermodynamics, photochemistry, and kinetics would dictate, for example, that only about 1 percent of the chlorine resident in the lower stratosphere would be in the form of active Cl or ClO, the remainder existing in the reservoir compounds HCl and ClONO2. The consistency of this picture was recently challenged by the recognition that important chemical transformations take place on polar regions: the Airborne Antarctic Ozone Experiment (AAOE) and the Airborne Arctic Stratospheric Expedition (AASA). Following the discovery of the Antarctic ozone hole, Solomon et al. suggested that the heterogeneous chemical reaction: ClONO2(g)+HCl(s) yields Cl2(g)+HNO3(s) could play a key role in converting chlorine from inactive forms into a species (Cl2) that would rapidly dissociate in sunlight to liberate atomic chlorine and initiate ozone depletion. The symbols (s) and (g) denote solid phase, or adsorbed onto a solid surface, and gas phase, respectively, and represent the approach by which such a reaction is modeled rather than the microscopic details of the reaction. The reaction was expected to be most important at altitudes where PSC's were most prevalent (10 to 25 km), thereby extending the altitude range over which chlorine compounds can efficiently destroy ozone from the 35 to 45 km region (where concentrations of active chlorine are usually highest) to lower altitudes where the ozone concentration is at its peak. This chapter will briefly review the current state of knowledge of heterogeneous processes in the stratosphere, emphasizing those results obtained since the World Meteorological Organization (WMO) conference. Sections are included on laboratory investigations of heterogeneous reactions, the

  20. Multidimensional integration in a heterogeneous network environment

    NASA Astrophysics Data System (ADS)

    Veseli, Siniša

    1998-01-01

    We consider several issues related to the multidimensional integration using a network of heterogeneous computers. Based on these considerations, we develop a new general purpose scheme which can significantly reduce the time needed for evaluation of integrals with CPU intensive integrands. This scheme is a parallel version of the well-known adaptive Monte Carlo method (the VEGAS algorithm), and is incorporated into a new integration package which uses the standard set of message-passing routines in the PVM software system.

  1. Heterogeneous photocatalytic oxidation of atmospheric trace contaminants

    NASA Technical Reports Server (NTRS)

    Ollis, David F.; Peral, Jose

    1992-01-01

    A two year study to examine the feasibility of using heterogeneous photocatalysis for spacecraft air purification was begun at North Carolina State University on November 1, 1990. The original grant proposal included examination of the rates of destruction of anticipated spacecraft-generated air contaminants, including alcohols, aldehydes, chlorinated compounds, as well as trace levels of volatile compounds containing nitrogen, sulfur, and silicon. The progress made in the second six month period of 5/1/91-11/1/91 is discussed.

  2. Bromine heterogenous chemistry in the troposhere

    SciTech Connect

    Abbatt, J.P.D.

    1996-10-01

    Motivated by the observations of boundary layer ozone loss which is correlated with high levels of bromine in the Arctic springtime, we have studied a number of heterogeneous interactions of tropospheric bromine species. The goal of this work is both to better define the source of inorganic bromine during this time of year and to determine the primary mechanism which keeps bromine in a photochemically active form.

  3. Evolution of altruistic punishment in heterogeneous populations.

    PubMed

    de Weerd, Harmen; Verbrugge, Rineke

    2011-12-01

    Evolutionary models for altruistic behavior typically make the assumption of homogeneity: each individual has the same costs and benefits associated with cooperating with each other and punishing for selfish behavior. In this paper, we relax this assumption by separating the population into heterogeneous classes, such that individuals from different classes differ in their ability to punish for selfishness. We compare the effects of introducing heterogeneity this way across two population models, that each represents a different type of population: the infinite and well-mixed population describes the way workers of social insects such as ants are organized, while a spatially structured population is more related to the way social norms evolve and are maintained in a social network. We find that heterogeneity in the effectiveness of punishment by itself has little to no effect on whether or not altruistic behavior will stabilize in a population. In contrast, heterogeneity in the cost that individuals pay to punish for selfish behavior allows altruistic behavior to be maintained more easily. Fewer punishers are needed to deter selfish behavior, and the individuals that punish will mostly belong to the class that pays a lower cost to do so. This effect is amplified when individuals that pay a lower cost for punishing inflict a higher punishment. The two population models differ when individuals that pay a low cost for punishing also inflict a lower punishment. In this situation, altruistic behavior becomes harder to maintain in an infinite and well-mixed population. However, this effect does not occur when the population is spatially structured.

  4. Method of assessing heterogeneity in images

    DOEpatents

    Jacob, Richard E.; Carson, James P.

    2016-08-23

    A method of assessing heterogeneity in images is disclosed. 3D images of an object are acquired. The acquired images may be filtered and masked. Iterative decomposition is performed on the masked images to obtain image subdivisions that are relatively homogeneous. Comparative analysis, such as variogram analysis or correlogram analysis, is performed of the decomposed images to determine spatial relationships between regions of the images that are relatively homogeneous.

  5. Nuclear photonics

    SciTech Connect

    Habs, D.; Guenther, M. M.; Jentschel, M.; Thirolf, P. G.

    2012-07-09

    With the planned new {gamma}-beam facilities like MEGa-ray at LLNL (USA) or ELI-NP at Bucharest (Romania) with 10{sup 13}{gamma}/s and a band width of {Delta}E{gamma}/E{gamma} Almost-Equal-To 10{sup -3}, a new era of {gamma} beams with energies up to 20MeV comes into operation, compared to the present world-leading HI{gamma}S facility at Duke University (USA) with 10{sup 8}{gamma}/s and {Delta}E{gamma}/E{gamma} Almost-Equal-To 3 Dot-Operator 10{sup -2}. In the long run even a seeded quantum FEL for {gamma} beams may become possible, with much higher brilliance and spectral flux. At the same time new exciting possibilities open up for focused {gamma} beams. Here we describe a new experiment at the {gamma} beam of the ILL reactor (Grenoble, France), where we observed for the first time that the index of refraction for {gamma} beams is determined by virtual pair creation. Using a combination of refractive and reflective optics, efficient monochromators for {gamma} beams are being developed. Thus, we have to optimize the total system: the {gamma}-beam facility, the {gamma}-beam optics and {gamma} detectors. We can trade {gamma} intensity for band width, going down to {Delta}E{gamma}/E{gamma} Almost-Equal-To 10{sup -6} and address individual nuclear levels. The term 'nuclear photonics' stresses the importance of nuclear applications. We can address with {gamma}-beams individual nuclear isotopes and not just elements like with X-ray beams. Compared to X rays, {gamma} beams can penetrate much deeper into big samples like radioactive waste barrels, motors or batteries. We can perform tomography and microscopy studies by focusing down to {mu}m resolution using Nuclear Resonance Fluorescence (NRF) for detection with eV resolution and high spatial resolution at the same time. We discuss the dominating M1 and E1 excitations like the scissors mode, two-phonon quadrupole octupole excitations, pygmy dipole excitations or giant dipole excitations under the new facet of

  6. Nuclear photonics

    NASA Astrophysics Data System (ADS)

    Habs, D.; Günther, M. M.; Jentschel, M.; Thirolf, P. G.

    2012-07-01

    With the planned new γ-beam facilities like MEGa-ray at LLNL (USA) or ELI-NP at Bucharest (Romania) with 1013 γ/s and a band width of ΔEγ/Eγ≈10-3, a new era of γ beams with energies up to 20MeV comes into operation, compared to the present world-leading HIγS facility at Duke University (USA) with 108 γ/s and ΔEγ/Eγ≈3ṡ10-2. In the long run even a seeded quantum FEL for γ beams may become possible, with much higher brilliance and spectral flux. At the same time new exciting possibilities open up for focused γ beams. Here we describe a new experiment at the γ beam of the ILL reactor (Grenoble, France), where we observed for the first time that the index of refraction for γ beams is determined by virtual pair creation. Using a combination of refractive and reflective optics, efficient monochromators for γ beams are being developed. Thus, we have to optimize the total system: the γ-beam facility, the γ-beam optics and γ detectors. We can trade γ intensity for band width, going down to ΔEγ/Eγ≈10-6 and address individual nuclear levels. The term "nuclear photonics" stresses the importance of nuclear applications. We can address with γ-beams individual nuclear isotopes and not just elements like with X-ray beams. Compared to X rays, γ beams can penetrate much deeper into big samples like radioactive waste barrels, motors or batteries. We can perform tomography and microscopy studies by focusing down to μm resolution using Nuclear Resonance Fluorescence (NRF) for detection with eV resolution and high spatial resolution at the same time. We discuss the dominating M1 and E1 excitations like the scissors mode, two-phonon quadrupole octupole excitations, pygmy dipole excitations or giant dipole excitations under the new facet of applications. We find many new applications in biomedicine, green energy, radioactive waste management or homeland security. Also more brilliant secondary beams of neutrons and positrons can be produced.

  7. Stochastic modeling of spatial heterogeneities conditioned to hydraulic and tracer tests

    SciTech Connect

    Datta Gupta, A.; Vasco, D.W.; Long, J.C.S.; Vomvoris, S.

    1994-07-01

    Uncertainty concerning the physical and chemical nature of subsurface heterogeneities constitutes a severe technical barrier to assessing long term performance of nuclear waste repositories. This paper discusses an approach to generation of stochastic permeability fields through simultaneous inversion of flow and transport data. For tracer transport calculations, we have used a semianalytic transit time algorithm which is fast, accurate and free from numerical dispersion. The inversion of data has been accomplished through the use of simulated annealing. We have addressed the non-uniqueness associated with our results by shifting the focus from the search for a single model that fits the data best to inferences about the properties that are shared by an ensemble of acceptable models. We then determine a most likely model for heterogeneity. The approach has been illustrated through application to tracer migration in a synthetic fracture plane.

  8. Improvement of Nuclear Heating Evaluation Inside the Core of the OSIRIS Material Testing Reactor

    NASA Astrophysics Data System (ADS)

    Péron, Arthur; Malouch, Fadhel; Diop, Cheikh M.

    2016-02-01

    In this paper we present a nuclear heating from neutron and photon rays calculation scheme mainly based on the Monte-Carlo neutral particle transport code TRIPOLI-4® which takes into account the axial distributions of fuel element compositions. This calculation scheme is applied to the OSIRIS reactor in order to evaluate the effect of using realistic axially heterogeneous compositions instead of uniform ones. After a description of nuclear heating evaluation, the calculation scheme is described. Numerical simulations and related results are detailed and analysed to determine the impact of axially heterogeneous compositions on fluxes, power and nuclear heating.

  9. Anisotropy and Heterogeneity Interaction in Shear Zones

    NASA Astrophysics Data System (ADS)

    Dabrowski, M.; Schmid, D. W.

    2009-04-01

    Rocks are heterogeneous on many different scales and deformation may introduce a coexistence of heterogeneity and anisotropy in shear zones. A competent inclusion embedded in a laminated matrix is a typical example. Indisputably, the presence of a mechanical heterogeneity leads to a flow perturbation and consequently to a deflection of the lamination in its vicinity. Assuming a passive response of the matrix phase, the pattern formation around rigid objects has been modeled in two and three dimensions using analytical solutions. Yet, the laminas may be mechanically distinct, leading to an effectively anisotropic rheology of the matrix. The feedback of an evolving matrix structure on the inclusion motion cannot be precluded in this case. In our study elliptical inclusions of varying aspect ratios are embedded in a laminated linear viscous host and subject to a large simple shear deformation in finite element numerical simulations. Increasing the viscosity ratio of the weak and strong lamina significantly changes the pattern characteristics in the matrix. The structural evolution around an inclusion proves to have a major impact on the inclusion motion, leading to the stabilization of elongated inclusions at antithetic orientations. We provide a comparison of two different modeling approaches. In the first approach discrete layers are introduced in the matrix and the large strain evolution of individual minute layers is resolved. Next, the matrix is modeled as an anisotropic medium using an evolving director field that locally describes the anisotropy direction. The length scale of layering can be restored in this model using the micropolar medium formulation.

  10. Genetic Heterogeneity in Algerian Human Populations

    PubMed Central

    Deba, Tahria; Calafell, Francesc; Benhamamouch, Soraya; Comas, David

    2015-01-01

    The demographic history of human populations in North Africa has been characterized by complex processes of admixture and isolation that have modeled its current gene pool. Diverse genetic ancestral components with different origins (autochthonous, European, Middle Eastern, and sub-Saharan) and genetic heterogeneity in the region have been described. In this complex genetic landscape, Algeria, the largest country in Africa, has been poorly covered, with most of the studies using a single Algerian sample. In order to evaluate the genetic heterogeneity of Algeria, Y-chromosome, mtDNA and autosomal genome-wide makers have been analyzed in several Berber- and Arab-speaking groups. Our results show that the genetic heterogeneity found in Algeria is not correlated with geography or linguistics, challenging the idea of Berber groups being genetically isolated and Arab groups open to gene flow. In addition, we have found that external sources of gene flow into North Africa have been carried more often by females than males, while the North African autochthonous component is more frequent in paternally transmitted genome regions. Our results highlight the different demographic history revealed by different markers and urge to be cautious when deriving general conclusions from partial genomic information or from single samples as representatives of the total population of a region. PMID:26402429

  11. Altering Emulsion Stability with Heterogeneous Surface Wettability

    PubMed Central

    Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob G. H.; Chen, Haosheng; Tsai, Peichun Amy

    2016-01-01

    Emulsions–liquid droplets dispersed in another immiscible liquid–are widely used in a broad spectrum of applications, including food, personal care, agrochemical, and pharmaceutical products. Emulsions are also commonly present in natural crude oil, hampering the production and quality of petroleum fuels. The stability of emulsions plays a crucial role in their applications, but controlling the stability without external driving forces has been proven to be difficult. Here we show how heterogeneous surface wettability can alter the stability and dynamics of oil-in-water emulsions, generated by a co-flow microfluidic device. We designed a useful methodology that can modify a micro-capillary of desired heterogeneous wettability (e.g., alternating hydrophilic and hydrophobic regions) without changing the hydraulic diameter. We subsequently investigated the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion. The experimental data revealed a universal critical timescale of advective emulsions, above which the microfluidic emulsions remain stable and intact, whereas below they become adhesive or inverse. A simple theoretical model based on a force balance can be used to explain this critical transition of emulsion dynamics, depending on the droplet size and the Capillary number–the ratio of viscous to surface effects. These results give insight into how to control the stability and dynamics of emulsions in microfluidics with flow velocity and different wettability. PMID:27256703

  12. Treatment Heterogeneity and Individual Qualitative Interaction

    PubMed Central

    Poulson, Robert S.; Gadbury, Gary L.; Allison, David B.

