Science.gov

Sample records for a1 iga1 protease

  1. IgA1 proteases of Haemophilus influenzae: cloning and characterization in Escherichia coli K-12.

    PubMed Central

    Bricker, J; Mulks, M H; Plaut, A G; Moxon, E R; Wright, A

    1983-01-01

    Haemophilus influenzae is one of several bacterial pathogens known to release IgA1 proteases into the extracellular environment. Each H. influenzae isolate produces one of at least three distinct types of these enzymes that differ in the specific peptide bond they cleave in the hinge region of human IgA1. We have isolated the gene specifying type 1 IgA1 protease from a total genomic library of H. influenzae, subcloned it into plasmid vectors, and introduced these vectors into Escherichia coli K-12. The enzyme synthesized by E. coli was active and had the same specificity as that of the H. influenzae donor. Unlike that of the donor, E. coli protease activity accumulated in the periplasm rather than being transported extracellularly. The position of the protease gene in H. influenzae DNA and its direction of transcription was approximated by deletion mapping. Tn5 insertions, and examination of the polypeptides synthesized by minicells. A 1-kilobase probe excised from the IgA1 protease gene hybridized with DNA restriction fragments of all H. influenzae serogroups but not with DNA of a nonpathogenic H. parainfluenzae species known to be IgA1 protease negative. Images PMID:6341996

  2. IgA1 Protease Treatment Reverses Mesangial Deposits and Hematuria in a Model of IgA Nephropathy.

    PubMed

    Lechner, Sebastian M; Abbad, Lilia; Boedec, Erwan; Papista, Christina; Le Stang, Marie-Bénédicte; Moal, Christelle; Maillard, Julien; Jamin, Agnès; Bex-Coudrat, Julie; Wang, Yong; Li, Aiqun; Martini, Paolo G V; Monteiro, Renato C; Berthelot, Laureline

    2016-09-01

    IgA nephropathy (IgAN), characterized by mesangial IgA1 deposits, is a leading cause of renal failure worldwide. IgAN pathogenesis involves circulating hypogalactosylated IgA1 complexed with soluble IgA Fc receptor I (sCD89) and/or anti-hypogalactosylated-IgA1 autoantibodies, but no specific treatment is available for IgAN. The absence of IgA1 and CD89 homologs in the mouse has precluded in vivo proof-of-concept studies of specific therapies targeting IgA1. However, the α1KI‑CD89Tg mouse model of IgAN, which expresses human IgA1 and human CD89, allows in vivo testing of recombinant IgA1 protease (IgA1‑P), a bacterial protein that selectively cleaves human IgA1. Mice injected with IgA1‑P (1-10 mg/kg) had Fc fragments of IgA1 in both serum and urine, associated with a decrease in IgA1-sCD89 complexes. Levels of mesangial IgA1 deposits and the binding partners of these deposits (sCD89, transferrin receptor, and transglutaminase 2) decreased markedly 1 week after treatment, as did the levels of C3 deposition, CD11b(+) infiltrating cells, and fibronectin. Antiprotease antibodies did not significantly alter IgA1‑P activity. Moreover, hematuria consistently decreased after treatment. In conclusion, IgA1‑P strongly diminishes human IgA1 mesangial deposits and reduces inflammation, fibrosis, and hematuria in a mouse IgAN model, and therefore may be a plausible treatment for patients with IgAN. Copyright © 2016 by the American Society of Nephrology.

  3. Immunoglobulins in Nasal Secretions of Healthy Humans: Structural Integrity of Secretory Immunoglobulin A1 (IgA1) and Occurrence of Neutralizing Antibodies to IgA1 Proteases of Nasal Bacteria

    PubMed Central

    Kirkeby, Line; Rasmussen, Trine Tang; Reinholdt, Jesper; Kilian, Mogens

    2000-01-01

    Certain bacteria, including overt pathogens as well as commensals, produce immunoglobulin A1 (IgA1) proteases. By cleaving IgA1, including secretory IgA1, in the hinge region, these enzymes may interfere with the barrier functions of mucosal IgA antibodies, as indicated by experiments in vitro. Previous studies have suggested that cleavage of IgA1 in nasal secretions may be associated with the development and perpetuation of atopic disease. To clarify the potential effect of IgA1 protease-producing bacteria in the nasal cavity, we have analyzed immunoglobulin isotypes in nasal secretions of 11 healthy humans, with a focus on IgA, and at the same time have characterized and quantified IgA1 protease-producing bacteria in the nasal flora of the subjects. Samples in the form of nasal wash were collected by using a washing liquid that contained lithium as an internal reference. Dilution factors and, subsequently, concentrations in undiluted secretions could thereby be calculated. IgA, mainly in the secretory form, was found by enzyme-linked immunosorbent assay to be the dominant isotype in all subjects, and the vast majority of IgA (median, 91%) was of the A1 subclass, corroborating results of previous analyses at the level of immunoglobulin-producing cells. Levels of serum-type immunoglobulins were low, except for four subjects in whom levels of IgG corresponded to 20 to 66% of total IgA. Cumulative levels of IgA, IgG, and IgM in undiluted secretions ranged from 260 to 2,494 (median, 777) μg ml−1. IgA1 protease-producing bacteria (Haemophilus influenzae, Streptococcus pneumoniae, or Streptococcus mitis biovar 1) were isolated from the nasal cavities of seven subjects at 2.1 × 103 to 7.2 × 106 CFU per ml of undiluted secretion, corresponding to 0.2 to 99.6% of the flora. Nevertheless, α-chain fragments characteristic of IgA1 protease activity were not detected in secretions from any subject by immunoblotting. Neutralizing antibodies to IgA1 proteases of autologous

  4. Genetic and biochemical analysis of gonococcal IgA1 protease: cloning in Escherichia coli and construction of mutants of gonococci that fail to produce the activity.

