Science.gov

Sample records for a1 heterogeneous nuclear

  1. Camptothecin (CPT) directly binds to human heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) and inhibits the hnRNP A1/topoisomerase I interaction.

    PubMed

    Manita, Daisuke; Toba, Yuzuru; Takakusagi, Yoichi; Matsumoto, Yuki; Kusayanagi, Tomoe; Takakusagi, Kaori; Tsukuda, Senko; Takada, Kazunori; Kanai, Yoshihiro; Kamisuki, Shinji; Sakaguchi, Kengo; Sugawara, Fumio

    2011-12-15

    Camptothecin (CPT) is an anti-tumor natural product that forms a ternary complex with topoisomerase I (top I) and DNA (CPT-top I-DNA). In this study, we identified the direct interaction between CPT and human heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) using the T7 phage display technology. On an avidin-agarose bead pull down assay, hnRNP A1 protein was selectively pulled down in the presence of C20-biotinylated CPT derivative (CPT-20-B) both in vitro and in vivo. The interaction was also confirmed by an analysis on a quartz-crystal microbalance (QCM) device, yielding a K(D) value of 82.7 nM. A surface plasmon resonance (SPR) analysis revealed that CPT inhibits the binding of hnRNP A1 to top I (K(D): 260 nM) in a non-competitive manner. Moreover, an in vivo drug evaluation assay using Drosophila melanogaster showed that the knockout of the hnRNP A1 homolog Hrb87F gene showed high susceptibility against 5-50 μM of CPT as compared to a wild-type strain. Such susceptibility was specific for CPT and not observed after treatment with other cytotoxic drugs. Collectively, our data suggests that CPT directly binds to hnRNP A1 and non-competitively inhibits the hnRNP A1/top I interaction in vivo. The knockout strain loses the hnRNP A1 homolog as a both CPT-binding partner and naïve brakes of top I, which enhances the formation of the CPT-top I-DNA ternary complexes and subsequently sensitizes the growth inhibitory effect of CPT in D. melanogaster. PMID:22071521

  2. Human Immunodeficiency Virus Type 1 (HIV-1) Induces the Cytoplasmic Retention of Heterogeneous Nuclear Ribonucleoprotein A1 by Disrupting Nuclear Import

    PubMed Central

    Monette, Anne; Ajamian, Lara; López-Lastra, Marcelo; Mouland, Andrew J.

    2009-01-01

    Human immunodeficiency virus type 1 (HIV-1) co-opts host proteins and cellular machineries to its advantage at every step of the replication cycle. Here we show that HIV-1 enhances heterogeneous nuclear ribonucleoprotein (hnRNP) A1 expression and promotes the relocalization of hnRNP A1 to the cytoplasm. The latter was dependent on the nuclear export of the unspliced viral genomic RNA (vRNA) and to alterations in the abundance and localization of the FG-repeat nuclear pore glycoprotein p62. hnRNP A1 and vRNA remain colocalized in the cytoplasm supporting a post-nuclear function during the late stages of HIV-1 replication. Consistently, we show that hnRNP A1 acts as an internal ribosomal entry site trans-acting factor up-regulating internal ribosome entry site-mediated translation initiation of the HIV-1 vRNA. The up-regulation and cytoplasmic retention of hnRNP A1 by HIV-1 would ensure abundant expression of viral structural proteins in cells infected with HIV-1. PMID:19737937

  3. The Drosophila Hrb98DE locus encodes four protein isoforms homologous to the A1 protein of mammalian heterogeneous nuclear ribonucleoprotein complexes.

    PubMed Central

    Haynes, S R; Raychaudhuri, G; Beyer, A L

    1990-01-01

    The Drosophila Hrb98DE locus encodes proteins that are highly homologous to the mammalian A1 protein, a major component of heterogeneous nuclear ribonucleoprotein (RNP) particles. The Hrb98DE locus is transcribed throughout development, with the highest transcript levels found in ovaries, early embryos, and pupae. Eight different transcripts are produced by the use of combinations of alternative promoters, exons, and splice acceptor sites; the various species are not all equally abundant. The 3'-most exon is unusual in that it is completely noncoding. These transcripts can potentially generate four protein isoforms that differ in their N-terminal 16 to 21 amino acids but are identical in the remainder of the protein, including the RNP consensus motif domain and the glycine-rich domain characteristic of the mammalian A1 protein. We suggest that these sequence differences could affect the affinities of the proteins for RNA or other protein components of heterogeneous nuclear RNP complexes, leading to differences in function. Images PMID:2104660

  4. Facilitation of hammerhead ribozyme catalysis by the nucleocapsid protein of HIV-1 and the heterogeneous nuclear ribonucleoprotein A1.

    PubMed Central

    Bertrand, E L; Rossi, J J

    1994-01-01

    In order to improve the activity of hammerhead ribozymes in vivo, we have analyzed the effect of several prototypical RNA binding proteins on the ribozyme cleavage reaction: bacteriophage T4 gene 32 protein (gp32), hnRNP A1 (A1) and the nucleocapsid protein of HIV-1 (NCp7). We show that, while gp32 has no effect on the cleavage reaction, A1 and NCp7 affect different steps of the reaction. Moreover, some of these effects depend upon the ribozyme-substrate hybrid length. A1 and NCp7 inhibit the reaction of the least stable ribozyme-substrate complexes, which have 12 bp of duplex. NCp7, but not A1, inhibits the cleavage of substrates that have long ribozyme-substrate duplexes (17 or 20 bp), while cleavage of complexes having shorter duplexes (13 or 14 bp) is not affected. NCp7 and A1 enhance the turnover of ribozymes by increasing the rate of product dissociation, but only when both cleavage products are bound with < or = 7 bp. A1 and NCp7 enhance ribozyme binding to long substrates, such as mRNAs, the structure of which otherwise limits ribozyme binding. Therefore, the effects of A1 or NCp7 on the different steps of the cleavage reaction define a length of the ribozyme-substrate duplex which allows enhancement of the rate of binding and product release without inhibiting the cleavage step. Interestingly, this duplex length (14 bases, or 7 on each side of the cleavage site) is identical for A1 and NCp7. Since A1 is thought to interact with most, if not all mRNAs in vivo, it may enhance the intracellular activity of ribozymes targeted against any mRNA.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8026475

  5. Heterogeneous nuclear ribonucleoproteins A1 and A2 modulate expression of Tid1 isoforms and EGFR signaling in non-small cell lung cancer

    PubMed Central

    Chen, Chi-Yuan; Jan, Chia-Ing; Pi, Wen-Chieh; Wang, Wen-Lung; Yang, Pan-Chyr; Wang, Tong-Hong; Karni, Rotem; Wang, Tzu-Chien V.

    2016-01-01

    The Tid1 protein is a DnaJ co-chaperone that has two alternative splicing isoforms: Tid1 long form (Tid1-L) and Tid1 short form (Tid1-S). Recent studies have shown that Tid1-L functions as a tumor suppressor by decreasing EGFR signaling in various cancers, including head and neck cancer and non-small cell lung cancer (NSCLC). However, the molecular mechanism responsible for regulating the alternative splicing of Tid1 is not yet known. Two splicing factors, heterogeneous nuclear ribonucleoproteins (hnRNP) A1 and A2, participate in alternative splicing and are known to be overexpressed in lung cancers. In this work, we examined if hnRNP A1 and A2 could regulate the alternative splicing of Tid1 to modulate tumorigenesis in NSCLC. We report that RNAi-mediated depletion of both hnRNP A1/A2 (but not single depletion of either) increased Tid1-L expression, inhibited cell proliferation and attenuated EGFR signaling. Analyses of the expression levels of hnRNP A1, hnRNP A2, EGFR and Tid1-L in NSCLC tissues revealed that hnRNP A1 and A2 are positively correlated with EGFR, but negatively correlated with Tid1-L. NSCLC patients with high-level expression of hnRNP A1, hnRNP A2 and EGFR combined with low-level expression of Tid1-L were associated with poor overall survival. Taken together, our results suggest that hnRNP A1 or A2 are both capable of facilitating the alternative splicing of exon 11 in the Tid1 pre-mRNA, thereby suppressing the expression of Tid1-L and allowing EGFR-related signaling to facilitate NSCLC tumorigenesis. PMID:26919236

  6. Heterogeneous nuclear ribonucleoproteins A1 and A2 modulate expression of Tid1 isoforms and EGFR signaling in non-small cell lung cancer.

    PubMed

    Chen, Chi-Yuan; Jan, Chia-Ing; Pi, Wen-Chieh; Wang, Wen-Lung; Yang, Pan-Chyr; Wang, Tong-Hong; Karni, Rotem; Wang, Tzu-Chien V

    2016-03-29

    The Tid1 protein is a DnaJ co-chaperone that has two alternative splicing isoforms: Tid1 long form (Tid1-L) and Tid1 short form (Tid1-S). Recent studies have shown that Tid1-L functions as a tumor suppressor by decreasing EGFR signaling in various cancers, including head and neck cancer and non-small cell lung cancer (NSCLC). However, the molecular mechanism responsible for regulating the alternative splicing of Tid1 is not yet known. Two splicing factors, heterogeneous nuclear ribonucleoproteins (hnRNP) A1 and A2, participate in alternative splicing and are known to be overexpressed in lung cancers. In this work, we examined if hnRNP A1 and A2 could regulate the alternative splicing of Tid1 to modulate tumorigenesis in NSCLC. We report that RNAi-mediated depletion of both hnRNP A1/A2 (but not single depletion of either) increased Tid1-L expression, inhibited cell proliferation and attenuated EGFR signaling. Analyses of the expression levels of hnRNP A1, hnRNP A2, EGFR and Tid1-L in NSCLC tissues revealed that hnRNP A1 and A2 are positively correlated with EGFR, but negatively correlated with Tid1-L. NSCLC patients with high-level expression of hnRNP A1, hnRNP A2 and EGFR combined with low-level expression of Tid1-L were associated with poor overall survival. Taken together, our results suggest that hnRNP A1 or A2 are both capable of facilitating the alternative splicing of exon 11 in the Tid1 pre-mRNA, thereby suppressing the expression of Tid1-L and allowing EGFR-related signaling to facilitate NSCLC tumorigenesis. PMID:26919236

  7. Solution Structure of the HIV-1 Intron Splicing Silencer and Its Interactions with the UP1 Domain of Heterogeneous Nuclear Ribonucleoprotein (hnRNP) A1.

    PubMed

    Jain, Niyati; Morgan, Christopher E; Rife, Brittany D; Salemi, Marco; Tolbert, Blanton S

    2016-01-29

    Splicing patterns in human immunodeficiency virus type 1 (HIV-1) are maintained through cis regulatory elements that recruit antagonistic host RNA-binding proteins. The activity of the 3' acceptor site A7 is tightly regulated through a complex network of an intronic splicing silencer (ISS), a bipartite exonic splicing silencer (ESS3a/b), and an exonic splicing enhancer (ESE3). Because HIV-1 splicing depends on protein-RNA interactions, it is important to know the tertiary structures surrounding the splice sites. Herein, we present the NMR solution structure of the phylogenetically conserved ISS stem loop. ISS adopts a stable structure consisting of conserved UG wobble pairs, a folded 2X2 (GU/UA) internal loop, a UU bulge, and a flexible AGUGA apical loop. Calorimetric and biochemical titrations indicate that the UP1 domain of heterogeneous nuclear ribonucleoprotein A1 binds the ISS apical loop site-specifically and with nanomolar affinity. Collectively, this work provides additional insights into how HIV-1 uses a conserved RNA structure to commandeer a host RNA-binding protein. PMID:26607354

  8. Chemical proteomics identifies heterogeneous nuclear ribonucleoprotein (hnRNP) A1 as the molecular target of quercetin in its anti-cancer effects in PC-3 cells.

    PubMed

    Ko, Chia-Chen; Chen, Yun-Ju; Chen, Chih-Ta; Liu, Yu-Chih; Cheng, Fong-Chi; Hsu, Kai-Chao; Chow, Lu-Ping

    2014-08-01

    Quercetin, a flavonoid abundantly present in plants, is widely used as a phytotherapy in prostatitis and prostate cancer. Although quercetin has been reported to have a number of therapeutic effects, the cellular target(s) responsible for its anti-cancer action has not yet been clearly elucidated. Here, employing affinity chromatography and mass spectrometry, we identified heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) as a direct target of quercetin. A specific interaction between quercetin and hnRNPA1 was validated by immunoblotting and in vitro binding experiments. We found that quercetin bound the C-terminal region of hnRNPA1, impairing the ability of hnRNPA1 to shuttle between the nucleus and cytoplasm and ultimately resulting in its cytoplasmic retention. In addition, hnRNPA1 was recruited to stress granules after treatment of cells with quercetin for up to 48 h, and the levels of cIAP1 (cellular inhibitor of apoptosis), an internal ribosome entry site translation-dependent protein, were reduced by hnRNPA1 regulation. This is the first report that anti-cancer effects of quercetin are mediated, in part, by impairing functions of hnRNPA1, insights that were obtained using a chemical proteomics strategy. PMID:24962584

  9. Antibodies to the RNA Binding Protein Heterogeneous Nuclear Ribonucleoprotein A1 Colocalize to Stress Granules Resulting in Altered RNA and Protein Levels in a Model of Neurodegeneration in Multiple Sclerosis

    PubMed Central

    Douglas, Joshua N.; Gardner, Lidia A.; Salapa, Hannah E; Levin, Michael C.

    2016-01-01

    Objective Multiple sclerosis (MS) is the most common demyelinating disorder of the central nervous system (CNS). Data suggest that antibodies to CNS targets contribute to the pathogenesis of MS. MS patients produce autoantibodies to heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1). hnRNP A1 is an RNA binding protein (RBP) overexpressed in neurons that functions in pre-mRNA splicing, mRNA trafficking, and translation. Previously, we showed that anti-hnRNP A1 antibodies entered neuronal cells (in vitro) via clathrin-mediated endocytosis, caused mislocalization of endogenous hnRNP A1 protein and increased markers of neurodegeneration including decreased ATP concentration and apoptosis. In this study, we hypothesized that anti-hnRNP A1 antibodies might cause stress granule formation and altered levels of RNAs and proteins that bind hnRNP A1. Methods Neuronal cell lines were exposed to anti-hnRNP A1 and isotype-matched control antibodies in vitro and examined for neuronal granule formation, including stress granules, P bodies and transport granules. In addition, RNAs that bound hnRNP A1 were determined. Levels of RNA and their translated proteins were measured upon exposure to the anti-hnRNP A1 antibodies. Results Anti-hnRNP A1 antibodies induced and localized to stress granules, a marker of neurodegeneration, within a neuronal cell line. The anti-hnRNP A1 antibodies did not induce P bodies or neuronal granules. Clinically relevant RNAs were found to bind hnRNP A1. In addition, the anti-hnRNP A1 antibodies caused reduced levels of RNA and protein of the spinal paraplegia genes (SPGs) 4 and 7, which when mutated mimic progressive MS. Conclusions Taken together, these data suggest potential mechanisms by which autoantibodies may contribute to neurodegeneration in MS. PMID:27375925

  10. Mechanistic Control of Carcinoembryonic Antigen-related Cell Adhesion Molecule-1 (CEACAM1) Splice Isoforms by the Heterogeneous Nuclear Ribonuclear Proteins hnRNP L, hnRNP A1, and hnRNP M*

    PubMed Central

    Dery, Kenneth J.; Gaur, Shikha; Gencheva, Marieta; Yen, Yun; Shively, John E.; Gaur, Rajesh K.

    2011-01-01

    Carcinoembryonic antigen-related cell adhesion molecule-1 (CEACAM1) is expressed in a variety of cell types and is implicated in carcinogenesis. Alternative splicing of CEACAM1 pre-mRNA generates two cytoplasmic domain splice variants characterized by the inclusion (L-isoform) or exclusion (S-isoform) of exon 7. Here we show that the alternative splicing of CEACAM1 pre-mRNA is regulated by novel cis elements residing in exon 7. We report the presence of three exon regulatory elements that lead to the inclusion or exclusion of exon 7 CEACAM1 mRNA in ZR75 breast cancer cells. Heterologous splicing reporter assays demonstrated that the maintenance of authentic alternative splicing mechanisms were independent of the CEACAM1 intron sequence context. We show that forced expression of these exon regulatory elements could alter CEACAM1 splicing in HEK-293 cells. Using RNA affinity chromatography, three members of the heterogeneous nuclear ribonucleoprotein family (hnRNP L, hnRNP A1, and hnRNP M) were identified. RNA immunoprecipitation of hnRNP L and hnRNP A1 revealed a binding motif located central and 3′ to exon 7, respectively. Depletion of hnRNP A1 or L by RNAi in HEK-293 cells promoted exon 7 inclusion, whereas overexpression led to exclusion of the variable exon. By contrast, overexpression of hnRNP M showed exon 7 inclusion and production of CEACAM1-L mRNA. Finally, stress-induced cytoplasmic accumulation of hnRNP A1 in MDA-MB-468 cells dynamically alters the CEACAM1-S:CEACAM1:L ratio in favor of the l-isoform. Thus, we have elucidated the molecular factors that control the mechanism of splice-site recognition in the alternative splicing regulation of CEACAM1. PMID:21398516

  11. Heterogeneous Nuclear Ribonucleoprotein M Facilitates Enterovirus Infection

    PubMed Central

    Jagdeo, Julienne M.; Dufour, Antoine; Fung, Gabriel; Luo, Honglin; Kleifeld, Oded; Overall, Christopher M.

    2015-01-01

    ABSTRACT Picornavirus infection involves a dynamic interplay of host and viral protein interactions that modulates cellular processes to facilitate virus infection and evade host antiviral defenses. Here, using a proteomics-based approach known as TAILS to identify protease-generated neo-N-terminal peptides, we identify a novel target of the poliovirus 3C proteinase, the heterogeneous nuclear ribonucleoprotein M (hnRNP M), a nucleocytoplasmic shuttling RNA-binding protein that is primarily known for its role in pre-mRNA splicing. hnRNP M is cleaved in vitro by poliovirus and coxsackievirus B3 (CVB3) 3C proteinases and is targeted in poliovirus- and CVB3-infected HeLa cells and in the hearts of CVB3-infected mice. hnRNP M relocalizes from the nucleus to the cytoplasm during poliovirus infection. Finally, depletion of hnRNP M using small interfering RNA knockdown approaches decreases poliovirus and CVB3 infections in HeLa cells and does not affect poliovirus internal ribosome entry site translation and viral RNA stability. We propose that cleavage of and subverting the function of hnRNP M is a general strategy utilized by picornaviruses to facilitate viral infection. IMPORTANCE Enteroviruses, a member of the picornavirus family, are RNA viruses that cause a range of diseases, including respiratory ailments, dilated cardiomyopathy, and paralysis. Although enteroviruses have been studied for several decades, the molecular basis of infection and the pathogenic mechanisms leading to disease are still poorly understood. Here, we identify hnRNP M as a novel target of a viral proteinase. We demonstrate that the virus subverts the function of hnRNP M and redirects it to a step in the viral life cycle. We propose that cleavage of hnRNP M is a general strategy that picornaviruses use to facilitate infection. PMID:25926642

  12. Structure of nuclear ribonucleoprotein: heterogeneous nuclear RNA is complexed with a major sextet of proteins in vivo.

    PubMed Central

    Economidis, I V; Pederson, T

    1983-01-01

    Mouse erythroleukemia cells were pulse-labeled with [3H]uridine and irradiated with 254-nm light to produce covalent crosslinks between RNA and proteins in close proximity to one another in vivo. Nuclear ribonucleoprotein particles containing heterogeneous nuclear RNA were isolated and digested with nucleases, and the resulting proteins were subjected to gel electrophoresis. Proteins carrying covalently crosslinked [3H]uridine nucleotides were identified by fluorography. The results demonstrate that heterogeneous nuclear RNA is complexed in vivo with a set of six major proteins having molecular weights between 32,500 and 41,500. Analysis of chromatin fractions indicates that nascent heterogeneous nuclear RNA chains assemble with these six proteins as a very early post-transcriptional event. These data, and other results [Nevins, J. R. & Darnell, J. E. (1981) Cell 15, 1477-1493], lead us to propose the usual order of post-transcriptional events to be: heterogeneous nuclear RNA-ribonucleoprotein particle assembly leads to poly(A) addition leads to splicing. Images PMID:6572923

  13. THE NOX SYSTEM IN HOMOGENEOUS AND HETEROGENEOUS NUCLEAR WASTE

    EPA Science Inventory

    This report summarizes advances of the above-mentioned EMSP project during the period July 1, 2001 - June 30, 2002. The project focuses on the effects of organic chemicals in stored nuclear waste and their impact on pretreatment and tank closure issues. Managing the tank wastes a...

  14. Inferring Diffusion Dynamics from FCS in Heterogeneous Nuclear Environments

    PubMed Central

    Tsekouras, Konstantinos; Siegel, Amanda P.; Day, Richard N.; Pressé, Steve

    2015-01-01

    Fluorescence correlation spectroscopy (FCS) is a noninvasive technique that probes the diffusion dynamics of proteins down to single-molecule sensitivity in living cells. Critical mechanistic insight is often drawn from FCS experiments by fitting the resulting time-intensity correlation function, G(t), to known diffusion models. When simple models fail, the complex diffusion dynamics of proteins within heterogeneous cellular environments can be fit to anomalous diffusion models with adjustable anomalous exponents. Here, we take a different approach. We use the maximum entropy method to show—first using synthetic data—that a model for proteins diffusing while stochastically binding/unbinding to various affinity sites in living cells gives rise to a G(t) that could otherwise be equally well fit using anomalous diffusion models. We explain the mechanistic insight derived from our method. In particular, using real FCS data, we describe how the effects of cell crowding and binding to affinity sites manifest themselves in the behavior of G(t). Our focus is on the diffusive behavior of an engineered protein in 1) the heterochromatin region of the cell’s nucleus as well as 2) in the cell’s cytoplasm and 3) in solution. The protein consists of the basic region-leucine zipper (BZip) domain of the CCAAT/enhancer-binding protein (C/EBP) fused to fluorescent proteins. PMID:26153697

  15. SNM-DAT: Simulation of a heterogeneous network for nuclear border security

    NASA Astrophysics Data System (ADS)

    Nemzek, R.; Kenyon, G.; Koehler, A.; Lee, D. M.; Priedhorsky, W.; Raby, E. Y.

    2007-08-01

    We approach the problem of detecting Special Nuclear Material (SNM) smuggling across open borders by modeling a heterogeneous sensor network using an agent-based simulation. Our simulation SNM Data Analysis Tool (SNM-DAT) combines fixed seismic, metal, and radiation detectors with a mobile gamma spectrometer. Decision making within the simulation determines threat levels by combined signatures. The spectrometer is a limited-availability asset, and is only deployed for substantial threats. "Crossers" can be benign or carrying shielded SNM. Signatures and sensors are physics based, allowing us to model realistic sensor networks. The heterogeneous network provides great gains in detection efficiency compared to a radiation-only system. We can improve the simulation through better sensor and terrain models, additional signatures, and crossers that mimic actual trans-border traffic. We expect further gains in our ability to design sensor networks as we learn the emergent properties of heterogeneous detection, and potential adversary responses.

  16. Rapid measurements of heterogeneity in sandstones using low-field nuclear magnetic resonance

    NASA Astrophysics Data System (ADS)

    Mitchell, Jonathan

    2014-03-01

    Sandstone rocks can contain microscopic variations in composition that complicate interpretation of nuclear magnetic resonance (NMR) relaxation time measurements. In this work, methods for assessing the degree of sample heterogeneity are demonstrated in three sandstones. A two-dimensional T1-Δχapp correlation (where Δχapp is the apparent solid/liquid magnetic susceptibility contrast) reveals the microscopic heterogeneity in composition, whilst a spatially resolved T1 profile reveals the macroscopic structural heterogeneity. To perform these measurements efficiently, a rapid measure of longitudinal T1 relaxation time has been implemented on a low-field NMR spectrometer with a magnetic field strength B0=0.3 T. The “double-shot” T1 pulse sequence is appropriate for analysis of porous materials in general. Example relaxation time distributions are presented for doped water phantoms to validate the method. The acquisition time of the double-shot T1 sequence is equivalent to the single-shot Carr-Purcell Meiboom-Gill (CPMG) sequence used routinely in petrophysics to measure transverse T2 relaxation. Rapid T1 measurements enable practical studies of core plugs at magnetic field strengths previously considered inappropriate, as T1 is independent of molecular diffusion through pore-scale (internal) magnetic field gradients.

  17. Classification and purification of proteins of heterogeneous nuclear ribonucleoprotein particles by RNA-binding specificities

    SciTech Connect

    Swanson, M.S.; Dreyfuss, G.

    1988-05-01

    Several proteins of heterogeneous nuclear ribonucleoprotein (hnRNP) particles display very high binding affinities for different ribonucleotide homopolymers. The specificity of some of these proteins at high salt concentrations and in the presence of heparin allows for their rapid one-step purification from HeLa nucleoplasm. The authors show that the hnRNP proteins are poly(U)-binding proteins and compare their specificity to that of the previously described cytoplasmic poly(A)-binding protein. These findings provide a useful tool for the classification and purification of hnRNP proteins from various tissues and organisms and indicate that different hnRNP proteins have different RNA-binding specificities.

  18. Antibodies specific for Epstein-Barr virus nuclear antigen-1 cross-react with human heterogeneous nuclear ribonucleoprotein L.

    PubMed

    Lindsey, J William; deGannes, Samantha L; Pate, Kimberly A; Zhao, Xiurong

    2016-01-01

    Epstein-Barr virus (EBV) is associated with multiple sclerosis (MS), and antibodies to the EBV nuclear antigen-1 (EBNA-1) are consistently increased in MS patients. The hypothesis of this study is that anti-EBNA-1 antibodies cross-react with a self antigen in MS patients. We affinity purified anti-EBNA-1 antibodies from human plasma, used the anti-EBNA-1 to immunoprecipitate antigens from human brain, and identified bound antigens with mass spectrometry. Anti-EBNA-1 consistently bound heterogeneous nuclear ribonucleoprotein L (HNRNPL). We expressed both the long and short isoforms of this protein, and verified with Western blots and ELISA that the long isoform cross-reacts with EBNA-1. Immunohistochemistry demonstrated that anti-EBNA-1 bound to an antigen in the nucleus of cultured rat central nervous system cells. ELISA demonstrated the presence of antibodies to HNRNPL in the plasma of both healthy controls and MS patients, but anti-HNRNPL was not increased in MS patients. We conclude that HNRNPL is an autoantigen which cross-reacts with EBNA-1. The relevance of this autoantigen to MS and other autoimmune diseases remains to be investigated. PMID:26637929

  19. Phosphorylation of rat liver heterogeneous nuclear ribonucleoproteins A2 and C can be modulated by calmodulin.

    PubMed Central

    Bosser, R; Faura, M; Serratosa, J; Renau-Piqueras, J; Pruschy, M; Bachs, O

    1995-01-01

    It was previously reported that the phosphorylation of three proteins of 36, 40 to 42, and 50 kDa by casein kinase 2 is inhibited by calmodulin in nuclear extracts from rat liver cells (R. Bosser, R. Aligué, D. Guerini, N. Agell, E. Carafoli, and O. Bachs, J. Biol. Chem. 268:15477-15483, 1993). By immunoblotting, peptide mapping, and endogenous phosphorylation experiments, the 36- and 40- to 42-kDa proteins have been identified as the A2 and C proteins, respectively, of the heterogeneous nuclear ribonucleoprotein particles. To better understand the mechanism by which calmodulin inhibits the phosphorylation of these proteins, they were purified by using single-stranded DNA chromatography, and the effect of calmodulin on their phosphorylation by casein kinase 2 was analyzed. Results revealed that whereas calmodulin inhibited the phosphorylation of purified A2 and C proteins in a Ca(2+)-dependent manner, it did not affect the casein kinase 2 phosphorylation of a different protein substrate, i.e., beta-casein. These results indicate that the effect of calmodulin was not on casein kinase 2 activity but on specific protein substrates. The finding that the A2 and C proteins can bind to a calmodulin-Sepharose column in a Ca(2+)-dependent manner suggests that this association could prevent the phosphorylation of the proteins by casein kinase 2. Immunoelectron microscopy studies have revealed that such interactions could also occur in vivo, since calmodulin and A2 and C proteins colocalize on the ribonucleoprotein particles in rat liver cell nuclei. PMID:7823935

  20. Expression and localization of heterogeneous nuclear ribonucleoprotein K in mouse ovaries and preimplantation embryos.

    PubMed

    Zhang, Ping; Wang, Ningling; Lin, Xianhua; Jin, Li; Xu, Hong; Li, Rong; Huang, Hefeng

    2016-02-26

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K), an evolutionarily conserved protein, is involved in several important cellular processes that are relevant to cell proliferation, differentiation, apoptosis, and cancer development. However, details of hnRNP K expression during mammalian oogenesis and preimplantation embryo development are lacking. The present study investigates the expression and cellular localization of K protein in the mouse ovaries and preimplantation embryos using immunostaining. We demonstrate, for the first time, that hnRNP K is abundantly expressed in the nuclei of mouse oocytes in primordial, primary and secondary follicles. In germ vesicle (GV)-stage oocytes, hnRNP K accumulates in the germinal vesicle in a spot distribution manner. After germinal vesicle breakdown, speckled hnRNP K is diffusely distributed in the cytoplasm. However, after fertilization, the K protein relocates into the female and male pronucleus and persists in the blastomere nuclei. Localization of K protein in the human ovary and ovarian granulosa cell tumor (GCT) was also investigated. Overall, this study provides important morphological evidence to better understand the possible roles of hnRNP K in mammalian oogenesis and early embryo development. PMID:26850853

  1. The algal metabolite yessotoxin affects heterogeneous nuclear ribonucleoproteins in HepG2 cells.

    PubMed

    Young, Clifford; Truman, Penelope; Boucher, Magalie; Keyzers, Robert A; Northcote, Peter; Jordan, T William

    2009-05-01

    The dinoflagellate metabolite yessotoxin (YTX) is produced by several species of algae and accumulates in marine food chains, leading to concerns about possible affects on aquaculture industries and human health. In mice used for toxicity testing, YTX is lethal by the intraperitoneal route, but is considerably less toxic when orally administered. The mode of action of YTX and its potential effect on humans is unclear and we therefore conducted the first proteomic analysis of the effects of this compound. We used 2-DE to examine protein changes in HepG2 cell cultures exposed to 1.4 microM YTX for 3, 12.5, 18 and 24 h. After selecting proteins that changed more than three-fold after YTX exposure, 55 spots were deemed significantly affected by the toxin (p<0.05). Major groups of affected proteins include members from the heterogeneous nuclear ribonucleoprotein (hnRNP), lamin, cathepsin and heat shock protein families that often are associated with apoptosis. We therefore confirmed apoptosis using Annexin-V-FLUOS staining of phosphatidylserine exposed at the surface of apoptotic cells. Ingenuity pathways analysis also indicated effects on pathways involved in protein processing, cell cycling and cell death. PMID:19343718

  2. Role and molecular mechanism of heterogeneous nuclear ribonucleoprotein K in tumor development and progression

    PubMed Central

    LU, JING; GAO, FENG-HOU

    2016-01-01

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a member of the hnRNP family, which exists in the nucleus and the cytoplasm simultaneously. It is a multifunctional protein that can participate in a variety of regulatory progressions of gene expression and signal transduction, such as chromatin remodeling, transcription, RNA alternative splicing and translation. hnRNP K not only directly binds to the kinases, but also recruits the associated factors regarding transcription, splicing and translation to control gene expression, and therefore, it serves as a docking platform for integrating transduction pathways to nucleic acid-directed processes. Numerous studies also show that abnormal expression of hnRNP K is closely associated with the tumor formation. This protein is overexpressed in numerous types of cancer and its aberrant cytoplasmic localization is also associated with a worse prognosis for patients. These results consistently indicate that hnRNP K has a key role in cancer progression. To understand the hnRNP K pathophysiological process in tumor disease, the previous research results regarding the association between hnRNP K and tumors were reviewed. PMID:27284403

  3. An association between RBMX, a heterogeneous nuclear ribonucleoprotein, and ARTS-1 regulates extracellular TNFR1 release

    SciTech Connect

    Adamik, Barbara; Islam, Aminul; Rouhani, Farshid N.; Hawari, Feras I.; Zhang Jing; Levine, Stewart J.

    2008-07-04

    The type I, 55-kDa tumor necrosis factor receptor (TNFR1) is released to the extracellular space by two mechanisms, the constitutive release of TNFR1 exosome-like vesicles and the inducible proteolytic cleavage of TNFR1 ectodomains. Both pathways appear to be regulated by an interaction between TNFR1 and ARTS-1 (aminopeptidase regulator of TNFR1 shedding). Here, we sought to identify ARTS-1-interacting proteins that modulate TNFR1 release. Co-immunoprecipitation identified an association between ARTS-1 and RBMX (RNA-binding motif gene, X chromosome), a 43-kDa heterogeneous nuclear ribonucleoprotein. RNA interference attenuated RBMX expression, which reduced both the constitutive release of TNFR1 exosome-like vesicles and the IL-1{beta}-mediated inducible proteolytic cleavage of soluble TNFR1 ectodomains. Reciprocally, over-expression of RBMX increased TNFR1 exosome-like vesicle release and the IL-1{beta}-mediated inducible shedding of TNFR1 ectodomains. This identifies RBMX as an ARTS-1-associated protein that regulates both the constitutive release of TNFR1 exosome-like vesicles and the inducible proteolytic cleavage of TNFR1 ectodomains.

  4. Heterogeneous nuclear ribonucleoprotein K is overexpressed and associated with poor prognosis in gastric cancer.

    PubMed

    Yang, Ruirui; Zeng, Ying; Xu, Haifan; Chen, Zhuo; Xiang, Mengqin; Fu, Yun; Yin, Yufang; Zhong, Jing; Zeng, Min; Wang, Peihua; You, Qin; Zeng, Xi

    2016-08-01

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is one of the major pre-mRNA-binding proteins, that is involved in translational modifications. In our previous studies, we found that hnRNP K is associated with human gastric cancer. The protein levels of hnRNP K were detected in cell lines and tissue microarrays. The correlation between hnRNP K expression and patient survival rate was evaluated by Kaplan-Meier survival analysis. In addition, we also detected hnRNP K expression in preoperative and postoperative serum samples from patients with gastric cancer, and serum samples from healthy volunteers. We found that hnRNP K was overexpressed in the gastric cancer cell lines. The levels of hnRNP K were significantly elevated in the gastric cancer tissues compared with that noted in the tumor-adjacent gastric mucosal and normal gastric mucosal sampes, and hnRNP K expression was found to correlate with tumor stage and lymph node metastasis. However, the level of serum hnRNP K did not differ significantly between gastric cancer patients and healthy volunteers. We also found that patients whose tumors showed elevated expression of hnRNP K had poor survival. The present study suggests that hnRNP K is a promising tissue biomarker for diagnosing gastric cancer and is a prognostic indicator for patients with gastric cancer. PMID:27278897

  5. Cytoplasmic Accumulation of Heterogeneous Nuclear Ribonucleoprotein K Strongly Promotes Tumor Invasion in Renal Cell Carcinoma Cells

    PubMed Central

    Otoshi, Taiyo; Tanaka, Tomoaki; Morimoto, Kazuya; Nakatani, Tatsuya

    2015-01-01

    Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a part of the ribonucleoprotein complex which regulates diverse biological events. While overexpression of hnRNP K has been shown to be related to tumorigenesis in several cancers, both the expression patterns and biological mechanisms of hnRNP K in renal cell carcinoma (RCC) cells remain unclear. In this study, we showed that hnRNP K protein was strongly expressed in selected RCC cell lines (ACHN, A498, Caki-1, 786–0), and knock-down of hnRNP K expression by siRNA induced cell growth inhibition and apoptosis. Based on immunohistochemical (IHC) analysis of hnRNP K expression in human clear cell RCC specimens, we demonstrated that there was a significant positive correlation between hnRNP K staining score and tumor aggressiveness (e.g., Fuhrman grade, metastasis). Particularly, the rate of cytoplasmic localization of hnRNP K in primary RCC with distant metastasis was significantly higher than that in RCC without metastasis. Additionally, our results indicated that the cytoplasmic distribution of hnRNP K induced by TGF-β stimulus mainly contributed to TGF-β-triggered tumor cell invasion in RCC cells. Dominant cytoplasmic expression of ectopic hnRNP K markedly suppressed the inhibition of invasion by knock-down of endogenous hnRNP K. The expression level of matrix metalloproteinase protein-2 was decreased by endogenous hnRNP K knock-down, and restored by ectopic hnRNP K. Therefore, hnRNP K may be a key molecule involved in cell motility in RCC cells, and molecular mechanism associated with the subcellular localization of hnRNP K may be a novel target in the treatment of metastatic RCC. PMID:26713736

  6. Protein and gene expression characteristics of heterogeneous nuclear ribonucleoprotein H1 in esophageal squamous cell carcinoma

    PubMed Central

    Sun, Yu-Lin; Liu, Fei; Liu, Fang; Zhao, Xiao-Hang

    2016-01-01

    AIM To investigate the expression characteristics of heterogeneous nuclear ribonucleoprotein H1 (HNRNPH1) mRNA and protein in cell lines and tissues of esophageal squamous cell carcinoma (ESCC). METHODS Western blotting was used to assess the expression of HNRNPH1 protein in seven ESCC cell lines and 30 paired fresh tissue specimens. The subcellular localization of HNRNPH1 was determined by immunofluorescence in ESCC cells. The RNA sequencing data from 87 patients with ESCC were obtained from the cancer genome atlas (TCGA), and the expression and clinical characteristics analysis of different transcript variants of HNRNPH1 were evaluated in this dataset. In addition, immunohistochemistry was carried out to detect the expression of HNRNPH1 protein in 125 patients. RESULTS The expression of HNRNPH1 protein varied across different ESCC cell lines. It was exclusively restricted to the nucleus of the ESCC cells. There are two transcript variants of the HNRNPH1 gene. Variant 1 was constitutively expressed, and its expression did not change during tumorigenesis. In contrast, levels of variant 2 were low in non-tumorous tissues and were dramatically increased in ESCC (P = 0.0026). The high levels of variant 2 were associated with poorer differentiated tumors (P = 0.0287). Furthermore, in paired fresh tissue specimens, HNRNPH1 protein was overexpressed in 73.3% (22/30) of neoplastic tissues. HNRNPH1 was significantly upregulated in ESCC, with strong staining in 43.2% (54/125) of tumor tissues and 22.4% (28/125) of matched non-cancerous tissues (P = 0.0005). Positive HNRNPH1 expression was significantly associated with poor tumor differentiation degree (P = 0.0337). CONCLUSION The different alternative transcript variants of HNRNPH1 exhibited different expression changes during tumorigenesis. Its mRNA and protein were overexpressed in ESCC and associated with poorer differentiation of tumor cells. These findings highlight the potential of HNRNPH1 in the therapy and diagnosis

  7. Heterogeneity Between Ducts of the Same Nuclear Grade Involved by Duct Carcinoma In Situ (DCIS) of the Breast

    PubMed Central

    Miller, Naomi A.; Chapman, Judith-Anne W.; Qian, Jin; Christens-Barry, William A.; Fu, Yuejiao; Yuan, Yan; Lickley, H. Lavina A.; Axelrod, David E.

    2010-01-01

    Purpose Nuclear grade of breast DCIS is considered during patient management decision-making although it may have only a modest prognostic association with therapeutic outcome. We hypothesized that visual inspection may miss substantive differences in nuclei classified as having the same nuclear grade. To test this hypothesis, we measured subvisual nuclear features by quantitative image cytometry for nuclei with the same grade, and tested for statistical differences in these features. Experimental design and statistical analysis Thirty-nine nuclear digital image features of about 100 nuclei were measured in digital images of H&E stained slides of 81 breast biopsy specimens. One field with at least 5 ducts was evaluated for each patient. We compared features of nuclei with the same grade in multiple ducts of the same patient with ANOVA (or Welch test), and compared features of nuclei with the same grade in two ducts of different patients using 2-sided t-tests (P ≤ 0.05). Also, we compared image features for nuclei in patients with single grade to those with the same grade in patients with multiple grades using t-tests. Results Statistically significant differences were detected in nuclear features between ducts with the same nuclear grade, both in different ducts of the same patient, and between ducts in different patients with DCIS of more than one grade. Conclusion Nuclei in ducts visually described as having the same nuclear grade had significantly different subvisual digital image features. These subvisual differences may be considered additional manifestations of heterogeneity over and above differences that can be observed microscopically. This heterogeneity may explain the inconsistency of nuclear grading as a prognostic factor. PMID:20981137

  8. Homogenized moment tensor and the effect of near-field heterogeneities on nonisotropic radiation in nuclear explosion

    NASA Astrophysics Data System (ADS)

    Burgos, Gaël.; Capdeville, Yann; Guillot, Laurent

    2016-06-01

    We investigate the effect of small-scale heterogeneities close to a seismic explosive source, at intermediate periods (20-50 s), with an emphasis on the resulting nonisotropic far-field radiation. First, using a direct numerical approach, we show that small-scale elastic heterogeneities located in the near-field of an explosive source, generate unexpected phases (i.e., long period S waves). We then demonstrate that the nonperiodic homogenization theory applied to 2-D and 3-D elastic models, with various pattern of small-scale heterogeneities near the source, leads to accurate waveforms at a reduced computational cost compared to direct modeling. Further, it gives an interpretation of how nearby small-scale features interact with the source at low frequencies, through an explicit correction to the seismic moment tensor. In 2-D simulations, we find a deviatoric contribution to the moment tensor, as high as 21% for near-source heterogeneities showing a 25% contrast of elastic values (relative to a homogeneous background medium). In 3-D this nonisotropic contribution reaches 27%. Second, we analyze intermediate-periods regional seismic waveforms associated with some underground nuclear explosions conducted at the Nevada National Security Site and invert for the full moment tensor, in order to quantify the relative contribution of the isotropic and deviatoric components of the tensor. The average value of the deviatoric part is about 35%. We conclude that the interactions between an explosive source and small-scale local heterogeneities of moderate amplitude may lead to a deviatoric contribution to the seismic moment, close to what is observed using regional data from nuclear test explosions.

  9. Histone acetylation regulates orphan nuclear receptor NR4A1 expression in hypercholesterolaemia.

    PubMed

    Xie, Xina; Song, Xuhong; Yuan, Song; Cai, Haitao; Chen, Yequn; Chang, Xiaolan; Liang, Bin; Huang, Dongyang

    2015-12-01

    Hypercholesterolaemia and inflammation are correlated with atherogenesis. Orphan nuclear receptor NR4A1, as a key regulator of inflammation, is closely associated with lipid levels in vivo. However, the mechanism by which lipids regulate NR4A1 expression remains unknown. We aimed to elucidate the underlying mechanism of NR4A1 expression in monocytes during hypercholesterolaemia, and reveal the potential role of NR4A1 in hypercholesterolaemia-induced circulating inflammation. Circulating leucocytes were collected from blood samples of 139 patients with hypercholesterolaemia and 139 sex- and age-matched healthy subjects. We found that there was a low-grade inflammatory state and higher expression of NR4A1 in patients. Both total cholesterol and low-density lipoprotein cholesterol levels in plasma were positively correlated with NR4A1 mRNA level. ChIP revealed that acetylation of histone H3 was enriched in the NR4A1 promoter region in patients. Human mononuclear cell lines THP-1 and U937 were treated with cholesterol. Supporting our clinical observations, cholesterol enhanced p300 acetyltransferase and decreased HDAC7 (histone deacetylase 7) recruitment to the NR4A1 promoter region, resulting in histone H3 hyperacetylation and further contributing to NR4A1 up-regulation in monocytes. Moreover, cytosporone B, an NR4A1 agonist, completely reversed cholesterol-induced IL-6 (interleukin 6) and MCP-1 (monocyte chemoattractant protein 1) expression to below basal levels, and knockdown of NR4A1 expression by siRNA not only mimicked, but also exaggerated the effects of cholesterol on inflammatory biomarker up-regulation. Thus we conclude that histone acetylation contributes to the regulation of NR4A1 expression in hypercholesterolaemia, and that NR4A1 expression reduces hypercholesterolaemia-induced inflammation. PMID:26396259

  10. Relaxation Nuclear Magnetic Resonance Imaging Investigation of Heterogeneous Aging in a Hydroxy-Terminated Polybutadiene-Based Elastomer

    SciTech Connect

    Alam, Todd M.; Cherry, Brian R.; Minard, Kevin R.; Celina, Mat C.

    2005-12-27

    Relaxation nuclear magnetic resonance imaging (R-NMRI) was employed to investigate the effects of thermo-oxidative aging in a hydroxy-terminated polybutadiene (HTPB) based elastomer. A series of three-dimensional (3D) Hahn-echo weighted single point images (SPI) of the elastomer were utilized to generate a 3D parameter map of the aged material. NMR spin-spin relaxation times (T2) were measured for each voxel producing a 3D NMR parameter (T2) map of the aged polymer. These T2 maps reveal a dramatic reduction of local polymer mobility near the aging surface with the degree of T2 heterogeneity varying as a function of aging. Using correlations between NMR T2 and material modulus, the impact of this heterogeneous thermo-oxidative aging on the material properties is discussed.

  11. In Silico Adoption of an Orphan Nuclear Receptor NR4A1

    PubMed Central

    Lanig, Harald; Reisen, Felix; Whitley, David; Schneider, Gisbert; Banting, Lee; Clark, Timothy

    2015-01-01

    A 4.1μs molecular dynamics simulation of the NR4A1 (hNur77) apo-protein has been undertaken and a previously undetected druggable pocket has become apparent that is located remotely from the ‘traditional’ nuclear receptor ligand-binding site. A NR4A1/bis-indole ligand complex at this novel site has been found to be stable over 1 μs of simulation and to result in an interesting conformational transmission to a remote loop that has the capacity to communicate with a NBRE within a RXR-α/NR4A1 heterodimer. Several features of the simulations undertaken indicate how NR4A1 can be affected by alternate-site modulators. PMID:26270486

  12. Nanoscale nuclear magnetic resonance with a 1.9-nm-deep nitrogen-vacancy sensor

    SciTech Connect

    Loretz, M.; Degen, C. L.; Pezzagna, S.; Meijer, J.

    2014-01-20

    We present nanoscale nuclear magnetic resonance (NMR) measurements performed with nitrogen-vacancy (NV) centers located down to about 2 nm from the diamond surface. NV centers were created by shallow ion implantation followed by a slow, nanometer-by-nanometer removal of diamond material using oxidative etching in air. The close proximity of NV centers to the surface yielded large {sup 1}H NMR signals of up to 3.4 μT-rms, corresponding to ∼330 statistically polarized or ∼10 fully polarized proton spins in a (1.8 nm){sup 3} detection volume.

  13. Patterns of cyto-nuclear linkage disequilibrium in Silene latifolia: genomic heterogeneity and temporal stability

    PubMed Central

    Fields, P D; McCauley, D E; McAssey, E V; Taylor, D R

    2014-01-01

    Non-random association of alleles in the nucleus and cytoplasmic organelles, or cyto-nuclear linkage disequilibrium (LD), is both an important component of a number of evolutionary processes and a statistical indicator of others. The evolutionary significance of cyto-nuclear LD will depend on both its magnitude and how stable those associations are through time. Here, we use a longitudinal population genetic data set to explore the magnitude and temporal dynamics of cyto-nuclear disequilibria through time. We genotyped 135 and 170 individuals from 16 and 17 patches of the plant species Silene latifolia in Southwestern VA, sampled in 1993 and 2008, respectively. Individuals were genotyped at 14 highly polymorphic microsatellite markers and a single-nucleotide polymorphism (SNP) in the mitochondrial gene, atp1. Normalized LD (D′) between nuclear and cytoplasmic loci varied considerably depending on which nuclear locus was considered (ranging from 0.005–0.632). Four of the 14 cyto-nuclear associations showed a statistically significant shift over approximately seven generations. However, the overall magnitude of this disequilibrium was largely stable over time. The observed origin and stability of cyto-nuclear LD is most likely caused by the slow admixture between anciently diverged lineages within the species' newly invaded range, and the local spatial structure and metapopulation dynamics that are known to structure genetic variation in this system. PMID:24002238

  14. Dynamic nuclear polarization solid-state NMR in heterogeneous catalysis research

    DOE PAGESBeta

    Kobayashi, Takeshi; Perras, Frédéric A.; Slowing, Igor I.; Sadow, Aaron D.; Pruski, Marek

    2015-10-20

    In this study, a revolution in solid-state nuclear magnetic resonance (SSNMR) spectroscopy is taking place, attributable to the rapid development of high-field dynamic nuclear polarization (DNP), a technique yielding sensitivity improvements of 2–3 orders of magnitude. This higher sensitivity in SSNMR has already impacted materials research, and the implications of new methods on catalytic sciences are expected to be profound.

  15. Dynamic nuclear polarization solid-state NMR in heterogeneous catalysis research

    SciTech Connect

    Kobayashi, Takeshi; Perras, Frédéric A.; Slowing, Igor I.; Sadow, Aaron D.; Pruski, Marek

    2015-10-20

    In this study, a revolution in solid-state nuclear magnetic resonance (SSNMR) spectroscopy is taking place, attributable to the rapid development of high-field dynamic nuclear polarization (DNP), a technique yielding sensitivity improvements of 2–3 orders of magnitude. This higher sensitivity in SSNMR has already impacted materials research, and the implications of new methods on catalytic sciences are expected to be profound.

  16. Heterogeneous behavior of lipids according to HbA1c levels undermines the plausibility of metabolic syndrome in type 1 diabetes: data from a nationwide multicenter survey

    PubMed Central

    2012-01-01

    Background Cardiovascular risk factors (CVRF) may cluster in type 1 diabetes, analogously to the metabolic syndrome described in type 2 diabetes. The threshold of HbA1c above which lipid variables start changing behavior is unclear. This study aims to 1) assess the behavior of dyslipidemia according to HbA1c values; 2) detect a threshold of HbA1c beyond which lipids start to change and 3) compare the clustering of lipids and other non-lipid CVRF among strata of HbA1c individuals with type 1 diabetes. Methods Effects of HbA1c quintiles (1st: ≤7.4%; 2nd: 7.5-8.5%; 3rd: 8.6-9.6%; 4th: 9.7-11.3%; and 5th: >11.5%) and covariates (gender, BMI, blood pressure, insulin daily dose, lipids, statin use, diabetes duration) on dyslipidemia were studied in 1275 individuals from the Brazilian multi-centre type 1 diabetes study and 171 normal controls. Results Body size and blood pressure were not correlated to lipids and glycemic control. OR (99% CI) for high-LDL were 2.07 (1.21-3.54) and 2.51 (1.46-4.31), in the 4th and 5th HbA1c quintiles, respectively. Hypertriglyceridemia increased in the 5th quintile of HbA1c, OR 2.76 (1.20-6.37). OR of low-HDL-cholesterol were 0.48 (0.24-0.98) and 0.41 (0.19-0.85) in the 3rd and 4th HbA1c quintiles, respectively. HDL-cholesterol correlated positively (0.437) with HbA1c in the 3rd quintile. HDL-cholesterol and insulin dose correlated inversely in all levels of glycemic control. Conclusions Correlation of serum lipids with HbA1c is heterogeneous across the spectrum of glycemic control in type 1 diabetes individuals. LDL-cholesterol and triglycerides worsened alongside HbA1c with distinct thresholds. Association of lower HDL-cholesterol with higher daily insulin dose is consistent and it points out to a role of exogenous hyperinsulinemia in the pathophysiology of the CVRF clustering. These data suggest diverse pathophysiological processes depending on HbA1c, refuting a unified explanation for cardiovascular risk in type 1 diabetes. PMID

  17. Nuclear analysis of the chornobyl fuel containing masses with heterogeneous fuel distribution.

    SciTech Connect

    Turski, R. B.

    1998-10-14

    Although significant data has been obtained on the condition and composition of the fuel containing masses (FCM) located in the concrete chambers under the Chernobyl Unit 4 reactor cavity, there is still uncertainty regarding the possible recriticality of this material. The high radiation levels make access extremely difficult, and most of the samples are from the FCM surface regions. There is little information on the interior regions of the FCM, and one cannot assume with confidence that the surface measurements are representative of the interior regions. Therefore, reasonable assumptions on the key parameters such as fuel concentration, the concentrations of impurities and neutron poisons (especially boron), the void fraction of the FCM due to its known porosity, and the degrees of fuel heterogeneity, are necessary to evaluate the possibility of recriticality. The void fraction is important since it introduces the possibility of water moderator being distributed throughout the FCM. Calculations indicate that the addition of 10 to 30 volume percent (v/o) water to the FCM has a significant impact on the calculated reactivity of the FCM. Therefore, water addition must be considered carefully. The other possible moderators are graphite and silicone dioxide. As discussed later in this paper, silicone dioxide moderation does not represent a criticality threat. For graphite, both heterogeneous fuel arrangements and very large volume fractions of graphite are necessary for a graphite moderated system to go critical. Based on the observations and measurements of the FCM compositions, these conditions do not appear creditable for the Chernobyl FCM. Therefore, the focus of the analysis reported in this paper will be on reasonable heterogeneous fuel arrangements and water moderation. The analysis will evaluate a range of fuel and diluent compositions.

  18. Heterogeneous nuclear ribonuclear protein U associates with YAP and regulates its co-activation of Bax transcription.

    PubMed

    Howell, Michael; Borchers, Christoph; Milgram, Sharon L

    2004-06-18

    Although initially described as a cytosolic scaffolding protein, YAP (Yes-associated protein of 65 kDa) is known to associate with multiple transcription factors in the nucleus. Using affinity chromatography and mass spectrometry, we show that YAP interacts with heterogeneous nuclear ribonuclear protein U (hnRNP U), an RNA- and DNA-binding protein enriched in the nuclear matrix that also plays a role in the regulation of gene expression. hnRNP U interacts specifically with the proline-rich amino terminus of YAP, a region of YAP that is not found in the related protein TAZ. Although hnRNP U and YAP localize to both the nucleus and the cytoplasm, YAP does not translocate to the nucleus in an hnRNP U-dependent manner. Furthermore, hnRNP U and YAP only interact in the nucleus, suggesting that the association between the two proteins is regulated. Co-expression of hnRNP U attenuates the ability of YAP to increase the activity of a p73-driven Bax-luciferase reporter plasmid. In contrast, hnRNP U has no effect when co-expressed with a truncated YAP protein lacking the hnRNP U-binding site. Because YAP is distinguished from the homologue TAZ by its proline-rich amino terminus, the YAP-hnRNP U interaction may uniquely regulate the nuclear function(s) of YAP. The YAP-hnRNP U interaction provides another mechanism of YAP transcriptional regulation. PMID:15096513

  19. The nuclear receptor Nr4a1 mediates anti-inflammatory effects of apoptotic cells.

    PubMed

    Ipseiz, Natacha; Uderhardt, Stefan; Scholtysek, Carina; Steffen, Martin; Schabbauer, Gernot; Bozec, Aline; Schett, Georg; Krönke, Gerhard

    2014-05-15

    Uptake of apoptotic cells (ACs) by macrophages ensures the nonimmunogenic clearance of dying cells, as well as the maintenance of self-tolerance to AC-derived autoantigens. Upon ingestion, ACs exert an inhibitory influence on the inflammatory signaling within the phagocyte. However, the molecular signals that mediate these immune-modulatory properties of ACs are incompletely understood. In this article, we show that the phagocytosis of apoptotic thymocytes was enhanced in tissue-resident macrophages where this process resulted in the inhibition of NF-κB signaling and repression of inflammatory cytokines, such as IL-12. In parallel, ACs induced a robust expression of a panel of immediate early genes, which included the Nr4a subfamily of nuclear receptors. Notably, deletion of Nr4a1 interfered with the anti-inflammatory effects of ACs in macrophages and restored both NF-κB signaling and IL-12 expression. Accordingly, Nr4a1 mediated the anti-inflammatory properties of ACs in vivo and was required for maintenance of self-tolerance in the murine model of pristane-induced lupus. Thus, our data point toward a key role for Nr4a1 as regulator of the immune response to ACs and of the maintenance of tolerance to "dying self." PMID:24740500

  20. Fluorescence studies on the role of tryptophan in heterogeneous nuclear ribonucleoprotein particles of HeLa cells.

    PubMed Central

    Schenkel, J; Appel, I; Schwarzwald, R; Bautz, E k; Wolfrum, J; Greulich, K O

    1989-01-01

    The 40 S heterogeneous nuclear ribonucleoprotein (hnRNP) particles from HeLa cells reveal tryptophan fluorescence with a bi-exponential decay, indicating that only a few of the 'core' proteins contain tryptophan residues. The presence of tryptophan residues distinguishes hnRNP particles from nucleosomes, with which they otherwise share a number of properties. This difference, however, is not essential for protein-RNA binding, as the fluorescence decay remains unchanged when hnRNP particles are dissociated into protein and RNA. However, the Stern-Volmer quenching constant is doubled upon salt dissociation, i.e. tryptophan residues become more accessible to solvent. Thus tryptophan quenching is a useful parameter for monitoring protein-protein interactions in hnRNP particles. PMID:2604698

  1. Identification of the methylation preference region in heterogeneous nuclear ribonucleoprotein K by protein arginine methyltransferase 1 and its implication in regulating nuclear/cytoplasmic distribution

    SciTech Connect

    Chang, Yuan-I; Hsu, Sheng-Chieh; Chau, Gar-Yang; Huang, Chi-Ying F.; Sung, Jung-Sung; Hua, Wei-Kai; Lin, Wey-Jinq

    2011-01-21

    Research highlights: {yields} Verifying by direct methylation assay the substrate sites of PRMT1 in the hnRNP K protein. {yields} Identifying the preferred PMRT1 methylation regions in hnRNP K by kinetic analysis. {yields} Linking methylation in regulating nuclear localization of hnRNP K. -- Abstract: Protein arginine methylation plays crucial roles in numerous cellular processes. Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein participating in a variety of cellular functions including transcription and RNA processing. HnRNP K is methylated at multiple sites in the glycine- and arginine-rich (RGG) motif. Using various RGG domain deletion mutants of hnRNP K as substrates, here we show by direct methylation assay that protein arginine methyltransferase 1 (PRMT1) methylated preferentially in a.a. 280-307 of the RGG motif. Kinetic analysis revealed that deletion of a.a. 280-307, but not a.a. 308-327, significantly inhibited rate of methylation. Importantly, nuclear localization of hnRNP K was significantly impaired in mutant hnRNP K lacking the PRMT1 methylation region or upon pharmacological inhibition of methylation. Together our results identify preferred PRMT1 methylation sequences of hnRNP K by direct methylation assay and implicate a role of arginine methylation in regulating intracellular distribution of hnRNP K.

  2. An investigation into heterogeneity in a single vein-type uranium ore deposit: Implications for nuclear forensics.

    PubMed

    Keatley, A C; Scott, T B; Davis, S; Jones, C P; Turner, P

    2015-12-01

    Minor element composition and rare earth element (REE) concentrations in nuclear materials are important as they are used within the field of nuclear forensics as an indicator of sample origin. However recent studies into uranium ores and uranium ore concentrates (UOCs) have shown significant elemental and isotopic heterogeneity from a single mine site such that some sites have shown higher variation within the mine site than that seen between multiple sites. The elemental composition of both uranium and gangue minerals within ore samples taken along a single mineral vein in South West England have been measured and reported here. The analysis of the samples was undertaken to determine the extent of the localised variation in key elements. Energy Dispersive X-ray spectroscopy (EDS) was used to analyse the gangue mineralogy and measure major element composition. Minor element composition and rare earth element (REE) concentrations were measured by Electron Probe Microanalysis (EPMA). The results confirm that a number of key elements, REE concentrations and patterns used for origin location do show significant variation within mine. Furthermore significant variation is also visible on a meter scale. In addition three separate uranium phases were identified within the vein which indicates multiple uranium mineralisation events. In light of these localised elemental variations it is recommended that representative sampling for an area is undertaken prior to establishing the REE pattern that may be used to identify the originating mine for an unknown ore sample and prior to investigating impact of ore processing on any arising REE patterns. PMID:26301831

  3. Comparison of Different Upscaling Methods for Predicting Thermal Conductivity of Complex Heterogeneous Materials System: Application on Nuclear Waste Forms

    SciTech Connect

    Li, Dongsheng; Sun, Xin; Khaleel, Mohammad A.

    2012-06-16

    To develop a strategy in thermal conductivity prediction of a complex heterogeneous materials system, loaded nuclear waste forms, the computational efficiency and accuracy of different upscaling methods have been evaluated. The effective thermal conductivity, obtained from microstructure information and local thermal conductivity of different components, is critical in predicting the life and performance of waste form during storage. Several methods, including the Taylor model, Sachs model, self-consistent model, and statistical upscaling method, were developed and implemented. Microstructure based finite element method (FEM) prediction results were used to as benchmark to determine the accuracy of the different upscaling methods. Micrographs from waste forms with varying waste loadings were used in the prediction of thermal conductivity in FEM and homogenization methods. Prediction results demonstrated that in term of efficiency, boundary models (e.g., Taylor model and Sachs model) are stronger than the self-consistent model, statistical upscaling method, and finite element method. However, when balancing computational efficiency and accuracy, statistical upscaling is a useful method in predicting effective thermal conductivity for nuclear waste forms.

  4. Reconstruction of the isotope activity content of heterogeneous nuclear waste drums.

    PubMed

    Krings, Thomas; Mauerhofer, Eric

    2012-07-01

    Radioactive waste must be characterized in order to verify its conformance with national regulations for intermediate storage or its disposal. Segmented gamma scanning (SGS) is a most widely applied non-destructive analytical technique for the characterization of radioactive waste drums. The isotope specific activity content is generally calculated assuming a homogeneous matrix and activity distribution for each measured drum segment. However, real radioactive waste drums exhibit non-uniform isotope and density distributions most affecting the reliability and accuracy of activities reconstruction in SGS. The presence of internal shielding structures in the waste drum contributes generally to a strong underestimation of the activity and this in particular for radioactive sources emitting low energy gamma-rays independently of their spatial distribution. In this work we present an improved method to quantify the activity of spatially concentrated gamma-emitting isotopes (point sources or hot spots) in heterogeneous waste drums with internal shielding structures. The isotope activity is reconstructed by numerical simulations and fits of the angular dependent count rate distribution recorded during the drum rotation in SGS using an analytical expression derived from a geometric model. First results of the improved method and enhancements of this method are shown and are compared to each other as well as to the conventional method which assumes a homogeneous matrix and activity distribution. It is shown that the new model improves the accuracy and the reliability of the activity reconstruction in SGS and that the presented algorithm is suitable with respect to the framework requirement of industrial application. PMID:22134026

  5. 26 CFR 1.468A-1T - Nuclear decommissioning costs; general rules (temporary).

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 6 2010-04-01 2010-04-01 false Nuclear decommissioning costs; general rules...-1T Nuclear decommissioning costs; general rules (temporary). (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income...

  6. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 6 2011-04-01 2011-04-01 false Nuclear decommissioning costs; general rules. 1...-1 Nuclear decommissioning costs; general rules. (a) Introduction. Section 468A provides an elective method for taking into account nuclear decommissioning costs for Federal income tax purposes. In...

  7. Ocean dynamic processes causing spatially heterogeneous distribution of sedimentary caesium-137 massively released from the Fukushima Daiichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Higashi, H.; Morino, Y.; Furuichi, N.; Ohara, T.

    2015-12-01

    Massive amounts of anthropogenic radiocaesium 137Cs that were released into the environment by the Fukushima Daiichi Nuclear Power Plant accident in March 2011 are widely known to have extensively migrated to Pacific Ocean sediment off of eastern Japan. Several recent reports have stated that the sedimentary 137Cs is now stable with a remarkably heterogeneous distribution. The present study elucidates ocean dynamic processes causing this heterogeneous sedimentary 137Cs distribution in and around the shelf off Fukushima and adjacent prefectures. We performed a numerical simulation of oceanic 137Cs behaviour for about 10 months after the accident, using a comprehensive dynamic model involving advection-diffusion transport in seawater, adsorption and desorption to and from particulate matter, sedimentation and suspension on and from the bottom, and vertical diffusion transport in the sediment. A notable simulated result was that the sedimentary 137Cs significantly accumulated in a swath just offshore of the shelf break (along the 50-100 m isobath) as in recent observations, although the seabed in the entire simulation domain was assumed to have ideal properties such as identical bulk density, uniform porosity, and aggregation of particles with a single grain diameter. This result indicated that the heterogeneous sedimentary 137Cs distribution was not necessarily a result of the spatial distribution of 137Cs sediment adsorptivity. The present simulation suggests that the shape of the swath is mainly associated with spatiotemporal variation between bottom shear stress in the shallow shelf (< 50 m depths) and that offshore of the shelf break. In a large part of the shallow shelf, the simulation indicated that strong bottom friction suspending particulate matter from the seabed frequently occurred via a periodic spring tide about every 2 weeks and via occasional strong wind. The sedimentary 137Cs thereby could hardly stay on the surface of the seabed with the result that

  8. Promoter-associated small double-stranded RNA interacts with heterogeneous nuclear ribonucleoprotein A2/B1 to induce transcriptional activation.

    PubMed

    Hu, Jia; Chen, Zhong; Xia, Ding; Wu, Jia; Xu, Hua; Ye, Zhang-Qun

    2012-11-01

    Several recent reports have demonstrated that small activating dsRNA [double-stranded RNA; saRNA (small activating dsRNA)] complementary to promoter regions can up-regulate gene expression in mammalian cells, a phenomenon termed RNAa (RNA activation). However, the mechanism of RNAa remains obscure with regard to what is the target molecule for promoter-targeted saRNA and what are the proteins involved in this process. p21Waf1/Cip1 (p21) [CDKN1A (cyclin-dependent kinase inhibitor 1A)], an important tumour suppressor gene, is among the genes that can be activated by RNAa in tumour cells. In the present study, we provide direct evidence that p21 promoter-targeted saRNA interact with its intended target on the p21 promoter to activate p21 expression. This process is associated with recruitment of RNA polymerase II and AGO2 (argonaute 2) protein to the saRNA-target site. Additionally, we found that several hnRNPs (heterogeneous nuclear ribonucleoproteins) (A1, A2/B1 and C1/C2) are associated with saRNA. Further studies show that hnRNPA2/B1 interacts with the saRNA in vivo and in vitro and is required for RNAa activity. These findings indicate that RNAa results from specific targeting of promoters and reveals additional mechanistic details of RNAa. PMID:23035981

  9. Characterisation of heterogeneous molybdate and chromate phase assemblages in model nuclear waste glasses by multinuclear magnetic resonance spectroscopy.

    PubMed

    Greer, Brandon J; Kroeker, Scott

    2012-05-28

    A series of sodium borosilicate glasses containing cesium, molybdenum, and chromium was prepared to investigate the partitioning of chromium amongst the glass and phase-separated crystalline molybdates. The precipitates were examined by (133)Cs, (23)Na, and (95)Mo MAS NMR, revealing a phase assemblage consisting of Na(2)MoO(4), Na(2)MoO(4)·2H(2)O, Cs(2)MoO(4), Cs(2)CrO(4), CsNaMoO(4)·2H(2)O, and Cs(3)Na(MoO(4))(2). (133)Cs MAS NMR indicates random substitution of Cr into the Mo sites of Cs(3)Na(MoO(4))(2) and provides a quantitative assessment of Cr incorporation. The sample compositions were verified by various analytical techniques and highlight the centrality of NMR in the identification and quantification of heterogeneous crystalline composites, including sensitivity to cationic substitution. The observation and facile interconversion of hydrated phases invites careful consideration of these materials for nuclear waste disposal. PMID:22532058

  10. Heterogeneous Nuclear Ribonucleoprotein L is required for the survival and functional integrity of murine hematopoietic stem cells

    PubMed Central

    Gaudreau, Marie-Claude; Grapton, Damien; Helness, Anne; Vadnais, Charles; Fraszczak, Jennifer; Shooshtarizadeh, Peiman; Wilhelm, Brian; Robert, François; Heyd, Florian; Möröy, Tarik

    2016-01-01

    The proliferation and survival of hematopoietic stem cells (HSCs) has to be strictly coordinated to ensure the timely production of all blood cells. Here we report that the splice factor and RNA binding protein hnRNP L (heterogeneous nuclear ribonucleoprotein L) is required for hematopoiesis, since its genetic ablation in mice reduces almost all blood cell lineages and causes premature death of the animals. In agreement with this, we observed that hnRNP L deficient HSCs lack both the ability to self-renew and foster hematopoietic differentiation in transplanted hosts. They also display mitochondrial dysfunction, elevated levels of γH2AX, are Annexin V positive and incorporate propidium iodide indicating that they undergo cell death. Lin-c-Kit+ fetal liver cells from hnRNP L deficient mice show high p53 protein levels and up-regulation of p53 target genes. In addition, cells lacking hnRNP L up-regulated the expression of the death receptors TrailR2 and CD95/Fas and show Caspase-3, Caspase-8 and Parp cleavage. Treatment with the pan-caspase inhibitor Z-VAD-fmk, but not the deletion of p53, restored cell survival in hnRNP L deficient cells. Our data suggest that hnRNP L is critical for the survival and functional integrity of HSCs by restricting the activation of caspase-dependent death receptor pathways. PMID:27271479

  11. Dynamics of cross polarization in solid state nuclear magnetic resonance experiments of amorphous and heterogeneous natural organic substances.