    2012-01-01

    Plausibility of high variability in treatment effects across individuals has been recognized as an important consideration in clinical studies. Surprisingly, little attention has been given to evaluating this variability in design of clinical trials or analyses of resulting data. High variation in a treatment’s efficacy or safety across individuals (referred to herein as treatment heterogeneity) may have important consequences because the optimal treatment choice for an individual may be different from that suggested by a study of average effects. We call this an individual qualitative interaction (IQI), borrowing terminology from earlier work - referring to a qualitative interaction (QI) being present when the optimal treatment varies across a“groups” of individuals. At least three techniques have been proposed to investigate treatment heterogeneity: techniques to detect a QI, use of measures such as the density overlap of two outcome variables under different treatments, and use of cross-over designs to observe “individual effects.” We elucidate underlying connections among them, their limitations and some assumptions that may be required. We do so under a potential outcomes framework that can add insights to results from usual data analyses and to study design features that improve the capability to more directly assess treatment heterogeneity. PMID:23204562

  13. Evidence for genetic heterogeneity in tuberous sclerosis.

    PubMed Central

    Sampson, J R; Yates, J R; Pirrit, L A; Fleury, P; Winship, I; Beighton, P; Connor, J M

    1989-01-01

    The question of genetic heterogeneity in tuberous sclerosis (TSC) was addressed by genetic linkage studies in eight affected families using nine polymorphic markers (EFD126.3, MCT136, ABO, ABL, AK1, and MCOA12 from distal 9q, and PBGD, MCT128.1, and 1CJ52.208M from distal 11q). The data as a whole supported a TSC locus on distal 9q, the peak lod score on multipoint analysis being 3.77 at 6 cM proximal to the Abelson oncogene locus (ABL). However, analysis of two point lod scores using the HOMOG programs showed significant evidence for genetic heterogeneity (p = 0.01), linkage to ABL being unlikely in one family. After exclusion of the unlinked family, multipoint analysis gave a peak lod score of 6.1 in the vicinity of ABL. The family unlinked to ABL showed no recombinants with two chromosome 11 probes, but was too small to provide significant evidence for linkage. Genetic heterogeneity in TSC will complicate efforts to clone the causative genes and severely limit the use of linked probes for carrier detection and prenatal diagnosis. PMID:2769723

  14. Genetic Heterogeneity in Algerian Human Populations.

    PubMed

    Bekada, Asmahan; Arauna, Lara R; Deba, Tahria; Calafell, Francesc; Benhamamouch, Soraya; Comas, David

    2015-01-01

    The demographic history of human populations in North Africa has been characterized by complex processes of admixture and isolation that have modeled its current gene pool. Diverse genetic ancestral components with different origins (autochthonous, European, Middle Eastern, and sub-Saharan) and genetic heterogeneity in the region have been described. In this complex genetic landscape, Algeria, the largest country in Africa, has been poorly covered, with most of the studies using a single Algerian sample. In order to evaluate the genetic heterogeneity of Algeria, Y-chromosome, mtDNA and autosomal genome-wide makers have been analyzed in several Berber- and Arab-speaking groups. Our results show that the genetic heterogeneity found in Algeria is not correlated with geography or linguistics, challenging the idea of Berber groups being genetically isolated and Arab groups open to gene flow. In addition, we have found that external sources of gene flow into North Africa have been carried more often by females than males, while the North African autochthonous component is more frequent in paternally transmitted genome regions. Our results highlight the different demographic history revealed by different markers and urge to be cautious when deriving general conclusions from partial genomic information or from single samples as representatives of the total population of a region.

  15. Soft random solids and their heterogeneous elasticity.

    PubMed

    Mao, Xiaoming; Goldbart, Paul M; Xing, Xiangjun; Zippelius, Annette

    2009-09-01

    Spatial heterogeneity in the elastic properties of soft random solids is examined via vulcanization theory. The spatial heterogeneity in the structure of soft random solids is a result of the fluctuations locked-in at their synthesis, which also brings heterogeneity in their elastic properties. Vulcanization theory studies semimicroscopic models of random-solid-forming systems and applies replica field theory to deal with their quenched disorder and thermal fluctuations. The elastic deformations of soft random solids are argued to be described by the Goldstone sector of fluctuations contained in vulcanization theory, associated with a subtle form of spontaneous symmetry breaking that is associated with the liquid-to-random-solid transition. The resulting free energy of this Goldstone sector can be reinterpreted as arising from a phenomenological description of an elastic medium with quenched disorder. Through this comparison, we arrive at the statistics of the quenched disorder of the elasticity of soft random solids in terms of residual stress and Lamé-coefficient fields. In particular, there are large residual stresses in the equilibrium reference state, and the disorder correlators involving the residual stress are found to be long ranged and governed by a universal parameter that also gives the mean shear modulus. PMID:19905095

  16. Genetic heterogeneity of familial hemiplegic migraine

    SciTech Connect

    Joutel, A.; Ducros, A.; Delrieu, O.; Maziaceck, J.; Tournier-Lasserve, E.; Vahedi, K. |; Bousser, M.G.; Ponsot, G.; Gouttiere, F.; Labauge, P.; Mancini, J.

    1994-12-01

    Familial hemiplegic migraine (FHM) is an autosomal dominant variety of migraine with aura. We previously mapped a gene for this disorder to the short arm of chromosome 19, within a 30-cM interval bracketed by D19S216 and D19S215. Linkage analysis conducted on two large pedigrees did not show any evidence of heterogeneity, despite their clinical differences due to the presence, in one family, of cerebellar ataxia and nystagmus. Herein we report linkage data on seven additional FHM families including another one with cerebellar ataxia. Analysis was conducted with a set of seven markers spanning the D19S216-D19S215 interval. Two-point and multipoint strong evidence for genetic heterogeneity. Strong evidence of linkage was obtained in two families and of absence of linkage in four families. The posterior probability of being of the linked type was >.95 in the first two families and <.01 in four other ones. It was not possible to draw any firm conclusion for the last family. Thus, within the nine families so far tested, four were linked, including those with associated cerebellar ataxia. We could not find any clinical difference between the pure FHM families regardless of whether they were linked. In addition to the demonstration of genetic heterogeneity of FHM, this study also allowed us to establish that the most likely location of the gene was within an interval of 12 cM between D19S413 and D19S226.

  17. Evidence for heterogeneous reactions in the atmosphere

    NASA Astrophysics Data System (ADS)

    Hidy, George M.

    Verification of heterogeneous reactions in the atmosphere through observations has remained a difficult, perhaps unachievable task because of the diversity and complexity of simultaneous chemical interactions which are suspected to occur. However, recent measurements combined with data analysis show promise for supplying both direct and indirect evidence of heterogeneous sulfur oxide and nitrogen oxide chemistry. Examples of useful methods are provided, which include (1) direct interpretation of observations in and near clouds and inference from thermodynamic properties, (2) inspection of combinations of aerometric data, (3) inference from statistical analysis, (4) comparison of observations with a validated air quality model, and (5) differences in particle size/composition distributions. An example involving thermodynamics is dry ammonium nitrate undergoing equilibrium transformation to the vapor phase, which is very sensitive to temperature. The other sample results presented suggest that heterogeneous oxidation of SO2 to sulfate may occur in the presence of suspended liquid water, particularly in winter, either through media buffered by absorbed ammonia or via suspended soot in droplets. No observational evidence has been found supporting metal-oxide- or ion-catalyzed reactions of sulfur dioxide or nitrogen oxides under atmospheric conditions.

  18. Soft random solids and their heterogeneous elasticity

    NASA Astrophysics Data System (ADS)

    Mao, Xiaoming; Goldbart, Paul M.; Xing, Xiangjun; Zippelius, Annette

    2009-09-01

    Spatial heterogeneity in the elastic properties of soft random solids is examined via vulcanization theory. The spatial heterogeneity in the structure of soft random solids is a result of the fluctuations locked-in at their synthesis, which also brings heterogeneity in their elastic properties. Vulcanization theory studies semimicroscopic models of random-solid-forming systems and applies replica field theory to deal with their quenched disorder and thermal fluctuations. The elastic deformations of soft random solids are argued to be described by the Goldstone sector of fluctuations contained in vulcanization theory, associated with a subtle form of spontaneous symmetry breaking that is associated with the liquid-to-random-solid transition. The resulting free energy of this Goldstone sector can be reinterpreted as arising from a phenomenological description of an elastic medium with quenched disorder. Through this comparison, we arrive at the statistics of the quenched disorder of the elasticity of soft random solids in terms of residual stress and Lamé-coefficient fields. In particular, there are large residual stresses in the equilibrium reference state, and the disorder correlators involving the residual stress are found to be long ranged and governed by a universal parameter that also gives the mean shear modulus.

  19. Heterogeneity of schizophrenia: Genetic and symptomatic factors.

    PubMed

    Takahashi, Sakae

    2013-10-01

    Schizophrenia may have etiological heterogeneity, and may reflect common symptomatology caused by many genetic and environmental factors. In this review, we show the potential existence of heterogeneity in schizophrenia based on the results of our previous studies. In our study of the NOTCH4 gene, there were no significant associations between any single nucleotide polymorphisms (SNPs) of NOTCH4 and schizophrenia. However, exploratory analyses suggested that the SNP, rs3134928 may be associated with early-onset schizophrenia, and that rs387071 may be associated with schizophrenia characterized by negative symptoms. In our highly familial schizophrenia study, the African-American cohort without environmental exposure showed a possible linkage at marker 8p23.1 in the dominant model and in the European-American cohort, a marker at 22q13.32 showed a probable linkage in the recessive model. In the less familial schizophrenia families, these linkages were not shown. Based on our eye movement study, a putative subtype of schizophrenia with severe symptoms related to excitement/hostility, negative symptoms and disorganization may be associated with chromosome 22q11. We consider that a sample stratification approach may clarify the heterogeneity of schizophrenia. Therefore, this approach may lead to a more straightforward way of identifying susceptibility genes of schizophrenia.

  20. Altering Emulsion Stability with Heterogeneous Surface Wettability

    NASA Astrophysics Data System (ADS)

    Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob G. H.; Chen, Haosheng; Tsai, Peichun Amy

    2016-06-01

    Emulsions–liquid droplets dispersed in another immiscible liquid–are widely used in a broad spectrum of applications, including food, personal care, agrochemical, and pharmaceutical products. Emulsions are also commonly present in natural crude oil, hampering the production and quality of petroleum fuels. The stability of emulsions plays a crucial role in their applications, but controlling the stability without external driving forces has been proven to be difficult. Here we show how heterogeneous surface wettability can alter the stability and dynamics of oil-in-water emulsions, generated by a co-flow microfluidic device. We designed a useful methodology that can modify a micro-capillary of desired heterogeneous wettability (e.g., alternating hydrophilic and hydrophobic regions) without changing the hydraulic diameter. We subsequently investigated the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion. The experimental data revealed a universal critical timescale of advective emulsions, above which the microfluidic emulsions remain stable and intact, whereas below they become adhesive or inverse. A simple theoretical model based on a force balance can be used to explain this critical transition of emulsion dynamics, depending on the droplet size and the Capillary number–the ratio of viscous to surface effects. These results give insight into how to control the stability and dynamics of emulsions in microfluidics with flow velocity and different wettability.

  1. Site occupancy models with heterogeneous detection probabilities

    USGS Publications Warehouse

    Royle, J. Andrew

    2006-01-01

    Models for estimating the probability of occurrence of a species in the presence of imperfect detection are important in many ecological disciplines. In these ?site occupancy? models, the possibility of heterogeneity in detection probabilities among sites must be considered because variation in abundance (and other factors) among sampled sites induces variation in detection probability (p). In this article, I develop occurrence probability models that allow for heterogeneous detection probabilities by considering several common classes of mixture distributions for p. For any mixing distribution, the likelihood has the general form of a zero-inflated binomial mixture for which inference based upon integrated likelihood is straightforward. A recent paper by Link (2003, Biometrics 59, 1123?1130) demonstrates that in closed population models used for estimating population size, different classes of mixture distributions are indistinguishable from data, yet can produce very different inferences about population size. I demonstrate that this problem can also arise in models for estimating site occupancy in the presence of heterogeneous detection probabilities. The implications of this are discussed in the context of an application to avian survey data and the development of animal monitoring programs.