    PubMed Central

    Koomey, J M; Gill, R E; Falkow, S

    1982-01-01

    The biological significance of bacterial extracellular proteases that specifically cleave human IgA1 is unknown. We have prepared a gene bank of gonococcal chromosomal DNA in Escherichia coli K-12 using a cosmid cloning system. Among these clones, we have identified and characterized an E. coli strain that elaborates an extracellular endopeptidase that is indistinguishable from gonococcal IgA1 protease in its substrate specificity and action on human IgA1. Analysis of recombinant plasmids and examination of plasmid-specific peptides in minicells have shown that the IgA1 protease activity in E. coli is associated with expression of a Mr 140,000 peptide. We have isolated IgA1 protease-deficient mutants of Neisseria gonorrhoeae by reintroduction of physically defined deletions of the cloned gene into the gonococcal chromosome by transformation. Images PMID:6818556

  5. Similar proportions of immunoglobulin A1 (IgA1) protease-producing streptococci in initial dental plaque of selectively IgA-deficient and normal individuals.

    PubMed Central

    Reinholdt, J; Friman, V; Kilian, M

    1993-01-01

    By comparing the initial colonization of cleaned teeth in immunoglobulin A (IgA)-deficient, IgM-compensating individuals with that in normal individuals, no significant difference in the proportion of IgA1 protease-producing streptococci was found. Thus, as one of several bacterial means of immune evasion, the ability to cleave secretory IgA1 does not appear essential to the successful adherence of oral streptococci. PMID:8359924

  6. Internalization and trafficking of nontypeable Haemophilus influenzae in human respiratory epithelial cells and roles of IgA1 proteases for optimal invasion and persistence.

    PubMed

    Clementi, Cara F; Håkansson, Anders P; Murphy, Timothy F

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells.

  7. Internalization and Trafficking of Nontypeable Haemophilus influenzae in Human Respiratory Epithelial Cells and Roles of IgA1 Proteases for Optimal Invasion and Persistence

    PubMed Central

    Clementi, Cara F.; Håkansson, Anders P.

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells. PMID:24218477

  8. Clustered O-Glycans of IgA1

    PubMed Central

    Takahashi, Kazuo; Wall, Stephanie B.; Suzuki, Hitoshi; Smith, Archer D.; Hall, Stacy; Poulsen, Knud; Kilian, Mogens; Mobley, James A.; Julian, Bruce A.; Mestecky, Jiri; Novak, Jan; Renfrow, Matthew B.

    2010-01-01

    IgA nephropathy (IgAN) is the most common primary glomerulonephritis in the world. Aberrantly glycosylated IgA1, with galactose (Gal)-deficient hinge region (HR) O-glycans, plays a pivotal role in the pathogenesis of the disease. It is not known whether the glycosylation defect occurs randomly or preferentially at specific sites. We have described the utility of activated ion-electron capture dissociation (AI-ECD) mass spectrometric analysis of IgA1 O-glycosylation. However, locating and characterizing the entire range of O-glycan attachment sites are analytically challenging due to the clustered serine and threonine residues in the HR of IgA1 heavy chain. To address this problem, we analyzed all glycoforms of the HR glycopeptides of a Gal-deficient IgA1 myeloma protein, mimicking the aberrant IgA1 in patients with IgAN, by use of a combination of IgA-specific proteases + trypsin and AI-ECD Fourier transform ion cyclotron resonance (FT-ICR) tandem mass spectrometry (MS/MS). The IgA-specific proteases provided a variety of IgA1 HR fragments that allowed unambiguous localization of all O-glycosylation sites in the six most abundant glycoforms, including the sites deficient in Gal. Additionally, this protocol was adapted for on-line liquid chromatography (LC)-AI-ECD MS/MS and LC-electron transfer dissociation MS/MS analysis. Our results thus represent a new clinically relevant approach that requires ECD/electron transfer dissociation-type fragmentation to define the molecular events leading to pathogenesis of a chronic kidney disease. Furthermore, this work offers generally applicable principles for the analysis of clustered sites of O-glycosylation. PMID:20823119

  9. Occurrence and evolution of the paralogous zinc metalloproteases IgA1 protease, ZmpB, ZmpC, and ZmpD in Streptococcus pneumoniae and related commensal species.

    PubMed

    Bek-Thomsen, Malene; Poulsen, Knud; Kilian, Mogens

    2012-01-01

    The distribution, genome location, and evolution of the four paralogous zinc metalloproteases, IgA1 protease, ZmpB, ZmpC, and ZmpD, in Streptococcus pneumoniae and related commensal species were studied by in silico analysis of whole genomes and by activity screening of 154 representatives of 20 species. ZmpB was ubiquitous in the Mitis and Salivarius groups of the genus Streptococcus and in the genera Gemella and Granulicatella, with the exception of a fragmented gene in Streptococcus thermophilus, the only species with a nonhuman habitat. IgA1 protease activity was observed in all members of S. pneumoniae, S. pseudopneumoniae, S. oralis, S. sanguinis, and Gemella haemolysans, was variably present in S. mitis and S. infantis, and absent in S. gordonii, S. parasanguinis, S. cristatus, S. oligofermentans, S. australis, S. peroris, and S. suis. Phylogenetic analysis of 297 zmp sequences and representative housekeeping genes provided evidence for an unprecedented selection for genetic diversification of the iga, zmpB, and zmpD genes in S. pneumoniae and evidence of very frequent intraspecies transfer of entire genes and combination of genes. Presumably due to their adaptation to a commensal lifestyle, largely unaffected by adaptive mucosal immune factors, the corresponding genes in commensal streptococci have remained conserved. The widespread distribution and significant sequence diversity indicate an ancient origin of the zinc metalloproteases predating the emergence of the humanoid species. zmpB, which appears to be the ancestral gene, subsequently duplicated and successfully diversified into distinct functions, is likely to serve an important but yet unknown housekeeping function associated with the human host. The paralogous zinc metalloproteases IgA1 protease, ZmpB, ZmpC, and ZmpD have been identified as crucial for virulence of the human pathogen Streptococcus pneumoniae. This study maps the presence of the corresponding genes and enzyme activities in S