    PubMed

    Conte, Pellegrino; Berns, Anne E

    2008-09-01

    Nuclear magnetic resonance (NMR) experiments on carbon-13 in the solid state were done with cross polarization (CP) and magic angle spinning (MAS) in order to overcome the low NMR sensitivity of (13)C and the chemical shift anisotropy, respectively. In the present research, CPMAS (13)C-NMR spectra were collected by modulating the contact time needed for cross polarization (variable contact times experiments, VCT) on two different humic acids (a soil-HA and a coal-HA). VCT data were fitted by a model containing either a monotonic or a non-monotonic cross polarization term. The non-monotonic model, which fitted the experimental results better than the monotonic one, provided two cross-polarization rates, thereby suggesting that two different mechanisms for the energy transfer from protons to carbons arise in amorphous and heterogeneous humic substances. The first mechanism was a fast proton-to-carbon energy transfer due to protons directly bound to carbons. The second mechanism was related to a slow transfer mediated by local segmental motions. Different domains in the humic acids were identified. Soil-HA was made of rigid domains, containing mainly aromatic and carboxylic moieties, and fast moving domains, containing alkyl, C-O and C-O groups. Coal-HA showed a rigid aromatic domain that was differentiated from a very mobile domain made of alkyl and COOH groups. PMID:18781033

  12. Heterogeneous Nuclear Ribonucleoprotein L is required for the survival and functional integrity of murine hematopoietic stem cells.

    PubMed

    Gaudreau, Marie-Claude; Grapton, Damien; Helness, Anne; Vadnais, Charles; Fraszczak, Jennifer; Shooshtarizadeh, Peiman; Wilhelm, Brian; Robert, François; Heyd, Florian; Möröy, Tarik

    2016-01-01

    The proliferation and survival of hematopoietic stem cells (HSCs) has to be strictly coordinated to ensure the timely production of all blood cells. Here we report that the splice factor and RNA binding protein hnRNP L (heterogeneous nuclear ribonucleoprotein L) is required for hematopoiesis, since its genetic ablation in mice reduces almost all blood cell lineages and causes premature death of the animals. In agreement with this, we observed that hnRNP L deficient HSCs lack both the ability to self-renew and foster hematopoietic differentiation in transplanted hosts. They also display mitochondrial dysfunction, elevated levels of γH2AX, are Annexin V positive and incorporate propidium iodide indicating that they undergo cell death. Lin(-)c-Kit(+) fetal liver cells from hnRNP L deficient mice show high p53 protein levels and up-regulation of p53 target genes. In addition, cells lacking hnRNP L up-regulated the expression of the death receptors TrailR2 and CD95/Fas and show Caspase-3, Caspase-8 and Parp cleavage. Treatment with the pan-caspase inhibitor Z-VAD-fmk, but not the deletion of p53, restored cell survival in hnRNP L deficient cells. Our data suggest that hnRNP L is critical for the survival and functional integrity of HSCs by restricting the activation of caspase-dependent death receptor pathways. PMID:27271479

  13. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    SciTech Connect

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo . E-mail: sueokae@post.saga-med.ac.jp

    2005-08-05

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression.

  14. Experimental results from pressure testing a 1:6-scale nuclear power plant containment

    SciTech Connect

    Horschel, D.S.

    1992-01-01

    This report discusses the testing of a 1:6-scale, reinforced-concrete containment building at Sandia National Laboratories, in Albuquerque, New Mexico. The scale-model, Light Water Reactor (LWR) containment building was designed and built to the American Society of Mechanical Engineers (ASME) code by United Engineers and Constructors, Inc., and was instrumented with over 1200 transducers to prepare for the test. The containment model was tested to failure to determine its response to static internal overpressurization. As part of the US Nuclear Regulatory Commission`s program on containment integrity, the test results will be used to assess the capability of analytical methods to predict the performance of containments under severe-accident loads. The scaled dimensions of the cylindrical wall and hemispherical dome were typical of a full-size containment. Other typical features included in the heavily reinforced model were equipment hatches, personnel air locks, several small piping penetrations, and a ihin steel liner that was attached to the concrete by headed studs. In addition to the transducers attached to the model, an acoustic detection system and several video and still cameras were used during testing to gather data and to aid in the conduct of the test. The model and its instrumentation are briefly discussed, and is followed by the testing procedures and measured response of the containment model. A summary discussion is included to aid in understanding the significance of the test as it applies to real world reinforced concrete containment structures. The data gathered during SIT and overpressure testing are included as an appendix.

  15. Isolation and characterization of the heterogeneous nuclear RNA-ribonucleoprotein complex

    SciTech Connect

    Choi, Y.D.

    1985-01-01

    Exposure of cells to UV light of sufficient intensity brings about crosslinking of RNA to proteins which are in direct contact with it in vivo. The major (/sup 35/S)methionine-labeled proteins which become crosslinked to poly(A)/sup +/hnRNA in HeLa cells are of 120K, 68K, 53K, 43K, 41K, 38K, and 36K (K = kilodaltons). By immunizing mice with UV crosslinked complexes two monoclonal antibodies (2B12 and 4F4) against the C proteins (41K and 43K) and one (3G6) against the 120K protein of the hnRNP complex were obtained. Immunofluorescence microscopy demonstrates that the C proteins and 120K are segregated to the nucleus and are not associated with nucleoli or chromatin. The two C proteins are highly related to each other antigenically. Monoclonal antibody 4F4 identifies the C proteins of the hnRNP complex in widely divergent species from human to lizard. The C proteins are phosphorylated and are in contact with hnRNA in vivo. The hnRNP complex was isolated from vertebrate cell nuclei by immunoprecipitation with these monoclonal antibodies. This complex contains proteins and hnRNA of up to approx.10 kb. The major steady state labeled (/sup 35/S)methionine labeled proteins of the isolated complex from HeLa cells are of 34K, 36K, 36K (A1 and A2), 37K, 38K (B1 and B2), 41K, 43K (C1 and C2) and doublets at 68K and at 120K. These proteins are organized into a 30S particle. Large hnRNP complexes are composed of multiples of 30S particles which are connected by highly nuclease sensitive stretches of hnRNA. It it concluded that the hnRNP structure is an integral component of the mRNA formation pathway in the eukaryotic cell.

  16. Primary structure of human nuclear ribonucleoprotein particle C proteins: conservation of sequence and domain structures in heterogeneous nuclear RNA, mRNA, and pre-rRNA-binding proteins.

    PubMed Central

    Swanson, M S; Nakagawa, T Y; LeVan, K; Dreyfuss, G

    1987-01-01

    RNA-binding site, and a carboxy terminus that is very negatively charged, contains no aromatic amino acids or prolines, and contains a putative nucleoside triphosphate-binding fold, as well as a phosphorylation site for casein kinase type II. The RNP consensus sequence was also found in the yeast poly(A)-binding protein (PABP), the heterogeneous nuclear RNA-binding proteins A1 and A2, and the pre-rRNA binding protein C23. All of these proteins are also composed of at least two distinct domains: an amino terminus, which possesses one or more RNP consensus sequences, and a carboxy terminus, which is unique to each protein, being very acidic in the C proteins and rich in glycine in A1, and C23 and rich in proline in the poly(A)-binding protein. These findings suggest that the amino terminus of these proteins possesses a highly conserved RNA-binding domain, whereas the carboxy terminus contains a region essential to the unique function and interactions of each of the RNA-binding proteins. Images PMID:3110598

  17. Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells

    SciTech Connect

    Sugimasa, Hironobu; Taniue, Kenzui; Kurimoto, Akiko; Takeda, Yasuko; Kawasaki, Yoshihiro; Akiyama, Tetsu

    2015-03-27

    Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein involved in transcription, mRNA splicing, mRNA stabilization and translation. Although hnRNP K has been suggested to play a role in the development of many cancers, its molecular function in colorectal cancer has remained elusive. Here we show that hnRNP K plays an important role in the mitotic process in HCT116 colon cancer cells. Furthermore, we demonstrate that hnRNP K directly transactivates the NUF2 gene, the product of which is a component of the NDC80 kinetochore complex and which is known to be critical for a stable spindle microtubule-kinetochore attachment. In addition, knockdown of both hnRNP K and NUF2 caused failure in metaphase chromosome alignment and drastic decrease in the growth of colon cancer cells. These results suggest that the hnRNP K-NUF2 axis is important for the mitotic process and proliferation of colon cancer cells and that this axis could be a target for the therapy of colon cancer. - Highlights: • hnRNP K is required for the tumorigenicity of colon cancer cells. • hnRNP K binds to the promoter region of NUF2 and activates its transcription. • NUF2 expression is correlated with hnRNP K expression in colorectal cancer tissue. • hnRNP K and NUF2 are required for metaphase chromosome alignment. • The hnRNP K-NUF2 axis is important for the proliferation of colon cancer cells.

  18. Heterogeneous Nuclear Ribonucleoprotein C1/C2 Controls the Metastatic Potential of Glioblastoma by Regulating PDCD4

    PubMed Central

    Park, Young Mi; Hwang, Su Jin; Masuda, Kiyoshi; Choi, Kyung-Min; Jeong, Mi-Ran; Nam, Do-Hyun

    2012-01-01

    MicroRNAs (miRNAs) have been implicated in the pathogenesis and progression of brain tumors. miR-21 is one of the most highly overexpressed miRNAs in glioblastoma multiforme (GBM), and its level of expression correlates with the tumor grade. Programmed cell death 4 (PDCD4) is a well-known miR-21 target and is frequently downregulated in glioblastomas in accordance with increased miR-21 expression. Downregulation of miR-21 or overexpression of PDCD4 can inhibit metastasis. Here, we investigate the role of heterogeneous nuclear ribonucleoprotein C1/C2 (hnRNPC) in the metastatic potential of the glioblastoma cell line T98G. hnRNPC bound directly to primary miR-21 (pri-miR-21) and promoted miR-21 expression in T98G cells. Silencing of hnRNPC lowered miR-21 levels, in turn increasing the expression of PDCD4, suppressing Akt and p70S6K activation, and inhibiting migratory and invasive activities. Silencing of hnRNPC reduced cell proliferation and enhanced etoposide-induced apoptosis. In support of a role for hnRNPC in the invasiveness of GBM, highly aggressive U87MG cells showed higher hnRNPC expression levels and hnRNPC abundance in tissue arrays and also showed elevated levels as a function of brain tumor grade. Taken together, our data indicate that hnRNPC controls the aggressiveness of GBM cells through the regulation of PDCD4, underscoring the potential usefulness of hnRNPC as a prognostic and therapeutic marker of GBM. PMID:22907752

  19. A novel SDS-stable dimer of a heterogeneous nuclear ribonucleoprotein at presynaptic terminals of squid neurons.

    PubMed

    Lico, D T P; Lopes, G S; Brusco, J; Rosa, J C; Gould, R M; De Giorgis, J A; Larson, R E

    2015-08-01

    The presence of mRNAs in synaptic terminals and their regulated translation are important factors in neuronal communication and plasticity. Heterogeneous nuclear ribonucleoprotein (hnRNP) complexes are involved in the translocation, stability, and subcellular localization of mRNA and the regulation of its translation. Defects in these processes and mutations in components of the hnRNP complexes have been related to the formation of cytoplasmic inclusion bodies and neurodegenerative diseases. Despite much data on mRNA localization and evidence for protein synthesis, as well as the presence of translation machinery, in axons and presynaptic terminals, the identity of RNA-binding proteins involved in RNA transport and function in presynaptic regions is lacking. We previously characterized a strongly basic RNA-binding protein (p65), member of the hnRNPA/B subfamily, in squid presynaptic terminals. Intriguingly, in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), p65 migrated as a 65-kDa protein, whereas members of the hnRNPA/B family typically have molecular masses ranging from 35 to 42kDa. In this report we present further biochemical and molecular characterization that shows endogenous p65 to be an SDS-stable dimer composed of ∼37-kDa hnRNPA/B-like subunits. We cloned and expressed a recombinant protein corresponding to squid hnRNPA/B-like protein and showed its propensity to aggregate and form SDS-stable dimers in vitro. Our data suggest that this unique hnRNPA/B-like protein co-localizes with synaptic vesicle protein 2 and RNA-binding protein ELAV and thus may serve as a link between local mRNA processing and presynaptic function and regulation. PMID:26012490

  20. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... the furnishing or sale of electric energy. Each unit (that is, nuclear reactor) located on a multi... electric energy or has permanently ceased to produce electric energy. Such term includes all otherwise... approves rates for the furnishing or sale of electric energy. (8) The term ratemaking proceeding means...

  1. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... the furnishing or sale of electric energy. Each unit (that is, nuclear reactor) located on a multi... electric energy or has permanently ceased to produce electric energy. Such term includes all otherwise... approves rates for the furnishing or sale of electric energy. (8) The term ratemaking proceeding means...

  2. 26 CFR 1.468A-1 - Nuclear decommissioning costs; general rules.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... the furnishing or sale of electric energy. Each unit (that is, nuclear reactor) located on a multi... electric energy or has permanently ceased to produce electric energy. Such term includes all otherwise... approves rates for the furnishing or sale of electric energy. (8) The term ratemaking proceeding means...

  3. Non-genomic effects of the NR4A1/Nur77/TR3/NGFIB orphan nuclear receptor.

    PubMed

    Pawlak, Alicja; Strzadala, Leon; Kalas, Wojciech

    2015-03-01

    The orphan nuclear receptor NR4A1/Nur77/TR3/NGFIB acts primarily as a transcription factor to regulate the expression of multiple genes. However, increasing research attention has recently been given to non-genomic activities of NR4A1. The first description of a non-genomic action of NR4A1 referred to the conversion of anti-apoptotic Bcl-2 into a pro-apoptotic protein by direct interaction with NR4A1. In response to certain apoptotic stimuli, NR4A1 translocates from the nucleus to the mitochondrial outer membrane (MOM) where it associates with Bcl-2 and thereby causes apoptosis. Afterwards, it appeared that NR4A1 could also bind and convert other anti-apoptotic Bcl-2 family members. The latest studies indicate a significant role of NR4A1 in the process of autophagy. For example, a new NR4A1-mediated pathway specific for melanoma cells has been described where NR4A1 interacts with the adenine nucleotide translocase 1 (ANT1) on the mitochondrial inner membrane (MIM) leading to induction of the autophagy pathway. Moreover, NR4A1 interaction with cytoplasmic p53 may also contribute to the induction of autophagy. In addition to mitochondria, NR4A1 could be translocated to the outer membrane of the endoplasmic reticulum (ER) and associate with Bcl-2 or translocon-associated protein subunit γ (TRAPγ) causing ER stress-induced apoptosis. NR4A1 also contributes to the proteasomal degradation of β-catenin in colon cancer cells in vitro and in vivo, as well as to the stabilization of hypoxia-inducible factor-1α (HIF-1α) under non-hypoxic conditions. This review summarizes research findings on non-genomic effects of NR4A1 in normal and cancer cells. PMID:25555471

  4. Negative Effects of SRD5A1 on Nuclear Activity of Progesterone Receptor Isoform B in JEG3 Cells.

    PubMed

    Miao, Zhuo; Sun, Min; Jiang, Feng; Yao, Yuanqing; Li, Yi

    2016-02-01

    Progesterone withdrawal signals labor in mammals. Elevated intracellular metabolism contributes to progesterone functional withdrawal through unknown mechanism, which is thought to act via progesterone receptor (PR). This study aims to investigate molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. We investigated the role of 5α-reductase type I (SRD5A1) in enzymatic catalysis of progesterone and loss of PR function in a human trophoblast choriocarcinoma cell line JEG3. The PR isoform B (PR-B) was robustly expressed in JEG3 cells. The SRD5A1 small-interfering RNA knockdown led to significant increase in PR-B nuclear import, ectopic, whereas SRD5A1 overexpression resulted in remarkable inhibition of nuclear PR-B in P4-treated cells. Repression of SRD5A1 activated PR-B responsive gene, whereas overexpression of SRD5A1 possessed an inhibitory effect. JEG3 cell line is a valuable tool to study mechanisms responsible for loss of PR function and screening of drugs for preterm birth treatment. Our study aims to investigate the molecular mechanisms underlying progesterone withdrawal during pregnancy and labor. PMID:26243543

  5. The autism-related gene SNRPN regulates cortical and spine development via controlling nuclear receptor Nr4a1.

    PubMed

    Li, Huiping; Zhao, Pingping; Xu, Qiong; Shan, Shifang; Hu, Chunchun; Qiu, Zilong; Xu, Xiu

    2016-01-01

    The small nuclear ribonucleoprotein polypeptide N (SNRPN) gene, encoding the RNA-associated SmN protein, duplications or deletions of which are strongly associated with neurodevelopmental disabilities. SNRPN-coding protein is highly expressed in the brain. However, the role of SNRPN protein in neural development remains largely unknown. Here we showed that the expression of SNRPN increased markedly during postnatal brain development. Overexpression or knockdown of SNRPN in cortical neurons impaired neurite outgrowth, neuron migration, and the distribution of dendritic spines. We found that SNRPN regulated the expression level of Nr4a1, a critical nuclear receptor during neural development, in cultured primary cortical neurons. The abnormal spine development caused by SNRPN overexpression could be fully rescued by Nr4a1 co-expression. Importantly, we found that either knockdown of Nr4a1 or 3, 3'- Diindolylmethane (DIM), an Nr4a1 antagonist, were able to rescue the effects of SNRPN knockdown on neurite outgrowth of embryonic cortical neurons, providing the potential therapeutic methods for SNRPN deletion disorders. We thus concluded that maintaining the proper level of SNRPN is critical in cortical neurodevelopment. Finally, Nr4a1 may serve as a potential drug target for SNRPN-related neurodevelopmental disabilities, including Prader-Willi syndrome (PWS) and autism spectrum disorders (ASDs). PMID:27430727

  6. The autism-related gene SNRPN regulates cortical and spine development via controlling nuclear receptor Nr4a1

    PubMed Central

    Li, Huiping; Zhao, Pingping; Xu, Qiong; Shan, Shifang; Hu, Chunchun; Qiu, Zilong; Xu, Xiu

    2016-01-01

    The small nuclear ribonucleoprotein polypeptide N (SNRPN) gene, encoding the RNA-associated SmN protein, duplications or deletions of which are strongly associated with neurodevelopmental disabilities. SNRPN-coding protein is highly expressed in the brain. However, the role of SNRPN protein in neural development remains largely unknown. Here we showed that the expression of SNRPN increased markedly during postnatal brain development. Overexpression or knockdown of SNRPN in cortical neurons impaired neurite outgrowth, neuron migration, and the distribution of dendritic spines. We found that SNRPN regulated the expression level of Nr4a1, a critical nuclear receptor during neural development, in cultured primary cortical neurons. The abnormal spine development caused by SNRPN overexpression could be fully rescued by Nr4a1 co-expression. Importantly, we found that either knockdown of Nr4a1 or 3, 3′- Diindolylmethane (DIM), an Nr4a1 antagonist, were able to rescue the effects of SNRPN knockdown on neurite outgrowth of embryonic cortical neurons, providing the potential therapeutic methods for SNRPN deletion disorders. We thus concluded that maintaining the proper level of SNRPN is critical in cortical neurodevelopment. Finally, Nr4a1 may serve as a potential drug target for SNRPN-related neurodevelopmental disabilities, including Prader-Willi syndrome (PWS) and autism spectrum disorders (ASDs). PMID:27430727

  7. CRYβA3/A1-Crystallin Knockout Develops Nuclear Cataract and Causes Impaired Lysosomal Cargo Clearance and Calpain Activation

    PubMed Central

    Hegde, Shylaja; Kesterson, Robert A.; Srivastava, Om P.

    2016-01-01

    βA3/A1-crystallin is an abundant structural protein of the lens that is very critical for lens function. Many different genetic mutations have been shown to associate with different types of cataracts in humans and in animal models. βA3/A1-crystallin has four Greek key-motifs that organize into two crystallin domains. It shown to bind calcium with moderate affinity and has putative calcium-binding site. Other than in the lens, βA3/A1 is also expressed in retinal astrocytes, retinal pigment epithelial (RPE) cells, and retinal ganglion cells. The function of βA3/A1-crystallin in the retinal cell types is well studied; however, a clear understanding of the function of this protein in the lens has not yet been established. In the current study, we generated the βA3/A1-crystallin knockout (KO) mouse and explored the function of βA3/A1-crystallin in lens development. Our results showed that βA3-KO mice develop congenital nuclear cataract and exhibit persistent fetal vasculature condition. At the cellular level KO lenses show defective lysosomal clearance and accumulation of nuclei, mitochondria, and autophagic cargo in the outer cortical region of the lens. In addition, the calcium level and the expression and activity of calpain-3 were increased in KO lenses. Taken together, these results suggest the lack of βA3-crystallin function in lenses, alters calcium homeostasis which in turn causes lysosomal defects and calpain activation. These defects are responsible for the development of nuclear cataract in KO lenses. PMID:26863613

  8. The rice RING finger E3 ligase, OsHCI1, drives nuclear export of multiple substrate proteins and its heterogeneous overexpression enhances acquired thermotolerance

    PubMed Central

    Lim, Sung Don; Cho, Hyun Yong; Park, Yong Chan; Ham, Deok Jae; Lee, Ju Kyong; Jang, Cheol Seong

    2013-01-01

    Thermotolerance is very important for plant survival when plants are subjected to lethally high temperature. However, thus far little is known about the functions of RING E3 ligase in response to heat shock in plants. This study found that one rice gene encoding the RING finger protein was specifically induced by heat and cold stress treatments but not by salinity or dehydration and named it OsHCI1 (Oryza sativa heat and cold induced 1). Subcellular localization results showed that OsHCI1 was mainly associated with the Golgi apparatus and moved rapidly and extensively along the cytoskeleton. In contrast, OsHCI1 may have accumulated in the nucleus under high temperatures. OsHCI1 physically interacted with nuclear substrate proteins including a basic helix-loop-helix transcription factor. Transient co-overexpression of OsHCI1 and each of three nuclear proteins showed that their fluorescent signals moved into the cytoplasm as punctuate formations. Heterogeneous overexpression of OsHCI1 in Arabidopsis highly increased survival rate through acquired thermotolerance. It is proposed that OsHCI1 mediates nuclear–cytoplasmic trafficking of nuclear substrate proteins via monoubiquitination and drives an inactivation device for the nuclear proteins under heat shock. PMID:23698632

  9. Isolation and characterization of a Xenopus laevis C protein cDNA: structure and expression of a heterogeneous nuclear ribonucleoprotein core protein.

    PubMed Central

    Preugschat, F; Wold, B

    1988-01-01

    The C proteins are major components of heterogeneous nuclear ribonucleoprotein complexes in nuclei of vertebrate cells. To begin to describe their structure, expression, and function we isolated and determined the DNA sequence of Xenopus laevis C protein cDNA clones. The protein predicted from the DNA sequence has a molecular mass of 30,916 kDa and is very similar to its human counterpart. Although mammalian genomes contain many copies of C protein sequence, the Xenopus genome contains few copies. When C protein RNA was synthesized in vitro and microinjected into stage-VI Xenopus oocytes, newly synthesized C proteins were efficiently localized in the nucleus. In vitro rabbit reticulocyte lysate and in vivo Xenopus oocyte translation systems both produce from a single mRNA two discrete polypeptide species that accumulate in a ratio similar to that of mammalian C1 and C2 proteins in vivo. Images PMID:2904678

  10. Early termination of heterogeneous nuclear RNA transcripts in mammalian cells: accentuation by 5,6-dichloro 1-beta-D-ribofuranosylbenzimidazole.

    PubMed Central

    Tamm, I; Kikuchi, T

    1979-01-01

    Labeling of RNA in isolated HeLa cell nuclei in vitro reveals an abundance of short RNA chains made by RNA polymerase II. These short chains were initiated prior to isolation of the nuclei. The short abundant chains are increased in amount in nuclei isolated from cells treated with 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB). Kinetic evidence indicates that the bulk of the putative heterogeneous nuclear RNA (hnRNA) precursor molecules that are terminated early in vivo are terminated approximately 100-300 nucleotides from sites of initiation. DRB increases the frequency of early termination, but there is a fraction of hnRNA precursor molecules whose elongation is not affected by DRB. Heparin is useful in studies of hnRNA transcription in isolated nuclei because it enhances chain elongation. Images PMID:293679

  11. Centromere Protein (CENP)-W Interacts with Heterogeneous Nuclear Ribonucleoprotein (hnRNP) U and May Contribute to Kinetochore-Microtubule Attachment in Mitotic Cells

    PubMed Central

    Chun, Younghwa; Kim, Raehyung; Lee, Soojin

    2016-01-01

    Background Recent studies have shown that heterogeneous nuclear ribonucleoprotein U (hnRNP U), a component of the hnRNP complex, contributes to stabilize the kinetochore-microtubule interaction during mitosis. CENP-W was identified as an inner centromere component that plays crucial roles in the formation of a functional kinetochore complex. Results We report that hnRNP U interacts with CENP-W, and the interaction between hnRNP U and CENP-W mutually increased each other’s protein stability by inhibiting the proteasome-mediated degradation. Further, their co-localization was observed chiefly in the nuclear matrix region and at the microtubule-kinetochore interface during interphase and mitosis, respectively. Both microtubule-stabilizing and microtubule-destabilizing agents significantly decreased the protein stability of CENP-W. Furthermore, loss of microtubules and defects in microtubule organization were observed in CENP-W-depleted cells. Conclusion Our data imply that CENP-W plays an important role in the attachment and interaction between microtubules and kinetochore during mitosis. PMID:26881882

  12. Rho-kinase signaling controls nucleocytoplasmic shuttling of class IIa Histone Deacetylase (HDAC7) and transcriptional activation of orphan nuclear receptor NR4A1

    SciTech Connect

    Compagnucci, Claudia; Barresi, Sabina; Petrini, Stefania; Bertini, Enrico; Zanni, Ginevra

    2015-04-03

    Rho-kinase (ROCK) has been well documented to play a key role in RhoA-induced actin remodeling. ROCK activation results in myosin light chain (MLC) phosphorylation either by direct action on MLC kinase (MLCK) or by inhibition of MLC phosphatase (MLCP), modulating actin–myosin contraction. We found that inhibition of the ROCK pathway in induced pluripotent stem cells, leads to nuclear export of HDAC7 and transcriptional activation of the orphan nuclear receptor NR4A1 while in cells with constitutive ROCK hyperactivity due to loss of function of the RhoGTPase activating protein Oligophrenin-1 (OPHN1), the orphan nuclear receptor NR4A1 is downregulated. Our study identify a new target of ROCK signaling via myosin phosphatase subunit (MYPT1) and Histone Deacetylase (HDAC7) at the nuclear level and provide new insights in the cellular functions of ROCK. - Highlights: • ROCK regulates nucleocytoplasmic shuttling of HDAC7 via phosphorylation of MYPT1. • Nuclear export of HDAC7 and upregulation of NR4A1 occurs with low ROCK activity. • High levels of ROCK activity due to OPHN1 loss of function downregulate NR4A1.

  13. Heterogeneous Catalysis.

    ERIC Educational Resources Information Center

    Miranda, R.

    1989-01-01

    Described is a heterogeneous catalysis course which has elements of materials processing embedded in the classical format of catalytic mechanisms and surface chemistry. A course outline and list of examples of recent review papers written by students are provided. (MVL)

  14. Nuclear factor XIIIa staining (clone AC-1A1 mouse monoclonal) is a sensitive and specific marker to discriminate sebaceous proliferations from other cutaneous clear cell neoplasms.

    PubMed

    Uhlenhake, Elizabeth E; Clark, Lindsey N; Smoller, Bruce R; Shalin, Sara C; Gardner, Jerad M

    2016-08-01

    Sebaceous carcinoma is a rare but serious malignancy that may be difficult to diagnose when poorly differentiated. Other epithelial tumors with clear cell change may mimic sebaceous carcinoma. Few useful or specific immunohistochemical markers for sebaceous differentiation are available. Nuclear staining with factor XIIIa (clone AC-1A1) was recently found to be a highly sensitive marker of sebaceous differentiation. We evaluated nuclear factor XIIIa (AC-1A1) staining in sebaceous neoplasms vs. other cutaneous clear cell tumors. We stained 27 sebaceous proliferations: sebaceous hyperplasia (7), sebaceous adenoma (8), sebaceoma (5), sebaceous carcinoma (7). We also stained 67 tumors with clear cell change: basal cell carcinoma (8), squamous cell carcinoma (8), hidradenoma (7), desmoplastic trichilemmoma (2), trichilemmoma (10), trichilemmal carcinoma (3), clear cell acanthoma (9), atypical fibroxanthoma (1), syringoma (8), trichoepithelioma (1), metastatic renal cell carcinoma (2), and nevi with balloon cell change (8). Nuclear factor XIIIa (AC-1A1) staining was present in 100% of sebaceous proliferations; 96% displayed strong staining. Non-sebaceous clear cell tumors were negative or only weakly positive with factor XIIIa (AC-1A1) in 95.5%; only 4.5% showed strong staining. This suggests that strong nuclear factor XIIIa (AC-1A1) staining is a sensitive and specific marker of sebaceous neoplasms vs. other clear cell tumors. PMID:27153339

  15. Identification of two RNA-binding proteins in Balbiani ring premessenger ribonucleoprotein granules and presence of these proteins in specific subsets of heterogeneous nuclear ribonucleoprotein particles.

    PubMed Central

    Wurtz-T; Kiseleva, E; Nacheva, G; Alzhanova-Ericcson, A; Rosén, A; Daneholt, B

    1996-01-01

    Balbiani ring (BR) granules are premessenger ribonucleoprotein particles (RNPs) generated in giant chromosomal puffs, the BRs, in the larval salivary glands of the dipteran chironomus tentans. Monoclonal antibodies were raised against nuclear proteins collected on a single-stranded-DNA-agarose affinity column, and two of them were used to identify RNA-binding proteins in BR granules. First, in Western blots (immunoblots), one of the antibodies recognized a 36-kDa protein and the other recognized a 45-KDa protein. Second, both antibodies bound to the BRs in immunocytological experiments. It was shown in cross-linking experiments that the two proteins are associated with heterogeneous nuclear RNP (hnRNP) complexes extracted from C. tentans nuclei. By immunoelectron microscopy of isolated and partly unfolded BR RNPs, it was specifically demonstrated that the BR granules contain the two proteins and, in addition, that both proteins are distributed frequently along the RNP fiber of the particles. Thus, the 36- and 45-KDa proteins are likely to be abundant, RNA-binding proteins in the BR particles. To elucidate to what extent the two proteins are also present in other hnRNPs, we studied the binding of the antibodies to chromosomal puffs in general. It was observed that many puffs in addition to the BRs harbor the two proteins, but there are also puffs containing only one of the components, either the 36- or the 45-kDa protein. We conclude that the two proteins are not randomly bound to all hnRNPs but that each of them seems to be linked to a specific subset of the particles. PMID:8657116

  16. Ocean dynamic processes causing spatially heterogeneous distribution of sedimentary caesium-137 massively released from the Fukushima Dai-ichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Higashi, H.; Morino, Y.; Furuichi, N.; Ohara, T.

    2015-08-01

    Massive amounts of anthropogenic radiocaesium 137Cs that was released into the environment by the Fukushima Dai-ichi Nuclear Power Plant accident on March 2011 are widely known to have extensively migrated to Pacific oceanic sediment off of east Japan. Several recent reports have stated that the sedimentary 137Cs is now stable with a remarkably heterogeneous distribution. The present study elucidates ocean dynamic processes causing this heterogeneous sedimentary 137Cs distribution in and around the shelf off Fukushima and adjacent prefectures. We performed a numerical simulation of oceanic 137Cs behaviour for about 10 months after the accident, using a comprehensive dynamic model involving advection-diffusion transport in seawater, adsorption and desorption to and from particulate matter, sedimentation and suspension on and from the bottom, and vertical diffusion transport in the sediment. A notable simulated result was that the sedimentary 137Cs significantly accumulated in a swath just offshore of the shelf break (along the 50-100 m isobath) as in recent observations, although the seabed in the entire simulation domain was assumed to have ideal properties such as identical bulk density, uniform porosity, and aggregation of particles with a single grain diameter. This result indicated that the heterogeneous sedimentary 137Cs distribution was not necessarily a result of the spatial distribution of 137Cs sediment adsorptivity. The present simulation suggests that the shape of the swath is mainly associated with spatiotemporal variation between bottom shear stress in the shallow shelf (< 50 m depths) and that offshore of the shelf break. In a large part of the shallow shelf, the simulation indicated that strong bottom friction suspending particulate matter from the seabed frequently occurred via a periodic spring tide about every 2 weeks and via occasional strong wind. The sedimentary 137Cs thereby could hardly stay on the surface of the seabed with the result that

  17. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses.

    PubMed

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. PMID:26923071

  18. Heterogeneous nuclear ribonucleoprotein (hnRNP) F is a novel component of oligodendroglial RNA transport granules contributing to regulation of myelin basic protein (MBP) synthesis.

    PubMed

    White, Robin; Gonsior, Constantin; Bauer, Nina M; Krämer-Albers, Eva-Maria; Luhmann, Heiko J; Trotter, Jacqueline

    2012-01-13

    Myelin basic protein (MBP) is a major component of central nervous system (CNS) myelin. The absence of MBP results in the loss of almost all compact myelin in the CNS. MBP mRNA is sorted into RNA granules that are transported to the periphery of oligodendrocytes in a translationally inactive state. A central mediator of this transport process is the trans-acting factor heterogeneous nuclear ribonucleoprotein (hnRNP) A2 that binds to the cis-acting A2-response element in the 3'UTR of MBP mRNA. Recently, we found that activation of the Src family nonreceptor tyrosine kinase Fyn in oligodendrocytes leads to phosphorylation of hnRNP A2 and to increased translation of MBP mRNA. Here, we identify the RNA-binding protein hnRNP F as a novel component of MBP mRNA transport granules. It is associated with hnRNP A2 and MBP mRNA in cytoplasmic granular structures and is involved in post-transcriptional regulation of MBP expression. Fyn kinase activity results in phosphorylation of hnRNP F in the cytoplasm and its release from MBP mRNA and RNA granules. Our results define hnRNP F as a regulatory element of MBP expression in oligodendrocytes and imply an important function of hnRNP F in the control of myelin synthesis. PMID:22128153

  19. Molecular Insights into the Coding Region Determinant-binding Protein-RNA Interaction through Site-directed Mutagenesis in the Heterogeneous Nuclear Ribonucleoprotein-K-homology Domains*

    PubMed Central

    Barnes, Mark; van Rensburg, Gerrit; Li, Wai-Ming; Mehmood, Kashif; Mackedenski, Sebastian; Chan, Ching-Man; King, Dustin T.; Miller, Andrew L.; Lee, Chow H.

    2015-01-01

    The ability of its four heterogeneous nuclear RNP-K-homology (KH) domains to physically associate with oncogenic mRNAs is a major criterion for the function of the coding region determinant-binding protein (CRD-BP). However, the particular RNA-binding role of each of the KH domains remains largely unresolved. Here, we mutated the first glycine to an aspartate in the universally conserved GXXG motif of the KH domain as an approach to investigate their role. Our results show that mutation of a single GXXG motif generally had no effect on binding, but the mutation in any two KH domains, with the exception of the combination of KH3 and KH4 domains, completely abrogated RNA binding in vitro and significantly retarded granule formation in zebrafish embryos, suggesting that any combination of at least two KH domains cooperate in tandem to bind RNA efficiently. Interestingly, we found that any single point mutation in one of the four KH domains significantly impacted CRD-BP binding to mRNAs in HeLa cells, suggesting that the dynamics of the CRD-BP-mRNA interaction vary over time in vivo. Furthermore, our results suggest that different mRNAs bind preferentially to distinct CRD-BP KH domains. The novel insights revealed in this study have important implications on the understanding of the oncogenic mechanism of CRD-BP as well as in the future design of inhibitors against CRD-BP function. PMID:25389298

  20. Heterogeneous nuclear ribonucleoprotein K and nucleolin as transcriptional activators of the vascular endothelial growth factor promoter through interaction with secondary DNA structures

    PubMed Central

    Uribe, Diana J.; Guo, Kexiao; Shin, Yoon-Joo; Sun, Daekyu

    2011-01-01

    The human vascular endothelial growth factor (VEGF) promoter contains a polypurine/polypyrimidine (pPu/pPy) tract that is known to play a critical role in its transcriptional regulation. This pPu/pPy tract undergoes a conformational transition between B-DNA, single stranded DNA and atypical secondary DNA structures such as G-quadruplexes and i-motifs. We studied the interaction of the cytosine-rich (C-rich) and guanine-rich (G-rich) strands of this tract with transcription factors heterogeneous nuclear ribonucleoprotein (hnRNP) K and nucleolin, respectively, both in vitro and in vivo and their potential role in the transcriptional control of VEGF. Using chromatin immunoprecipitation (ChIP) assay for our in vivo studies and electrophoretic mobility shift assay (EMSA) for our in vitro studies, we demonstrated that both nucleolin and hnRNP K bind selectively to the G- and C-rich sequences, respectively, in the pPu/pPy tract of the VEGF promoter. The small interfering RNA (siRNA)-mediated silencing of either nucleolin or hnRNP K resulted in the down-regulation of basal VEGF gene, suggesting that they act as activators of VEGF transcription. Taken together, the identification of transcription factors that can recognize and bind to atypical DNA structures within the pPu/pPy tract will provide new insight into mechanisms of transcriptional regulation of the VEGF gene. PMID:21466159

  1. Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA.

    PubMed

    Zaidi, S H; Malter, J S

    1995-07-21

    The central nervous system deposition by neurons and glia of beta A4 amyloid protein is an important contributing factor to the development of Alzheimer's disease. Amyloidogenic cells overexpress amyloid precursor protein (APP) mRNAs suggesting a transcriptional or post-transcriptional defect may contribute to this process. We have previously shown that APP mRNAs display regulated stability which is dependent on a 29-base element within the 3'-untranslated region (UTR). This domain specifically interacted with several cytoplasmic RNA-binding proteins. We have purified these APP RNA-binding proteins from a human T-cell leukemia and demonstrate that five cytoplasmic proteins of 70, 48, 47, 39, and 38 kDa form the previously observed APP RNA protein complexes. Amino acid sequence analyses showed that the 70-, 48-, and 47-kDa proteins were fragments of nucleolin and that the 39- and 38-kDa proteins were heterogeneous nuclear ribonucleoprotein (hnRNP) C protein. Northwestern and Western blot analyses of purified material further confirmed these data. Nucleolin protein is known to shuttle between the nucleus and cytoplasm but hnRNP C has not been reported within the cytoplasm. This report of sequence specific, mRNA binding by nucleolin and hnRNP C suggests that these proteins participate in the post-transcriptional regulation of APP mRNA through 3'-UTR, site-specific interactions. PMID:7615529

  2. Heterogeneous Nuclear Ribonucleoprotein (hnRNP) F Is a Novel Component of Oligodendroglial RNA Transport Granules Contributing to Regulation of Myelin Basic Protein (MBP) Synthesis*

    PubMed Central

    White, Robin; Gonsior, Constantin; Bauer, Nina M.; Krämer-Albers, Eva-Maria; Luhmann, Heiko J.; Trotter, Jacqueline

    2012-01-01

    Myelin basic protein (MBP) is a major component of central nervous system (CNS) myelin. The absence of MBP results in the loss of almost all compact myelin in the CNS. MBP mRNA is sorted into RNA granules that are transported to the periphery of oligodendrocytes in a translationally inactive state. A central mediator of this transport process is the trans-acting factor heterogeneous nuclear ribonucleoprotein (hnRNP) A2 that binds to the cis-acting A2-response element in the 3′UTR of MBP mRNA. Recently, we found that activation of the Src family nonreceptor tyrosine kinase Fyn in oligodendrocytes leads to phosphorylation of hnRNP A2 and to increased translation of MBP mRNA. Here, we identify the RNA-binding protein hnRNP F as a novel component of MBP mRNA transport granules. It is associated with hnRNP A2 and MBP mRNA in cytoplasmic granular structures and is involved in post-transcriptional regulation of MBP expression. Fyn kinase activity results in phosphorylation of hnRNP F in the cytoplasm and its release from MBP mRNA and RNA granules. Our results define hnRNP F as a regulatory element of MBP expression in oligodendrocytes and imply an important function of hnRNP F in the control of myelin synthesis. PMID:22128153

  3. Epidermal growth factor increases the interaction between nucleolin and heterogeneous nuclear ribonucleoprotein K/poly(C) binding protein 1 complex to regulate the gastrin mRNA turnover.

    PubMed

    Lee, Pin-Tse; Liao, Pao-Chi; Chang, Wen-Chang; Tseng, Joseph T

    2007-12-01

    Gastrin, a gastrointestinal hormone responsible for gastric acid secretion, has been confirmed as a growth factor for gastrointestinal tract malignancies. High expression of gastrin mRNA was observed in pancreatic and colorectal cancer; however, the mechanism is unclear. Epidermal growth factor (EGF) was found to increase gastrin mRNA stability, indicating mRNA turnover regulation mechanism is involved in the control of gastrin mRNA expression. Using biotin-labeled RNA probe pull-down assay combined with mass spectrometry analysis, we identified the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and poly(C) binding protein 1 (PCBP1) bound with the C-rich region in gastrin mRNA 3' untranslated region. Nucleolin bound with the AGCCCU motif and interacted with hnRNP K were also demonstrated. Under EGF treatment, we observed the amount of nucleolin interacting with hnRNP K and gastrin mRNA increased. Using small interfering RNA technology to define their functional roles, we found hnRNP K, PCBP1, and nucleolin were all responsible for stabilizing gastrin mRNA. Moreover, nucleolin plays a crucial role in mediating the increased gastrin mRNA stability induced by EGF signaling. Besides, we also observed hnRNP K/PCBP1 complex bound with the C-rich region in the gastrin mRNA increased nucleolin binding with gastrin mRNA. Finally, a novel binding model was proposed. PMID:17928403

  4. β-Cell deletion of Nr4a1 and Nr4a3 nuclear receptors impedes mitochondrial respiration and insulin secretion.

    PubMed

    Reynolds, Merrick S; Hancock, Chad R; Ray, Jason D; Kener, Kyle B; Draney, Carrie; Garland, Kevin; Hardman, Jeremy; Bikman, Benjamin T; Tessem, Jeffery S

    2016-07-01

    β-Cell insulin secretion is dependent on proper mitochondrial function. Various studies have clearly shown that the Nr4a family of orphan nuclear receptors is essential for fuel utilization and mitochondrial function in liver, muscle, and adipose. Previously, we have demonstrated that overexpression of Nr4a1 or Nr4a3 is sufficient to induce proliferation of pancreatic β-cells. In this study, we examined whether Nr4a expression impacts pancreatic β-cell mitochondrial function. Here, we show that β-cell mitochondrial respiration is dependent on the nuclear receptors Nr4a1 and Nr4a3. Mitochondrial respiration in permeabilized cells was significantly decreased in β-cells lacking Nr4a1 or Nr4a3. Furthermore, respiration rates of intact cells deficient for Nr4a1 or Nr4a3 in the presence of 16 mM glucose resulted in decreased glucose mediated oxygen consumption. Consistent with this reduction in respiration, a significant decrease in glucose-stimulated insulin secretion rates is observed with deletion of Nr4a1 or Nr4a3. Interestingly, the changes in respiration and insulin secretion occur without a reduction in mitochondrial content, suggesting decreased mitochondrial function. We establish that knockdown of Nr4a1 and Nr4a3 results in decreased expression of the mitochondrial dehydrogenase subunits Idh3g and Sdhb. We demonstrate that loss of Nr4a1 and Nr4a3 impedes production of ATP and ultimately inhibits glucose-stimulated insulin secretion. These data demonstrate for the first time that the orphan nuclear receptors Nr4a1 and Nr4a3 are critical for β-cell mitochondrial function and insulin secretion. PMID:27221116

  5. Orphan nuclear receptor oestrogen-related receptor γ (ERRγ) plays a key role in hepatic cannabinoid receptor type 1-mediated induction of CYP7A1 gene expression.

    PubMed

    Zhang, Yaochen; Kim, Don-Kyu; Lee, Ji-Min; Park, Seung Bum; Jeong, Won-Il; Kim, Seong Heon; Lee, In-Kyu; Lee, Chul-Ho; Chiang, John Y L; Choi, Hueng-Sik

    2015-09-01

    Bile acids are primarily synthesized from cholesterol in the liver and have important roles in dietary lipid absorption and cholesterol homoeostasis. Detailed roles of the orphan nuclear receptors regulating cholesterol 7α-hydroxylase (CYP7A1), the rate-limiting enzyme in bile acid synthesis, have not yet been fully elucidated. In the present study, we report that oestrogen-related receptor γ (ERRγ) is a novel transcriptional regulator of CYP7A1 expression. Activation of cannabinoid receptor type 1 (CB1 receptor) signalling induced ERRγ-mediated transcription of the CYP7A1 gene. Overexpression of ERRγ increased CYP7A1 expression in vitro and in vivo, whereas knockdown of ERRγ attenuated CYP7A1 expression. Deletion analysis of the CYP7A1 gene promoter and a ChIP assay revealed an ERRγ-binding site on the CYP7A1 gene promoter. Small heterodimer partner (SHP) inhibited the transcriptional activity of ERRγ and thus regulated CYP7A1 expression. Overexpression of ERRγ led to increased bile acid levels, whereas an inverse agonist of ERRγ, GSK5182, reduced CYP7A1 expression and bile acid synthesis. Finally, GSK5182 significantly reduced hepatic CB1 receptor-mediated induction of CYP7A1 expression and bile acid synthesis in alcohol-treated mice. These results provide the molecular mechanism linking ERRγ and bile acid metabolism. PMID:26348907

  6. Heterogeneous Nuclear Ribonucleoprotein (hnRNP) E1 Binds to hnRNP A2 and Inhibits Translation of A2 Response Element mRNAs

    PubMed Central

    Kosturko, Linda D.; Maggipinto, Michael J.; Korza, George; Lee, Joo Won; Carson, John H.

    2006-01-01

    Heterogeneous nuclear ribonucleoprotein (hnRNP) A2 is a trans-acting RNA-binding protein that mediates trafficking of RNAs containing the cis-acting A2 response element (A2RE). Previous work has shown that A2RE RNAs are transported to myelin in oligodendrocytes and to dendrites in neurons. hnRNP E1 is an RNA-binding protein that regulates translation of specific mRNAs. Here, we show by yeast two-hybrid analysis, in vivo and in vitro coimmunoprecipitation, in vitro cross-linking, and fluorescence correlation spectroscopy that hnRNP E1 binds to hnRNP A2 and is recruited to A2RE RNA in an hnRNP A2-dependent manner. hnRNP E1 is colocalized with hnRNP A2 and A2RE mRNA in granules in dendrites of oligodendrocytes. Overexpression of hnRNP E1 or microinjection of exogenous hnRNP E1 in neural cells inhibits translation of A2RE mRNA, but not of non-A2RE RNA. Excess hnRNP E1 added to an in vitro translation system reduces translation efficiency of A2RE mRNA, but not of nonA2RE RNA, in an hnRNP A2-dependent manner. These results are consistent with a model where hnRNP E1 recruited to A2RE RNA granules by binding to hnRNP A2 inhibits translation of A2RE RNA during granule transport. PMID:16775011

  7. Radiosensitization and downregulation of heterogeneous nuclear ribonucleoprotein K (hnRNP K) upon inhibition of mitogen/extracellular signal-regulated kinase (MEK) in malignant melanoma cells

    PubMed Central

    Eder, Stefan; Lamkowski, Andreas; Priller, Markus; Port, Matthias; Steinestel, Konrad

    2015-01-01

    Background Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is an important cofactor in the p53-mediated DNA damage response pathway upon ionizing radiation (IR) and exerts anti-apoptotic effects also independent of p53 pathway activation. Furthermore, hnRNP K is overexpressed in various neoplasms including malignant melanoma (MM). Here, we investigate the role of hnRNP K in the radioresistance of MM cells. Methods and results Our results show cytoplasmic expression of hnRNP K in human MM surgical specimens, but not in benign nevi, and a quick dose- and time-dependent upregulation in response to IR accompanied by cytoplasmic redistribution of the protein in the IPC-298 cellular tumor model carrying an activating NRAS mutation (p.Q61L). SiRNA-based knockdown of hnRNP K induced a delayed decline in γH2AX/53BP1-positive DNA repair foci upon IR. Pharmacological interference with MAPK signaling abrogated ERK phosphorylation, diminished cellular hnRNP K levels, impaired γH2AX/53BP1-foci repair and proliferative capability and increased apoptosis comparable to the observed hnRNP K knockdown phenotype in IPC-298 cells. Conclusion Our results indicate that pharmacological interference with MAPK signaling increases vulnerability of NRAS-mutant malignant melanoma cells to ionizing radiation along with downregulation of endogenous hnRNP K and point towards a possible use for combined MEK inhibition and localized radiation therapy of MM in the NRAS-mutant setting where BRAF inhibitors offer no clinical benefit. PMID:26136337

  8. The orphan nuclear receptor NR4A1 specifies a distinct subpopulation of quiescent myeloid-biased long-term HSCs.

    PubMed

    Land, Ruben H; Rayne, Anna K; Vanderbeck, Ashley N; Barlowe, Trevor S; Manjunath, Shwetha; Gross, Matthew; Eiger, Sophie; Klein, Peter S; Cunningham, Nicole R; Huang, Jian; Emerson, Stephen G; Punt, Jennifer A

    2015-01-01

    Hematopoiesis is maintained throughout life by self-renewing hematopoietic stem cells (HSCs) that differentiate to produce both myeloid and lymphoid cells. The NR4A family of orphan nuclear receptors, which regulates cell fate in many tissues, appears to play a key role in HSC proliferation and differentiation. Using a NR4A1(GFP) BAC transgenic reporter mouse we have investigated NR4A1 expression and its regulation in early hematopoiesis. We show that NR4A1 is most highly expressed in a subset of Lin(-) Sca-1(+) c-Kit(+) CD48(-) CD150(+) long-term (LT) HSCs, and its expression is tightly associated with HSC quiescence. We also show that NR4A1 expression in HSCs is induced by PGE2, a known enhancer of stem cell engraftment potential. Finally, we find that both NR4A1(GFP+) and NR4A1(GFP-) HSCs successfully engraft primary and secondary irradiated hosts; however, NR4A1(GFP+) HSCs are distinctly myeloid-biased. These results show that NR4A1 expression identifies a highly quiescent and distinct population of myeloid-biased LT-HSCs. PMID:25284014

  9. The orphan nuclear receptor NR4A1 specifies a distinct subpopulation of quiescent myeloid-biased long-term HSCs

    PubMed Central

    Land, Ruben H.; Rayne, Anna K.; Vanderbeck, Ashley N.; Barlowe, Trevor S.; Manjunath, Shwetha; Gross, Matthew; Eiger, Sophie; Klein, Peter S.; Cunningham, Nicole R.; Huang, Jian; Emerson, Stephen G.; Punt, Jennifer A.

    2014-01-01

    Hematopoiesis is maintained throughout life by self-renewing hematopoietic stem cells (HSCs) that differentiate to produce both myeloid and lymphoid cells. The NR4A family of orphan nuclear receptors, which regulates cell fate in many tissues, appears to play a key role in HSC proliferation and differentiation. Using a NR4A1GFP BAC transgenic reporter mouse we have investigated NR4A1 expression and its regulation in early hematopoiesis. We show that NR4A1 is most highly expressed in a subset of Lin−Sca-1+c-Kit+ CD48−CD150+ long-term (LT) HSCs, and its expression is tightly associated with HSC quiescence. We also show that NR4A1 expression in HSCs is induced by PGE2, a known enhancer of stem cell engraftment potential. Finally, we find that both NR4A1GFP+ and NR4A1GFP− HSCs successfully engraft primary and secondary irradiated hosts; however, NR4A1GFP+ HSCs are distinctly myeloid-biased. These results show that NR4A1 expression identifies a highly quiescent and distinct population of myeloid-biased LT-HSCs. PMID:25284014

  10. Phorbol ester treatment to mice inhibits DNA binding of the TCDD inducible nuclear dioxin-receptor to Cyp1A1 enhancer elements

    SciTech Connect

    Okino, S.T.; Tukey, R.H. )

    1991-03-15

    The treatment of C57BL/6 mice with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) results in transcriptional activation of the Cyp1A1 and Cyp1A2 genes. Quantitation of mRNA levels and transcription rates demonstrate that post-transcriptional mechanisms are not involved in TCDD induction of the Cyp1A genes. The induction of the Cyp1A genes by TCDD occurs following ligand binding to the dioxin-receptor and accumulation of the ligand-receptor complex in the nucleus. The administration of the tumor promoting agent 12-O-tetradecanoylphorbol-13-acetate (TPA) before or in combination with the administration of TCDD inhibits transcriptional activation of the Cyp1A genes. To analyze the mechanism of this inhibition, methods were developed to determine if the DNA binding potential of the nuclear dioxin-receptor was impaired. Using an oligonucleotide covering the Cyp1A1 xenobiotic responsive element (XRE), gel retardation assays demonstrated that within 1 hour, TCDD induces a nuclear DNA binding protein. This bonding is completely inhibited when incubated with excess XRE. Transcriptional increases in the Cyp1A1 and Cyp1A2 gene follow the appearance of the nuclear dioxin-receptor. When TPA is administered together with TCDD, the ligand dependent accumulation of the nuclear dioxin-receptor is abolished. Similar results are observed if TPA is administered prior to treatment with TCDD. These results indicate that TPA inhibits TCDD induced activation of the Cyp1A genes through a receptor mediated mechanism.

  11. The C-protein tetramer binds 230 to 240 nucleotides of pre-mRNA and nucleates the assembly of 40S heterogeneous nuclear ribonucleoprotein particles.

    PubMed Central

    Huang, M; Rech, J E; Northington, S J; Flicker, P F; Mayeda, A; Krainer, A R; LeStourgeon, W M

    1994-01-01

    A series of in vitro protein-RNA binding studies using purified native (C1)3C2 and (A2)3B1 tetramers, total soluble heterogeneous nuclear ribonucleoprotein (hnRNP), and pre-mRNA molecules differing in length and sequence have revealed that a single C-protein tetramer has an RNA site size of 230 to 240 nucleotides (nt). Two tetramers bind twice this RNA length, and three tetramers fold monoparticle lengths of RNA (700 nt) into a unique 19S triangular complex. In the absence of this unique structure, the basic A- and B-group proteins bind RNA to form several different artifactual structures which are not present in preparations of native hnRNP and which do not function in hnRNP assembly. Three (A2)3B1 tetramers bind the 19S complex to form a 35S assembly intermediate. Following UV irradiation to immobilize the C proteins on the packaged RNA, the 19S triangular complex is recovered as a remnant structure from both native and reconstituted hnRNP particles. C protein-RNA complexes composed of three, six, or nine tetramers (one, two, or three triangular complexes) nucleate the stoichiometric assembly of monomer, dimer, and trimer hnRNP particles. The binding of C-protein tetramers to RNAs longer than 230 nt is through a self-cooperative combinatorial mode. RNA packaged in the 19S complex and in 40S hnRNP particles is efficiently spliced in vitro. These findings demonstrate that formation of the triangular C protein-RNA complex is an obligate first event in the in vitro and probably the in vivo assembly the 40S hnRNP core particle, and they provide insight into the mechanism through which the core proteins package 700-nt increments of RNA. These findings also demonstrate that unless excluded by other factors, the C proteins are likely to be located along the length of nascent transcripts. Images PMID:8264621

  12. Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

    SciTech Connect

    Primorac, D.; Stover, M.L.; McKinstry, M.B.

    1994-09-01

    Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or the donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.

  13. Analysis of GFP-FOXO3a nuclear-cytoplasmic shuttling in ASTC-a-1 cells under growth factor stimulation

    NASA Astrophysics Data System (ADS)

    Wang, Xianwang; Xing, Da; Chen, Wei R.

    2010-02-01

    FOXO transcription factors are important regulators of cell survival in response to a variety of stimuli, among which are hypoxic stress, oxidative stress, and growth factor deprivation. Subcellular localization of FOXO proteins plays a major role in the regulation of their activity. In this study, using confocal imaging of the cells transfected with GFP-FOXO3a and fluorescence recovery after photobleaching technique, we visualized the dynamic nuclear translocation of GFP-FOXO3a in ASTC-a-1 cells under growth factor stimulus. In healthy cells, GFP-FOXO3a was well-distributed in the cytoplasm or widespread distributed in the cytoplasm and the nucleus but the cytoplasm was significantly more than the nucleus. Deprivation of growth factor, we monitored the nuclear localization of GFP-FOXO3a and the dynamic translocation of it from cytoplasm to nucleus. Interestingly, upon stimulation with growth factor in cells again, we visualized the dynamic nuclear exclusion of GFP-FOXO3a and cytoplasm distribution rapidly. In conclusion, these results demonstrated that FOXO3a can reversible shuttling between cytoplasm and nucleus upon stimulation with growth factor.

  14. Mimicking the membrane-mediated conformation of dynorphin A-(1-13)-peptide: Circular dichroism and nuclear magnetic resonance studies in methanolic solution

    SciTech Connect

    Lancaster, C.R.D.; Hughes, D.W.; Epand, R.M. ); Mishra, P.K.; Bothner-By, A.A. ); St.Pierre, S.A. )

    1991-05-14

    The structural requirements for the binding of dynorphin to the {kappa}-opioid receptor are of profound clinical interest in the search for a powerful nonaddictive analgesic. These requirements are thought to be met by the membrane-mediated conformation of the opioid peptide dynorphin A-(1-13)-peptide, Tyr{sup 1}-Gly{sup 2}-Gly{sup 3}-Phe{sup 4}-Leu{sup 5}-Arg{sup 6}-Arg{sup 7}-Ile{sup 8}-Arg{sup 9}-Pro{sup 10}-Lys{sup 11}-Leu{sup 12}-Lys{sup 13}. Schwyzer has proposed an essentially {alpha}-helical membrane-mediated conformation of the 13 amino acid peptide. In the present study, circular dichroism (CD) studies on dynorphin A-(1-13)-peptide bound to an anionic phospholipid signified negligible helical content of the peptide. CD studies also demonstrated that the aqueous-membraneous interphase may be mimicked by methanol. The 500- and 620-MHz {sup 1}H nuclear magnetic resonance (NMR) spectra of dynorphin A-(1-13)-peptide in methanolic solution were sequence-specifically assigned with the aid of correlated spectroscopy (COSY), double-quantum filtered phase-sensitive COSY (DQF-COSY), relayed COSY (RELAY), and nuclear Overhauser enhancement spectroscopy (NOESY). 2-D CAMELSPIN/ROESY experiments indicated that at least the part of the molecule from Arg{sup 7} to Arg{sup 9} was in an extended or {beta}-strand conformation, which agreed with deuterium-exchange and temperature-dependence studies of the amide protons and analysis of the vicinal spin-spin coupling constants {sup 3}J{sub HN{alpha}}. The results clearly demonstrated the absence of extensive {alpha}-helix formation. {chi}{sub 1} rotamer analysis of the {sup 3}J{sub {alpha}{beta}} demonstrated no preferred side-chain conformations.

  15. Hydrogen Sulfide Up-Regulates the Expression of ATP-Binding Cassette Transporter A1 via Promoting Nuclear Translocation of PPARα

    PubMed Central

    Li, Dong; Xiong, Qinghui; Peng, Jin; Hu, Bin; Li, Wanzhen; Zhu, Yizhun; Shen, Xiaoyan

    2016-01-01

    ATP binding cassette transporter A1 (ABCA1) plays a key role in atherogenesis. Hydrogen sulfide (H2S), a gasotransmitter, has been reported to play an anti-atherosclerotic role. However, the underlying mechanisms are largely unknown. In this study we examined whether and how H2S regulates ABCA1 expression. The effect of H2S on ABCA1 expression and lipid metabolism were assessed in vitro by cultured human hepatoma cell line HepG2, and in vivo by ApoE−/− mice with a high-cholesterol diet. NaHS (an exogenous H2S donor) treatment significantly increased the expression of ABCA1, ApoA1, and ApoA2 and ameliorated intracellular lipid accumulation in HepG2 cells. Depletion of the endogenous H2S generator cystathionine γ-lyase (CSE) by small RNA interference (siRNA) significantly decreased the expression of ABCA1 and resulted in the accumulation of lipids in HepG2 cells. In vivo NaHS treatment significantly reduced the serum levels of total cholesterol (TC), triglycerides (TG), and low-density lipoproteins (LDL), diminished atherosclerotic plaque size, and increased hepatic ABCA1 expression in fat-fed ApoE−/− mice. Further study revealed that NaHS upregulated ABCA1 expression by promoting peroxisome proliferator-activated receptor α (PPARα) nuclear translocation. H2S up-regulates the expression of ABCA1 by promoting the nuclear translocation of PPARα, providing a fundamental mechanism for the anti-atherogenic activity of H2S. H2S may be a promising potential drug candidate for the treatment of atherosclerosis. PMID:27136542

  16. Hydrogen Sulfide Up-Regulates the Expression of ATP-Binding Cassette Transporter A1 via Promoting Nuclear Translocation of PPARα.

    PubMed

    Li, Dong; Xiong, Qinghui; Peng, Jin; Hu, Bin; Li, Wanzhen; Zhu, Yizhun; Shen, Xiaoyan

    2016-01-01

    ATP binding cassette transporter A1 (ABCA1) plays a key role in atherogenesis. Hydrogen sulfide (H₂S), a gasotransmitter, has been reported to play an anti-atherosclerotic role. However, the underlying mechanisms are largely unknown. In this study we examined whether and how H₂S regulates ABCA1 expression. The effect of H₂S on ABCA1 expression and lipid metabolism were assessed in vitro by cultured human hepatoma cell line HepG2, and in vivo by ApoE(-/-) mice with a high-cholesterol diet. NaHS (an exogenous H₂S donor) treatment significantly increased the expression of ABCA1, ApoA1, and ApoA2 and ameliorated intracellular lipid accumulation in HepG2 cells. Depletion of the endogenous H₂S generator cystathionine γ-lyase (CSE) by small RNA interference (siRNA) significantly decreased the expression of ABCA1 and resulted in the accumulation of lipids in HepG2 cells. In vivo NaHS treatment significantly reduced the serum levels of total cholesterol (TC), triglycerides (TG), and low-density lipoproteins (LDL), diminished atherosclerotic plaque size, and increased hepatic ABCA1 expression in fat-fed ApoE(-/-) mice. Further study revealed that NaHS upregulated ABCA1 expression by promoting peroxisome proliferator-activated receptor α (PPARα) nuclear translocation. H₂S up-regulates the expression of ABCA1 by promoting the nuclear translocation of PPARα, providing a fundamental mechanism for the anti-atherogenic activity of H₂S. H₂S may be a promising potential drug candidate for the treatment of atherosclerosis. PMID:27136542

  17. Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2011-04-15

    To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

  18. The influence of standardized Valeriana officinalis extract on the CYP3A1 gene expression by nuclear receptors in in vivo model.

    PubMed

    Bogacz, Anna; Mrozikiewicz, Przemyslaw M; Karasiewicz, Monika; Bartkowiak-Wieczorek, Joanna; Majchrzycki, Marian; Mikolajczak, Przemyslaw L; Ozarowski, Marcin; Grzeskowiak, Edmund

    2014-01-01

    Valeriana officinalis is one of the most popular medicinal plants commonly used as a sedative and sleep aid. It is suggested that its pharmacologically active compounds derived from the root may modulate the CYP3A4 gene expression by activation of pregnane X receptor (PXR) or constitutive androstane receptor (CAR) and lead to pharmacokinetic herb-drug interactions. The aim of the study was to determine the influence of valerian on the expression level of CYP3A1 (homologue to human CYP3A4) as well as nuclear receptors PXR, CAR, RXR, GR, and HNF-4α. Male Wistar rats were given standardized valerian extract (300 mg/kg/day, p.o.) for 3 and 10 days. The expression in liver tissue was analyzed by using real-time PCR. Our result showed a decrease of CYP3A1 expression level by 35% (P = 0.248) and 37% (P < 0.001), respectively. Moreover, Valeriana exhibited statistically significant reduction in RXR (approximately 28%) only after 3-day treatment. We also demonstrated a decrease in the amount HNF-4α by 22% (P = 0.005) and 32% (P = 0.012), respectively. In case of CAR, the increase of expression level by 46% (P = 0.023) was noted. These findings suggest that Valeriana officinalis extract can decrease the CYP3A4 expression and therefore may lead to interactions with synthetic drugs metabolized by this enzyme. PMID:25302309

  19. The Influence of Standardized Valeriana officinalis Extract on the CYP3A1 Gene Expression by Nuclear Receptors in In Vivo Model

    PubMed Central

    Mrozikiewicz, Przemyslaw M.; Karasiewicz, Monika; Mikolajczak, Przemyslaw L.; Ozarowski, Marcin; Grzeskowiak, Edmund

    2014-01-01

    Valeriana officinalis is one of the most popular medicinal plants commonly used as a sedative and sleep aid. It is suggested that its pharmacologically active compounds derived from the root may modulate the CYP3A4 gene expression by activation of pregnane X receptor (PXR) or constitutive androstane receptor (CAR) and lead to pharmacokinetic herb-drug interactions. The aim of the study was to determine the influence of valerian on the expression level of CYP3A1 (homologue to human CYP3A4) as well as nuclear receptors PXR, CAR, RXR, GR, and HNF-4α. Male Wistar rats were given standardized valerian extract (300 mg/kg/day, p.o.) for 3 and 10 days. The expression in liver tissue was analyzed by using real-time PCR. Our result showed a decrease of CYP3A1 expression level by 35% (P = 0.248) and 37% (P < 0.001), respectively. Moreover, Valeriana exhibited statistically significant reduction in RXR (approximately 28%) only after 3-day treatment. We also demonstrated a decrease in the amount HNF-4α by 22% (P = 0.005) and 32% (P = 0.012), respectively. In case of CAR, the increase of expression level by 46% (P = 0.023) was noted. These findings suggest that Valeriana officinalis extract can decrease the CYP3A4 expression and therefore may lead to interactions with synthetic drugs metabolized by this enzyme. PMID:25302309

  20. Age-Related Nuclear Translocation of P2X6 Subunit Modifies Splicing Activity Interacting with Splicing Factor 3A1

    PubMed Central

    Díaz-Hernández, Juan Ignacio; Sebastián-Serrano, Álvaro; Gómez-Villafuertes, Rosa

    2015-01-01

    P2X receptors are ligand-gated ion channels sensitive to extracellular nucleotides formed by the assembling of three equal or different P2X subunits. In this work we report, for the first time, the accumulation of the P2X6 subunit inside the nucleus of hippocampal neurons in an age-dependent way. This location is favored by its anchorage to endoplasmic reticulum through its N-terminal domain. The extracellular domain of P2X6 subunit is the key to reach the nucleus, where it presents a speckled distribution pattern and is retained by interaction with the nuclear envelope protein spectrin α2. The in vivo results showed that, once inside the nucleus, P2X6 subunit interacts with the splicing factor 3A1, which ultimately results in a reduction of the mRNA splicing activity. Our data provide new insights into post-transcriptional regulation of mRNA splicing, describing a novel mechanism that could explain why this process is sensitive to changes that occur with age. PMID:25874565

  1. Fractal heterogeneity in minimal matrix models of scars modulates stiff-niche stem-cell responses via the nuclear exit of a mechanorepressor

    PubMed Central

    P. Dingal, P. C. Dave; Bradshaw, Andrew M.; Cho, Sangkyun; Raab, Matthew; Buxboim, Amnon; Swift, Joe; Discher, Dennis E.

    2015-01-01

    Scarring is a long-lasting problem in higher animals, and reductionist approaches could aid in developing treatments. Here, we show that co-polymerization of collagen-I with polyacrylamide produces minimal matrix models of scars (MMMS), in which fractal-fiber bundles segregate heterogeneously to the hydrogel subsurface. Matrix stiffens locally – as in scars – while allowing separate control over adhesive-ligand density. The MMMS elicits scar-like phenotypes from mesenchymal stem cells (MSCs): cells spread and polarize quickly, increasing nucleoskeletal lamin-A yet expressing the ‘scar marker’, smooth muscle actin (SMA) more slowly. Surprisingly, expression responses to MMMS exhibit less cell-to-cell noise than homogeneously stiff gels. Such differences from bulk-average responses arise because a strong SMA repressor, NKX2.5, slowly exits the nucleus on rigid matrices. NKX2.5 overexpression overrides rigid phenotypes, inhibiting SMA and cell spreading, while cytoplasm-localized NKX2.5 mutants degrade in well-spread cells. MSCs thus form a ‘mechanical memory’ of rigidity by progressively suppressing NKX2.5, thereby elevating SMA in a scar-like state. PMID:26168347

  2. Fractal heterogeneity in minimal matrix models of scars modulates stiff-niche stem-cell responses via nuclear exit of a mechanorepressor

    NASA Astrophysics Data System (ADS)

    Dingal, P. C. Dave P.; Bradshaw, Andrew M.; Cho, Sangkyun; Raab, Matthew; Buxboim, Amnon; Swift, Joe; Discher, Dennis E.