  2. Heterogeneous nanofluids: natural convection heat transfer enhancement

    PubMed Central

    2011-01-01

    Convective heat transfer using different nanofluid types is investigated. The domain is differentially heated and nanofluids are treated as heterogeneous mixtures with weak solutal diffusivity and possible Soret separation. Owing to the pronounced Soret effect of these materials in combination with a considerable solutal expansion, the resulting solutal buoyancy forces could be significant and interact with the initial thermal convection. A modified formulation taking into account the thermal conductivity, viscosity versus nanofluids type and concentration and the spatial heterogeneous concentration induced by the Soret effect is presented. The obtained results, by solving numerically the full governing equations, are found to be in good agreement with the developed solution based on the scale analysis approach. The resulting convective flows are found to be dependent on the local particle concentration φ and the corresponding solutal to thermal buoyancy ratio N. The induced nanofluid heterogeneity showed a significant heat transfer modification. The heat transfer in natural convection increases with nanoparticle concentration but remains less than the enhancement previously underlined in forced convection case. PMID:21711755

  3. Measuring statistical heterogeneity: The Pietra index

    NASA Astrophysics Data System (ADS)

    Eliazar, Iddo I.; Sokolov, Igor M.

    2010-01-01

    There are various ways of quantifying the statistical heterogeneity of a given probability law: Statistics uses variance - which measures the law’s dispersion around its mean; Physics and Information Theory use entropy - which measures the law’s randomness; Economics uses the Gini index - which measures the law’s egalitarianism. In this research we explore an alternative to the Gini index-the Pietra index-which is a counterpart of the Kolmogorov-Smirnov statistic. The Pietra index is shown to be a natural and elemental measure of statistical heterogeneity, which is especially useful in the case of asymmetric and skewed probability laws, and in the case of asymptotically Paretian laws with finite mean and infinite variance. Moreover, the Pietra index is shown to have immediate and fundamental interpretations within the following applications: renewal processes and continuous time random walks; infinite-server queueing systems and shot noise processes; financial derivatives. The interpretation of the Pietra index within the context of financial derivatives implies that derivative markets, in effect, use the Pietra index as their benchmark measure of statistical heterogeneity.

  4. Soil Porous Structure as Heterogeneous Networks

    NASA Astrophysics Data System (ADS)

    Cárdenas, J. P.; Santiago, A.; Losada, J. C.; Borondo, F.; Benito, R. M.

    2010-05-01

    In this paper we present an application of the Complex Network theory to Geosciences. In particular, we show the implementation of the Heterogeneous Preferential Attachment (HPA) model [1] as a new way to quantify the structure of porous soils and closer relate them with soil texture. In the HPA model, already introduced in this context [2], pores are considered as nodes and their properties, such as position and size, are described by fixed states in a metric space. An affinity function is introduced in the HPA soil model in order to bias the attachment probabilities of links between pores according to their properties and soil texture. We perform an analytical study of the connectivity distributions of pores, P(k), and develop a numerical analysis for the HPA soil model considering a combination of parameters corresponding to eleven empirical soil samples with different physical properties and five different textures. [1] A. Santiago and R. M. Benito, An extended formalism for preferential attachment in heterogeneous complex networks, Europhysics Letters, 82 (2008) 58004. [2] A. Santiago, J.P. Cárdenas, J.C. Losada, R.M. Benito, A.M. Tarquis and F. Borondo, Multiscaling of porous soils as heterogeneous complex networks, Nonlinear Processes in Geophysics, 15 (2008) 893-902.

  5. Altering Emulsion Stability with Heterogeneous Surface Wettability.

    PubMed

    Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob G H; Chen, Haosheng; Tsai, Peichun Amy

    2016-01-01

    Emulsions-liquid droplets dispersed in another immiscible liquid-are widely used in a broad spectrum of applications, including food, personal care, agrochemical, and pharmaceutical products. Emulsions are also commonly present in natural crude oil, hampering the production and quality of petroleum fuels. The stability of emulsions plays a crucial role in their applications, but controlling the stability without external driving forces has been proven to be difficult. Here we show how heterogeneous surface wettability can alter the stability and dynamics of oil-in-water emulsions, generated by a co-flow microfluidic device. We designed a useful methodology that can modify a micro-capillary of desired heterogeneous wettability (e.g., alternating hydrophilic and hydrophobic regions) without changing the hydraulic diameter. We subsequently investigated the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion. The experimental data revealed a universal critical timescale of advective emulsions, above which the microfluidic emulsions remain stable and intact, whereas below they become adhesive or inverse. A simple theoretical model based on a force balance can be used to explain this critical transition of emulsion dynamics, depending on the droplet size and the Capillary number-the ratio of viscous to surface effects. These results give insight into how to control the stability and dynamics of emulsions in microfluidics with flow velocity and different wettability. PMID:27256703

  6. Modeling Heterogeneity of Latent Growth Depending on Initial Status

    ERIC Educational Resources Information Center

    Klein, Andreas G.; Muthen, Bengt O.

    2006-01-01

    In this article, a heterogeneous latent growth curve model for modeling heterogeneity of growth rates is proposed. The suggested model is an extension of a conventional growth curve model and a complementary tool to mixed growth modeling. It allows the modeling of heterogeneity of growth rates as a continuous function of latent initial status and…

  7. Coordinating the Design and Management of Heterogeneous Datacenter Resources

    ERIC Educational Resources Information Center

    Guevara, Marisabel

    2014-01-01

    Heterogeneous design presents an opportunity to improve energy efficiency but raises a challenge in management. Whereas prior work separates the two, we coordinate heterogeneous design and management. We present a market-based resource allocation mechanism that navigates the performance and power trade-offs of heterogeneous architectures. Given…

  8. Are Heterogeneous or Homogeneous Groups More Beneficial to Students?

    ERIC Educational Resources Information Center

    Schullery, Nancy M.; Schullery, Stephen E.

    2006-01-01

    This study investigated the relative benefits to the student of working in homogeneous versus heterogeneous classroom groups. Correlation analysis of 18 desirable outcomes versus 8 personality-based heterogeneity variables reveals that heterogeneity associates with advantages as well as disadvantages. Ways in which group composition might be…

  9. The Nuclear Power and Nuclear Weapons Connection.

    ERIC Educational Resources Information Center

    Leventhal, Paul

    1990-01-01

    Explains problems enforcing the Nuclear Non-Proliferation Treaty (NPT) of 1968. Provides factual charts and details concerning the production of nuclear energy and arms, the processing and disposal of waste products, and outlines the nuclear fuel cycle. Discusses safeguards, the risk of nuclear terrorism, and ways to deal with these problems. (NL)

  10. The nuclear arsenals and nuclear disarmament.

    PubMed

    Barnaby, F

    1998-01-01

    Current world stockpiles of nuclear weapons and the status of treaties for nuclear disarmament and the ultimate elimination of nuclear weapons are summarised. The need for including stockpiles of civil plutonium in a programme for ending production and disposing of fissile materials is emphasized, and the ultimate difficulty of disposing of the last few nuclear weapons discussed.

  11. The Nuclear Power/Nuclear Weapons Connection.

    ERIC Educational Resources Information Center

    Totten, Sam; Totten, Martha Wescoat

    1985-01-01

    Once they have nuclear power, most countries will divert nuclear materials from commercial to military programs. In excerpts from the book "Facing the Danger" (by Totten, S. and M. W., Crossing Press, 1984), five anti-nuclear activists explain how and why they have been addressing the nuclear connection. (RM)

  12. Dynamic Heterogeneity in the Monoclinic Phase of CCl4.

    PubMed

    Caballero, Nirvana B; Zuriaga, Mariano; Carignano, Marcelo; Serra, Pablo

    2016-02-01

    Carbon tetrachloride (CCl4) is one of the simplest compounds having a translationally stable monoclinic phase while exhibiting a rich rotational dynamics below 226 K. Recent nuclear quadrupolar resonance experiments revealed that the dynamics of CCl4 is similar to that of the other members of the isostructural series CBrnCl4-n, suggesting that the universal relaxation features of canonical glasses such as α and β relaxation are also present in nonglass formers. Using molecular dynamics simulations we studied the rotational dynamics in the monoclinic phase of CCl4. The molecules undergo C3-type jump-like rotations around each one of the four C-Cl bonds. The rotational dynamics is very well described with a master equation using as the only input the rotational rates measured from the simulated trajectories. It is found that the heterogeneous dynamics emerges from faster and slower modes associated with different rotational axes, which have fixed orientations relative to the crystal and are distributed among the four nonequivalent molecules of the unit cell.

  13. Inverse problems in heterogeneous and fractured media using peridynamics

    DOE PAGES

    Turner, Daniel Z.; van Bloemen Waanders, Bart G.; Parks, Michael L.

    2015-12-10

    The following work presents an adjoint-based methodology for solving inverse problems in heterogeneous and fractured media using state-based peridynamics. We show that the inner product involving the peridynamic operators is self-adjoint. The proposed method is illustrated for several numerical examples with constant and spatially varying material parameters as well as in the context of fractures. We also present a framework for obtaining material parameters by integrating digital image correlation (DIC) with inverse analysis. This framework is demonstrated by evaluating the bulk and shear moduli for a sample of nuclear graphite using digital photographs taken during the experiment. The resulting measuredmore » values correspond well with other results reported in the literature. Lastly, we show that this framework can be used to determine the load state given observed measurements of a crack opening. Furthermore, this type of analysis has many applications in characterizing subsurface stress-state conditions given fracture patterns in cores of geologic material.« less

  14. The Power of Heterogeneity: Parameter Relationships from Distributions.

    PubMed

    Röding, Magnus; Bradley, Siobhan J; Williamson, Nathan H; Dewi, Melissa R; Nann, Thomas; Nydén, Magnus

    2016-01-01

    Complex scientific data is becoming the norm, many disciplines are growing immensely data-rich, and higher-dimensional measurements are performed to resolve complex relationships between parameters. Inherently multi-dimensional measurements can directly provide information on both the distributions of individual parameters and the relationships between them, such as in nuclear magnetic resonance and optical spectroscopy. However, when data originates from different measurements and comes in different forms, resolving parameter relationships is a matter of data analysis rather than experiment. We present a method for resolving relationships between parameters that are distributed individually and also correlated. In two case studies, we model the relationships between diameter and luminescence properties of quantum dots and the relationship between molecular weight and diffusion coefficient for polymers. Although it is expected that resolving complicated correlated relationships require inherently multi-dimensional measurements, our method constitutes a useful contribution to the modelling of quantitative relationships between correlated parameters and measurements. We emphasise the general applicability of the method in fields where heterogeneity and complex distributions of parameters are obstacles to scientific insight. PMID:27182701

  15. The Power of Heterogeneity: Parameter Relationships from Distributions

    PubMed Central

    Röding, Magnus; Bradley, Siobhan J.; Williamson, Nathan H.; Dewi, Melissa R.; Nann, Thomas; Nydén, Magnus

    2016-01-01

    Complex scientific data is becoming the norm, many disciplines are growing immensely data-rich, and higher-dimensional measurements are performed to resolve complex relationships between parameters. Inherently multi-dimensional measurements can directly provide information on both the distributions of individual parameters and the relationships between them, such as in nuclear magnetic resonance and optical spectroscopy. However, when data originates from different measurements and comes in different forms, resolving parameter relationships is a matter of data analysis rather than experiment. We present a method for resolving relationships between parameters that are distributed individually and also correlated. In two case studies, we model the relationships between diameter and luminescence properties of quantum dots and the relationship between molecular weight and diffusion coefficient for polymers. Although it is expected that resolving complicated correlated relationships require inherently multi-dimensional measurements, our method constitutes a useful contribution to the modelling of quantitative relationships between correlated parameters and measurements. We emphasise the general applicability of the method in fields where heterogeneity and complex distributions of parameters are obstacles to scientific insight. PMID:27182701

  16. Para-hydrogen induced polarization in heterogeneous hydrogenationreactions

    SciTech Connect

    Koptyug, Igor V.; Kovtunov, Kirill; Burt, Scott R.; Anwar, M.Sabieh; Hilty, Christian; Han, Song-I; Pines, Alexander; Sagdeev, Renad Z.

    2007-01-31

    We demonstrate the creation and observation ofpara-hydrogen-induced polarization in heterogeneous hydrogenationreactions. Wilkinson's catalyst, RhCl(PPh3)3, supported on eithermodified silica gel or a polymer, is shown to hydrogenate styrene intoethylbenzene and to produce enhanced spin polarizations, observed throughNMR, when the reaction was performed with H2 gas enriched in the paraspinisomer. Furthermore, gaseous phase para-hydrogenation of propylene topropane with two catalysts, the Wilkinson's catalyst supported onmodified silica gel and Rh(cod)(sulfos) (cod = cycloocta-1,5-diene;sulfos) - O3S(C6H4)CH2C(CH2PPh2)3) supported on silica gel, demonstratesheterogeneous catalytic conversion resulting in large spin polarizations.These experiments serve as a direct verification of the mechanism ofheterogeneous hydrogenation reactions involving immobilized metalcomplexes and can be potentially developed into a practical tool forproducing catalyst-free fluids with highly polarized nuclear spins for abroad range of hyperpolarized NMR and MRI applications.

  17. Nuclear security

    SciTech Connect

    Dingell, J.D.

    1991-02-01

    The Department of Energy's (DOE) Lawrence Livermore National Laboratory, located in Livermore, California, generates and controls large numbers of classified documents associated with the research and testing of nuclear weapons. Concern has been raised about the potential for espionage at the laboratory and the national security implications of classified documents being stolen. This paper determines the extent of missing classified documents at the laboratory and assesses the adequacy of accountability over classified documents in the laboratory's custody. Audit coverage was limited to the approximately 600,000 secret documents in the laboratory's custody. The adequacy of DOE's oversight of the laboratory's secret document control program was also assessed.

  18. NUCLEAR REACTOR

    DOEpatents

    Young, G.