  10. Occurrence and Evolution of the Paralogous Zinc Metalloproteases IgA1 Protease, ZmpB, ZmpC, and ZmpD in Streptococcus pneumoniae and Related Commensal Species

    PubMed Central

    Bek-Thomsen, Malene; Poulsen, Knud; Kilian, Mogens

    2012-01-01

    ABSTRACT The distribution, genome location, and evolution of the four paralogous zinc metalloproteases, IgA1 protease, ZmpB, ZmpC, and ZmpD, in Streptococcus pneumoniae and related commensal species were studied by in silico analysis of whole genomes and by activity screening of 154 representatives of 20 species. ZmpB was ubiquitous in the Mitis and Salivarius groups of the genus Streptococcus and in the genera Gemella and Granulicatella, with the exception of a fragmented gene in Streptococcus thermophilus, the only species with a nonhuman habitat. IgA1 protease activity was observed in all members of S. pneumoniae, S. pseudopneumoniae, S. oralis, S. sanguinis, and Gemella haemolysans, was variably present in S. mitis and S. infantis, and absent in S. gordonii, S. parasanguinis, S. cristatus, S. oligofermentans, S. australis, S. peroris, and S. suis. Phylogenetic analysis of 297 zmp sequences and representative housekeeping genes provided evidence for an unprecedented selection for genetic diversification of the iga, zmpB, and zmpD genes in S. pneumoniae and evidence of very frequent intraspecies transfer of entire genes and combination of genes. Presumably due to their adaptation to a commensal lifestyle, largely unaffected by adaptive mucosal immune factors, the corresponding genes in commensal streptococci have remained conserved. The widespread distribution and significant sequence diversity indicate an ancient origin of the zinc metalloproteases predating the emergence of the humanoid species. zmpB, which appears to be the ancestral gene, subsequently duplicated and successfully diversified into distinct functions, is likely to serve an important but yet unknown housekeeping function associated with the human host. PMID:23033471

  11. Irreversible aggregation of the Fc fragment derived from polymeric but not monomeric serum IgA1--implications in IgA-mediated disease.

    PubMed

    Almogren, Adel; Kerr, Michael A

    2008-01-01

    IgA is by far the most abundant immunoglobulin in humans. It is found in serum and in secretions (SIgA). Unlike any other class of immunoglobulin, each form of IgA occurs naturally in different polymerisation states. In serum, the predominant form of IgA is IgA1 of which around 90% is monomeric and 10% is dimeric or polymeric. The proportion of dimeric/polymeric IgA increases in a number of important diseases, such as IgA nephropathy and in chronic liver disease. In both, there is evidence that further aggregation of dimeric/polymeric IgA is the cause of the characteristic tissue deposition. To investigate the effect of role of IgA polymerisation on the structure and function of IgA, we purified different molecular forms of IgA1 from myeloma serum (monomer, dimer and trimer) and SIgA1 from colostrum. Structural features of these different IgA1 forms were examined following proteolysis using Neisseria gonorrhoeae IgA1 type 2 protease and Streptococcus pneumoniae IgA1 protease. These IgA1 proteases cleave IgA1 at the hinge region and produce Fcalpha and Fab fragments. Western blot analysis demonstrated that the Fcalpha fragments of serum dimeric and trimeric but not monomeric IgA1 aggregated to form multimers resistant to disruption in SDS-PAGE under non-reducing conditions. Size exclusion chromatography under native conditions of cleaved serum dimeric IgA1 demonstrated that aggregation occurs because of structural changes in the IgA per se and was not an effect of the SDS-PAGE system. In the same assay, SIgA1 (dimeric) did not aggregate after digestion. The results suggest an important, previously unrecognised, property of dimeric/polymeric serum IgA1, which might explain its propensity to aggregate and deposit in tissues.

  12. IgA1-secreting cell lines from patients with IgA nephropathy produce aberrantly glycosylated IgA1

    PubMed Central

    Suzuki, Hitoshi; Moldoveanu, Zina; Hall, Stacy; Brown, Rhubell; Vu, Huong L.; Novak, Lea; Julian, Bruce A.; Tomana, Milan; Wyatt, Robert J.; Edberg, Jeffrey C.; Alarcón, Graciela S.; Kimberly, Robert P.; Tomino, Yasuhiko; Mestecky, Jiri; Novak, Jan