    2015-09-01

    Scarring is a long-lasting problem in higher animals, and reductionist approaches could aid in developing treatments. Here, we show that copolymerization of collagen I with polyacrylamide produces minimal matrix models of scars (MMMS), in which fractal-fibre bundles segregate heterogeneously to the hydrogel subsurface. Matrix stiffens locally--as in scars--while allowing separate control over adhesive-ligand density. The MMMS elicits scar-like phenotypes from mesenchymal stem cells (MSCs): cells spread and polarize quickly, increasing nucleoskeletal lamin-A yet expressing the `scar marker' smooth muscle actin (SMA) more slowly. Surprisingly, expression responses to MMMS exhibit less cell-to-cell noise than homogeneously stiff gels. Such differences from bulk-average responses arise because a strong SMA repressor, NKX2.5, slowly exits the nucleus on rigid matrices. NKX2.5 overexpression overrides rigid phenotypes, inhibiting SMA and cell spreading, whereas cytoplasm-localized NKX2.5 mutants degrade in well-spread cells. MSCs thus form a `mechanical memory' of rigidity by progressively suppressing NKX2.5, thereby elevating SMA in a scar-like state.

  3. Fractal heterogeneity in minimal matrix models of scars modulates stiff-niche stem-cell responses via nuclear exit of a mechanorepressor.

    PubMed

    Dingal, P C Dave P; Bradshaw, Andrew M; Cho, Sangkyun; Raab, Matthew; Buxboim, Amnon; Swift, Joe; Discher, Dennis E

    2015-09-01

    Scarring is a long-lasting problem in higher animals, and reductionist approaches could aid in developing treatments. Here, we show that copolymerization of collagen I with polyacrylamide produces minimal matrix models of scars (MMMS), in which fractal-fibre bundles segregate heterogeneously to the hydrogel subsurface. Matrix stiffens locally-as in scars-while allowing separate control over adhesive-ligand density. The MMMS elicits scar-like phenotypes from mesenchymal stem cells (MSCs): cells spread and polarize quickly, increasing nucleoskeletal lamin-A yet expressing the 'scar marker' smooth muscle actin (SMA) more slowly. Surprisingly, expression responses to MMMS exhibit less cell-to-cell noise than homogeneously stiff gels. Such differences from bulk-average responses arise because a strong SMA repressor, NKX2.5, slowly exits the nucleus on rigid matrices. NKX2.5 overexpression overrides rigid phenotypes, inhibiting SMA and cell spreading, whereas cytoplasm-localized NKX2.5 mutants degrade in well-spread cells. MSCs thus form a 'mechanical memory' of rigidity by progressively suppressing NKX2.5, thereby elevating SMA in a scar-like state. PMID:26168347

  4. Relative Expression of Vitamin D Hydroxylases, CYP27B1 and CYP24A1, and of Cyclooxygenase-2 and Heterogeneity of Human Colorectal Cancer in Relation to Age, Gender, Tumor Location, and Malignancy: Results from Factor and Cluster Analysis.

    PubMed

    Brozek, Wolfgang; Manhardt, Teresa; Kállay, Enikö; Peterlik, Meinrad; Cross, Heide S

    2012-01-01

    Previous studies on the significance of vitamin D insufficiency and chronic inflammation in colorectal cancer development clearly indicated that maintenance of cellular homeostasis in the large intestinal epithelium requires balanced interaction of 1,25-(OH)2D3 and prostaglandin cellular signaling networks. The present study addresses the question how colorectal cancer pathogenesis depends on alterations of activities of vitamin D hydroxylases, i.e., CYP27B1-encoded 25-hydroxyvitamin D-1a-hydroxylase and CYP24A1-encoded 25-hydroxyvitamin D-24-hydroxylase, and inflammation-induced cyclooxygenase-2 (COX-2). Data from 105 cancer patients on CYP27B1, VDR, CYP24A1, and COX-2 mRNA expression in relation to tumor grade, anatomical location, gender and age were fit into a multivariate model of exploratory factor analysis. Nearly identical results were obtained by the principal factor and the maximum likelihood method, and these were confirmed by hierarchical cluster analysis: Within the eight mutually dependent variables studied four independent constellations were found that identify different features of colorectal cancer pathogenesis: (i) Escape of COX-2 activity from restraints by the CYP27B1/VDR system can initiate cancer growth anywhere in the colorectum regardless of age and gender; (ii) variations in COX-2 expression are mainly responsible for differences in cancer incidence in relation to tumor location; (iii) advancing age has a strong gender-specific influence on cancer incidence; (iv) progression from well differentiated to undifferentiated cancer is solely associated with a rise in CYP24A1 expression. PMID:24213465

  5. Heterogeneous Nuclear Ribonucleoprotein C Proteins Interact with the Human Papillomavirus Type 16 (HPV16) Early 3′-Untranslated Region and Alleviate Suppression of HPV16 Late L1 mRNA Splicing*

    PubMed Central

    Dhanjal, Soniya; Kajitani, Naoko; Glahder, Jacob; Mossberg, Ann-Kristin; Johansson, Cecilia; Schwartz, Stefan

    2015-01-01

    In order to identify cellular factors that regulate human papillomavirus type 16 (HPV16) gene expression, cervical cancer cells permissive for HPV16 late gene expression were identified and characterized. These cells either contained a novel spliced variant of the L1 mRNAs that bypassed the suppressed HPV16 late, 5′-splice site SD3632; produced elevated levels of RNA-binding proteins SRSF1 (ASF/SF2), SRSF9 (SRp30c), and HuR that are known to regulate HPV16 late gene expression; or were shown by a gene expression array analysis to overexpress the RALYL RNA-binding protein of the heterogeneous nuclear ribonucleoprotein C (hnRNP C) family. Overexpression of RALYL or hnRNP C1 induced HPV16 late gene expression from HPV16 subgenomic plasmids and from episomal forms of the full-length HPV16 genome. This induction was dependent on the HPV16 early untranslated region. Binding of hnRNP C1 to the HPV16 early, untranslated region activated HPV16 late 5′-splice site SD3632 and resulted in production of HPV16 L1 mRNAs. Our results suggested that hnRNP C1 controls HPV16 late gene expression. PMID:25878250

  6. Heterogeneous Nuclear Ribonucleoprotein C Proteins Interact with the Human Papillomavirus Type 16 (HPV16) Early 3'-Untranslated Region and Alleviate Suppression of HPV16 Late L1 mRNA Splicing.

    PubMed

    Dhanjal, Soniya; Kajitani, Naoko; Glahder, Jacob; Mossberg, Ann-Kristin; Johansson, Cecilia; Schwartz, Stefan

    2015-05-22

    In order to identify cellular factors that regulate human papillomavirus type 16 (HPV16) gene expression, cervical cancer cells permissive for HPV16 late gene expression were identified and characterized. These cells either contained a novel spliced variant of the L1 mRNAs that bypassed the suppressed HPV16 late, 5'-splice site SD3632; produced elevated levels of RNA-binding proteins SRSF1 (ASF/SF2), SRSF9 (SRp30c), and HuR that are known to regulate HPV16 late gene expression; or were shown by a gene expression array analysis to overexpress the RALYL RNA-binding protein of the heterogeneous nuclear ribonucleoprotein C (hnRNP C) family. Overexpression of RALYL or hnRNP C1 induced HPV16 late gene expression from HPV16 subgenomic plasmids and from episomal forms of the full-length HPV16 genome. This induction was dependent on the HPV16 early untranslated region. Binding of hnRNP C1 to the HPV16 early, untranslated region activated HPV16 late 5'-splice site SD3632 and resulted in production of HPV16 L1 mRNAs. Our results suggested that hnRNP C1 controls HPV16 late gene expression. PMID:25878250

  7. Phenotypically heterogeneous populations in spatially heterogeneous environments

    NASA Astrophysics Data System (ADS)

    Patra, Pintu; Klumpp, Stefan

    2014-03-01

    The spatial expansion of a population in a nonuniform environment may benefit from phenotypic heterogeneity with interconverting subpopulations using different survival strategies. We analyze the crossing of an antibiotic-containing environment by a bacterial population consisting of rapidly growing normal cells and slow-growing, but antibiotic-tolerant persister cells. The dynamics of crossing is characterized by mean first arrival times and is found to be surprisingly complex. It displays three distinct regimes with different scaling behavior that can be understood based on an analytical approximation. Our results suggest that a phenotypically heterogeneous population has a fitness advantage in nonuniform environments and can spread more rapidly than a homogeneous population.

  8. Patterns of Emphysema Heterogeneity

    PubMed Central

    Valipour, Arschang; Shah, Pallav L.; Gesierich, Wolfgang; Eberhardt, Ralf; Snell, Greg; Strange, Charlie; Barry, Robert; Gupta, Avina; Henne, Erik; Bandyopadhyay, Sourish; Raffy, Philippe; Yin, Youbing; Tschirren, Juerg; Herth, Felix J.F.

    2016-01-01

    Background Although lobar patterns of emphysema heterogeneity are indicative of optimal target sites for lung volume reduction (LVR) strategies, the presence of segmental, or sublobar, heterogeneity is often underappreciated. Objective The aim of this study was to understand lobar and segmental patterns of emphysema heterogeneity, which may more precisely indicate optimal target sites for LVR procedures. Methods Patterns of emphysema heterogeneity were evaluated in a representative cohort of 150 severe (GOLD stage III/IV) chronic obstructive pulmonary disease (COPD) patients from the COPDGene study. High-resolution computerized tomography analysis software was used to measure tissue destruction throughout the lungs to compute heterogeneity (≥ 15% difference in tissue destruction) between (inter-) and within (intra-) lobes for each patient. Emphysema tissue destruction was characterized segmentally to define patterns of heterogeneity. Results Segmental tissue destruction revealed interlobar heterogeneity in the left lung (57%) and right lung (52%). Intralobar heterogeneity was observed in at least one lobe of all patients. No patient presented true homogeneity at a segmental level. There was true homogeneity across both lungs in 3% of the cohort when defining heterogeneity as ≥ 30% difference in tissue destruction. Conclusion Many LVR technologies for treatment of emphysema have focused on interlobar heterogeneity and target an entire lobe per procedure. Our observations suggest that a high proportion of patients with emphysema are affected by interlobar as well as intralobar heterogeneity. These findings prompt the need for a segmental approach to LVR in the majority of patients to treat only the most diseased segments and preserve healthier ones. PMID:26430783

  9. Interaction of ApoA-IV with NR4A1 and NR1D1 Represses G6Pase and PEPCK Transcription: Nuclear Receptor-Mediated Downregulation of Hepatic Gluconeogenesis in Mice and a Human Hepatocyte Cell Line

    PubMed Central

    Li, Xiaoming; Xu, Min; Wang, Fei; Ji, Yong; DavidsoN, W. Sean; Li, Zongfang; Tso, Patrick

    2015-01-01

    We have previously shown that the nuclear receptor, NR1D1, is a cofactor in ApoA-IV-mediated downregulation of gluconeogenesis. Nuclear receptor, NR4A1, is involved in the transcriptional regulation of various genes involved in inflammation, apoptosis, and glucose metabolism. We investigated whether NR4A1 influences the effect of ApoA-IV on hepatic glucose metabolism. Our in situ proximity ligation assays and coimmunoprecipitation experiments indicated that ApoA-IV colocalized with NR4A1 in human liver (HepG2) and kidney (HEK-293) cell lines. The chromatin immunoprecipitation experiments and luciferase reporter assays indicated that the ApoA-IV and NR4A1 colocalized at the RORα response element of the human G6Pase promoter, reducing its transcriptional activity. Our RNA interference experiments showed that knocking down the expression of NR4A1 in primary mouse hepatocytes treated with ApoA-IV increased the expression of NR1D1, G6Pase, and PEPCK, and that knocking down NR1D1 expression increased the level of NR4A1. We also found that ApoA-IV induced the expression of endogenous NR4A1 in both cultured primary mouse hepatocytes and in the mouse liver, and decreased glucose production in primary mouse hepatocytes. Our findings showed that ApoA-IV colocalizes with NR4A1, which suppresses G6Pase and PEPCK gene expression at the transcriptional level, reducing hepatic glucose output and lowering blood glucose. The ApoA-IV-induced increase in NR4A1 expression in hepatocytes mediates further repression of gluconeogenesis. Our findings suggest that NR1D1 and NR4A1 serve similar or complementary functions in the ApoA-IV-mediated regulation of gluconeogenesis. PMID:26556724

  10. Tumour Cell Heterogeneity

    PubMed Central

    Gay, Laura; Baker, Ann-Marie; Graham, Trevor A.

    2016-01-01

    The population of cells that make up a cancer are manifestly heterogeneous at the genetic, epigenetic, and phenotypic levels. In this mini-review, we summarise the extent of intra-tumour heterogeneity (ITH) across human malignancies, review the mechanisms that are responsible for generating and maintaining ITH, and discuss the ramifications and opportunities that ITH presents for cancer prognostication and treatment. PMID:26973786

  11. Modeling blood flow heterogeneity.

    PubMed

    King, R B; Raymond, G M; Bassingthwaighte, J B

    1996-01-01

    It has been known for some time that regional blood flows within an organ are not uniform. Useful measures of heterogeneity of regional blood flows are the standard deviation and coefficient of variation or relative dispersion of the probability density function (PDF) of regional flows obtained from the regional concentrations of tracers that are deposited in proportion to blood flow. When a mathematical model is used to analyze dilution curves after tracer solute administration, for many solutes it is important to account for flow heterogeneity and the wide range of transit times through multiple pathways in parallel. Failure to do so leads to bias in the estimates of volumes of distribution and membrane conductances. Since in practice the number of paths used should be relatively small, the analysis is sensitive to the choice of the individual elements used to approximate the distribution of flows or transit times. Presented here is a method for modeling heterogeneous flow through an organ using a scheme that covers both the high flow and long transit time extremes of the flow distribution. With this method, numerical experiments are performed to determine the errors made in estimating parameters when flow heterogeneity is ignored, in both the absence and presence of noise. The magnitude of the errors in the estimates depends upon the system parameters, the amount of flow heterogeneity present, and whether the shape of the input function is known. In some cases, some parameters may be estimated to within 10% when heterogeneity is ignored (homogeneous model), but errors of 15-20% may result, even when the level of heterogeneity is modest. In repeated trials in the presence of 5% noise, the mean of the estimates was always closer to the true value with the heterogeneous model than when heterogeneity was ignored, but the distributions of the estimates from the homogeneous and heterogeneous models overlapped for some parameters when outflow dilution curves were

  12. The proliferation potential protein-related (P2P-R) gene with domains encoding heterogeneous nuclear ribonucleoprotein association and Rb1 binding shows repressed expression during terminal differentiation.

    PubMed

    Witte, M M; Scott, R E

    1997-02-18

    Terminal differentiation is associated with repression in the expression of the proliferation potential proteins (P2P) subset of heterogeneous nuclear ribonucleoprotein (hnRNP) proteins. We report here the cloning and characterization of a 5173-bp P2P-related (P2P-R) cDNA that contains a 4214-bp open reading frame. Probes to this cDNA detect a single 8-kb mRNA in multiple murine tissues and in proliferating 3T3T cells, but not in terminally differentiated 3T3T adipocytes. Evidence that this cDNA can encode peptides with domains for hnRNP association was established by showing that such peptides are recognized by two monoclonal antibodies known to detect core hnRNP proteins, and by showing that the C130 monoclonal antibody, produced against a cDNA-derived fusion protein, also selectively detects native P2P hnRNP proteins. In addition, P2P-R cDNA-derived fusion proteins bind single-stranded nucleic acids, and a P2P-R cDNA-derived antisense oligonucleotide selectively represses P2P expression. Because terminal differentiation is associated with modulation in Rb1 function, we assayed if products of this cDNA might interact with Rb1. Evidence that the P2P-R cDNA encodes a protein domain that binds Rb1 was established using a glutathione S-transferase fusion protein to selectively precipitate Rb1 from cellular extracts. Data also show that this binding is reduced by competition with the adenovirus E1a protein, indicating that binding occurs through the "pocket" domain of Rb1. These results establish that the P2P-R cDNA encodes protein domains involved in both hnRNP association and Rb1 binding and complement recent reports that localize Rb1 to sites of RNA processing in the nucleus. PMID:9037032

  13. SF-1 (Nuclear Receptor 5A1) Activity Is Activated by Cyclic AMP via p300-Mediated Recruitment to Active Foci, Acetylation, and Increased DNA Binding

    PubMed Central

    Chen, Wei-Yi; Juan, Li-Jung; Chung, Bon-chu

    2005-01-01

    Steroidogenic factor 1 (SF-1) is a nuclear receptor essential for steroidogenic gene expression, but how its activity is regulated is unclear. Here we demonstrate that p300 plays an important role in regulating SF-1 function. SF-1 was acetylated in vitro and in vivo by p300 at the KQQKK motif in the Ftz-F1 (Fushi-tarazu factor 1) box adjacent to its DNA-binding domain. Mutation of the KQQKK motif reduced the DNA-binding activity and p300-dependent activation of SF-1. When stimulated with cyclic AMP (cAMP), adrenocortical Y1 cells expressed more p300, leading to additional SF-1 association with p300 and increased SF-1 acetylation and DNA binding. It also increased SF-1 colocalization with p300 in nuclear foci. Collectively, these results indicate that SF-1 transcriptional activity is regulated by p300 in response to the cAMP signaling pathway by way of increased acetylation, DNA binding, and recruitment to nuclear foci. PMID:16287857

  14. The orphan nuclear receptor Nr4a1 couples sympathetic and inflammatory cues in CNS-recruited macrophages to limit neuroinflammation

    PubMed Central

    Shaked, Iftach; Hanna, Richard N.; Shaked, Helena; Chodaczek, Grzegorz; Nowyhed, Heba N.; Tweet, George; Tacke, Robert; Basat, Alp Bugra; Mikulski, Zbigniew; Togher, Susan; Miller, Jacqueline; Blatchley, Amy; Salek-Ardakani, Shahram; Darvas, Martin; Kaikkonen, Minna U.; Thomas, Graham; Lai-Wing-Sun, Sonia; Rezk, Ayman; Bar-Or, Amit; Glass, Christopher K.; Bandukwala, Hozefa; Hedrick, Catherine C.

    2016-01-01

    Molecular mechanisms linking the sympathetic stress response and inflammation remain enigmatic. Here we demonstrate that the transcription factor Nr4a1 regulates production of norepinephrine (NE) in macrophages, thereby limiting experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis. Lack of Nr4a1 in myeloid cells led to enhanced NE production, accelerated leukocyte infiltration to the central nervous system (CNS) and disease exacerbation in vivo. In contrast, myeloid-specific deletion of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, protected against EAE. Further, we found that Nr4a1 repressed autocrine NE production in macrophages by recruiting the corepressor CoREST to the Th promoter. Our data reveal a new role for macrophages in neuroinflammation and identify Nr4a1 as a key regulator of macrophage catecholamine production. PMID:26523867

  15. Heterogeneous Atmospheric Chemistry

    NASA Astrophysics Data System (ADS)

    Schryer, David R.

    In the past few years it has become increasingly clear that heterogeneous, or multiphase, processes play an important role in the atmosphere. Unfortunately the literature on the subject, although now fairly extensive, is still rather dispersed. Furthermore, much of the expertise regarding heterogeneous processes lies in fields not directly related to atmospheric science. Therefore, it seemed desirable to bring together for an exchange of ideas, information, and methodologies the various atmospheric scientists who are actively studying heterogeneous processes as well as other researchers studying similar processes in the context of other fields.

  16. Search for φ-Meson Nuclear Bound States in the overline{p} + ^{A}Z → φ + ^{A-1}_{φ}(Z-1) Reaction

    NASA Astrophysics Data System (ADS)

    Bühler, P.; Curceanu, C.; Guaraldo, C.; Hartmann, O.; Hicks, K.; Iwasaki, M.; Ishiwatari, T.; Kienle, P.; Marton, J.; Muto, R.; Niiyama, M.; Noumi, H.; Ohnishi, H.; Okada, S.; Vidal, A.; Sakaguchi, A.; Sakuma, F.; Sawada, S.; Sirghi, D.; Sirghi, F.; Suzuki, K.; Tsukada, K.; Tedeschi, D. J.; Doce, O.; Widmann, E.; Yokkaichi, S.; Zmeskal, J.; J-Parc P29 Collaboration

    We propose to study in-medium mass modification of the φ mesonusing the formation of φ meson bound state. We demonstrate that a clear missing-mass spectrum can be obtained efficiently by (overline{p}, φ) spectroscopy together with the Λ tagging, using the primary reaction channel overline{p} p → φ φ. A systematic study over several nuclear targets will yield a unique, definitive and precise determination of the in-medium mass modification of the vector meson φ (s overline{s}).

  17. NUCLEAR REACTOR CONTROL SYSTEM

    DOEpatents

    Epler, E.P.; Hanauer, S.H.; Oakes, L.C.

    1959-11-01

    A control system is described for a nuclear reactor using enriched uranium fuel of the type of the swimming pool and other heterogeneous nuclear reactors. Circuits are included for automatically removing and inserting the control rods during the course of normal operation. Appropriate safety circuits close down the nuclear reactor in the event of emergency.

  18. Teaching Heterogeneous Classes.

    ERIC Educational Resources Information Center

    Millrood, Radislav

    2002-01-01

    Discusses an approach to teaching heterogeneous English-as-a-Second/Foreign-Language classes. Draws on classroom research data to describe the features of a success-building lesson context. (Author/VWL)

  19. Heterogeneous atmospheric chemistry

    NASA Technical Reports Server (NTRS)

    Schryer, D. R.

    1982-01-01

    The present conference on heterogeneous atmospheric chemistry considers such topics concerning clusters, particles and microparticles as common problems in nucleation and growth, chemical kinetics, and catalysis, chemical reactions with aerosols, electron beam studies of natural and anthropogenic microparticles, and structural studies employing molecular beam techniques, as well as such gas-solid interaction topics as photoassisted reactions, catalyzed photolysis, and heterogeneous catalysis. Also discussed are sulfur dioxide absorption, oxidation, and oxidation inhibition in falling drops, sulfur dioxide/water equilibria, the evidence for heterogeneous catalysis in the atmosphere, the importance of heterogeneous processes to tropospheric chemistry, soot-catalyzed atmospheric reactions, and the concentrations and mechanisms of formation of sulfate in the atmospheric boundary layer.

  20. Towards heterogeneous distributed debugging

    SciTech Connect

    Damodaran-Kamal, S.K.

    1995-04-01

    Several years of research and development in parallel debugger design have given up several techniques, though implemented in a wide range of tools for an equally wide range of systems. This paper is an evaluation of these myriad techniques as applied to the design of a heterogeneous distributed debugger. The evaluation is based on what features users perceive as useful, as well as the ease of implementation of the features using the available technology. A preliminary architecture for such a heterogeneous tool is proposed. Our effort in this paper is significantly different from the other efforts at creating portable and heterogeneous distributed debuggers in that we concentrate on support for all the important issues in parallel debugging, instead of simply concentrating on portability and heterogeneity.

  1. Characterization of Paper Heterogeneity

    NASA Astrophysics Data System (ADS)

    Considine, John M.

    Paper and paperboard are the most widely-used green materials in the world because they are renewable, recyclable, reusable, and compostable. Continued and expanded use of these materials and their potential use in new products requires a comprehensive understanding of the variability of their mechanical properties. This work develops new methods to characterize the mechanical properties of heterogeneous materials through a combination of techniques in experimental mechanics, materials science and numerical analysis. Current methods to analyze heterogeneous materials focus on crystalline materials or polymer-crystalline composites, where material boundaries are usually distinct. This work creates a methodology to analyze small, continuously-varying stiffness gradients in 100% polymer systems and is especially relevant to paper materials where factors influencing heterogeneity include local mass, fiber orientation, individual pulp fiber properties, local density, and drying restraint. A unique approach was used to understand the effect of heterogeneity on paper tensile strength. Additional variation was intentionally introduced, in the form of different size holes, and their effect on strength was measured. By modifying two strength criteria, an estimate of strength in the absence of heterogeneity was determined. In order to characterize stiffness heterogeneity, a novel load fixture was developed to excite full-field normal and shear strains for anisotropic stiffness determination. Surface strains were measured with digital image correlation and were analyzed with the VFM (Virtual Fields Method). This approach led to VFM-identified stiffnesses that were similar to values determined by conventional tests. The load fixture and VFM analyses were used to measure local stiffness and local stiffness variation on heterogeneous anisotropic materials. The approach was validated on simulated heterogeneous materials and was applied experimentally to three different paperboards

  2. hnRNP A1: the Swiss army knife of gene expression.

    PubMed

    Jean-Philippe, Jacques; Paz, Sean; Caputi, Massimo

    2013-01-01

    Eukaryotic cells express a large variety of RNA binding proteins (RBPs), with diverse affinities and specificities towards target RNAs. These proteins play a crucial role in almost every aspect of RNA biogenesis, expression and function. The heterogeneous nuclear ribonucleoproteins (hnRNPs) are a complex and diverse family of RNA binding proteins. hnRNPs display multiple functions in the processing of heterogeneous nuclear RNAs into mature messenger RNAs. hnRNP A1 is one of the most abundant and ubiquitously expressed members of this protein family. hnRNP A1 plays multiple roles in gene expression by regulating major steps in the processing of nascent RNA transcripts. The transcription, splicing, stability, export through nuclear pores and translation of cellular and viral transcripts are all mechanisms modulated by this protein. The diverse functions played by hnRNP A1 are not limited to mRNA biogenesis, but extend to the processing of microRNAs, telomere maintenance and the regulation of transcription factor activity. Genomic approaches have recently uncovered the extent of hnRNP A1 roles in the development and differentiation of living organisms. The aim of this review is to highlight recent developments in the study of this protein and to describe its functions in cellular and viral gene expression and its role in human pathologies. PMID:24065100

  3. Overview of medium heterogeneity and transport processes

    SciTech Connect

    Tsang, Y.; Tsang, C.F.

    1993-11-01

    Medium heterogeneity can have significant impact on the behavior of solute transport. Tracer breakthrough curves from transport in a heterogeneous medium are distinctly different from that in a homogeneous porous medium. Usually the shape of the breakthrough curves are highly non-symmetrical with a fast rise at early times and very long tail at late times, and often, they consist of multiple peaks. Moreover, unlike transport in a homogeneous medium where the same transport parameters describe the entire medium, transport through heterogeneous media gives rise to breakthrough curves which have strong spatial dependence. These inherent characteristics of transport in heterogeneous medium present special challenge to the performance assessment of a potential high level nuclear waste repository with respect to the possible release of radio nuclides to the accessible environment. Since an inherently desirable site characteristic for a waste repository is that flow and transport should be slow, then transport measurements in site characterization efforts will necessarily be spatially small and temporally short compare to the scales which are of relevance to performance assessment predictions. In this paper we discuss the role of medium heterogeneity in site characterization and performance assessment. Our discussion will be based on a specific example of a 3D heterogeneous stochastic model of a site generally similar to, the Aespoe Island, the site of the Hard Rock Laboratory in Southern Sweden. For our study, alternative 3D stochastic fields of hydraulic conductivities conditioned on ``point`` measurements shall be generated. Results of stochastic flow and transport simulations would be used to address the issues of (1) the relationship of tracer breakthrough with the structure of heterogeneity, and (2) the inference from small scale testing results to large scale and long term predictions.

  4. Orphan Nuclear Receptor NR4A1 Binds a Novel Protein Interaction Site on Anti-apoptotic B Cell Lymphoma Gene 2 Family Proteins.

    PubMed

    Godoi, Paulo H C; Wilkie-Grantham, Rachel P; Hishiki, Asami; Sano, Renata; Matsuzawa, Yasuko; Yanagi, Hiroko; Munte, Claudia E; Chen, Ya; Yao, Yong; Marassi, Francesca M; Kalbitzer, Hans R; Matsuzawa, Shu-Ichi; Reed, John C

    2016-07-01

    B cell lymphoma gene 2 (Bcl-2) family proteins are key regulators of programmed cell death and important targets for drug discovery. Pro-apoptotic and anti-apoptotic Bcl-2 family proteins reciprocally modulate their activities in large part through protein interactions involving a motif known as BH3 (Bcl-2 homology 3). Nur77 is an orphan member of the nuclear receptor family that lacks a BH3 domain but nevertheless binds certain anti-apoptotic Bcl-2 family proteins (Bcl-2, Bfl-1, and Bcl-B), modulating their effects on apoptosis and autophagy. We used a combination of NMR spectroscopy-based methods, mutagenesis, and functional studies to define the interaction site of a Nur77 peptide on anti-apoptotic Bcl-2 family proteins and reveal a novel interaction surface. Nur77 binds adjacent to the BH3 peptide-binding crevice, suggesting the possibility of cross-talk between these discrete binding sites. Mutagenesis of residues lining the identified interaction site on Bcl-B negated the interaction with Nur77 protein in cells and prevented Nur77-mediated modulation of apoptosis and autophagy. The findings establish a new protein interaction site with the potential to modulate the apoptosis and autophagy mechanisms governed by Bcl-2 family proteins. PMID:27129202

  5. Managing Power Heterogeneity

    NASA Astrophysics Data System (ADS)

    Pruhs, Kirk

    A particularly important emergent technology is heterogeneous processors (or cores), which many computer architects believe will be the dominant architectural design in the future. The main advantage of a heterogeneous architecture, relative to an architecture of identical processors, is that it allows for the inclusion of processors whose design is specialized for particular types of jobs, and for jobs to be assigned to a processor best suited for that job. Most notably, it is envisioned that these heterogeneous architectures will consist of a small number of high-power high-performance processors for critical jobs, and a larger number of lower-power lower-performance processors for less critical jobs. Naturally, the lower-power processors would be more energy efficient in terms of the computation performed per unit of energy expended, and would generate less heat per unit of computation. For a given area and power budget, heterogeneous designs can give significantly better performance for standard workloads. Moreover, even processors that were designed to be homogeneous, are increasingly likely to be heterogeneous at run time: the dominant underlying cause is the increasing variability in the fabrication process as the feature size is scaled down (although run time faults will also play a role). Since manufacturing yields would be unacceptably low if every processor/core was required to be perfect, and since there would be significant performance loss from derating the entire chip to the functioning of the least functional processor (which is what would be required in order to attain processor homogeneity), some processor heterogeneity seems inevitable in chips with many processors/cores.

  6. Evaluating foam heterogeneity

    NASA Technical Reports Server (NTRS)

    Liou, D. W.; Lee, W. M.

    1972-01-01

    New analytical tool is available to calculate the degree of foam heterogeneity based on the measurement of gas diffusivity values. Diffusion characteristics of plastic foam are described by a system of differential equations based on conventional diffusion theory. This approach saves research and computation time in studying mass or heat diffusion problems.

  7. Heterogeneous waste processing

    DOEpatents

    Vanderberg, Laura A.; Sauer, Nancy N.; Brainard, James R.; Foreman, Trudi M.; Hanners, John L.

    2000-01-01

    A combination of treatment methods are provided for treatment of heterogeneous waste including: (1) treatment for any organic compounds present; (2) removal of metals from the waste; and, (3) bulk volume reduction, with at least two of the three treatment methods employed and all three treatment methods emplyed where suitable.

  8. Heterogeneities in granular dynamics.

    PubMed

    Mehta, A; Barker, G C; Luck, J M

    2008-06-17

    The absence of Brownian motion in granular media is a source of much complexity, including the prevalence of heterogeneity, whether static or dynamic, within a given system. Such strong heterogeneities can exist as a function of depth in a box of grains; this is the system we study here. First, we present results from three-dimensional, cooperative and stochastic Monte Carlo shaking simulations of spheres on heterogeneous density fluctuations. Next, we juxtapose these with results obtained from a theoretical model of a column of grains under gravity; frustration via competing local fields is included in our model, whereas the effect of gravity is to slow down the dynamics of successively deeper layers. The combined conclusions suggest that the dynamics of a real granular column can be divided into different phases-ballistic, logarithmic, activated, and glassy-as a function of depth. The nature of the ground states and their retrieval (under zero-temperature dynamics) is analyzed; the glassy phase shows clear evidence of its intrinsic ("crystalline") states, which lie below a band of approximately degenerate ground states. In the other three phases, by contrast, the system jams into a state chosen randomly from this upper band of metastable states. PMID:18541918

  9. Atmospheric Heterogeneous Stereochemistry

    NASA Astrophysics Data System (ADS)

    Stokes, G. Y.; Buchbinder, A. M.; Geiger, F. M.

    2009-12-01

    This paper addresses the timescale and mechanism of heterogeneous interactions of laboratory models of organic-coated mineral dust and ozone. We are particularly interested in investigating the role of stereochemistry in heterogeneous oxidation reactions involving chiral biogenic VOCs. Using the surface-specific nonlinear optical spectroscopy, sum frequency generation, we tracked terpene diastereomers during exposure to 10^11 to 10^13 molecules of ozone per cm^3 in 1 atm helium to model ozone-limited and ozone-rich tropospheric conditions. Our kinetic data indicate that the diastereomers which orient their reactive C=C double bonds towards the gas phase exhibit heterogeneous ozonolysis rate constants that are two times faster than diastereomers that orient their C=C double bonds away from the gas phase. Insofar as our laboratory model studies are representative of real world environments, our studies suggest that the propensity of aerosol particles coated with chiral semivolatile organic compounds to react with ozone may depend on stereochemistry. Implications of these results for chiral markers that would allow for source appointment of anthropogenic versus biogenic carbon emissions will be discussed.

  10. Heterogeneity in Melanoma.

    PubMed

    Shannan, Batool; Perego, Michela; Somasundaram, Rajasekharan; Herlyn, Meenhard

    2016-01-01

    Melanoma is among the most aggressive and therapy-resistant human cancers. While great strides in therapy have generated enthusiasm, many challenges remain. Heterogeneity is the most pressing issue for all types of therapy. This chapter summarizes the clinical classification of melanoma, of which the research community now adds additional layers of classifications for better diagnosis and prediction of therapy response. As the search for new biomarkers increases, we expect that biomarker analyses will be essential for all clinical trials to better select patient populations for optimal therapy. While individualized therapy that is based on extensive biomarker analyses is an option, we expect in the future genetic and biologic biomarkers will allow grouping of melanomas in such a way that we can predict therapy outcome. At this time, tumor heterogeneity continues to be the major challenge leading inevitably to relapse. To address heterogeneity therapeutically, we need to develop complex therapies that eliminate the bulk of the tumor and, at the same time, the critical subpopulations. PMID:26601857

  11. Inferring biological dynamics in heterogeneous cellular environments

    NASA Astrophysics Data System (ADS)

    Pressé, Steve

    In complex environments, it often appears that biomolecules such as proteins do not diffuse normally. That is, their mean square displacement does not scale linearly with time. This anomalous diffusion happens for multiple reasons: proteins can bind to structures and other proteins; fluorophores used to label proteins may flicker or blink making it appear that the labeled protein is diffusing anomalously; and proteins can diffuse in differently crowded environments. Here we describe methods for learning about such processes from imaging data collected inside the heterogeneous environment of the living cell. Refs.: ''Inferring Diffusional Dynamics from FCS in Heterogeneous Nuclear Environments'' Konstantinos Tsekouras, Amanda Siegel, Richard N. Day, Steve Pressé*, Biophys. J. , 109, 7 (2015). ''A data-driven alternative to the fractional Fokker-Planck equation'' Steve Pressé*, J. Stat. Phys.: Th. and Expmt. , P07009 (2015).

  12. Heterogeneity in expected longevities.

    PubMed

    Pijoan-Mas, Josep; Ríos-Rull, José-Víctor

    2014-12-01

    We develop a new methodology to compute differences in the expected longevity of individuals of a given cohort who are in different socioeconomic groups at a certain age. We address the two main problems associated with the standard use of life expectancy: (1) that people's socioeconomic characteristics change, and (2) that mortality has decreased over time. Our methodology uncovers substantial heterogeneity in expected longevities, yet much less heterogeneity than what arises from the naive application of life expectancy formulae. We decompose the longevity differences into differences in health at age 50, differences in the evolution of health with age, and differences in mortality conditional on health. Remarkably, education, wealth, and income are health-protecting but have very little impact on two-year mortality rates conditional on health. Married people and nonsmokers, however, benefit directly in their immediate mortality. Finally, we document an increasing time trend of the socioeconomic gradient of longevity in the period 1992-2008, and we predict an increase in the socioeconomic gradient of mortality rates for the coming years. PMID:25391225

  13. Biclustering with heterogeneous variance.

    PubMed

    Chen, Guanhua; Sullivan, Patrick F; Kosorok, Michael R

    2013-07-23

    In cancer research, as in all of medicine, it is important to classify patients into etiologically and therapeutically relevant subtypes to improve diagnosis and treatment. One way to do this is to use clustering methods to find subgroups of homogeneous individuals based on genetic profiles together with heuristic clinical analysis. A notable drawback of existing clustering methods is that they ignore the possibility that the variance of gene expression profile measurements can be heterogeneous across subgroups, and methods that do not consider heterogeneity of variance can lead to inaccurate subgroup prediction. Research has shown that hypervariability is a common feature among cancer subtypes. In this paper, we present a statistical approach that can capture both mean and variance structure in genetic data. We demonstrate the strength of our method in both synthetic data and in two cancer data sets. In particular, our method confirms the hypervariability of methylation level in cancer patients, and it detects clearer subgroup patterns in lung cancer data. PMID:23836637

  14. Heterogeneous broadband network

    NASA Astrophysics Data System (ADS)

    Dittmann, Lars

    1995-11-01

    Although the vision for the future Integrated Broadband Communication Network (IBCN) is an all optical network, it is certain that for a long period to come, the network will remain very heterogeneous, with a mixture of different physical media (fiber, coax and twisted pair), transmission systems (PDH, SDH, ADSL) and transport protocols (TCP/IP, AAL/ATM, frame relay). In the current work towards the IBCN, the ATM concept is considered the generic network protocol for both public and private network, with the ability to use different underlying transmission protocols and, through adaptation protocols, provide the appropriate services (old as well as new) to the customer. One of the major difficulties of heterogeneous network is the restriction that is usually given by the lowest common denominator, e.g. in terms of single channel capacity. A possible way to overcome these limitations is by extending the ATM concept with a multilink capability, that allows us to use separate resources as one common. The improved flexibility obtained by this protocol extension further allows a real time optimization of network and call configuration, without any impact on the quality of service seen from the user. This paper describes an example of an ATM based multilink protocol that has been experimentally implemented within the RACE project 'STRATOSPHERIC'. The paper outlines the complexity of introducing an extra network functionality compared with the added value, such as an improved ability to recover an error due to a malfunctioning network component.

  15. Large epidemic thresholds emerge in heterogeneous networks of heterogeneous nodes

    NASA Astrophysics Data System (ADS)

    Yang, Hui; Tang, Ming; Gross, Thilo

    2015-08-01

    One of the famous results of network science states that networks with heterogeneous connectivity are more susceptible to epidemic spreading than their more homogeneous counterparts. In particular, in networks of identical nodes it has been shown that network heterogeneity, i.e. a broad degree distribution, can lower the epidemic threshold at which epidemics can invade the system. Network heterogeneity can thus allow diseases with lower transmission probabilities to persist and spread. However, it has been pointed out that networks in which the properties of nodes are intrinsically heterogeneous can be very resilient to disease spreading. Heterogeneity in structure can enhance or diminish the resilience of networks with heterogeneous nodes, depending on the correlations between the topological and intrinsic properties. Here, we consider a plausible scenario where people have intrinsic differences in susceptibility and adapt their social network structure to the presence of the disease. We show that the resilience of networks with heterogeneous connectivity can surpass those of networks with homogeneous connectivity. For epidemiology, this implies that network heterogeneity should not be studied in isolation, it is instead the heterogeneity of infection risk that determines the likelihood of outbreaks.

  16. Disordered hyperuniform heterogeneous materials.

    PubMed

    Torquato, Salvatore

    2016-10-19

    Disordered hyperuniform many-body systems are distinguishable states of matter that lie between a crystal and liquid: they are like perfect crystals in the way they suppress large-scale density fluctuations and yet are like liquids or glasses in that they are statistically isotropic with no Bragg peaks. These systems play a vital role in a number of fundamental and applied problems: glass formation, jamming, rigidity, photonic and electronic band structure, localization of waves and excitations, self-organization, fluid dynamics, quantum systems, and pure mathematics. Much of what we know theoretically about disordered hyperuniform states of matter involves many-particle systems. In this paper, we derive new rigorous criteria that disordered hyperuniform two-phase heterogeneous materials must obey and explore their consequences. Two-phase heterogeneous media are ubiquitous; examples include composites and porous media, biological media, foams, polymer blends, granular media, cellular solids, and colloids. We begin by obtaining some results that apply to hyperuniform two-phase media in which one phase is a sphere packing in d-dimensional Euclidean space [Formula: see text]. Among other results, we rigorously establish the requirements for packings of spheres of different sizes to be 'multihyperuniform'. We then consider hyperuniformity for general two-phase media in [Formula: see text]. Here we apply realizability conditions for an autocovariance function and its associated spectral density of a two-phase medium, and then incorporate hyperuniformity as a constraint in order to derive new conditions. We show that some functional forms can immediately be eliminated from consideration and identify other forms that are allowable. Specific examples and counterexamples are described. Contact is made with well-known microstructural models (e.g. overlapping spheres and checkerboards) as well as irregular phase-separation and Turing-type patterns. We also ascertain a family

  17. [Neutrophilic functional heterogeneity].

    PubMed

    2006-02-01

    Blood neutrophilic functional heterogeneity is under discussion. The neutrophils of one subpopulation, namely killer neutrophils (Nk), potential phagocytes, constitute a marginal pool and a part of the circulating pool, intensively produce active oxygen forms (AOF) and they are adherent to the substrate. The neutrophils of another subpopulation, cager neutrophils (Nc), seem to perform a transport function of delivering foreign particles to the competent organs, to form about half of the circulating pool, to produce APC to a lesser extent, exclusively for self-defense and, probably, in usual conditions, to fail to interact with substrate. Analysis of the experimental findings suggests that the phylogenetic age of Nk is older than that of Nc and Nk has predominantly a tendency to spontaneous apoptosis under physiological conditions. PMID:16610631

  18. Multipartite entanglement in heterogeneous systems

    NASA Astrophysics Data System (ADS)

    Goyeneche, Dardo; Bielawski, Jakub; Życzkowski, Karol

    2016-07-01

    Heterogeneous bipartite quantum pure states, composed of two subsystems with a different number of levels, cannot have both reductions maximally mixed. In this work, we demonstrate the existence of a wide range of highly entangled states of heterogeneous multipartite systems consisting of N >2 parties such that every reduction to one and two parties is maximally mixed. Two constructions of generating genuinely multipartite maximally entangled states of heterogeneous systems for an arbitrary number of subsystems are presented. Such states are related to quantum error correction codes over mixed alphabets and mixed orthogonal arrays. Additionally, we show the advantages of considering heterogeneous systems in practical implementations of multipartite steering.

  19. Interconnecting heterogeneous database management systems

    NASA Technical Reports Server (NTRS)

    Gligor, V. D.; Luckenbaugh, G. L.

    1984-01-01

    It is pointed out that there is still a great need for the development of improved communication between remote, heterogeneous database management systems (DBMS). Problems regarding the effective communication between distributed DBMSs are primarily related to significant differences between local data managers, local data models and representations, and local transaction managers. A system of interconnected DBMSs which exhibit such differences is called a network of distributed, heterogeneous DBMSs. In order to achieve effective interconnection of remote, heterogeneous DBMSs, the users must have uniform, integrated access to the different DBMs. The present investigation is mainly concerned with an analysis of the existing approaches to interconnecting heterogeneous DBMSs, taking into account four experimental DBMS projects.

  20. {sup 48}Ca HETEROGENEITY IN DIFFERENTIATED METEORITES

    SciTech Connect

    Chen, Hsin-Wei; Lee, Typhoon; Lee, Der-Chuen; Shen, Jason Jiun-San; Chen, Jiang-Chang

    2011-12-10

    Isotopic heterogeneities of {sup 48}Ca have been found in numerous bulk meteorites that are correlated with {sup 50}Ti and {sup 54}Cr anomalies among differentiated planetary bodies, and the results suggest that a rare subset of neutron-rich Type Ia supernova (nSN Ia) was responsible for contributing these neutron-rich iron-group isotopes into the solar system (SS). The heterogeneity of these isotopes found in differentiated meteorites indicates that the isotopic compositions of the bulk SS are not uniform, and there are significant amounts of nSNe Ia dust incompletely mixed with the rest of SS materials during planetary formation. Combined with the data of now-extinct short-lived nuclide {sup 60}Fe, which can be produced more efficiently from an nSN Ia than a Type II supernova ejecta, the observed planetary-scale isotopic heterogeneity probably reflects a late input of stellar dust grains with neutron-rich nuclear statistical equilibrium nuclides into the early SS.

  1. Double trouble for grasshopper molecular systematics: intra-individual heterogeneity of both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer ribosomal DNA sequences in Hesperotettix viridis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Hesperotettix viridis grasshoppers (Orthoptera: Acrididae:Melanoplinae) exhibit intra-individual variation in both mitochondrial 12S-valine-16S and nuclear internal transcribed spacer (ITS) ribosomal DNA sequences. These findings violate core assumptions underlying DNA sequence data obtained via pol...

  2. Political Jurisdictions in Heterogeneous Communities.

    ERIC Educational Resources Information Center

    Alesina, Alberto; Baqir, Reza; Hoxby, Caroline

    2004-01-01

    We investigate whether political jurisdictions form in response to the trade-off between economies of scale and the costs of a heterogeneous population. We consider heterogeneity in income, race, ethnicity, and religion, and we test the model using American school districts, school attendance areas, municipalities, and special districts. We find…

  3. Biomarker Discovery for Heterogeneous Diseases

    PubMed Central

    Wallstrom, Garrick; Anderson, Karen S.; LaBaer, Joshua

    2013-01-01

    Background Modern genomic and proteomic studies reveal that many diseases are heterogeneous, comprising multiple different subtypes. The common notion that one biomarker can be predictive for all patients may need to be replaced by an understanding that each subtype has its own set of unique biomarkers, affecting how discovery studies are designed and analyzed. Methods We used Monte Carlo simulation to measure and compare the performance of eight selection methods with homogeneous and heterogeneous diseases using both single-stage and two-stage designs. We also applied the selection methods in an actual proteomic biomarker screening study of heterogeneous breast cancer cases. Results Different selection methods were optimal and more than 2-fold larger sample sizes were needed for heterogeneous diseases compared with homogeneous diseases. We also found that for larger studies, two-stage designs can achieve nearly the same statistical power as single-stage designs at significantly reduced cost. Conclusions We found that disease heterogeneity profoundly affected biomarker performance. We report sample size requirements and provide guidance on the design and analysis of biomarker discovery studies for both homogeneous and heterogeneous diseases. Impact We have shown that studies to identify biomarkers for the early detection of heterogeneous disease require different statistical selection methods and larger sample sizes than if the disease were homogeneous. These findings provide a methodological platform for biomarker discovery of heterogeneous diseases. PMID:23462916

  4. Heterogeneity of an earth

    NASA Astrophysics Data System (ADS)

    Litvinova, T.; Petrova, A.

    2009-04-01

    The study of magnetic anomaly field structure of the Barents Sea water area along seismic and extended profiles intersecting known fields is carried out. Geomagnetic and density sections down to 40 km depth are constructed. This allowed the estimation of heterogeneities of the Barents Sea water area deep structure. The analysis of geomagnetic and density sections along extended profiles showed the confinedness of oil-and-gas bearing provinces to deep permeable zones characterized by reduced magnetic and density features. Based on the analysis of permeable zones, regional diagnostic features similar to those obtained earlier in oil-and-gas bearing provinces in other regions, for example, in Timan-Pechora, Volga-Urals and Siberian, as well as in the Northern and Norwegian seas water areas, are revealed. The analysis of magnetic and gravity fields over the region area allowed the delineation of weakened zones as intersection areas of weakly magnetic areals with reduced density. Within the Barents Sea water area, permeable areas with lenticular-laminated structure of the upper and lower Earth's crust containing weakly magnetic areals with reduced rock density within the depth range of 8-12 and 15-20 km are revealed. Such ratio of magnetic and density heterogeneities in the Earth's crust is characteristic for zones with proved oil-and-gas content in the European part of the Atlantic Ocean water area. North Kildin field on 1 AR profile is confined to a trough with thick weakly magnetic stratum discontinuously traced to a depth of 6-10 km. At a depth of approximately 15 km, a lens of weakly magnetic and porous formations is observed. Ludlov field in the North Barents trough is confined to a zone of weakly magnetic rocks with reduced density traced to a depth of 8-9 km. Deeper, at Н=15 km, a lenticular areal of weakly magnetic formations with reduced density is observed. The profile transecting the Stockman field shows that it is located in the central part of a permeable

  5. Angiotensin II receptor heterogeneity

    SciTech Connect

    Herblin, W.F.; Chiu, A.T.; McCall, D.E.; Ardecky, R.J.; Carini, D.J.; Duncia, J.V.; Pease, L.J.; Wong, P.C.; Wexler, R.R.; Johnson, A.L. )

    1991-04-01

    The possibility of receptor heterogeneity in the angiotensin II (AII) system has been suggested previously, based on differences in Kd values or sensitivity to thiol reagents. One of the authors earliest indications was the frequent observation of incomplete inhibition of the binding of AII to adrenal cortical membranes. Autoradiographic studies demonstrated that all of the labeling of the rat adrenal was blocked by unlabeled AII or saralasin, but not by DuP 753. The predominant receptor in the rat adrenal cortex (80%) is sensitive to dithiothreitol (DTT) and DuP 753, and is designated AII-1. The residual sites in the adrenal cortex and almost all of the sites in the rat adrenal medulla are insensitive to both DTT and DuP 753, but were blocked by EXP655. These sites have been confirmed by ligand binding studies and are designated AII-2. The rabbit adrenal cortex is unique in yielding a nonuniform distribution of AII-2 sites around the outer layer of glomerulosa cells. In the rabbit kidney, the sites on the glomeruli are AII-1, but the sites on the kidney capsule are AII-2. Angiotensin III appears to have a higher affinity for AII-2 sites since it inhibits the binding to the rabbit kidney capsule but not the glomeruli. Elucidation of the distribution and function of these diverse sites should permit the development of more selective and specific therapeutic strategies.

  6. Heterogeneous recording media

    NASA Astrophysics Data System (ADS)

    Sukhanov, Vitaly I.

    1991-02-01

    The paper summarizes the results of investigations performed to obtain deep 3-D holograms with 102 i0 mkm physical thickness allowing the postexposure amplification and the a posteriori changing of the grating parameters. This aim has been achieved by developing heterogeneous systems on the basis of porous glass with light-sensitive compositions introduced into it. 1. INTRODUCTION. LIGHT-SENSITIVE MEDIA FOR 3-D HOLOGRAMS RECORDING. The 3-D holograms have many useful properties: very high diffraction efficiency angular and spectral selectivity but low level of noise. It shoud be noted that in this case deep 3-D holograms are dealt with whose physical thickness is as high as 102 -i mkm. Such hologram recording is usually done using homogeneous light-sensitive media for example dyed acid-halide and electrooptical crystals photochrome glass photostructurized polimer compositions and so on. The nature of photophisical and photochemical processes responsible for the light sensitivity of these materials exclude the possibility of post-exposure treatment. This does not allow to enhance the recorded holograms and considerably hampers their fixing or makes it practically impossible. The object of our work is to create the media which are quite suitable for two-stage processes of the deep hologram formation with post-exposure processing. Such material must satisfy the following requirements: a)they must have high permeability for the developing substances in order to make the development duration suitable for practical applications b)they must be shrinkproof to prevent deformation of the

  7. Node assignment in heterogeneous computing

    NASA Technical Reports Server (NTRS)

    Som, Sukhamoy

    1993-01-01

    A number of node assignment schemes, both static and dynamic, are explored for the Algorithm to Architecture Mapping Model (ATAMM). The architecture under consideration consists of heterogeneous processors and implements dataflow models of real-time applications. Terminology is developed for heterogeneous computing. New definitions are added to the ATAMM for token and assignment classifications. It is proved that a periodic execution is possible for dataflow graphs. Assignment algorithms are developed and proved. A design procedure is described for satisfying an objective function in an heterogeneous architecture. Several examples are provided for illustration.

  8. Heterogeneous Oxidation of Catechol.

    PubMed

    Pillar, Elizabeth A; Zhou, Ruixin; Guzman, Marcelo I

    2015-10-15

    Natural and anthropogenic emissions of aromatic hydrocarbons from biomass burning, agro-industrial settings, and fossil fuel combustion contribute precursors to secondary aerosol formation (SOA). How these compounds are processed under humid tropospheric conditions is the focus of current attention to understand their environmental fate. This work shows how catechol thin films, a model for oxygenated aromatic hydrocarbons present in biomass burning and combustion aerosols, undergo heterogeneous oxidation at the air-solid interface under variable relative humidity (RH = 0-90%). The maximum reactive uptake coefficient of O3(g) by catechol γO3 = (7.49 ± 0.35) × 10(-6) occurs for 90% RH. Upon exposure of ca. 104-μm thick catechol films to O3(g) mixing ratios between 230 ppbv and 25 ppmv, three main reaction pathways are observed. (1) The cleavage of the 1,2 carbon-carbon bond at the air-solid interface resulting in the formation of cis,cis-muconic acid via primary ozonide and hydroperoxide intermediates. Further direct ozonolysis of cis,cis-muconic yields glyoxylic, oxalic, crotonic, and maleic acids. (2) A second pathway is evidenced by the presence of Baeyer-Villiger oxidation products including glutaconic 4-hydroxy-2-butenoic and 5-oxo-2-pentenoic acids during electrospray ionization mass spectrometry (MS) and ion chromatography MS analyses. (3) Finally, indirect oxidation by in situ produced hydroxyl radical (HO(•)) results in the generation of semiquinone radical intermediates toward the synthesis of polyhydoxylated aromatic rings such as tri-, tetra-, and penta-hydroxybenzene. Remarkably, heavier polyhydroxylated biphenyl and terphenyl products present in the extracted oxidized films result from coupling reactions of semiquinones of catechol and its polyhydroxylated rings. The direct ozonolysis of 1,2,3- and 1,2,4-trihydroxybenezene yields 2- and 3-hydroxy-cis,cis-muconic acid, respectively. The production of 2,4- or 3,4-dihdroxyhex-2-enedioic acid is

  9. Homogeneous, Heterogeneous, and Enzymatic Catalysis.

    ERIC Educational Resources Information Center

    Oyama, S. Ted; Somorjai, Gabor A.

    1988-01-01

    Discusses three areas of catalysis: homegeneous, heterogeneous, and enzymatic. Explains fundamentals and economic impact of catalysis. Lists and discusses common industrial catalysts. Provides a list of 107 references. (MVL)

  10. Heterogeneity in motor driven transport

    NASA Astrophysics Data System (ADS)

    Tabei, Ali

    2015-03-01

    I will discuss quantitative analysis of particle tracking data for motor driven vesicles inside an insulin secreting cell. We use this method to study the dynamical and structural heterogeneity inside the cell. I will discuss our effort to explain the origin of observed heterogeneity in intracellular transport. Finally, I will explain how analyzing directional correlations in transport trajectories reveals self-similarity in the diffusion media.

  11. Analysis of active renin heterogeneity.

    PubMed

    Katz, S A; Malvin, R L; Lee, J; Kim, S H; Murray, R D; Opsahl, J A; Abraham, P A

    1991-09-01

    Active renin is a heterogeneous enzyme that can be separated into multiple forms with high-resolution isoelectric focusing. The isoelectric heterogeneity may result from differences in glycosylation between the different forms. In order to determine the relationship between active renin heterogeneity and differences in composition or attachment of oligosaccharides, two separate experiments were performed: (i) Tunicamycin, which interferes with normal glycosylation processing, increased the proportion of relatively basic renin forms secreted into the incubation media by rat renal cortical slices. (ii) Endoglycosidase F, which enzymatically removes carbohydrate from some classes of glycoprotein, similarly increased the proportion of relatively basic forms when incubated with active human recombinant renin. In addition, further studies with inhibitors of human renin activity revealed that the heterogeneous renin forms were similarly inhibited by two separate renin inhibitors. These results are consistent with the hypothesis that renin isoelectric heterogeneity is due in part to differences in carbohydrate moiety attachment and that the heterogeneity of renin does not influence access of direct renin inhibitors to the active site of renin. PMID:1908097

  12. Scaling of Waves in Heterogeneous Materials

    NASA Astrophysics Data System (ADS)

    Vogler, Tracy

    2011-06-01

    The fourth power scaling of strain rate with stress described by Swegle and Grady describes steady waves in many homogeneous materials, but heterogeneous materials can display different scaling relationships. In particular, layered materials exhibit a second power scaling of strain rate with stress, while first power scaling has been observed in granular materials. To better understand these scaling behaviors, numerical simulations of wave propagation in layered and granular materials are performed. The simulations demonstrate that the heterogeneous nature of these materials can cause behavior similar to what has historically been termed viscosity when observed in homogeneous materials. From these simulations, non-dimensional groups that control the scaling of the waves are identified. These groups collapse the available experimental data reasonably well onto a single curve. Finally, a simple model for the first power scaling in granular materials is proposed that illustrates the importance of void space between particles to the wave structure. Sandia National Laboratories is a multi-program laboratory operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin company, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  13. A truncated hnRNP A1 isoform, lacking the RGG-box RNA binding domain, can efficiently regulate HIV-1 splicing and replication.

    PubMed

    Jean-Philippe, Jacques; Paz, Sean; Lu, Michael L; Caputi, Massimo

    2014-01-01

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is one of the most abundant RNA binding proteins. hnRNP A1 is localized prevalently in the nucleus but it can relocate to the cytoplasm in response to specific stimuli shuttling between nuclear and cytoplasmic compartments. The cellular localization of this protein is regulated by a short C-terminus motif (M9) and other less defined sequences. The RNA binding specificity of this protein is dependent on multiple RNA binding domains (RBDs), which regulate its role in RNA processing and expression. hnRNP A1 plays multiple roles in gene expression by regulating the biogenesis and translation of messengers RNAs, the processing of miRNAs, affecting transcription and controlling telomere maintenance. The multiple functions of this protein correlate with diverse roles in genetic disease, cancer and the replication of viral pathogens. Utilizing a tagged hnRNP A1 deletion library we have shown that the three hnRNP A1 RBDs contribute to the prevalent nuclear distribution of the protein. Our data also indicate that a truncated form of the protein, lacking one of the RBDs, the RGG-box, can regulate splicing of a splicing reporter minigene and down-regulate replication of the HIV-1 virus with efficiency comparable to the wild-type protein. This functional hnRNP A1 deletion mutant is similar to a predicted hnRNP A1 isoform, which had not been previously experimentally characterized. PMID:24530421

  14. Dealing with spatial heterogeneity

    NASA Astrophysics Data System (ADS)

    Marsily, Gh.; Delay, F.; Gonçalvès, J.; Renard, Ph.; Teles, V.; Violette, S.

    2005-03-01

    Heterogeneity can be dealt with by defining homogeneous equivalent properties, known as averaging, or by trying to describe the spatial variability of the rock properties from geologic observations and local measurements. The techniques available for these descriptions are mostly continuous Geostatistical models, or discontinuous facies models such as the Boolean, Indicator or Gaussian-Threshold models and the Markov chain model. These facies models are better suited to treating issues of rock strata connectivity, e.g. buried high permeability channels or low permeability barriers, which greatly affect flow and, above all, transport in aquifers. Genetic models provide new ways to incorporate more geology into the facies description, an approach that has been well developed in the oil industry, but not enough in hydrogeology. The conclusion is that future work should be focused on improving the facies models, comparing them, and designing new in situ testing procedures (including geophysics) that would help identify the facies geometry and properties. A world-wide catalog of aquifer facies geometry and properties, which could combine site genesis and description with methods used to assess the system, would be of great value for practical applications. On peut aborder le problème de l'hétérogénéité en s'efforçant de définir une perméabilité équivalente homogène, par prise de moyenne, ou au contraire en décrivant la variation dans l'espace des propriétés des roches à partir des observations géologiques et des mesures locales. Les techniques disponibles pour une telle description sont soit continues, comme l'approche Géostatistique, soit discontinues, comme les modèles de faciès, Booléens, ou bien par Indicatrices ou Gaussiennes Seuillées, ou enfin Markoviens. Ces modèles de faciès sont mieux capables de prendre en compte la connectivité des strates géologiques, telles que les chenaux enfouis à forte perméabilité, ou au contraire les faci

  15. Dealing with spatial heterogeneity

    NASA Astrophysics Data System (ADS)

    Marsily, Gh.; Delay, F.; Gonçalvès, J.; Renard, Ph.; Teles, V.; Violette, S.

    2005-03-01

    Heterogeneity can be dealt with by defining homogeneous equivalent properties, known as averaging, or by trying to describe the spatial variability of the rock properties from geologic observations and local measurements. The techniques available for these descriptions are mostly continuous Geostatistical models, or discontinuous facies models such as the Boolean, Indicator or Gaussian-Threshold models and the Markov chain model. These facies models are better suited to treating issues of rock strata connectivity, e.g. buried high permeability channels or low permeability barriers, which greatly affect flow and, above all, transport in aquifers. Genetic models provide new ways to incorporate more geology into the facies description, an approach that has been well developed in the oil industry, but not enough in hydrogeology. The conclusion is that future work should be focused on improving the facies models, comparing them, and designing new in situ testing procedures (including geophysics) that would help identify the facies geometry and properties. A world-wide catalog of aquifer facies geometry and properties, which could combine site genesis and description with methods used to assess the system, would be of great value for practical applications. On peut aborder le problème de l'hétérogénéité en s'efforçant de définir une perméabilité équivalente homogène, par prise de moyenne, ou au contraire en décrivant la variation dans l'espace des propriétés des roches à partir des observations géologiques et des mesures locales. Les techniques disponibles pour une telle description sont soit continues, comme l'approche Géostatistique, soit discontinues, comme les modèles de faciès, Booléens, ou bien par Indicatrices ou Gaussiennes Seuillées, ou enfin Markoviens. Ces modèles de faciès sont mieux capables de prendre en compte la connectivité des strates géologiques, telles que les chenaux enfouis à forte perméabilité, ou au contraire les faci

  16. Reaction Selectivity in Heterogeneous Catalysis

    SciTech Connect

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  17. EIYMNVPV Motif is Essential for A1CF Nucleus Localization and A1CF (-8aa) Promotes Proliferation of MDA-MB-231 Cells via Up-Regulation of IL-6

    PubMed Central

    Zhou, Li; Hao, Jin; Yuan, Yue; Peng, Rui; Wang, Honglian; Ni, Dongsheng; Gu, Yuping; Huang, Liyuan; Mao, Zhaomin; Lyu, Zhongshi; Du, Yao; Liu, Zhicheng; Li, Yiman; Ju, Pan; Long, Yaoshui; Liu, Jianing; Zhou, Qin

    2016-01-01

    Apobec-1 complementation factor (A1CF) is a heterogeneous nuclear ribonuceloprotein (hnRNP) and mediates apolipoprotein-B mRNA editing. A1CF can promote the regeneration of the liver by post-transcriptionally stabilizing Interleukin-6 (IL-6) mRNA. It also contains two transcriptional variants-A1CF64 and A1CF65, distinguished by the appearance of a 24-nucleotide motif which contributes to the corresponding eight-amino acid motif of EIYMNVPV. For the first time, we demonstrated that the EIYMNVPV motif was essential for A1CF nucleus localization, A1CF deficient of the EIYMNVPV motif, A1CF (-8aa) showed cytoplasm distribution. More importantly, we found that A1CF (-8aa), but not its full-length counterpart, can promote proliferation of MDA-MB-231 cells accompanied with increased level of IL-6 mRNA. Furthermore, silencing of IL-6 attenuated A1CF (-8aa)-induced proliferation in MDA-MB-231 cells. In conclusion, notably, these findings suggest that A1CF (-8aa) promoted proliferation of MDA-MB-231 cells in vitro viewing IL-6 as a target. Thus, the EIYMNVPV motif could be developed as a potential target for basal-like breast cancer therapy. PMID:27231908

  18. EIYMNVPV Motif is Essential for A1CF Nucleus Localization and A1CF (-8aa) Promotes Proliferation of MDA-MB-231 Cells via Up-Regulation of IL-6.

    PubMed

    Zhou, Li; Hao, Jin; Yuan, Yue; Peng, Rui; Wang, Honglian; Ni, Dongsheng; Gu, Yuping; Huang, Liyuan; Mao, Zhaomin; Lyu, Zhongshi; Du, Yao; Liu, Zhicheng; Li, Yiman; Ju, Pan; Long, Yaoshui; Liu, Jianing; Zhou, Qin

    2016-01-01

    Apobec-1 complementation factor (A1CF) is a heterogeneous nuclear ribonuceloprotein (hnRNP) and mediates apolipoprotein-B mRNA editing. A1CF can promote the regeneration of the liver by post-transcriptionally stabilizing Interleukin-6 (IL-6) mRNA. It also contains two transcriptional variants-A1CF64 and A1CF65, distinguished by the appearance of a 24-nucleotide motif which contributes to the corresponding eight-amino acid motif of EIYMNVPV. For the first time, we demonstrated that the EIYMNVPV motif was essential for A1CF nucleus localization, A1CF deficient of the EIYMNVPV motif, A1CF (-8aa) showed cytoplasm distribution. More importantly, we found that A1CF (-8aa), but not its full-length counterpart, can promote proliferation of MDA-MB-231 cells accompanied with increased level of IL-6 mRNA. Furthermore, silencing of IL-6 attenuated A1CF (-8aa)-induced proliferation in MDA-MB-231 cells. In conclusion, notably, these findings suggest that A1CF (-8aa) promoted proliferation of MDA-MB-231 cells in vitro viewing IL-6 as a target. Thus, the EIYMNVPV motif could be developed as a potential target for basal-like breast cancer therapy. PMID:27231908

  19. Quantifying tumour heterogeneity with CT

    PubMed Central

    Miles, Kenneth A.

    2013-01-01

    Abstract Heterogeneity is a key feature of malignancy associated with adverse tumour biology. Quantifying heterogeneity could provide a useful non-invasive imaging biomarker. Heterogeneity on computed tomography (CT) can be quantified using texture analysis which extracts spatial information from CT images (unenhanced, contrast-enhanced and derived images such as CT perfusion) that may not be perceptible to the naked eye. The main components of texture analysis can be categorized into image transformation and quantification. Image transformation filters the conventional image into its basic components (spatial, frequency, etc.) to produce derived subimages. Texture quantification techniques include structural-, model- (fractal dimensions), statistical- and frequency-based methods. The underlying tumour biology that CT texture analysis may reflect includes (but is not limited to) tumour hypoxia and angiogenesis. Emerging studies show that CT texture analysis has the potential to be a useful adjunct in clinical oncologic imaging, providing important information about tumour characterization, prognosis and treatment prediction and response. PMID:23545171

  20. Heterogeneous surfaces to repel proteins.

    PubMed

    Shen, Lei; Zhu, Jintao

    2016-02-01

    The nonspecific adsorption of proteins is usually undesirable on solid surfaces as it induces adverse responses, such as platelet adhesion on medical devices, negative signals of biosensors and contamination blockage of filtration membranes. Thus, an important scheme in material science is to design and fabricate protein-repulsive surfaces. Early approaches in this field focused on homogeneous surfaces comprised of single type functionality. Yet, recent researches have demonstrated that surfaces with heterogeneities (chemistry and topography) show promising performance against protein adsorption. In this review, we will summarize the recent achievements and discuss the new perspectives in the research of developing and characterizing heterogeneous surfaces to repel proteins. The protein repulsion mechanisms of different heterogeneous surfaces will also be discussed in details, followed by the perspective and challenge of this emerging field. PMID:26691416

  1. Resource heterogeneity can facilitate cooperation

    PubMed Central

    Kun, Ádám; Dieckmann, Ulf

    2013-01-01

    Although social structure is known to promote cooperation, by locally exposing selfish agents to their own deeds, studies to date assumed that all agents have access to the same level of resources. This is clearly unrealistic. Here we find that cooperation can be maintained when some agents have access to more resources than others. Cooperation can then emerge even in populations in which the temptation to defect is so strong that players would act fully selfishly if their resources were distributed uniformly. Resource heterogeneity can thus be crucial for the emergence and maintenance of cooperation. We also show that resource heterogeneity can hinder cooperation once the temptation to defect is significantly lowered. In all cases, the level of cooperation can be maximized by managing resource heterogeneity. PMID:24088665

  2. Simulator for heterogeneous dataflow architectures

    NASA Technical Reports Server (NTRS)

    Malekpour, Mahyar R.

    1993-01-01

    A new simulator is developed to simulate the execution of an algorithm graph in accordance with the Algorithm to Architecture Mapping Model (ATAMM) rules. ATAMM is a Petri Net model which describes the periodic execution of large-grained, data-independent dataflow graphs and which provides predictable steady state time-optimized performance. This simulator extends the ATAMM simulation capability from a heterogenous set of resources, or functional units, to a more general heterogenous architecture. Simulation test cases show that the simulator accurately executes the ATAMM rules for both a heterogenous architecture and a homogenous architecture, which is the special case for only one processor type. The simulator forms one tool in an ATAMM Integrated Environment which contains other tools for graph entry, graph modification for performance optimization, and playback of simulations for analysis.