    1963-01-01

    This patent covers a power-producing nuclear reactor in which fuel rods of slightly enriched U are moderated by heavy water and cooled by liquid metal. The fuel rods arranged parallel to one another in a circle are contained in a large outer closed-end conduit that extends into a tank containing the heavy water. Liquid metal is introduced into the large conduit by a small inner conduit that extends within the circle of fuel rods to a point near the lower closed end of the outer conduit. (AEC) Production Reactors

  19. Nuclear energy.

    PubMed

    Grandin, Karl; Jagers, Peter; Kullander, Sven

    2010-01-01

    Nuclear energy can play a role in carbon free production of electrical energy, thus making it interesting for tomorrow's energy mix. However, several issues have to be addressed. In fission technology, the design of so-called fourth generation reactors show great promise, in particular in addressing materials efficiency and safety issues. If successfully developed, such reactors may have an important and sustainable part in future energy production. Working fusion reactors may be even more materials efficient and environmental friendly, but also need more development and research. The roadmap for development of fourth generation fission and fusion reactors, therefore, asks for attention and research in these fields must be strengthened.

  20. Nuclear energy.

    PubMed

    Grandin, Karl; Jagers, Peter; Kullander, Sven

    2010-01-01

    Nuclear energy can play a role in carbon free production of electrical energy, thus making it interesting for tomorrow's energy mix. However, several issues have to be addressed. In fission technology, the design of so-called fourth generation reactors show great promise, in particular in addressing materials efficiency and safety issues. If successfully developed, such reactors may have an important and sustainable part in future energy production. Working fusion reactors may be even more materials efficient and environmental friendly, but also need more development and research. The roadmap for development of fourth generation fission and fusion reactors, therefore, asks for attention and research in these fields must be strengthened. PMID:20873683

  1. NUCLEAR REACTORS

    DOEpatents

    Long, E.; Ashley, J.W.

    1958-12-16

    A graphite moderator structure is described for a gas-cooled nuclear reactor having a vertical orlentation wherein the structure is physically stable with regard to dlmensional changes due to Wigner growth properties of the graphite, and leakage of coolant gas along spaces in the structure is reduced. The structure is comprised of stacks of unlform right prismatic graphite blocks positioned in layers extending in the direction of the lengths of the blocks, the adjacent end faces of the blocks being separated by pairs of tiles. The blocks and tiles have central bores which are in alignment when assembled and are provided with cooperatlng keys and keyways for physical stability.

  2. Optimal sampling strategies for detecting linkage of a complex trait with known genetic heterogeneity

    SciTech Connect

    Easton, D.F.; Goldgar, D.E.

    1994-09-01

    As genes underlying susceptibility to human disease are identified through linkage analysis, it is becoming increasingly clear that genetic heterogeneity is the rule rather than the exception. The focus of the present work is to examine the power and optimal sampling design for localizing a second disease gene when one disease gene has previously been identified. In particular, we examined the case when the unknown locus had lower penetrance, but higher frequency, than the known locus. Three scenarios regarding knowledge about locus 1 were examined: no linkage information (i.e. standard heterogeneity analysis), tight linkage with a known highly polymorphic marker locus, and mutation testing. Exact expected LOD scores (ELODs) were calculated for a number of two-locus genetic models under the 3 scenarios of heterogeneity for nuclear families containing 2, 3 or 4 affected children, with 0 or 1 affected parents. A cost function based upon the cost of ascertaining and genotyping sufficient samples to achieve an ELOD of 3.0 was used to evaluate the designs. As expected, the power and the optimal pedigree sampling strategy was dependent on the underlying model and the heterogeneity testing status. When the known locus had higher penetrance than the unknown locus, three affected siblings with unaffected parents proved to be optimal for all levels of heterogeneity. In general, mutation testing at the first locus provided substantially more power for detecting the second locus than linkage evidence alone. However, when both loci had relatively low penetrance, mutation testing provided little improvement in power since most families could be expected to be segregating the high risk allele at both loci.

  3. Heterogeneity of link weight and the evolution of cooperation

    NASA Astrophysics Data System (ADS)

    Iwata, Manabu; Akiyama, Eizo

    2016-04-01

    In this paper, we investigate the effect of heterogeneity of link weight, heterogeneity of the frequency or amount of interactions among individuals, on the evolution of cooperation. Based on an analysis of the evolutionary prisoner's dilemma game on a weighted one-dimensional lattice network with intra-individual heterogeneity, we confirm that moderate level of link-weight heterogeneity can facilitate cooperation. Furthermore, we identify two key mechanisms by which link-weight heterogeneity promotes the evolution of cooperation: mechanisms for spread and maintenance of cooperation. We also derive the corresponding conditions under which the mechanisms can work through evolutionary dynamics.

  4. Dictionary of nuclear engineering

    SciTech Connect

    Sube, R.

    1985-01-01

    Ralf Sube, an experienced compiler of three wellknown four-language reference works has now prepared this glossary of nuclear engineering terms in English, German, French and Russian. Based on the proven lexicography of the Technik-Worterbuch series, it comprises about 30,000 terms in each language covering the following: Nuclear and Atomic Physics; Nuclear Radiation and Isotopes; Nuclear Materials; Nuclear Facilties; Nuclear Power Industry; Nuclear Weapons.

  5. Dissecting cancer evolution at the macro-heterogeneity and micro-heterogeneity scale

    PubMed Central

    Barber, Louise J; Davies, Matthew N; Gerlinger, Marco

    2015-01-01

    Intratumour heterogeneity complicates biomarker discovery and treatment personalization, and pervasive cancer evolution is a key mechanism leading to therapy failure and patient death. Thus, understanding subclonal heterogeneity architectures and cancer evolution processes is critical for the development of effective therapeutic approaches which can control or thwart cancer evolutionary plasticity. Current insights into heterogeneity are mainly limited to the macroheterogeneity level, established by cancer subclones that have undergone significant clonal expansion. Novel single cell sequencing and blood-based subclonal tracking technologies are enabling detailed insights into microheterogeneity and the dynamics of clonal evolution. We assess how this starts to delineate the rules governing cancer evolution and novel angles for more effective therapeutic intervention. PMID:25555261

  6. Heterogeneity in Genetic Diversity among Non-Coding Loci Fails to Fit Neutral Coalescent Models of Population History

    PubMed Central

    Peters, Jeffrey L.; Roberts, Trina E.; Winker, Kevin; McCracken, Kevin G.

    2012-01-01

    Inferring aspects of the population histories of species using coalescent analyses of non-coding nuclear DNA has grown in popularity. These inferences, such as divergence, gene flow, and changes in population size, assume that genetic data reflect simple population histories and neutral evolutionary processes. However, violating model assumptions can result in a poor fit between empirical data and the models. We sampled 22 nuclear intron sequences from at least 19 different chromosomes (a genomic transect) to test for deviations from selective neutrality in the gadwall (Anas strepera), a Holarctic duck. Nucleotide diversity among these loci varied by nearly two orders of magnitude (from 0.0004 to 0.029), and this heterogeneity could not be explained by differences in substitution rates alone. Using two different coalescent methods to infer models of population history and then simulating neutral genetic diversity under these models, we found that the observed among-locus heterogeneity in nucleotide diversity was significantly higher than expected for these simple models. Defining more complex models of population history demonstrated that a pre-divergence bottleneck was also unlikely to explain this heterogeneity. However, both selection and interspecific hybridization could account for the heterogeneity observed among loci. Regardless of the cause of the deviation, our results illustrate that violating key assumptions of coalescent models can mislead inferences of population history. PMID:22384117

  7. DNA Methylation Heterogeneity Patterns in Breast Cancer Cell Lines.

    PubMed

    Tian, Sunny; Bertelsmann, Karina; Yu, Linda; Sun, Shuying

    2016-01-01

    Heterogeneous DNA methylation patterns are linked to tumor growth. In order to study DNA methylation heterogeneity patterns for breast cancer cell lines, we comparatively study four metrics: variance, I (2) statistic, entropy, and methylation state. Using the categorical metric methylation state, we select the two most heterogeneous states to identify genes that directly affect tumor suppressor genes and high- or moderate-risk breast cancer genes. Utilizing the Gene Set Enrichment Analysis software and the ConsensusPath Database visualization tool, we generate integrated gene networks to study biological relations of heterogeneous genes. This analysis has allowed us to contribute 19 potential breast cancer biomarker genes to cancer databases by locating "hub genes" - heterogeneous genes of significant biological interactions, selected from numerous cancer modules. We have discovered a considerable relationship between these hub genes and heterogeneously methylated oncogenes. Our results have many implications for further heterogeneity analyses of methylation patterns and early detection of breast cancer susceptibility. PMID:27688708

  8. DNA Methylation Heterogeneity Patterns in Breast Cancer Cell Lines

    PubMed Central

    Tian, Sunny; Bertelsmann, Karina; Yu, Linda; Sun, Shuying

    2016-01-01

    Heterogeneous DNA methylation patterns are linked to tumor growth. In order to study DNA methylation heterogeneity patterns for breast cancer cell lines, we comparatively study four metrics: variance, I2 statistic, entropy, and methylation state. Using the categorical metric methylation state, we select the two most heterogeneous states to identify genes that directly affect tumor suppressor genes and high- or moderate-risk breast cancer genes. Utilizing the Gene Set Enrichment Analysis software and the ConsensusPath Database visualization tool, we generate integrated gene networks to study biological relations of heterogeneous genes. This analysis has allowed us to contribute 19 potential breast cancer biomarker genes to cancer databases by locating “hub genes” – heterogeneous genes of significant biological interactions, selected from numerous cancer modules. We have discovered a considerable relationship between these hub genes and heterogeneously methylated oncogenes. Our results have many implications for further heterogeneity analyses of methylation patterns and early detection of breast cancer susceptibility.

  9. Defining heterogeneity within bacterial populations via single cell approaches.

    PubMed

    Davis, Kimberly M; Isberg, Ralph R

    2016-08-01

    Bacterial populations are heterogeneous, which in many cases can provide a selective advantage during changes in environmental conditions. In some instances, heterogeneity exists at the genetic level, in which significant allelic variation occurs within a population seeded by a single cell. In other cases, heterogeneity exists due to phenotypic differences within a clonal, genetically identical population. A variety of mechanisms can drive this latter strategy. Stochastic fluctuations can drive differential gene expression, but heterogeneity in gene expression can also be driven by environmental changes sensed by individual cells residing in distinct locales. Utilizing multiple single cell approaches, workers have started to uncover the extent of heterogeneity within bacterial populations. This review will first describe several examples of phenotypic and genetic heterogeneity, and then discuss many single cell approaches that have recently been applied to define heterogeneity within bacterial populations. PMID:27273675

  10. DNA Methylation Heterogeneity Patterns in Breast Cancer Cell Lines

    PubMed Central

    Tian, Sunny; Bertelsmann, Karina; Yu, Linda; Sun, Shuying

    2016-01-01

    Heterogeneous DNA methylation patterns are linked to tumor growth. In order to study DNA methylation heterogeneity patterns for breast cancer cell lines, we comparatively study four metrics: variance, I2 statistic, entropy, and methylation state. Using the categorical metric methylation state, we select the two most heterogeneous states to identify genes that directly affect tumor suppressor genes and high- or moderate-risk breast cancer genes. Utilizing the Gene Set Enrichment Analysis software and the ConsensusPath Database visualization tool, we generate integrated gene networks to study biological relations of heterogeneous genes. This analysis has allowed us to contribute 19 potential breast cancer biomarker genes to cancer databases by locating “hub genes” – heterogeneous genes of significant biological interactions, selected from numerous cancer modules. We have discovered a considerable relationship between these hub genes and heterogeneously methylated oncogenes. Our results have many implications for further heterogeneity analyses of methylation patterns and early detection of breast cancer susceptibility. PMID:27688708

  11. Seismic response interpretation for heterogeneous reservoir models

    SciTech Connect

    Fichtl, P.; Fournier, F.

    1995-08-01

    Seismic information is crucial to constrain the reservoir image between wells. However, in heterogeneous environments, it is often difficult to interpret the seismic response of the reservoir, especially with limited well control. Analyses of synthetic seismic responses of typical reservoir models are helpful for defining the geological information contained in the seismic data. We propose a geological interpretation of seismic responses of various models in the frame of fluvio-deltaic deposits. The first model is the intermediate unit of the Mesa Verde outcrop, whose seismic response was computed by elastic wave modelling, after assignment of elastic parameters constant by lithofacies. The other models correspond to stochastic lithofacies simulations with different geostatistical characteristics. Their seismic responses were computed with 1D modelling (convolution). The geological interpretation carried out on those synthetic seismic data is based on a calibration of the seismic parameters in terms of probabilities of encountering the different lithofacies. The technique we use is a non parametric discriminant analysis. The seismic parameters are the amplitudes for the convolution models or impedances and reflection coefficients for the first model for which a post-stack stratigraphic inversion was carried out. We compare the seismic derived lithofacies to the true ones to determine the potential of the seismic data for describing the reservoir heterogeneities. We use the different models to discuss: the impact of the spatial distribution of heterogeneities on the geological interpretation of the seismic data; the influence of the seismic lateral filtering on the interpretation the influence of the number of wells, used in the interpretation, on the final results.

  12. Mathematical analysis of epidemiological models with heterogeneity

    SciTech Connect

    Van Ark, J.W.