    2008-01-01

    Aberrant glycosylation of IgA1 plays an essential role in the pathogenesis of IgA nephropathy. This abnormality is manifested by a deficiency of galactose in the hinge-region O-linked glycans of IgA1. Biosynthesis of these glycans occurs in a stepwise fashion beginning with the addition of N-acetylgalactosamine by the enzyme N-acetylgalactosaminyltransferase 2 and continuing with the addition of either galactose by β1,3-galactosyltransferase or a terminal sialic acid by a N-acetylgalactosamine–specific α2,6-sialyltransferase. To identify the molecular basis for the aberrant IgA glycosylation, we established EBV-immortalized IgA1-producing cells from peripheral blood cells of patients with IgA nephropathy. The secreted IgA1 was mostly polymeric and had galactose-deficient O-linked glycans, characterized by a terminal or sialylated N-acetylgalactosamine. As controls, we showed that EBV-immortalized cells from patients with lupus nephritis and healthy individuals did not produce IgA with the defective galactosylation pattern. Analysis of the biosynthetic pathways in cloned EBV-immortalized cells from patients with IgA nephropathy indicated a decrease in β1,3-galactosyltransferase activity and an increase in N-acetylgalactosamine–specific α2,6-sialyltransferase activity. Also, expression of β1,3-galactosyltransferase was significantly lower, and that of N-acetylgalactosamine–specific α2,6-sialyltransferase was significantly higher than the expression of these genes in the control cells. Thus, our data suggest that premature sialylation likely contributes to the aberrant IgA1 glycosylation in IgA nephropathy and may represent a new therapeutic target. PMID:18172551

  13. Serum galactose-deficient IgA1 levels in children with IgA nephropathy.

    PubMed

    Jiang, Mengjie; Jiang, Xiaoyun; Rong, Liping; Xu, Yuanyuan; Chen, Lizhi; Qiu, Zeting; Mo, Ying

    2015-01-01

    Immunoglobulin A nephropathy (IgAN) is an immunopathologic diagnosis based on a renal biopsy, it is characterized by deposits of IgA-containing immune complexes in the mesangium. Adults with IgAN have a galactose-deficient IgA1 in the circulation and glomerular deposition. There are few studies on the glycosylation of serum IgA1 in children with IgAN. To measure the serum levels of galactose-deficient IgA1 in pediatric patients with IgAN, 72 biopsy-proven IgAN children were divided into 3 groups based on the clinical features: isolated hematuria group (24 patients), hematuria and proteinuria group (22 patients), and nephritic syndrome group (26 patients). They were also divided into 3 groups according to pathologic grading: grade I + II group (25 patients), grade III group (33 patients) and grade IV + V group (14 patients). 30 healthy children were recruited as a control group. We used vicia villosa lectin binding enzyme-linked immunosorbent assay to measure the serum levels of galactose-deficient IgA1 in all groups and controls. Serum levels of galactose-deficient IgA1 in children with IgAN were higher than controls (P < 0.01). There were no significant differences in serum levels of galactose-deficient IgA1 among the different clinical and pathologic grading groups. The values of the area under the curve for galactose-deficient IgA1 levels were 0.976 (95% CI, 0.953-1.000). The cutoff point for galactose-deficient IgA1 levels was 0.125, with a sensitivity of 87.5% and a specificity of 83.3%, with a positive predictive value of 92.6% and a negative predictive value of 73.5% (P < 0.01). Children with IgAN presented serum galactose-deficient IgA1, which has shown no relationship with the clinical manifestations and pathologic grading of the disease. Detection of serum galactose-deficient IgA1 levels by vicia villosa lectin binding enzyme-linked immunosorbent assay has a certain clinical value in diagnosis of children with IgAN.

  14. Naturally Occurring Structural Isomers in Serum IgA1 O-Glycosylation

    PubMed Central

    Takahashi, Kazuo; Smith, Archer D.; Poulsen, Knud; Kilian, Mogens; Julian, Bruce A.; Mestecky, Jiri; Novak, Jan; Renfrow, Matthew B.

    2013-01-01

    IgA is the most abundantly produced antibody and plays an important role in the mucosal immune system. Human IgA is represented by two isotypes, IgA1 and IgA2. The major structural difference between these two subclasses is the presence of nine potential sites of O-glycosylation in the hinge region between the first and second constant region domains of the heavy chain. Thr225, Thr228, Ser230, Ser232 and Thr236 have been identified as the predominant sites of O-glycan attachment. The range and distribution of O-glycan chains at each site within the context of adjacent sites in this clustered region create a complex heterogeneity of surface epitopes that is incompletely defined. We previously described the analysis of IgA1 O-glycan heterogeneity by use of high resolution LC/MS and electron capture dissociation tandem MS to unambiguously localize all amino acid attachment sites in IgA1 (Ale) myeloma protein. Here, we report the identification and elucidation of IgA1 O-glycopeptide structural isomers that occur based on amino acid position of the attached glycans (positional isomers) and the structure of the O-glycan chains at individual sites (glycan isomers). These isomers are present in a model IgA1 (Mce1) myeloma protein and occur naturally in normal human serum IgA1. Variable O-glycan chains attached to Ser230, Thr233 or Thr236 produce the predominant positional isomers, including O-glycans composed of a single GalNAc residue. These findings represent the first definitive identification of structural isomeric IgA1 O-glycoforms, define the single-site heterogeneity for all O-glycan sites in a single sample, and have implications for defining epitopes based on clustered O-glycan variability. PMID:22067045

  15. Naturally occurring structural isomers in serum IgA1 o-glycosylation.

    PubMed

    Takahashi, Kazuo; Smith, Archer D; Poulsen, Knud; Kilian, Mogens; Julian, Bruce A; Mestecky, Jiri; Novak, Jan; Renfrow, Matthew B