  3. Static heterogeneities in liquid water

    NASA Astrophysics Data System (ADS)

    Stanley, H. Eugene; Buldyrev, Sergey V.; Giovambattista, Nicolas

    2004-10-01

    The thermodynamic behavior of water seems to be closely related to static heterogeneities. These static heterogeneities are related to the local structure of water molecules, and when properly characterized, may offer an economical explanation of thermodynamic data. The key feature of liquid water is not so much that the existence of hydrogen bonds, first pointed out by Linus Pauling, but rather the local geometry of the liquid molecules is not spherical or oblong but tetrahedral. In the consideration of static heterogeneities, this local geometry is critical. Recent experiments suggested more than one phase of amorphous solid water, while simulations suggest that one of these phases is metastable with respect to another, so that in fact there are only two stable phases.

  4. Social Capital and Community Heterogeneity

    ERIC Educational Resources Information Center

    Coffe, Hilde

    2009-01-01

    Recent findings indicate that more pronounced community heterogeneity is associated with lower levels of social capital. These studies, however, concentrate on specific aspects in which people differ (such as income inequality or ethnic diversity). In the present paper, we introduce the number of parties in the local party system as a more…

  5. Floodplain heterogeneity and meander migration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The impact of horizontal heterogeneity of floodplain soils on rates and patterns of meander migration is analyzed with a Ikeda et al. (1981)-type model for hydrodynamics and bed morphodynamics, coupled with a physically-based bank erosion model according to the approach developed by Motta et al. (20...

  6. Teaching about Heterogeneous Response Models

    ERIC Educational Resources Information Center

    Murray, Michael P.

    2014-01-01

    Individuals vary in their responses to incentives and opportunities. For example, additional education will affect one person differently than another. In recent years, econometricians have given increased attention to such heterogeneous responses and to the consequences of such responses for interpreting regression estimates, especially…

  7. Electoral Competition in Heterogeneous Districts

    ERIC Educational Resources Information Center

    Callander, Steven

    2005-01-01

    This paper considers a model of elections in which parties compete simultaneously for multiple districts. I show that if districts are heterogeneous, then a unique two-party equilibrium exists under plurality rule in which further entry is deterred. The equilibrium requires that parties choose noncentrist policy platforms and not converge to the…

  8. Flammability of Heterogeneously Combusting Metals

    NASA Technical Reports Server (NTRS)

    Jones, Peter D.

    1998-01-01

    Most engineering materials, including some metals, most notably aluminum, burn in homogeneous combustion. 'Homogeneous' refers to both the fuel and the oxidizer being in the same phase, which is usually gaseous. The fuel and oxidizer are well mixed in the combustion reaction zone, and heat is released according to some relation like q(sub c) = delta H(sub c)c[((rho/rho(sub 0))]exp a)(exp -E(sub c)/RT), Eq. (1) where the pressure exponent a is usually close to unity. As long as there is enough heat released, combustion is sustained. It is useful to conceive of a threshold pressure beyond which there is sufficient heat to keep the temperature high enough to sustain combustion, and beneath which the heat is so low that temperature drains away and the combustion is extinguished. Some materials burn in heterogeneous combustion, in which the fuel and oxidizer are in different phases. These include iron and nickel based alloys, which burn in the liquid phase with gaseous oxygen. Heterogeneous combustion takes place on the surface of the material (fuel). Products of combustion may appear as a solid slag (oxide) which progressively covers the fuel. Propagation of the combustion melts and exposes fresh fuel. Heterogeneous combustion heat release also follows the general form of Eq.(1), except that the pressure exponent a tends to be much less than 1. Therefore, the increase in heat release with increasing pressure is not as dramatic as it is in homogeneous combustion. Although the concept of a threshold pressure still holds in heterogeneous combustion, the threshold is more difficult to identify experimentally, and pressure itself becomes less important relative to the heat transfer paths extant in any specific application. However, the constants C, a, and E(sub c) may still be identified by suitable data reduction from heterogeneous combustion experiments, and may be applied in a heat transfer model to judge the flammability of a material in any particular actual

  9. Surface heterogeneity of small asteroids

    NASA Astrophysics Data System (ADS)

    Sasaki, Sho

    A rubble pile model of asteroid origin would predict averaged rather homogeneous surface of an asteroid. Previous spacecraft observations (mostly S-type asteroids) did not show large color/albedo variation on the surface. Vesta would be exceptional since HST observation suggested that its surface should be heterogeneous due to the impact excavation of the interior. As for a young asteroid (832) Karin (age being 5Ma), Sasaki et al. (2004) detected variation of infrared spectra which could be explained by the difference of the space weathering degree. They discussed the possibility of the survival of the old surface. However, the variation was not confirmed by later observation (Chapman et al., 2007; Vernazza et al., 2007). Recent observation of a small (550m) asteroid Itokawa by Hayabusa spacecraft revealed that Itokawa is heterogeneous in color and albedo although the overall rocky structure is considered as a rubble pile (Saito et al., 2006). The color difference can be explained by the difference of weathering degree (Ishiguro et al., 2008). The heterogeneity could be explained by mass movement caused by rapid rotation from YORP effect (Scheeres et al., 2007) or seismic shaking (Sasaki, 2006). Probably small silicate asteroids without significant regolith could have heterogeneous in color and albedo. On large asteroids (˜ a few 10km), regolith reaccumulation should have covered the underlying heterogeneity. References: Chapman, C. R. et al (2007) Icarus, 191, 323-329 Ishiguro, M. et al. (2008) MAPS, in press. Saito, J. et al. (2006) Science, 312, 1341-1344 Sasaki, S. (2006) in Spacecraft Reconnaissance of Asteroid and Comet Interiors Sasaki, T. et al (2004) Astrophys. J. 615, L161-L164 Scheeres, D. J. (2007) Icarus 188, 425-429 Vernazza, P. et al. (2007) Icarus 191, 330-336.

  10. Heterogeneous Viscoelasticity: A Combined Theory of Dynamic and Elastic Heterogeneity.

    PubMed

    Schirmacher, Walter; Ruocco, Giancarlo; Mazzone, Valerio

    2015-07-01

    We present a heterogeneous version of Maxwell's theory of viscoelasticity based on the assumption of spatially fluctuating local viscoelastic coefficients. The model is solved in coherent-potential approximation. The theory predicts an Arrhenius-type temperature dependence of the viscosity in the vanishing-frequency limit, independent of the distribution of the activation energies. It is shown that this activation energy is generally different from that of a diffusing particle with the same barrier-height distribution, which explains the violation of the Stokes-Einstein relation observed frequently in glasses. At finite but low frequencies, the theory describes low-temperature asymmetric alpha relaxation. As examples, we report the good agreement obtained for selected inorganic, metallic, and organic glasses. At high frequencies, the theory reduces to heterogeneous elasticity theory, which explains the occurrence of the boson peak and related vibrational anomalies. PMID:26182108

  11. A1C test

    MedlinePlus

    HbA1C test; Glycated hemoglobin test; Glycosylated hemoglobin test; Hemoglobin glycosylated test; Glycohemoglobin test ... have recently eaten does not affect the A1C test, so you do not need to fast to ...

  12. NASA GSFC Perspective on Heterogeneous Processing

    NASA Technical Reports Server (NTRS)

    Powell, Wesley A.

    2016-01-01

    This presentation provides an overview of NASA GSFC, our onboard processing applications, the applicability heterogeneous processing to these applications, and necessary developments to enable heterogeneous processing to be infused into our missions.

  13. Biodiesel production using heterogeneous catalysts.

    PubMed

    Semwal, Surbhi; Arora, Ajay K; Badoni, Rajendra P; Tuli, Deepak K

    2011-02-01

    The production and use of biodiesel has seen a quantum jump in the recent past due to benefits associated with its ability to mitigate greenhouse gas (GHG). There are large number of commercial plants producing biodiesel by transesterification of vegetable oils and fats based on base catalyzed (caustic) homogeneous transesterification of oils. However, homogeneous process needs steps of glycerol separation, washings, very stringent and extremely low limits of Na, K, glycerides and moisture limits in biodiesel. Heterogeneous catalyzed production of biodiesel has emerged as a preferred route as it is environmentally benign needs no water washing and product separation is much easier. The present report is review of the progress made in development of heterogeneous catalysts suitable for biodiesel production. This review shall help in selection of suitable catalysts and the optimum conditions for biodiesel production. PMID:21106371

  14. Heterogeneous, weakly coupled map lattices

    NASA Astrophysics Data System (ADS)

    Sotelo Herrera, M.a. Dolores; San Martín, Jesús; Porter, Mason A.

    2016-07-01

    Coupled map lattices (CMLs) are often used to study emergent phenomena in nature. It is typically assumed (unrealistically) that each component is described by the same map, and it is important to relax this assumption. In this paper, we characterize periodic orbits and the laminar regime of type-I intermittency in heterogeneous weakly coupled map lattices (HWCMLs). We show that the period of a cycle in an HWCML is preserved for arbitrarily small coupling strengths even when an associated uncoupled oscillator would experience a period-doubling cascade. Our results characterize periodic orbits both near and far from saddle-node bifurcations, and we thereby provide a key step for examining the bifurcation structure of heterogeneous CMLs.

  15. Advanced reactor physics methods for heterogeneous reactor cores

    NASA Astrophysics Data System (ADS)

    Thompson, Steven A.

    To maintain the economic viability of nuclear power the industry has begun to emphasize maximizing the efficiency and output of existing nuclear power plants by using longer fuel cycles, stretch power uprates, shorter outage lengths, mixed-oxide (MOX) fuel and more aggressive operating strategies. In order to accommodate these changes, while still satisfying the peaking factor and power envelope requirements necessary to maintain safe operation, more complexity in commercial core designs have been implemented, such as an increase in the number of sub-batches and an increase in the use of both discrete and integral burnable poisons. A consequence of the increased complexity of core designs, as well as the use of MOX fuel, is an increase in the neutronic heterogeneity of the core. Such heterogeneous cores introduce challenges for the current methods that are used for reactor analysis. New methods must be developed to address these deficiencies while still maintaining the computational efficiency of existing reactor analysis methods. In this thesis, advanced core design methodologies are developed to be able to adequately analyze the highly heterogeneous core designs which are currently in use in commercial power reactors. These methodological improvements are being pursued with the goal of not sacrificing the computational efficiency which core designers require. More specifically, the PSU nodal code NEM is being updated to include an SP3 solution option, an advanced transverse leakage option, and a semi-analytical NEM solution option.

  16. Specialization and Bet Hedging in Heterogeneous Populations

    NASA Astrophysics Data System (ADS)

    Rulands, Steffen; Jahn, David; Frey, Erwin

    2014-09-01

    Phenotypic heterogeneity is a strategy commonly used by bacteria to rapidly adapt to changing environmental conditions. Here, we study the interplay between phenotypic heterogeneity and genetic diversity in spatially extended populations. By analyzing the spatiotemporal dynamics, we show that the level of mobility and the type of competition qualitatively influence the persistence of phenotypic heterogeneity. While direct competition generally promotes persistence of phenotypic heterogeneity, specialization dominates in models with indirect competition irrespective of the degree of mobility.

  17. On comparing heterogeneity across biomarkers

    PubMed Central

    Steininger, Robert J.; Rajaram, Satwik; Girard, Luc; Minna, John D.; Wu, Lani F.; Altschuler, Steven J.

    2015-01-01

    Microscopy reveals complex patterns of cellular heterogeneity that can be biologically informative. However, a limitation of microscopy is that only a small number of biomarkers can typically be monitored simultaneously. Thus, a natural question is whether additional biomarkers provide a deeper characterization of the distribution of cellular states in a population. How much information about a cell’s phenotypic state in one biomarker is gained by knowing its state in another biomarker? Here, we describe a framework for comparing phenotypic states across biomarkers. Our approach overcomes the current limitation of microscopy by not requiring co-staining biomarkers on the same cells; instead we require staining of biomarkers (possibly separately) on a common collection of phenotypically diverse cell lines. We evaluate our approach on two image datasets: 33 oncogenically diverse lung cancer cell lines stained with 7 biomarkers, and 49 less diverse subclones of one lung cancer cell line stained with 12 biomarkers. We first validate our method by comparing it to the “gold standard” of co-staining. We then apply our approach to all pairs of biomarkers and use it to identify biomarkers that yield similar patterns of heterogeneity. The results presented in this work suggest that many biomarkers provide redundant information about heterogeneity. Thus, our approach provides a practical guide for selecting independently informative biomarkers and, more generally, will yield insights into both the connectivity of biological networks and the complexity of the state space of biological systems. PMID:25425168

  18. Translational Implications of Tumor Heterogeneity

    PubMed Central

    Jamal-Hanjani, Mariam; Quezada, Sergio A.; Larkin, James; Swanton, Charles

    2015-01-01

    Advances in next-generation sequencing and bioinformatics have led to an unprecedented view of the cancer genome and its evolution. Genomic studies have demonstrated the complex and heterogeneous clonal landscape of tumors of different origins, and the potential impact of intratumor heterogeneity on treatment response and resistance, cancer progression and the risk of disease relapse. However, the significance of subclonal mutations, in particular mutations in driver genes, and their evolution through time and their dynamics in response to cancer therapies, is yet to be determined. The necessary tools are now available to prospectively determine whether clonal heterogeneity can be used as a biomarker of clinical outcome, and to what extent subclonal somatic alterations might influence clinical outcome. Studies that employ longitudinal tissue sampling, integrating both genomic and clinical data, have the potential to reveal the subclonal composition and track the evolution of tumors in order to address these questions, and to begin to define the breadth of genetic diversity in different tumor types, and its relevance to patient outcome. Such studies may provide further evidence for novel drug resistance mechanisms informing novel combinatorial, adaptive and tumour immune-therapies placed within the context of tumor evolution. PMID:25770293

  19. Heterogeneous nucleation or homogeneous nucleation?

    NASA Astrophysics Data System (ADS)

    Liu, X. Y.

    2000-06-01

    The generic heterogeneous effect of foreign particles on three dimensional nucleation was examined both theoretically and experimentally. It shows that the nucleation observed under normal conditions includes a sequence of progressive heterogeneous processes, characterized by different interfacial correlation function f(m,x)s. At low supersaturations, nucleation will be controlled by the process with a small interfacial correlation function f(m,x), which results from a strong interaction and good structural match between the foreign bodies and the crystallizing phase. At high supersaturations, nucleation on foreign particles having a weak interaction and poor structural match with the crystallizing phase (f(m,x)→1) will govern the kinetics. This frequently leads to the false identification of homogeneous nucleation. Genuine homogeneous nucleation, which is the up-limit of heterogeneous nucleation, may not be easily achievable under gravity. In order to check these results, the prediction is confronted with nucleation experiments of some organic and inorganic crystals. The results are in excellent agreement with the theory.

  20. Analyzing and modeling heterogeneous behavior

    NASA Astrophysics Data System (ADS)

    Lin, Zhiting; Wu, Xiaoqing; He, Dongyue; Zhu, Qiang; Ni, Jixiang

    2016-05-01

    Recently, it was pointed out that the non-Poisson statistics with heavy tail existed in many scenarios of human behaviors. But most of these studies claimed that power-law characterized diverse aspects of human mobility patterns. In this paper, we suggest that human behavior may not be driven by identical mechanisms and can be modeled as a Semi-Markov Modulated Process. To verify our suggestion and model, we analyzed a total of 1,619,934 records of library visitations (including undergraduate and graduate students). It is found that the distribution of visitation intervals is well fitted with three sections of lines instead of the traditional power law distribution in log-log scale. The results confirm that some human behaviors cannot be simply expressed as power law or any other simple functions. At the same time, we divided the data into groups and extracted period bursty events. Through careful analysis in different groups, we drew a conclusion that aggregate behavior might be composed of heterogeneous behaviors, and even the behaviors of the same type tended to be different in different period. The aggregate behavior is supposed to be formed by "heterogeneous groups". We performed a series of experiments. Simulation results showed that we just needed to set up two states Semi-Markov Modulated Process to construct proper representation of heterogeneous behavior.

  1. Investigating Population Heterogeneity With Factor Mixture Models

    ERIC Educational Resources Information Center

    Lubke, Gitta H.; Muthen, Bengt

    2005-01-01

    Sources of population heterogeneity may or may not be observed. If the sources of heterogeneity are observed (e.g., gender), the sample can be split into groups and the data analyzed with methods for multiple groups. If the sources of population heterogeneity are unobserved, the data can be analyzed with latent class models. Factor mixture models…

  2. Nuclear heterogeneity in conidial populations of Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus flavus is a major producer of aflatoxin and an opportunistic pathogen for a wide range of hosts. Understanding genotypic and phenotypic variations within strains of A. flavus is important for controlling disease and reducing aflatoxin contamination. A. flavus is multinucleate and predomi...

  3. A1C

    MedlinePlus

    A1C is a blood test for type 2 diabetes and prediabetes. It measures your average blood glucose, or blood sugar, level over the past 3 ... A1C alone or in combination with other diabetes tests to make a diagnosis. They also use the ...

  4. A Heterogeneous Medium Analytical Benchmark

    SciTech Connect

    Ganapol, B.D.

    1999-09-27

    A benchmark, called benchmark BLUE, has been developed for one-group neutral particle (neutron or photon) transport in a one-dimensional sub-critical heterogeneous plane parallel medium with surface illumination. General anisotropic scattering is accommodated through the Green's Function Method (GFM). Numerical Fourier transform inversion is used to generate the required Green's functions which are kernels to coupled integral equations that give the exiting angular fluxes. The interior scalar flux is then obtained through quadrature. A compound iterative procedure for quadrature order and slab surface source convergence provides highly accurate benchmark qualities (4- to 5- places of accuracy) results.

  5. Root Patterns in Heterogeneous Soils

    NASA Astrophysics Data System (ADS)

    Dara, A.; Moradi, A. B.; Carminati, A.; Oswald, S. E.

    2010-12-01

    Heterogeneous water availability is a typical characteristic of soils in which plant roots grow. Despite the intrinsic heterogeneity of soil-plant water relations, we know little about the ways how plants respond to local environmental quality. Furthermore, increasing use of soil amendments as partial water reservoirs in agriculture calls for a better understanding of plant response to soil heterogeneity. Neutron radiography is a non-invasive imaging that is highly sensitive to water and root distribution and that has high capability for monitoring spatial and temporal soil-plant water relations in heterogeneous systems. Maize plants were grown in 25 x 30 x 1 cm aluminum slabs filled with sandy soil. On the right side of the compartments a commercial water absorbent (Geohumus) was mixed with the soil. Geohumus was distributed with two patterns: mixed homogeneously with the soil, and arranged as 1-cm diameter aggregates (Fig. 1). Two irrigation treatments were applied: sufficient water irrigation and moderate water stress. Neutron radiography started 10 days after planting and has been performed twice a day for one week. At the end of the experiment, the containers were opened, the root were removed and dry root weight in different soil segments were measured. Neutron radiography showed root growth tendency towards Geohumus treated parts and preferential water uptake from Geohumus aggregates. Number and length of fine lateral roots were lower in treated areas compared to the non-treated zone and to control soil. Although corn plants showed an overall high proliferation towards the soil water sources, they decreased production of branches and fine root when water was more available near the main root parts. However there was 50% higher C allocation in roots grown in Geohumus compartments, as derived by the relative dry weight of root. The preferential C allocation in treated regions was higher when plants grew under water stress. We conclude that in addition to the

  6. Nuclear Medicine

    MedlinePlus

    ... Parents/Teachers Resource Links for Students Glossary Nuclear Medicine What is nuclear medicine? What are radioactive tracers? ... funded researchers advancing nuclear medicine? What is nuclear medicine? Nuclear medicine is a medical specialty that uses ...

  7. A1C Test

    MedlinePlus

    ... to minimize the complications caused by chronically elevated glucose levels, such as progressive damage to body organs like the kidneys, eyes, cardiovascular system, and nerves. The A1c test result ...

  8. Socially Aware Heterogeneous Wireless Networks.

    PubMed

    Kosmides, Pavlos; Adamopoulou, Evgenia; Demestichas, Konstantinos; Theologou, Michael; Anagnostou, Miltiades; Rouskas, Angelos

    2015-01-01

    The development of smart cities has been the epicentre of many researchers' efforts during the past decade. One of the key requirements for smart city networks is mobility and this is the reason stable, reliable and high-quality wireless communications are needed in order to connect people and devices. Most research efforts so far, have used different kinds of wireless and sensor networks, making interoperability rather difficult to accomplish in smart cities. One common solution proposed in the recent literature is the use of software defined networks (SDNs), in order to enhance interoperability among the various heterogeneous wireless networks. In addition, SDNs can take advantage of the data retrieved from available sensors and use them as part of the intelligent decision making process contacted during the resource allocation procedure. In this paper, we propose an architecture combining heterogeneous wireless networks with social networks using SDNs. Specifically, we exploit the information retrieved from location based social networks regarding users' locations and we attempt to predict areas that will be crowded by using specially-designed machine learning techniques. By recognizing possible crowded areas, we can provide mobile operators with recommendations about areas requiring datacell activation or deactivation. PMID:26110402

  9. Immunophenotype Heterogeneity in Nasal Glomangiopericytoma

    PubMed Central

    Handra-Luca, Adriana; Abd Elmageed, Zakaria Y.; Magkou, Christina; Lae, Marick

    2015-01-01

    Nasal glomangiopericytoma is rare. The immunophenotype is heterogeneous, more frequently smooth-muscle-actin and CD34-positive. We report expression patterns for several vascular-related proteins such as CD99, CD146, Bcl2, and WT1 as well as for treatment-related proteins such as mTOR and EGFR in a nasal glomangiopericytoma. The patient (woman, 86 years) presented with a left nasal tumefaction. The resected specimen (1.5-cm) showed a glomangiopericytoma. Tumor cells expressed smooth-muscle-actin, CD31, CD34, and progesterone receptor. They also expressed the vascular-cell-related proteins Bcl2, CD99, CD146, and WT1, as well as mTOR and EGFR. Nasal glomangiopericytomas show immunohistochemical heterogeneity for vascular-related markers, suggesting a possible extensive pericytic differentiation. The expression of potential targets for drug treatments such as mTOR and EGFR may impact on the clinical follow-up of these tumors occurring at advanced ages, which may require complex surgery. PMID:26351605

  10. On evolutionary spatial heterogeneous games

    NASA Astrophysics Data System (ADS)

    Fort, H.

    2008-03-01

    How cooperation between self-interested individuals evolve is a crucial problem, both in biology and in social sciences, that is far from being well understood. Evolutionary game theory is a useful approach to this issue. The simplest model to take into account the spatial dimension in evolutionary games is in terms of cellular automata with just a one-parameter payoff matrix. Here, the effects of spatial heterogeneities of the environment and/or asymmetries in the interactions among the individuals are analysed through different extensions of this model. Instead of using the same universal payoff matrix, bimatrix games in which each cell at site ( i, j) has its own different ‘temptation to defect’ parameter T(i,j) are considered. First, the case in which these individual payoffs are constant in time is studied. Second, an evolving evolutionary spatial game such that T=T(i,j;t), i.e. besides depending on the position evolves (by natural selection), is used to explore the combination of spatial heterogeneity and natural selection of payoff matrices.

  11. Shock Initiation of Heterogeneous Explosives

    SciTech Connect

    Reaugh, J E

    2004-05-10

    The fundamental picture that shock initiation in heterogeneous explosives is caused by the linking of hot spots formed at inhomogeneities was put forward by several researchers in the 1950's and 1960's, and more recently. Our work uses the computer hardware and software developed in the Advanced Simulation and Computing (ASC) program of the U.S. Department of Energy to explicitly include heterogeneities at the scale of the explosive grains and to calculate the consequences of realistic although approximate models of explosive behavior. Our simulations are performed with ALE-3D, a three-dimensional, elastic-plastic-hydrodynamic Arbitrary Lagrange-Euler finite-difference program, which includes chemical kinetics and heat transfer, and which is under development at this laboratory. We developed the parameter values for a reactive-flow model to describe the non-ideal detonation behavior of an HMX-based explosive from the results of grain-scale simulations. In doing so, we reduced the number of free parameters that are inferred from comparison with experiment to a single one - the characteristic defect dimension. We also performed simulations of the run to detonation in small volumes of explosive. These simulations illustrate the development of the reaction zone and the acceleration of the shock front as the flame fronts start from hot spots, grow, and interact behind the shock front. In this way, our grain-scale simulations can also connect to continuum experiments directly.

  12. Heterogeneous Integration of Compound Semiconductors

    NASA Astrophysics Data System (ADS)

    Moutanabbir, Oussama; Gösele, Ulrich

    2010-08-01

    The ability to tailor compound semiconductors and to integrate them onto foreign substrates can lead to superior or novel functionalities with a potential impact on various areas in electronics, optoelectronics, spintronics, biosensing, and photovoltaics. This review provides a brief description of different approaches to achieve this heterogeneous integration, with an emphasis on the ion-cut process, also known commercially as the Smart-Cut™ process. This process combines semiconductor wafer bonding and undercutting using defect engineering by light ion implantation. Bulk-quality heterostructures frequently unattainable by direct epitaxial growth can be produced, provided that a list of technical criteria is fulfilled, thus offering an additional degree of freedom in the design and fabrication of heterogeneous and flexible devices. Ion cutting is a generic process that can be employed to split and transfer fine monocrystalline layers from various crystals. Materials and engineering issues as well as our current understanding of the underlying physics involved in its application to cleaving thin layers from freestanding GaN, InP, and GaAs wafers are presented.

  13. Dispersivity in heterogeneous permeable media

    SciTech Connect

    Chesnut, D.A.

    1994-01-01

    When one fluid displaces another through a one-dimensional porous medium, the composition changes from pure displacing fluid at the inlet to pure displaced fluid some distance downstream. The distance over which an arbitrary percentage of this change occurs is defined as the mixing zone length, which increases with increasing average distance traveled by the displacement front. For continuous injection, the mixing zone size can be determined from a breakthrough curve as the time required for the effluent displacing fluid concentration to change from, say, 10% to 90%. In classical dispersion theory, the mixing zone grows in proportion to the square root of the mean distance traveled, or, equivalently, to the square root of the mean breakthrough time. In a multi-dimensional heterogeneous medium, especially at field scales, the size of the mixing zone grows almost linearly with mean distance or travel time. If an observed breakthrough curve is forced to fit the, clinical theory, the resulting effective dispersivity, instead of being constant, also increases almost linearly with the spatial or temporal scale of the problem. This occurs because the heterogeneity in flow properties creates a corresponding velocity distribution along the different flow pathways from the inlet to the outlet of the system. Mixing occurs mostly at the outlet, or wherever the fluid is sampled, rather than within the medium. In this paper, we consider the effects. of this behavior on radionuclide or other contaminant migration.

  14. Heterogeneous catalytic transesterification of phosphatidylcholine.

    PubMed

    Balasubramanian, Rajesh Kumar; Obbard, Jeffrey Philip

    2011-01-01

    The transesterification of phosphatidylcholine (PC) via homogeneous and heterogeneous catalysis was investigated for the production of fatty acid methyl esters (FAME) i.e. biodiesel. Calcium methoxide and calcium oxide were used as heterogeneous catalysts, and KOH as a homogeneous catalyst for the transesterification of phosphatidylcholine (PC)--a polar phospholipid prevalent in eukaryotic organisms. The initial reaction rate was higher for KOH (24.23 g of FAME/g of catalyst.min) than for calcium methoxide (17.06 g of FAME/g of catalyst.min) and calcium oxide (1.06 g of FAME/g of catalyst.min). PC was then mixed with soybean oil at different proportions (i.e. 10%, 30% and 50%, PC10, PC30 and PC50, respectively) which was then used as the feedstock for transesterification using calcium methoxide. When the mass fraction of PC was increased in the feedstock reaction rate also increased. Phosphorus content of the FAME layer of PC100, PC50, PC30 and PC10 was 0.081, 0.041, 0.035 and 0.028% (w/w), respectively. PMID:20832299

  15. Socially Aware Heterogeneous Wireless Networks

    PubMed Central

    Kosmides, Pavlos; Adamopoulou, Evgenia; Demestichas, Konstantinos; Theologou, Michael; Anagnostou, Miltiades; Rouskas, Angelos

    2015-01-01

    The development of smart cities has been the epicentre of many researchers’ efforts during the past decade. One of the key requirements for smart city networks is mobility and this is the reason stable, reliable and high-quality wireless communications are needed in order to connect people and devices. Most research efforts so far, have used different kinds of wireless and sensor networks, making interoperability rather difficult to accomplish in smart cities. One common solution proposed in the recent literature is the use of software defined networks (SDNs), in order to enhance interoperability among the various heterogeneous wireless networks. In addition, SDNs can take advantage of the data retrieved from available sensors and use them as part of the intelligent decision making process contacted during the resource allocation procedure. In this paper, we propose an architecture combining heterogeneous wireless networks with social networks using SDNs. Specifically, we exploit the information retrieved from location based social networks regarding users’ locations and we attempt to predict areas that will be crowded by using specially-designed machine learning techniques. By recognizing possible crowded areas, we can provide mobile operators with recommendations about areas requiring datacell activation or deactivation. PMID:26110402

  16. Thermal properties of heterogeneous grains

    NASA Technical Reports Server (NTRS)

    Lien, David J.

    1988-01-01

    Cometary dust is not spherical nor homogeneous, yet these are the assumptions used to model its thermal, optical, and dynamical properties. To better understand the effects of heterogeneity on the thermal and optical properties of dust grains, the effective dielectric constant for an admixture of magnetite and a silicate were calculated using two different effective medium theories: the Maxwell-Garnett theory and the Bruggeman theory. In concept, the MG theory describes the effective dielectric constant of a matrix material into which is embedded a large number of very small inclusions of a second material. The Bruggeman theory describes the dielectric constant of a well mixed aggregate of two or more types of materials. Both theories assume that the individual particles are much smaller than the wavelength of the incident radiation. The refractivity for a heterogeneous grain using the MG theory is very similar to the refractivity of the matrix material, even for large volume fractions of the inclusion. The equilibrium grain temperature for spherical particles sized from .001 to 100 microns in radius at 1 astronomical unit from the sun was calculated. Further explanation is given.

  17. Heterogeneous Transmutation Sodium Fast Reactor

    SciTech Connect

    S. E. Bays

    2007-09-01

    The threshold-fission (fertile) nature of Am-241 is used to destroy this minor actinide by capitalizing upon neutron capture instead of fission within a sodium fast reactor. This neutron-capture and its subsequent decay chain leads to the breeding of even neutron number plutonium isotopes. A slightly moderated target design is proposed for breeding plutonium in an axial blanket located above the active “fast reactor” driver fuel region. A parametric study on the core height and fuel pin diameter-to-pitch ratio is used to explore the reactor and fuel cycle aspects of this design. This study resulted in both non-flattened and flattened core geometries. Both of these designs demonstrated a high capacity for removing americium from the fuel cycle. A reactivity coefficient analysis revealed that this heterogeneous design will have comparable safety aspects to a homogeneous reactor of comparable size. A mass balance analysis revealed that the heterogeneous design may reduce the number of fast reactors needed to close the current once-through light water reactor fuel cycle.

  18. Groundwater pumping by heterogeneous users

    NASA Astrophysics Data System (ADS)

    Saak, Alexander E.; Peterson, Jeffrey M.

    2012-08-01

    Farm size is a significant determinant of both groundwater-irrigated farm acreage and groundwater-irrigation-application rates per unit land area. This paper analyzes the patterns of groundwater exploitation when resource users in the area overlying a common aquifer are heterogeneous. In the presence of user heterogeneity, the common resource problem consists of inefficient dynamic and spatial allocation of groundwater because it impacts income distribution not only across periods but also across farmers. Under competitive allocation, smaller farmers pump groundwater faster if farmers have a constant marginal periodic utility of income. However, it is possible that larger farmers pump faster if the Arrow-Pratt coefficient of relative risk-aversion is sufficiently decreasing in income. A greater farm-size inequality may either moderate or amplify income inequality among farmers. Its effect on welfare depends on the curvature properties of the agricultural output function and the farmer utility of income. Also, it is shown that a flat-rate quota policy that limits the quantity of groundwater extraction per unit land area may have unintended consequences for the income distribution among farmers.

  19. A dynamic fuel cycle analysis for a heterogeneous thorium-DUPIC recycle in CANDU reactors

    SciTech Connect

    Jeong, C. J.; Park, C. J.; Choi, H.

    2006-07-01

    A heterogeneous thorium fuel recycle scenario in a Canada deuterium uranium (CANDU) reactor has been analyzed by the dynamic analysis method. The thorium recycling is performed through a dry process which has a strong proliferation resistance. In the fuel cycle model, the existing nuclear power plant construction plan was considered up to 2016, while the nuclear demand growth rate from the year 2016 was assumed to be 0%. In this analysis, the spent fuel inventory as well as the amount of plutonium, minor actinides, and fission products of a multiple thorium recycling fuel cycle were estimated and compared to those of the once-through fuel cycle. The analysis results have shown that the heterogeneous thorium fuel cycle can be constructed through the dry process technology. It is also shown that the heterogeneous thorium fuel cycle can reduce the spent fuel inventory and save on the natural uranium resources when compared with the once-through cycle. (authors)

  20. Sulfotransferase 4A1.

    PubMed

    Minchin, Rodney F; Lewis, Aaron; Mitchell, Deanne; Kadlubar, Fred F; McManus, Michael E

    2008-01-01

    In this review, we highlight the physical and enzymatic properties of the novel human sulfotransferase, SULT4A1. The gene is most highly expressed in selective regions of the brain, although work to date has failed to identify any specific endogenous substrate for the enzyme. SULT4A1 shares low homology with other human sulfotransferases. Nevertheless, it is highly conserved between species. Despite the low homology, it is structurally very similar to other cytosolic sulfotransferases with a conserved substrate binding domain, dimerization site and partial cofactor binding sites. However, the catalytic cavity is much smaller, and it has been suggested that the cofactor may not be accommodated within it. A recent link between variability in the 5'UTR of the SULT4A1 gene and schizophrenia has heightened interest in the endogenous function of the enzyme and its possible role in human disease. PMID:18248844

  1. Weakly bound states in heterogeneous waveguides

    NASA Astrophysics Data System (ADS)

    Amore, Paolo; Fernández, Francisco M.; Hofmann, Christoph P.

    2016-07-01

    We study the spectrum of the Helmholtz equation in a two-dimensional infinite waveguide, containing a weak heterogeneity localized at an internal point, and obeying Dirichlet boundary conditions at its border. We use the variational theorem to derive the condition for which the lowest eigenvalue of the spectrum falls below the continuum threshold and a bound state appears, localized at the heterogeneity. We devise a rigorous perturbation scheme and derive the exact expression for the energy to third order in the heterogeneity.

  2. Heterogeneous Reburning By Mixed Fuels

    SciTech Connect

    Anderson Hall

    2009-03-31

    Recent studies of heterogeneous reburning, i.e., reburning involving a coal-derived char, have elucidated its variables, kinetics and mechanisms that are valuable to the development of a highly efficient reburning process. Young lignite chars contain catalysts that not only reduce NO, but they also reduce HCN that is an important intermediate that recycles to NO in the burnout zone. Gaseous CO scavenges the surface oxides that are formed during NO reduction, regenerating the active sites on the char surface. Based on this mechanistic information, cost-effective mixed fuels containing these multiple features has been designed and tested in a simulated reburning apparatus. Remarkably high reduction of NO and HCN has been observed and it is anticipated that mixed fuel will remove 85% of NO in a three-stage reburning process.

  3. Genetic heterogeneity of hepatocellular carcinoma

    SciTech Connect

    Unsal, H.; Isselbacher, K.J. ); Yakicier, C.; Marcais, C.; Ozturk, M. ); Kew, M. ); Volkmann, M. ); Zentgraf, H. )

    1994-01-18

    The authors studied 80 hepatocellular carcinomas from three continents for p53 gene (TP53) mutations and hepatitis B virus (HBV) sequences. p53 mutations were frequent in tumors from Mozambique but not in tumors from South Africa, China, and Germany. Independent of geographic origin, most tumors were positive for HBV sequences. X gene coding sequences of HBV were detected in 78% of tumors, whereas viral sequences in the surface antigen- and core antigen-encoding regions were present in less than 35% of tumors. These observations indicate that hepatocellular carcinomas are genetically heterogeneous. Mozambican-types of hepatocellular carcinomas are characterized by a high incidence of p53 mutations related to aflatoxins. In other tumors, the rarity of p53 mutations combined with the frequent presence of viral X gene coding sequences suggests a possible interference of HBV with the wild-type p53 function.

  4. HETEROGENEOUS REBURNING BY MIXED FUELS

    SciTech Connect

    Wei-Yin Chen; Benson B. Gathitu

    2005-01-14

    Recent studies of heterogeneous reburning, i.e., reburning involving a coal-derived char, have elucidated its variables, kinetics and mechanisms that are valuable to the development of a highly efficient reburning process. Young lignite chars contain catalysts that not only reduce NO, but they also reduce HCN that is an important intermediate that recycles to NO in the burnout zone. Gaseous CO scavenges the surface oxides that are formed during NO reduction, regenerating the active sites on the char surface. Based on this mechanistic information, cost-effective mixed fuels containing these multiple features has been designed and tested in a simulated reburning apparatus. Remarkably high reduction of NO and HCN has been observed and it is anticipated that mixed fuel will remove 85% of NO in a three-stage reburning process.

  5. Mesoscale poroelasticity of heterogeneous media

    NASA Astrophysics Data System (ADS)

    Monfared, Siavash; Laubie, Hadrien; Radjai, Farhang; Pellenq, Roland; Ulm, Franz-Josef

    Poroelastic behavior of heterogeneous media is revisited. Lattice Element Method (LEM) is used to model interaction between solid constituents due to a pressurized pore space. Exploring beyond mean-field based theories in continuum microporomechanics, local textural variations and its contribution to the global anisotropic poroelastic behavior of real multiphase porous media are captured. To this end, statistical distributions of mesoscale poroelastic coefficients from numerical simulations on X-ray microscopy scans of two different organic-rich shales with different microtextures are presented. The results are compared with predictions using mean-field based tools of continuum micromechanics. The textural dependency of strain localization and stress chain formation captured in this framework promises a powerful tool for modeling poroelastic response of complex porous composites and a path to incorporate local textural and elastic variations into a continuum description. Visiting Scientist, CNRS-MIT, MIT.

  6. Heterogeneous fuel for hybrid rocket

    NASA Technical Reports Server (NTRS)

    Stickler, David B. (Inventor)

    1996-01-01

    Heterogeneous fuel compositions suitable for use in hybrid rocket engines and solid-fuel ramjet engines, The compositions include mixtures of a continuous phase, which forms a solid matrix, and a dispersed phase permanently distributed therein. The dispersed phase or the matrix vaporizes (or melts) and disperses into the gas flow much more rapidly than the other, creating depressions, voids and bumps within and on the surface of the remaining bulk material that continuously roughen its surface, This effect substantially enhances heat transfer from the combusting gas flow to the fuel surface, producing a correspondingly high burning rate, The dispersed phase may include solid particles, entrained liquid droplets, or gas-phase voids having dimensions roughly similar to the displacement scale height of the gas-flow boundary layer generated during combustion.

  7. Data Integration for Heterogenous Datasets

    PubMed Central

    2014-01-01

    Abstract More and more, the needs of data analysts are requiring the use of data outside the control of their own organizations. The increasing amount of data available on the Web, the new technologies for linking data across datasets, and the increasing need to integrate structured and unstructured data are all driving this trend. In this article, we provide a technical overview of the emerging “broad data” area, in which the variety of heterogeneous data being used, rather than the scale of the data being analyzed, is the limiting factor in data analysis efforts. The article explores some of the emerging themes in data discovery, data integration, linked data, and the combination of structured and unstructured data. PMID:25553272

  8. [Systemic mastocytosis: a heterogeneous disease].

    PubMed

    Hermans, M A W; Verburg, M; van Laar, J A M; van Hagen, P M; Pasmans, S G M A; van Daele, P L A

    2016-01-01

    Systemic mastocytosis (SM) is an acquired myeloproliferative disease, which is caused by an uncontrolled proliferation of aberrant mast cells. SM patients can have very different clinical phenotypes and may therefore initially present to different specialties. Diagnosis is often delayed because many physicians are unfamiliar with this illness. This can lead to substantial morbidity and puts patients at risk of complications such as severe anaphylaxis. Measurement of serum tryptase levels is always a sensible first step in the diagnostic work-up, but a normal serum tryptase does not rule out SM completely, and a bone marrow biopsy is essential for a conclusive diagnosis. Here, we describe two patient cases to illustrate the heterogeneous nature of this disease, and provide an overview of the symptoms, diagnostic work-up and current treatments options for SM. PMID:27229688

  9. Toward understanding and exploiting tumor heterogeneity

    PubMed Central

    Alizadeh, Ash A; Aranda, Victoria; Bardelli, Alberto; Blanpain, Cedric; Bock, Christoph; Borowski, Christine; Caldas, Carlos; Califano, Andrea; Doherty, Michael; Elsner, Markus; Esteller, Manel; Fitzgerald, Rebecca; Korbel, Jan O; Lichter, Peter; Mason, Christopher E; Navin, Nicholas; Pe’er, Dana; Polyak, Kornelia; Roberts, Charles W M; Siu, Lillian; Snyder, Alexandra; Stower, Hannah; Swanton, Charles; Verhaak, Roel G W; Zenklusen, Jean C; Zuber, Johannes; Zucman-Rossi, Jessica

    2016-01-01

    The extent of tumor heterogeneity is an emerging theme that researchers are only beginning to understand. How genetic and epigenetic heterogeneity affects tumor evolution and clinical progression is unknown. The precise nature of the environmental factors that influence this heterogeneity is also yet to be characterized. Nature Medicine, Nature Biotechnology and the Volkswagen Foundation organized a meeting focused on identifying the obstacles that need to be overcome to advance translational research in and tumor heterogeneity. Once these key questions were established, the attendees devised potential solutions. Their ideas are presented here. PMID:26248267

  10. Toward understanding and exploiting tumor heterogeneity.

    PubMed

    Alizadeh, Ash A; Aranda, Victoria; Bardelli, Alberto; Blanpain, Cedric; Bock, Christoph; Borowski, Christine; Caldas, Carlos; Califano, Andrea; Doherty, Michael; Elsner, Markus; Esteller, Manel; Fitzgerald, Rebecca; Korbel, Jan O; Lichter, Peter; Mason, Christopher E; Navin, Nicholas; Pe'er, Dana; Polyak, Kornelia; Roberts, Charles W M; Siu, Lillian; Snyder, Alexandra; Stower, Hannah; Swanton, Charles; Verhaak, Roel G W; Zenklusen, Jean C; Zuber, Johannes; Zucman-Rossi, Jessica

    2015-08-01

    The extent of tumor heterogeneity is an emerging theme that researchers are only beginning to understand. How genetic and epigenetic heterogeneity affects tumor evolution and clinical progression is unknown. The precise nature of the environmental factors that influence this heterogeneity is also yet to be characterized. Nature Medicine, Nature Biotechnology and the Volkswagen Foundation organized a meeting focused on identifying the obstacles that need to be overcome to advance translational research in and tumor heterogeneity. Once these key questions were established, the attendees devised potential solutions. Their ideas are presented here. PMID:26248267

  11. MRI of Heterogeneous Hydrogenation Reactions Using Parahydrogen Polarization

    SciTech Connect

    Burt, Scott Russell

    2008-01-01

    The power of magnetic resonance imaging (MRI) is its ability to image the internal structure of optically opaque samples and provide detailed maps of a variety of important parameters, such as density, diffusion, velocity and temperature. However, one of the fundamental limitations of this technique is its inherent low sensitivity. For example, the low signal to noise ratio (SNR) is particularly problematic for imaging gases in porous materials due to the low density of the gas and the large volume occluded by the porous material. This is unfortunate, as many industrially relevant chemical reactions take place at gas-surface interfaces in porous media, such as packed catalyst beds. Because of this severe SNR problem, many techniques have been developed to directly increase the signal strength. These techniques work by manipulating the nuclear spin populations to produce polarized} (i.e., non-equilibrium) states with resulting signal strengths that are orders of magnitude larger than those available at thermal equilibrium. This dissertation is concerned with an extension of a polarization technique based on the properties of parahydrogen. Specifically, I report on the novel use of heterogeneous catalysis to produce parahydrogen induced polarization and applications of this new technique to gas phase MRI and the characterization of micro-reactors. First, I provide an overview of nuclear magnetic resonance (NMR) and how parahydrogen is used to improve the SNR of the NMR signal. I then present experimental results demonstrating that it is possible to use heterogeneous catalysis to produce parahydrogen-induced polarization. These results are extended to imaging void spaces using a parahydrogen polarized gas. In the second half of this dissertation, I demonstrate the use of parahydrogen-polarized gas-phase MRI for characterizing catalytic microreactors. Specifically, I show how the improved SNR allows one to map parameters important for characterizing the heat and mass

  12. Chemical and seismological constraints on mantle heterogeneity.

    PubMed

    Helffrich, George

    2002-11-15

    Recent seismological studies that use scattered waves to detect heterogeneities in the mantle reveal the presence of a small, distributed elastic heterogeneity in the lower mantle which does not appear to be thermal in nature. The characteristic size of these heterogeneities appears to be ca. 8 km, suggesting that they represent subducted recycled oceanic crust. With this stimulus, old ideas that the mantle is heterogeneous in structure, rather than stratified, are reinterpreted and a simple, end-member model for the heterogeneity structure is proposed. The volumetrically largest components in the model are recycled oceanic crust, which contains the heat-producing elements, and mantle depleted of these and other incompatible trace elements. About 10% of the mantle's mass is made up of recycled oceanic crust, which is associated with the observed small-scale seismic heterogeneity. The way this heterogeneity is distributed is in convectively stretched and thinned bodies ranging downwards in size from 8 km. With the present techniques to detect small bodies through scattering, only ca. 55% of the mantle's small-scale heterogeneities are detectable seismically. PMID:12460477

  13. Heterogeneous Factor Analysis Models: A Bayesian Approach.

    ERIC Educational Resources Information Center

    Ansari, Asim; Jedidi, Kamel; Dube, Laurette

    2002-01-01

    Developed Markov Chain Monte Carlo procedures to perform Bayesian inference, model checking, and model comparison in heterogeneous factor analysis. Tested the approach with synthetic data and data from a consumption emotion study involving 54 consumers. Results show that traditional psychometric methods cannot fully capture the heterogeneity in…

  14. Understanding the Executive Functioning Heterogeneity in Schizophrenia

    ERIC Educational Resources Information Center

    Raffard, Stephane; Bayard, Sophie

    2012-01-01

    Schizophrenia is characterized by heterogeneous brain abnormalities involving cerebral regions implied in the executive functioning. The dysexecutive syndrome is one of the most prominent and functionally cognitive features of schizophrenia. Nevertheless, it is not clear to what extend executive deficits are heterogeneous in schizophrenia…

  15. Heterogeneity in Health Care Computing Environments

    PubMed Central

    Sengupta, Soumitra

    1989-01-01

    This paper discusses issues of heterogeneity in computer systems, networks, databases, and presentation techniques, and the problems it creates in developing integrated medical information systems. The need for institutional, comprehensive goals are emphasized. Using the Columbia-Presbyterian Medical Center's computing environment as the case study, various steps to solve the heterogeneity problem are presented.

  16. Fine scale heterogeneity in the Earth's mantle - observation and interpretation

    NASA Astrophysics Data System (ADS)

    Thybo, H.

    2012-12-01

    High resolution seismic data has over the last decade provided significant evidence for pronounced fine scale heterogeneity in the Earth's mantle at an unprecedented detail. Seismic tomography developed tremendously during the last 20-30 years. The results show overall structure in the mantle which can be correlated to main plate tectonic features, such as oceanic spreading centres, continental rift zones and subducting slabs. Much seismological mantle research is now concentrated on imaging fine scale heterogeneity, which may be detected and imaged with high-resolution seismic data with dense station spacing and at high frequency, e.g. from the Russian Peaceful Nuclear Explosion (PNE) data set and array recordings of waves from natural seismic sources. Mantle body waves indicate pronounced heterogeneity at three depth levels whereas other depth intervals appear transparent, at least in the frequency band of 0.5-15 Hz: (1) The Mantle Low-Velocity Zone (LVZ) is a global feature which has been detected in more than 50 long-range seismic profiles (Thybo and Perchuc, Science, 1997). Since then numerous studies based on receiver functions, surface waves, and controlled source seismology have confirmed the presence of this zone. The data demonstrates that the top of the LVZ everywhere is at a depth of 100±20 km. A pronounced coda shows that the zone is highly heterogeneous at characteristic scale lengths of 5-15 by 2-6 km. We interpret that the rocks in the LVZ have a temperature close to the solidus or even may contain small fractions of partial melt. The solidus of mantle rocks is very low below a depth of ca. 90 km if volatiles are present due to a characteristic kink in the solidus which is much lower than for dry mantle rocks. We suggest that the rocks are in a totally solid state below the LVZ and that the depth to the interface to fully solid rocks is an indicator of the thermal state of the upper mantle. (2) Significant scattering from around the top of the

  17. Quantification of heterogeneity observed in medical images

    PubMed Central

    2013-01-01

    Background There has been much recent interest in the quantification of visually evident heterogeneity within functional grayscale medical images, such as those obtained via magnetic resonance or positron emission tomography. In the case of images of cancerous tumors, variations in grayscale intensity imply variations in crucial tumor biology. Despite these considerable clinical implications, there is as yet no standardized method for measuring the heterogeneity observed via these imaging modalities. Methods In this work, we motivate and derive a statistical measure of image heterogeneity. This statistic measures the distance-dependent average deviation from the smoothest intensity gradation feasible. We show how this statistic may be used to automatically rank images of in vivo human tumors in order of increasing heterogeneity. We test this method against the current practice of ranking images via expert visual inspection. Results We find that this statistic provides a means of heterogeneity quantification beyond that given by other statistics traditionally used for the same purpose. We demonstrate the effect of tumor shape upon our ranking method and find the method applicable to a wide variety of clinically relevant tumor images. We find that the automated heterogeneity rankings agree very closely with those performed visually by experts. Conclusions These results indicate that our automated method may be used reliably to rank, in order of increasing heterogeneity, tumor images whether or not object shape is considered to contribute to that heterogeneity. Automated heterogeneity ranking yields objective results which are more consistent than visual rankings. Reducing variability in image interpretation will enable more researchers to better study potential clinical implications of observed tumor heterogeneity. PMID:23453000

  18. Heterogeneous Chemistry in Global Chemistry Transport Models

    NASA Astrophysics Data System (ADS)

    Stadtler, Scarlet; Simpson, David; Schultz, Martin; Bott, Andreas

    2016-04-01

    The impact of six tropospheric heterogeneous reactions on ozone and nitrogen species was studied using two chemical transport models EMEP MSC-W and ECHAM6-HAMMOZ. Since heterogeneous reactions depend on reactant concentrations (in this study these are N_2O_5, NO_3, NO_2, O_3, HNO_3, HO_2) and aerosol surface area S_a, the modeled surface area of both models was compared to a satellite product retrieving the surface area. This comparison shows a good agreement in global pattern and especially the capability of both models to capture the extreme aerosol loadings in East Asia. Further, the impact of the heterogeneous reactions was evaluated by the simulation of a reference run containing all heterogeneous reactions and several sensitivity runs. One reaction was turned off in each sensitivity run to compare it with the reference run. As previously shown, the analysis of the sensitivity runs shows that the globally most important heterogeneous reaction is the one of N_2O_5. Nevertheless, NO_2, NO_3, HNO3 and HO2 heterogeneous reactions gain relevance particular in East China due to presence of high NOx concentrations and high Sa in the same region. The heterogeneous reaction of O3 itself on dust is compared to the other heterogeneous reactions of minor relevance. Evaluation of the models with northern hemispheric ozone surface observations yields a better agreement of the models with observations when the heterogeneous reactions are incorporated. Impacts of emission changes on the importance of the heterogeneous chemistry will be discussed.

  19. Genetic heterogeneity in juvenile NCL

    SciTech Connect

    Hart, Y.M.; Andermann, E.; Mitchison, H.M.

    1994-09-01

    The neuronal ceroid lipofuscinoses (NCL) are a group of related lysosomal storage diseases classified according to the age of onset, clinical syndrome, and pathology. The clinical syndromes include myoclonus, visual failure, progressive dementia, ataxia and generalized tonic clonic seizures in varying combinations depending on the age of onset and pathology. The mode of inheritance is autosomal recessive in most cases, except for several families with the adult form (Kufs` disease) which have autosomal dominant inheritance. Linkage for the infantile (Halatia-Santavuori) form (CLN1), characterized ultrastructurally by lysosomal granular osmiophilic deposits (GROD), has been demonstrated with markers on chromosome lp, while the gene for the typical juvenile (Spielmeyer-Vogt) form (CLN3), characterized by fingerprint-profile inclusions, has been linked to chromosome 16p. The gene locations of the late infantile (Jansky-Bielschowsky) and adult (Kufs` disease) forms are unknown, although it has recently been shown that the late infantile form does not link to chromosome 16p. We describe three siblings, including a pair of monozygotic twins, with juvenile onset NCL with GROD in whom linkage to the CLN3 region of chromsome 16p has been excluded. This would suggest that there is genetic heterogeneity not only among the different clinical syndromes, but also among identical clinical syndromes with different ultrastructural characteristics. Preliminary studies of linkage to chromosome 1p employing the microsatellite marker HY-TM1 have been uninformative. Further studies with other chromosome 1 markers are underway.

  20. Operating a heterogeneous telescope network

    NASA Astrophysics Data System (ADS)

    Allan, Alasdair; Bischoff, Karsten; Burgdorf, Martin; Cavanagh, Brad; Christian, Damien; Clay, Neil; Dickens, Rob; Economou, Frossie; Fadavi, Mehri; Frazer, Stephen; Granzer, Thomas; Grosvenor, Sandy; Hessman, Frederic V.; Jenness, Tim; Koratkar, Anuradha; Lehner, Matthew; Mottram, Chris; Naylor, Tim; Saunders, Eric S.; Solomos, Nikolaos; Steele, Iain A.; Tuparev, Georg; Vestrand, W. Thomas; White, Robert R.; Yost, Sarah

    2006-06-01

    In the last few years the ubiquitous availability of high bandwidth networks has changed the way both robotic and non-robotic telescopes operate, with single isolated telescopes being integrated into expanding "smart" telescope networks that can span continents and respond to transient events in seconds. The Heterogeneous Telescope Networks (HTN)* Consortium represents a number of major research groups in the field of robotic telescopes, and together we are proposing a standards based approach to providing interoperability between the existing proprietary telescope networks. We further propose standards for interoperability, and integration with, the emerging Virtual Observatory. We present the results of the first interoperability meeting held last year and discuss the protocol and transport standards agreed at the meeting, which deals with the complex issue of how to optimally schedule observations on geographically distributed resources. We discuss a free market approach to this scheduling problem, which must initially be based on ad-hoc agreements between the participants in the network, but which may eventually expand into a electronic market for the exchange of telescope time.

  1. Heterogeneity of the Tumor Vasculature

    PubMed Central

    Nagy, Janice A.; Chang, Sung-Hee; Shih, Shou-Ching; Dvorak, Ann M.; Dvorak, Harold F.

    2012-01-01

    The blood vessels supplying tumors are strikingly heterogeneous and differ from their normal counterparts with respect to organization, structure, and function. Six distinctly different tumor vessel types have been identified, and much has been learned about the steps and mechanisms by which they form. Four of the six vessel types (mother vessels, capillaries, glomeruloid microvascular proliferations, and vascular malformations) develop from preexisting normal venules and capillaries by angiogenesis. The two remaining vessel types (feeder arteries and draining veins) develop from arterio-venogenesis, a parallel, poorly understood process that involves the remodeling of preexisting arteries and veins. All six of these tumor vessel types can be induced to form sequentially in normal mouse tissues by an adenoviral vector expressing vascular endothelial growth factor (VEGF)-A164. Current antiangiogenic cancer therapies directed at VEGF-A or its receptors have been of only limited benefit to cancer patients, perhaps because they target only the endothelial cells of the tumor blood vessel subset that requires exogenous VEGF-A for maintenance. A goal of future work is to identify therapeutic targets on tumor blood vessel endothelial cells that have lost this requirement. PMID:20490982

  2. Distributional Scaling in Heterogeneous Aquifers

    NASA Astrophysics Data System (ADS)

    Polsinelli, J. F.

    2015-12-01

    An investigation is undertaken into the fractal scaling properties of the piezometric head in a heterogeneous unconfined aquifer. The governing equations for the unconfined flow are derived from conservation of mass and the Darcy law. The Dupuit approximation will be used to model the dynamics. The spatially varying nature of the tendency to conduct flow (e.g. the hydraulic conductivity) is represented as a stochastic process. Experimental studies in the literature have indicated that the conductivity belongs to a class of non-stationary stochastic fields, called H-ss fields. The uncertainty in the soil parameters is imparted onto the flow variables; in groundwater investigations the potentiometric head will be a random function. The structure of the head field will be analyzed with an emphasis on the scaling properties. The scaling scheme for the modeling equations and the simulation procedure for the saturated hydraulic conductivity process will be explained, then the method will be validated through numerical experimentation using the USGS Modflow-2005 software. The results of the numerical simulations demonstrate that the head will exhibit multi-fractal scaling if the hydraulic conductivity exhibits multi-fractal scaling and the differential equations for the groundwater equation satisfy a particular set of scale invariance conditions.

  3. Adaptation Driven by Spatial Heterogeneities

    NASA Astrophysics Data System (ADS)

    Hermsen, Rutger

    2011-03-01

    Biological evolution and ecology are intimately linked, because the reproductive success or ``fitness'' of an organism depends crucially on its ecosystem. Yet, most models of evolution (or population genetics) consider homogeneous, fixed-size populations subjected to a constant selection pressure. To move one step beyond such ``mean field'' descriptions, we discuss stochastic models of evolution driven by spatial heterogeneity. We imagine a population whose range is limited by a spatially varying environmental parameter, such as a temperature or the concentration of an antibiotic drug. Individuals in the population replicate, die and migrate stochastically. Also, by mutation, they can adapt to the environmental stress and expand their range. This way, adaptation and niche expansion go hand in hand. This mode of evolution is qualitatively different from the usual notion of a population climbing a fitness gradient. We analytically calculate the rate of adaptation by solving a first passage time problem. Interestingly, the joint effects of reproduction, death, mutation and migration result in two distinct parameter regimes depending on the relative time scales of mutation and migration. We argue that the proposed scenario may be relevant for the rapid evolution of antibiotic resistance. This work was supported by the Center for Theoretical Biological Physics sponsored by the National Science Foundation (NSF) (Grant PHY-0822283).

  4. Bedload sheets in heterogeneous sediment

    SciTech Connect

    Whiting, P.J.; Dietrich, W.E.; Leopold, L.B.; Drake, T.G.; Shreve, R.L.

    1988-02-01

    Field observations in streams with beds of coarse sand and fine gravel have revealed that bedload moves primarily as thin, migrating accumulations of sediment, and coarse grains cluster at their leading edge. These accumulations are one or two coarse grains high and are much longer (0.2-0.6 m long in sand; 0.5-2.0 m in fine gravel) than their height. The authors propose the term bedload sheet for these features, and the authors argue that they result from an instability inherent to bedload movement of moderately and poorly sorted sediment. In essence, coarse particles in the bedload slow or stop each other, trap finer particles in their interstices, and thus cause the coarse particles to become mobile again. Bedload sheets develop on the stoss side of dunes, causing the dune to advance incrementally with the arrival of each sheet. Successive deposition of coarse sediment from the leading edge followed by fine sediment may generate the grain-size sorting that distinguishes cross-bedding. Available flume experiments and field observations indicate that bedload sheets are a common, but generally unrecognized, feature of heterogeneous sediment transport.

  5. Surface area controlled heterogeneous nucleation

    NASA Astrophysics Data System (ADS)

    Steer, Brian; Gorbunov, Boris; Rowles, Jonathan; Green, David

    2012-02-01

    Heterogeneous nucleation of liquid from a gas phase on nanoparticles has been studied under various saturation ratios and nuclei size. The probability of liquid droplet nucleation, especially at a low degree of deviation from equilibrium, was measured for both atmospheric aerosol particles and engineered nanoparticles Cr2O3. The concept of a critical saturation ratio and the validity of the one-to-one relationship between the nuclei number and the number of droplets were examined. A transient zone between no nucleation and established nucleation termed the surface area controlled nucleation was observed. In this zone, the probability of stable phase formation is determined by the surface area of nuclei. There are two distinctive features of the surface area controlled nucleation: the nucleation probability is much less than 1 and is proportional to the surface area of nuclei. For condensation particle counters (CPCs) counting nanoparticles, these features mean that counts measured are proportional to the surface area of nanoparticles and, therefore, the CPCs counts can be calibrated to measure the surface area.

  6. Anatomical heterogeneity of Alzheimer disease

    PubMed Central

    Noh, Young; Jeon, Seun; Seo, Sang Won; Kim, Geon Ha; Cho, Hanna; Ye, Byoung Seok; Yoon, Cindy W.; Kim, Hee Jin; Chin, Juhee; Park, Kee Hyung; Heilman, Kenneth M.

    2014-01-01

    Objective: Because the signs associated with dementia due to Alzheimer disease (AD) can be heterogeneous, the goal of this study was to use 3-dimensional MRI to examine the various patterns of cortical atrophy that can be associated with dementia of AD type, and to investigate whether AD dementia can be categorized into anatomical subtypes. Methods: High-resolution T1-weighted volumetric MRIs were taken of 152 patients in their earlier stages of AD dementia. The images were processed to measure cortical thickness, and hierarchical agglomerative cluster analysis was performed using Ward's clustering linkage. The identified clusters of patients were compared with an age- and sex-matched control group using a general linear model. Results: There were several distinct patterns of cortical atrophy and the number of patterns varied according to the level of cluster analyses. At the 3-cluster level, patients were divided into (1) bilateral medial temporal–dominant atrophy subtype (n = 52, ∼34.2%), (2) parietal-dominant subtype (n = 28, ∼18.4%) in which the bilateral parietal lobes, the precuneus, along with bilateral dorsolateral frontal lobes, were atrophic, and (3) diffuse atrophy subtype (n = 72, ∼47.4%) in which nearly all association cortices revealed atrophy. These 3 subtypes also differed in their demographic and clinical features. Conclusions: This cluster analysis of cortical thickness of the entire brain showed that AD dementia in the earlier stages can be categorized into various anatomical subtypes, with distinct clinical features. PMID:25344382

  7. Aggregation of Heterogeneously Charged Colloids.

    PubMed

    Dempster, Joshua M; Olvera de la Cruz, Monica

    2016-06-28

    Patchy colloids are attractive as programmable building blocks for metamaterials. Inverse patchy colloids, in which a charged surface is decorated with patches of the opposite charge, are additionally noteworthy as models for heterogeneously charged biological materials such as proteins. We study the phases and aggregation behavior of a single charged patch in an oppositely charged colloid with a single-site model. This single-patch inverse patchy colloid model shows a large number of phases when varying patch size. For large patch sizes we find ferroelectric crystals, while small patch sizes produce cross-linked gels. Intermediate values produce monodisperse clusters and unusual worm structures that preserve finite ratios of area to volume. The polarization observed at large patch sizes is robust under extreme disorder in patch size and shape. We examine phase-temperature dependence and coexistence curves and find that large patch sizes produce polarized liquids, in contrast to mean-field predictions. Finally, we introduce small numbers of unpatched charged colloids. These can either suppress or encourage aggregation depending on their concentration and the size of the patches on the patched colloids. These effects can be exploited to control aggregation and to measure effective patch size. PMID:27253725

  8. Transmission imaging in heterogeneous media

    NASA Astrophysics Data System (ADS)

    Bongajum, E. L.; Meng, Y.; Milkereit, B.

    2010-12-01

    Wave propagation in heterogeneous media is characterized by amplitude, traveltime, and spectral fluctuations that reflect the variations in elastic properties (e.g. Vp, Vs, density). Variations in physical rock properties exist at different scales and occasionally result in effective anisotropy in medium parameters. If the variations in rock properties can be characterized from existing information such as logs, then it becomes possible to incorporate this information in wave modeling algorithms to understand its impact on acquisition design, processing of seismic waves for velocity information, AVO analysis as well as reverse time migration (RTM) routines. This study evaluates some of these aspects by using transmitted (direct) waves. When the variations exist over large scale lengths, RTM can be successfully implemented on Vertical Seismic Profiling (VSP) data in order to image the interface between two inhomogeneities as well as characterize the velocity distribution beyond the borehole location. However, when the existing geology causes anisotropy in the variability of the physical rock properties, the use of transmitted waves becomes strongly dependent on the acquisition geometry. In this circumstance, travel time fluctuations are influenced by the strength of the perturbations of the elastic parameters and the direction with the least variability (large scale lengths) in these parameters. This has according implications for seismic imaging in hardrock environment as well microseismic imaging applications.

  9. Clinical significance of monocyte heterogeneity.

    PubMed

    Stansfield, Brian K; Ingram, David A

    2015-01-01

    Monocytes are primitive hematopoietic cells that primarily arise from the bone marrow, circulate in the peripheral blood and give rise to differentiated macrophages. Over the past two decades, considerable attention to monocyte diversity and macrophage polarization has provided contextual clues into the role of myelomonocytic derivatives in human disease. Until recently, human monocytes were subdivided based on expression of the surface marker CD16. "Classical" monocytes express surface markers denoted as CD14(++)CD16(-) and account for greater than 70% of total monocyte count, while "non-classical" monocytes express the CD16 antigen with low CD14 expression (CD14(+)CD16(++)). However, recognition of an intermediate population identified as CD14(++)CD16(+) supports the new paradigm that monocytes are a true heterogeneous population and careful identification of specific subpopulations is necessary for understanding monocyte function in human disease. Comparative studies of monocytes in mice have yielded more dichotomous results based on expression of the Ly6C antigen. In this review, we will discuss the use of monocyte subpopulations as biomarkers of human disease and summarize correlative studies in mice that may yield significant insight into the contribution of each subset to disease pathogenesis. PMID:25852821

  10. Nuclear power and nuclear weapons

    SciTech Connect

    Vaughen, V.C.A.

    1983-01-01

    The proliferation of nuclear weapons and the expanded use of nuclear energy for the production of electricity and other peaceful uses are compared. The difference in technologies associated with nuclear weapons and nuclear power plants are described.

  11. HnRNP A1 phosphorylated by VRK1 stimulates telomerase and its binding to telomeric DNA sequence

    PubMed Central

    Choi, Yoon Ha; Lim, Jong-Kwan; Jeong, Min-Woo; Kim, Kyong-Tai

    2012-01-01

    The telomere integrity is maintained via replication machinery, telomere associated proteins and telomerase. Many telomere associated proteins are regulated in a cell cycle-dependent manner. Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), a single-stranded oligonucleotide binding protein, is thought to play a pivotal role in telomere maintenance. Here, we identified hnRNP A1 as a novel substrate for vaccinia-related kinase 1 (VRK1), a cell cycle regulating kinase. Phosphorylation by VRK1 potentiates the binding of hnRNP A1 to telomeric ssDNA and telomerase RNA in vitro and enhances its function for telomerase reaction. VRK1 deficiency induces a shortening of telomeres with an abnormal telomere arrangement and activation of DNA-damage signaling in mouse male germ cells. Together, our data suggest that VRK1 is required for telomere maintenance via phosphorylation of hnRNP A1, which regulates proteins associated with the telomere and telomerase RNA. PMID:22740652

  12. Breast cancer intra-tumor heterogeneity

    PubMed Central

    2014-01-01

    In recent years it has become clear that cancer cells within a single tumor can display striking morphological, genetic and behavioral variability. Burgeoning genetic, epigenetic and phenomenological data support the existence of intra-tumor genetic heterogeneity in breast cancers; however, its basis is yet to be fully defined. Two of the most widely evoked concepts to explain the origin of heterogeneity within tumors are the cancer stem cell hypothesis and the clonal evolution model. Although the cancer stem cell model appeared to provide an explanation for the variability among the neoplastic cells within a given cancer, advances in massively parallel sequencing have provided several lines of evidence to suggest that intra-tumor genetic heterogeneity likely plays a fundamental role in the phenotypic heterogeneity observed in cancers. Many challenges remain, however, in the interpretation of the next generation sequencing results obtained so far. Here we review the models that explain tumor heterogeneity, the causes of intra-tumor genetic diversity and their impact on our understanding and management of breast cancer, methods to study intra-tumor heterogeneity and the assessment of intra-tumor genetic heterogeneity in the clinic. PMID:25928070

  13. Nuclear rights - nuclear wrongs

    SciTech Connect

    Paul, E.F.; Miller, F.D.; Paul, J.; Ahrens, J.

    1986-01-01

    This book contains 11 selections. The titles are: Three Ways to Kill Innocent Bystanders: Some Conundrums Concerning the Morality of War; The International Defense of Liberty; Two Concepts of Deterrence; Nuclear Deterrence and Arms Control; Ethical Issues for the 1980s; The Moral Status of Nuclear Deterrent Threats; Optimal Deterrence; Morality and Paradoxical Deterrence; Immoral Risks: A Deontological Critique of Nuclear Deterrence; No War Without Dictatorship, No Peace Without Democracy: Foreign Policy as Domestic Politics; Marxism-Leninism and its Strategic Implications for the United States; Tocqueveille War.