    1992-01-01

    For many diseases in human populations the disease shows dissimilar characteristics in separate subgroups of the population; for example, the probability of disease transmission for gonorrhea or AIDS is much higher from male to female than from female to male. There is reason to construct and analyze epidemiological models which allow this heterogeneity of population, and to use these models to run computer simulations of the disease to predict the incidence and prevalence of the disease. In the models considered here the heterogeneous population is separated into subpopulations whose internal and external interactions are homogeneous in the sense that each person in the population can be assumed to have all average actions for the people of that subpopulation. The first model considered is an SIRS models; i.e., the Susceptible can become Infected, and if so he eventually Recovers with temporary immunity, and after a period of time becomes Susceptible again. Special cases allow for permanent immunity or other variations. This model is analyzed and threshold conditions are given which determine whether the disease dies out or persists. A deterministic model is presented; this model is constructed using difference equations, and it has been used in computer simulations for the AIDS epidemic in the homosexual population in San Francisco. The homogeneous version and the heterogeneous version of the differential-equations and difference-equations versions of the deterministic model are analyzed mathematically. In the analysis, equilibria are identified and threshold conditions are set forth for the disease to die out if the disease is below the threshold so that the disease-free equilibrium is globally asymptotically stable. Above the threshold the disease persists so that the disease-free equilibrium is unstable and there is a unique endemic equilibrium.

  13. Features and heterogeneities in growing network models

    NASA Astrophysics Data System (ADS)

    Ferretti, Luca; Cortelezzi, Michele; Yang, Bin; Marmorini, Giacomo; Bianconi, Ginestra

    2012-06-01

    Many complex networks from the World Wide Web to biological networks grow taking into account the heterogeneous features of the nodes. The feature of a node might be a discrete quantity such as a classification of a URL document such as personal page, thematic website, news, blog, search engine, social network, etc., or the classification of a gene in a functional module. Moreover the feature of a node can be a continuous variable such as the position of a node in the embedding space. In order to account for these properties, in this paper we provide a generalization of growing network models with preferential attachment that includes the effect of heterogeneous features of the nodes. The main effect of heterogeneity is the emergence of an “effective fitness” for each class of nodes, determining the rate at which nodes acquire new links. The degree distribution exhibits a multiscaling behavior analogous to the the fitness model. This property is robust with respect to variations in the model, as long as links are assigned through effective preferential attachment. Beyond the degree distribution, in this paper we give a full characterization of the other relevant properties of the model. We evaluate the clustering coefficient and show that it disappears for large network size, a property shared with the Barabási-Albert model. Negative degree correlations are also present in this class of models, along with nontrivial mixing patterns among features. We therefore conclude that both small clustering coefficients and disassortative mixing are outcomes of the preferential attachment mechanism in general growing networks.

  14. Reporting Tumor Molecular Heterogeneity in Histopathological Diagnosis

    PubMed Central

    Mafficini, Andrea; Amato, Eliana; Fassan, Matteo; Simbolo, Michele; Antonello, Davide; Vicentini, Caterina; Scardoni, Maria; Bersani, Samantha; Gottardi, Marisa; Rusev, Borislav; Malpeli, Giorgio; Corbo, Vincenzo; Barbi, Stefano; Sikora, Katarzyna O.; Lawlor, Rita T.; Tortora, Giampaolo; Scarpa, Aldo

    2014-01-01

    Background Detection of molecular tumor heterogeneity has become of paramount importance with the advent of targeted therapies. Analysis for detection should be comprehensive, timely and based on routinely available tumor samples. Aim To evaluate the diagnostic potential of targeted multigene next-generation sequencing (TM-NGS) in characterizing gastrointestinal cancer molecular heterogeneity. Methods 35 gastrointestinal tract tumors, five of each intestinal type gastric carcinomas, pancreatic ductal adenocarcinomas, pancreatic intraductal papillary mucinous neoplasms, ampulla of Vater carcinomas, hepatocellular carcinomas, cholangiocarcinomas, pancreatic solid pseudopapillary tumors were assessed for mutations in 46 cancer-associated genes, using Ion Torrent semiconductor-based TM-NGS. One ampulla of Vater carcinoma cell line and one hepatic carcinosarcoma served to assess assay sensitivity. TP53, PIK3CA, KRAS, and BRAF mutations were validated by conventional Sanger sequencing. Results TM-NGS yielded overlapping results on matched fresh-frozen and formalin-fixed paraffin-embedded (FFPE) tissues, with a mutation detection limit of 1% for fresh-frozen high molecular weight DNA and 2% for FFPE partially degraded DNA. At least one somatic mutation was observed in all tumors tested; multiple alterations were detected in 20/35 (57%) tumors. Seven cancers displayed significant differences in allelic frequencies for distinct mutations, indicating the presence of intratumor molecular heterogeneity; this was confirmed on selected samples by immunohistochemistry of p53 and Smad4, showing concordance with mutational analysis. Conclusions TM-NGS is able to detect and quantitate multiple gene alterations from limited amounts of DNA, moving one step closer to a next-generation histopathologic diagnosis that integrates morphologic, immunophenotypic, and multigene mutational analysis on routinely processed tissues, essential for personalized cancer therapy. PMID:25127237

  15. Features and heterogeneities in growing network models.

    PubMed

    Ferretti, Luca; Cortelezzi, Michele; Yang, Bin; Marmorini, Giacomo; Bianconi, Ginestra

    2012-06-01

    Many complex networks from the World Wide Web to biological networks grow taking into account the heterogeneous features of the nodes. The feature of a node might be a discrete quantity such as a classification of a URL document such as personal page, thematic website, news, blog, search engine, social network, etc., or the classification of a gene in a functional module. Moreover the feature of a node can be a continuous variable such as the position of a node in the embedding space. In order to account for these properties, in this paper we provide a generalization of growing network models with preferential attachment that includes the effect of heterogeneous features of the nodes. The main effect of heterogeneity is the emergence of an "effective fitness" for each class of nodes, determining the rate at which nodes acquire new links. The degree distribution exhibits a multiscaling behavior analogous to the the fitness model. This property is robust with respect to variations in the model, as long as links are assigned through effective preferential attachment. Beyond the degree distribution, in this paper we give a full characterization of the other relevant properties of the model. We evaluate the clustering coefficient and show that it disappears for large network size, a property shared with the Barabási-Albert model. Negative degree correlations are also present in this class of models, along with nontrivial mixing patterns among features. We therefore conclude that both small clustering coefficients and disassortative mixing are outcomes of the preferential attachment mechanism in general growing networks.

  16. Pb isotopic heterogeneity in basaltic phenocrysts

    SciTech Connect

    Bryce, Julia G.; DePaolo, Donald J.

    2002-06-01

    The Pb isotopic compositions of phenocrystic phases in young basaltic lavas have been investigated using the Getty-DePaolo method (Getty S. J. and DePaolo D. J. [1995] Quaternary geochronology by the U-Th-Pb method. Geochim. Cosmochim. Acta 59, 3267 3272), which allows for the resolution of small isotopic differences. Phenocryst, matrix, and whole rock analyses were made on samples from the 17 Myr-old Imnaha basalts of the Columbia River Group, a zero-age MORB from the Mid-Atlantic Ridge, and a ca. 260 kyr-old tholeiite from Mount Etna. Plagioclase feldspar phenocrysts have low-(U, Th)/Pb, and in each sample the plagioclase has significantly lower 206Pb/207Pb and 208Pb/207Pb values than whole rock, matrix, and magnetite-rich separates. The Pb isotopic contrast between plagioclase and matrix/whole rock is found in three samples with varying grain sizes (0.5 2 cm for the Imnaha basalt and MORB and <1 mm for the Etna sample) from different tectonic settings, suggesting that these results are not unique. The isotopic contrasts are only slightly smaller in magnitude than the variations exhibited by whole rock samples from the region. The Imnaha basalts also have Sr isotopic heterogeneity evident only in plagioclase phenocrysts, but the MORB and Etna lavas do not. The isotopic heterogeneities reflect magma mixing, and indicate that isotopically diverse magmas were mixed together just prior to eruption. The results reinforce indications from melt inclusion studies that magma source region isotopic heterogeneities have large amplitudes at short length scales, and that the isotopic variations imparted to the magmas are not entirely homogenized during segregation and transport processes.

  17. Cancer stem cells: impact, heterogeneity, and uncertainty

    PubMed Central

    Magee, Jeffrey A.; Piskounova, Elena; Morrison, Sean J.

    2015-01-01

    The differentiation of tumorigenic cancer stem cells into non-tumorigenic cancer cells confers heterogeneity to some cancers beyond that explained by clonal evolution or environmental differences. In such cancers, functional differences between tumorigenic and non-tumorigenic cells influence response to therapy and prognosis. However, it remains uncertain whether the model applies to many, or few, cancers due to questions about the robustness of cancer stem cell markers and the extent to which existing assays underestimate the frequency of tumorigenic cells. In cancers with rapid genetic change, reversible changes in cell states, or biological variability among patients the stem cell model may not be readily testable. PMID:22439924

  18. Understanding as Integration of Heterogeneous Representations

    NASA Astrophysics Data System (ADS)

    Martínez, Sergio F.

    2014-03-01

    The search for understanding is a major aim of science. Traditionally, understanding has been undervalued in the philosophy of science because of its psychological underpinnings; nowadays, however, it is widely recognized that epistemology cannot be divorced from psychology as sharp as traditional epistemology required. This eliminates the main obstacle to give scientific understanding due attention in philosophy of science. My aim in this paper is to describe an account of scientific understanding as an emergent feature of our mastering of different (causal) explanatory frameworks that takes place through the mastering of scientific practices. Different practices lead to different kinds of representations. Such representations are often heterogeneous. The integration of such representations constitute understanding.

  19. Heterogeneity versus homogeneity of multiple sclerosis

    PubMed Central

    Sato, Fumitaka; Martinez, Nicholas E; Omura, Seiichi; Tsunoda, Ikuo

    2011-01-01

    The 10th International Congress of Neuroimmunology, including the 10th European School of Neuroimmunology Course, was held by the International Society of Neuroimmunology in Sitges (Barcelona, Spain) on 26–30 October 2010. The conference covered a wide spectrum of issues and challenges in both basic science and clinical aspects of neuroimmunology. Data and ideas were shared through a variety of programs, including review talks and poster sessions. One of the topics of the congress was whether multiple sclerosis is a homogenous or heterogenous disease, clinically and pathologically, throughout its course. PMID:21426254

  20. Term histologic chorioamnionitis: a heterogeneous condition.

    PubMed

    Conti, Nathalie; Torricelli, Michela; Voltolini, Chiara; Vannuccini, Silvia; Clifton, Vicky L; Bloise, Enrico; Petraglia, Felice

    2015-05-01

    A histologic response of histologic chorioamnionitis (HCA) is defined as an intrauterine inflammatory condition characterized by acute granulocyte infiltration into the fetal-maternal or the fetal tissues. Prevalence of HCA is inversely correlated with gestational age, occurring in 50% of preterm birth and in up to 20% of deliveries at term. Regardless of these standard definitions, understanding HCA is challenging as it reflects a heterogeneous condition. A histologic response of HCA from term placentas often does not correspond to a clinical presentation; in this context, the present review aims to analyze main characteristics of this condition, in particular focusing on mechanisms and birth outcomes. PMID:25770845

  1. Dual compile strategy for parallel heterogeneous execution.

    SciTech Connect

    Smith, Tyler Barratt; Perry, James Thomas

    2012-06-01

    The purpose of the Dual Compile Strategy is to increase our trust in the Compute Engine during its execution of instructions. This is accomplished by introducing a heterogeneous Monitor Engine that checks the execution of the Compute Engine. This leads to the production of a second and custom set of instructions designed for monitoring the execution of the Compute Engine at runtime. This use of multiple engines differs from redundancy in that one engine is working on the application while the other engine is monitoring and checking in parallel instead of both applications (and engines) performing the same work at the same time.

  2. Markovian Search Games in Heterogeneous Spaces

    SciTech Connect

    Griffin, Christopher H

    2009-01-01

    We consider how to search for a mobile evader in a large heterogeneous region when sensors are used for detection. Sensors are modeled using probability of detection. Due to environmental effects, this probability will not be constant over the entire region. We map this problem to a graph search problem and, even though deterministic graph search is NP-complete, we derive a tractable, optimal, probabilistic search strategy. We do this by defining the problem as a differential game played on a Markov chain. We prove that this strategy is optimal in the sense of Nash. Simulations of an example problem illustrate our approach and verify our claims.

  3. Nanoparticles for heterogeneous catalysis: new mechanistic insights.

    PubMed

    Schauermann, Swetlana; Nilius, Niklas; Shaikhutdinov, Shamil; Freund, Hans-Joachim

    2013-08-20

    Metallic nanoparticles finely dispersed over oxide supports have found use as heterogeneous catalysts in many industries including chemical manufacturing, energy-related applications and environmental remediation. The compositional and structural complexity of such nanosized systems offers many degrees of freedom for tuning their catalytic properties. However, fully rational design of heterogeneous catalysts based on an atomic-level understanding of surface processes remains an unattained goal in catalysis research. Researchers have used surface science methods and metal single crystals to explore elementary processes in heterogeneous catalysis. In this Account, we use more realistic materials that capture part of the complexity inherent to industrial catalysts. We assess the impacts on the overall catalytic performance of characteristics such as finite particle size, particle structure, particle chemical composition, flexibility of atoms in clusters, and metal-support interactions. To prepare these materials, we grew thin oxide films on metal single crystals under ultrahigh vacuum conditions and used these films as supports for metallic nanoparticles. We present four case studies on specifically designed materials with properties that expand our atomic-level understanding of surface chemistry. Specifically, we address (1) the effect of dopants in the oxide support on the growth of metal nanoclusters; (2) the effects of size and structural flexibility of metal clusters on the binding energy of gas-phase adsorbates and their catalytic activity; (3) the role of surface modifiers, such as carbon, on catalytic activity and selectivity; and (4) the structural and compositional changes of the active surface as a result of strong metal-support interaction. Using these examples, we demonstrate how studies of complex nanostructured materials can help revealing atomic processes at the solid-gas interface of heterogeneous catalysts. Among our findings is that doping of oxide

  4. Heterogeneously integrated microsystem-on-a-chip

    DOEpatents

    Chanchani, Rajen

    2008-02-26

    A microsystem-on-a-chip comprises a bottom wafer of normal thickness and a series of thinned wafers can be stacked on the bottom wafer, glued and electrically interconnected. The interconnection layer comprises a compliant dielectric material, an interconnect structure, and can include embedded passives. The stacked wafer technology provides a heterogeneously integrated, ultra-miniaturized, higher performing, robust and cost-effective microsystem package. The highly integrated microsystem package, comprising electronics, sensors, optics, and MEMS, can be miniaturized both in volume and footprint to the size of a bottle-cap or less.