    2012-02-03

    IgA is the most abundantly produced antibody and plays an important role in the mucosal immune system. Human IgA is represented by two isotypes, IgA1 and IgA2. The major structural difference between these two subclasses is the presence of nine potential sites of O-glycosylation in the hinge region between the first and second constant region domains of the heavy chain. Thr(225), Thr(228), Ser(230), Ser(232) and Thr(236) have been identified as the predominant sites of O-glycan attachment. The range and distribution of O-glycan chains at each site within the context of adjacent sites in this clustered region create a complex heterogeneity of surface epitopes that is incompletely defined. We previously described the analysis of IgA1 O-glycan heterogeneity by use of high resolution LC-MS and electron capture dissociation tandem MS to unambiguously localize all amino acid attachment sites in IgA1 (Ale) myeloma protein. Here, we report the identification and elucidation of IgA1 O-glycopeptide structural isomers that occur based on amino acid position of the attached glycans (positional isomers) and the structure of the O-glycan chains at individual sites (glycan isomers). These isomers are present in a model IgA1 (Mce1) myeloma protein and occur naturally in normal human serum IgA1. Variable O-glycan chains attached to Ser(230), Thr(233) or Thr(236) produce the predominant positional isomers, including O-glycans composed of a single GalNAc residue. These findings represent the first definitive identification of structural isomeric IgA1 O-glycoforms, define the single-site heterogeneity for all O-glycan sites in a single sample, and have implications for defining epitopes based on clustered O-glycan variability.

  16. Clustered O-glycans of IgA1: defining macro- and microheterogeneity by use of electron capture/transfer dissociation.

    PubMed

    Takahashi, Kazuo; Wall, Stephanie B; Suzuki, Hitoshi; Smith, Archer D; Hall, Stacy; Poulsen, Knud; Kilian, Mogens; Mobley, James A; Julian, Bruce A; Mestecky, Jiri; Novak, Jan; Renfrow, Matthew B

    2010-11-01

    IgA nephropathy (IgAN) is the most common primary glomerulonephritis in the world. Aberrantly glycosylated IgA1, with galactose (Gal)-deficient hinge region (HR) O-glycans, plays a pivotal role in the pathogenesis of the disease. It is not known whether the glycosylation defect occurs randomly or preferentially at specific sites. We have described the utility of activated ion-electron capture dissociation (AI-ECD) mass spectrometric analysis of IgA1 O-glycosylation. However, locating and characterizing the entire range of O-glycan attachment sites are analytically challenging due to the clustered serine and threonine residues in the HR of IgA1 heavy chain. To address this problem, we analyzed all glycoforms of the HR glycopeptides of a Gal-deficient IgA1 myeloma protein, mimicking the aberrant IgA1 in patients with IgAN, by use of a combination of IgA-specific proteases + trypsin and AI-ECD Fourier transform ion cyclotron resonance (FT-ICR) tandem mass spectrometry (MS/MS). The IgA-specific proteases provided a variety of IgA1 HR fragments that allowed unambiguous localization of all O-glycosylation sites in the six most abundant glycoforms, including the sites deficient in Gal. Additionally, this protocol was adapted for on-line liquid chromatography (LC)-AI-ECD MS/MS and LC-electron transfer dissociation MS/MS analysis. Our results thus represent a new clinically relevant approach that requires ECD/electron transfer dissociation-type fragmentation to define the molecular events leading to pathogenesis of a chronic kidney disease. Furthermore, this work offers generally applicable principles for the analysis of clustered sites of O-glycosylation.

  17. Reactivities of N-acetylgalactosamine-specific lectins with human IgA1 proteins

    PubMed Central

    Moore, Jennifer S.; Kulhavy, Rose; Tomana, Milan; Moldoveanu, Zina; Brown, Rhubell; Hall, Stacy; Kilian, Mogens; Poulsen, Knud; Mestecky, Jiri; Julian, Bruce A.; Novak, Jan

    2009-01-01

    Lectins are proteins with specificity of binding to certain monosaccharides or oligosaccharides. They can detect abnormal glycosylation patterns on immunoglobulins in patients with various chronic inflammatory diseases, including rheumatoid arthritis and IgA nephropathy (IgAN). However, lectins exhibit binding heterogeneity, depending on their source and methods of isolation. To characterize potential differences in recognition of terminal N-acetylgalactosamine (GalNAc) on IgA1, we evaluated the binding characteristics of several commercial preparations of GalNAc-specific lectins using a panel of IgA1 and, as controls, IgA2 and IgG myeloma proteins. These lectins were from snails Helix aspersa (HAA) and Helix pomatia (HPA), and the plant Vicia villosa (VV). Only HAA and HPA bound exclusively to IgA1, with its O-linked glycans composed of GalNAc, galactose, and sialic acid. In contrast, VV reacted with sugars of both IgA subclasses and IgG, indicating that it also recognized N-linked glycans without GalNAc. Furthermore, HAA and HPA from several manufacturers differed in their ability to bind various IgA1 myeloma proteins and other GalNAc-containing glycoproteins in ELISA and western blot. For serum samples from IgAN patients, HAA was the optimal lectin to study IgA1 glycosylation in ELISA and western blot assays, including identification of the sites of attachment of the aberrant glycans. The Gal-deficient glycans were site-specific, localized mostly at Thr228 and/or Ser230. Because of the heterogeneity of GalNAc-specific lectins, they should be carefully characterized with appropriate substrates before undertaking any study. PMID:17275907