  14. Interoperability of heterogeneous distributed systems

    NASA Astrophysics Data System (ADS)

    Zaschke, C.; Essendorfer, B.; Kerth, C.

    2016-05-01

    To achieve knowledge superiority in today's operations interoperability is the key. Budget restrictions as well as the complexity and multiplicity of threats combined with the fact that not single nations but whole areas are subject to attacks force nations to collaborate and share information as appropriate. Multiple data and information sources produce different kinds of data, real time and non-real time, in different formats that are disseminated to the respective command and control level for further distribution. The data is most of the time highly sensitive and restricted in terms of sharing. The question is how to make this data available to the right people at the right time with the right granularity. The Coalition Shared Data concept aims to provide a solution to these questions. It has been developed within several multinational projects and evolved over time. A continuous improvement process was established and resulted in the adaptation of the architecture as well as the technical solution and the processes it supports. Coming from the idea of making use of existing standards and basing the concept on sharing of data through standardized interfaces and formats and enabling metadata based query the concept merged with a more sophisticated service based approach. The paper addresses concepts for information sharing to facilitate interoperability between heterogeneous distributed systems. It introduces the methods that were used and the challenges that had to be overcome. Furthermore, the paper gives a perspective how the concept could be used in the future and what measures have to be taken to successfully bring it into operations.

  15. Heterogeneity of packing: structural approach.

    PubMed Central

    Kurochkina, N.; Privalov, G.

    1998-01-01

    Analysis of the heterogeneity of packing in proteins showed that different groups of the protein preferentially contribute to low- or high-density regions. Statistical distribution reveals the two preferable values for packing density in the form of two peaks. One peak occurs in the range of densities 0.55-0.65, the other occurs in the range 0.75-0.8. The high-density peak is originated primarily by high packing inside the hydrogen bonded backbone and to some extent by side chains. Polar/charged and apolar side chains both contribute to the low-density peak. The average packing density values of individual atomic groups significantly vary for backbone atoms as well as for side chain atoms. The carbonyl oxygen atoms of protein backbone and the end groups of side chains show lower packing density than the rest of the protein. The side-chain atomic groups of a secondary structure element when packed against the neighboring secondary structure element form stronger contacts with the side chains of this element than with its backbone. Analysis of the low-density regions around each buried peptide group was done for the set of proteins with different types of packing, including alpha-alpha, alpha-beta, and beta-beta packing. It was shown that cavities are regularly situated in the groove of secondary structure element packed against neighboring elements for all types of packing. Low density in the regions surrounding the peptide groups and the end groups of side chains can be explained by their positioning next to a cavity formed upon the association of secondary structure elements. The model proposed can be applied to the analysis of protein internal motions, mechanisms of cellular signal transduction, diffusion through protein matrix, and other events. PMID:9568896

  16. Mechanical heterogeneities and lithospheric extension

    NASA Astrophysics Data System (ADS)

    Duretz, Thibault; Petri, Benoit; Mohn, Geoffroy; Schenker, Filippo L.; Schmalholz, Stefan

    2016-04-01

    Detailed geological and geophysical studies of passive margins have highlighted the multi-stage and depth-dependent aspect of lithospheric thinning. Lithospheric thinning involves a variety of structures (normal faults, low angle detachments, extensional shear zones, extraction faults) and leads to a complex architecture of passive margins (with e.g. necking zone, mantle exhumation, continental allochthons). The processes controlling the generation and evolution of these structures as well as the impact of pre-rift inheritance are so far incompletely understood. In this study, we investigate the impact of pre-rift inheritance on the development of rifted margins using two-dimensional thermo-mechanical models of lithospheric thinning. To first order, we represent the pre-rift mechanical heterogeneities with lithological layering. The rheologies are kept simple (visco-plastic) and do not involve any strain softening mechanism. Our models show that mechanical layering causes multi-stage and depth-dependent extension. In the initial rifting phase, lithospheric extension is decoupled: as the crust undergoes thinning by brittle (frictional-plastic) faults, the lithospheric mantle accommodates extension by symmetric ductile necking. In a second rifting phase, deformation in the crust and lithospheric mantle is coupled and marks the beginning of an asymmetric extension stage. Low angle extensional shear zones develop across the lithosphere and exhume subcontinental mantle. Furthemore, crustal allochthons and adjacent basins develop coevally. We describe as well the thermal evolution predicted by the numerical models and discuss the first-order implications of our results in the context of the Alpine geological history.

  17. Graphene-Si heterogeneous nanotechnology

    NASA Astrophysics Data System (ADS)

    Akinwande, Deji; Tao, Li

    2013-05-01

    It is widely envisioned that graphene, an atomic sheet of carbon that has generated very broad interest has the largest prospects for flexible smart systems and for integrated graphene-silicon (G-Si) heterogeneous very large-scale integrated (VLSI) nanoelectronics. In this work, we focus on the latter and elucidate the research progress that has been achieved for integration of graphene with Si-CMOS including: wafer-scale graphene growth by chemical vapor deposition on Cu/SiO2/Si substrates, wafer-scale graphene transfer that afforded the fabrication of over 10,000 devices, wafer-scalable mitigation strategies to restore graphene's device characteristics via fluoropolymer interaction, and demonstrations of graphene integrated with commercial Si- CMOS chips for hybrid nanoelectronics and sensors. Metrology at the wafer-scale has led to the development of custom Raman processing software (GRISP) now available on the nanohub portal. The metrology reveals that graphene grown on 4-in substrates have monolayer quality comparable to exfoliated flakes. At room temperature, the high-performance passivated graphene devices on SiO2/Si can afford average mobilities 3000cm2/V-s and gate modulation that exceeds an order of magnitude. The latest growth research has yielded graphene with high mobilities greater than 10,000cm2/V-s on oxidized silicon. Further progress requires track compatible graphene-Si integration via wafer bonding in order to translate graphene research from basic to applied research in commercial R and D laboratories to ultimately yield a viable nanotechnology.

  18. ARCHER, a New Monte Carlo Software Tool for Emerging Heterogeneous Computing Environments

    NASA Astrophysics Data System (ADS)

    Xu, X. George; Liu, Tianyu; Su, Lin; Du, Xining; Riblett, Matthew; Ji, Wei; Gu, Deyang; Carothers, Christopher D.; Shephard, Mark S.; Brown, Forrest B.; Kalra, Mannudeep K.; Liu, Bob

    2014-06-01

    The Monte Carlo radiation transport community faces a number of challenges associated with peta- and exa-scale computing systems that rely increasingly on heterogeneous architectures involving hardware accelerators such as GPUs. Existing Monte Carlo codes and methods must be strategically upgraded to meet emerging hardware and software needs. In this paper, we describe the development of a software, called ARCHER (Accelerated Radiation-transport Computations in Heterogeneous EnviRonments), which is designed as a versatile testbed for future Monte Carlo codes. Preliminary results from five projects in nuclear engineering and medical physics are presented.

  19. A heterogeneous graph-based recommendation simulator

    SciTech Connect

    Yeonchan, Ahn; Sungchan, Park; Lee, Matt Sangkeun; Sang-goo, Lee

    2013-01-01

    Heterogeneous graph-based recommendation frameworks have flexibility in that they can incorporate various recommendation algorithms and various kinds of information to produce better results. In this demonstration, we present a heterogeneous graph-based recommendation simulator which enables participants to experience the flexibility of a heterogeneous graph-based recommendation method. With our system, participants can simulate various recommendation semantics by expressing the semantics via meaningful paths like User Movie User Movie. The simulator then returns the recommendation results on the fly based on the user-customized semantics using a fast Monte Carlo algorithm.

  20. Heterogeneous Chemistry Involving Methanol in Tropospheric Clouds

    NASA Technical Reports Server (NTRS)

    Tabazadeh, A.; Yokelson, R. J.; Singh, H. B.; Hobbs, P. V.; Crawford, J. H.; Iraci, L. T.

    2004-01-01

    In this report we analyze airborne measurements to suggest that methanol in biomass burning smoke is lost heterogeneously in clouds. When a smoke plume intersected a cumulus cloud during the SAFARI 2000 field project, the observed methanol gas phase concentration rapidly declined. Current understanding of gas and aqueous phase chemistry cannot explain the loss of methanol documented by these measurements. Two plausible heterogeneous reactions are proposed to explain the observed simultaneous loss and production of methanol and formaldehyde, respectively. If the rapid heterogeneous processing of methanol, seen in a cloud impacted by smoke, occurs in more pristine clouds, it could affect the oxidizing capacity of the troposphere on a global scale.

  1. Neural Field Dynamics with Heterogeneous Connection Topology

    NASA Astrophysics Data System (ADS)

    Qubbaj, Murad R.; Jirsa, Viktor K.

    2007-06-01

    Neural fields receive inputs from local and nonlocal sources. Notably in a biologically realistic architecture the latter vary under spatial translations (heterogeneous), the former do not (homogeneous). To understand the mutual effects of homogeneous and heterogeneous connectivity, we study the stability of the steady state activity of a neural field as a function of its connectivity and transmission speed. We show that myelination, a developmentally relevant change of the heterogeneous connectivity, always results in the stabilization of the steady state via oscillatory instabilities, independent of the local connectivity. Nonoscillatory instabilities are shown to be independent of any influences of time delay.

  2. Thermodynamic equilibrium at heterogeneous pressure

    NASA Astrophysics Data System (ADS)

    Vrijmoed, Johannes C.; Podladchikov, Yuri Y.

    2014-05-01

    Recent advances in metamorphic petrology point out the importance of grain-scale pressure variations in high-temperature metamorphic rocks. Pressures derived from chemical zonation using unconventional geobarometry based on equal chemical potentials fit mechanically feasible pressure variations. Here a thermodynamic equilibrium method is presented that predicts chemical zoning as a result of pressure variations by Gibbs energy minimization. Equilibrium thermodynamic prediction of the chemical zoning in the case of pressure heterogeneity is done by constraint Gibbs minimization using linear programming techniques. Compositions of phases considered in the calculation are discretized into 'pseudo-compounds' spanning the entire compositional space. Gibbs energies of these discrete compounds are generated for a given range and resolution of pressures for example derived by barometry or from mechanical model predictions. Gibbs energy minimization is subsequently performed considering all compounds of different composition and pressure. In addition to constraining the system composition a certain proportion of the system is constraint at a specified pressure. Input pressure variations need to be discretized and each discrete pressure defines an additional constraint for the minimization. The proportion of the system at each different pressure is equally distributed over the number of input pressures. For example if two input pressures P1 and P2 are specified, two constraints are added: 50 percent of the system is constraint at P1 while the remaining 50 percent is constraint at P2. The method has been tested for a set of 10 input pressures obtained by Tajčmanová et al. (2014) using their unconventional geobarometry method in a plagioclase rim around kyanite. Each input pressure is added as constraint to the minimization (1/10 percent of the system for each discrete pressure). Constraining the system composition to the average composition of the plagioclase rim

  3. Eradication of infectious diseases in heterogeneous populations

    SciTech Connect

    Travis, C.C.; Lenhart, S.M.

    1987-04-01

    A model is presented of infectious disease in heterogeneous populations, which allows for variable intra- to intergroup contact ratios. The authors give necessary and sufficient conditions for disease eradication by means of vaccination. Smallpox is used as an illustrative example.

  4. Heterogeneity and Risk Sharing in Village Economies*

    PubMed Central

    Chiappori, Pierre-André; Samphantharak, Krislert; Schulhofer-Wohl, Sam; Townsend, Robert M.

    2013-01-01

    We show how to use panel data on household consumption to directly estimate households’ risk preferences. Specifically, we measure heterogeneity in risk aversion among households in Thai villages using a full risk-sharing model, which we then test allowing for this heterogeneity. There is substantial, statistically significant heterogeneity in estimated risk preferences. Full insurance cannot be rejected. As the risk sharing, as-if-complete-markets theory might predict, estimated risk preferences are unrelated to wealth or other characteristics. The heterogeneity matters for policy: Although the average household would benefit from eliminating village-level risk, less-risk-averse households who are paid to absorb that risk would be worse off by several percent of household consumption. PMID:24932226

  5. Heterogeneous photocatalytic oxidation of atmospheric trace contaminants

    NASA Technical Reports Server (NTRS)

    Ollis, David F.

    1993-01-01

    Work performed during the period 1 May - 31 Oct. 1992 on heterogeneous photocatalytic oxidation of atmospheric trace contaminants is presented. Topics discussed include photoreactor monolith fundamental studies and monolith reactor operation: batch recirculation system.

  6. Heterogeneous treatment in the variational nodal method

    SciTech Connect

    Fanning, T.H.; Palmiotti, G.

    1995-06-01

    The variational nodal transport method is reduced to its diffusion form and generalized for the treatment of heterogeneous nodes while maintaining nodal balances. Adapting variational methods to heterogeneous nodes requires the ability to integrate over a node with discontinuous cross sections. In this work, integrals are evaluated using composite gaussian quadrature rules, which permit accurate integration while minimizing computing time. Allowing structure within a nodal solution scheme avoids some of the necessity of cross section homogenization, and more accurately defines the intra-nodal flux shape. Ideally, any desired heterogeneity can be constructed within the node; but in reality, the finite set of basis functions limits the practical resolution to which fine detail can be defined within the node. Preliminary comparison tests show that the heterogeneous variational nodal method provides satisfactory results even if some improvements are needed for very difficult, configurations.

  7. Changing Emulsion Dynamics with Heterogeneous Surface Wettability

    NASA Astrophysics Data System (ADS)

    Tsai, Peichun Amy; Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob; Chen, Haosheng

    2015-11-01

    We elucidate the effect of heterogeneous surface wettability on the morphology and dynamics of microfluidic emulsions, generated by a co-flowing device. We first design a useful methodology of modifying a micro-capillary with desired heterogeneous wettability, such as alternating hydrophilic and hydrophobic regions. Subsequently, the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion in the micro-capillary are investigated. Our experimental data reveal a universal critical time scale of advective emulsions, above which the microfluidic emulsions remain intact, whereas below this time-scale emulsions become adhesive or inverse. A simple model based on a force balance can be used to explain this critical transition. These results show a control of emulsion dynamics by tuning the droplet size and the Capillary number, the ratio of viscous to surface effects, with heterogeneous surface wettability.

  8. Heterogeneous Clustering: Operational and User Impacts

    NASA Technical Reports Server (NTRS)

    Salm, Saita Wood

    1999-01-01

    Heterogeneous clustering can improve overall utilization of multiple hosts and can provide better turnaround to users by balancing workloads across hosts. Building a cluster requires both operational changes and revisions in user scripts.

  9. Lipid rafts: heterogeneity on the high seas.

    PubMed Central

    Pike, Linda J

    2004-01-01

    Lipid rafts are membrane microdomains that are enriched in cholesterol and glycosphingolipids. They have been implicated in processes as diverse as signal transduction, endocytosis and cholesterol trafficking. Recent evidence suggests that this diversity of function is accompanied by a diversity in the composition of lipid rafts. The rafts in cells appear to be heterogeneous both in terms of their protein and their lipid content, and can be localized to different regions of the cell. This review summarizes the data supporting the concept of heterogeneity among lipid rafts and outlines the evidence for cross-talk between raft components. Based on differences in the ways in which proteins interact with rafts, the Induced-Fit Model of Raft Heterogeneity is proposed to explain the establishment and maintenance of heterogeneity within raft populations. PMID:14662007

  10. Wetting of a chemically heterogeneous surface

    SciTech Connect

    Frink, L.J.; Salinger, A.G.

    1999-03-01

    Theories for inhomogeneous fluids have focused in recent years on wetting, capillary condensation, and solvation forces for model systems where the surface(s) is(are) smooth homogeneous parallel plates, cylinders, or spherical drops. Unfortunately natural systems are more likely to be heterogeneous both in surface shape and surface chemistry. In this paper we discuss the consequences of chemical heterogeneity on wetting. Specifically, a two-dimensional (2D) implementation of a nonlocal density-functional theory is solved for a striped surface model. Both the strength and range of the heterogeneity are varied. Contact angles are calculated, and phase transitions (both the wetting transition and a local layering transition) are located. The wetting properties of the surface are shown to be strongly dependent on the nature of the surface heterogeneity. In addition highly ordered nanoscopic phases are found, and the operational limits for formation of ordered or crystalline phases of nanoscopic extent are discussed. {copyright} {ital 1999 American Institute of Physics.}

  11. Exploring heterogeneous market hypothesis using realized volatility

    NASA Astrophysics Data System (ADS)

    Chin, Wen Cheong; Isa, Zaidi; Mohd Nor, Abu Hassan Shaari

    2013-04-01

    This study investigates the heterogeneous market hypothesis using high frequency data. The cascaded heterogeneous trading activities with different time durations are modelled by the heterogeneous autoregressive framework. The empirical study indicated the presence of long memory behaviour and predictability elements in the financial time series which supported heterogeneous market hypothesis. Besides the common sum-of-square intraday realized volatility, we also advocated two power variation realized volatilities in forecast evaluation and risk measurement in order to overcome the possible abrupt jumps during the credit crisis. Finally, the empirical results are used in determining the market risk using the value-at-risk approach. The findings of this study have implications for informationally market efficiency analysis, portfolio strategies and risk managements.

  12. Dehydrogenation of Formic Acid by Heterogeneous Catalysts.

    PubMed

    Li, Jun; Zhu, Qi-Long; Xu, Qiang

    2015-01-01

    Formic acid has recently been considered as one of the most promising hydrogen storage materials. The basic concept is briefly discussed and the research progress is detailledly reviewed on the dehydrogenation of aqueous formic acid by heterogeneous catalysts. PMID:26507481

  13. HETEROGENOUS PHOTOREACTION OF FORMALDEHYDE WITH HYDROXYL RADICALS

    EPA Science Inventory

    Atmospheric heterogeneous photoreactions occur between formaldehyde and hydroxyl radicals to produce formic acid. hese photoreactions not only occur in clouds, but also in other tropospheric hydrometeors such as precipitation and dew droplets. xperiments were performed by irradia...

  14. Heterogeneity and Risk Sharing in Village Economies.

    PubMed

    Chiappori, Pierre-André; Samphantharak, Krislert; Schulhofer-Wohl, Sam; Townsend, Robert M

    2014-03-01

    We show how to use panel data on household consumption to directly estimate households' risk preferences. Specifically, we measure heterogeneity in risk aversion among households in Thai villages using a full risk-sharing model, which we then test allowing for this heterogeneity. There is substantial, statistically significant heterogeneity in estimated risk preferences. Full insurance cannot be rejected. As the risk sharing, as-if-complete-markets theory might predict, estimated risk preferences are unrelated to wealth or other characteristics. The heterogeneity matters for policy: Although the average household would benefit from eliminating village-level risk, less-risk-averse households who are paid to absorb that risk would be worse off by several percent of household consumption. PMID:24932226

  15. Effects of near-source heterogeneity on wave fields emanating from crustal sources observed at regional and teleseismic distances

    NASA Astrophysics Data System (ADS)

    Avants, Megan S.

    Near-source path effects imprint the wave field emanating from a seismic source and, if not well resolved, can obscure the details of source characteristics determined from observations of the seismic waves at regional and teleseismic distances (≥200 km). These effects are particularly strong for crustal sources such as shallow earthquakes and underground nuclear explosions. First, I explore 2D effects of random seismic P-wave velocity heterogeneity resulting from volumetric heterogeneity in the upper mantle and variability of the Moho on the amplitude decay of the regional phase Pn. Results indicate that the pattern of amplitude decay due to geometric spreading for a simple Earth model is more complex than that for an Earth model containing strong heterogeneity in the mantle lid. Next, I implement the representation theorem in a method which collects displacement and strain components output from a 3D finite difference program capable of including realistic surface topography and geologic structure in a 3D velocity model, and calculates teleseismic 3D Green functions (3DGFs) to specified receiver locations. Green functions produced from a 3D source model match Green functions produced from a 1D source model for theoretical source-receiver geometries. This new method is then applied to the problem of constraining the source depth and location of the three nuclear tests conducted by North Korea, by using a realistic topography model for the mountainous test region to calculate 3DGFs for several possible locations of each event. Amplitude ratios of P and pP from 3DGFs are correlated to those in observed stacked traces. Results show a sensitivity of this method to source depth and location across the test site region with source depths slightly greater than published estimates, but relative locations consistent with other studies. Finally, I determine a rupture model of the 2008 Wenchuan earthquake using 3DGFs calculated in a velocity model containing the dramatic

  16. NMR CHARACTERIZATIONS OF PROPERTIES OF HETEROGENEOUS MEDIA

    SciTech Connect

    C.T. Philip Chang; Changho Choi; Jeromy T. Hollenshead; Rudi Michalak; Jack Phan; Ramon Saavedra; John C. Slattery; Jinsoo Uh; Randi Valestrand; A. Ted Watson; Song Xue

    2005-01-01

    A critical and long-standing need within the petroleum industry is the specification of suitable petrophysical properties for mathematical simulation of fluid flow in petroleum reservoirs (i.e., reservoir characterization). The development of accurate reservoir characterizations is extremely challenging. Property variations may be described on many scales, and the information available from measurements reflect different scales. In fact, experiments on laboratory core samples, well-log data, well-test data, and reservoir-production data all represent information potentially valuable to reservoir characterization, yet they all reflect information about spatial variations of properties at different scales. Nuclear magnetic resonance (NMR) spectroscopy and imaging (MRI) provide enormous potential for developing new descriptions and understandings of heterogeneous media. NMR has the rare capability to probe permeable media non-invasively, with spatial resolution, and it provides unique information about molecular motions and interactions that are sensitive to morphology. NMR well-logging provides the best opportunity ever to resolve permeability distributions within petroleum reservoirs. We develop MRI methods to determine, for the first time, spatially resolved distributions of porosity and permeability within permeable media samples that approach the intrinsic scale: the finest resolution of these macroscopic properties possible. To our knowledge, this is the first time that the permeability is actually resolved at a scale smaller than the sample. In order to do this, we have developed a robust method to determine of relaxation distributions from NMR experiments and a novel implementation and analysis of MRI experiments to determine the amount of fluid corresponding to imaging regions, which are in turn used to determine porosity and saturation distributions. We have developed a novel MRI experiment to determine velocity distributions within flowing experiments, and

  17. Tumor heterogeneity and circulating tumor cells.

    PubMed

    Zhang, Chufeng; Guan, Yan; Sun, Yulan; Ai, Dan; Guo, Qisen

    2016-05-01

    In patients with cancer, individualized treatment strategies are generally guided by an analysis of molecular biomarkers. However, genetic instability allows tumor cells to lose monoclonality and acquire genetic heterogeneity, an important characteristic of tumors, during disease progression. Researchers have found that there is tumor heterogeneity between the primary tumor and metastatic lesions, between different metastatic lesions, and even within a single tumor (either primary or metastatic). Tumor heterogeneity is associated with heterogeneous protein functions, which lowers diagnostic precision and consequently becomes an obstacle to determining the appropriate therapeutic strategies for individual cancer patients. With the development of novel testing technologies, an increasing number of studies have attempted to explore tumor heterogeneity by examining circulating tumor cells (CTCs), with the expectation that CTCs may comprehensively represent the full spectrum of mutations and/or protein expression alterations present in the cancer. In addition, this strategy represents a minimally invasive approach compared to traditional tissue biopsies that can be used to dynamically monitor tumor evolution. The present article reviews the potential efficacy of using CTCs to identify both spatial and temporal tumor heterogeneity. This review also highlights current issues in this field and provides an outlook toward future applications of CTCs. PMID:26902424

  18. Heterogeneous reactions in aircraft gas turbine engines

    NASA Astrophysics Data System (ADS)

    Brown, R. C.; Miake-Lye, R. C.; Lukachko, S. P.; Waitz, I. A.

    2002-05-01

    One-dimensional flow models and unity probability heterogeneous rate parameters are used to estimate the maximum effect of heterogeneous reactions on trace species evolution in aircraft gas turbines. The analysis includes reactions on soot particulates and turbine/nozzle material surfaces. Results for a representative advanced subsonic engine indicate the net change in reactant mixing ratios due to heterogeneous reactions is <10-6 for O2, CO2, and H2O, and <10-10 for minor combustion products such as SO2 and NO2. The change in the mixing ratios relative to the initial values is <0.01%. Since these estimates are based on heterogeneous reaction probabilities of unity, the actual changes will be even lower. Thus, heterogeneous chemistry within the engine cannot explain the high conversion of SO2 to SO3 which some wake models require to explain the observed levels of volatile aerosols. Furthermore, turbine heterogeneous processes will not effect exhaust NOx or NOy levels.

  19. Materials properties: heterogeneity and appropriate sampling modes.

    PubMed

    Esbensen, Kim H

    2015-01-01

    The target audience for this Special Section comprises parties related to the food and feed sectors, e.g., field samplers, academic and industrial scientists, laboratory personnel, companies, organizations, regulatory bodies, and agencies who are responsible for sampling, as well as project leaders, project managers, quality managers, supervisors, and directors. All these entities face heterogeneous materials, and the characteristics of heterogeneous materials needs to be competently understood by all of them. Before delivering analytical results for decision-making, one form or other of primary sampling is always necessary, which must counteract the effects of the sampling target heterogeneity. Up to five types of sampling error may arise as a specific sampling process interacts with a heterogeneous material; two sampling errors arise because of the heterogeneity of the sampling target, and three additional sampling errors are produced by the sampling process itself-if not properly understood, reduced, and/or eliminated, which is the role of Theory of Sampling. This paper discusses the phenomenon and concepts involved in understanding, describing, and managing the adverse effects of heterogeneity in sampling. PMID:25807041

  20. Nuclear Medicine.

    ERIC Educational Resources Information Center

    Badawi, Ramsey D.

    2001-01-01

    Describes the use of nuclear medicine techniques in diagnosis and therapy. Describes instrumentation in diagnostic nuclear medicine and predicts future trends in nuclear medicine imaging technology. (Author/MM)

  1. Identification of crustal and upper mantle heterogeneity by modelling of controlled-source seismic data

    NASA Astrophysics Data System (ADS)

    Nielsen, L.; Thybo, H.

    2006-04-01

    High-frequency controlled-source seismic sections with dense spatial sampling show the existence of heterogeneity at different depth levels of the continental crust and upper mantle. Our sources of information are the Peaceful Nuclear Explosion (PNE) seismic data sets recorded to large offsets in the former Soviet Union supplemented by recordings from the North American Early Rise deep seismic experiment and normal-incidence reflection seismic sections collected in northwest Europe. Heterogeneity in the crust and upper mantle can be uniquely identified in reversed high-frequency (2-10 Hz) PNE seismic sections collected with dense spatial sampling (nominal receiver spacing of 10-15 km) out to 4000 km offset. We document pronounced seismic scattering from three heterogeneous zones: The lower crust from ˜20 km to ˜40 km depth, an ˜80 km thick low-velocity zone below ˜100 km depth, and the ˜320-460 km depth interval around the top of the mantle transition zone. We calculate the full seismic wavefield in heterogeneous crust-mantle models with a two-dimensional finite-difference algorithm. We represent the heterogeneous layers by random fluctuations of the elastic parameters and Q-values. The spatial (horizontal and vertical) correlation lengths and the standard deviation of the scattering media are constrained by comparison of observed and calculated seismic sections. The lower crustal heterogeneity causes a coda to the upper mantle arrivals at all recorded frequencies. This coda is a prominent feature for whispering-gallery phases (teleseismic Pn), which travel as multiply reflected refractions below the Moho to more than 3000 km offset from the PNE sources. The heterogeneous mantle low-velocity zone causes a scattered coda trailing the first arrivals in the ˜800-1400 km offset range. The best fit to the observations along profile Kraton in Siberia is obtained by an 80 km thick heterogeneous low-velocity zone below 100 km depth, represented by fluctuations

  2. Nuclear data for nuclear transmutation

    SciTech Connect

    Harada, Hideo

    2009-05-04

    Current status on nuclear data for the study of nuclear transmutation of radioactive wastes is reviewed, mainly focusing on neutron capture reactions. It is stressed that the highest-precision frontier research in nuclear data measurements should be a key to satisfy the target accuracies on the nuclear data requested for realizing the nuclear transmutation.

  3. Regional Heterogenity In Ceres' Subsurface

    NASA Astrophysics Data System (ADS)

    Raymond, Carol A.; Marchi, Simone; Bland, Michael T.; Castillo-Rogez, Julie C.; Park, Ryan S.; Russell, Christopher T.; Hughson, Kynan G.; Scully, Jennifer E. C.

    2016-04-01

    subdued or degraded rims. Regional-scale variations in roughness and cratering could be caused by varia-bility in the viscosity of the volatile-rich shell, or could reflect a resurfacing process. However, these two processes would yield differences that would help to distinguish them. In the case of relaxation, the degree of crater obilitera-tion would be a function of crater size and age, and possibly would vary with latitude (temperature). If caused by resurfacing, the crater size frequency distribution would be similar to but offset with respect to that of the surround-ing terrains. Some correlation is seen between variations in the visible spectrum and the areas of smooth terrain. In either case, relaxation or resurfacing would indicate an internal process that resulted in primordial heterogeneity in the volatile-rich shell, or subsequent convective processes that drove regional resurfacing.

  4. Heterogeneous expression of apolipoprotein-E by human macrophages

    PubMed Central

    Tedla, Nicodemus; Glaros, Elias N; Brunk, Ulf T; Jessup, Wendy; Garner, Brett

    2004-01-01

    Apolipoprotein-E (apoE) is expressed at high levels by macrophages. In addition to its role in lipid transport, macrophage-derived apoE plays an important role in immunoregulation. Previous studies have identified macrophage subpopulations that differ substantially in their ability to synthesize specific cytokines and enzymes, however, potential heterogeneous macrophage apoE expression has not been studied. Here we examined apoE expression in human THP-1 macrophages and monocyte-derived macrophages (MDM). Using immunocytochemistry and flow cytometry methods we reveal a striking heterogeneity in macrophage apoE expression in both cell types. In phorbol-ester-differentiated THP-1 macrophages, 5% of the cells over-expressed apoE at levels more than 50-fold higher than the rest of the population. ApoE over-expressing THP-1 macrophages contained condensed/fragmented nuclei and increased levels of activated caspase-3 indicating induction of apoptosis. In MDM, 3–5% of the cells also highly over-expressed apoE, up to 50-fold higher than the rest of the population; however, this was not associated with obvious nuclear alterations. The apoE over-expressing MDM were larger, more granular, and more autofluorescent than the majority of cells and they contained numerous vesicle-like structures that appeared to be coated by apoE. Flow cytometry experiments indicated that the apoE over-expressing subpopulation of MDM were positive for CD14, CD11b/Mac-1 and CD68. These observations suggest that specific macrophage subpopulations may be important for apoE-mediated immunoregulation and clearly indicate that subpopulation heterogeneity should be taken into account when investigating macrophage apoE expression. PMID:15500620

  5. Inverse problems in heterogeneous and fractured media using peridynamics

    SciTech Connect

    Turner, Daniel Z.; van Bloemen Waanders, Bart G.; Parks, Michael L.

    2015-12-10

    The following work presents an adjoint-based methodology for solving inverse problems in heterogeneous and fractured media using state-based peridynamics. We show that the inner product involving the peridynamic operators is self-adjoint. The proposed method is illustrated for several numerical examples with constant and spatially varying material parameters as well as in the context of fractures. We also present a framework for obtaining material parameters by integrating digital image correlation (DIC) with inverse analysis. This framework is demonstrated by evaluating the bulk and shear moduli for a sample of nuclear graphite using digital photographs taken during the experiment. The resulting measured values correspond well with other results reported in the literature. Lastly, we show that this framework can be used to determine the load state given observed measurements of a crack opening. Furthermore, this type of analysis has many applications in characterizing subsurface stress-state conditions given fracture patterns in cores of geologic material.

  6. NUCLEAR REACTOR COMPENENT CLADDING MATERIAL

    DOEpatents

    Draley, J.E.; Ruther, W.E.

    1959-01-27

    Fuel elements and coolant tubes used in nuclear reactors of the heterogeneous, water-cooled type are described, wherein the coolant tubes extend through the moderator and are adapted to contain the fuel elements. The invention comprises forming the coolant tubes and the fuel element cladding material from an alloy of aluminum and nickel, or an alloy of aluminum, nickel, alloys are selected to prevent intergranular corrosion of these components by water at temperatures up to 35O deg C.

  7. Heterogeneous calretinin expression in the avian cochlear nucleus angularis.

    PubMed

    Bloom, S; Williams, A; MacLeod, K M

    2014-08-01

    Multiple calcium-binding proteins (CaBPs) are expressed at high levels and in complementary patterns in the auditory pathways of birds, mammals, and other vertebrates, but whether specific members of the CaBP family can be used to identify neuronal subpopulations is unclear. We used double immunofluorescence labeling of calretinin (CR) in combination with neuronal markers to investigate the distribution of CR-expressing neurons in brainstem sections of the cochlear nucleus in the chicken (Gallus gallus domesticus). While CR was homogeneously expressed in cochlear nucleus magnocellularis, CR expression was highly heterogeneous in cochlear nucleus angularis (NA), a nucleus with diverse cell types analogous in function to neurons in the mammalian ventral cochlear nucleus. To quantify the distribution of CR in the total NA cell population, we used antibodies against neuronal nuclear protein (NeuN), a postmitotic neuron-specific nuclear marker. In NA neurons, NeuN label was variably localized to the cell nucleus and the cytoplasm, and the intensity of NeuN immunoreactivity was inversely correlated with the intensity of CR immunoreactivity. The percentage of CR + neurons in NA increased from 31 % in embryonic (E)17/18 chicks, to 44 % around hatching (E21), to 51 % in postnatal day (P) 8 chicks. By P8, the distribution of CR + neurons was uniform, both rostrocaudal and in the tonotopic (dorsoventral) axis. Immunoreactivity for the voltage-gated potassium ion channel Kv1.1, used as a marker for physiological type, showed broad and heterogeneous postsynaptic expression in NA, but did not correlate with CR expression. These results suggest that CR may define a subpopulation of neurons within nucleus angularis. PMID:24752525

  8. Nuclear weapons and nuclear war

    SciTech Connect

    Cassel, C.; McCally, M.; Abraham, H.

    1984-01-01

    This book examines the potential radiation hazards and environmental impacts of nuclear weapons. Topics considered include medical responsibility and thermonuclear war, the threat of nuclear war, nuclear weaponry, biological effects, radiation injury, decontamination, long-term effects, ecological effects, psychological aspects, the economic implications of nuclear weapons and war, ethics, civil defense, arms control, nuclear winter, and long-term biological consequences of nuclear war.

  9. Heterogonous Nanofluids for Nuclear Power Plants

    NASA Astrophysics Data System (ADS)

    Alammar, Khalid

    2014-09-01

    Nuclear reactions can be associated with high heat energy release. Extracting such energy efficiently requires the use of high-rate heat exchangers. Conventional heat transfer fluids, such as water and oils are limited in their thermal conductivity, and hence nanofluids have been introduced lately to overcome such limitation. By suspending metal nanoparticles with high thermal conductivity in conventional heat transfer fluids, thermal conductivity of the resulting homogeneous nanofluid is increased. Heterogeneous nanofluids offer yet more potential for heat transfer enhancement. By stratifying nanoparticles within the boundary layer, thermal conductivity is increased where temperature gradients are highest, thereby increasing overall heat transfer of a flowing fluid. In order to test the merit of this novel technique, a numerical study of a laminar pipe flow of a heterogeneous nanofluid was conducted. Effect of Iron-Oxide distribution on flow and heat transfer characteristics was investigated. With Iron-Oxide volume concentration of 0.009 in water, up to 50% local heat transfer enhancement was predicted for the heterogeneous compared to homogeneous nanofluids. Increasing the Reynolds number is shown to increase enhancement while having negligible effect on pressure drop. Using permanent magnets attached externally to the pipe, an experimental investigation conducted at MIT nuclear reactor laboratory for similar flow characteristics of a heterogeneous nanofluid have shown upto 160% enhancement in heat transfer. Such results show that heterogeneous nanofluids are promising for augmenting heat transfer rates in nuclear power heat exchanger systems.

  10. Heterogeneous physicochemistry of the winter polar stratosphere

    NASA Technical Reports Server (NTRS)

    Turco, R. P.; Toon, O. B.

    1988-01-01

    Present chemical theories of the Antarctic ozone hole assume that heterogeneous reactions involving polar stratospheric clouds (PSCs) are the precursor of springtime ozone depletions. However, none of the theories quantify the rates of proposed heterogeneous processed, and none utilize the extensive data base on PSC's. Thus, all of the theories must be considered incomplete until the heterogeneous mechanisms are properly defined. A unified treatment developed of the cloud related processes, both physical and chemical, and the importance of these processes using observation data is calibrated. The rates are compared competitive heterogeneous processes to place reasonable limits on critical mechanisms such as the denitrification and dechlorination of the polar winter stratosphere. Among the subjects addressed here are the physical/chemical properties of PSC's including their relevant microphysical, optical and compositional characteristics, mass transfer rates of gaseous constituents to cloud particles, adsorption, accommodation and sticking coefficients on cloud particles, time constants for condensation, absorption and other microphysical processes, effects of solubility and vapor pressure on cloud composition, the statistics of cloud processing of chemically active condensible species, rate limiting steps in heterogeneous chemical reactions, and the nonlinear dependence of ozone loss on physical and chemical parameters.

  11. Computational model of heterogeneous heating in melanin

    NASA Astrophysics Data System (ADS)

    Kellicker, Jason; DiMarzio, Charles A.; Kowalski, Gregory J.

    2015-03-01

    Melanin particles often present as an aggregate of smaller melanin pigment granules and have a heterogeneous surface morphology. When irradiated with light within the absorption spectrum of melanin, these heterogeneities produce measurable concentrations of the electric field that result in temperature gradients from thermal effects that are not seen with spherical or ellipsoidal modeling of melanin. Modeling melanin without taking into consideration the heterogeneous surface morphology yields results that underestimate the strongest signals or over{estimate their spatial extent. We present a new technique to image phase changes induced by heating using a computational model of melanin that exhibits these surface heterogeneities. From this analysis, we demonstrate the heterogeneous energy absorption and resulting heating that occurs at the surface of the melanin granule that is consistent with three{photon absorption. Using the three{photon dluorescence as a beacon, we propose a method for detecting the extents of the melanin granule using photothermal microscopy to measure the phase changes resulting from the heating of the melanin.

  12. Heterogeneity of liver cancer and personalized therapy.

    PubMed

    Li, Liang; Wang, Hongyang

    2016-09-01

    Liver cancer is an extraordinarily heterogeneous malignant disease among the tumors that have so far been identified. Hepatocellular carcinoma (HCC) arises most frequently in the setting of chronic liver inflammation and fibrosis, and takes a variety of course in individual patients to process to tumor. The risk factors such as HBV and/or HCV infections, aflatoxin infection, abuse alcohol intake, metabolic syndrome, obesity and diabetes are closely related to the environmental and genetic susceptibilities to HCC. The consequent resulting genomic instability, molecular and signal transduction network disorders and microenvironmental discrepancies are characterized by the extraordinary heterogeneity of liver cancer. The histology-based definition of the morphological heterogeneity of liver cancer has been modified and refined to treat patients with targeted therapies, but this still cannot solve all the problems. Lack of consistent outcome for anticancer agents and conventional therapies in liver cancer treatment calls for assessing the benefits of new molecularly targeted drugs and combined therapy, under the heterogeneity condition of tumor. The present review article will provide the complex mechanism and phenotype of liver cancer heterogeneity, and help us to execute precision medicine in a really personalized manner. PMID:26213370

  13. On the origin of sperm epigenetic heterogeneity.

    PubMed

    Laurentino, Sandra; Borgmann, Jennifer; Gromoll, Jörg

    2016-05-01

    The influence of epigenetic modifications on reproduction and on the function of male germ cells has been thoroughly demonstrated. In particular, aberrant DNA methylation levels in sperm have been associated with abnormal sperm parameters, lower fertilization rates and impaired embryo development. Recent reports have indicated that human sperm might be epigenetically heterogeneous and that abnormal DNA methylation levels found in the sperm of infertile men could be due to the presence of sperm populations with different epigenetic quality. However, the origin and the contribution of different germ cell types to this suspected heterogeneity remain unclear. In this review, we focus on sperm epigenetics at the DNA methylation level and its importance in reproduction. We take into account the latest developments and hypotheses concerning the functional significance of epigenetic heterogeneity coming from the field of stem cell and cancer biology and discuss the potential importance and consequences of sperm epigenetic heterogeneity for reproduction, male (in)fertility and assisted reproductive technologies (ART). Based on the current information, we propose a model in which spermatogonial stem cell variability, either intrinsic or due to external factors (such as endocrine action and environmental stimuli), can lead to epigenetic sperm heterogeneity, sperm epimutations and male infertility. The elucidation of the precise causes for epimutations, the conception of adequate therapeutic options and the development of sperm selection technologies based on epigenetic quality should be regarded as crucial to the improvement of ART outcome in the near future. PMID:26884419

  14. Implications of Heterogeneity in Multiple Myeloma

    PubMed Central

    de Mel, Sanjay; Lim, Su Hong; Tung, Moon Ley; Chng, Wee-Joo

    2014-01-01

    Multiple myeloma is the second most common hematologic malignancy in the world. Despite improvement in outcome, the disease is still incurable for most patients. However, not all myeloma are the same. With the same treatment, some patients can have very long survival whereas others can have very short survival. This suggests that there is underlying heterogeneity in myeloma. Studies over the years have revealed multiple layers of heterogeneity. First, clinical parameters such as age and tumor burden could significantly affect outcome. At the genetic level, there are also significant heterogeneity ranging for chromosome numbers, genetic translocations, and genetic mutations. At the clonal level, there appears to be significant clonal heterogeneity with multiple clones coexisting in the same patient. At the cell differentiation level, there appears to be a hierarchy of clonally related cells that have different clonogenic potential and sensitivity to therapies. These levels of complexities present challenges in terms of treatment and prognostication as well as monitoring of treatment. However, if we can clearly delineate and dissect this heterogeneity, we may also be presented with unique opportunities for precision and personalized treatment of myeloma. Some proof of concepts of such approaches has been demonstrated. PMID:25101266

  15. Multiscale hyporheic exchange through strongly heterogeneous sediments

    NASA Astrophysics Data System (ADS)

    Pryshlak, Timothy T.; Sawyer, Audrey H.; Stonedahl, Susa H.; Soltanian, Mohamad Reza

    2015-11-01

    Heterogeneity in hydraulic conductivity (K) and channel morphology both control surface water-groundwater exchange (hyporheic exchange), which influences stream ecosystem processes and biogeochemical cycles. Here we show that heterogeneity in K is the dominant control on exchange rates, residence times, and patterns in hyporheic zones with abrupt lithologic contrasts. We simulated hyporheic exchange in a representative low-gradient stream with 300 different bimodal K fields composed of sand and silt. Simulations span five sets of sand-silt ratios and two sets of low and high K contrasts (1 and 3 orders of magnitude). Heterogeneity increases interfacial flux by an order of magnitude relative to homogeneous cases, drastically changes the shape of residence time distributions, and decreases median residence times. The positioning of highly permeable sand bodies controls patterns of interfacial flux and flow paths. These results are remarkably different from previous studies of smooth, continuous K fields that indicate only moderate effects on hyporheic exchange. Our results also show that hyporheic residence times are least predictable when sand body connectivity is low. As sand body connectivity increases, the expected residence time distribution (ensemble average for a given sand-silt ratio) remains approximately constant, but the uncertainty around the expectation decreases. Including strong heterogeneity in hyporheic models is imperative for understanding hyporheic fluxes and solute transport. In streams with strongly heterogeneous sediments, characterizing lithologic structure is more critical for predicting hyporheic exchange metrics than characterizing channel morphology.

  16. The Computational Modeling of Alloys:From ab initio and thermodynamics to heterogeneous precipitation.

    SciTech Connect

    Caro, A

    2007-10-09

    In this lecture we presented a methodology to obtain free energies from empirical potentials and applied it to the study of the phase diagram of FeCr. Subsequently, we used Metropolis Monte Carlo to analyze homogeneous and heterogeneous precipitation of the Cr rich solid solution {alpha}{prime}. These examples are part of our work in the area of steels for nuclear applications and can be found in several publications of our group cited as References.

  17. Integrated Design and Analysis for Heterogeneous Objects

    NASA Astrophysics Data System (ADS)

    Qian, Xiaoping; Yang, Pinghai

    2008-02-01

    The recent advancement of solid freeform fabrication, design techniques and fundamental understanding of material properties in functionally graded material objects has made it possible to design and fabricate multifunctional heterogeneous objects. In this paper, we present an integrated design and analysis approach for heterogeneous object realization, which employs a unified design and analysis model based on B-splines and allows for direct interaction between the design and analysis model without a laborious meshing operation. In the design module, a new approach for intuitively modeling multi-material objects, termed heterogeneous lofting, is presented. In the analysis module, a novel graded B-spline finite element solution procedure is described, which gives orders of magnitude better convergence rate in comparison with current methods, as demonstrated in several case studies. Further advantages of this approach include simplified mesh construction, exact geometry/material composition representation and easy extraction of iso-material surface for manufacturing process planning.

  18. Self-attracting walk on heterogeneous networks

    NASA Astrophysics Data System (ADS)

    Kim, Kanghun; Kyoung, Jaegu; Lee, D.-S.

    2016-05-01

    Understanding human mobility in cyberspace becomes increasingly important in this information era. While human mobility, memory-dependent and subdiffusive, is well understood in Euclidean space, it remains elusive in random heterogeneous networks like the World Wide Web. Here we study the diffusion characteristics of self-attracting walks, in which a walker is more likely to move to the locations visited previously than to unvisited ones, on scale-free networks. Under strong attraction, the number of distinct visited nodes grows linearly in time with larger coefficients in more heterogeneous networks. More interestingly, crossovers to sublinear growths occur in strongly heterogeneous networks. To understand these phenomena, we investigate the characteristic volumes and topology of the cluster of visited nodes and find that the reinforced attraction to hubs results in expediting exploration first but delaying later, as characterized by the scaling exponents that we derive. Our findings and analysis method can be useful for understanding various diffusion processes mediated by human.

  19. Seismoelectric effects due to mesoscopic heterogeneities

    NASA Astrophysics Data System (ADS)

    Jougnot, Damien; Rubino, J. GermáN.; Carbajal, Marina Rosas; Linde, Niklas; Holliger, Klaus

    2013-05-01

    While the seismic effects of wave-induced fluid flow due to mesoscopic heterogeneities have been studied for several decades, the role played by these types of heterogeneities on seismoelectric phenomena is largely unexplored. To address this issue, we have developed a novel methodological framework which allows for the coupling of wave-induced fluid flow, as inferred through numerical oscillatory compressibility tests, with the pertinent seismoelectric conversion mechanisms. Simulating the corresponding response of a water-saturated sandstone sample containing mesoscopic fractures, we demonstrate for the first time that these kinds of heterogeneities can produce measurable seismoelectric signals under typical laboratory conditions. Given that this phenomenon is sensitive to key hydraulic and mechanical properties, we expect that the results of this pilot study will stimulate further exploration on this topic in several domains of the Earth, environmental, and engineering sciences.

  20. Characterizing hydrogeologic heterogeneity using lithologic data

    SciTech Connect

    Flach, G.; Hamm, LL.L.; Harris, M.K.; Thayer, P.A.; Haselow, J.S.; Smits, A.D.

    1997-06-13

    Large-scale (>1 m) variability in hydraulic conductivity is usually the main influence on field-scale groundwater flow patterns and dispersive transport. Incorporating realistic hydraulic conductivity heterogeneity into flow and transport models is paramount to accurate simulations, particularly for contaminant migration. Sediment lithologic descriptions and geophysical logs typically offer finer spatial resolution, and therefore more potential information about site-scale heterogeneity, than other site characterization data. In this study, a technique for generating a heterogeneous, three- dimensional hydraulic conductivity field from sediment lithologic descriptions is presented. The approach involves creating a three-dimensional, fine-scale representation of mud (silt and clay) percentage using a stratified interpolation algorithm. Mud percentage is then translated into horizontal and vertical conductivity using direct correlations derived from measured data and inverse groundwater flow modeling. Lastly, the fine-scale conductivity fields are averaged to create a coarser grid for use in groundwater flow and transport modeling.

  1. A physical mechanism of cancer heterogeneity

    PubMed Central

    Chen, Cong; Wang, Jin

    2016-01-01

    We studied a core cancer gene regulatory network motif to uncover possible source of cancer heterogeneity from epigenetic sources. When the time scale of the protein regulation to the gene is faster compared to the protein synthesis and degradation (adiabatic regime), normal state, cancer state and an intermediate premalignant state emerge. Due to the epigenetics such as DNA methylation and histone remodification, the time scale of the protein regulation to the gene can be slower or comparable to the protein synthesis and degradation (non-adiabatic regime). In this case, many more states emerge as possible phenotype alternations. This gives the origin of the heterogeneity. The cancer heterogeneity is reflected from the emergence of more phenotypic states, larger protein concentration fluctuations, wider kinetic distributions and multiplicity of kinetic paths from normal to cancer state, higher energy cost per gene switching, and weaker stability. PMID:26854017

  2. Correlation between spatial heterogeneity and local dynamics

    NASA Astrophysics Data System (ADS)

    Bhatia, Ritwik; Medvedev, Grigori; Corti, David; Caruthers, James

    2003-03-01

    Spatially correlated dynamic heterogeneity has been observed in binary Lennard-Jones mixtures [1]; however, the properites that cause the dynamic heterogeneity are not completely understood. In order to investigate the origin of the dynamic heterogeneity, we have examined the correlation of various thermodynamic properties in the region surrounding the mobile particles. Specifically, the simulation box is divided into a number of sub-volumes and the autocorrelation functions of the density, potential energy and thermal energy are determioned for each sub-volume. A comparison of autocorrelation functions of the sub-volumes containing a large number of mobile particles to sub-volumes containing no mobile particles is reported. [1] Donati et. al., Phys Rev E. v60, n3, p3107, 1999.

  3. Heterogeneous Chemistry Related to Stratospheric Aircraft

    NASA Technical Reports Server (NTRS)

    Tolbert, Margaret A.

    1995-01-01

    Emissions from stratospheric aircraft that may directly or indirectly affect ozone include NO(y), H2O, soot and sulfuric acid. To fully assess the impact of such emissions, it is necessary to have a full understanding of both the homogeneous and heterogeneous transformations that may occur in the stratosphere. Heterogeneous reactions on stratospheric particles play a key role in partitioning ozone-destroying species between their active and reservoir forms. In particular, heterogeneous reactions tend to activate odd chlorine while deactivating odd nitrogen. Accurate modeling of the net atmospheric effects of stratospheric aircraft requires a thorough understanding of the competing effects of this activation/deactivation. In addition, a full understanding of the potential aircraft impacts requires that the abundance, composition and formation mechanisms of the particles themselves be established. Over the last three years with support from the High Speed Research Program, we have performed laboratory experiments to determine the chemical composition, formation mechanism, and reactivity of stratospheric aerosols.

  4. Multiple roles of graphene in heterogeneous catalysis.

    PubMed

    Fan, Xiaobin; Zhang, Guoliang; Zhang, Fengbao

    2015-05-21

    Scientific interest in graphene as a catalyst and as a catalyst support in heterogeneous catalytic reactions has grown dramatically over the past several years. The present critical review summarizes the multiple roles of graphene in heterogeneous catalysis and highlights the influence of defects, heteroatom-containing functionalities, and graphene's two-dimensional structure on catalytic performance. We first discuss the role and advantages of graphene as a catalyst support, with emphasis on its interactions with the catalytic phases and the influence of mass transfer processes. We then clarify the origin of the intrinsic catalytic activity of graphene in heterogeneous catalytic reactions. Finally we suggest challenges and potential practical applications for graphene in industrial processes. PMID:25777748

  5. Stretchable heterogeneous composites with extreme mechanical gradients.

    PubMed

    Libanori, Rafael; Erb, Randall M; Reiser, Alain; Le Ferrand, Hortense; Süess, Martin J; Spolenak, Ralph; Studart, André R

    2012-01-01

    Heterogeneous composite materials with variable local stiffness are widespread in nature, but are far less explored in engineering structural applications. The development of heterogeneous synthetic composites with locally tuned elastic properties would allow us to extend the lifetime of functional devices with mechanically incompatible interfaces, and to create new enabling materials for applications ranging from flexible electronics to regenerative medicine. Here we show that heterogeneous composites with local elastic moduli tunable over five orders of magnitude can be prepared through the site-specific reinforcement of an entangled elastomeric matrix at progressively larger length scales. Using such a hierarchical reinforcement approach, we designed and produced composites exhibiting regions with extreme soft-to-hard transitions, while still being reversibly stretchable up to 350%. The implementation of the proposed methodology in a mechanically challenging application is illustrated here with the development of locally stiff and globally stretchable substrates for flexible electronics. PMID:23232395

  6. Dynamical robustness of coupled heterogeneous oscillators

    NASA Astrophysics Data System (ADS)

    Tanaka, Gouhei; Morino, Kai; Daido, Hiroaki; Aihara, Kazuyuki

    2014-05-01

    We study tolerance of dynamic behavior in networks of coupled heterogeneous oscillators to deterioration of the individual oscillator components. As the deterioration proceeds with reduction in dynamic behavior of the oscillators, an order parameter evaluating the level of global oscillation decreases and then vanishes at a certain critical point. We present a method to analytically derive a general formula for this critical point and an approximate formula for the order parameter in the vicinity of the critical point in networks of coupled Stuart-Landau oscillators. Using the critical point as a measure for dynamical robustness of oscillator networks, we show that the more heterogeneous the oscillator components are, the more robust the oscillatory behavior of the network is to the component deterioration. This property is confirmed also in networks of Morris-Lecar neuron models coupled through electrical synapses. Our approach could provide a useful framework for theoretically understanding the role of population heterogeneity in robustness of biological networks.

  7. Impact of Aquifer Heterogeneities on Autotrophic Denitrification.

    NASA Astrophysics Data System (ADS)

    McCarthy, A.; Roques, C.; Selker, J. S.; Istok, J. D.; Pett-Ridge, J. C.

    2015-12-01

    Nitrate contamination in groundwater is a big challenge that will need to be addressed by hydrogeologists throughout the world. With a drinking water standard of 10mg/L of NO3-, innovative techniques will need to be pursued to ensure a decrease in drinking water nitrate concentration. At the pumping site scale, the influence and relationship between heterogeneous flow, mixing, and reactivity is not well understood. The purpose of this project is to incorporate both physical and chemical modeling techniques to better understand the effect of aquifer heterogeneities on autotrophic denitrification. We will investigate the link between heterogeneous hydraulic properties, transport, and the rate of autotrophic denitrification. Data collected in previous studies in laboratory experiments and pumping site scale experiments will be used to validate the models. The ultimate objective of this project is to develop a model in which such coupled processes are better understood resulting in best management practices of groundwater.

  8. Self-attracting walk on heterogeneous networks.

    PubMed

    Kim, Kanghun; Kyoung, Jaegu; Lee, D-S

    2016-05-01

    Understanding human mobility in cyberspace becomes increasingly important in this information era. While human mobility, memory-dependent and subdiffusive, is well understood in Euclidean space, it remains elusive in random heterogeneous networks like the World Wide Web. Here we study the diffusion characteristics of self-attracting walks, in which a walker is more likely to move to the locations visited previously than to unvisited ones, on scale-free networks. Under strong attraction, the number of distinct visited nodes grows linearly in time with larger coefficients in more heterogeneous networks. More interestingly, crossovers to sublinear growths occur in strongly heterogeneous networks. To understand these phenomena, we investigate the characteristic volumes and topology of the cluster of visited nodes and find that the reinforced attraction to hubs results in expediting exploration first but delaying later, as characterized by the scaling exponents that we derive. Our findings and analysis method can be useful for understanding various diffusion processes mediated by human. PMID:27300913

  9. Stretchable heterogeneous composites with extreme mechanical gradients

    NASA Astrophysics Data System (ADS)

    Libanori, Rafael; Erb, Randall M.; Reiser, Alain; Le Ferrand, Hortense; Süess, Martin J.; Spolenak, Ralph; Studart, André R.

    2012-12-01

    Heterogeneous composite materials with variable local stiffness are widespread in nature, but are far less explored in engineering structural applications. The development of heterogeneous synthetic composites with locally tuned elastic properties would allow us to extend the lifetime of functional devices with mechanically incompatible interfaces, and to create new enabling materials for applications ranging from flexible electronics to regenerative medicine. Here we show that heterogeneous composites with local elastic moduli tunable over five orders of magnitude can be prepared through the site-specific reinforcement of an entangled elastomeric matrix at progressively larger length scales. Using such a hierarchical reinforcement approach, we designed and produced composites exhibiting regions with extreme soft-to-hard transitions, while still being reversibly stretchable up to 350%. The implementation of the proposed methodology in a mechanically challenging application is illustrated here with the development of locally stiff and globally stretchable substrates for flexible electronics.

  10. A physical mechanism of cancer heterogeneity

    NASA Astrophysics Data System (ADS)

    Chen, Cong; Wang, Jin

    2016-02-01

    We studied a core cancer gene regulatory network motif to uncover possible source of cancer heterogeneity from epigenetic sources. When the time scale of the protein regulation to the gene is faster compared to the protein synthesis and degradation (adiabatic regime), normal state, cancer state and an intermediate premalignant state emerge. Due to the epigenetics such as DNA methylation and histone remodification, the time scale of the protein regulation to the gene can be slower or comparable to the protein synthesis and degradation (non-adiabatic regime). In this case, many more states emerge as possible phenotype alternations. This gives the origin of the heterogeneity. The cancer heterogeneity is reflected from the emergence of more phenotypic states, larger protein concentration fluctuations, wider kinetic distributions and multiplicity of kinetic paths from normal to cancer state, higher energy cost per gene switching, and weaker stability.

  11. Heterogeneous Distributed Computing for Computational Aerosciences

    NASA Technical Reports Server (NTRS)

    Sunderam, Vaidy S.

    1998-01-01

    The research supported under this award focuses on heterogeneous distributed computing for high-performance applications, with particular emphasis on computational aerosciences. The overall goal of this project was to and investigate issues in, and develop solutions to, efficient execution of computational aeroscience codes in heterogeneous concurrent computing environments. In particular, we worked in the context of the PVM[1] system and, subsequent to detailed conversion efforts and performance benchmarking, devising novel techniques to increase the efficacy of heterogeneous networked environments for computational aerosciences. Our work has been based upon the NAS Parallel Benchmark suite, but has also recently expanded in scope to include the NAS I/O benchmarks as specified in the NHT-1 document. In this report we summarize our research accomplishments under the auspices of the grant.

  12. Information flow in heterogeneously interacting systems.

    PubMed

    Yamaguti, Yutaka; Tsuda, Ichiro; Takahashi, Yoichiro

    2014-02-01

    Motivated by studies on the dynamics of heterogeneously interacting systems in neocortical neural networks, we studied heterogeneously-coupled chaotic systems. We used information-theoretic measures to investigate directions of information flow in heterogeneously coupled Rössler systems, which we selected as a typical chaotic system. In bi-directionally coupled systems, spontaneous and irregular switchings of the phase difference between two chaotic oscillators were observed. The direction of information transmission spontaneously switched in an intermittent manner, depending on the phase difference between the two systems. When two further oscillatory inputs are added to the coupled systems, this system dynamically selects one of the two inputs by synchronizing, selection depending on the internal phase differences between the two systems. These results indicate that the effective direction of information transmission dynamically changes, induced by a switching of phase differences between the two systems. PMID:24465282

  13. Spatial Heterogeneity in the Tumor Microenvironment.

    PubMed

    Yuan, Yinyin

    2016-01-01

    Recent developments in studies of tumor heterogeneity have provoked new thoughts on cancer management. There is a desperate need to understand influence of the tumor microenvironment on cancer development and evolution. Applying principles and quantitative methods from ecology can suggest novel solutions to fulfil this need. We discuss spatial heterogeneity as a fundamental biological feature of the microenvironment, which has been largely ignored. Histological samples can provide spatial context of diverse cell types coexisting within the microenvironment. Advanced computer-vision techniques have been developed for spatial mapping of cells in histological samples. This has enabled the applications of experimental and analytical tools from ecology to cancer research, generating system-level knowledge of microenvironmental spatial heterogeneity. We focus on studies of immune infiltrate and tumor resource distribution, and highlight statistical approaches for addressing the emerging challenges based on these new approaches. PMID:27481837

  14. Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration

    PubMed Central

    Garg, Megha; R., Indulaxmi; Perumalsamy, Lakshmi R.; Sarin, Apurva; Shivashankar, G. V.

    2012-01-01

    Cellular differentiation programs are accompanied by large-scale changes in nuclear organization and gene expression. In this context, accompanying transitions in chromatin assembly that facilitates changes in gene expression and cell behavior in a developmental system are poorly understood. Here, we address this gap and map structural changes in chromatin organization during murine T-cell development, to describe an unusual heterogeneity in chromatin organization and associated functional correlates in T-cell lineage. Confocal imaging of DNA assembly in cells isolated from bone marrow, thymus and spleen reveal the emergence of heterogeneous patterns in DNA organization in mature T-cells following their exit from the thymus. The central DNA pattern dominated in immature precursor cells in the thymus whereas both central and peripheral DNA patterns were observed in naïve and memory cells in circulation. Naïve T-cells with central DNA patterns exhibited higher mechanical pliability in response to compressive loads in vitro and transmigration assays in vivo, and demonstrated accelerated expression of activation-induced marker CD69. T-cell activation was characterized by marked redistribution of DNA assembly to a central DNA pattern and increased nuclear size. Notably, heterogeneity in DNA patterns recovered in cells induced into quiescence in culture, suggesting an internal regulatory mechanism for chromatin reorganization. Taken together, our results uncover an important component of plasticity in nuclear organization, reflected in chromatin assembly, during T-cell development, differentiation and transmigration. PMID:22957031

  15. Heterogeneity and Scaling in Geologic Media

    SciTech Connect

    Gregory N. Boitnott; Gilles Y. Bussod; Paul N. Hagin; Stephen R. Brown

    2005-04-18

    The accurate characterization and remediation of contaminated subsurface environments requires the detailed knowledge of subsurface structures and flow paths. Enormous resources are invested in scoping and characterizing sites using core sampling, 3-D geophysical surveys, well tests, etc.... Unfortunately, much of the information acquired is lost to compromises and simplifications made in constructing numerical grids for the simulators used to predict flow and transport from the contaminated area to the accessible environment. In rocks and soils, the bulk geophysical and transport properties of the matrix and of fracture systems are determined by the juxtaposition of geometric features at many length scales. In the interest of computational efficiency, recognized heterogeneities are simplified, averaged out, or entirely ignored in spite of recent studies that recognize that: (1) Structural and lithologic heterogeneities exist on all scales in rocks. (2) Small heterogeneities influence, and can control the physical and chemical properties of rocks. In this work we propose a physically based approach for the description and treatment of heterogeneities, that highlights the use of laboratory equipment designed to measure the effect on physical properties of fine scale heterogeneities observed in rocks and soils. We then discuss the development of an integration methodology that uses these measurements to develop and upscale flow and transport models. Predictive simulations are 'calibrated' to the measured heterogeneity data, and subsequently upscaled in a way that is consistent with the transport physics and the efficient use of environmental geophysics. This methodology provides a more accurate interpretation and representation of the subsurface for both environmental engineering and remediation. We show through examples, (i) the important influence of even subtle heterogeneity in the interpreting of geophysical data, and (ii) how physically based upscaling can lead

  16. PDA based control of multiple heterogeneous robots

    NASA Astrophysics Data System (ADS)

    Kim, Tae Geun; Suk, Sung Youn; Park, Jae Suk; Kim, Sung Rock; Jeon, You Ju; Lee, Suk Gyu

    2005-12-01

    This paper proposed PDA based control of multiple heterogeneous robots by sharing information to perform surveillance and reconnaissance. Since heterogeneous groups were equipped with different sensor systems, they in particular allow a potentially greater degree of fault-tolerance compared to homogeneous groups. In this paper, unknown environment around robots was recognized efficiently by multiple robots using internet based PDA, where communication between PDA(user interface) and host PC(a controller for robots) is based on TCP/IP protocol. Each of the robots collects sensor data regarding its own motion and environment to share this information with the rest of he team during he update cycles.

  17. A framework for querying heterogeneous images repositories

    NASA Astrophysics Data System (ADS)

    Albanesi, Maria G.; Falchero, Emanuele; Guerrini, Federico; Ferretti, Marco

    2003-12-01

    In this paper we describe a new system for storing annotated images in a large database and querying by means of a dynamical retrieval of images through use of metadata. It is based on a three-tier architecture suitable for building a common gateway for accessing heterogeneous data. Based on XML schema of documents, the extraction of metadata is used for successive querying. We give an example on a database of astronomical and geographical images, but the method is quite general and can be applied to more general case of large heterogeneous databases.

  18. Heterogeneity in the muscle satellite cell population

    PubMed Central

    Biressi, Stefano; Rando, Thomas A.

    2010-01-01

    Satellite cells, the adult stem cells responsible for skeletal muscle regeneration, are defined by their location between the basal lamina and the fiber sarcolemma. Increasing evidence suggests that satellite cells represent a heterogeneous population of cells with distinct embryological origin and multiple levels of biochemical and functional diversity. This review focuses on the rich diversity of the satellite cell population based on studies across species. Ultimately, a more complete characterization of the heterogeneity of satellite cells will be essential to understand the functional significance in terms of muscle growth, homeostasis, tissue repair, and aging. PMID:20849971

  19. Effective permeabilities for model heterogeneous porous media

    SciTech Connect

    Otevo, C.; Rusinek, I. ); Saez, A.E. )

    1990-01-01

    This paper presents a technique to evaluate effective absolute permeabilities for heterogeneous porous media. The technique is based on a perturbation analysis of the equations of motion of a slightly compressible fluid in a homogeneous porous medium at low Reynolds numbers. The effective permeabilities can be calculated once the local geometry of the heterogeneous medium is specified. The technique is used to evaluate two- and three-dimensional effective vertical permeabilities in porous media with shale intercalations, including the case in which the porous matrix is anisotropic.

  20. Method for Accessing Distributed Heterogeneous Databases

    NASA Technical Reports Server (NTRS)

    Jacobs, B. E.

    1984-01-01

    A scenario of relational, hierarchial, and network data bases is presented and a distributed access view integrated data base system (DAVID) is described for uniformly accessing data bases which are heterogeneous and physically distributed. The DAVID system is based on data base logic so that the relational approach is generalized to the heterogeneous approach. The global data manager is explained as are global data manipulation languages which can operate on all the data bases and can query the data dictionary and the data directory.

  1. Random sphere packing model of heterogeneous propellants

    NASA Astrophysics Data System (ADS)

    Kochevets, Sergei Victorovich

    It is well recognized that combustion of heterogeneous propellants is strongly dependent on the propellant morphology. Recent developments in computing systems make it possible to start three-dimensional modeling of heterogeneous propellant combustion. A key component of such large scale computations is a realistic model of industrial propellants which retains the true morphology---a goal never achieved before. The research presented develops the Random Sphere Packing Model of heterogeneous propellants and generates numerical samples of actual industrial propellants. This is done by developing a sphere packing algorithm which randomly packs a large number of spheres with a polydisperse size distribution within a rectangular domain. First, the packing code is developed, optimized for performance, and parallelized using the OpenMP shared memory architecture. Second, the morphology and packing fraction of two simple cases of unimodal and bimodal packs are investigated computationally and analytically. It is shown that both the Loose Random Packing and Dense Random Packing limits are not well defined and the growth rate of the spheres is identified as the key parameter controlling the efficiency of the packing. For a properly chosen growth rate, computational results are found to be in excellent agreement with experimental data. Third, two strategies are developed to define numerical samples of polydisperse heterogeneous propellants: the Deterministic Strategy and the Random Selection Strategy. Using these strategies, numerical samples of industrial propellants are generated. The packing fraction is investigated and it is shown that the experimental values of the packing fraction can be achieved computationally. It is strongly believed that this Random Sphere Packing Model of propellants is a major step forward in the realistic computational modeling of heterogeneous propellant of combustion. In addition, a method of analysis of the morphology of heterogeneous

  2. Atmospheric pressure microwave assisted heterogeneous catalytic reactions.

    PubMed

    Chemat-Djenni, Zoubida; Hamada, Boudjema; Chemat, Farid

    2007-01-01

    The purpose of the study was to investigate microwave selective heating phenomena and their impact on heterogeneous chemical reactions. We also present a tool which will help microwave chemists to answer to such questions as "My reaction yields 90% after 7 days at reflux; is it possible to obtain the same yield after a few minutes under microwaves?" and to have an approximation of their reactions when conducted under microwaves with different heterogeneous procedures. This model predicting reaction kinetics and yields under microwave heating is based on the Arrhenius equation, in agreement with experimental data and procedures. PMID:17909495

  3. Retinal regionalization and heterogeneity of butterfly eyes

    NASA Astrophysics Data System (ADS)

    Stavenga, D.; Kinoshita, M.; Yang, E.-C.; Arikawa, K.