  5. Invasion Threshold in Heterogeneous Metapopulation Networks

    NASA Astrophysics Data System (ADS)

    Colizza, Vittoria; Vespignani, Alessandro

    2007-10-01

    We study the dynamics of epidemic and reaction-diffusion processes in metapopulation models with heterogeneous connectivity patterns. In susceptible-infected-removed-like processes, along with the standard local epidemic threshold, the system exhibits a global invasion threshold. We provide an explicit expression of the threshold that sets a critical value of the diffusion/mobility rate below, which the epidemic is not able to spread to a macroscopic fraction of subpopulations. The invasion threshold is found to be affected by the topological fluctuations of the metapopulation network. The results presented provide a general framework for the understanding of the effect of travel restrictions in epidemic containment.

  6. Treatment of Organic Pollutants by Heterogeneous Photocatalysis

    NASA Astrophysics Data System (ADS)

    Feroz, S.; Jesil, A.

    2012-08-01

    An experimental investigation was carried out in the area of heterogeneous catalysis using TiO2 as a catalyst for the removal of the model organic compounds (benzoic acid and phenol) in three different photocatalytic reactors. Natural and artificial UV source of radiation were used and the performance of the reactors were studied in the present investigation. The extent of degradation/removal of the organic compounds was found by varying the initial concentration, flow rate, pipe diameter, TiO2 concentration and exposure time.

  7. [Neuromyelitis optica: problems of heterogeneity and systematization].

    PubMed

    Totolian, N A; Prakhova, L N; Sofienko, L Iu; Kataeva, G V; Il'ves, A G; Stoliarov, I D; Skoromets, A A

    2009-01-01

    Prospective-retrospective data on 10 cases of neuromyelitis optica (NO) have been analyzed. Demographic and clinical features of patients with primary NO as well as NO comorbid with other organospecific disorders are discussed. Magnetic-resonance imaging data of the brain and spinal cord are summarized and discussed in the context of its heterogeneity. Positron emission tomography with the functional imaging of the brain performed in 3 patients revealed changes in glucose metabolism in the brain regions corresponding to deficits in motor and sensory functional systems. The issues of additional laboratory analyses, including those of cerebrospinal fluid, are reviewed.

  8. Nuclear "waffles"

    NASA Astrophysics Data System (ADS)

    Schneider, A. S.; Berry, D. K.; Briggs, C. M.; Caplan, M. E.; Horowitz, C. J.

    2014-11-01

    Background: The dense neutron-rich matter found in supernovae and inside neutron stars is expected to form complex nonuniform phases, often referred to as nuclear pasta. The pasta shapes depend on density, temperature and proton fraction and determine many transport properties in supernovae and neutron star crusts. Purpose: To characterize the topology and compute two observables, the radial distribution function (RDF) g (r ) and the structure factor S (q ) , for systems with proton fractions Yp=0.10 ,0.20 ,0.30 , and 0.40 at about one-third of nuclear saturation density, n =0.050 fm-3 , and temperatures near k T =1 MeV . Methods: We use two recently developed hybrid CPU/GPU codes to perform large scale molecular dynamics (MD) simulations with 51 200 and 409 600 nucleons. From the output of the MD simulations we obtain the two desired observables. Results: We compute and discuss the differences in topology and observables for each simulation. We observe that the two lowest proton fraction systems simulated, Yp=0.10 and 0.20 , equilibrate quickly and form liquidlike structures. Meanwhile, the two higher proton fraction systems, Yp=0.30 and 0.40 , take a longer time to equilibrate and organize themselves in solidlike periodic structures. Furthermore, the Yp=0.40 system is made up of slabs, lasagna phase, interconnected by defects while the Yp=0.30 systems consist of a stack of perforated plates, the nuclear waffle phase. Conclusions: The periodic configurations observed in our MD simulations for proton fractions Yp≥0.30 have important consequences for the structure factors S (q ) of protons and neutrons, which relate to many transport properties of supernovae and neutron star crust. A detailed study of the waffle phase and how its structure depends on temperature, size of the simulation, and the screening length showed that finite-size effects appear to be under control and, also, that the plates in the waffle phase merge at temperatures slightly above 1.0 MeV and

  9. 75 FR 9956 - PSEG Nuclear LLC, Hope Creek Generating Station and Salem Nuclear Generating Station, Unit Nos. 1...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-04

    ... licensed activities in nuclear power reactors against radiological sabotage,'' published as part of a final... Implementation Date Pursuant to 10 CFR 73.55(a)(1), ``By March 31, 2010, each nuclear power reactor licensee... rule's compliance date for all operating nuclear power plants, but noted that the...

  10. Nuclear Fusion

    NASA Astrophysics Data System (ADS)

    Veres, G.

    This chapter is devoted to the fundamental concepts of nuclear fusion. To be more precise, it is devoted to the theoretical basics of fusion reactions between light nuclei such as hydrogen, helium, boron, and lithium. The discussion is limited because our purpose is to focus on laboratory-scale fusion experiments that aim at gaining energy from the fusion process. After discussing the methods of calculating the fusion cross section, it will be shown that sustained fusion reactions with energy gain must happen in a thermal medium because, in beam-target experiments, the energy of the beam is randomized faster than the fusion rate. Following a brief introduction to the elements of plasma physics, the chapter is concluded with the introduction of the most prominent fusion reactions ongoing in the Sun.

  11. NUCLEAR REACTOR

    DOEpatents

    Grebe, J.J.

    1959-12-15

    A reactor which is particularly adapted tu serve as a heat source for a nuclear powered alrcraft or rocket is described. The core of this reactor consists of a porous refractory modera;or body which is impregnated with fissionable nuclei. The core is designed so that its surface forms tapered inlet and outlet ducts which are separated by the porous moderator body. In operation a gaseous working fluid is circulated through the inlet ducts to the surface of the moderator, enters and passes through the porous body, and is heated therein. The hot gas emerges into the outlet ducts and is available to provide thrust. The principle advantage is that tremendous quantities of gas can be quickly heated without suffering an excessive pressure drop.

  12. NUCLEAR REACTOR

    DOEpatents

    Christy, R.F.

    1958-07-15

    A nuclear reactor of the homogeneous liquid fuel type is described wherein the fissionable isotope is suspended or dissolved in a liquid moderator such as water. The reactor core is comprised essentially of a spherical vessel for containing the reactive composition surrounded by a reflector, preferably of beryllium oxide. The reactive composition may be an ordinary water solution of a soluble salt of uranium, the quantity of fissionable isotope in solution being sufficient to provide a critical mass in the vessel. The liquid fuel is stored in a tank of non-crtttcal geometry below the reactor vessel and outside of the reflector and is passed from the tank to the vessel through a pipe connecting the two by air pressure means. Neutron absorbing control and safety rods are operated within slots in the reflector adjacent to the vessel.

  13. NUCLEAR REACTOR

    DOEpatents

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  14. Nuclear reactor

    DOEpatents

    Wade, Elman E.

    1979-01-01

    A nuclear reactor including two rotatable plugs and a positive top core holddown structure. The top core holddown structure is divided into two parts: a small core cover, and a large core cover. The small core cover, and the upper internals associated therewith, are attached to the small rotating plug, and the large core cover, with its associated upper internals, is attached to the large rotating plug. By so splitting the core holddown structures, under-the-plug refueling is accomplished without the necessity of enlarging the reactor pressure vessel to provide a storage space for the core holddown structure during refueling. Additionally, the small and large rotating plugs, and their associated core covers, are arranged such that the separation of the two core covers to permit rotation is accomplished without the installation of complex lifting mechanisms.

  15. Nuclear exoticism

    NASA Astrophysics Data System (ADS)

    Penionzhkevich, Yu. E.

    2016-07-01

    Extreme states of nuclearmatter (such that feature high spins, large deformations, high density and temperature, or a large excess of neutrons and protons) play an important role in studying fundamental properties of nuclei and are helpful in solving the problem of constructing the equation of state for nuclear matter. The synthesis of neutron-rich nuclei near the nucleon drip lines and investigation of their properties permit drawing conclusions about the positions of these boundaries and deducing information about unusual states of such nuclei and about their decays. At the present time, experimental investigations along these lines can only be performed via the cooperation of leading research centers that possess powerful heavy-ion accelerators, such as the Large Hadron Collider (LHC) at CERN and the heavy-ion cyclotrons at the Joint Institute for Nuclear Research (JINR, Dubna), where respective experiments are being conducted by physicists from about 20 JINR member countries. The present article gives a survey of the most recent results in the realms of super neutron-rich nuclei. Implications of the change in the structure of such nuclei near the nucleon drip lines are discussed. Information about the results obtained by measuring the masses (binding energies) of exotic nuclei, the nucleon-distribution radii (neutron halo) and momentum distributions in them, and their deformations and quantum properties is presented. It is shown that the properties of nuclei lying near the stability boundaries differ strongly from the properties of other nuclei. The problem of the stability of nuclei that is associated with the magic numbers of 20 and 28 is discussed along with the effect of new magic numbers.

  16. Heterogeneity of chromosome 17 and erbB-2 gene copy number in primary and metastatic bladder cancer

    SciTech Connect

    Sauter, G.; Mihatsch, M.J.; Gasser, T.C.

    1995-09-01

    To study the relationship of tumor genomic heterogeneity with bladder cancer phenotype and p53 gene alterations, 139 primary bladder tumors were examined by dual labeling fluorescence in situ hybridization (FISH) using probes for chromosome 17 centromere (p17H8) and p53 (17p13.1). The number of different aneusomic populations >5% (and monosomic populations >20%) of cells served as a marker for heterogeneity. Nuclear p53 overexpression and Ki67 labeling index (Ki67 LI) were determined by immunohistochemistry. The number of aneusomic populations was 0 in 53 tumors, 1 in 18, 2 in 47, 3 in 9, and >3 in 11 tumors. Presence of aneusomy was associated with tumor grade and stage (P < 0.0001 each). Ki67 LI was low in disomic tumors (11.0 {+-} 7.7), higher in tumors with 1-3 aneusomic populations (17.4 {+-} 11.3), and highest in tumors with >3 aneusomic populations (25.8 {+-} 10.9; P = 0.02 for >3 vs. 1-3 populations). Aneusomy and heterogeneity were associated with p53 alterations. Aneusomy was seen in 35% of tumors with neither p53 expression nor p53 deletion but in 97% of tumors with both p53 deletion and expression. Nine of 11 tumors with >3 aneusomic populations exhibited both p53 deletion and overexpression. To study genomic heterogeneity in tumor progression, two recurrences and three metastases of a tumor with known erbB-2 amplification were examined for centromere 17 and erbB-2 copy number. A considerable heterogeneity in centromere 17 and erbB-2 gene copy number was found in both recurrences and metastases, indicating a marked genomic instability in these metastatic cells. These results show that genomic heterogeneity is common in bladder cancer. Highly heterogeneous tumors might represent a particularly aggressive subtype of bladder carcinoma. 28 refs., 4 figs., 3 tabs.