  18. IgA1 dominant subclass of latent IgA mesangial deposition in donated kidney

    PubMed Central

    Oka, Kazumasa; Nishimura, Kenji; Kishikawa, Hidefumi; Ichikawa, Yasuji

    2016-01-01

    Background In the pathogenesis of immunoglobulin A nephropathy (IgAN), the IgA1 subclass is more important than the IgA2 subclass. In healthy men, the prevalence of mesangial IgA deposition has been previously investigated. However, it remains unknown whether the presence of urinary abnormalities depends on the subclass of IgA deposition. Materials and methods We researched the subclasses of IgA (IgA1 and IgA2) by the direct immunofluorescence (IF) staining method using specimens in which we identified the deposition of IgA through zero-hour renal transplant biopsies from donors without urinary abnormalities. The samples of the zero-hour biopsies were collected from 46 cases of living renal transplant patients at Nishinomiya Hospital, Hyogo Prefecture, from January 2011 to December 2013. Results In seven of the 46 cases (15%), IgA deposition and C3 in mesangium were confirmed. All seven cases showed IgA1 predominant mesangial deposition on IF. The results of the histological evaluations for all seven cases were Oxford Classification M0.S0.E0.T0. Conclusion This study showed similar patterns of latent mesangial IgA deposition according to IgA subclass and frequency of C3 deposition as IgAN. Latent mesangial IgA deposition may require some, as yet undefined factors, to become clinically apparent as IgAN. PMID:27942230

  19. IgA1 dominant subclass of latent IgA mesangial deposition in donated kidney.

    PubMed

    Oka, Kazumasa; Nishimura, Kenji; Kishikawa, Hidefumi; Ichikawa, Yasuji

    2016-01-01

    In the pathogenesis of immunoglobulin A nephropathy (IgAN), the IgA1 subclass is more important than the IgA2 subclass. In healthy men, the prevalence of mesangial IgA deposition has been previously investigated. However, it remains unknown whether the presence of urinary abnormalities depends on the subclass of IgA deposition. We researched the subclasses of IgA (IgA1 and IgA2) by the direct immunofluorescence (IF) staining method using specimens in which we identified the deposition of IgA through zero-hour renal transplant biopsies from donors without urinary abnormalities. The samples of the zero-hour biopsies were collected from 46 cases of living renal transplant patients at Nishinomiya Hospital, Hyogo Prefecture, from January 2011 to December 2013. In seven of the 46 cases (15%), IgA deposition and C3 in mesangium were confirmed. All seven cases showed IgA1 predominant mesangial deposition on IF. The results of the histological evaluations for all seven cases were Oxford Classification M0.S0.E0.T0. This study showed similar patterns of latent mesangial IgA deposition according to IgA subclass and frequency of C3 deposition as IgAN. Latent mesangial IgA deposition may require some, as yet undefined factors, to become clinically apparent as IgAN.

  20. Aberrant IgA1 Glycosylation in IgA Nephropathy: A Systematic Review

    PubMed Central

    Sun, Qiang; Zhang, Zhenhai; Liu, Xiaorong

    2016-01-01

    Objective Galactose-deficient IgA1 was evaluated in patients with IgA nephropathy(IgAN) and controls in order to determine the predictive value of galactose-deficient IgA1 in cases of IgA nephropathy. Methods PubMed, EMBASE, Cochrane central register of controlled trials, CNKI, CBM disc, and VIP database were searched to identify eligible studies that evaluated a difference in aberrant IgA1 glycosylation in IgAN patients compared with controls. A meta-analysis was conducted to evaluate the impact of galactose-deficient IgA1(Gd-IgA1) levels in different groups. Results A total of 22 studies (n = 1657) met inclusion criteria. The mean Newcastle-Ottawa Scale (NOS) score was 7.2 and ranged from 6 to 8. The standard mean difference(SMD) in the meta-analysis of 20 studies of the level of Gd-IgA1 in the serum and/or supernatant of cultured cells was higher in the IgAN group compared with healthy controls as well as in those with other renal diseases (SMD = 1.76, 95% CI = 1.18–2.34, P<0.00001; SMD = 1.05, 95% CI = 0.05–2.04, P = 0.04). The data synthesis suggested that IgAN patients had similar levels of serum Gd-IgA1, with no significant differences, compared with first-degree relatives and Henoch-Schonlein purpura nephritis (HSPN) patients (MD = 0.04, 95% CI = 0.00–0.08, P = 0.05; MD = -46.03, 95% CI = -217.70–125.64, P = 0.60). In addition, the combined MD of 5 studies indicated that there were no significant differences in Gd-IgA1 levels among patients with varying severities of IgAN (MD = 0.02, 95% CI = -0.02–0.05, P = 0.28). Conclusions The pooled evidence suggests that the level of Gd-IgA1 in the serum or supernatant of cultured cells from peripheral blood or tonsils may be a useful biomarker for predicting IgA nephropathy, though the level of Gd-IgA1 was not significantly associated with disease severity. PMID:27870872

  1. Galactosylation of IgA1 Is Associated with Common Variation in C1GALT1.

    PubMed

    Gale, Daniel P; Molyneux, Karen; Wimbury, David; Higgins, Patricia; Levine, Adam P; Caplin, Ben; Ferlin, Anna; Yin, Peiran; Nelson, Christopher P; Stanescu, Horia; Samani, Nilesh J; Kleta, Robert; Yu, Xueqing; Barratt, Jonathan