    2001-11-01

    The regional characteristics of the eyes of butterflies from different families have been surveyed using epi-illumination microscopy, utilizing the eyeshine visible due to the tapetum situated proximally to the rhabdom. All butterflies studied have a high spatial acuity in the frontal region. The facet diameter varies slightly across the eye, and the interommatidial angle and the eye parameter p are especially large dorsally. Whereas the ommatidial lattice is generally highly regular, the eyeshine colours distinctly depend on the species. Sometimes the eyeshine is locally uniform, but often it is heterogeneous. It is hypothesized that the regional characteristics as well as the local heterogeneity are adaptations that optimize spectral discrimination.

  4. MNK1 expression increases during cellular senescence and modulates the subcellular localization of hnRNP A1

    SciTech Connect

    Ziaei, Samira; Shimada, Naoko; Kucharavy, Herman; Hubbard, Karen

    2012-03-10

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is an RNA-binding protein that modulates splice site usage, polyadenylation, and cleavage efficiency. This protein has also been implicated in mRNA stability and transport from the nucleus. We have previously demonstrated that hnRNP A1 had diminished protein levels and showed cytoplasmic accumulation in senescent human diploid fibroblasts. Furthermore, we have shown that inhibition of p38 MAPK, a key regulator of cellular senescence, elevated hnRNP A1 protein levels and inhibited hnRNP A1 cytoplasmic localization. In this study, we have explored the possible involvement of MNK1, one of the downstream effector of p38 MAPK, in the regulation of hnRNP A1. We have demonstrated that pharmacological inhibition of MNK1 by CGP 57380 decreased the phosphorylation levels of hnRNP A1 in young and senescent fibroblast cells and blocked the cytoplasmic accumulation of hnRNP A1 in senescent cells. In addition, MNK1 formed a complex with hnRNP A1 in vivo. The expression levels of MNK1, phospho-MNK1, and phospho-eIF4E proteins were found to be elevated in senescent cells. These data suggest that MNK1 regulates the phosphorylation and the subcellular distribution of hnRNP A1 and that MNK1 may play a role in the induction of senescence. -- Highlights: Black-Right-Pointing-Pointer MNK1 and not MAPKAPK2 phosphorylates hnRNP A1. Black-Right-Pointing-Pointer MNK1 has elevated levels in senescent cells, this has not been reported previously. Black-Right-Pointing-Pointer MNK1 activity induces cytoplasmic accumulation of hnRNP A1 in senescent cells. Black-Right-Pointing-Pointer Altered cytoplasmic localization of hnRNP A1 may alter gene expression patterns. Black-Right-Pointing-Pointer Our studies may increase our understanding of RNA metabolism during cellular aging.

  5. Molecular Heterogeneity Within the Clinical Diagnosis of Pericentral Retinal Degeneration

    PubMed Central

    Matsui, Rodrigo; Cideciyan, Artur V.; Schwartz, Sharon B.; Sumaroka, Alexander; Roman, Alejandro J.; Swider, Malgorzata; Huang, Wei Chieh; Sheplock, Rebecca; Jacobson, Samuel G.

    2015-01-01

    Purpose To characterize in detail the phenotype and genotype of patients with pericentral retinal degeneration (PRD). Methods Patients were screened for an annular ring scotoma ranging from 3° to 40° (n = 28, ages 24–71) with kinetic perimetry. All patients had pigmentary retinopathy in the region of the dysfunction. Further studies included cross-sectional and en face imaging, static chromatic perimetry, and electroretinography. Molecular screening was performed. Results Genotypes of 14 of 28 PRD patients were identified: There were mutations in eight different genes previously associated with autosomal dominant or autosomal recessive RDs. Kinetic fields monitored in some patients over years to more than a decade could be stable or show increased extent of the scotoma. Electroretinograms were recordable but with different severities of dysfunction. Patterns of photoreceptor outer nuclear layer (ONL) loss corresponded to the distribution of visual dysfunction. Outer nuclear layer thickness topography and en face imaging indicated that the greatest disease expression was in the area of known highest rod photoreceptor density. Conclusions Molecular heterogeneity was a feature of the PRD phenotype. Many of the molecular causes were also associated with other phenotypes, such as maculopathies, typical retinitis pigmentosa (RP) and cone–rod dystrophy. The pericentral pattern of retinal degeneration is thus confirmed to be an uncommon phenotype of many different genotypes rather than a distinct disease entity. PMID:26393467

  6. A 'green' chitosan silver nanoparticle composite as a heterogeneous as well as micro-heterogeneous catalyst

    NASA Astrophysics Data System (ADS)

    Murugadoss, A.; Chattopadhyay, Arun

    2008-01-01

    In this paper, we report on the catalytic activity of a new metal nanoparticle-polymer composite consisting of Ag nanoparticles (NPs) and environmentally friendly ('green') chitosan. The polymer (chitosan) not only acted as the reducing agent for the metal ions, but also stabilized the product NPs by anchoring them. The majority of the particles produced in this way had sizes less than 5 nm. The catalytic activity of the composite was investigated photometrically by monitoring the reduction of 4-nitrophenol (4NP) in the presence of excess NaBH4 in water, under both heterogeneous and micro-heterogeneous conditions. The reaction was first order with respect to the concentration of 4NP. We also observed that the apparent rate constant, kapp, for the reaction was linearly dependent on the amount of Ag NPs present in the composite. Moreover, the turn-over frequency (TOF) of the catalyst was found to be (1.5 ± 0.3) × 10-3 s-1, when the reaction was carried out under heterogeneous conditions. The Ag NPs in the composite retained their catalytic activities even after using them for ten cycles. Our observations also suggest that the catalytic efficiency under micro-heterogeneous conditions is much higher than under heterogeneous conditions. Thus the composite we have represents an ideal case of an environmentally friendly and stable catalyst, which works under heterogeneous as well as micro-heterogeneous conditions with the advantage of nanoscopic particles as the catalyst.

  7. Towards inverse modeling of intratumor heterogeneity

    NASA Astrophysics Data System (ADS)

    Brutovsky, Branislav; Horvath, Denis

    2015-08-01

    Development of resistance limits efficiency of present anticancer therapies and preventing it remains a big challenge in cancer research. It is accepted, at the intuitive level, that resistance emerges as a consequence of the heterogeneity of cancer cells at the molecular, genetic and cellular levels. Produced by many sources, tumor heterogeneity is extremely complex time dependent statistical characteristics which may be quantified by measures defined in many different ways, most of them coming from statistical mechanics. In this paper, we apply the Markovian framework to relate population heterogeneity to the statistics of the environment. As, from an evolutionary viewpoint, therapy corresponds to a purposeful modi- fication of the cells' fitness landscape, we assume that understanding general relationship between the spatiotemporal statistics of a tumor microenvironment and intratumor heterogeneity will allow to conceive the therapy as an inverse problem and to solve it by optimization techniques. To account for the inherent stochasticity of biological processes at cellular scale, the generalized distancebased concept was applied to express distances between probabilistically described cell states and environmental conditions, respectively.

  8. Heterogeneous nucleation in hypermonotectic aluminum alloys

    NASA Astrophysics Data System (ADS)

    Köhler, M.; Ratke, L.; Kaban, I.; Hoyer, W.

    2012-01-01

    Simple casting experiments were set up to solve the question, if heterogeneous nucleation of the liquid-liquid decomposition in monotectic systems is possible. Al-Pb alloys with different inoculants were solidified, and the resulting microstructure was analysed by SEM and X-ray microtomography. Pronounced changes in the distribution of the lead precipitations indicate that it is possible to trigger the nucleation.

  9. Heterogeneity: The key to failure forecasting

    NASA Astrophysics Data System (ADS)

    Vasseur, Jérémie; Wadsworth, Fabian B.; Lavallée, Yan; Bell, Andrew F.; Main, Ian G.; Dingwell, Donald B.

    2015-08-01

    Elastic waves are generated when brittle materials are subjected to increasing strain. Their number and energy increase non-linearly, ending in a system-sized catastrophic failure event. Accelerating rates of geophysical signals (e.g., seismicity and deformation) preceding large-scale dynamic failure can serve as proxies for damage accumulation in the Failure Forecast Method (FFM). Here we test the hypothesis that the style and mechanisms of deformation, and the accuracy of the FFM, are both tightly controlled by the degree of microstructural heterogeneity of the material under stress. We generate a suite of synthetic samples with variable heterogeneity, controlled by the gas volume fraction. We experimentally demonstrate that the accuracy of failure prediction increases drastically with the degree of material heterogeneity. These results have significant implications in a broad range of material-based disciplines for which failure forecasting is of central importance. In particular, the FFM has been used with only variable success to forecast failure scenarios both in the field (volcanic eruptions and landslides) and in the laboratory (rock and magma failure). Our results show that this variability may be explained, and the reliability and accuracy of forecast quantified significantly improved, by accounting for material heterogeneity as a first-order control on forecasting power.

  10. Fragmentation of metal particles during heterogeneous explosion

    NASA Astrophysics Data System (ADS)

    Ripley, R. C.; Donahue, L.; Zhang, F.

    2015-03-01

    Heterogeneous explosives contain a mixture of standard explosive material and reactive metal particles. The inclusion of metal particles alters the energy density and energy release timescales involved in the blast event. Available experimental evidence indicates that metal particles may be damaged or fragmented during heterogeneous blast, altering the distribution of particle sizes from their initial state. This paper discusses adaptation and application of fragmentation theory and physical models for particle damage during condensed matter detonation, aerodynamic breakup of molten particles, and particle impact fragmentation with nearby structures. The shock compression and impact fragmentation models are based on the energy methods for dynamic fragmentation by Grady and Kipp, while aerodynamic breakup is treated according to Weber number stability criteria for droplets. These particle fragmentation models are validated against fundamental test cases from the literature. The models are then applied to heterogeneous blast scenarios including free field and wall reflection in a semi-confined urban street. Comparison with experimental records of pressure shows good agreement despite challenges inherent in the complexity of heterogeneous blast measurement and multiphase simulation.

  11. Heterogeneity: The key to failure forecasting.

    PubMed

    Vasseur, Jérémie; Wadsworth, Fabian B; Lavallée, Yan; Bell, Andrew F; Main, Ian G; Dingwell, Donald B

    2015-01-01

    Elastic waves are generated when brittle materials are subjected to increasing strain. Their number and energy increase non-linearly, ending in a system-sized catastrophic failure event. Accelerating rates of geophysical signals (e.g., seismicity and deformation) preceding large-scale dynamic failure can serve as proxies for damage accumulation in the Failure Forecast Method (FFM). Here we test the hypothesis that the style and mechanisms of deformation, and the accuracy of the FFM, are both tightly controlled by the degree of microstructural heterogeneity of the material under stress. We generate a suite of synthetic samples with variable heterogeneity, controlled by the gas volume fraction. We experimentally demonstrate that the accuracy of failure prediction increases drastically with the degree of material heterogeneity. These results have significant implications in a broad range of material-based disciplines for which failure forecasting is of central importance. In particular, the FFM has been used with only variable success to forecast failure scenarios both in the field (volcanic eruptions and landslides) and in the laboratory (rock and magma failure). Our results show that this variability may be explained, and the reliability and accuracy of forecast quantified significantly improved, by accounting for material heterogeneity as a first-order control on forecasting power. PMID:26307196

  12. Heterogeneity: The key to failure forecasting

    PubMed Central

    Vasseur, Jérémie; Wadsworth, Fabian B.; Lavallée, Yan; Bell, Andrew F.; Main, Ian G.; Dingwell, Donald B.

    2015-01-01

    Elastic waves are generated when brittle materials are subjected to increasing strain. Their number and energy increase non-linearly, ending in a system-sized catastrophic failure event. Accelerating rates of geophysical signals (e.g., seismicity and deformation) preceding large-scale dynamic failure can serve as proxies for damage accumulation in the Failure Forecast Method (FFM). Here we test the hypothesis that the style and mechanisms of deformation, and the accuracy of the FFM, are both tightly controlled by the degree of microstructural heterogeneity of the material under stress. We generate a suite of synthetic samples with variable heterogeneity, controlled by the gas volume fraction. We experimentally demonstrate that the accuracy of failure prediction increases drastically with the degree of material heterogeneity. These results have significant implications in a broad range of material-based disciplines for which failure forecasting is of central importance. In particular, the FFM has been used with only variable success to forecast failure scenarios both in the field (volcanic eruptions and landslides) and in the laboratory (rock and magma failure). Our results show that this variability may be explained, and the reliability and accuracy of forecast quantified significantly improved, by accounting for material heterogeneity as a first-order control on forecasting power. PMID:26307196

  13. Diffusion and Surface Reaction in Heterogeneous Catalysis

    ERIC Educational Resources Information Center

    Baiker, A.; Richarz, W.

    1978-01-01

    Ethylene hydrogenation on a platinum catalyst, electrolytically applied to a tube wall, is a good system for the study of the interactions between diffusion and surface reaction in heterogeneous catalysis. Theoretical background, apparatus, procedure, and student performance of this experiment are discussed. (BB)

  14. Scale Reliability Evaluation with Heterogeneous Populations

    ERIC Educational Resources Information Center

    Raykov, Tenko; Marcoulides, George A.

    2015-01-01

    A latent variable modeling approach for scale reliability evaluation in heterogeneous populations is discussed. The method can be used for point and interval estimation of reliability of multicomponent measuring instruments in populations representing mixtures of an unknown number of latent classes or subpopulations. The procedure is helpful also…

  15. Heterogeneous photocatalytic oxidation of atmospheric trace contaminants

    NASA Technical Reports Server (NTRS)

    Ollis, David F.

    1993-01-01

    The progress report on heterogeneous photocatalytic oxidation of atmospheric trace contaminants covering the period from 1 May - 31 Oct. 1992 is presented. The two topics discussed are photoreactor monolith fundamental studies and monolith reactor operation: batch recirculation system. Concentration profiles are shown.

  16. Burning Fat Fuels Leukemic Stem Cell Heterogeneity.

    PubMed

    Thomas, Daniel; Majeti, Ravindra

    2016-07-01

    Obese leukemia patients exhibit reduced survival after chemotherapy, suggesting an important role of adipose tissue in disease progression. In this issue of Cell Stem Cell, Ye et al. (2016) reveal metabolic heterogeneity in leukemic stem cell (LSC) subpopulations and show that chemotherapy-resistant CD36+ LSCs co-opt gonadal adipose tissue to support their metabolism and survival. PMID:27392217

  17. Electron beam sterilisation of heterogeneous medical devices

    NASA Astrophysics Data System (ADS)

    Sadat, T.; Morisseau, MrD.; Ross, MissA.

    1993-07-01

    Electron beam radiation is used in the sterilisation of medical disposable devices. High energy, 10 MeV, electron beam linear accelerators are in use worldwide for this purpose. The dose distribution achieved in the products treated influences the efficiency of treatment. This paper looks at the dose distribution achieved with such machines and the methods used to define it in heterogeneous products.

  18. Mapping the Structure of Heterogeneous Materials

    NASA Technical Reports Server (NTRS)

    Strand, L. D.; Cohen, N. S.; Hernan, M. A.

    1986-01-01

    Image-processing microdensitometer/Fourier analyzer yields statistics of subcomponent distribution. Nondestructive method for studying structure heterogeneous materials uses energy-dispersive X-ray analysis in scanning electron microscope. Scanning microdensitometer/Fourier analyzer (SMFA) is applied to SEM images to obtain statistics about sample structure. Method originally developed for studying effect on combustion of fine structure of composite solid propellants.

  19. Sampling designs for heterogeneous snow distributions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Intensive snow surveys of mountain basins are the most accurate means of characterizing the heterogeneous mosaic of snow distribution typically present. The collection of survey data is however costly and time-consuming and important decisions are required to adequately sample larger basins. In this...

  20. Accelerating Mathematics Achievement Using Heterogeneous Grouping

    ERIC Educational Resources Information Center

    Burris, Carol Corbett; Heubert, Jay P.; Levin, Henry M.

    2006-01-01

    This longitudinal study examined the effects of providing an accelerated mathematics curriculum in heterogeneously grouped middle school classes in a diverse suburban school district. A quasi-experimental cohort design was used to evaluate subsequent completion of advanced high school math courses as well as academic achievement. Results showed…

  1. Phenotypic heterogeneity of Streptococcus mutans in dentin.

    PubMed

    Rupf, S; Hannig, M; Breitung, K; Schellenberger, W; Eschrich, K; Remmerbach, T; Kneist, S

    2008-12-01

    Information concerning phenotypic heterogeneity of Streptococcus mutans in carious dentin is sparse. Matrix-assisted laser-desorption/ionization-time-of-flight mass-spectrometry (MALDI-TOF-MS) facilitates the phenotypic differentiation of bacteria to the subspecies level. To verify a supposed influence of restorative treatment on the phenotypic heterogeneity of S. mutans, we isolated and compared a total of 222 S. mutans strains from dentin samples of 21 human deciduous molars during caries excavation (T(1)) and 8 wks (T(2)) after removal of the temporary restoration. Phenotypic heterogeneity was determined by MALDI-TOF-MS and hierarchical clustering. Thirty-six distinct S. mutans phenotypes could be identified. Although indistinguishable phenotypes were found in the same teeth at T(1) and T(2), as well as in different teeth of individual participants, the phenotypic heterogeneity increased significantly, from 1.4 phenotypes per S. mutans-positive dentin sample at T(1) to 2.2 phenotypes at T(2). We attribute this to an adaptation of S. mutans to the modified environment under the restoration following caries excavation. PMID:19029088

  2. Multilingual Federated Searching Across Heterogeneous Collections.

    ERIC Educational Resources Information Center

    Powell, James; Fox, Edward A.

    1998-01-01

    Describes a scalable system for searching heterogeneous multilingual collections on the World Wide Web. Details Searchable Database Markup Language (SearchDB-ML) for describing the characteristics of a search engine and its interface, and a protocol for requesting word translations between languages. (Author)

  3. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  4. Heterogeneity of FFA responses or multiplexing?

    PubMed Central

    Ross, David A.; McGugin, Rankin W.; Gauthier, Isabel

    2014-01-01

    Recent work using cluster analysis of brain activity during movies revealed distinct clusters that respond to faces and different non-face categories in the fusiform face area (FFA). Because of the limited heterogeneity observed, these results could mean that FFA contains one population of cells capable of representing multiple categories. PMID:24360882

  5. Forecasting the failure of heterogeneous magmas

    NASA Astrophysics Data System (ADS)

    Vasseur, J.; Wadsworth, F. B.; Lavallée, Y.; Bell, A. F.; Main, I. G.; Dingwell, D. B.

    2015-12-01

    Eruption prediction is a long-sought-after goal of volcanology. Yet applying existing techniques retrospectively (hindcasting), we fail to predict events more often than we success. As much of the seismicity associated with intermediate to silicic volcanic eruptions comes from the brittle response of the ascending magma itself, we clearly require a good understanding of the parameters that control the ability to forecast magma failure itself. Here, we present suites of controlled experiments at magmatic temperatures using a range of synthetic magmas to investigate the control of microstructures on the efficacy of forecast models for material failure. We find that the failure of magmas with very little microstructural heterogeneity - such as melts - is very challenging to predict; whereas, the failure of very heterogeneous magmas is always well-predicted. To shed further light on this issue, we provide a scaling law based on the relationship between the microstructural heterogeneity in a magma and the error in the prediction of its failure time. We propose this method be used to elucidate the variable success rate of predicting volcanic predictions. We discuss this scaling in the context of the birth, life and death of structural heterogeneity during magma ascent with specific emphasis on obsidian-forming eruptions such as Chaitèn, 2008. During such eruptions, the repetitive creation and destruction of fractures filled with granular magma, which are thought to be the in situ remnants of seismogenic fracturing itself, are expressions of the life-cycle of heterogeneity in an otherwise coherent, melt-rich magma. We conclude that the next generation of failure forecast tools available to monitoring teams should incorporate some acknowledgment of the magma microstructure and not be solely based on the geophysical signals prior to eruption.

  6. Characterization of oil and gas reservoir heterogeneity

    SciTech Connect

    Tyler, N.; Barton, M.D.; Bebout, D.G.; Fisher, R.S.; Grigsby, J.D.; Guevara, E.; Holtz, M.; Kerans, C.; Nance, H.S.; Levey, R.A.

    1992-10-01

    Research described In this report addresses the internal architecture of two specific reservoir types: restricted-platform carbonates and fluvial-deltaic sandstones. Together, these two reservoir types contain more than two-thirds of the unrecovered mobile oil remaining ill Texas. The approach followed in this study was to develop a strong understanding of the styles of heterogeneity of these reservoir types based on a detailed outcrop description and a translation of these findings into optimized recovery strategies in select subsurface analogs. Research targeted Grayburg Formation restricted-platform carbonate outcrops along the Algerita Escarpment and In Stone Canyon In southeastern New Mexico and Ferron deltaic sandstones in central Utah as analogs for the North Foster (Grayburg) and Lake Creek (Wilcox) units, respectively. In both settings, sequence-stratigraphic style profoundly influenced between-well architectural fabric and permeability structure. It is concluded that reservoirs of different depositional origins can therefore be categorized Into a heterogeneity matrix'' based on varying intensity of vertical and lateral heterogeneity. The utility of the matrix is that it allows prediction of the nature and location of remaining mobile oil. Highly stratified reservoirs such as the Grayburg, for example, will contain a large proportion of vertically bypassed oil; thus, an appropriate recovery strategy will be waterflood optimization and profile modification. Laterally heterogeneous reservoirs such as deltaic distributary systems would benefit from targeted infill drilling (possibly with horizontal wells) and improved areal sweep efficiency. Potential for advanced recovery of remaining mobile oil through heterogeneity-based advanced secondary recovery strategies In Texas is projected to be an Incremental 16 Bbbl. In the Lower 48 States this target may be as much as 45 Bbbl at low to moderate oil prices over the near- to mid-term.

  7. Numerical Model Sensitivity to Heterogeneous Satellite Derived Vegetation Roughness

    NASA Technical Reports Server (NTRS)

    Jasinski, Michael; Eastman, Joseph; Borak, Jordan

    2011-01-01

    The sensitivity of a mesoscale weather prediction model to a 1 km satellite-based vegetation roughness initialization is investigated for a domain within the south central United States. Three different roughness databases are employed: i) a control or standard lookup table roughness that is a function only of land cover type, ii) a spatially heterogeneous roughness database, specific to the domain, that was previously derived using a physically based procedure and Moderate Resolution Imaging Spectroradiometer (MODIS) imagery, and iii) a MODIS climatologic roughness database that like (i) is a function only of land cover type, but possesses domain specific mean values from (ii). The model used is the Weather Research and Forecast Model (WRF) coupled to the Community Land Model within the Land Information System (LIS). For each simulation, a statistical comparison is made between modeled results and ground observations within a domain including Oklahoma, Eastern Arkansas, and Northwest Louisiana during a 4-day period within IHOP 2002. Sensitivity analysis compares the impact the three roughness initializations on time-series temperature, precipitation probability of detection (POD), average wind speed, boundary layer height, and turbulent kinetic energy (TKE). Overall, the results indicate that, for the current investigation, replacement of the standard look-up table values with the satellite-derived values statistically improves model performance for most observed variables. Such natural roughness heterogeneity enhances the surface wind speed, PBL height and TKE production up to 10 percent, with a lesser effect over grassland, and greater effect over mixed land cover domains.

  8. Nuclear Scans

    MedlinePlus

    Nuclear scans use radioactive substances to see structures and functions inside your body. They use a special ... images. Most scans take 20 to 45 minutes. Nuclear scans can help doctors diagnose many conditions, including ...

  9. Nuclear Chemistry.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1979

    1979-01-01

    Provides a brief review of the latest developments in nuclear chemistry. Nuclear research today is directed toward increased activity in radiopharmaceuticals and formation of new isotopes by high-energy, heavy-ion collisions. (Author/BB)

  10. Nuclear Winter.

    ERIC Educational Resources Information Center

    Ehrlich, Anne

    1984-01-01

    "Nuclear Winter" was recently coined to describe the climatic and biological effects of a nuclear war. These effects are discussed based on models, simulations, scenarios, and projections. Effects on human populations are also considered. (JN)

  11. Plasma filtering techniques for nuclear waste remediation

    DOE PAGESBeta

    Gueroult, Renaud; Hobbs, David T.; Fisch, Nathaniel J.

    2015-04-24

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. As a result, this advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste.

  12. Plasma filtering techniques for nuclear waste remediation.

    PubMed

    Gueroult, Renaud; Hobbs, David T; Fisch, Nathaniel J

    2015-10-30

    Nuclear waste cleanup is challenged by the handling of feed stocks that are both unknown and complex. Plasma filtering, operating on dissociated elements, offers advantages over chemical methods in processing such wastes. The costs incurred by plasma mass filtering for nuclear waste pretreatment, before ultimate disposal, are similar to those for chemical pretreatment. However, significant savings might be achieved in minimizing the waste mass. This advantage may be realized over a large range of chemical waste compositions, thereby addressing the heterogeneity of legacy nuclear waste. PMID:25956646

  13. Scaling the heterogeneously heated convective boundary layer

    NASA Astrophysics Data System (ADS)

    Van Heerwaarden, C.; Mellado, J.; De Lozar, A.

    2013-12-01

    We have studied the heterogeneously heated convective boundary layer (CBL) by means of large-eddy simulations (LES) and direct numerical simulations (DNS). What makes our study different from previous studies on this subject are our very long simulations in which the system travels through multiple states and that from there we have derived scaling laws. In our setup, a stratified atmosphere is heated from below by square patches with a high surface buoyancy flux, surrounded by regions with no or little flux. By letting a boundary layer grow in time we let the system evolve from the so-called meso-scale to the micro-scale regime. In the former the heterogeneity is large and strong circulations can develop, while in the latter the heterogeneity is small and does no longer influence the boundary layer structure. Within each simulation we can now observe the formation of a peak in kinetic energy, which represents the 'optimal' heterogeneity size in the meso-scale, and the subsequent decay of the peak and the development towards the transition to the micro-scale. We have created a non-dimensional parameter space that describes all properties of this system. By studying the previously described evolution for different combinations of parameters, we have derived three important conclusions. First, there exists a horizontal length scale of the heterogeneity (L) that is a function of the boundary layer height (h) and the Richardson (Ri) number of the inversion at the top of the boundary layer. This relationship has the form L = h Ri^(3/8). Second, this horizontal length scale L allows for expressing the time evolution, and thus the state of the system, as a ratio of this length scale and the distance between two patches Xp. This ratio thus describes to which extent the circulation fills up the space that exists between two patch centers. The timings of the transition from the meso- to the micro-scale collapse under this scaling for all simulations sharing the same flux

  14. Nuclear Fuels.

    ERIC Educational Resources Information Center

    Nash, J. Thomas

    1983-01-01

    Trends in and factors related to the nuclear industry and nuclear fuel production are discussed. Topics addressed include nuclear reactors, survival of the U.S. uranium industry, production costs, budget cuts by the Department of Energy and U.S. Geological survey for resource studies, mining, and research/development activities. (JN)

  15. Nuclear weapons, nuclear effects, nuclear war

    SciTech Connect

    Bing, G.F.

    1991-08-20

    This paper provides a brief and mostly non-technical description of the militarily important features of nuclear weapons, of the physical phenomena associated with individual explosions, and of the expected or possible results of the use of many weapons in a nuclear war. Most emphasis is on the effects of so-called ``strategic exchanges.``

  16. Induction of cytochromes P450 1A1 and 1A2 by tanshinones in human HepG2 hepatoma cell line

    SciTech Connect

    Zhang Rong; Sun Jianguo; Ma Liping; Wu Xiaolan; Pan Guoyu; Hao Haiping; Zhou Fang; Jiye, A; Liu Changhui; Ai Hua; Shang Lili; Gao Haiyan; Peng Ying; Wan Ping; Wu Hui; Wang Guangji

    2011-04-01

    Diterpenoid tanshinones including tanshinone IIA (TIIA), cryptotanshinone (CTS), tanshinone I (TI) and dihydrotanshinone I (DHTI) are the major bioactive components from Danshen. The major aim of our present study was to investigate the induction potential of these four main components of tanshinones (TIIA, CTS, TI, and DHTI) on the expression of CYP1A1 and CYP1A2 in HepG2 cells. Our results showed that all of these four tanshinones caused a significant time- and concentration-dependent increase in the amount of CYP1A1/2 expression in HepG2 cells. These induction effects were further characterized through transcriptional regulation: the induction of CYP1A1/2 mRNA level by tanshinones was completely blocked by the transcription inhibitor actinomycin D; the expression of CYP1A1/2 heterogeneous nuclear RNA was induced by tanshinone treatment; and CYP1A1 mRNA stability was not influenced by these tanshinones. Interestingly, tanshinones plus B[a]P produced additive/synergistic effect on CYP1A1/2 induction. In addition, the tanshinone-induced CYP1A1/2 expression was abolished by the aryl hydrocarbon receptor (AhR) antagonist resveratrol, suggesting an AhR dependent transcription mechanism. In the reporter gene assay, while TI and DHTI significantly induced AhR-dependent luciferase activity, TIIA and CTS failed to induce this activity. Collectively, the tanshinones could induce CYP1A1 and CYP1A2 expression through transcriptional activation mechanism and exert differential effects on activating AhR in HepG2 cells. Our findings suggest that rational administration of tanshinones should be considered with respect to their effect on AhR and CYP1A1/2 expression.

  17. MICROSITE AND HERBACEOUS VEGETATION HETEROGENEITY AFTER BURNING ARTEMISIA TRIDENTATA STEPPE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Woody vegetation can create distinct subcanopy and interspace microsites, which often results in resource islands in subcanopies compared to interspaces. This heterogeneity in soil resources contributes to herbaceous vegetation heterogeneity in plant communities. However, information detailing the...

  18. Heterogeneity and the genetics of autism.

    PubMed Central

    Szatmari, P

    1999-01-01

    The objective of this review is to summarize recent data on the genetics of autism, highlight the evidence for genetic heterogeneity and extend the implications of these findings for the identification of susceptibility genes in this disorder. Family studies have shown that autism runs in families and twin studies indicate that the basis of that familial aggregation is genetic. As a result the prospects for the identification of susceptibility genes using either linkage or association studies are quite good. However, recent evidence is accumulating suggesting that the disorder is genetically heterogeneous; higher functioning individuals with autism may arise from separate genetic mechanisms that lower functioning ones. If true, this will make the detection of linkage and association much more difficult. PMID:10212560

  19. Dedicated heterogeneous node scheduling including backfill scheduling

    DOEpatents

    Wood, Robert R.; Eckert, Philip D.; Hommes, Gregg

    2006-07-25

    A method and system for job backfill scheduling dedicated heterogeneous nodes in a multi-node computing environment. Heterogeneous nodes are grouped into homogeneous node sub-pools. For each sub-pool, a free node schedule (FNS) is created so that the number of to chart the free nodes over time. For each prioritized job, using the FNS of sub-pools having nodes useable by a particular job, to determine the earliest time range (ETR) capable of running the job. Once determined for a particular job, scheduling the job to run in that ETR. If the ETR determined for a lower priority job (LPJ) has a start time earlier than a higher priority job (HPJ), then the LPJ is scheduled in that ETR if it would not disturb the anticipated start times of any HPJ previously scheduled for a future time. Thus, efficient utilization and throughput of such computing environments may be increased by utilizing resources otherwise remaining idle.

  20. Deciphering intratumor heterogeneity using cancer genome analysis.

    PubMed

    Ryu, Daeun; Joung, Je-Gun; Kim, Nayoung K D; Kim, Kyu-Tae; Park, Woong-Yang

    2016-06-01

    Intratumor heterogeneity within individual cancer tissues underlies the numerous phenotypes of cancer. Tumor subclones ultimately affect therapeutic outcomes due to their distinct molecular features. Drug-resistant subclones are present at a low frequency in tissues at the time of biopsy, but can also arise as a result of acquired somatic mutations. A number of different approaches have been utilized to understand the nature of intratumor heterogeneity. Clonal analysis using whole exome or genome sequencing data can help monitor subclones in the context of tumor progression. Multiregional biopsies permit the molecular characterization of subclones within tumors. Deep sequencing has also provided researchers with the ability to measure the low allele fraction variant within a small number of cells. Ultimately, single-cell sequencing will enable the identification of every minor population within a tumor microenvironment. In the clinical context, the ability to identify and monitor the subclonal architecture of a tumor is valuable for the development of precise cancer therapeutic methods. PMID:27126234

  1. Modeling heterogeneous polymer-grafted nanoparticle networks

    NASA Astrophysics Data System (ADS)

    Zhang, Tao; Mbanga, Badel; Yashin, Victor; Balazs, Anna

    Via a dynamic 3D computational approach, we simulate the heterogeneous polymer-grafted nanoparticle networks. The nanoparticles rigid cores are decorated with a corona of grafted polymers, which contain reactive functional groups at the chain ends. With the overlap of grafted polymers, these reactive groups can form weak labile bonds, which can reform after breakage, or stronger bonds, which rupture irreversibly and thus, the nanoparticles are interconnected by dual cross-links. Previous work has been done on homogeneous networks, while we introduce the heterogeneity by considering two types of particles having different reactive functional groups, so that the labile bond energy varies depending on types of the two end reactive groups. We study the effect of tensile and rotational deformations on the network morphology, and observe, in particular, the phase separation of two types of particles. Our results will provide guidelines for designing transformable material that can controllably change structure under mechanical action.

  2. Blind and myopic ants in heterogeneous networks.

    PubMed

    Hwang, S; Lee, D-S; Kahng, B

    2014-11-01

    The diffusion processes on complex networks may be described by different Laplacian matrices due to heterogeneous connectivity. Here we investigate the random walks of blind ants and myopic ants on heterogeneous networks: While a myopic ant hops to a neighbor node every step, a blind ant may stay or hop with probabilities that depend on node connectivity. By analyzing the trajectories of blind ants, we show that the asymptotic behaviors of both random walks are related by rescaling time and probability with node connectivity. Using this result, we show how the small eigenvalues of the Laplacian matrices generating the two random walks are related. As an application, we show how the return-to-origin probability of a myopic ant can be used to compute the scaling behaviors of the Edwards-Wilkinson model, a representative model of load balancing on networks. PMID:25493841

  3. Blind and myopic ants in heterogeneous networks

    NASA Astrophysics Data System (ADS)

    Hwang, S.; Lee, D.-S.; Kahng, B.

    2014-11-01

    The diffusion processes on complex networks may be described by different Laplacian matrices due to heterogeneous connectivity. Here we investigate the random walks of blind ants and myopic ants on heterogeneous networks: While a myopic ant hops to a neighbor node every step, a blind ant may stay or hop with probabilities that depend on node connectivity. By analyzing the trajectories of blind ants, we show that the asymptotic behaviors of both random walks are related by rescaling time and probability with node connectivity. Using this result, we show how the small eigenvalues of the Laplacian matrices generating the two random walks are related. As an application, we show how the return-to-origin probability of a myopic ant can be used to compute the scaling behaviors of the Edwards-Wilkinson model, a representative model of load balancing on networks.

  4. Simple model to study heterogeneous electrocatalysts

    NASA Astrophysics Data System (ADS)

    Franco-Junior, Edison; Lopes, Ana Carolina G.; Suffredini, Hugo B.; Homem-de-Mello, Paula

    2015-01-01

    New electrocatalyst materials have been proposed to increase the performance of fuel cells. Experimental studies show that Pt and Pb metallic and oxide materials are quite efficient in the oxidation of alcohols and small organic molecules such as formic acid in advanced fuel cells. This work proposes a model for studying morphologically heterogeneous catalysts through quantum chemistry methods such as density functional calculations. For testing the model, we have experimentally studied the adsorption of small organic molecules, namely formic acid and methanol, on Pt and Pb electrodes. All methodologies we have tested can be employed for this kind of study, but M06 functional results correlate best with previous simulations of homogeneous catalysts and with experimental data obtained for homogeneous and heterogeneous electrodes. Our model indicates that the presence of a Pt-Pb interface is responsible for higher adsorption energies of these molecules, most likely due to the orientation of the organic molecules that should facilitate the oxidation process.

  5. Population dynamics on heterogeneous bacterial substrates

    NASA Astrophysics Data System (ADS)

    Mobius, Wolfram; Murray, Andrew W.; Nelson, David R.

    2012-02-01

    How species invade new territories and how these range expansions influence the population's genotypes are important questions in the field of population genetics. The majority of work addressing these questions focuses on homogeneous environments. Much less is known about the population dynamics and population genetics when the environmental conditions are heterogeneous in space. To better understand range expansions in two-dimensional heterogeneous environments, we employ a system of bacteria and bacteriophage, the viruses of bacteria. Thereby, the bacteria constitute the environment in which a population of bacteriophages expands. The spread of phage constitutes itself in lysis of bacteria and thus formation of clear regions on bacterial lawns, called plaques. We study the population dynamics and genetics of the expanding page for various patterns of environments.

  6. Heterogeneous concurrent computing with exportable services

    NASA Technical Reports Server (NTRS)

    Sunderam, Vaidy

    1995-01-01

    Heterogeneous concurrent computing, based on the traditional process-oriented model, is approaching its functionality and performance limits. An alternative paradigm, based on the concept of services, supporting data driven computation, and built on a lightweight process infrastructure, is proposed to enhance the functional capabilities and the operational efficiency of heterogeneous network-based concurrent computing. TPVM is an experimental prototype system supporting exportable services, thread-based computation, and remote memory operations that is built as an extension of and an enhancement to the PVM concurrent computing system. TPVM offers a significantly different computing paradigm for network-based computing, while maintaining a close resemblance to the conventional PVM model in the interest of compatibility and ease of transition Preliminary experiences have demonstrated that the TPVM framework presents a natural yet powerful concurrent programming interface, while being capable of delivering performance improvements of upto thirty percent.

  7. Modeling vaccination in a heterogeneous metapopulation system

    NASA Astrophysics Data System (ADS)

    Lachiany, Menachem

    2016-09-01

    We present here a multicity SIS epidemic model with vaccination. The model describes the dynamics of heterogeneous metapopulations that contain imperfectly vaccinated individuals. The effect of vaccination on heterogeneous multicity models has not been previously studied. We show that under very generic conditions, the epidemic threshold does not depend on the diffusion coefficient of the vaccinated individuals, but it does depend on the diffusion coefficient of the infected population. We then show, using a novel methodology, that the reproduction number is determined by the homogeneous model parameters and by the maximal number of neighbors a city can have, when the diffusion coefficient of the infected population is low. Finally, we present numerical simulations to support the analytical results.

  8. Beyond relationships between homogeneous and heterogeneous catalysis

    SciTech Connect

    Dixon, David A.; Katz, Alexander; Arslan, Ilke; Gates, Bruce C.

    2014-08-13

    Scientists who regard catalysis as a coherent field have been striving for decades to articulate the fundamental unifying principles. But because these principles seem to be broader than chemistry, chemical engineering, and materials science combined, catalytic scientists commonly interact within the sub-domains of homogeneous, heterogeneous, and bio-catalysis, and increasingly within even narrower domains such as organocatalysis, phase-transfer catalysis, acid-base catalysis, zeolite catalysis, etc. Attempts to unify catalysis have motivated researchers to find relationships between homogeneous and heterogeneous catalysis and to mimic enzymes. These themes have inspired vibrant international meetings and workshops, and we have benefited from the idea exchanges and have some thoughts about a path forward.

  9. Microgrids and Heterogeneous Power Quality and Reliability

    SciTech Connect

    LaCommare, Kristina; Marnay, Chris

    2007-10-01

    This paper describes two stylized alternative visions of how the power system might evolve to meet future requirements for the high quality electricity service that modern digital economies demand, a supergrids paradigm and a dispersed paradigm. Some of the economics of the dispersed vision are explored, and perspectives are presented on both the choice of homogeneous universal power quality upstream in the electricity supply chain and on the extremely heterogeneous requirements of end-use loads. It is argued that meeting the demanding requirements of sensitive loads by local provision of high quality power may be more cost effective than increasing the quality of universal homogeneous supply upstream in the legacy grid. Finally, the potential role of microgrids in delivering heterogeneous power quality is demonstrated by reference to two ongoing microgrid tests in the U.S. and Japan.

  10. Heterogeneous chemistry of HBr and HF

    SciTech Connect

    Hanson, D.R.; Ravishankara, A.R.

    1992-11-12

    The authors present information on heterogeneous chemistry of HF and HBr on glass and ice surfaces at a temperature of 200K. Their objective is to study whether heterogeneous reactions of these species could be important in the atmospheric chemistry occuring on NAT particles or cloud condensation nuclei, and be a contributor to ozone depletion. HF showed no significant uptake or reactions with ClONO{sub 2} or HOCl. HBr was found to adsorb on these surfaces, and did not exhibit saturation for even relative high concentrations. In addition it showed reactivity with ClONO{sub 2}, Cl{sub 2} and N{sub 2}O{sub 5} on ice surfaces.

  11. Maintaining robust connectivity in heterogeneous robotic networks

    NASA Astrophysics Data System (ADS)

    Cruz, P.; Fierro, R.; Lu, W.; Ferrari, S.

    2013-05-01

    In this paper, we are interested in exploiting the heterogeneity of a robotic network made of ground and aerial agents to sense multiple targets in a cluttered environment. Maintaining wireless communication on this type of networks is fundamentally important specially for cooperative purposes. The proposed heterogeneous network consists of ground sensors, e.g., OctoRoACHes, and aerial routers, e.g., quadrotors. Adaptive potential field methods are used to coordinate the ground mobile sensors. Moreover, a reward function for the aerial mobile wireless routers is formulated to guarantee communication coverage among the ground sensors and a fixed base station. A sub-optimal controller is proposed based on an approximate control policy iteration technique. Simulation results of a case study are presented to illustrate the proposed methodology.

  12. Fluorescence lifetime measurements in heterogeneous scattering medium

    NASA Astrophysics Data System (ADS)

    Nishimura, Goro; Awasthi, Kamlesh; Furukawa, Daisuke

    2016-07-01

    Fluorescence lifetime in heterogeneous multiple light scattering systems is analyzed by an algorithm without solving the diffusion or radiative transfer equations. The algorithm assumes that the optical properties of medium are constant in the excitation and emission wavelength regions. If the assumption is correct and the fluorophore is a single species, the fluorescence lifetime can be determined by a set of measurements of temporal point-spread function of the excitation light and fluorescence at two different concentrations of the fluorophore. This method is not dependent on the heterogeneity of the optical properties of the medium as well as the geometry of the excitation-detection on an arbitrary shape of the sample. The algorithm was validated by an indocyanine green fluorescence in phantom measurements and demonstrated by an in vivo measurement.

  13. Satellite Cell Heterogeneity in Skeletal Muscle Homeostasis.

    PubMed

    Tierney, Matthew T; Sacco, Alessandra

    2016-06-01

    The cellular turnover required for skeletal muscle maintenance and repair is mediated by resident stem cells, also termed satellite cells. Satellite cells normally reside in a quiescent state, intermittently entering the cell cycle to fuse with neighboring myofibers and replenish the stem cell pool. However, the mechanisms by which satellite cells maintain the precise balance between self-renewal and differentiation necessary for long-term homeostasis remain unclear. Recent work has supported a previously unappreciated heterogeneity in the satellite cell compartment that may underlie the observed variability in cell fate and function. In this review, we examine the work supporting this notion as well as the potential governing principles, developmental origins, and principal determinants of satellite cell heterogeneity. PMID:26948993

  14. Heterogeneous distribution of metabolites across plant species

    NASA Astrophysics Data System (ADS)

    Takemoto, Kazuhiro; Arita, Masanori

    2009-07-01

    We investigate the distribution of flavonoids, a major category of plant secondary metabolites, across species. Flavonoids are known to show high species specificity, and were once considered as chemical markers for understanding adaptive evolution and characterization of living organisms. We investigate the distribution among species using bipartite networks, and find that two heterogeneous distributions are conserved among several families: the power-law distributions of the number of flavonoids in a species and the number of shared species of a particular flavonoid. In order to explain the possible origin of the heterogeneity, we propose a simple model with, essentially, a single parameter. As a result, we show that two respective power-law statistics emerge from simple evolutionary mechanisms based on a multiplicative process. These findings provide insights into the evolution of metabolite diversity and characterization of living organisms that defy genome sequence analysis for different reasons.

  15. Psoriatic arthritis: embracing pathogenetic and clinical heterogeneity?

    PubMed

    McInnes, Iain B

    2016-01-01

    Psoriatic arthritis (PsA) is a clinically heterogeneous condition of skin, joint, enthesis and bone that provides considerable unmet therapeutic need. Recent treatment advances have offered new opportunities to improve quality of life and long term well being for afflicted patients. It is timely therefore, to consider the underlying heterogeneity inherent in the disease from a pathologic aspect so as to best optimise the choice and order of therapeutic application over time. Herein I will discuss the various contributions made by immune pathways to discrete tissue compartments that in turn might allow a more targeted approach to the management of PsA in which different tissues express variable severity of involvement. PMID:27586796

  16. Sparse covariance estimation in heterogeneous samples*

    PubMed Central

    Rodríguez, Abel; Lenkoski, Alex; Dobra, Adrian

    2015-01-01

    Standard Gaussian graphical models implicitly assume that the conditional independence among variables is common to all observations in the sample. However, in practice, observations are usually collected from heterogeneous populations where such an assumption is not satisfied, leading in turn to nonlinear relationships among variables. To address such situations we explore mixtures of Gaussian graphical models; in particular, we consider both infinite mixtures and infinite hidden Markov models where the emission distributions correspond to Gaussian graphical models. Such models allow us to divide a heterogeneous population into homogenous groups, with each cluster having its own conditional independence structure. As an illustration, we study the trends in foreign exchange rate fluctuations in the pre-Euro era. PMID:26925189

  17. Heterogeneous propellant internal ballistics: criticism and regeneration

    NASA Astrophysics Data System (ADS)

    Glick, R. L.

    2011-10-01

    Although heterogeneous propellant and its innately nondeterministic, chemically discrete morphology dominates applications, ballisticcharacterization deterministic time-mean burning rate and acoustic admittance measures' absence of explicit, nondeterministic information requires homogeneous propellant with a smooth, uniformly regressing burning surface: inadequate boundary conditions for heterogeneous propellant grained applications. The past age overcame this dichotomy with one-dimensional (1D) models and empirical knowledge from numerous, adequately supported motor developments and supplementary experiments. However, current cost and risk constraints inhibit this approach. Moreover, its fundamental science approach is more sensitive to incomplete boundary condition information (garbage-in still equals garbage-out) and more is expected. This work critiques this situation and sketches a path forward based on enhanced ballistic and motor characterizations in the workplace and approximate model and apparatus developments mentored by CSAR DNS capabilities (or equivalent).

  18. Heterogeneous differential evolution for numerical optimization.

    PubMed

    Wang, Hui; Wang, Wenjun; Cui, Zhihua; Sun, Hui; Rahnamayan, Shahryar

    2014-01-01

    Differential evolution (DE) is a population-based stochastic search algorithm which has shown a good performance in solving many benchmarks and real-world optimization problems. Individuals in the standard DE, and most of its modifications, exhibit the same search characteristics because of the use of the same DE scheme. This paper proposes a simple and effective heterogeneous DE (HDE) to balance exploration and exploitation. In HDE, individuals are allowed to follow different search behaviors randomly selected from a DE scheme pool. Experiments are conducted on a comprehensive set of benchmark functions, including classical problems and shifted large-scale problems. The results show that heterogeneous DE achieves promising performance on a majority of the test problems. PMID:24683329

  19. Heterogeneously-Catalyzed Conversion of Carbohydrates

    NASA Astrophysics Data System (ADS)

    Vigier, Karine De Oliveira; Jérôme, François

    Polyfunctionality of carbohydrates and their low solubility in conventional organic solvents make rather complex their conversion to higher value added chemicals. Therefore, innovative processes are now strongly needed in order to increase the selectivity of these reactions. Here, we report an overview of the different heterogeneously-catalyzed processes described in the literature. In particular, hydrolysis, dehydration, oxidation, esterification, and etherification of carbohydrates are presented. We shall discuss the main structural parameters that need to be controlled and that permit the conversion of carbohydrates to bioproducts with good selectivity. The conversion of monosaccharides and disaccharides over solid catalysts, as well as recent advances in the heterogeneously-catalyzed conversion of cellulose, will be presented.

  20. Multiparametric imaging with heterogeneous radiofrequency fields

    PubMed Central

    Cloos, Martijn A.; Knoll, Florian; Zhao, Tiejun; Block, Kai T.; Bruno, Mary; Wiggins, Graham C.; Sodickson, Daniel K.

    2016-01-01

    Magnetic resonance imaging (MRI) has become an unrivalled medical diagnostic technique able to map tissue anatomy and physiology non-invasively. MRI measurements are meticulously engineered to control experimental conditions across the sample. However, residual radiofrequency (RF) field inhomogeneities are often unavoidable, leading to artefacts that degrade the diagnostic and scientific value of the images. Here we show that, paradoxically, these artefacts can be eliminated by deliberately interweaving freely varying heterogeneous RF fields into a magnetic resonance fingerprinting data-acquisition process. Observations made based on simulations are experimentally confirmed at 7 Tesla (T), and the clinical implications of this new paradigm are illustrated with in vivo measurements near an orthopaedic implant at 3T. These results show that it is possible to perform quantitative multiparametric imaging with heterogeneous RF fields, and to liberate MRI from the traditional struggle for control over the RF field uniformity. PMID:27526996

  1. Micromechanical modeling of heterogeneous energetic materials

    SciTech Connect

    Baer, M.R.; Kipp, M.E.; Swol, F. van

    1998-09-01

    In this work, the mesoscale processes of consolidation, deformation and reaction of shocked porous energetic materials are studied using shock physics analysis of impact on a collection of discrete HMX crystals. High resolution three-dimensional CTH simulations indicate that rapid deformation occurs at material contact points causing large amplitude fluctuations of stress states having wavelengths of the order of several particle diameters. Localization of energy produces hot-spots due to shock focusing and plastic work near grain boundaries as material flows to interstitial regions. These numerical experiments demonstrate that hot-spots are strongly influenced by multiple crystal interactions. Chemical reaction processes also produce multiple wave structures associated with particle distribution effects. This study provides new insights into the micromechanical behavior of heterogeneous energetic materials strongly suggesting that initiation and reaction of shocked heterogeneous materials involves states distinctly different than single jump state descriptions.

  2. Scroll waves pinned to moving heterogeneities

    NASA Astrophysics Data System (ADS)

    Ke, Hua; Zhang, Zhihui; Steinbock, Oliver

    2015-03-01

    Three-dimensional excitable systems can self-organize vortex patterns that rotate around one-dimensional phase singularities called filaments. In experiments with the Belousov-Zhabotinsky reaction and numerical simulations, we pin these scroll waves to translating inert cylinders and demonstrate the controlled repositioning of their rotation centers. If the pinning site extends only along a portion of the filament, the phase singularity is stretched out along the trajectory of the heterogeneity, which effectively writes the singularity into the system. Its trailing end point follows the heterogeneity with a lower velocity. This velocity, its dependence on the placement of the anchor, and the shape of the filament are explained by a curvature flow model.

  3. Multiparametric imaging with heterogeneous radiofrequency fields.

    PubMed

    Cloos, Martijn A; Knoll, Florian; Zhao, Tiejun; Block, Kai T; Bruno, Mary; Wiggins, Graham C; Sodickson, Daniel K

    2016-01-01

    Magnetic resonance imaging (MRI) has become an unrivalled medical diagnostic technique able to map tissue anatomy and physiology non-invasively. MRI measurements are meticulously engineered to control experimental conditions across the sample. However, residual radiofrequency (RF) field inhomogeneities are often unavoidable, leading to artefacts that degrade the diagnostic and scientific value of the images. Here we show that, paradoxically, these artefacts can be eliminated by deliberately interweaving freely varying heterogeneous RF fields into a magnetic resonance fingerprinting data-acquisition process. Observations made based on simulations are experimentally confirmed at 7 Tesla (T), and the clinical implications of this new paradigm are illustrated with in vivo measurements near an orthopaedic implant at 3T. These results show that it is possible to perform quantitative multiparametric imaging with heterogeneous RF fields, and to liberate MRI from the traditional struggle for control over the RF field uniformity. PMID:27526996

  4. Norovirus Genome Circularization and Efficient Replication Are Facilitated by Binding of PCBP2 and hnRNP A1

    PubMed Central

    López-Manríquez, Eduardo; Vashist, Surender; Ureña, Luis; Goodfellow, Ian; Chavez, Pedro; Mora-Heredia, José Eduardo; Cancio-Lonches, Clotilde; Garrido, Efraín

    2013-01-01

    Sequences and structures within the terminal genomic regions of plus-strand RNA viruses are targets for the binding of host proteins that modulate functions such as translation, RNA replication, and encapsidation. Using murine norovirus 1 (MNV-1), we describe the presence of long-range RNA-RNA interactions that were stabilized by cellular proteins. The proteins potentially responsible for the stabilization were selected based on their ability to bind the MNV-1 genome and/or having been reported to be involved in the stabilization of RNA-RNA interactions. Cell extracts were preincubated with antibodies against the selected proteins and used for coprecipitation reactions. Extracts treated with antibodies to poly(C) binding protein 2 (PCBP2) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1 significantly reduced the 5′-3′ interaction. Both PCBP2 and hnRNP A1 recombinant proteins stabilized the 5′-3′ interactions and formed ribonucleoprotein complexes with the 5′ and 3′ ends of the MNV-1 genomic RNA. Mutations within the 3′ complementary sequences (CS) that disrupt the 5′-3′-end interactions resulted in a significant reduction of the viral titer, suggesting that the integrity of the 3′-end sequence and/or the lack of complementarity with the 5′ end is important for efficient virus replication. Small interfering RNA-mediated knockdown of PCBP2 or hnRNP A1 resulted in a reduction in virus yield, confirming a role for the observed interactions in efficient viral replication. PCBP2 and hnRNP A1 induced the circularization of MNV-1 RNA, as revealed by electron microscopy. This study provides evidence that PCBP2 and hnRNP A1 bind to the 5′ and 3′ ends of the MNV-1 viral RNA and contribute to RNA circularization, playing a role in the virus life cycle. PMID:23946460

  5. PKiKP Coda Observations Interpreted in Terms of the Earth's Inner Core Heterogeneities

    NASA Astrophysics Data System (ADS)

    Krasnoshchekov, D.; Kaazik, P.; Ovtchinnikov, V.

    2007-12-01

    Although resulting from gradual few billion years long crystallization process, Earth's inner core (IC) is rather heterogeneous than a single crystal of iron. IC fabric variations such as changes in crystallographic alignment or supposed increase in crystal size with depth often constitute physical grounds for hypothesizing IC heterogeneities of various scale lengths. To constrain upper IC heterogeneities, we analyze reflections from the Earth's inner core boundary and the coda waves following the reflections (PKiKP) on array records of underground nuclear explosions. In particular, we compare PKiKP codas observed after reflections with close bounce points on the surface of the IC and diverse ray paths in the Earth's crust, mantle and outer core. Such PKiKP coda doublets show similar shape, frequency content, intensity and duration, and feature powerful arrivals originating from IC heterogeneities. The proposed interpretation favors misaligned anisotropic iron crystals up to 10 km in size to cause the observed PKiKP codas rather than classical scattering on inclusions in the outermost IC. Also, the IC fabric's image observed as PKiKP coda appears to be time stationary in 20 years span, failing to exhibit any pronounced effect of IC differential rotation.

  6. Method of assessing heterogeneity in images

    DOEpatents

    Jacob, Richard E.; Carson, James P.

    2016-08-23

    A method of assessing heterogeneity in images is disclosed. 3D images of an object are acquired. The acquired images may be filtered and masked. Iterative decomposition is performed on the masked images to obtain image subdivisions that are relatively homogeneous. Comparative analysis, such as variogram analysis or correlogram analysis, is performed of the decomposed images to determine spatial relationships between regions of the images that are relatively homogeneous.

  7. Mutational Heterogeneity in Melanoma: An Inconvenient Truth.

    PubMed

    Chang, Gregory A; Polsky, David

    2015-12-01

    Identification of oncogenic BRAF mutations in primary and metastatic melanomas supports a linear model of clonal evolution in cancer. Some mutational studies, however, have failed to identify BRAF mutations in metastatic tumors from patients with BRAFmutant primary melanomas. Using a combination of methods, Riveiro-Falkenbach et al. (2015) assert that technical issues, and not clonal heterogeneity, may explain prior discordant mutational results. PMID:26569584

  8. Heterogeneous photocatalytic oxidation of atmospheric trace contaminants

    NASA Technical Reports Server (NTRS)

    Ollis, David F.; Peral, Jose

    1992-01-01

    A two year study to examine the feasibility of using heterogeneous photocatalysis for spacecraft air purification was begun at North Carolina State University on November 1, 1990. The original grant proposal included examination of the rates of destruction of anticipated spacecraft-generated air contaminants, including alcohols, aldehydes, chlorinated compounds, as well as trace levels of volatile compounds containing nitrogen, sulfur, and silicon. The progress made in the second six month period of 5/1/91-11/1/91 is discussed.

  9. [Heterogeneity of parasitic contamination of megalopolis soils].

    PubMed

    Aliautdinova, L V; Semenova, T A; Zavoĭkin, V D

    2011-01-01

    A morphological group ofwhipworm (Trichuris trichiura) eggs, which is detectable in the soil samples from the city's different control lands, shows that their origin is heterogeneous and it is possible to differentiate them by morphometric signs. At the same time is necessary to consider the specific biological factors contributing to soil contamination. Priority in parasitic soil contamination should be given to animals, dogs in particular, which is supported by the fact that the dog walking grounds exhibit the highest contamination rates. PMID:21797059

  10. Evidence for surface heterogeneity on Titan

    NASA Astrophysics Data System (ADS)

    Griffith, C. A.

    1993-08-01

    Observational results are presented for two rotational periods of Titan which exhibit the albedo difference noted by Lemmon et al. (1993) between this moon's positions at eastern and western elongation relative to Saturn. The persistence of this difference indicates that this heterogeneity is unlikely to be associated with transient features, and must be intrinsic to the surface. The results presented also indicate that Titan is locked in a synchronous orbit around Saturn.

  11. Bromine heterogenous chemistry in the troposhere

    SciTech Connect

    Abbatt, J.P.D.

    1996-10-01

    Motivated by the observations of boundary layer ozone loss which is correlated with high levels of bromine in the Arctic springtime, we have studied a number of heterogeneous interactions of tropospheric bromine species. The goal of this work is both to better define the source of inorganic bromine during this time of year and to determine the primary mechanism which keeps bromine in a photochemically active form.

  12. Heterogeneous processes: Laboratory, field, and modeling studies

    NASA Technical Reports Server (NTRS)

    Poole, Lamont R.; Kurylo, Michael J.; Jones, Rod L.; Wahner, Andreas; Calvert, Jack G.; Leu, M.-T.; Fried, A.; Molina, Mario J.; Hampson, Robert F.; Pitts, M. C.

    1991-01-01

    The efficiencies of chemical families such as ClO(x) and NO(x) for altering the total abundance and distribution of stratospheric ozone are controlled by a partitioning between reactive (active) and nonreactive (reservoir) compounds within each family. Gas phase thermodynamics, photochemistry, and kinetics would dictate, for example, that only about 1 percent of the chlorine resident in the lower stratosphere would be in the form of active Cl or ClO, the remainder existing in the reservoir compounds HCl and ClONO2. The consistency of this picture was recently challenged by the recognition that important chemical transformations take place on polar regions: the Airborne Antarctic Ozone Experiment (AAOE) and the Airborne Arctic Stratospheric Expedition (AASA). Following the discovery of the Antarctic ozone hole, Solomon et al. suggested that the heterogeneous chemical reaction: ClONO2(g)+HCl(s) yields Cl2(g)+HNO3(s) could play a key role in converting chlorine from inactive forms into a species (Cl2) that would rapidly dissociate in sunlight to liberate atomic chlorine and initiate ozone depletion. The symbols (s) and (g) denote solid phase, or adsorbed onto a solid surface, and gas phase, respectively, and represent the approach by which such a reaction is modeled rather than the microscopic details of the reaction. The reaction was expected to be most important at altitudes where PSC's were most prevalent (10 to 25 km), thereby extending the altitude range over which chlorine compounds can efficiently destroy ozone from the 35 to 45 km region (where concentrations of active chlorine are usually highest) to lower altitudes where the ozone concentration is at its peak. This chapter will briefly review the current state of knowledge of heterogeneous processes in the stratosphere, emphasizing those results obtained since the World Meteorological Organization (WMO) conference. Sections are included on laboratory investigations of heterogeneous reactions, the

  13. Phenotype heterogeneity in cancer cell populations

    NASA Astrophysics Data System (ADS)

    Almeida, Luis; Chisholm, Rebecca; Clairambault, Jean; Escargueil, Alexandre; Lorenzi, Tommaso; Lorz, Alexander; Trélat, Emmanuel

    2016-06-01

    Phenotype heterogeneity in cancer cell populations, be it of genetic, epigenetic or stochastic origin, has been identified as a main source of resistance to drug treatments and a major source of therapeutic failures in cancers. The molecular mechanisms of drug resistance are partly understood at the single cell level (e.g., overexpression of ABC transporters or of detoxication enzymes), but poorly predictable in tumours, where they are hypothesised to rely on heterogeneity at the cell population scale, which is thus the right level to describe cancer growth and optimise its control by therapeutic strategies in the clinic. We review a few results from the biological literature on the subject, and from mathematical models that have been published to predict and control evolution towards drug resistance in cancer cell populations. We propose, based on the latter, optimisation strategies of combined treatments to limit emergence of drug resistance to cytotoxic drugs in cancer cell populations, in the monoclonal situation, which limited as it is still retains consistent features of cell population heterogeneity. The polyclonal situation, that may be understood as "bet hedging" of the tumour, thus protecting itself from different sources of drug insults, may lie beyond such strategies and will need further developments. In the monoclonal situation, we have designed an optimised therapeutic strategy relying on a scheduled combination of cytotoxic and cytostatic treatments that can be adapted to different situations of cancer treatments. Finally, we review arguments for biological theoretical frameworks proposed at different time and development scales, the so-called atavistic model (diachronic view relying on Darwinian genotype selection in the coursof billions of years) and the Waddington-like epigenetic landscape endowed with evolutionary quasi-potential (synchronic view relying on Lamarckian phenotype instruction of a given genome by reversible mechanisms), to

  14. Safety analysis report for the Hanford Critical Mass Laboratory: Supplement No. 2. Experiments with heterogeneous assemblies

    SciTech Connect

    Gore, B.F.; Davenport, L.C.

    1981-04-01

    Factors affecting the safety of criticality experiments using heterogeneous assemblies are described and assessed. It is concluded that there is no substantial change in safety from experiments already being routinely performed at the Critical Mass Laboratory (CML), and that laboratory and personnel safety are adequately provided by the combination of engineered and administrative safety limits enforced at the CML. This conclusion is based on the analysis of operational controls, potential hazards, and the consequences of accidents. Contingencies considered that could affect nuclear criticality include manual changes in fuel loadings, water flooding, fire, explosion, loss of services, earthquake, windstorm, and flood. Other potential hazards considered include radiation exposure to personnel, and potential releases within the Assembly Room and outside to the environment. It is concluded that the Maximum Credible Nuclear Burst of 3 x 10/sup 18/ fissions (which served as the design basis for the CML) is valid for heterogeneous assemblies as well as homogeneous assemblies. This is based upon examination of the results of reactor destructive tests and the results of the SL-1 reactor destructive accident. The production of blast effects which might jeopardize the CML critical assembly room (of thick reinforced concrete) is not considered credible due to the extreme circumstances required to produce blast effects in reactor destructive tests. Consequently, it is concluded that, for experiments with heterogeneous assemblies, the consequences of the Maximum Credible Burst are unchanged from those previously estimated for experiments with homogeneous systems.

  15. Altering Emulsion Stability with Heterogeneous Surface Wettability

    PubMed Central

    Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob G. H.; Chen, Haosheng; Tsai, Peichun Amy

    2016-01-01

    Emulsions–liquid droplets dispersed in another immiscible liquid–are widely used in a broad spectrum of applications, including food, personal care, agrochemical, and pharmaceutical products. Emulsions are also commonly present in natural crude oil, hampering the production and quality of petroleum fuels. The stability of emulsions plays a crucial role in their applications, but controlling the stability without external driving forces has been proven to be difficult. Here we show how heterogeneous surface wettability can alter the stability and dynamics of oil-in-water emulsions, generated by a co-flow microfluidic device. We designed a useful methodology that can modify a micro-capillary of desired heterogeneous wettability (e.g., alternating hydrophilic and hydrophobic regions) without changing the hydraulic diameter. We subsequently investigated the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion. The experimental data revealed a universal critical timescale of advective emulsions, above which the microfluidic emulsions remain stable and intact, whereas below they become adhesive or inverse. A simple theoretical model based on a force balance can be used to explain this critical transition of emulsion dynamics, depending on the droplet size and the Capillary number–the ratio of viscous to surface effects. These results give insight into how to control the stability and dynamics of emulsions in microfluidics with flow velocity and different wettability. PMID:27256703

  16. Site occupancy models with heterogeneous detection probabilities

    USGS Publications Warehouse

    Royle, J. Andrew

    2006-01-01

    Models for estimating the probability of occurrence of a species in the presence of imperfect detection are important in many ecological disciplines. In these ?site occupancy? models, the possibility of heterogeneity in detection probabilities among sites must be considered because variation in abundance (and other factors) among sampled sites induces variation in detection probability (p). In this article, I develop occurrence probability models that allow for heterogeneous detection probabilities by considering several common classes of mixture distributions for p. For any mixing distribution, the likelihood has the general form of a zero-inflated binomial mixture for which inference based upon integrated likelihood is straightforward. A recent paper by Link (2003, Biometrics 59, 1123?1130) demonstrates that in closed population models used for estimating population size, different classes of mixture distributions are indistinguishable from data, yet can produce very different inferences about population size. I demonstrate that this problem can also arise in models for estimating site occupancy in the presence of heterogeneous detection probabilities. The implications of this are discussed in the context of an application to avian survey data and the development of animal monitoring programs.

  17. Heterogeneous nanofluids: natural convection heat transfer enhancement

    PubMed Central

    2011-01-01

    Convective heat transfer using different nanofluid types is investigated. The domain is differentially heated and nanofluids are treated as heterogeneous mixtures with weak solutal diffusivity and possible Soret separation. Owing to the pronounced Soret effect of these materials in combination with a considerable solutal expansion, the resulting solutal buoyancy forces could be significant and interact with the initial thermal convection. A modified formulation taking into account the thermal conductivity, viscosity versus nanofluids type and concentration and the spatial heterogeneous concentration induced by the Soret effect is presented. The obtained results, by solving numerically the full governing equations, are found to be in good agreement with the developed solution based on the scale analysis approach. The resulting convective flows are found to be dependent on the local particle concentration φ and the corresponding solutal to thermal buoyancy ratio N. The induced nanofluid heterogeneity showed a significant heat transfer modification. The heat transfer in natural convection increases with nanoparticle concentration but remains less than the enhancement previously underlined in forced convection case. PMID:21711755

  18. Heterogeneous nanofluids: natural convection heat transfer enhancement.

    PubMed

    Oueslati, Fakhreddine Segni; Bennacer, Rachid

    2011-01-01

    Convective heat transfer using different nanofluid types is investigated. The domain is differentially heated and nanofluids are treated as heterogeneous mixtures with weak solutal diffusivity and possible Soret separation. Owing to the pronounced Soret effect of these materials in combination with a considerable solutal expansion, the resulting solutal buoyancy forces could be significant and interact with the initial thermal convection. A modified formulation taking into account the thermal conductivity, viscosity versus nanofluids type and concentration and the spatial heterogeneous concentration induced by the Soret effect is presented. The obtained results, by solving numerically the full governing equations, are found to be in good agreement with the developed solution based on the scale analysis approach. The resulting convective flows are found to be dependent on the local particle concentration φ and the corresponding solutal to thermal buoyancy ratio N. The induced nanofluid heterogeneity showed a significant heat transfer modification. The heat transfer in natural convection increases with nanoparticle concentration but remains less than the enhancement previously underlined in forced convection case. PMID:21711755

  19. Heterogeneous nanofluids: natural convection heat transfer enhancement

    NASA Astrophysics Data System (ADS)

    Oueslati, Fakhreddine Segni; Bennacer, Rachid

    2011-12-01

    Convective heat transfer using different nanofluid types is investigated. The domain is differentially heated and nanofluids are treated as heterogeneous mixtures with weak solutal diffusivity and possible Soret separation. Owing to the pronounced Soret effect of these materials in combination with a considerable solutal expansion, the resulting solutal buoyancy forces could be significant and interact with the initial thermal convection. A modified formulation taking into account the thermal conductivity, viscosity versus nanofluids type and concentration and the spatial heterogeneous concentration induced by the Soret effect is presented. The obtained results, by solving numerically the full governing equations, are found to be in good agreement with the developed solution based on the scale analysis approach. The resulting convective flows are found to be dependent on the local particle concentration φ and the corresponding solutal to thermal buoyancy ratio N. The induced nanofluid heterogeneity showed a significant heat transfer modification. The heat transfer in natural convection increases with nanoparticle concentration but remains less than the enhancement previously underlined in forced convection case.