  17. Deformation field heterogeneity in punch indentation

    PubMed Central

    Murthy, Tejas G.; Saldana, Christopher; Hudspeth, Matthew; M'Saoubi, Rachid

    2014-01-01

    Plastic heterogeneity in indentation is fundamental for understanding mechanics of hardness testing and impression-based deformation processing methods. The heterogeneous deformation underlying plane-strain indentation was investigated in plastic loading of copper by a flat punch. Deformation parameters were measured, in situ, by tracking the motion of asperities in high-speed optical imaging. These measurements were coupled with multi-scale analyses of strength, microstructure and crystallographic texture in the vicinity of the indentation. Self-consistency is demonstrated in description of the deformation field using the in situ mechanics-based measurements and post-mortem materials characterization. Salient features of the punch indentation process elucidated include, among others, the presence of a dead-metal zone underneath the indenter, regions of intense strain rate (e.g. slip lines) and extent of the plastic flow field. Perhaps more intriguing are the transitions between shear-type and compression-type deformation modes over the indentation region that were quantified by the high-resolution crystallographic texture measurements. The evolution of the field concomitant to the progress of indentation is discussed and primary differences between the mechanics of indentation for a rigid perfectly plastic material and a strain-hardening material are described. PMID:24910521

  18. Dynamic contact angle cycling homogenizes heterogeneous surfaces.

    PubMed

    Belibel, R; Barbaud, C; Mora, L

    2016-12-01

    In order to reduce restenosis, the necessity to develop the appropriate coating material of metallic stent is a challenge for biomedicine and scientific research over the past decade. Therefore, biodegradable copolymers of poly((R,S)-3,3 dimethylmalic acid) (PDMMLA) were prepared in order to develop a new coating exhibiting different custom groups in its side chain and being able to carry a drug. This material will be in direct contact with cells and blood. It consists of carboxylic acid and hexylic groups used for hydrophilic and hydrophobic character, respectively. The study of this material wettability and dynamic surface properties is of importance due to the influence of the chemistry and the potential motility of these chemical groups on cell adhesion and polymer kinetic hydrolysis. Cassie theory was used for the theoretical correction of contact angles of these chemical heterogeneous surfaces coatings. Dynamic Surface Analysis was used as practical homogenizer of chemical heterogeneous surfaces by cycling during many cycles in water. In this work, we confirmed that, unlike receding contact angle, advancing contact angle is influenced by the difference of only 10% of acidic groups (%A) in side-chain of polymers. It linearly decreases with increasing acidity percentage. Hysteresis (H) is also a sensitive parameter which is discussed in this paper. Finally, we conclude that cycling provides real information, thus avoiding theoretical Cassie correction. H(10)is the most sensible parameter to %A. PMID:27612817

  19. Resistance to change within heterogeneous response sequences.

    PubMed

    Reid, Alliston K

    2009-07-01

    Three experiments investigated how instrumental and Pavlovian contingencies contribute to resistance to change (RTC) in different ordinal response positions within heterogeneous response sequences in pigeons. RTC in the initial and terminal response positions of a three-response sequence were compared in Experiment 1, which presented three colored key lights in succession in each trial; and in Experiment 2, which severely degraded Pavlovian contingencies by presenting the lights simultaneously at each ordinal position. Experiment 3 eliminated the instrumental contingency in a high-order sign-tracking procedure. When the instrumental contingency was in effect, RTC of the initial position was greater than the terminal position (Initial RTC > Terminal RTC) when the Pavlovian contingencies were strong and when they were degraded. When the instrumental contingency was eliminated, RTC patterns reversed, producing a graded pattern of RTC (Initial < Middle < Terminal). Current theoretical approaches (e.g., behavioral momentum theory, conditioned reinforcement, and motivational control of instrumental conditioning) cannot account for these results. An alternative approach (a gradient model) shows that obtained measures of RTC in heterogeneous sequences may reflect a combination of three dissociable processes.

  20. Genetic heterogeneity in Pakistani microcephaly families.

    PubMed

    Sajid Hussain, M; Marriam Bakhtiar, S; Farooq, M; Anjum, I; Janzen, E; Reza Toliat, M; Eiberg, H; Kjaer, K W; Tommerup, N; Noegel, A A; Nürnberg, P; Baig, S M; Hansen, L

    2013-05-01

    Autosomal recessive primary microcephaly (MCPH) is caused by mutations in at least eight different genes involved either in cell division or DNA repair. Most mutations are identified in consanguine families from Pakistan, Iran and India. To further assess their genetic heterogeneity and mutational spectra, we have analyzed 57 consanguine Pakistani MCPH families. In 34 MCPH families, we detected linkage to five out of the eight well-characterized disease loci and identified mutations in 27 families, leaving seven families without mutations in the coding exons of the presumably underlying MCPH genes. In the MCPH cohort 23 families could not be linked to any of the known loci, pointing to remarkable locus heterogeneity. The majority of mutations were found in ASPM followed by WDR62, CENPJ, CEP152 and MCPH1. One ASPM mutation (p.Trp1326*) was found in as many as eight families suggesting a Pakistani founder mutation. One third of the families were linked to ASPM followed by WDR62 confirming previous data. We identified three novel ASPM mutations, four novel WDR62 mutations, one novel MCPH1 mutation and two novel CEP152 mutations. CEP152 mutations have not been described before in the Pakistani population.

  1. Collective action problem in heterogeneous groups.

    PubMed

    Gavrilets, Sergey

    2015-12-01

    I review the theoretical and experimental literature on the collective action problem in groups whose members differ in various characteristics affecting individual costs, benefits and preferences in collective actions. I focus on evolutionary models that predict how individual efforts and fitnesses, group efforts and the amount of produced collective goods depend on the group's size and heterogeneity, as well as on the benefit and cost functions and parameters. I consider collective actions that aim to overcome the challenges from nature or win competition with neighbouring groups of co-specifics. I show that the largest contributors towards production of collective goods will typically be group members with the highest stake in it or for whom the effort is least costly, or those who have the largest capability or initial endowment. Under some conditions, such group members end up with smaller net pay-offs than the rest of the group. That is, they effectively behave as altruists. With weak nonlinearity in benefit and cost functions, the group effort typically decreases with group size and increases with within-group heterogeneity. With strong nonlinearity in benefit and cost functions, these patterns are reversed. I discuss the implications of theoretical results for animal behaviour, human origins and psychology.

  2. Inferring tumor progression from genomic heterogeneity

    PubMed Central

    Navin, Nicholas; Krasnitz, Alexander; Rodgers, Linda; Cook, Kerry; Meth, Jennifer; Kendall, Jude; Riggs, Michael; Eberling, Yvonne; Troge, Jennifer; Grubor, Vladimir; Levy, Dan; Lundin, Pär; Månér, Susanne; Zetterberg, Anders; Hicks, James; Wigler, Michael

    2010-01-01

    Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We have developed a method we call Sector-Ploidy-Profiling (SPP) to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization (CGH). Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that heterogeneity can be ascribed to a few clonal subpopulations, rather than a series of gradual intermediates. By comparing multiple subpopulations from different anatomic locations, we have inferred pathways of cancer progression and the organization of tumor growth. PMID:19903760

  3. [Phenotypic heterogeneity of chronic obstructive pulmonary disease].

    PubMed

    Garcia-Aymerich, Judith; Agustí, Alvar; Barberà, Joan A; Belda, José; Farrero, Eva; Ferrer, Antoni; Ferrer, Jaume; Gáldiz, Juan B; Gea, Joaquim; Gómez, Federico P; Monsó, Eduard; Morera, Josep; Roca, Josep; Sauleda, Jaume; Antó, Josep M

    2009-03-01

    A functional definition of chronic obstructive pulmonary disease (COPD) based on airflow limitation has largely dominated the field. However, a view has emerged that COPD involves a complex array of cellular, organic, functional, and clinical events, with a growing interest in disentangling the phenotypic heterogeneity of COPD. The present review is based on the opinion of the authors, who have extensive research experience in several aspects of COPD. The starting assumption of the review is that current knowledge on the pathophysiology and clinical features of COPD allows us to classify phenotypic information in terms of the following dimensions: respiratory symptoms and health status, acute exacerbations, lung function, structural changes, local and systemic inflammation, and systemic effects. Twenty-six phenotypic traits were identified and assigned to one of the 6 dimensions. For each dimension, a summary is provided of the best evidence on the relationships among phenotypic traits, in particular among those corresponding to different dimensions, and on the relationship between these traits and relevant events in the natural history of COPD. The information has been organized graphically into a phenotypic matrix where each cell representing a pair of phenotypic traits is linked to relevant references. The information provided has the potential to increase our understanding of the heterogeneity of COPD phenotypes and help us plan future studies on aspects that are as yet unexplored.

  4. Spatial heterogeneity of daphniid parasitism within lakes.

    PubMed

    Hall, Spencer R; Duffy, Meghan A; Tessier, Alan J; Cáceres, Carla E

    2005-05-01

    Spatially explicit models show that local interactions of hosts and parasites can strongly influence invasion and persistence of parasites and can create lasting spatial patchiness of parasite distributions. These predictions have been supported by experiments conducted in two-dimensional landscapes. Yet, three-dimensional systems, such as lakes, ponds, and oceans, have received comparatively little attention from epidemiologists. Freshwater zooplankton hosts often aggregate horizontally and vertically in lakes, potentially leading to local host-parasite interactions in one-, two-, or three-dimensions. To evaluate the potential spatial component of daphniid parasitism driven by these local interactions (patchiness), we surveyed vertical and horizontal heterogeneity of pelagic Daphnia infected with multiple microparasites in several north temperate lakes. These surveys uncovered little evidence for persistent vertical patchiness of parasitism, since the prevalence of two parasites showed little consistent trend with depth in four lakes (but more heterogeneity during day than at night). On a horizontal scale of tens of meters, we found little systematic evidence of strong aggregation and spatial patterning of daphniid hosts and parasites. Yet, we observed broad-scale, basin-wide patterns of parasite prevalence. These patterns suggest that nearshore offshore gradients, rather than local-scale interactions, could play a role in governing epidemiology of this open water host-parasite system.

  5. Heterogeneous chemistry in the atmosphere of Mars.

    PubMed

    Lefèvre, Franck; Bertaux, Jean-Loup; Clancy, R Todd; Encrenaz, Thérèse; Fast, Kelly; Forget, François; Lebonnois, Sébastien; Montmessin, Franck; Perrier, Séverine

    2008-08-21

    Hydrogen radicals are produced in the martian atmosphere by the photolysis of water vapour and subsequently initiate catalytic cycles that recycle carbon dioxide from its photolysis product carbon monoxide. These processes provide a qualitative explanation for the stability of the atmosphere of Mars, which contains 95 per cent carbon dioxide. Balancing carbon dioxide production and loss based on our current understanding of the gas-phase chemistry in the martian atmosphere has, however, proven to be difficult. Interactions between gaseous chemical species and ice cloud particles have been shown to be key factors in the loss of polar ozone observed in the Earth's stratosphere, and may significantly perturb the chemistry of the Earth's upper troposphere. Water-ice clouds are also commonly observed in the atmosphere of Mars and it has been suggested previously that heterogeneous chemistry could have an important impact on the composition of the martian atmosphere. Here we use a state-of-the-art general circulation model together with new observations of the martian ozone layer to show that model simulations that include chemical reactions occurring on ice clouds lead to much improved quantitative agreement with observed martian ozone levels in comparison with model simulations based on gas-phase chemistry alone. Ozone is readily destroyed by hydrogen radicals and is therefore a sensitive tracer of the chemistry that regulates the atmosphere of Mars. Our results suggest that heterogeneous chemistry on ice clouds plays an important role in controlling the stability and composition of the martian atmosphere.

  6. Genetic heterogeneity of familial hemiplegic migraine

    SciTech Connect

    Joutel, A.; Ducros, A.; Vahedi, K.

    1994-09-01

    Familial hemiplegic migraine (FHM) is an autosomal dominant subtype of migraine with aura, characterized by the occurrence of a transient hemiplegia during the aura. We previously mapped the affected gene to the short arm of chromosome 19, within a 30 cM interval bracketed by D19S216 and D19S215. Linkage analysis conducted on 2 large FHM pedigrees did not show evidence of heterogeneity, despite their clinical differences due to the presence in one family of a cerebellar ataxia and a nystagmus. Herein we report linkage data on 9 additional FHM families including 2 other ones with cerebellar ataxia. Analysis was conducted with a set of 7 markers spanning the D19S216-D19S215 interval. Two point and multipoint lodscores analysis as well as HOMOG testing provided significant evidence for genetic heterogenity. Strong evidence of linkage was obtained in 3 families and absence of linkage in 6 families. Thus within the 11 families so far tested, 5 were linked, including those with an associated cerebellar ataxia. We could not find any clinical difference between the {open_quotes}pure{close_quotes} FHM families whether or not they were linked. This study also allowed us to establish that the most likely location of the gene is a 12 cM interval bracketed by D19S413 and D19S226. One of the unlinked family was large enough to conduct genetic mapping of the affected gene. Data will be presented at the meeting.

  7. Genetic heterogeneity of familial hemiplegic migraine

    SciTech Connect

    Ophoff, R.A.; Van Eijk, R.; Sandkuijl, L.A.

    1994-07-01

    Familial hemiplegic migraine (FHM) is a distinctive form of migraine with an autosomal dominant mode of inheritance. The migraine-like attacks are associated with transient hemiparesis. A locus for FHM has recently been assigned to chromosome 19 by linkage mapping. In the present study, five unrelated pedigrees with multiple members suffering from hemiplegic migraine were investigated. In two of the pedigrees additional symptoms, cerebellar ataxia and benign neonatal convulsions, respectively, were observed in affected members. Three pedigrees showed linkage to loci D19S391, D19S221, and D19S226 at chromosome 19p13. Haplotyping suggested a location of a FHM gene between D19S391 and D19S221. In the two remaining families, evidence against linkage was found. These results confirm the localization of a gene for familial hemiplegic migraine to the short arm of chromosome 19, but locus heterogeneity not corresponding to the observed clinical heterogeneity is likely to exist. 19 refs., 3 figs., 3 tabs.

  8. Host heterogeneity dominates West Nile virus transmission

    PubMed Central

    Marm Kilpatrick, A; Daszak, Peter; Jones, Matthew J; Marra, Peter P; Kramer, Laura D

    2006-01-01

    Heterogeneity in host populations and communities can have large effects on the transmission and control of a pathogen. In extreme cases, a few individuals give rise to the majority of secondary infections, which have been termed super spreading events. Here, we show that transmission of West Nile virus (WNV) is dominated by extreme heterogeneity in the host community, resulting in highly inflated reproductive ratios. A single relatively uncommon avian species, American robin (Turdus migratorius), appeared to be responsible for the majority of WNV-infectious mosquitoes and acted as the species equivalent of a super spreader for this multi-host pathogen. Crows were also highly preferred by mosquitoes at some sites, while house sparrows were significantly avoided. Nonetheless, due to their relative rarity, corvids (crows and jays) were relatively unimportant in WNV amplification. These results challenge current beliefs about the role of certain avian species in WNV amplification and demonstrate the importance of determining contact rates between vectors and host species to understand pathogen transmission dynamics. PMID:16928635

  9. Dynamic Heterogeneity in Interacting Miscible Polymer Blends

    NASA Astrophysics Data System (ADS)

    Gaikwad, Ashish; Lodge, Timothy

    2008-03-01

    Dynamic heterogeneity leading to time-temperature superposition (tTS) failure has been widely reported in non-interacting/weakly interacting miscible polymer blends. However, coupling of the component dynamic response in blends, even with a huge dynamic asymmetry in the pure components, is possible with H-bonding interactions. This study is focused on finding the minimum level of interaction necessary for thermo-rheological simplicity in blends. Blends of styrene-co-vinylphenol (PSVPh) and poly(vinyl methyl ether) (PVME) were chosen. Incorporation of styrene provides an effective way to modulate H-bonding interactions in the system. Linear viscoelastic data indicate that tTS fails for PS/PVME blends, whereas data obtained for different PVPh/PVME blends showed that tTS was obeyed a over wide temperature range. For PSVPh/PVME blends with low PSVPh content, tTS was successful. This suggests that the presence of alternating styrene and vinyl phenol units was insufficient for dynamic response decoupling. Further studies are in progress, with varying vinyl phenol content in PSVPh, to explore the influence of H-bonding on dynamic heterogeneity and blend dynamics.