    2017-02-16

    IgA nephropathy (IgAN), an important cause of kidney failure, is characterized by glomerular IgA deposition and is associated with changes in O-glycosylation of the IgA1 molecule. Here, we sought to identify genetic factors contributing to levels of galactose-deficient IgA1 (Gd-IgA1) in white and Chinese populations. Gd-IgA1 levels were elevated in IgAN patients compared with ethnically matched healthy subjects and correlated with evidence of disease progression. White patients with IgAN exhibited significantly higher Gd-IgA1 levels than did Chinese patients. Among individuals without IgAN, Gd-IgA1 levels did not correlate with kidney function. Gd-IgA1 level heritability (h(2)), estimated by comparing midparental and offspring Gd-IgA1 levels, was 0.39. Genome-wide association analysis by linear regression identified alleles at a single locus spanning the C1GALT1 gene that strongly associated with Gd-IgA1 level (β=0.26; P=2.35×10(-9)). This association was replicated in a genome-wide association study of separate cohorts comprising 308 patients with membranous GN from the UK (P<1.00×10(-6)) and 622 controls with normal kidney function from the UK (P<1.00×10(-10)), and in a candidate gene study of 704 Chinese patients with IgAN (P<1.00×10(-5)). The same extended haplotype associated with elevated Gd-IgA1 levels in all cohorts studied. C1GALT1 encodes a galactosyltransferase enzyme that is important in O-galactosylation of glycoproteins. These findings demonstrate that common variation at C1GALT1 influences Gd-IgA1 level in the population, which independently associates with risk of progressive IgAN, and that the pathogenic importance of changes in IgA1 O-glycosylation may vary between white and Chinese patients with IgAN.

  2. Abnormal IgD and IgA1 O-glycosylation in hyperimmunoglobulinaemia D and periodic fever syndrome.

    PubMed

    de Wolff, Jacob F; Dickinson, Stephen J; Smith, Alice C; Molyneux, Karen; Feehally, John; Simon, Anna; Barratt, Jonathan

    2009-12-01

    In order to determine the glycosylation pattern for IgD, and to examine whether there are changes in the pattern of IgD and IgA1 O-glycosylation in patients with hyperimmunoglobulinaemia D and periodic fever syndrome (HIDS) during acute febrile attacks and during periods of quiescence, serum was obtained from 20 patients with HIDS and 20 control subjects. In the HIDS group, serum was obtained either during an acute febrile episode (n = 9) or during a period of quiescence (n = 11). The O-glycosylation profiles of native and desialylated IgA1 and IgD were measured in an ELISA-type system using the lectins Helix aspersa and peanut agglutinin, which bind to alternative forms of O-glycan moieties. IgD is more heavily O-galactosylated and less O-sialylated than IgA1 in healthy subjects. HIDS is associated with more extensive O-galactosylation of IgD and a reduction in O-sialylation of both IgD and IgA1. These changes are present both during acute febrile attacks and periods of quiescence. The T cell IgD receptor is a lectin with binding affinity for the O-glycans of both IgD and IgA1. The observed changes in IgD and IgA1 O-glycosylation are likely to have a significant effect on IgD/IgA1-T cell IgD receptor interactions including basal immunoglobulin synthesis, and possibly myeloid IgD receptor-mediated cytokine release.

  3. Patients with IgA nephropathy have increased serum galactose-deficient IgA1 levels.

    PubMed

    Moldoveanu, Z; Wyatt, R J; Lee, J Y; Tomana, M; Julian, B A; Mestecky, J; Huang, W-Q; Anreddy, S R; Hall, S; Hastings, M C; Lau, K K; Cook, W J; Novak, J

    2007-06-01

    Immunoglobulin A (IgA) nephropathy is the most prevalent form of glomerulonephritis worldwide. A renal biopsy is required for an accurate diagnosis, as no convenient biomarker is currently available. We developed a serological test based upon the observation that this nephropathy is characterized by undergalactosylated IgA1 in the circulation and in mesangial immune deposits. In the absence of galactose, the terminal saccharide of O-linked chains in the hinge region of IgA1 is terminal or sialylated N-acetylgalactosamine. A lectin from Helix aspersa, recognizing N-acetylgalactosamine, was used to develop an enzyme-linked immunosorbent assay that measures galactose-deficient IgA1 in serum. The median serum lectin-binding IgA1 level was significantly higher for 153 Caucasian adult patients with IgA nephropathy without progression to end-stage renal disease as compared with that for 150 healthy Caucasian adult controls. As the lectin-binding IgA1 levels for the controls were not normally distributed, the 90th percentile was used for determination of significant elevation. Using a value of 1076 U/ml as the upper limit of normal, 117 of the 153 patients with IgA nephropathy had an elevated serum lectin-binding IgA1 level. The sensitivity as a diagnostic test was 76.5%, with specificity 94%; the positive predictive value was 88.6% and the negative predictive value was 78.9%. We conclude that this lectin-binding assay may have potential as a noninvasive diagnostic test for IgA nephropathy.

  4. Transient Glyco-Engineering to Produce Recombinant IgA1 with Defined N- and O-Glycans in Plants

    PubMed Central

    Dicker, Martina; Tschofen, Marc; Maresch, Daniel; König, Julia; Juarez, Paloma; Orzaez, Diego; Altmann, Friedrich; Steinkellner, Herta; Strasser, Richard