  20. Bridge monitoring using heterogeneous wireless sensor network

    NASA Astrophysics Data System (ADS)

    Haran, Shivan; Kher, Shubhalaxmi; Mehndiratta, Vandana

    2010-03-01

    Wireless sensor networks (WSN) are proving to be a good fit where real time monitoring of multiple physical parameters is required. In many applications such as structural health monitoring, patient data monitoring, traffic accident monitoring and analysis, sensor networks may involve interface with conventional P2P systems and it is challenging to handle heterogeneous network systems. Heterogeneous deployments will become increasingly prevalent as it allows for systems to seamlessly integrate and interoperate especially when it comes to applications involving monitoring of large infrastructures. Such networks may have wireless sensor network overlaid on a conventional computer network to pick up data from one distant location and carry out the analysis after relaying it over to another distant location. This paper discusses monitoring of bridges using WSN. As a test bed, a heterogeneous network of WSN and conventional P2P together with a combination of sensing devices (including vibration and strain) is to be used on a bridge model. Issues related to condition assessment of the bridge for situations including faults, overloads, etc., as well as analysis of network and system performance will be discussed. When conducted under controlled conditions, this is an important step towards fine tuning the monitoring system for recommendation of permanent mounting of sensors and collecting data that can help in the development of new methods for inspection and evaluation of bridges. The proposed model, design, and issues therein will be discussed, along with its implementation and results.

  1. Altering Emulsion Stability with Heterogeneous Surface Wettability

    NASA Astrophysics Data System (ADS)

    Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob G. H.; Chen, Haosheng; Tsai, Peichun Amy

    2016-06-01

    Emulsions–liquid droplets dispersed in another immiscible liquid–are widely used in a broad spectrum of applications, including food, personal care, agrochemical, and pharmaceutical products. Emulsions are also commonly present in natural crude oil, hampering the production and quality of petroleum fuels. The stability of emulsions plays a crucial role in their applications, but controlling the stability without external driving forces has been proven to be difficult. Here we show how heterogeneous surface wettability can alter the stability and dynamics of oil-in-water emulsions, generated by a co-flow microfluidic device. We designed a useful methodology that can modify a micro-capillary of desired heterogeneous wettability (e.g., alternating hydrophilic and hydrophobic regions) without changing the hydraulic diameter. We subsequently investigated the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion. The experimental data revealed a universal critical timescale of advective emulsions, above which the microfluidic emulsions remain stable and intact, whereas below they become adhesive or inverse. A simple theoretical model based on a force balance can be used to explain this critical transition of emulsion dynamics, depending on the droplet size and the Capillary number–the ratio of viscous to surface effects. These results give insight into how to control the stability and dynamics of emulsions in microfluidics with flow velocity and different wettability.

  2. Altering Emulsion Stability with Heterogeneous Surface Wettability.

    PubMed

    Meng, Qiang; Zhang, Yali; Li, Jiang; Lammertink, Rob G H; Chen, Haosheng; Tsai, Peichun Amy

    2016-01-01

    Emulsions-liquid droplets dispersed in another immiscible liquid-are widely used in a broad spectrum of applications, including food, personal care, agrochemical, and pharmaceutical products. Emulsions are also commonly present in natural crude oil, hampering the production and quality of petroleum fuels. The stability of emulsions plays a crucial role in their applications, but controlling the stability without external driving forces has been proven to be difficult. Here we show how heterogeneous surface wettability can alter the stability and dynamics of oil-in-water emulsions, generated by a co-flow microfluidic device. We designed a useful methodology that can modify a micro-capillary of desired heterogeneous wettability (e.g., alternating hydrophilic and hydrophobic regions) without changing the hydraulic diameter. We subsequently investigated the effects of flow rates and heterogeneous wettability on the emulsion morphology and motion. The experimental data revealed a universal critical timescale of advective emulsions, above which the microfluidic emulsions remain stable and intact, whereas below they become adhesive or inverse. A simple theoretical model based on a force balance can be used to explain this critical transition of emulsion dynamics, depending on the droplet size and the Capillary number-the ratio of viscous to surface effects. These results give insight into how to control the stability and dynamics of emulsions in microfluidics with flow velocity and different wettability. PMID:27256703

  3. Dynamical Heterogeneity in Glass-Forming Liquids

    NASA Astrophysics Data System (ADS)

    Glotzer, S. C.; Donati, C.

    1998-03-01

    The dynamical properties of cold, dense liquids differ dramatically from what is expected from extrapolation of their high temperature behavior. Recently, it has been proposed that such liquids may be dynamically heterogeneous over time scales which increase as the liquid cools. It has been suggested that, e.g., this is a mechanism for the stretched exponential decay of relaxation functions. Using extensive molecular dynamics simulations, we have investigated several supercooled liquids [1-4] ([1] W. Kob, C. Donati, S.J. Plimpton, P.H. Poole and S.C. Glotzer, PRL) 79 2827 (1997); [2] C. Donati, S.J. Plimpton, J.F. Douglas, W. Kob, P.H. Poole, and S.C. Glotzer, preprint; [3] Glotzer, Donati, Sciortino, unpublished; [4] Donati, Mountain, Glotzer, unpublished. to determine the extent and character of their dynamical heterogeneity. In the case of a binary Lennard-Jones mixture, e.g., we find [1] that particles of similar mobility form highly ramified clusters which grow with decreasing temperature [1]. Remarkably, their size appears to diverge as a power law at the mode coupling dynamical critical point [2]. We further find that the dynamical heterogeneity is related to the local potential energy landscape [2].

  4. Evidence for heterogeneous reactions in the atmosphere

    NASA Astrophysics Data System (ADS)

    Hidy, George M.

    Verification of heterogeneous reactions in the atmosphere through observations has remained a difficult, perhaps unachievable task because of the diversity and complexity of simultaneous chemical interactions which are suspected to occur. However, recent measurements combined with data analysis show promise for supplying both direct and indirect evidence of heterogeneous sulfur oxide and nitrogen oxide chemistry. Examples of useful methods are provided, which include (1) direct interpretation of observations in and near clouds and inference from thermodynamic properties, (2) inspection of combinations of aerometric data, (3) inference from statistical analysis, (4) comparison of observations with a validated air quality model, and (5) differences in particle size/composition distributions. An example involving thermodynamics is dry ammonium nitrate undergoing equilibrium transformation to the vapor phase, which is very sensitive to temperature. The other sample results presented suggest that heterogeneous oxidation of SO2 to sulfate may occur in the presence of suspended liquid water, particularly in winter, either through media buffered by absorbed ammonia or via suspended soot in droplets. No observational evidence has been found supporting metal-oxide- or ion-catalyzed reactions of sulfur dioxide or nitrogen oxides under atmospheric conditions.

  5. Heterogeneity and plasticity of T helper cells.

    PubMed

    Zhu, Jinfang; Paul, William E

    2010-01-01

    CD4 T helper (Th) cells play critical roles in adaptive immune responses. They recruit and activate other immune cells including B cells, CD8 T cells, macrophages, mast cells, neutrophils, eosinophils and basophils. Based on their functions, their pattern of cytokine secretion and their expression of specific transcription factors, Th cells, differentiated from naïve CD4 T cells, are classified into four major lineages, Th1, Th2, Th17 and T regulatory (Treg) cells, although other Th lineages may exist. Subsets of the same lineage may express different effector cytokines, reside at different locations or give rise to cells with different fates, whereas cells from different lineages may secrete common cytokines, such as IL-2, IL-9 and IL-10, resulting in massive heterogeneity of the Th cell population. In addition, the pattern of cytokine secretion may switch from that of one lineage toward another under certain circumstances, suggesting that Th cells are plastic. Tregs are also more heterogeneous and plastic than were originally thought. In this review, we summarize recent reports on heterogeneity and plasticity of Th cells, and discuss potential mechanisms and implications of such features that Th cells display. PMID:20010916

  6. Nanoscale Spatial Heterogeneity in Deep Eutectic Solvents.

    PubMed

    Kaur, Supreet; Gupta, Aditya; Kashyap, Hemant K

    2016-07-14

    In this article, we report a molecular dynamics simulation study on the X-ray and neutron scattering structures of deep eutectic solvents (DESs) and show that the DESs studied possess unique spatial heterogeneity on molecular length scales. The simulated X-ray and neutron scattering structure functions (S(q)s) of the DESs made of alkylamide + Li(+)/ClO4(-) display two peaks in the intermolecular region of the S(q)s. As a signature of nanoscale structural organization/heterogeneity, a prepeak is observed at 0.1 < q/Å(-1) < 0.4. The principal peak observed at around 1.2 < q/Å(-1) < 2 is rendered by short-distance inter- and intraspecies correlations. For the DESs studied, we demonstrate that nanoscale spatial heterogeneity is exhibited profoundly by the segregated domains of the constituent electrolyte, and the principal peak in S(q) is because of all sorts of close-contact correlations. The extent of nanoscale morphology as well as the strength of ion pairing is enhanced for the longer-tail alkylamide DES. PMID:27314310

  7. Soft random solids and their heterogeneous elasticity.

    PubMed

    Mao, Xiaoming; Goldbart, Paul M; Xing, Xiangjun; Zippelius, Annette

    2009-09-01

    Spatial heterogeneity in the elastic properties of soft random solids is examined via vulcanization theory. The spatial heterogeneity in the structure of soft random solids is a result of the fluctuations locked-in at their synthesis, which also brings heterogeneity in their elastic properties. Vulcanization theory studies semimicroscopic models of random-solid-forming systems and applies replica field theory to deal with their quenched disorder and thermal fluctuations. The elastic deformations of soft random solids are argued to be described by the Goldstone sector of fluctuations contained in vulcanization theory, associated with a subtle form of spontaneous symmetry breaking that is associated with the liquid-to-random-solid transition. The resulting free energy of this Goldstone sector can be reinterpreted as arising from a phenomenological description of an elastic medium with quenched disorder. Through this comparison, we arrive at the statistics of the quenched disorder of the elasticity of soft random solids in terms of residual stress and Lamé-coefficient fields. In particular, there are large residual stresses in the equilibrium reference state, and the disorder correlators involving the residual stress are found to be long ranged and governed by a universal parameter that also gives the mean shear modulus. PMID:19905095

  8. Soft random solids and their heterogeneous elasticity

    NASA Astrophysics Data System (ADS)

    Mao, Xiaoming; Goldbart, Paul M.; Xing, Xiangjun; Zippelius, Annette

    2009-09-01

    Spatial heterogeneity in the elastic properties of soft random solids is examined via vulcanization theory. The spatial heterogeneity in the structure of soft random solids is a result of the fluctuations locked-in at their synthesis, which also brings heterogeneity in their elastic properties. Vulcanization theory studies semimicroscopic models of random-solid-forming systems and applies replica field theory to deal with their quenched disorder and thermal fluctuations. The elastic deformations of soft random solids are argued to be described by the Goldstone sector of fluctuations contained in vulcanization theory, associated with a subtle form of spontaneous symmetry breaking that is associated with the liquid-to-random-solid transition. The resulting free energy of this Goldstone sector can be reinterpreted as arising from a phenomenological description of an elastic medium with quenched disorder. Through this comparison, we arrive at the statistics of the quenched disorder of the elasticity of soft random solids in terms of residual stress and Lamé-coefficient fields. In particular, there are large residual stresses in the equilibrium reference state, and the disorder correlators involving the residual stress are found to be long ranged and governed by a universal parameter that also gives the mean shear modulus.

  9. Emerging Understanding of Multiscale Tumor Heterogeneity

    PubMed Central

    Gerdes, Michael J.; Sood, Anup; Sevinsky, Christopher; Pris, Andrew D.; Zavodszky, Maria I.; Ginty, Fiona

    2014-01-01

    Cancer is a multifaceted disease characterized by heterogeneous genetic alterations and cellular metabolism, at the organ, tissue, and cellular level. Key features of cancer heterogeneity are summarized by 10 acquired capabilities, which govern malignant transformation and progression of invasive tumors. The relative contribution of these hallmark features to the disease process varies between cancers. At the DNA and cellular level, germ-line and somatic gene mutations are found across all cancer types, causing abnormal protein production, cell behavior, and growth. The tumor microenvironment and its individual components (immune cells, fibroblasts, collagen, and blood vessels) can also facilitate or restrict tumor growth and metastasis. Oncology research is currently in the midst of a tremendous surge of comprehension of these disease mechanisms. This will lead not only to novel drug targets but also to new challenges in drug discovery. Integrated, multi-omic, multiplexed technologies are essential tools in the quest to understand all of the various cellular changes involved in tumorigenesis. This review examines features of cancer heterogeneity and discusses how multiplexed technologies can facilitate a more comprehensive understanding of these features. PMID:25566504

  10. Genetic heterogeneity of familial hemiplegic migraine

    SciTech Connect

    Joutel, A.; Ducros, A.; Delrieu, O.; Maziaceck, J.; Tournier-Lasserve, E.; Vahedi, K. |; Bousser, M.G.; Ponsot, G.; Gouttiere, F.; Labauge, P.; Mancini, J.

    1994-12-01

    Familial hemiplegic migraine (FHM) is an autosomal dominant variety of migraine with aura. We previously mapped a gene for this disorder to the short arm of chromosome 19, within a 30-cM interval bracketed by D19S216 and D19S215. Linkage analysis conducted on two large pedigrees did not show any evidence of heterogeneity, despite their clinical differences due to the presence, in one family, of cerebellar ataxia and nystagmus. Herein we report linkage data on seven additional FHM families including another one with cerebellar ataxia. Analysis was conducted with a set of seven markers spanning the D19S216-D19S215 interval. Two-point and multipoint strong evidence for genetic heterogeneity. Strong evidence of linkage was obtained in two families and of absence of linkage in four families. The posterior probability of being of the linked type was >.95 in the first two families and <.01 in four other ones. It was not possible to draw any firm conclusion for the last family. Thus, within the nine families so far tested, four were linked, including those with associated cerebellar ataxia. We could not find any clinical difference between the pure FHM families regardless of whether they were linked. In addition to the demonstration of genetic heterogeneity of FHM, this study also allowed us to establish that the most likely location of the gene was within an interval of 12 cM between D19S413 and D19S226.

  11. Genetic Heterogeneity in Algerian Human Populations

    PubMed Central

    Deba, Tahria; Calafell, Francesc; Benhamamouch, Soraya; Comas, David

    2015-01-01

    The demographic history of human populations in North Africa has been characterized by complex processes of admixture and isolation that have modeled its current gene pool. Diverse genetic ancestral components with different origins (autochthonous, European, Middle Eastern, and sub-Saharan) and genetic heterogeneity in the region have been described. In this complex genetic landscape, Algeria, the largest country in Africa, has been poorly covered, with most of the studies using a single Algerian sample. In order to evaluate the genetic heterogeneity of Algeria, Y-chromosome, mtDNA and autosomal genome-wide makers have been analyzed in several Berber- and Arab-speaking groups. Our results show that the genetic heterogeneity found in Algeria is not correlated with geography or linguistics, challenging the idea of Berber groups being genetically isolated and Arab groups open to gene flow. In addition, we have found that external sources of gene flow into North Africa have been carried more often by females than males, while the North African autochthonous component is more frequent in paternally transmitted genome regions. Our results highlight the different demographic history revealed by different markers and urge to be cautious when deriving general conclusions from partial genomic information or from single samples as representatives of the total population of a region. PMID:26402429

  12. Evolutionary optimization of cooperative heterogeneous teams

    NASA Astrophysics Data System (ADS)

    Soule, Terence; Heckendorn, Robert B.

    2007-04-01

    There is considerable interest in developing teams of autonomous, unmanned vehicles that can function in hostile environments without endangering human lives. However, heterogeneous teams, teams of units with specialized roles and/or specialized capabilities, have received relatively little attention. Specialized roles and capabilities can significantly increase team effectiveness and efficiency. Unfortunately, developing effective cooperation mechanisms is much more difficult in heterogeneous teams. Units with specialized roles or capabilities require specialized software that take into account the role and capabilities of both itself and its neighbors. Evolutionary algorithms, algorithms modeled on the principles of natural selection, have a proven track record in generating successful teams for a wide variety of problem domains. Using classification problems as a prototype, we have shown that typical evolutionary algorithms either generate highly effective teams members that cooperate poorly or poorly performing individuals that cooperate well. To overcome these weaknesses we have developed a novel class of evolutionary algorithms. In this paper we apply these algorithms to the problem of controlling simulated, heterogeneous teams of "scouts" and "investigators". Our test problem requires producing a map of an area and to further investigate "areas of interest". We compare several evolutionary algorithms for their ability to generate individually effective members and high levels of cooperation.

  13. Seismoelectric effects caused by mesoscopic heterogeneities

    NASA Astrophysics Data System (ADS)

    Germán Rubino, J.; Jougnot, Damien; Rosas Carbajal, Marina; Linde, Niklas; Holliger, Klaus

    2013-04-01

    When a seismic wave propagates through a fluid saturated porous medium, it produces a relative motion between the fluid phase and the rock matrix. In the presence of an electric double layer at the fluid-solid interface, this movement introduces a separation of electrical charges which in turn generates a time-varying electrical source current and a resulting distribution of electrical potential. The presence of mesoscopic heterogeneities, that is, heterogeneities having sizes larger than the typical pore size but smaller than the prevailing wavelength, can induce a significant oscillatory fluid flow in response to the propagation of seismic waves. Indeed, the energy dissipation related to this phenomenon is considered to be one of the most common and important seismic attenuation mechanisms operating in the shallow part of the crust. Given that the amount of fluid flow produced by this phenomenon can be significant, a potentially important seismoelectric signal is also expected in such media. However, to the best of the authors' knowledge, the role played by mesoscopic wave-induced fluid flow on seismoelectric phenomenon is so far largely unexplored. In this work, we propose a numerical approach for computing seismoelectric signals related to the presence of mesoscopic heterogeneities. To this end, we consider a two-dimensional representative rock sample containing mesoscopic heterogeneities and apply an oscillatory compression on its top boundary. The solid phase is neither allowed to move on the bottom boundary nor to have horizontal displacements on the lateral boundaries and the fluid is not allowed to flow into or out of the sample. The fluid velocity field is determined by solving the quasi-static poroelastic equations in the space-frequency domain under the governing boundary conditions. Next, the seismoelectric conversion is calculated using the so-called effective electrical excess charge approach, which has been recently developed in streaming potential

  14. Heterogeneity of link weight and the evolution of cooperation

    NASA Astrophysics Data System (ADS)

    Iwata, Manabu; Akiyama, Eizo

    2016-04-01

    In this paper, we investigate the effect of heterogeneity of link weight, heterogeneity of the frequency or amount of interactions among individuals, on the evolution of cooperation. Based on an analysis of the evolutionary prisoner's dilemma game on a weighted one-dimensional lattice network with intra-individual heterogeneity, we confirm that moderate level of link-weight heterogeneity can facilitate cooperation. Furthermore, we identify two key mechanisms by which link-weight heterogeneity promotes the evolution of cooperation: mechanisms for spread and maintenance of cooperation. We also derive the corresponding conditions under which the mechanisms can work through evolutionary dynamics.

  15. Nuclear astrophysics

    SciTech Connect

    Haxton, W.C.

    1992-12-31

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized.

  16. Nuclear astrophysics

    SciTech Connect

    Haxton, W.C.

    1992-01-01

    The problem of core-collapse supernovae is used to illustrate the many connections between nuclear astrophysics and the problems nuclear physicists study in terrestrial laboratories. Efforts to better understand the collapse and mantle ejection are also motivated by a variety of interdisciplinary issues in nuclear, particle, and astrophysics, including galactic chemical evolution, neutrino masses and mixing, and stellar cooling by the emission of new particles. The current status of theory and observations is summarized.

  17. Nuclear APC.

    PubMed

    Neufeld, Kristi L

    2009-01-01

    Mutational inactivation of the tumor suppressor gene APC (Adenomatous polyposis coli) is thought to be an initiating step in the progression of the vast majority ofcolorectal cancers. Attempts to understand APC function have revealed more than a dozen binding partners as well as several subcellular localizations including at cell-cell junctions, associated with microtubules at the leading edge of migrating cells, at the apical membrane, in the cytoplasm and in the nucleus. The present chapter focuses on APC localization and functions in the nucleus. APC contains two classical nuclear localization signals, with a third domain that can enhance nuclear import. Along with two sets of nuclear export signals, the nuclear localization signals enable the large APC protein to shuttle between the nucleus and cytoplasm. Nuclear APC can oppose beta-catenin-mediated transcription. This down-regulation of nuclear beta-catenin activity by APC most likely involves nuclear sequestration of beta-catenin from the transcription complex as well as interaction of APC with transcription corepressor CtBP. Additional nuclear binding partners for APC include transcription factor activator protein AP-2alpha, nuclear export factor Crm1, protein tyrosine phosphatase PTP-BL and perhaps DNA itself. Interaction of APC with polymerase beta and PCNA, suggests a role for APC in DNA repair. The observation that increases in the cytoplasmic distribution of APC correlate with colon cancer progression suggests that disruption of these nuclear functions of APC plays an important role in cancer progression. APC prevalence in the cytoplasm of quiescent cells points to a potential function for nuclear APC in control of cell proliferation. Clear definition of APC's nuclear function(s) will expand the possibilities for early colorectal cancer diagnostics and therapeutics targeted to APC. PMID:19928349

  18. Significance of Heterogeneous Twist2 Expression in Human Breast Cancers

    PubMed Central

    Mao, Yubin; Zhang, Nini; Xu, Jinfei; Ding, Zhijie; Zong, Rongrong; Liu, Zuguo

    2012-01-01

    Background Twist2 (Dermo1) has been shown to mediate the epithelial-mesenchymal transition (EMT) to promote tumor invasion and even metastasis. However, the involvement of EMT in breast cancer progression is highly debated, partially due to clinical observations showing that the majority of human breast carcinoma metastases express E-cadherin and maintain their epithelial morphology. The molecular mechanism by which Twist2 participates in EMT of breast cancer in vivo remains poorly understood. Methods We examined Twist2 expression pattern in human breast carcinomas by western blot and tissue microarray, and analyzed Twist2 cellular localization by confocal microscopy, cell fractionation and other approaches. Results Twist2 expression was significantly increased in breast cancer. Cytoplasmic Twist2 positive cancer cells expressing E-cadherin on the cellular membrane were mainly located at tumor center of primary carcinomas and lymph metastases, while cancer cells with nuclear Twist2 clearly showed loss of E-cadherin and were detected at the invasive front in ductal breast carcinomas. In addition, ectopically stable-expressed Twist2 was found to localize in the cytoplasm of cancer cells. Collectively, these data indicate that upregulation of cytoplasmic Twist2 is correlated with tumor histological type and tumor metastasis in human breast cancers. Conclusion The differential cellular distribution of Twist2 may be associated with tumor progression. The cytoplasmic Twist2 in cancer cells at tumor center of primary carcinomas and lymph metastases contributes to the maintenance of epithelial cancer characteristics expressing E-cadherin in a noninvasive state, while the nuclear Twist2 at the cancer invasion front activates EMT to deprive epithelial property of neoplastic cells, thus facilitating invasion and metastasis. These findings suggest that heterogeneous expression of Twist2 in tumors may have a functional link to tumor progression. PMID:23133563

  19. Marked heterogeneity of ERG expression in large primary prostate cancers.

    PubMed

    Minner, Sarah; Gärtner, Michael; Freudenthaler, Fabian; Bauer, Melanie; Kluth, Martina; Salomon, Georg; Heinzer, Hans; Graefen, Markus; Bokemeyer, Carsten; Simon, Ronald; Sauter, Guido; Schlomm, Thorsten; Wilczak, Waldemar

    2013-01-01

    Approximately 50% of prostate cancers are characterized by TMPRSS2 (transmembrane protease serine 2)-ERG (avian v-ets erythroblastosis virus E26 oncogene homolog) gene fusions resulting in an androgen-regulated overexpression of the transcription factor ERG. Some studies have suggested prognostic or predictive relevance of ERG status in prostate cancer. Such concepts could be impaired by extensive ERG heterogeneity in analyzed tumors. The aim of this study was to analyze the extent of heterogeneity for TMPRSS2-ERG fusion in prostate cancer. To enable large-scale studies on the extent of heterogeneity of biomarkers in prostate cancer, a heterogeneity tissue microarray containing samples from 10 different tumor blocks of 190 large prostate cancers selected from a consecutive series of 480 radical prostatectomies was developed. ERG expression was analyzed by immunohistochemistry. Positive ERG immunostaining was found in arrayed cancer-containing samples from 103 of the 178 analyzable patients (58%). ERG immunostaining was homogeneously positive in 29 prostate cancers (16%), whereas heterogeneous ERG positivity was seen in 74 cancers (42%). ERG heterogeneity was within one tumor focus (intrafocal heterogeneity) in 69 cases (93% of heterogeneous cases) and between different tumor foci (interfocal heterogeneity) in 5 cases (7%). Marked intrafocal heterogeneity challenges the concept of TMPRSS2-ERG fusion always representing an early step in prostate cancer development. Marked heterogeneity also compromises the concept of analyzing ERG status for treatment decisions in diagnostic needle core biopsies. PMID:22899295

  20. The role of heterogeneity in structuring spatial hierarchies

    SciTech Connect

    O'Neill, R.V.

    1987-07-01

    Following a paradigm based on Statistics and Newtonian physics, ecology often emphasizes the central tendency of observations and considers heterogeneity as extraneous noise. This approach ignores heterogeneity as an important measure of ecological systems. The present paper discusses two ways that heterogeneity characterizes the spatial hierarchies we observe on a landscape. As an exogenous factor, heterogeneity transforms a uniform landscape into a diverse array of habitats. Topography, moisture gradients, etc., create a spectrum of opportunities for species establishment. Heterogeneity compresses space, allowing a larger number of species to survive in a given area. As an endogenous factor, heterogeneity results from competition and natural selection acting to fill the available niches. In either case, heterogeneity is critical to understanding spatial hierarchies and community structure.

  1. Defining heterogeneity within bacterial populations via single cell approaches.

    PubMed

    Davis, Kimberly M; Isberg, Ralph R

    2016-08-01

    Bacterial populations are heterogeneous, which in many cases can provide a selective advantage during changes in environmental conditions. In some instances, heterogeneity exists at the genetic level, in which significant allelic variation occurs within a population seeded by a single cell. In other cases, heterogeneity exists due to phenotypic differences within a clonal, genetically identical population. A variety of mechanisms can drive this latter strategy. Stochastic fluctuations can drive differential gene expression, but heterogeneity in gene expression can also be driven by environmental changes sensed by individual cells residing in distinct locales. Utilizing multiple single cell approaches, workers have started to uncover the extent of heterogeneity within bacterial populations. This review will first describe several examples of phenotypic and genetic heterogeneity, and then discuss many single cell approaches that have recently been applied to define heterogeneity within bacterial populations. PMID:27273675

  2. Heterogeneity in pineapple fruit quality results from plant heterogeneity at flower induction.

    PubMed

    Fassinou Hotegni, V Nicodème; Lommen, Willemien J M; Agbossou, Euloge K; Struik, Paul C

    2014-01-01

    Heterogeneity in fruit quality constitutes a major constraint in agri-food chains. In this paper the sources of the heterogeneity in pineapple in the field were studied in four experiments in commercial pineapple fields. The aims were to determine (a) whether differences in pineapple fruit quality among individual fruits are associated with differences in vigor of the individual plants within the crop at the time of artificial flower induction; and (b) whether the side shoots produced by the plant during the generative phase account for the fruit quality heterogeneity. Two pineapple cultivars were considered: cv. Sugarloaf and cv. Smooth Cayenne. Plant vigor at the time of artificial flower induction was measured by three variates: the number of functional leaves, the D-leaf length and their cross product. Fruit quality attributes measured at harvest time included external attributes (weight and height of fruit, infructescence and crown) and internal quality attributes [total soluble solids (TSS), pH, translucent flesh]. Results showed that the heterogeneity in fruit weight was a consequence of the heterogeneity in vigor of the plants at the moment of flower induction; that effect was mainly on the infructescence weight and less or not on the crown weight. The associations between plant vigor variates at flower induction and the internal quality attributes of the fruit were poor and/or not consistent across experiments. The weight of the slips (side shoots) explained part of the heterogeneity in fruit weight, infructescence weight and fruit height in cv. Sugarloaf. Possibilities for reducing the variation in fruit quality by precise cultural practices are discussed. PMID:25538714

  3. Heterogeneity in pineapple fruit quality results from plant heterogeneity at flower induction

    PubMed Central

    Fassinou Hotegni, V. Nicodème; Lommen, Willemien J. M.; Agbossou, Euloge K.; Struik, Paul C.

    2014-01-01

    Heterogeneity in fruit quality constitutes a major constraint in agri-food chains. In this paper the sources of the heterogeneity in pineapple in the field were studied in four experiments in commercial pineapple fields. The aims were to determine (a) whether differences in pineapple fruit quality among individual fruits are associated with differences in vigor of the individual plants within the crop at the time of artificial flower induction; and (b) whether the side shoots produced by the plant during the generative phase account for the fruit quality heterogeneity. Two pineapple cultivars were considered: cv. Sugarloaf and cv. Smooth Cayenne. Plant vigor at the time of artificial flower induction was measured by three variates: the number of functional leaves, the D-leaf length and their cross product. Fruit quality attributes measured at harvest time included external attributes (weight and height of fruit, infructescence and crown) and internal quality attributes [total soluble solids (TSS), pH, translucent flesh]. Results showed that the heterogeneity in fruit weight was a consequence of the heterogeneity in vigor of the plants at the moment of flower induction; that effect was mainly on the infructescence weight and less or not on the crown weight. The associations between plant vigor variates at flower induction and the internal quality attributes of the fruit were poor and/or not consistent across experiments. The weight of the slips (side shoots) explained part of the heterogeneity in fruit weight, infructescence weight and fruit height in cv. Sugarloaf. Possibilities for reducing the variation in fruit quality by precise cultural practices are discussed. PMID:25538714

  4. Para-hydrogen induced polarization in heterogeneous hydrogenationreactions

    SciTech Connect

    Koptyug, Igor V.; Kovtunov, Kirill; Burt, Scott R.; Anwar, M.Sabieh; Hilty, Christian; Han, Song-I; Pines, Alexander; Sagdeev, Renad Z.

    2007-01-31

    We demonstrate the creation and observation ofpara-hydrogen-induced polarization in heterogeneous hydrogenationreactions. Wilkinson's catalyst, RhCl(PPh3)3, supported on eithermodified silica gel or a polymer, is shown to hydrogenate styrene intoethylbenzene and to produce enhanced spin polarizations, observed throughNMR, when the reaction was performed with H2 gas enriched in the paraspinisomer. Furthermore, gaseous phase para-hydrogenation of propylene topropane with two catalysts, the Wilkinson's catalyst supported onmodified silica gel and Rh(cod)(sulfos) (cod = cycloocta-1,5-diene;sulfos) - O3S(C6H4)CH2C(CH2PPh2)3) supported on silica gel, demonstratesheterogeneous catalytic conversion resulting in large spin polarizations.These experiments serve as a direct verification of the mechanism ofheterogeneous hydrogenation reactions involving immobilized metalcomplexes and can be potentially developed into a practical tool forproducing catalyst-free fluids with highly polarized nuclear spins for abroad range of hyperpolarized NMR and MRI applications.

  5. Tomographic gamma scanning to assay heterogeneous radioactive waste

    SciTech Connect

    Estep, R.J.; Prettyman, T.H.; Sheppard, G.A. )

    1994-11-01

    Current methods for the nondestructive assay of special nuclear materials (SNM) and transuranic (TRU) waste in 208-l drums can give assay errors of 100% or more when the drum matrix and/or radionuclide distribution is nonuniform. This problem is addressed by the development of the tomographic-gamma-scanner (TGS) method for assaying heterogeneous drummed SNM/TRU waste. The TGS method improves on the well-established segmented-gamma-scanner (SGS) method by performing low-resolution tomographic emission and transmission scans on the drum, yielding coarse three-dimensional images of the matrix density and radionuclide distributions. The images are used to make accurate, point-to-point attenuation corrections. The TGS geometric counting efficiency is 60% that of a typical SGS device, allowing a TGS assay time of only 28 min/drum with a one-detector system. The TGS method may also be useful for nondestructive examination. Currently, TGS is the only practical method of imaging SNM in drums.

  6. Inverse problems in heterogeneous and fractured media using peridynamics

    DOE PAGESBeta

    Turner, Daniel Z.; van Bloemen Waanders, Bart G.; Parks, Michael L.

    2015-12-10

    The following work presents an adjoint-based methodology for solving inverse problems in heterogeneous and fractured media using state-based peridynamics. We show that the inner product involving the peridynamic operators is self-adjoint. The proposed method is illustrated for several numerical examples with constant and spatially varying material parameters as well as in the context of fractures. We also present a framework for obtaining material parameters by integrating digital image correlation (DIC) with inverse analysis. This framework is demonstrated by evaluating the bulk and shear moduli for a sample of nuclear graphite using digital photographs taken during the experiment. The resulting measuredmore » values correspond well with other results reported in the literature. Lastly, we show that this framework can be used to determine the load state given observed measurements of a crack opening. Furthermore, this type of analysis has many applications in characterizing subsurface stress-state conditions given fracture patterns in cores of geologic material.« less

  7. The Power of Heterogeneity: Parameter Relationships from Distributions

    PubMed Central

    Röding, Magnus; Bradley, Siobhan J.; Williamson, Nathan H.; Dewi, Melissa R.; Nann, Thomas; Nydén, Magnus

    2016-01-01

    Complex scientific data is becoming the norm, many disciplines are growing immensely data-rich, and higher-dimensional measurements are performed to resolve complex relationships between parameters. Inherently multi-dimensional measurements can directly provide information on both the distributions of individual parameters and the relationships between them, such as in nuclear magnetic resonance and optical spectroscopy. However, when data originates from different measurements and comes in different forms, resolving parameter relationships is a matter of data analysis rather than experiment. We present a method for resolving relationships between parameters that are distributed individually and also correlated. In two case studies, we model the relationships between diameter and luminescence properties of quantum dots and the relationship between molecular weight and diffusion coefficient for polymers. Although it is expected that resolving complicated correlated relationships require inherently multi-dimensional measurements, our method constitutes a useful contribution to the modelling of quantitative relationships between correlated parameters and measurements. We emphasise the general applicability of the method in fields where heterogeneity and complex distributions of parameters are obstacles to scientific insight. PMID:27182701

  8. Phenotypic and Functional Heterogeneity of Bovine Blood Monocytes

    PubMed Central

    Hussen, Jamal; Düvel, Anna; Sandra, Olivier; Smith, David; Sheldon, Iain Martin; Zieger, Peter; Schuberth, Hans-Joachim

    2013-01-01

    Murine and human peripheral blood monocytes are heterogeneous in size, granularity, nuclear morphology, phenotype and function. Whether and how bovine blood monocytes follow this pattern was analyzed in this study. Flow cytometrically, classical monocytes (cM) CD14+ CD16−, intermediate monocytes (intM) CD14+ CD16+ and nonclassical monocytes (ncM) CD14+ CD16+ were identified, with cM being the predominant subset (89%). cM showed a significant lower expression of CD172a, intM expressed the highest level of MHC class II molecules, and ncM were low positive for CD163. Compared to cM and intM, ncM showed a significantly reduced phagocytosis capacity, a significantly reduced generation of reactive oxygen species, and reduced mRNA expression of CXCL8, CXCL1 and IL-1β after LPS stimulation. Based on IL-1β secretion after LPS/ATP stimulation, the inflammasome could be activated in cM and intM, but not in ncM. IFNγ increased the expression of CD16 selectively on cM and induced a shift from cM into intM in vitro. In summary, bovine CD172a-positive mononuclear cells define three monocyte subsets with distinct phenotypic and functional differences. Bovine cM and intM share homologies with their human counterparts, whereas bovine ncM are not inflammatory monocytes. PMID:23967219

  9. Emerging heterogeneous integrated photonic platforms on silicon

    NASA Astrophysics Data System (ADS)

    Fathpour, Sasan

    2015-05-01

    Silicon photonics has been established as a mature and promising technology for optoelectronic integrated circuits, mostly based on the silicon-on-insulator (SOI) waveguide platform. However, not all optical functionalities can be satisfactorily achieved merely based on silicon, in general, and on the SOI platform, in particular. Long-known shortcomings of silicon-based integrated photonics are optical absorption (in the telecommunication wavelengths) and feasibility of electrically-injected lasers (at least at room temperature). More recently, high two-photon and free-carrier absorptions required at high optical intensities for third-order optical nonlinear effects, inherent lack of second-order optical nonlinearity, low extinction ratio of modulators based on the free-carrier plasma effect, and the loss of the buried oxide layer of the SOI waveguides at mid-infrared wavelengths have been recognized as other shortcomings. Accordingly, several novel waveguide platforms have been developing to address these shortcomings of the SOI platform. Most of these emerging platforms are based on heterogeneous integration of other material systems on silicon substrates, and in some cases silicon is integrated on other substrates. Germanium and its binary alloys with silicon, III-V compound semiconductors, silicon nitride, tantalum pentoxide and other high-index dielectric or glass materials, as well as lithium niobate are some of the materials heterogeneously integrated on silicon substrates. The materials are typically integrated by a variety of epitaxial growth, bonding, ion implantation and slicing, etch back, spin-on-glass or other techniques. These wide range of efforts are reviewed here holistically to stress that there is no pure silicon or even group IV photonics per se. Rather, the future of the field of integrated photonics appears to be one of heterogenization, where a variety of different materials and waveguide platforms will be used for different purposes with

  10. Is ventilation heterogeneity related to asthma control?

    PubMed

    Svenningsen, Sarah; Nair, Parameswaran; Guo, Fumin; McCormack, David G; Parraga, Grace

    2016-08-01

    In asthma patients, magnetic resonance imaging (MRI) and the lung clearance index (LCI) have revealed persistent ventilation heterogeneity, although its relationship to asthma control is not well understood. Therefore, our goal was to explore the relationship of MRI ventilation defects and the LCI with asthma control and quality of life in patients with severe, poorly controlled asthma.18 patients with severe, poorly controlled asthma (mean±sd 46±12 years, six males/12 females) provided written informed consent to an ethics board approved protocol, and underwent spirometry, LCI and (3)He MRI during a single 2-h visit. Asthma control and quality of life were evaluated using the Asthma Control Questionnaire (ACQ) and Asthma Quality of Life Questionnaire (AQLQ). Ventilation heterogeneity was quantified using the LCI and (3)He MRI ventilation defect percent (VDP).All participants reported poorly controlled disease (mean±sd ACQ score=2.3±0.9) and highly heterogeneous ventilation (mean±sd VDP=12±11% and LCI=10.5±3.0). While VDP and LCI were strongly correlated (r=0.86, p<0.0001), in a multivariate model that included forced expiratory volume in 1 s, VDP and LCI, VDP was the only independent predictor of asthma control (R(2)=0.38, p=0.01). There was also a significantly worse VDP, but not LCI in asthma patients with an ACQ score >2 (p=0.04) and AQLQ score <5 (p=0.04), and a trend towards worse VDP (p=0.053), but not LCI in asthma patients reporting ≥1 exacerbation in the past 6 months.In patients with poorly controlled, severe asthma MRI ventilation, but not LCI was significantly worse in those with worse ACQ and AQLQ. PMID:27174885

  11. Diffusion of hydrogen in heterogeneous systems

    NASA Astrophysics Data System (ADS)

    Herrmann, A.; Schimmele, L.; Mössinger, J.; Hirscher, M.; Kronmüller, H.

    2001-04-01

    The effective long-range long-time tracer diffusivity Deff for interstitial diffusion of hydrogen through heterogeneous systems was studied theoretically for model systems consisting of isolated grains of material G embedded in a matrix of material M. Different solubilities of hydrogen in these two materials as well as different diffusivities are allowed for. Additionally, modified diffusion barriers at the phase boundaries were included in the diffusion model. The effect of different sizes, arrangements, and forms of the grains was also considered. Deff was determined by Monte Carlo (MC) simulations on simple lattice models of the systems described above. An equilibrium distribution of hydrogen atoms among the two constituent materials was assumed. Our main interest was focused on whether and how Deff may be related to mesoscopic or macroscopic quantities characterizing the heterogeneous system and its constituent materials, such as the volume fractions of the two materials, the fraction of lattice sites in the immediate vicinity of the phase boundary, the hydrogen concentrations cG and cM in the grains and in the matrix and the respective hydrogen diffusivities DG(cG) and DM(cM). In order to obtain good estimates for these relations in terms of analytic formulas, we attempted to model a heterogeneous system by a network of diffusion elements connected in series and in parallel, in analogy to an electric network. The properties of the basic connections, in parallel and in series, were studied on layered structures, for which analytic expressions for Deff could be derived. The network formulas for different grain-matrix systems were tested by comparing with results of MC simulations. In general, the network formulas describe the corresponding MC results for Deff fairly well. It was found that differences in the hydrogen solubilities in the two phases as well as modified energy barriers at the phase boundaries may have dramatic effects on Deff.

  12. Reporting Tumor Molecular Heterogeneity in Histopathological Diagnosis

    PubMed Central

    Mafficini, Andrea; Amato, Eliana; Fassan, Matteo; Simbolo, Michele; Antonello, Davide; Vicentini, Caterina; Scardoni, Maria; Bersani, Samantha; Gottardi, Marisa; Rusev, Borislav; Malpeli, Giorgio; Corbo, Vincenzo; Barbi, Stefano; Sikora, Katarzyna O.; Lawlor, Rita T.; Tortora, Giampaolo; Scarpa, Aldo

    2014-01-01

    Background Detection of molecular tumor heterogeneity has become of paramount importance with the advent of targeted therapies. Analysis for detection should be comprehensive, timely and based on routinely available tumor samples. Aim To evaluate the diagnostic potential of targeted multigene next-generation sequencing (TM-NGS) in characterizing gastrointestinal cancer molecular heterogeneity. Methods 35 gastrointestinal tract tumors, five of each intestinal type gastric carcinomas, pancreatic ductal adenocarcinomas, pancreatic intraductal papillary mucinous neoplasms, ampulla of Vater carcinomas, hepatocellular carcinomas, cholangiocarcinomas, pancreatic solid pseudopapillary tumors were assessed for mutations in 46 cancer-associated genes, using Ion Torrent semiconductor-based TM-NGS. One ampulla of Vater carcinoma cell line and one hepatic carcinosarcoma served to assess assay sensitivity. TP53, PIK3CA, KRAS, and BRAF mutations were validated by conventional Sanger sequencing. Results TM-NGS yielded overlapping results on matched fresh-frozen and formalin-fixed paraffin-embedded (FFPE) tissues, with a mutation detection limit of 1% for fresh-frozen high molecular weight DNA and 2% for FFPE partially degraded DNA. At least one somatic mutation was observed in all tumors tested; multiple alterations were detected in 20/35 (57%) tumors. Seven cancers displayed significant differences in allelic frequencies for distinct mutations, indicating the presence of intratumor molecular heterogeneity; this was confirmed on selected samples by immunohistochemistry of p53 and Smad4, showing concordance with mutational analysis. Conclusions TM-NGS is able to detect and quantitate multiple gene alterations from limited amounts of DNA, moving one step closer to a next-generation histopathologic diagnosis that integrates morphologic, immunophenotypic, and multigene mutational analysis on routinely processed tissues, essential for personalized cancer therapy. PMID:25127237

  13. Pb isotopic heterogeneity in basaltic phenocrysts

    SciTech Connect

    Bryce, Julia G.; DePaolo, Donald J.

    2002-06-01

    The Pb isotopic compositions of phenocrystic phases in young basaltic lavas have been investigated using the Getty-DePaolo method (Getty S. J. and DePaolo D. J. [1995] Quaternary geochronology by the U-Th-Pb method. Geochim. Cosmochim. Acta 59, 3267 3272), which allows for the resolution of small isotopic differences. Phenocryst, matrix, and whole rock analyses were made on samples from the 17 Myr-old Imnaha basalts of the Columbia River Group, a zero-age MORB from the Mid-Atlantic Ridge, and a ca. 260 kyr-old tholeiite from Mount Etna. Plagioclase feldspar phenocrysts have low-(U, Th)/Pb, and in each sample the plagioclase has significantly lower 206Pb/207Pb and 208Pb/207Pb values than whole rock, matrix, and magnetite-rich separates. The Pb isotopic contrast between plagioclase and matrix/whole rock is found in three samples with varying grain sizes (0.5 2 cm for the Imnaha basalt and MORB and <1 mm for the Etna sample) from different tectonic settings, suggesting that these results are not unique. The isotopic contrasts are only slightly smaller in magnitude than the variations exhibited by whole rock samples from the region. The Imnaha basalts also have Sr isotopic heterogeneity evident only in plagioclase phenocrysts, but the MORB and Etna lavas do not. The isotopic heterogeneities reflect magma mixing, and indicate that isotopically diverse magmas were mixed together just prior to eruption. The results reinforce indications from melt inclusion studies that magma source region isotopic heterogeneities have large amplitudes at short length scales, and that the isotopic variations imparted to the magmas are not entirely homogenized during segregation and transport processes.

  14. Mathematical analysis of epidemiological models with heterogeneity

    SciTech Connect

    Van Ark, J.W.

    1992-01-01

    For many diseases in human populations the disease shows dissimilar characteristics in separate subgroups of the population; for example, the probability of disease transmission for gonorrhea or AIDS is much higher from male to female than from female to male. There is reason to construct and analyze epidemiological models which allow this heterogeneity of population, and to use these models to run computer simulations of the disease to predict the incidence and prevalence of the disease. In the models considered here the heterogeneous population is separated into subpopulations whose internal and external interactions are homogeneous in the sense that each person in the population can be assumed to have all average actions for the people of that subpopulation. The first model considered is an SIRS models; i.e., the Susceptible can become Infected, and if so he eventually Recovers with temporary immunity, and after a period of time becomes Susceptible again. Special cases allow for permanent immunity or other variations. This model is analyzed and threshold conditions are given which determine whether the disease dies out or persists. A deterministic model is presented; this model is constructed using difference equations, and it has been used in computer simulations for the AIDS epidemic in the homosexual population in San Francisco. The homogeneous version and the heterogeneous version of the differential-equations and difference-equations versions of the deterministic model are analyzed mathematically. In the analysis, equilibria are identified and threshold conditions are set forth for the disease to die out if the disease is below the threshold so that the disease-free equilibrium is globally asymptotically stable. Above the threshold the disease persists so that the disease-free equilibrium is unstable and there is a unique endemic equilibrium.

  15. Cell heterogeneity during the cell cycle

    SciTech Connect

    Darzynkiewicz, Z.; Crissman, H.; Traganos, F.; Steinkamp, J.

    1982-12-01

    Using flow cytometry, populations of Chinese hamster ovary cells, asynchronous and synchronized in the cycle, were measured with respect to cellular RNA- and protein-content, as well as cell light scatter properties. Heterogeneities of cell populations were expressed as coefficients of variation (c.v.) in percent of the respective mean values. Populations of cells immediately after mitosis have about 15% higher c.v. than mitotic cell populations, regardless of whether RNA, proteins, or light scatter are measured. These data indicate that cytoplasmic constituents are unequally distributed into the daughter cells during cytokinesis and that unequal cytokinesis generates intercellular metabolic variability during the cycle. An additional increase in heterogeneity, although of smaller degree, occurs during G/sub 2/ phase. Populations of S-phase cells are the most uniform, having 20-30% lower c.v. than the postmitotic cells. Cell progression through S does not involve any significant increase in intercellular variability with respect to RNA or protein content. In unperturbed exponentially growing cultures a critical RNA content is required for G/sub 1/ cells prior to their entrance into S. The cell residence times in the equalization compartments are exponentially distributed, which may reflect the randomness generated by the uneven division of metabolic constituents to daughter cells during cytokinesis. The cell heterogeneities were presently estimated at two metabolic levels, transcription (RNA content) and translation (proteins). The most uniform were populations stained for RNA and the highest variability was observed after staining of proteins. This suggests that the regulatory mechanisms equalizing cells in the cell cycle may operate primarily at the level of DNA transcription.

  16. Features and heterogeneities in growing network models

    NASA Astrophysics Data System (ADS)

    Ferretti, Luca; Cortelezzi, Michele; Yang, Bin; Marmorini, Giacomo; Bianconi, Ginestra

    2012-06-01

    Many complex networks from the World Wide Web to biological networks grow taking into account the heterogeneous features of the nodes. The feature of a node might be a discrete quantity such as a classification of a URL document such as personal page, thematic website, news, blog, search engine, social network, etc., or the classification of a gene in a functional module. Moreover the feature of a node can be a continuous variable such as the position of a node in the embedding space. In order to account for these properties, in this paper we provide a generalization of growing network models with preferential attachment that includes the effect of heterogeneous features of the nodes. The main effect of heterogeneity is the emergence of an “effective fitness” for each class of nodes, determining the rate at which nodes acquire new links. The degree distribution exhibits a multiscaling behavior analogous to the the fitness model. This property is robust with respect to variations in the model, as long as links are assigned through effective preferential attachment. Beyond the degree distribution, in this paper we give a full characterization of the other relevant properties of the model. We evaluate the clustering coefficient and show that it disappears for large network size, a property shared with the Barabási-Albert model. Negative degree correlations are also present in this class of models, along with nontrivial mixing patterns among features. We therefore conclude that both small clustering coefficients and disassortative mixing are outcomes of the preferential attachment mechanism in general growing networks.

  17. Identification and analysis of CYP7A1, CYP17A1, CYP20A1, CYP27A1 and CYP51A1 in cynomolgus macaques.

    PubMed

    Uno, Yasuhiro; Hosaka, Shinya; Yamazaki, Hiroshi

    2014-12-01

    Cytochromes P450 (P450) are important for not only drug metabolism and toxicity, but also biosynthesis and metabolism of cholesterol and bile acids, and steroid synthesis. In cynomolgus macaques, widely used in biomedical research, we have characterized P450 cDNAs, which were isolated as expressed sequence tags of cynomolgus macaque liver. In this study, cynomolgus CYP7A1, CYP17A1, CYP20A1, CYP27A1 and CYP51A1 cDNAs were characterized by sequence analysis, phylogenetic analysis and tissue expression pattern. By sequence analysis, these five cynomolgus P450s had high sequence identities (94-99%) to the human orthologs in amino acids. By phylogenetic analysis, each cynomolgus P450 was more closely related to the human ortholog as compared with the dog or rat ortholog. By quantitative polymerase chain reaction, among the 10 tissue types, CYP7A1 and CYP17A1 mRNAs were preferentially expressed in liver and adrenal gland, respectively. Cynomolgus CYP27A1 and CYP51A1 mRNAs were most abundantly expressed in liver and testis, respectively. Cynomolgus CYP20A1 mRNA was expressed in all the tissues, including brain and liver. Tissue expression patterns of each cynomolgus P450 were generally similar to that of the human ortholog. These results suggest the molecular similarities of CYP7A1, CYP17A1, CYP20A1, CYP27A1 and CYP51A1 between cynomolgus macaques and humans. PMID:25649950

  18. A heterogeneous multiscale method for poroelasticity

    NASA Astrophysics Data System (ADS)

    Delgado, Paul M.

    In this thesis, we develop and analyze a heterogeneous multiscale model for coupled fluid flow and solid deformation in porous media based on operator splitting and finite volume method. The splitting method results in two elliptic multiscale PDE's in the form of a reaction diffusion equation and a linear elasticity equation. We extend our previous multiscale method from 1D to higher dimensions and develop new approaches for the inclusion of mixed boundary conditions and source terms. We derive an error estimate for our multiscale method and analyze the stability of our splitting method. We also test the effectiveness of our method in the case of steady state linear poroelasticity.

  19. Heterogeneously integrated microsystem-on-a-chip

    DOEpatents

    Chanchani, Rajen

    2008-02-26

    A microsystem-on-a-chip comprises a bottom wafer of normal thickness and a series of thinned wafers can be stacked on the bottom wafer, glued and electrically interconnected. The interconnection layer comprises a compliant dielectric material, an interconnect structure, and can include embedded passives. The stacked wafer technology provides a heterogeneously integrated, ultra-miniaturized, higher performing, robust and cost-effective microsystem package. The highly integrated microsystem package, comprising electronics, sensors, optics, and MEMS, can be miniaturized both in volume and footprint to the size of a bottle-cap or less.

  20. Dynamical Heterogeneity of the Glassy State

    NASA Astrophysics Data System (ADS)

    Wisitsorasak, Apiwat

    The understanding and the complete description of the glass transition are impeded by the complexity of nature of the glass. Parts of this complexity come from the emergence of long-lived inherent structures of a liquid at a temperature below which the activated reconfiguration events play a dominant role. Molecules in a glass change their locations through the activated process at a rate which varies throughout the glass owing to these local and aperiodic structures. Motions in one location also cause or relieve constrains, thereby altering the rate of transitions of neighboring regions. The key to understanding this problem is the interplay between the activated events that generate mobility and the transport of mobility. In the following we explore fluctuating mobility generation and transport in glasses to understand the dynamics of the glassy state within the framework of the random first order transition theory of glass. Fluctuating mobility generation and transport in the glass that arise from there being a distribution of local stability and thus effective temperature are treated by numerically solving stochastic continuum equations for mobility and fictive temperature fields. Fluctuating spatiotemporal structures in aging and rejuvenating glasses lead to dynamical heterogeneity in glasses with characteristics that are distinct from those found in the equilibrium liquid. We illustrate in this thesis how the heterogeneity in glasses gives rises of a non-Gaussian distribution of activation free energies, the stretching exponent, and the growth of characteristic lengths. These are studied along with the four-point dynamic correlation function. Asymmetric thermodynamic responses upon heating and cooling are also predicted to be the results of the heterogeneity and the out-of-equilibrium behavior of glasses below the glass transition temperature. Moreover the dynamical heterogeneity can lead to a growth front of mobility in rejuvenating glasses that emanates

  1. Bridge mediated ultrafast heterogeneous electron transfer

    NASA Astrophysics Data System (ADS)

    Ramakrishna, S.; Willig, F.; May, V.

    2002-01-01

    Bridge mediated photoinduced ultrafast heterogeneous electron transfer (ET) from a molecularly anchored chromophore to a semiconductor surface is modelled theoretically. The continuum levels of the semiconductor substrate are taken into account in the numerical calculations via a polynomial expansion. Electron transfer for the direct injection case in the strong coupling limit is studied and compared with cases where intermediate bridging states are successively introduced to weaken the effective electronic coupling. The role of vibronic coherences in the strong electronic coupling limit as well as in off-resonant bridge mediated electron transfer is also discussed.

  2. Nanoparticles for heterogeneous catalysis: new mechanistic insights.

    PubMed

    Schauermann, Swetlana; Nilius, Niklas; Shaikhutdinov, Shamil; Freund, Hans-Joachim

    2013-08-20

    Metallic nanoparticles finely dispersed over oxide supports have found use as heterogeneous catalysts in many industries including chemical manufacturing, energy-related applications and environmental remediation. The compositional and structural complexity of such nanosized systems offers many degrees of freedom for tuning their catalytic properties. However, fully rational design of heterogeneous catalysts based on an atomic-level understanding of surface processes remains an unattained goal in catalysis research. Researchers have used surface science methods and metal single crystals to explore elementary processes in heterogeneous catalysis. In this Account, we use more realistic materials that capture part of the complexity inherent to industrial catalysts. We assess the impacts on the overall catalytic performance of characteristics such as finite particle size, particle structure, particle chemical composition, flexibility of atoms in clusters, and metal-support interactions. To prepare these materials, we grew thin oxide films on metal single crystals under ultrahigh vacuum conditions and used these films as supports for metallic nanoparticles. We present four case studies on specifically designed materials with properties that expand our atomic-level understanding of surface chemistry. Specifically, we address (1) the effect of dopants in the oxide support on the growth of metal nanoclusters; (2) the effects of size and structural flexibility of metal clusters on the binding energy of gas-phase adsorbates and their catalytic activity; (3) the role of surface modifiers, such as carbon, on catalytic activity and selectivity; and (4) the structural and compositional changes of the active surface as a result of strong metal-support interaction. Using these examples, we demonstrate how studies of complex nanostructured materials can help revealing atomic processes at the solid-gas interface of heterogeneous catalysts. Among our findings is that doping of oxide

  3. Understanding as Integration of Heterogeneous Representations

    NASA Astrophysics Data System (ADS)

    Martínez, Sergio F.

    2014-03-01

    The search for understanding is a major aim of science. Traditionally, understanding has been undervalued in the philosophy of science because of its psychological underpinnings; nowadays, however, it is widely recognized that epistemology cannot be divorced from psychology as sharp as traditional epistemology required. This eliminates the main obstacle to give scientific understanding due attention in philosophy of science. My aim in this paper is to describe an account of scientific understanding as an emergent feature of our mastering of different (causal) explanatory frameworks that takes place through the mastering of scientific practices. Different practices lead to different kinds of representations. Such representations are often heterogeneous. The integration of such representations constitute understanding.

  4. Heterogeneous distributed query processing: The DAVID system

    NASA Technical Reports Server (NTRS)

    Jacobs, Barry E.

    1985-01-01

    The objective of the Distributed Access View Integrated Database (DAVID) project is the development of an easy to use computer system with which NASA scientists, engineers and administrators can uniformly access distributed heterogeneous databases. Basically, DAVID will be a database management system that sits alongside already existing database and file management systems. Its function is to enable users to access the data in other languages and file systems without having to learn the data manipulation languages. Given here is an outline of a talk on the DAVID project and several charts.

  5. Dual compile strategy for parallel heterogeneous execution.

    SciTech Connect

    Smith, Tyler Barratt; Perry, James Thomas

    2012-06-01

    The purpose of the Dual Compile Strategy is to increase our trust in the Compute Engine during its execution of instructions. This is accomplished by introducing a heterogeneous Monitor Engine that checks the execution of the Compute Engine. This leads to the production of a second and custom set of instructions designed for monitoring the execution of the Compute Engine at runtime. This use of multiple engines differs from redundancy in that one engine is working on the application while the other engine is monitoring and checking in parallel instead of both applications (and engines) performing the same work at the same time.

  6. Fractures in heterogeneous two-dimensional systems

    NASA Astrophysics Data System (ADS)

    Politi, Antonio; Zei, Maria

    2001-05-01

    A two-dimensional triangular lattice with bond disorder is used as a testing ground for fracture behavior in heterogeneous materials in strain-controlled conditions. Simulations are performed with two interaction potentials (harmonic and Lennard-Jones types) and different breaking thresholds. We study the strain range where the fracture progressively develops from the first to the last breakdown. Scaling properties with the lattice size are investigated: no qualitative difference is found between the two interaction potentials. Clustering properties of the broken bonds are also studied by grouping them into disjoint sets of connected bonds. Finally, the role of kinetic energy is analyzed by comparing overdamped with dissipationless dynamics.

  7. Markovian Search Games in Heterogeneous Spaces

    SciTech Connect

    Griffin, Christopher H

    2009-01-01

    We consider how to search for a mobile evader in a large heterogeneous region when sensors are used for detection. Sensors are modeled using probability of detection. Due to environmental effects, this probability will not be constant over the entire region. We map this problem to a graph search problem and, even though deterministic graph search is NP-complete, we derive a tractable, optimal, probabilistic search strategy. We do this by defining the problem as a differential game played on a Markov chain. We prove that this strategy is optimal in the sense of Nash. Simulations of an example problem illustrate our approach and verify our claims.

  8. Heterogeneity versus homogeneity of multiple sclerosis

    PubMed Central

    Sato, Fumitaka; Martinez, Nicholas E; Omura, Seiichi; Tsunoda, Ikuo

    2011-01-01

    The 10th International Congress of Neuroimmunology, including the 10th European School of Neuroimmunology Course, was held by the International Society of Neuroimmunology in Sitges (Barcelona, Spain) on 26–30 October 2010. The conference covered a wide spectrum of issues and challenges in both basic science and clinical aspects of neuroimmunology. Data and ideas were shared through a variety of programs, including review talks and poster sessions. One of the topics of the congress was whether multiple sclerosis is a homogenous or heterogenous disease, clinically and pathologically, throughout its course. PMID:21426254

  9. An effective medium theory for three-dimensional elastic heterogeneities

    NASA Astrophysics Data System (ADS)

    Jordan, Thomas H.

    2015-11-01

    A second-order Born approximation is used to formulate a self-consistent theory for the effective elastic parameters of stochastic media with ellipsoidal distributions of small-scale heterogeneity. The covariance of the stiffness tensor is represented as the product of a one-point tensor variance and a two-point scalar correlation function with ellipsoidal symmetry, which separates the statistical properties of the local anisotropy from those of the geometric anisotropy. The spatial variations can then be rescaled to an isotropic distribution by a simple metric transformation; the spherical average of the strain Green's function in the transformed space reduces to a constant Kneer tensor, and the second-order corrections to the effective elastic parameters are given by the contraction of the rescaled Kneer tensor against the single-point variance of the stiffness tensor. Explicit results are derived for stochastic models in which the heterogeneity is transversely isotropic and its second moments are characterized by a horizontal-to-vertical aspect ratio η. If medium is locally isotropic, the expressions for the anisotropic effective moduli reduce in the limit η → ∞ to Backus's second-order expressions for a 1-D stochastic laminate. Comparisons with the exact Backus theory show that the second-order approximation predicts the effective anisotropy for non-Gaussian media fairly well for relative rms fluctuations in the moduli smaller than about 30 per cent. A locally anisotropic model is formulated in which the local elastic properties have hexagonal symmetry, guided by a Gaussian random vector field that is transversely isotropic and specified by a horizontal-to-vertical orientation ratio ξ. The self-consistent theory provides closed-form expressions for the dependence of the effective moduli on 0 < ξ < ∞ and 0 < η < ∞. The effective-medium parametrizations described here appear to be suitable for incorporation into tomographic modelling.

  10. Nuclear safety

    NASA Technical Reports Server (NTRS)

    Buden, D.

    1991-01-01

    Topics dealing with nuclear safety are addressed which include the following: general safety requirements; safety design requirements; terrestrial safety; SP-100 Flight System key safety requirements; potential mission accidents and hazards; key safety features; ground operations; launch operations; flight operations; disposal; safety concerns; licensing; the nuclear engine for rocket vehicle application (NERVA) design philosophy; the NERVA flight safety program; and the NERVA safety plan.

  11. Nuclear stress test

    MedlinePlus

    ... Persantine stress test; Thallium stress test; Stress test - nuclear; Adenosine stress test; Regadenoson stress test; CAD - nuclear stress; Coronary artery disease - nuclear stress; Angina - nuclear ...

  12. Heterogeneous Participant Recruitment for Comprehensive Vehicle Sensing.

    PubMed

    Liu, Yazhi; Li, Xiong

    2015-01-01

    Widely distributed mobile vehicles wherein various sensing devices and wireless communication interfaces are installed bring vehicular participatory sensing into practice. However, the heterogeneity of vehicles in terms of sensing capability and mobility, and the participants' expectations on the incentives blackmake the collection of comprehensive sensing data a challenging task. A sensing data quality-oriented optimal heterogeneous participant recruitment strategy is proposed in this paper for vehicular participatory sensing. In the proposed strategy, the differences between the sensing data requirements and the collected sensing data are modeled. An optimization formula is established to model the optimal participant recruitment problem, and a participant utility analysis scheme is built based on the sensing and mobility features of vehicles. Besides, a greedy algorithm is then designed according to the utility of vehicles to recruit the most efficient vehicles with a limited total incentive budget. Real trace-driven simulations show that the proposed strategy can collect 85.4% of available sensing data with 34% incentive budget. PMID:26407102

  13. Characterizing hydrogeologic heterogeneity using lithologic data

    SciTech Connect

    Flach, G.P.; Hamm, L.L.; Harris, M.K.; Thayer, P.A.; Haselow, J.S.; Smits, A.D.

    1995-12-31

    Large-scale (> 1 m) variability in hydraulic conductivity is usually the main influence on field-scale groundwater flow patterns and dispersive transport. Sediment lithologic descriptions and geophysical logs typically offer finer spatial resolution, and therefore more potential information about site-scale heterogeneity, than other site characterization data. In this study, a technique for generating a heterogeneous, three-dimensional hydraulic conductivity field from sediment lithologic descriptions is presented. The approach involves creating a three-dimensional, fine-scale representation of mud (silt + clay) percentage using a stratified interpolation algorithm. Mud percentage is then translated into horizontal and vertical conductivity using direct correlations derived from measured data and inverse groundwater flow modeling. Lastly, the fine-scale conductivity fields are averaged to create a coarser grid for use in groundwater flow and transport modeling. The approach is demonstrated using a finite-element groundwater flow model of a Savannah River Site solid radioactive and hazardous waste burial ground. Hydrostratigraphic units in the area consist of fluvial, deltaic, and shallow marine sand, mud and calcareous sediment that exhibit abrupt facies changes over short distances.

  14. MULTIGRID HOMOGENIZATION OF HETEROGENEOUS POROUS MEDIA

    SciTech Connect

    Dendy, J.E.; Moulton, J.D.

    2000-10-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL); this report, however, reports on only two years research, since this project was terminated at the end of two years in response to the reduction in funding for the LDRD Program at LANL. The numerical simulation of flow through heterogeneous porous media has become a vital tool in forecasting reservoir performance, analyzing groundwater supply and predicting the subsurface flow of contaminants. Consequently, the computational efficiency and accuracy of these simulations is paramount. However, the parameters of the underlying mathematical models (e.g., permeability, conductivity) typically exhibit severe variations over a range of significantly different length scales. Thus the numerical treatment of these problems relies on a homogenization or upscaling procedure to define an approximate coarse-scale problem that adequately captures the influence of the fine-scale structure, with a resultant compromise between the competing objectives of computational efficiency and numerical accuracy. For homogenization in models of flow through heterogeneous porous media, We have developed new, efficient, numerical, multilevel methods, that offer a significant improvement in the compromise between accuracy and efficiency. We recently combined this approach with the work of Dvorak to compute bounded estimates of the homogenized permeability for such flows and demonstrated the effectiveness of this new algorithm with numerical examples.

  15. Dynamic Heterogeneity in Interacting Miscible Polymer Blends

    NASA Astrophysics Data System (ADS)

    Gaikwad, Ashish; Lodge, Timothy

    2008-03-01

    Dynamic heterogeneity leading to time-temperature superposition (tTS) failure has been widely reported in non-interacting/weakly interacting miscible polymer blends. However, coupling of the component dynamic response in blends, even with a huge dynamic asymmetry in the pure components, is possible with H-bonding interactions. This study is focused on finding the minimum level of interaction necessary for thermo-rheological simplicity in blends. Blends of styrene-co-vinylphenol (PSVPh) and poly(vinyl methyl ether) (PVME) were chosen. Incorporation of styrene provides an effective way to modulate H-bonding interactions in the system. Linear viscoelastic data indicate that tTS fails for PS/PVME blends, whereas data obtained for different PVPh/PVME blends showed that tTS was obeyed a over wide temperature range. For PSVPh/PVME blends with low PSVPh content, tTS was successful. This suggests that the presence of alternating styrene and vinyl phenol units was insufficient for dynamic response decoupling. Further studies are in progress, with varying vinyl phenol content in PSVPh, to explore the influence of H-bonding on dynamic heterogeneity and blend dynamics.

  16. Heterogeneous Photochemical Oxidation of Sulfur Dioxide

    NASA Astrophysics Data System (ADS)

    El-Zanan, H. S.; Stockwell, W. R.

    2007-12-01

    The gas phase oxidation of sulfur dioxide by the hydroxyl radical is a significant source of sulfate aerosol in the troposphere and stratosphere. Stockwell and Calvert (1983) performed fifteen chamber experiments where mixtures of HONO, NO, NO2, H2O, SO2 and CO were photolyzed in synthetic air or in nitrogen containing approximately 50 ppm oxygen. They found that the atmospheric oxidation of SO2 by hydroxyl radical was a chain process that occurs through the production of an HO2 radical followed by reaction with NO to reproduce HO. We have reanalyzed this dataset and we have found that a very large amount of the observed SO2 oxidation (70.0 ± 9.1 %) is not explained through the HO + SO2 reaction alone. The Regional Atmospheric Chemistry Mechanism (RACM2) was used to investigate additional chemical pathways for the oxidation of SO2. A mechanism consisting of photochemical heterogeneous reactions is proposed to account for the observed additional sulfur dioxide oxidation not accounted for by gas phase oxidation. The analysis showed that the measured time dependent SO2, CO2 and nitrogenous compound concentrations could be simulated by the photochemical heterogeneous mechanism in conjunction with the RACM2 mechanism.

  17. Adaptive load sharing in heterogeneous distributed systems

    NASA Astrophysics Data System (ADS)

    Mirchandaney, Ravi; Towsley, Don; Stankovic, John A.

    1990-08-01

    In this paper, we study the performance characteristics of simple load sharing algorithms for heterogeneous distributed systems. We assume that nonnegligible delays are encountered in transferring jobs from one node to another. We analyze the effects of these delays on the performance of two threshold-based algorithms called Forward and Reverse. We formulate queuing theoretic models for each of the algorithms operating in heterogeneous systems under the assumption that the job arrival process at each node in Poisson and the service times and job transfer times are exponentially distributed. The models are solved using the Matrix-Geometric solution technique. These models are used to study the effects of different parameters and algorithm variations on the mean job response time: e.g., the effects of varying the thresholds, the impact of changing the probe limit, the impact of biasing the probing, and the optimal response times over a large range of loads and delays. Wherever relevant, the results of the models are compared with the M/M/ 1 model, representing no load balancing (hereafter referred to as NLB), and the M/M/K model, which is an achievable lower bound (hereafter referred to as LB).