  10. Integrating data from heterogeneous DNA microarray platforms.

    PubMed

    Valente, Eduardo; Rocha, Miguel

    2015-01-01

    DNA microarrays are one of the most used technologies for gene expression measurement. However, there are several distinct microarray platforms, from different manufacturers, each with its own measurement protocol, resulting in data that can hardly be compared or directly integrated. Data integration from multiple sources aims to improve the assertiveness of statistical tests, reducing the data dimensionality problem. The integration of heterogeneous DNA microarray platforms comprehends a set of tasks that range from the re-annotation of the features used on gene expression, to data normalization and batch effect elimination. In this work, a complete methodology for gene expression data integration and application is proposed, which comprehends a transcript-based re-annotation process and several methods for batch effect attenuation. The integrated data will be used to select the best feature set and learning algorithm for a brain tumor classification case study. The integration will consider data from heterogeneous Agilent and Affymetrix platforms, collected from public gene expression databases, such as The Cancer Genome Atlas and Gene Expression Omnibus. PMID:26673932

  11. Visual EKF-SLAM from Heterogeneous Landmarks.

    PubMed

    Esparza-Jiménez, Jorge Othón; Devy, Michel; Gordillo, José L

    2016-04-07

    Many applications require the localization of a moving object, e.g., a robot, using sensory data acquired from embedded devices. Simultaneous localization and mapping from vision performs both the spatial and temporal fusion of these data on a map when a camera moves in an unknown environment. Such a SLAM process executes two interleaved functions: the front-end detects and tracks features from images, while the back-end interprets features as landmark observations and estimates both the landmarks and the robot positions with respect to a selected reference frame. This paper describes a complete visual SLAM solution, combining both point and line landmarks on a single map. The proposed method has an impact on both the back-end and the front-end. The contributions comprehend the use of heterogeneous landmark-based EKF-SLAM (the management of a map composed of both point and line landmarks); from this perspective, the comparison between landmark parametrizations and the evaluation of how the heterogeneity improves the accuracy on the camera localization, the development of a front-end active-search process for linear landmarks integrated into SLAM and the experimentation methodology.

  12. Inferring tumor progression from genomic heterogeneity.

    PubMed

    Navin, Nicholas; Krasnitz, Alexander; Rodgers, Linda; Cook, Kerry; Meth, Jennifer; Kendall, Jude; Riggs, Michael; Eberling, Yvonne; Troge, Jennifer; Grubor, Vladimir; Levy, Dan; Lundin, Pär; Månér, Susanne; Zetterberg, Anders; Hicks, James; Wigler, Michael

    2010-01-01

    Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We have developed a method we call Sector-Ploidy-Profiling (SPP) to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization (CGH). Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that heterogeneity can be ascribed to a few clonal subpopulations, rather than a series of gradual intermediates. By comparing multiple subpopulations from different anatomic locations, we have inferred pathways of cancer progression and the organization of tumor growth.

  13. Visual EKF-SLAM from Heterogeneous Landmarks.

    PubMed

    Esparza-Jiménez, Jorge Othón; Devy, Michel; Gordillo, José L

    2016-01-01

    Many applications require the localization of a moving object, e.g., a robot, using sensory data acquired from embedded devices. Simultaneous localization and mapping from vision performs both the spatial and temporal fusion of these data on a map when a camera moves in an unknown environment. Such a SLAM process executes two interleaved functions: the front-end detects and tracks features from images, while the back-end interprets features as landmark observations and estimates both the landmarks and the robot positions with respect to a selected reference frame. This paper describes a complete visual SLAM solution, combining both point and line landmarks on a single map. The proposed method has an impact on both the back-end and the front-end. The contributions comprehend the use of heterogeneous landmark-based EKF-SLAM (the management of a map composed of both point and line landmarks); from this perspective, the comparison between landmark parametrizations and the evaluation of how the heterogeneity improves the accuracy on the camera localization, the development of a front-end active-search process for linear landmarks integrated into SLAM and the experimentation methodology. PMID:27070602

  14. Heterogeneous Participant Recruitment for Comprehensive Vehicle Sensing

    PubMed Central

    Liu, Yazhi; Li, Xiong

    2015-01-01

    Widely distributed mobile vehicles wherein various sensing devices and wireless communication interfaces are installed bring vehicular participatory sensing into practice. However, the heterogeneity of vehicles in terms of sensing capability and mobility, and the participants’ expectations on the incentives blackmake the collection of comprehensive sensing data a challenging task. A sensing data quality-oriented optimal heterogeneous participant recruitment strategy is proposed in this paper for vehicular participatory sensing. In the proposed strategy, the differences between the sensing data requirements and the collected sensing data are modeled. An optimization formula is established to model the optimal participant recruitment problem, and a participant utility analysis scheme is built based on the sensing and mobility features of vehicles. Besides, a greedy algorithm is then designed according to the utility of vehicles to recruit the most efficient vehicles with a limited total incentive budget. Real trace-driven simulations show that the proposed strategy can collect 85.4% of available sensing data with 34% incentive budget. PMID:26407102

  15. Resistance to change within heterogeneous response sequences.

    PubMed

    Reid, Alliston K

    2009-07-01

    Three experiments investigated how instrumental and Pavlovian contingencies contribute to resistance to change (RTC) in different ordinal response positions within heterogeneous response sequences in pigeons. RTC in the initial and terminal response positions of a three-response sequence were compared in Experiment 1, which presented three colored key lights in succession in each trial; and in Experiment 2, which severely degraded Pavlovian contingencies by presenting the lights simultaneously at each ordinal position. Experiment 3 eliminated the instrumental contingency in a high-order sign-tracking procedure. When the instrumental contingency was in effect, RTC of the initial position was greater than the terminal position (Initial RTC > Terminal RTC) when the Pavlovian contingencies were strong and when they were degraded. When the instrumental contingency was eliminated, RTC patterns reversed, producing a graded pattern of RTC (Initial < Middle < Terminal). Current theoretical approaches (e.g., behavioral momentum theory, conditioned reinforcement, and motivational control of instrumental conditioning) cannot account for these results. An alternative approach (a gradient model) shows that obtained measures of RTC in heterogeneous sequences may reflect a combination of three dissociable processes. PMID:19594277

  16. MULTIGRID HOMOGENIZATION OF HETEROGENEOUS POROUS MEDIA

    SciTech Connect

    Dendy, J.E.; Moulton, J.D.

    2000-10-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL); this report, however, reports on only two years research, since this project was terminated at the end of two years in response to the reduction in funding for the LDRD Program at LANL. The numerical simulation of flow through heterogeneous porous media has become a vital tool in forecasting reservoir performance, analyzing groundwater supply and predicting the subsurface flow of contaminants. Consequently, the computational efficiency and accuracy of these simulations is paramount. However, the parameters of the underlying mathematical models (e.g., permeability, conductivity) typically exhibit severe variations over a range of significantly different length scales. Thus the numerical treatment of these problems relies on a homogenization or upscaling procedure to define an approximate coarse-scale problem that adequately captures the influence of the fine-scale structure, with a resultant compromise between the competing objectives of computational efficiency and numerical accuracy. For homogenization in models of flow through heterogeneous porous media, We have developed new, efficient, numerical, multilevel methods, that offer a significant improvement in the compromise between accuracy and efficiency. We recently combined this approach with the work of Dvorak to compute bounded estimates of the homogenized permeability for such flows and demonstrated the effectiveness of this new algorithm with numerical examples.

  17. Heterogeneous information-based artificial stock market

    NASA Astrophysics Data System (ADS)

    Pastore, S.; Ponta, L.; Cincotti, S.

    2010-05-01

    In this paper, an information-based artificial stock market is considered. The market is populated by heterogeneous agents that are seen as nodes of a sparsely connected graph. Agents trade a risky asset in exchange for cash. Besides the amount of cash and assets owned, each agent is characterized by a sentiment. Moreover, agents share their sentiments by means of interactions that are identified by the graph. Interactions are unidirectional and are supplied with heterogeneous weights. The agent's trading decision is based on sentiment and, consequently, the stock price process depends on the propagation of information among the interacting agents, on budget constraints and on market feedback. A central market maker (clearing house mechanism) determines the price process at the intersection of the demand and supply curves. Both closed- and open-market conditions are considered. The results point out the validity of the proposed model of information exchange among agents and are helpful for understanding the role of information in real markets. Under closed market conditions, the interaction among agents' sentiments yields a price process that reproduces the main stylized facts of real markets, e.g. the fat tails of the returns distributions and the clustering of volatility. Within open-market conditions, i.e. with an external cash inflow that results in asset price inflation, also the unitary root stylized fact is reproduced by the artificial stock market. Finally, the effects of model parameters on the properties of the artificial stock market are also addressed.

  18. Heterogeneous photocatalytic reactions of sulfur aromatic compounds.

    PubMed

    Samokhvalov, Alexander

    2011-11-18

    Sulfur aromatic compounds, such as mono-, di-, tri-, and tetraalkyl-substituted thiophene, benzothiophenes, dibenzothiophenes, are the molecular components of many fossils (petroleum, oil shale, tar sands, bitumen). Structural units of natural, cross-linked heteroaromatic polymers present in brown coals, turf, and soil are similar to those of sulfur aromatic compounds. Many sulfur aromatic compounds are found in the streams of petroleum refining and upgrading (naphthas, gas oils) and in the consumer products (gasoline, diesel, jet fuels, heating fuels). Besides fossils, the structural fragments of sulfur aromatic compounds are present in molecules of certain organic semiconductors, pesticides, small molecule drugs, and in certain biomolecules present in human body (pheomelanin pigments). Photocatalysis is the frontier area of physical chemistry that studies chemical reactions initiated by absorption of photons by photocatalysts, that is, upon electronic rather than thermal activation, under "green" ambient conditions. This review provides systematization and critical review of the fundamental chemical and physicochemical information on heterogeneous photocatalysis of sulfur aromatic compounds accumulated in the last 20-30 years. Specifically, the following topics are covered: physicochemical properties of sulfur aromatic compounds, major classes of heterogeneous photocatalysts, mechanisms and reactive intermediates of photocatalytic reactions of sulfur aromatic compounds, and the selectivity of these reactions. Quantum chemical calculations of properties and structures of sulfur aromatic compounds, their reactive intermediates, and the structure of adsorption complexes formed on the surface of the photocatalysts are also discussed.

  19. Characterizing hydrogeologic heterogeneity using lithologic data

    SciTech Connect

    Flach, G.P.; Hamm, L.L.; Harris, M.K.; Thayer, P.A.; Haselow, J.S.; Smits, A.D.

    1995-12-31

    Large-scale (> 1 m) variability in hydraulic conductivity is usually the main influence on field-scale groundwater flow patterns and dispersive transport. Sediment lithologic descriptions and geophysical logs typically offer finer spatial resolution, and therefore more potential information about site-scale heterogeneity, than other site characterization data. In this study, a technique for generating a heterogeneous, three-dimensional hydraulic conductivity field from sediment lithologic descriptions is presented. The approach involves creating a three-dimensional, fine-scale representation of mud (silt + clay) percentage using a stratified interpolation algorithm. Mud percentage is then translated into horizontal and vertical conductivity using direct correlations derived from measured data and inverse groundwater flow modeling. Lastly, the fine-scale conductivity fields are averaged to create a coarser grid for use in groundwater flow and transport modeling. The approach is demonstrated using a finite-element groundwater flow model of a Savannah River Site solid radioactive and hazardous waste burial ground. Hydrostratigraphic units in the area consist of fluvial, deltaic, and shallow marine sand, mud and calcareous sediment that exhibit abrupt facies changes over short distances.

  20. Heterogeneous nucleation of aspartame from aqueous solutions

    NASA Astrophysics Data System (ADS)

    Kubota, Noriaki; Kinno, Hiroaki; Shimizu, Kenji

    1990-03-01

    Waiting times, the time from the instant of quenching needed for a first nucleus to appear, were measured at constant supercoolings for primary nucleation of aspartame (α-L-aspartyl-L-phenylalanine methylester) from aqueous solutions, which were sealed into glass ampoules (solution volume = 3.16 cm 3). Since the waiting time became shorter by filtering the solution prior to quenching, the nucleation was concluded to be heterogeneously induced. The measured waiting time consisted of two parts: time needed for the nucleus to grow to a detactable size (growth time) and stochastic time needed for nucleation (true waiting time). The distribution of the true waiting time, is well explained by a stochastic model, in which nucleation is regarded to occur heterogeneously and in a stochastic manner by two kinds of active sites. The active sites are estimated to be located on foreign particles in which such elements as Si, Al and Mg were contained. The amount of each element is very small in the order of magnitude of ppb (mass basis) of the whole solution. The growth time was correlated with the degree of supercooling.