  18. Visual EKF-SLAM from Heterogeneous Landmarks.

    PubMed

    Esparza-Jiménez, Jorge Othón; Devy, Michel; Gordillo, José L

    2016-01-01

    Many applications require the localization of a moving object, e.g., a robot, using sensory data acquired from embedded devices. Simultaneous localization and mapping from vision performs both the spatial and temporal fusion of these data on a map when a camera moves in an unknown environment. Such a SLAM process executes two interleaved functions: the front-end detects and tracks features from images, while the back-end interprets features as landmark observations and estimates both the landmarks and the robot positions with respect to a selected reference frame. This paper describes a complete visual SLAM solution, combining both point and line landmarks on a single map. The proposed method has an impact on both the back-end and the front-end. The contributions comprehend the use of heterogeneous landmark-based EKF-SLAM (the management of a map composed of both point and line landmarks); from this perspective, the comparison between landmark parametrizations and the evaluation of how the heterogeneity improves the accuracy on the camera localization, the development of a front-end active-search process for linear landmarks integrated into SLAM and the experimentation methodology. PMID:27070602

  19. Integrating data from heterogeneous DNA microarray platforms.

    PubMed

    Valente, Eduardo; Rocha, Miguel

    2015-01-01

    DNA microarrays are one of the most used technologies for gene expression measurement. However, there are several distinct microarray platforms, from different manufacturers, each with its own measurement protocol, resulting in data that can hardly be compared or directly integrated. Data integration from multiple sources aims to improve the assertiveness of statistical tests, reducing the data dimensionality problem. The integration of heterogeneous DNA microarray platforms comprehends a set of tasks that range from the re-annotation of the features used on gene expression, to data normalization and batch effect elimination. In this work, a complete methodology for gene expression data integration and application is proposed, which comprehends a transcript-based re-annotation process and several methods for batch effect attenuation. The integrated data will be used to select the best feature set and learning algorithm for a brain tumor classification case study. The integration will consider data from heterogeneous Agilent and Affymetrix platforms, collected from public gene expression databases, such as The Cancer Genome Atlas and Gene Expression Omnibus. PMID:26673932

  20. Heterogeneous information-based artificial stock market

    NASA Astrophysics Data System (ADS)

    Pastore, S.; Ponta, L.; Cincotti, S.

    2010-05-01

    In this paper, an information-based artificial stock market is considered. The market is populated by heterogeneous agents that are seen as nodes of a sparsely connected graph. Agents trade a risky asset in exchange for cash. Besides the amount of cash and assets owned, each agent is characterized by a sentiment. Moreover, agents share their sentiments by means of interactions that are identified by the graph. Interactions are unidirectional and are supplied with heterogeneous weights. The agent's trading decision is based on sentiment and, consequently, the stock price process depends on the propagation of information among the interacting agents, on budget constraints and on market feedback. A central market maker (clearing house mechanism) determines the price process at the intersection of the demand and supply curves. Both closed- and open-market conditions are considered. The results point out the validity of the proposed model of information exchange among agents and are helpful for understanding the role of information in real markets. Under closed market conditions, the interaction among agents' sentiments yields a price process that reproduces the main stylized facts of real markets, e.g. the fat tails of the returns distributions and the clustering of volatility. Within open-market conditions, i.e. with an external cash inflow that results in asset price inflation, also the unitary root stylized fact is reproduced by the artificial stock market. Finally, the effects of model parameters on the properties of the artificial stock market are also addressed.

  1. Genetic heterogeneity of familial hemiplegic migraine

    SciTech Connect

    Joutel, A.; Ducros, A.; Vahedi, K.

    1994-09-01

    Familial hemiplegic migraine (FHM) is an autosomal dominant subtype of migraine with aura, characterized by the occurrence of a transient hemiplegia during the aura. We previously mapped the affected gene to the short arm of chromosome 19, within a 30 cM interval bracketed by D19S216 and D19S215. Linkage analysis conducted on 2 large FHM pedigrees did not show evidence of heterogeneity, despite their clinical differences due to the presence in one family of a cerebellar ataxia and a nystagmus. Herein we report linkage data on 9 additional FHM families including 2 other ones with cerebellar ataxia. Analysis was conducted with a set of 7 markers spanning the D19S216-D19S215 interval. Two point and multipoint lodscores analysis as well as HOMOG testing provided significant evidence for genetic heterogenity. Strong evidence of linkage was obtained in 3 families and absence of linkage in 6 families. Thus within the 11 families so far tested, 5 were linked, including those with an associated cerebellar ataxia. We could not find any clinical difference between the {open_quotes}pure{close_quotes} FHM families whether or not they were linked. This study also allowed us to establish that the most likely location of the gene is a 12 cM interval bracketed by D19S413 and D19S226. One of the unlinked family was large enough to conduct genetic mapping of the affected gene. Data will be presented at the meeting.

  2. Heterogeneous Participant Recruitment for Comprehensive Vehicle Sensing

    PubMed Central

    Liu, Yazhi; Li, Xiong

    2015-01-01

    Widely distributed mobile vehicles wherein various sensing devices and wireless communication interfaces are installed bring vehicular participatory sensing into practice. However, the heterogeneity of vehicles in terms of sensing capability and mobility, and the participants’ expectations on the incentives blackmake the collection of comprehensive sensing data a challenging task. A sensing data quality-oriented optimal heterogeneous participant recruitment strategy is proposed in this paper for vehicular participatory sensing. In the proposed strategy, the differences between the sensing data requirements and the collected sensing data are modeled. An optimization formula is established to model the optimal participant recruitment problem, and a participant utility analysis scheme is built based on the sensing and mobility features of vehicles. Besides, a greedy algorithm is then designed according to the utility of vehicles to recruit the most efficient vehicles with a limited total incentive budget. Real trace-driven simulations show that the proposed strategy can collect 85.4% of available sensing data with 34% incentive budget. PMID:26407102

  3. Phenotypic Heterogeneity of Monogenic Frontotemporal Dementia

    PubMed Central

    Benussi, Alberto; Padovani, Alessandro; Borroni, Barbara

    2015-01-01

    Frontotemporal dementia (FTD) is a genetically and pathologically heterogeneous disorder characterized by personality changes, language impairment, and deficits of executive functions associated with frontal and temporal lobe degeneration. Different phenotypes have been defined on the basis of presenting clinical symptoms, i.e., the behavioral variant of FTD, the agrammatic variant of primary progressive aphasia, and the semantic variant of PPA. Some patients have an associated movement disorder, either parkinsonism, as in progressive supranuclear palsy and corticobasal syndrome, or motor neuron disease (FTD–MND). A family history of dementia is found in 40% of cases of FTD and about 10% have a clear autosomal-dominant inheritance. Genetic studies have identified several genes associated with monogenic FTD: microtubule-associated protein tau, progranulin, TAR DNA-binding protein 43, valosin-containing protein, charged multivesicular body protein 2B, fused in sarcoma, and the hexanucleotide repeat expansion in intron 1 of the chromosome 9 open reading frame 72. Patients often present with an extensive phenotypic variability, even among different members of the same kindred carrying an identical disease mutation. The objective of the present work is to review and evaluate available literature data in order to highlight recent advances in clinical, biological, and neuroimaging features of monogenic frontotemporal lobar degeneration and try to identify different mechanisms underlying the extreme phenotypic heterogeneity that characterizes this disease. PMID:26388768

  4. Heterogeneous nucleation of aspartame from aqueous solutions

    NASA Astrophysics Data System (ADS)

    Kubota, Noriaki; Kinno, Hiroaki; Shimizu, Kenji

    1990-03-01

    Waiting times, the time from the instant of quenching needed for a first nucleus to appear, were measured at constant supercoolings for primary nucleation of aspartame (α-L-aspartyl-L-phenylalanine methylester) from aqueous solutions, which were sealed into glass ampoules (solution volume = 3.16 cm 3). Since the waiting time became shorter by filtering the solution prior to quenching, the nucleation was concluded to be heterogeneously induced. The measured waiting time consisted of two parts: time needed for the nucleus to grow to a detactable size (growth time) and stochastic time needed for nucleation (true waiting time). The distribution of the true waiting time, is well explained by a stochastic model, in which nucleation is regarded to occur heterogeneously and in a stochastic manner by two kinds of active sites. The active sites are estimated to be located on foreign particles in which such elements as Si, Al and Mg were contained. The amount of each element is very small in the order of magnitude of ppb (mass basis) of the whole solution. The growth time was correlated with the degree of supercooling.

  5. Dynamic contact angle cycling homogenizes heterogeneous surfaces.

    PubMed

    Belibel, R; Barbaud, C; Mora, L

    2016-12-01

    In order to reduce restenosis, the necessity to develop the appropriate coating material of metallic stent is a challenge for biomedicine and scientific research over the past decade. Therefore, biodegradable copolymers of poly((R,S)-3,3 dimethylmalic acid) (PDMMLA) were prepared in order to develop a new coating exhibiting different custom groups in its side chain and being able to carry a drug. This material will be in direct contact with cells and blood. It consists of carboxylic acid and hexylic groups used for hydrophilic and hydrophobic character, respectively. The study of this material wettability and dynamic surface properties is of importance due to the influence of the chemistry and the potential motility of these chemical groups on cell adhesion and polymer kinetic hydrolysis. Cassie theory was used for the theoretical correction of contact angles of these chemical heterogeneous surfaces coatings. Dynamic Surface Analysis was used as practical homogenizer of chemical heterogeneous surfaces by cycling during many cycles in water. In this work, we confirmed that, unlike receding contact angle, advancing contact angle is influenced by the difference of only 10% of acidic groups (%A) in side-chain of polymers. It linearly decreases with increasing acidity percentage. Hysteresis (H) is also a sensitive parameter which is discussed in this paper. Finally, we conclude that cycling provides real information, thus avoiding theoretical Cassie correction. H(10)is the most sensible parameter to %A. PMID:27612817

  6. Infrared and Raman Imaging of Heterogeneous Catalysts

    SciTech Connect

    E Stavistki; B Weckhuysen

    2011-12-31

    The miniaturization of in situ spectroscopic tools has been recognized as a forefront instrumental development for the characterization of heterogeneous catalysts. With the multitude of micro-spectroscopic methods available fundamental insight into the structure-function relationships of catalytic processes can be obtained. Among these techniques vibrational spectroscopy is one of the most versatile methods and capable to shed insight into the molecular structure of reaction intermediates and products, the chemical state of catalyst materials during reaction as well as the nature of interactions between reactants/intermediates/products and the catalyst surface. In this tutorial review we discuss the recent developments in the field of infrared (IR) and Raman micro-spectroscopy and illustrate their potential. Showcase examples include (1) chemical imaging of spatial heterogeneities during catalyst preparation, (2) high-throughput catalyst screening, (3) transport and adsorption phenomena within catalytic solids and (4) reactivity studies of porous oxides, such as zeolites. Finally, new in situ spectroscopy tools based on vibrational spectroscopy and their potential in the catalysis domain are discussed.

  7. Genetic heterogeneity of familial hemiplegic migraine

    SciTech Connect

    Ophoff, R.A.; Van Eijk, R.; Sandkuijl, L.A.

    1994-07-01

    Familial hemiplegic migraine (FHM) is a distinctive form of migraine with an autosomal dominant mode of inheritance. The migraine-like attacks are associated with transient hemiparesis. A locus for FHM has recently been assigned to chromosome 19 by linkage mapping. In the present study, five unrelated pedigrees with multiple members suffering from hemiplegic migraine were investigated. In two of the pedigrees additional symptoms, cerebellar ataxia and benign neonatal convulsions, respectively, were observed in affected members. Three pedigrees showed linkage to loci D19S391, D19S221, and D19S226 at chromosome 19p13. Haplotyping suggested a location of a FHM gene between D19S391 and D19S221. In the two remaining families, evidence against linkage was found. These results confirm the localization of a gene for familial hemiplegic migraine to the short arm of chromosome 19, but locus heterogeneity not corresponding to the observed clinical heterogeneity is likely to exist. 19 refs., 3 figs., 3 tabs.

  8. Heterogeneous magnetic state in nanocrystalline cupric oxide CuO

    NASA Astrophysics Data System (ADS)

    Yermakov, A. Ye.; Uimin, M. A.; Korolyov, A. V.; Mikhalev, K. N.; Pirogov, A. N.; Teplykh, A. E.; Shchegoleva, N. N.; Gaviko, V. S.; Byzov, I. V.; Maikov, V. V.

    2015-02-01

    This paper presents the results of investigations of the structural state and magnetic properties of nanocrystalline cupric oxide samples with average particle sizes of approximately 40 and 13 nm, which were synthesized by the electric explosion and gas phase methods, respectively. The samples have been studied using X-ray diffraction, neutron diffraction, magnetic measurements, high-resolution transmission electron microscopy, and copper nuclear magnetic resonance. It has been shown that, in the initial state, regardless of the synthesis method, CuO nanoparticles are characterized by a heterogeneous magnetic state, i.e., by the existence of long-range antiferromagnetic order, spontaneous magnetization, especially at low temperatures, and paramagnetic centers in the material. The ferromagnetic contribution is probably caused by the formation of magnetic polaron states due to the phase separation induced in the system by excess charge carriers as a result of the existence of point defects (vacancies in the anion sublattice) in the nanocrystalline state. In this state, there is an inhomogeneously broadened nuclear magnetic resonance spectrum, which is a superposition of the spectrum of the initial antiferromagnetic matrix and the spectrum of ferromagnetically ordered regions. At high concentrations of ferromagnetically ordered regions, the antiferromagnetic matrix exhibits a nuclear magnetic resonance spectrum of CuO nanoparticles, predominantly from regions with the ferromagnetic phase. The appearance of magnetization can also be partly due to the frustration of spins in CuO, and this state is presumably localized near the most imperfect surface of the nanoparticles. The magnetic susceptibility of nanoparticles in the initial state in strong magnetic fields is significantly higher than that for the annealed samples, which, most likely, is associated with the influence of the high concentration of magnetic polarons. No correlation between the ferromagnetic

  9. Heterogeneity in Genetic Diversity among Non-Coding Loci Fails to Fit Neutral Coalescent Models of Population History

    PubMed Central

    Peters, Jeffrey L.; Roberts, Trina E.; Winker, Kevin; McCracken, Kevin G.

    2012-01-01

    Inferring aspects of the population histories of species using coalescent analyses of non-coding nuclear DNA has grown in popularity. These inferences, such as divergence, gene flow, and changes in population size, assume that genetic data reflect simple population histories and neutral evolutionary processes. However, violating model assumptions can result in a poor fit between empirical data and the models. We sampled 22 nuclear intron sequences from at least 19 different chromosomes (a genomic transect) to test for deviations from selective neutrality in the gadwall (Anas strepera), a Holarctic duck. Nucleotide diversity among these loci varied by nearly two orders of magnitude (from 0.0004 to 0.029), and this heterogeneity could not be explained by differences in substitution rates alone. Using two different coalescent methods to infer models of population history and then simulating neutral genetic diversity under these models, we found that the observed among-locus heterogeneity in nucleotide diversity was significantly higher than expected for these simple models. Defining more complex models of population history demonstrated that a pre-divergence bottleneck was also unlikely to explain this heterogeneity. However, both selection and interspecific hybridization could account for the heterogeneity observed among loci. Regardless of the cause of the deviation, our results illustrate that violating key assumptions of coalescent models can mislead inferences of population history. PMID:22384117

  10. Fluid dynamics of active heterogeneities in a mantle plume conduit

    NASA Astrophysics Data System (ADS)

    Farnetani, C. G.; Limare, A.; Hofmann, A. W.

    2015-12-01

    Laboratory experiments and numerical simulations indicate that the flow of a purely thermal plume preserves the azimuthal zonation of the source region, thus providing a framework to attribute a deep origin to the isotopic zonation of Hawaiian lavas. However, previous studies were limited to passive heterogeneities not affecting the flow. We go beyond this simplification by considering active heterogeneities which are compositionally denser, or more viscous, and we address the following questions: (1) How do active heterogeneities modify the axially symmetric velocity field of the plume conduit? (2) Under which conditions is the azimuthal zonation of the source region no longer preserved in the plume stem? (3) How do active heterogeneities deform during upwelling and what is their shape once at sublithospheric depths? We conducted both laboratory experiments, using a Particle Image Velocimetry (PIV) to calculate the velocity field, and high resolution three-dimensional simulations where millions of tracers keep track of the heterogeneous fluid. For compositionally denser heterogeneities we cover a range of buoyancy ratios 0heterogeneities, the range of viscosity ratios is 0<λ<20, where λ=ηheterogeneity/ηfluid and η is viscosity. The initial heterogeneity has the arbitrary shape of a sphere and we vary its volume and its distance from the plume axis. We find that by increasing λ, the shape of the heterogeneity changes from filament-like to blob-like characterized by internal rotation and little stretching. By increasing B the heterogeneity tends to spread at the base of the plume stem and to rise as a tendril close to the axis, so that the initial zonation may be poorly preserved. We also find that the plume velocity field can be profoundly modified by active heterogeneities, and we explore the relation between strain rates and the evolving shape of the upwelling heterogeneity.

  11. Numerical and experimental simulations of shock waves propagation through heterogeneous media

    NASA Astrophysics Data System (ADS)

    Ganjehi, L.; Marchiano, R.; Thomas, J.-L.; Coulouvrat, F.

    2006-05-01

    The influence of the planetary boundary layer on the sonic boom received at the ground level is known since the 60s to be a major importance, with a decrease of the mean pressure, an increase of the mean rise time but a huge variability. A generalized "KZ" paraxial approximation of the nonlinear wave equation is obtained in a weakly heterogeneous (small temperature fluctuations) and slowly moving medium (small Mach number), two consistent approximations for the atmosphere. For a non-moving medium, the generalized KZ equation is solved numerically using a finite differences scheme adapted from one developed for sonic boom focusing. To validate quantitatively the model in a deterministic way, experiments are conducted at a 1:100 000 scale for ultrasonic shocks in a water tank. Atmospheric heterogeneities are simulated by introducing cylindrical (sub)wavelength silicon tubes. Experiments and simulation of the nonlinear pressure fields are in very good agreements. The sensitivity of the scattered signal to the size of the heterogeneities is investigated. Also the influence of nonlinear effects on the shock wave/heterogeneity interaction is examined. Finally, the limitation of the paraxial approximation for wave scattering are discussed.

  12. Nuclear Speckles

    PubMed Central

    Spector, David L.; Lamond, Angus I.

    2011-01-01

    Nuclear speckles, also known as interchromatin granule clusters, are nuclear domains enriched in pre-mRNA splicing factors, located in the interchromatin regions of the nucleoplasm of mammalian cells. When observed by immunofluorescence microscopy, they usually appear as 20–50 irregularly shaped structures that vary in size. Speckles are dynamic structures, and their constituents can exchange continuously with the nucleoplasm and other nuclear locations, including active transcription sites. Studies on the composition, structure, and dynamics of speckles have provided an important paradigm for understanding the functional organization of the nucleus and the dynamics of the gene expression machinery. PMID:20926517

  13. Heterogeneity: The key to forecasting material failure?

    NASA Astrophysics Data System (ADS)

    Vasseur, J.; Wadsworth, F. B.; Lavallée, Y.; Dingwell, D. B.

    2014-12-01

    Empirical mechanistic models have been applied to the description of the stress and strain rate upon failure for heterogeneous materials. The behaviour of porous rocks and their analogous two-phase viscoelastic suspensions are particularly well-described by such models. Nevertheless, failure cannot yet be predicted forcing a reliance on other empirical prediction tools such as the Failure Forecast Method (FFM). Measurable, accelerating rates of physical signals (e.g., seismicity and deformation) preceding failure are often used as proxies for damage accumulation in the FFM. Previous studies have already statistically assessed the applicability and performance of the FFM, but none (to the best of our knowledge) has done so in terms of intrinsic material properties. Here we use a rheological standard glass, which has been powdered and then sintered for different times (up to 32 hours) at high temperature (675°C) in order to achieve a sample suite with porosities in the range of 0.10-0.45 gas volume fraction. This sample suite was then subjected to mechanical tests in a uniaxial press at a constant strain rate of 10-3 s-1 and a temperature in the region of the glass transition. A dual acoustic emission (AE) rig has been employed to test the success of the FFM in these materials of systematically varying porosity. The pore-emanating crack model describes well the peak stress at failure in the elastic regime for these materials. We show that the FFM predicts failure within 0-15% error at porosities >0.2. However, when porosities are <0.2, the forecast error associated with predicting the failure time increases to >100%. We interpret these results as a function of the low efficiency with which strain energy can be released in the scenario where there are few or no heterogeneities from which cracks can propagate. These observations shed light on questions surrounding the variable efficacy of the FFM applied to active volcanoes. In particular, they provide a systematic

  14. Spatial Heterogeneity Induces Scale Dependent Rock Friction

    NASA Astrophysics Data System (ADS)

    Yamashita, F.; Fukuyama, E.; Xu, S.; Takizawa, S.; Mizoguchi, K.; Kawakata, H.; Passelègue, F. X.; Schubnel, A.

    2014-12-01

    We carried out large-scale biaxial friction experiments (Fukuyama et al., 2012; 2014) using a pair of meter-sized Indian gabbro as specimens, whose contacting area was 1.5 × 0.1 m2, normal stress was up to 6.7 MPa and loading velocity was up to 3 × 10-2 m/s. After each experiment, we found localized damages (i.e. grooves) were generated on the fault surface and gouges were distributed around them. We confirmed work rate dependency of rock friction as revealed by centimeter-sized rock samples (Di Toro et al., 2011), but further found that the meter-sized rock friction starts to decrease at one order of magnitude smaller work rate than that of the centimeter sized rock (Yamashita et al., 2013, AGU fall meeting). Here, we concluded that this difference is caused by stress localization and associated increase in heterogeneity on the fault as shown by: 1) Total amount of deviations of each local shear stress from the average, which were monitored by strain gauge array, increased with the decrease in friction. 2) Friction coefficients were negatively correlated with degree of spatial heterogeneity evaluated from the distribution of grooves and gouges. 3) Melt textures were found in the collected gouges by microscopic observation using HRSEM. Based on these observations, we propose a stress localization model; the fault surfaces are composed of patched and non-patched areas with high and low normal stress, respectively. The high normal stress patch leads to high shear stress, high mechanical work and thus production of much wear material (gouge), which further causes additional increase in normal stress. Assuming that the local friction follows the results by centimeter-sized gabbro experiments, we numerically simulated a slip-dependent friction for both patched and non-patched areas, and successively reproduced a weakening in macroscopic friction. We confirmed that the work rate dependency of simulated friction was consistent with that of biaxial experiments (Fig. 1

  15. Harvesting geographic features from heterogeneous raster maps

    NASA Astrophysics Data System (ADS)

    Chiang, Yao-Yi

    2010-11-01

    Raster maps offer a great deal of geospatial information and are easily accessible compared to other geospatial data. However, harvesting geographic features locked in heterogeneous raster maps to obtain the geospatial information is challenging. This is because of the varying image quality of raster maps (e.g., scanned maps with poor image quality and computer-generated maps with good image quality), the overlapping geographic features in maps, and the typical lack of metadata (e.g., map geocoordinates, map source, and original vector data). Previous work on map processing is typically limited to a specific type of map and often relies on intensive manual work. In contrast, this thesis investigates a general approach that does not rely on any prior knowledge and requires minimal user effort to process heterogeneous raster maps. This approach includes automatic and supervised techniques to process raster maps for separating individual layers of geographic features from the maps and recognizing geographic features in the separated layers (i.e., detecting road intersections, generating and vectorizing road geometry, and recognizing text labels). The automatic technique eliminates user intervention by exploiting common map properties of how road lines and text labels are drawn in raster maps. For example, the road lines are elongated linear objects and the characters are small connected-objects. The supervised technique utilizes labels of road and text areas to handle complex raster maps, or maps with poor image quality, and can process a variety of raster maps with minimal user input. The results show that the general approach can handle raster maps with varying map complexity, color usage, and image quality. By matching extracted road intersections to another geospatial dataset, we can identify the geocoordinates of a raster map and further align the raster map, separated feature layers from the map, and recognized features from the layers with the geospatial

  16. OH initiated heterogeneous degradation of organophosphorus compounds

    NASA Astrophysics Data System (ADS)

    Liggio, J.; Liu, Y.; Harner, T.; Jantunen, L.; Shoeib, M.; Li, S.

    2013-12-01

    Organophosphorus compounds (OPs) have been extensively used worldwide as flame retardants, plasticizers, antifoaming agents, and additives because of their favorable physicochemical characteristics. The global consumption of OPs is likely to greatly increase due to the phasing out of bromine-containing flame retardants (BFRs) with OPs identified as possible substitutes. In most applications, OPs easily leach out of the material into the environment via volatilization, abrasion, and dissolution and have been observed widely in atmospheric particles even in polar regions. However, little is known about their atmospheric fate. The Canadian Chemicals Management Plan (CMP) has targeted OP FRs for risk assessment, including assessing stability and atmospheric transport potential of OP FRs and other priority chemicals that are associated primarily with particles. In the current study, OH initiated heterogeneous reaction kinetics of tris(1,3-dichloro-2-propyl) phosphate (TDCPP), tris-2-ethylhexyl-phosphate (TEHP), tris-2-butoxyethyl-phosphate (TBEP), and tri-phenyl phosphate (TPhP) coated on (NH4)2SO4 were investigated using a photo-chemical flow tube which was coupled to an Aerosol Mass Spectrometer (AMS) and Proton Transfer Reaction Mass Spectrometer (PTR-MS). second-order rate constants (k2) for the heterogeneous loss of TPhP, TEHP and TDCPP were (2.07×0.19)×10-12, (2.69×0.63)×10-12 and (9.22×0.92)×10-13 cm3 molecule-1 s-1, respectively, from which approximate atmospheric lifetimes were estimated to be 5.6 (5.2-6.0), 4.3 (3.5-5.6), and 12.6 (11.4-14.0) days. These results represent the first reported estimates of heterogeneous rate constants for these species, and suggest that particle bound OPEs will be highly persistent in the atmosphere, supporting the assumption that OPEs can undergo medium or long-range transport, as proposed on the basis of field measurements.

  17. Irreversible adsorption of particles on heterogeneous surfaces.

    PubMed

    Adamczyk, Zbigniew; Jaszczółt, Katarzyna; Michna, Aneta; Siwek, Barbara; Szyk-Warszyńska, Lilianna; Zembala, Maria

    2005-12-30

    Methods of theoretical and experimental evaluation of irreversible adsorption of particles, e.g., colloids and globular proteins at heterogeneous surfaces were reviewed. The theoretical models were based on the generalized random sequential adsorption (RSA) approach. Within the scope of these models, localized adsorption of particles occurring as a result of short-ranged attractive interactions with discrete adsorption sites was analyzed. Monte-Carlo type simulations performed according to this model enabled one to determine the initial flux, adsorption kinetics, jamming coverage and the structure of the particle monolayer as a function of the site coverage and the particle/site size ratio, denoted by lambda. It was revealed that the initial flux increased significantly with the site coverage theta(s) and the lambda parameter. This behavior was quantitatively interpreted in terms of the scaled particle theory. It also was demonstrated that particle adsorption kinetics and the jamming coverage increased significantly, at fixed site coverage, when the lambda parameter increased. Practically, for alpha = lambda2theta(s) > 1 the jamming coverage at the heterogeneous surfaces attained the value pertinent to continuous surfaces. The results obtained prove unequivocally that spherically shaped sites were more efficient in binding particles in comparison with disk-shaped sites. It also was predicted that for particle size ratio lambda < 4 the site multiplicity effect plays a dominant role, affecting significantly the structure of particle monolayers and the jamming coverage. Experimental results validating main aspects of these theoretical predictions also have been reviewed. These results were derived by using monodisperse latex particles adsorbing on substrates produced by covering uniform surface by adsorption sites of a desired size, coverage and surface charge. Particle deposition occurred under diffusion-controlled transport conditions and their coverage was

  18. Spatially correlated heterogeneous aspirations to enhance network reciprocity

    NASA Astrophysics Data System (ADS)

    Tanimoto, Jun; Nakata, Makoto; Hagishima, Aya; Ikegaya, Naoki

    2012-02-01

    Perc & Wang demonstrated that aspiring to be the fittest under conditions of pairwise strategy updating enhances network reciprocity in structured populations playing 2×2 Prisoner's Dilemma games (Z. Wang, M. Perc, Aspiring to the fittest and promoted of cooperation in the Prisoner's Dilemma game, Physical Review E 82 (2010) 021115; M. Perc, Z. Wang, Heterogeneous aspiration promotes cooperation in the Prisoner's Dilemma game, PLOS one 5 (12) (2010) e15117). Through numerical simulations, this paper shows that network reciprocity is even greater if heterogeneous aspirations are imposed. We also suggest why heterogeneous aspiration fosters network reciprocity. It distributes strategy updating speed among agents in a manner that fortifies the initially allocated cooperators' clusters against invasion. This finding prompted us to further enhance the usual heterogeneous aspiration cases for heterogeneous network topologies. We find that a negative correlation between degree and aspiration level does extend cooperation among heterogeneously structured agents.

  19. (Nuclear theory). [Research in nuclear physics

    SciTech Connect

    Haxton, W.

    1990-01-01

    This report discusses research in nuclear physics. Topics covered in this paper are: symmetry principles; nuclear astrophysics; nuclear structure; quark-gluon plasma; quantum chromodynamics; symmetry breaking; nuclear deformation; and cold fusion. (LSP)

  20. Heterogenous catalysis mediated by plasmon heating.

    PubMed

    Adleman, James R; Boyd, David A; Goodwin, David G; Psaltis, Demetri

    2009-12-01

    We introduce a new method for performing and miniaturizing many types of heterogeneous catalysis involving nanoparticles. The method makes use of the plasmon resonance present in nanoscale metal catalysts to provide the necessary heat of reaction when illuminated with a low-power laser. We demonstrate our approach by reforming a flowing, liquid mixture of ethanol and water over gold nanoparticle catalysts in a microfluidic channel. Plasmon heating of the nanoparticles provides not only the heat of reaction but the means to generate both water and ethanol vapor locally over the catalysts, which in turn allows the chip and the fluid lines to remain at room temperature. The measured products of the reaction, CO(2), CO, and H(2), are consistent with catalytic steam reforming of ethanol. The approach, which we refer to as plasmon-assisted catalysis, is general and can be used with a variety of endothermic catalytic processes involving nanoparticles. PMID:19908825

  1. Comprehensive Monitoring for Heterogeneous Geographically Distributed Storage

    NASA Astrophysics Data System (ADS)

    Ratnikova, N.; Karavakis, E.; Lammel, S.; Wildish, T.

    2015-12-01

    Storage capacity at CMS Tier-1 and Tier-2 sites reached over 100 Petabytes in 2014, and will be substantially increased during Run 2 data taking. The allocation of storage for the individual users analysis data, which is not accounted as a centrally managed storage space, will be increased to up to 40%. For comprehensive tracking and monitoring of the storage utilization across all participating sites, CMS developed a space monitoring system, which provides a central view of the geographically dispersed heterogeneous storage systems. The first prototype was deployed at pilot sites in summer 2014, and has been substantially reworked since then. In this paper we discuss the functionality and our experience of system deployment and operation on the full CMS scale.

  2. Mitochondrial disease heterogeneity: a prognostic challenge.

    PubMed

    Moggio, Maurizio; Colombo, Irene; Peverelli, Lorenzo; Villa, Luisa; Xhani, Rubjona; Testolin, Silvia; Di Mauro, Salvatore; Sciacco, Monica

    2014-10-01

    Mitochondrial diseases are a heterogeneous group of progressive, genetically transmitted, multisystem disorders caused by impaired mitochondrial function. The disease course for individuals with mitochondrial myopathies varies greatly from patient to patient because disease progression largely depends on the type of disease and on the degree of involvement of various organs which makes the prognosis unpredictable both within the same family and among families with the same mutation. This is particularly, but not exclusively, true for mitochondrial disorders caused by mtDNA point mutations, which are maternally inherited and subject to the randomness of the heteroplasmy. For this reason, the prognosis cannot be given by single mitochondrial disease, but should be formulated by any single mitochondrial disease-related event or complication keeping in mind that early recognition and treatment of symptoms are crucial for the prognosis. The following approach can help prevent severe organ dysfunctions or at least allow early diagnosis and treatment of disease-related complications. PMID:25709378

  3. Job Scheduling in a Heterogeneous Grid Environment

    NASA Technical Reports Server (NTRS)

    Shan, Hong-Zhang; Smith, Warren; Oliker, Leonid; Biswas, Rupak

    2004-01-01

    Computational grids have the potential for solving large-scale scientific problems using heterogeneous and geographically distributed resources. However, a number of major technical hurdles must be overcome before this potential can be realized. One problem that is critical to effective utilization of computational grids is the efficient scheduling of jobs. This work addresses this problem by describing and evaluating a grid scheduling architecture and three job migration algorithms. The architecture is scalable and does not assume control of local site resources. The job migration policies use the availability and performance of computer systems, the network bandwidth available between systems, and the volume of input and output data associated with each job. An extensive performance comparison is presented using real workloads from leading computational centers. The results, based on several key metrics, demonstrate that the performance of our distributed migration algorithms is significantly greater than that of a local scheduling framework and comparable to a non-scalable global scheduling approach.

  4. Heterogeneous reaction of ozone with aluminum oxide

    NASA Technical Reports Server (NTRS)

    Keyser, L. F.

    1976-01-01

    Rates and collision efficiencies for ozone decomposition on aluminum oxide surfaces were determined. Samples were characterized by BET surface area, X-ray diffraction, particle size, and chemical analysis. Collision efficiencies were found to be between 2 times 10 to the -10 power and 2 times 10 to the -9 power. This is many orders of magnitude below the value of 0.000001 to 0.00001 needed for appreciable long-term ozone loss in the stratosphere. An activation energy of 7.2 kcal/mole was found for the heterogeneous reaction between -40 C and 40 C. Effects of pore diffusion, outgassing and treatment of the aluminum oxide with several chemical species were also investigated.

  5. Achondrogenesis II-hypochondrogenesis: variability versus heterogeneity.

    PubMed

    Borochowitz, Z; Ornoy, A; Lachman, R; Rimoin, D L

    1986-06-01

    Recently hypochondrogenesis was described as a form of neonatally lethal dwarfism said to resemble spondyloepiphyseal dysplasia congenita radiographically and achondrogenesis II morphologically. Because of the difficulty in distinguishing radiographically between mild achondrogenesis II and severe hypochondrogenesis, we performed a clinical, radiographic, and morphologic study of 24 cases originally classified as either achondrogenesis II or hypochondrogenesis, in an attempt to distinguish between heterogeneity and clinical variability. Review of the radiographic findings in these cases show a fairly continuous spectrum of bony defects, rather than two distinct radiographic syndromes. Chondro-osseous histology and ultrastructure was similar in all cases regardless of severity and was characterized by hypervascularity and hypercellularity of the cartilage with multiple small, round dilated cysternae of rough endoplasmic reticulum. These findings suggest that hypochondrogenesis and achondrogenesis type II represent a spectrum with marked phenotypic variability. PMID:3717210

  6. Percolation and permeability of heterogeneous fracture networks

    NASA Astrophysics Data System (ADS)

    Adler, Pierre; Mourzenko, Valeri; Thovert, Jean-François

    2013-04-01

    Natural fracture fields are almost necessarily heterogeneous with a fracture density varying with space. Two classes of variations are quite frequent. In the first one, the fracture density is decreasing from a given surface; the fracture density is usually (but not always see [1]) an exponential function of depth as it has been shown by many measurements. Another important example of such an exponential decrease consists of the Excavated Damaged Zone (EDZ) which is created by the excavation process of a gallery [2,3]. In the second one, the fracture density undergoes some local random variations around an average value. This presentation is mostly focused on the first class and numerical samples are generated with an exponentially decreasing density from a given plane surface. Their percolation status and hydraulic transmissivity can be calculated by the numerical codes which are detailed in [4]. Percolation is determined by a pseudo diffusion algorithm. Flow determination necessitates the meshing of the fracture networks and the discretisation of the Darcy equation by a finite volume technique; the resulting linear system is solved by a conjugate gradient algorithm. Only the flow properties of the EDZ along the directions which are parallel to the wall are of interest when a pressure gradient parallel to the wall is applied. The transmissivity T which relates the total flow rate per unit width Q along the wall through the whole fractured medium to the pressure gradient grad p, is defined by Q = - T grad p/mu where mu is the fluid viscosity. The percolation status and hydraulic transmissivity are systematically determined for a wide range of decay lengths and anisotropy parameters. They can be modeled by comparison with anisotropic fracture networks with a constant density. A heuristic power-law model is proposed which accurately describes the results for the percolation threshold over the whole investigated range of heterogeneity and anisotropy. Then, the data

  7. Job scheduling in a heterogenous grid environment

    SciTech Connect

    Oliker, Leonid; Biswas, Rupak; Shan, Hongzhang; Smith, Warren

    2004-02-11

    Computational grids have the potential for solving large-scale scientific problems using heterogeneous and geographically distributed resources. However, a number of major technical hurdles must be overcome before this potential can be realized. One problem that is critical to effective utilization of computational grids is the efficient scheduling of jobs. This work addresses this problem by describing and evaluating a grid scheduling architecture and three job migration algorithms. The architecture is scalable and does not assume control of local site resources. The job migration policies use the availability and performance of computer systems, the network bandwidth available between systems, and the volume of input and output data associated with each job. An extensive performance comparison is presented using real workloads from leading computational centers. The results, based on several key metrics, demonstrate that the performance of our distributed migration algorithms is significantly greater than that of a local scheduling framework and comparable to a non-scalable global scheduling approach.

  8. Heterogeneity in spending change at retirement

    PubMed Central

    Hurd, Michael D.; Rohwedder, Susann

    2014-01-01

    The simple one-good model of life-cycle consumption requires that consumption be continuous over retirement; yet prior research based on partial measures of consumption or on synthetic panels indicates that spending drops at retirement, a result that has been called the retirement-consumption puzzle. Using panel data on total spending, nondurable spending and food spending, we find that spending declines at small rates at retirement, rates that could be explained by mechanisms such as the cessation of work-related expenses, unexpected retirement due to a health shock or by the substitution of time for spending. We find substantial heterogeneity in spending change at retirement: in the upper half of the wealth distribution spending increased. In the low-wealth population where spending did decline at higher rates, the main explanation for the decline appears to be early retirement due to poor health, possibly augmented by a short planning horizon by a minority of the population. PMID:24524026

  9. Training neural networks with heterogeneous data.

    PubMed

    Drakopoulos, John A; Abdulkader, Ahmad

    2005-01-01

    Data pruning and ordered training are two methods and the results of a small theory that attempts to formalize neural network training with heterogeneous data. Data pruning is a simple process that attempts to remove noisy data. Ordered training is a more complex method that partitions the data into a number of categories and assigns training times to those assuming that data size and training time have a polynomial relation. Both methods derive from a set of premises that form the 'axiomatic' basis of our theory. Both methods have been applied to a time-delay neural network-which is one of the main learners in Microsoft's Tablet PC handwriting recognition system. Their effect is presented in this paper along with a rough estimate of their effect on the overall multi-learner system. The handwriting data and the chosen language are Italian. PMID:16095874

  10. [Psychopathological heterogeneity in opium drug addicts].

    PubMed

    Pani, P P; Carta, M; Rudas, N

    1991-01-01

    The aim of the study was to assess the presence and nature of psychiatric disorders in opium drug addicts. One hundred and six subjects receiving treatment at the CMAS in Cagliari were included in the study. Hathawai and McKinley's MMPI test was preventively carried out on all subjects; each drug addict was then interviewed three times in the space of three weeks in order to formulate a diagnosis in line with DSM III R criteria. The results obtained show a high incidence of psychopathological disorders which are not included among those caused by drug abuse, and a high degree of diagnostic heterogeneity on both axis I and axis II. The comparative assessment of three subsamples undergoing different phases of treatment reveals both qualitative and quantitative differences. PMID:1749353

  11. Heterogeneous distributed databases: A case study

    NASA Technical Reports Server (NTRS)

    Stewart, Tracy R.; Mukkamala, Ravi

    1991-01-01

    Alternatives are reviewed for accessing distributed heterogeneous databases and a recommended solution is proposed. The current study is limited to the Automated Information Systems Center at the Naval Sea Combat Systems Engineering Station at Norfolk, VA. This center maintains two databases located on Digital Equipment Corporation's VAX computers running under the VMS operating system. The first data base, ICMS, resides on a VAX11/780 and has been implemented using VAX DBMS, a CODASYL based system. The second database, CSA, resides on a VAX 6460 and has been implemented using the ORACLE relational database management system (RDBMS). Both databases are used for configuration management within the U.S. Navy. Different customer bases are supported by each database. ICMS tracks U.S. Navy ships and major systems (anti-sub, sonar, etc.). Even though the major systems on ships and submarines have totally different functions, some of the equipment within the major systems are common to both ships and submarines.

  12. Spatially heterogeneous wastage of Himalayan glaciers

    PubMed Central

    Fujita, Koji; Nuimura, Takayuki

    2011-01-01

    We describe volumetric changes in three benchmark glaciers in the Nepal Himalayas on which observations have been made since the 1970s. Compared with the global mean of glacier mass balance, the Himalayan glaciers showed rapid wastage in the 1970s–1990s, but similar wastage in the last decade. In the last decade, a glacier in an arid climate showed negative but suppressed mass balance compared with the period 1970s–1990s, whereas two glaciers in a humid climate showed accelerated wastage. A mass balance model with downscaled gridded datasets depicts the fate of the observed glaciers. We also show a spatially heterogeneous distribution of glacier wastage in the Asian highlands, even under the present-day climate warming. PMID:21808042

  13. Heterogeneity and plasticity of epidermal stem cells

    PubMed Central

    Schepeler, Troels; Page, Mahalia E.; Jensen, Kim B.

    2014-01-01

    The epidermis is an integral part of our largest organ, the skin, and protects us against the hostile environment. It is a highly dynamic tissue that, during normal steady-state conditions, undergoes constant turnover. Multiple stem cell populations residing in autonomously maintained compartments facilitate this task. In this Review, we discuss stem cell behaviour during normal tissue homeostasis, regeneration and disease within the pilosebaceous unit, an integral structure of the epidermis that is responsible for hair growth and lubrication of the epithelium. We provide an up-to-date view of the pilosebaceous unit, encompassing the heterogeneity and plasticity of multiple discrete stem cell populations that are strongly influenced by external cues to maintain their identity and function. PMID:24961797

  14. Heterogeneous, three-dimensional texturing of graphene.

    PubMed

    Wang, Michael Cai; Chun, SungGyu; Han, Ryan Steven; Ashraf, Ali; Kang, Pilgyu; Nam, SungWoo

    2015-03-11

    We report a single-step strategy to achieve heterogeneous, three-dimensional (3D) texturing of graphene and graphite by using a thermally activated shape-memory polymer substrate. Uniform arrays of graphene crumples can be created on the centimeter scale by controlling simple thermal processing parameters without compromising the electrical properties of graphene. In addition, we show the capability to selectively pattern crumples from otherwise flat graphene and graphene/graphite in a localized manner, which has not been previously achievable using other methods. Finally, we demonstrate 3D crumpled graphene field-effect transistor arrays in a solution-gated configuration. The presented approach has the capability to conform onto arbitrary 3D surfaces, a necessary prerequisite for adaptive electronics, and will enable facile large-scale topography engineering of not only graphene but also other thin-film and 2D materials in the future. PMID:25667959

  15. Dynamics on modular networks with heterogeneous correlations

    SciTech Connect

    Melnik, Sergey; Porter, Mason A.; Mucha, Peter J.; Gleeson, James P.

    2014-06-15

    We develop a new ensemble of modular random graphs in which degree-degree correlations can be different in each module, and the inter-module connections are defined by the joint degree-degree distribution of nodes for each pair of modules. We present an analytical approach that allows one to analyze several types of binary dynamics operating on such networks, and we illustrate our approach using bond percolation, site percolation, and the Watts threshold model. The new network ensemble generalizes existing models (e.g., the well-known configuration model and Lancichinetti-Fortunato-Radicchi networks) by allowing a heterogeneous distribution of degree-degree correlations across modules, which is important for the consideration of nonidentical interacting networks.

  16. Solute transport in heterogeneous porous formations

    NASA Astrophysics Data System (ADS)

    Demmy, George Gary, Jr.

    1999-10-01

    This work quantifies relationships between the spatial, or Eulerian, distribution of the properties of a chemically and physically heterogeneous porous medium and those as observed along the natural, or Lagrangian, trajectories that a fluid particle traces in a steady and irrotational flow. From these relationships, expressions that relate the transport of solutes through the porous medium along the natural trajectories to the aforementioned Eulerian distributions are developed. The effects of injection mode upon global measures of transport as reflected by the temporal moments of breakthrough curves and spatial moments of a solute plume are developed. The coupled effects of correlation of a linear equilibrium sorption to the underlying log hydraulic conductivity field and injection mode on the evolving temporal moments of mass breakthrough curve and the coupled effects of correlation of a first-order decay coefficient and injection mode upon the spatial moments of a solute plume are examined.

  17. Seismic signal processing on heterogeneous supercomputers

    NASA Astrophysics Data System (ADS)

    Gokhberg, Alexey; Ermert, Laura; Fichtner, Andreas

    2015-04-01

    The processing of seismic signals - including the correlation of massive ambient noise data sets - represents an important part of a wide range of seismological applications. It is characterized by large data volumes as well as high computational input/output intensity. Development of efficient approaches towards seismic signal processing on emerging high performance computing systems is therefore essential. Heterogeneous supercomputing systems introduced in the recent years provide numerous computing nodes interconnected via high throughput networks, every node containing a mix of processing elements of different architectures, like several sequential processor cores and one or a few graphical processing units (GPU) serving as accelerators. A typical representative of such computing systems is "Piz Daint", a supercomputer of the Cray XC 30 family operated by the Swiss National Supercomputing Center (CSCS), which we used in this research. Heterogeneous supercomputers provide an opportunity for manifold application performance increase and are more energy-efficient, however they have much higher hardware complexity and are therefore much more difficult to program. The programming effort may be substantially reduced by the introduction of modular libraries of software components that can be reused for a wide class of seismology applications. The ultimate goal of this research is design of a prototype for such library suitable for implementing various seismic signal processing applications on heterogeneous systems. As a representative use case we have chosen an ambient noise correlation application. Ambient noise interferometry has developed into one of the most powerful tools to image and monitor the Earth's interior. Future applications will require the extraction of increasingly small details from noise recordings. To meet this demand, more advanced correlation techniques combined with very large data volumes are needed. This poses new computational problems that

  18. Epidemic Extinction and Control in Heterogeneous Networks

    NASA Astrophysics Data System (ADS)

    Hindes, Jason; Schwartz, Ira B.

    2016-07-01

    We consider epidemic extinction in finite networks with a broad variation in local connectivity. Generalizing the theory of large fluctuations to random networks with a given degree distribution, we are able to predict the most probable, or optimal, paths to extinction in various configurations, including truncated power laws. We find that paths for heterogeneous networks follow a limiting form in which infection first decreases in low-degree nodes, which triggers a rapid extinction in high-degree nodes, and finishes with a residual low-degree extinction. The usefulness of our approach is further demonstrated through optimal control strategies that leverage the dependence of finite-size fluctuations on network topology. Interestingly, we find that the optimal control is a mix of treating both high- and low-degree nodes based on theoretical predictions, in contrast to methods that ignore dynamical fluctuations.

  19. Does Environmental Heterogeneity Promote Cognitive Abilities?

    PubMed

    González-Gómez, Paulina L; Razeto-Barry, Pablo; Araya-Salas, Marcelo; Estades, Cristian F

    2015-09-01

    In the context of global change the possible loss of biodiversity has been identified as a major concern. Biodiversity could be seriously threatened as a direct consequence of changes in availability of food, changing thermal conditions, and loss and fragmentation of habitat. Considering the magnitude of global change, an understanding of the mechanisms involved in coping with a changing environment is urgent. We explore the hypothesis that species and individuals experiencing highly variable environments are more likely to develop a wider range of responses to handle the different and unpredictable conditions imposed by global change. In the case of vertebrates, the responses to the challenges imposed by unpredictable perturbations ultimately are linked to cognitive abilities allowing the solving of problems, and the maximization of energy intake. Our models were hummingbirds, which offer a particularly compelling group in which to examine the functional and mechanistic links between behavioral and energetic strategies in individuals experiencing different degrees of social and environmental heterogeneity. PMID:26082484

  20. p53 mutation heterogeneity in cancer

    SciTech Connect

    Soussi, T. . E-mail: thierry.soussi@free.fr; Lozano, G.

    2005-06-10

    The p53 gene is inactivated in about 50% of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy. It is therefore highly likely that these alterations are an important component in tumor resistance to therapy. The particular characteristics of these alterations, 80% of which are missense mutations leading to functionally heterogeneous proteins, make p53 a unique gene in the class of tumor suppressor genes. A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation. The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia.

  1. Heterogeneous chiral catalysis: Past, present, and future

    SciTech Connect

    Brenner, J.R.

    1996-12-31

    In order to improve the scalability of the synthesis of chiral compounds, considerable effort has been devoted to the design of heterogeneous chiral catalysts. The attachment of {open_quotes}curved{close_quotes} chiral ligands, such as cinchona alkaloids, to supported metal complexes has permitted enantioselectivities approaching those in homogeneous solution. While the nature of the support has received less attention, the increased pore structure control gained during the gradual shift from polymeric supports to pillared clays, and finally to mesoporous zeolites and controlled pore glasses will hopefully allow better molecular size and shape control. Future work in this area likely will entail the use of polymeric templates as molecular imprints for protein synthesis and for antibody delivery systems.

  2. Detectability of communities in heterogeneous networks

    NASA Astrophysics Data System (ADS)

    Radicchi, Filippo

    2013-07-01

    Communities are fundamental entities for the characterization of the structure of real networks. The standard approach to the identification of communities in networks is based on the optimization of a quality function known as modularity. Although modularity has been at the center of an intense research activity and many methods for its maximization have been proposed, not much is yet known about the necessary conditions that communities need to satisfy in order to be detectable with modularity maximization methods. Here, we develop a simple theory to establish these conditions, and we successfully apply it to various classes of network models. Our main result is that heterogeneity in the degree distribution helps modularity to correctly recover the community structure of a network and that, in the realistic case of scale-free networks with degree exponent γ<2.5, modularity is always able to detect the presence of communities.

  3. Detectability of communities in heterogeneous networks.

    PubMed

    Radicchi, Filippo

    2013-07-01

    Communities are fundamental entities for the characterization of the structure of real networks. The standard approach to the identification of communities in networks is based on the optimization of a quality function known as modularity. Although modularity has been at the center of an intense research activity and many methods for its maximization have been proposed, not much is yet known about the necessary conditions that communities need to satisfy in order to be detectable with modularity maximization methods. Here, we develop a simple theory to establish these conditions, and we successfully apply it to various classes of network models. Our main result is that heterogeneity in the degree distribution helps modularity to correctly recover the community structure of a network and that, in the realistic case of scale-free networks with degree exponent γ<2.5, modularity is always able to detect the presence of communities. PMID:23944399

  4. Resolution of structural heterogeneity in dynamic crystallography

    PubMed Central

    Ren, Zhong; Chan, Peter W. Y.; Moffat, Keith; Pai, Emil F.; Royer, William E.; Šrajer, Vukica; Yang, Xiaojing

    2013-01-01

    Dynamic behavior of proteins is critical to their function. X-­ray crystallography, a powerful yet mostly static technique, faces inherent challenges in acquiring dynamic information despite decades of effort. Dynamic ‘structural changes’ are often indirectly inferred from ‘structural differences’ by comparing related static structures. In contrast, the direct observation of dynamic structural changes requires the initiation of a biochemical reaction or process in a crystal. Both the direct and the indirect approaches share a common challenge in analysis: how to interpret the structural heterogeneity intrinsic to all dynamic processes. This paper presents a real-space approach to this challenge, in which a suite of analytical methods and tools to identify and refine the mixed structural species present in multiple crystallographic data sets have been developed. These methods have been applied to representative scenarios in dynamic crystallography, and reveal structural information that is otherwise difficult to interpret or inaccessible using conventional methods. PMID:23695239

  5. Metastable dynamics in heterogeneous neural fields.

    PubMed

    Schwappach, Cordula; Hutt, Axel; Beim Graben, Peter

    2015-01-01

    We present numerical simulations of metastable states in heterogeneous neural fields that are connected along heteroclinic orbits. Such trajectories are possible representations of transient neural activity as observed, for example, in the electroencephalogram. Based on previous theoretical findings on learning algorithms for neural fields, we directly construct synaptic weight kernels from Lotka-Volterra neural population dynamics without supervised training approaches. We deliver a MATLAB neural field toolbox validated by two examples of one- and two-dimensional neural fields. We demonstrate trial-to-trial variability and distributed representations in our simulations which might therefore be regarded as a proof-of-concept for more advanced neural field models of metastable dynamics in neurophysiological data. PMID:26175671

  6. Metabolomic Heterogeneity of Pulmonary Arterial Hypertension

    PubMed Central

    Zhao, Yidan; Peng, Jenny; Lu, Catherine; Hsin, Michael; Mura, Marco; Wu, Licun; Chu, Lei; Zamel, Ricardo; Machuca, Tiago; Waddell, Thomas; Liu, Mingyao; Keshavjee, Shaf; Granton, John; de Perrot, Marc

    2014-01-01

    Although multiple gene and protein expression have been extensively profiled in human pulmonary arterial hypertension (PAH), the mechanism for the development and progression of pulmonary hypertension remains elusive. Analysis of the global metabolomic heterogeneity within the pulmonary vascular system leads to a better understanding of disease progression. Using a combination of high-throughput liquid-and-gas-chromatography-based mass spectrometry, we showed unbiased metabolomic profiles of disrupted glycolysis, increased TCA cycle, and fatty acid metabolites with altered oxidation pathways in the human PAH lung. The results suggest that PAH has specific metabolic pathways contributing to increased ATP synthesis for the vascular remodeling process in severe pulmonary hypertension. These identified metabolites may serve as potential biomarkers for the diagnosis of PAH. By profiling metabolomic alterations of the PAH lung, we reveal new pathogenic mechanisms of PAH, opening an avenue of exploration for therapeutics that target metabolic pathway alterations in the progression of PAH. PMID:24533144

  7. Heterogeneous vibrations in {sup 112}Sn

    SciTech Connect

    Kumar, A.; Orce, J.N.; Lesher, S.R.; McKay, C.J.; McEllistrem, M.T.; Yates, S.W.

    2005-09-01

    The low-lying structure of {sup 112}Sn has been studied by use of the (n,n{sup '}{gamma}) reaction. Excitation functions and angular distributions of {gamma} rays have been used to characterize the decays of the excited levels, and level lifetimes have been measured with the Doppler-shift attenuation method. A {gamma}-{gamma} coincidence experiment has also been performed to confirm {gamma}-ray placements. Low-lying 1{sup -}, 2{sup (-)},3{sup -}, and 5{sup -} states are suggested as members of a heterogeneous quadrupole-octupole quintuplet. Their excitation energies and decay properties are consistent with a structure formed by the coupling of the lowest quadrupole 2{sub 1}{sup +} and octupole 3{sub 1}{sup -} excitations.

  8. Heterogeneous metasurface for high temperature selective emission

    SciTech Connect

    Woolf, D. Hensley, J.; Cederberg, J. G.; Bethke, D. T.; Grine, A. D.; Shaner, E. A.

    2014-08-25

    We demonstrate selective emission from a heterogeneous metasurface that can survive repeated temperature cycling at 1300 K. Simulations, fabrication, and characterization were performed for a cross-over-a-backplane metasurface consisting of platinum and alumina layers on a sapphire substrate. The structure was stabilized for high temperature operation by an encapsulating alumina layer. The geometry was optimized for integration into a thermophotovoltaic (TPV) system, and was designed to have its emissivity matched to the external quantum efficiency spectrum of 0.6 eV InGaAs TPV material. We present spectral measurements of the metasurface that result in a predicted 22% optical-to-electrical power conversion efficiency in a simplified model at 1300 K. Furthermore, this broadly adaptable selective emitter design can be easily integrated into full-scale TPV systems.

  9. The heterogeneous nature of NG2-glia.

    PubMed

    Viganò, F; Dimou, L

    2016-05-01

    In the central nervous system, NG2-glia are the cells responsible for the generation of mature oligodendrocytes during development and adulthood. Some studies could show that NG2-glia can give origin also to astrocytes and neurons, a property that makes them similar to neural stem cells. Beside their important role as progenitors, NG2-glia are believed also to have more functions due to their unique interaction with neurons through synapses. It is however not clear whether these features are common to all NG2-glia or different subpopulations of NG2-glia devoted to different functions exist. Therefore the aim of this review is to highlight the state of the art on NG2-glia heterogeneity from development to adulthood and in different brain areas, and discuss the impact of it on our understanding of the glial neurobiology. This article is part of a Special Issue entitled SI:NG2-glia(Invited only). PMID:26388262

  10. Heterogeneous Interactions of Acetaldehyde and Sulfuric Acid

    NASA Technical Reports Server (NTRS)

    Michelsen, R. R.; Ashbourn, S. F. M.; Iraci, L. T.

    2004-01-01

    The uptake of acetaldehyde [CH3CHO] by aqueous sulfuric acid has been studied via Knudsen cell experiments over ranges of temperature (210-250 K) and acid concentration (40-80 wt. %) representative of the upper troposphere. The Henry's law constants for acetaldehyde calculated from these data range from 6 x 10(exp 2) M/atm for 40 wt. % H2SO4 at 228 K to 2 x 10(exp 5) M/atm for 80 wt. % H2SO4 at 212 K. In some instances, acetaldehyde uptake exhibits apparent steady-state loss. The possible sources of this behavior, including polymerization, will be explored. Furthermore, the implications for heterogeneous reactions of aldehydes in sulfate aerosols in the upper troposphere will be discussed.

  11. Comprehensive Monitoring for Heterogeneous Geographically Distributed Storage

    SciTech Connect

    Ratnikova, N.; Karavakis, E.; Lammel, S.; Wildish, T.

    2015-12-23

    Storage capacity at CMS Tier-1 and Tier-2 sites reached over 100 Petabytes in 2014, and will be substantially increased during Run 2 data taking. The allocation of storage for the individual users analysis data, which is not accounted as a centrally managed storage space, will be increased to up to 40%. For comprehensive tracking and monitoring of the storage utilization across all participating sites, CMS developed a space monitoring system, which provides a central view of the geographically dispersed heterogeneous storage systems. The first prototype was deployed at pilot sites in summer 2014, and has been substantially reworked since then. In this paper we discuss the functionality and our experience of system deployment and operation on the full CMS scale.

  12. Shock wave structure in heterogeneous reactive media

    SciTech Connect

    Baer, M.R.

    1997-06-01

    Continuum mixture theory and mesoscale modeling are applied to describe the behavior of shock-loaded heterogeneous media. One-dimensional simulations of gas-gun experiments demonstrate that the wave features are well described by mixture theory, including reflected wave behavior and conditions where significant reaction is initiated. Detailed wave fields are resolved in numerical simulations of impact on a lattice of discrete explosive {open_quotes}crystals{close_quotes}. It is shown that rapid distortion first occurs at material contact points; the nature of the dispersive fields includes large amplitude fluctuations of stress over several particle pathlengths. Localization of energy causes {open_quotes}hot-spots{close_quotes} due to shock focusing and plastic work as material flows into interstitial regions.

  13. RMIX: A Dynamic, Heterogeneous, Reconfigurable Communication Framework

    SciTech Connect

    Engelmann, Christian; Geist, Al

    2006-01-01

    RMIX is a dynamic, heterogeneous, reconfigurable communication framework that allows software components to communicate using various RMI/RPC protocols, such as ONC RPC, Java RMI and SOAP, by facilitating dynamically loadable provider plug-ins to supply different protocol stacks. With this paper, we present a native (C-based), flexible, adaptable, multi-protocol RMI/RPC communication framework that complements the Java-based RMIX variant previously developed by our partner team at Emory University. Our approach offers the same multi-protocol RMI/RPC services and advanced invocation semantics via a C-based interface that does not require an object-oriented programming language. This paper provides a detailed description of our RMIX framework architecture and some of its features. It describes the general use case of the RMIX framework and its integration into the Harness metacomputing environment in form of a plug-in.

  14. Development of a Heterogeneous Laminating Resin

    NASA Technical Reports Server (NTRS)

    Gosnell, R.

    1984-01-01

    The feasibility of toughening the common types of matrix resins such as Narmco 5208 by utilizing a heterogeneous additive was examined. Some basic concepts and principles in the toughening of matrix resins for advanced composites were studied. The following conclusions were advanced: (1) the use of damage volume as a guide for measurement of impact resistance appears to be a valid determination; (2) short beam shear is a good test to determine the effect of toughening agents on mechanical properties; (3) rubber toughening results in improved laminate impact strength, but with substantial loss in high temperature dry and wet strength; (4) in the all-epoxy systems, the polycarbonate toughening agent seemed to be the most effective, although hot-wet strength is sacrificed; ABS was not as effective; and (5) in general, the toughened all-epoxy systems showed better damage tolerance, but less hot-wet strength; toughened bismaleimides had better hot-wet strength.

  15. AXAF user interfaces for heterogeneous analysis environments

    NASA Technical Reports Server (NTRS)

    Mandel, Eric; Roll, John; Ackerman, Mark S.

    1992-01-01

    The AXAF Science Center (ASC) will develop software to support all facets of data center activities and user research for the AXAF X-ray Observatory, scheduled for launch in 1999. The goal is to provide astronomers with the ability to utilize heterogeneous data analysis packages, that is, to allow astronomers to pick the best packages for doing their scientific analysis. For example, ASC software will be based on IRAF, but non-IRAF programs will be incorporated into the data system where appropriate. Additionally, it is desired to allow AXAF users to mix ASC software with their own local software. The need to support heterogeneous analysis environments is not special to the AXAF project, and therefore finding mechanisms for coordinating heterogeneous programs is an important problem for astronomical software today. The approach to solving this problem has been to develop two interfaces that allow the scientific user to run heterogeneous programs together. The first is an IRAF-compatible parameter interface that provides non-IRAF programs with IRAF's parameter handling capabilities. Included in the interface is an application programming interface to manipulate parameters from within programs, and also a set of host programs to manipulate parameters at the command line or from within scripts. The parameter interface has been implemented to support parameter storage formats other than IRAF parameter files, allowing one, for example, to access parameters that are stored in data bases. An X Windows graphical user interface called 'agcl' has been developed, layered on top of the IRAF-compatible parameter interface, that provides a standard graphical mechanism for interacting with IRAF and non-IRAF programs. Users can edit parameters and run programs for both non-IRAF programs and IRAF tasks. The agcl interface allows one to communicate with any command line environment in a transparent manner and without any changes to the original environment. For example, the authors

  16. Genetics of multiple myeloma: another heterogeneity level?

    PubMed Central

    Corre, Jill; Munshi, Nikhil

    2015-01-01

    Our knowledge of myeloma genetics remained limited and lagged behind many other hematologic malignancies because of the inherent difficulties in generating metaphases within the malignant plasma cell clone. With the development of molecular techniques (microarrays and next-generation sequencing), our understanding has been highly improved in the past 5 years. These studies have not only confirmed the prevalence of wide heterogeneity in myeloma at the molecular level, but has also provided a much clearer picture of the disease pathogenesis and progression. Whether these data will enable improvements in the therapeutic approach is still a matter of debate. The next improvement will come from detailed analyses of these molecular features to try to move from a treatment fitted to every patient to individualized therapies, taking into account the complexity of the chromosomal changes, the mutation spectrum, and subclonality evolution. PMID:25628468

  17. Metastable dynamics in heterogeneous neural fields

    PubMed Central

    Schwappach, Cordula; Hutt, Axel; beim Graben, Peter

    2015-01-01

    We present numerical simulations of metastable states in heterogeneous neural fields that are connected along heteroclinic orbits. Such trajectories are possible representations of transient neural activity as observed, for example, in the electroencephalogram. Based on previous theoretical findings on learning algorithms for neural fields, we directly construct synaptic weight kernels from Lotka-Volterra neural population dynamics without supervised training approaches. We deliver a MATLAB neural field toolbox validated by two examples of one- and two-dimensional neural fields. We demonstrate trial-to-trial variability and distributed representations in our simulations which might therefore be regarded as a proof-of-concept for more advanced neural field models of metastable dynamics in neurophysiological data. PMID:26175671

  18. Characterization of Reservoir Heterogeneity from Surface Deformation

    NASA Astrophysics Data System (ADS)

    Maharramov, M.; Zoback, M. D.

    2015-12-01

    In our earlier work we resolved complex evolution of pressure fronts in a heavyoil reservoir undergoing cyclic steam stimulation. Our method was based onsolving a regularized inverse problem for inverting the pore pressure changefrom surface displacements. In this work we extend our method to recoversharp contrasts in induced reservoir pressure that may be due to permeabilitybarriers or hydraulically conductive faults. We demonstrate our method byinverting the pressure change from uplift observations for a synthetic modelof a heterogeneous reservoir undergoing fluid injection. Using the theory ofconstrained optimization, we invert values and locations of sharp pressurecontrasts from noisy measurements of surface deformation, and estimate thelocation of an impermeable boundary between reservoir compartments. In our synthetic model, two highly permeable reservoir compartmentsseparated by a nearly impermeable barrier (first panel) undergo fluid injec-tion. We simulate pressure evolution within the reservoir (second panel) andmodel surface deformation induced by the subsurface pressure change (thirdpanel), adding measurement noise to the result. We invert the noisy sur-face uplift measurements by solving a constrained optimization problem withTikhonov regularization (fourth panel). The result achieves a good inversionquality in areas of finite pressure change but provides only a rough estimatefor the barrier location. However, applying our new inversion technique with atotal-variation regularization that favors sharp model contrasts while penalizingoscillations, we achieve a more accurate approximation of the permeabilitybarrier as a level set of the inverted pressure field (fifth panel). Our new method provides a potentially useful tool for locating sharpsubsurface pressure contrasts from surface uplift observations. The methodcan be used in a variety of applications for identifying subsurface permeabil-ity heterogeneities (such as seals and hydraulically conductive

  19. The heterogeneous dynamics of economic complexity.

    PubMed

    Cristelli, Matthieu; Tacchella, Andrea; Pietronero, Luciano

    2015-01-01

    What will be the growth of the Gross Domestic Product (GDP) or the competitiveness of China, United States, and Vietnam in the next 3, 5 or 10 years? Despite this kind of questions has a large societal impact and an extreme value for economic policy making, providing a scientific basis for economic predictability is still a very challenging problem. Recent results of a new branch--Economic Complexity--have set the basis for a framework to approach such a challenge and to provide new perspectives to cast economic prediction into the conceptual scheme of forecasting the evolution of a dynamical system as in the case of weather dynamics. We argue that a recently introduced non-monetary metrics for country competitiveness (fitness) allows for quantifying the hidden growth potential of countries by the means of the comparison of this measure for intangible assets with monetary figures, such as GDP per capita. This comparison defines the fitness-income plane where we observe that country dynamics presents strongly heterogeneous patterns of evolution. The flow in some zones is found to be laminar while in others a chaotic behavior is instead observed. These two regimes correspond to very different predictability features for the evolution of countries: in the former regime, we find strong predictable pattern while the latter scenario exhibits a very low predictability. In such a framework, regressions, the usual tool used in economics, are no more the appropriate strategy to deal with such a heterogeneous scenario and new concepts, borrowed from dynamical systems theory, are mandatory. We therefore propose a data-driven method--the selective predictability scheme--in which we adopt a strategy similar to the methods of analogues, firstly introduced by Lorenz, to assess future evolution of countries. PMID:25671312

  20. Computational drug repositioning through heterogeneous network clustering

    PubMed Central

    2013-01-01

    Background Given the costly and time consuming process and high attrition rates in drug discovery and development, drug repositioning or drug repurposing is considered as a viable strategy both to replenish the drying out drug pipelines and to surmount the innovation gap. Although there is a growing recognition that mechanistic relationships from molecular to systems level should be integrated into drug discovery paradigms, relatively few studies have integrated information about heterogeneous networks into computational drug-repositioning candidate discovery platforms. Results Using known disease-gene and drug-target relationships from the KEGG database, we built a weighted disease and drug heterogeneous network. The nodes represent drugs or diseases while the edges represent shared gene, biological process, pathway, phenotype or a combination of these features. We clustered this weighted network to identify modules and then assembled all possible drug-disease pairs (putative drug repositioning candidates) from these modules. We validated our predictions by testing their robustness and evaluated them by their overlap with drug indications that were either reported in published literature or investigated in clinical trials. Conclusions Previous computational approaches for drug repositioning focused either on drug-drug and disease-disease similarity approaches whereas we have taken a more holistic approach by considering drug-disease relationships also. Further, we considered not only gene but also other features to build the disease drug networks. Despite the relative simplicity of our approach, based on the robustness analyses and the overlap of some of our predictions with drug indications that are under investigation, we believe our approach could complement the current computational approaches for drug repositioning candidate discovery. PMID:24564976