    2016-01-01

    The production of therapeutic antibodies to combat pathogens and treat diseases, such as cancer is of great interest for the biotechnology industry. The recent development of plant-based expression systems has demonstrated that plants are well-suited for the production of recombinant monoclonal antibodies with defined glycosylation. Compared to immunoglobulin G (IgG), less effort has been undertaken to express immunoglobulin A (IgA), which is the most prevalent antibody class at mucosal sites and a promising candidate for novel recombinant biopharmaceuticals with enhanced anti-tumor activity. Here, we transiently expressed recombinant human IgA1 against the VP8* rotavirus antigen in glyco-engineered ΔXT/FT Nicotiana benthamiana plants. Mass spectrometric analysis of IgA1 glycopeptides revealed the presence of complex biantennary N-glycans with terminal N-acetylglucosamine present on the N-glycosylation site of the CH2 domain in the IgA1 alpha chain. Analysis of the peptide carrying nine potential O-glycosylation sites in the IgA1 alpha chain hinge region showed the presence of plant-specific modifications including hydroxyproline formation and the attachment of pentoses. By co-expression of enzymes required for initiation and elongation of human O-glycosylation it was possible to generate disialylated mucin-type core 1 O-glycans on plant-produced IgA1. Our data demonstrate that ΔXT/FT N. benthamiana plants can be engineered toward the production of recombinant IgA1 with defined human-type N- and O-linked glycans. PMID:26858738

  5. Transient Glyco-Engineering to Produce Recombinant IgA1 with Defined N- and O-Glycans in Plants.

    PubMed

    Dicker, Martina; Tschofen, Marc; Maresch, Daniel; König, Julia; Juarez, Paloma; Orzaez, Diego; Altmann, Friedrich; Steinkellner, Herta; Strasser, Richard

    2016-01-01

    The production of therapeutic antibodies to combat pathogens and treat diseases, such as cancer is of great interest for the biotechnology industry. The recent development of plant-based expression systems has demonstrated that plants are well-suited for the production of recombinant monoclonal antibodies with defined glycosylation. Compared to immunoglobulin G (IgG), less effort has been undertaken to express immunoglobulin A (IgA), which is the most prevalent antibody class at mucosal sites and a promising candidate for novel recombinant biopharmaceuticals with enhanced anti-tumor activity. Here, we transiently expressed recombinant human IgA1 against the VP8* rotavirus antigen in glyco-engineered ΔXT/FT Nicotiana benthamiana plants. Mass spectrometric analysis of IgA1 glycopeptides revealed the presence of complex biantennary N-glycans with terminal N-acetylglucosamine present on the N-glycosylation site of the CH2 domain in the IgA1 alpha chain. Analysis of the peptide carrying nine potential O-glycosylation sites in the IgA1 alpha chain hinge region showed the presence of plant-specific modifications including hydroxyproline formation and the attachment of pentoses. By co-expression of enzymes required for initiation and elongation of human O-glycosylation it was possible to generate disialylated mucin-type core 1 O-glycans on plant-produced IgA1. Our data demonstrate that ΔXT/FT N. benthamiana plants can be engineered toward the production of recombinant IgA1 with defined human-type N- and O-linked glycans.

  6. Proteolysis of bacterial membrane proteins by Neisseria gonorrhoeae type 2 immunoglobulin A1 protease.

    PubMed Central

    Shoberg, R J; Mulks, M H

    1991-01-01

    The immunoglobulin A1 (IgA1) proteases of Neisseria gonorrhoeae have been defined as having human IgA1 as their single permissive substrate. However, in recent years there have been reports of other proteins which are susceptible to the proteolytic activity of these enzymes. To examine the possibility that gonococcal membrane proteins are potential substrates for these enzymes, isolated outer and cytoplasmic membranes of N. gonorrhoeae were treated in vitro with exogenous pure IgA1 protease. Analysis of silver-stained sodium dodecyl sulfate-polyacrylamide gels of outer membranes indicated that there were two outer membrane proteins of 78 and 68 kDa which were cleaved by IgA1 protease in vitro in GCM 740 (a wild-type strain) and in two isogenic IgA1 protease-negative variants. Similar results were observed with a second gonococcal strain, F62, and its isogenic IgA1 protease-negative derivative. When GCM 740 cytoplasmic membranes were treated with protease, three minor proteins of 24.5, 23.5, and 21.5 kDa were cleaved. In addition, when outer membranes of Escherichia coli DH1 were treated with IgA1 protease, several proteins were hydrolyzed. While the identities of all of these proteolyzed proteins are unknown, the data presented indicate that there are several proteins found in the isolated membranes of gram-negative bacteria which are permissive in vitro substrates for gonococcal IgA1 protease. Images PMID:1713195

  7. GWAS for serum galactose-deficient IgA1 implicates critical genes of the O-glycosylation pathway

    PubMed Central

    Kiryluk, Krzysztof; Moldoveanu, Zina; Suzuki, Hitoshi; Reily, Colin; Hou, Ping; Xie, Jingyuan; Mladkova, Nikol; Prakash, Sindhuri; Fischman, Clara; Shapiro, Samantha; Bradbury, Drew; Ionita-Laza, Iuliana; Eitner, Frank; Rauen, Thomas; Maillard, Nicolas; Floege, Jürgen; Chen, Nan; Zhang, Hong; Scolari, Francesco; Wyatt, Robert J.; Julian, Bruce A.; Gharavi, Ali G.; Novak, Jan

    2017-01-01

    Aberrant O-glycosylation of serum immunoglobulin A1 (IgA1) represents a heritable pathogenic defect in IgA nephropathy, the most common form of glomerulonephritis worldwide, but specific genetic factors involved in its determination are not known. We performed a quantitative GWAS for serum levels of galactose-deficient IgA1 (Gd-IgA1) in 2,633 subjects of European and East Asian ancestry and discovered two genome-wide significant loci, in C1GALT1 (rs13226913, P = 3.2 x 10−11) and C1GALT1C1 (rs5910940, P = 2.7 x 10−8). These genes encode molecular partners essential for enzymatic O-glycosylation of IgA1. We demonstrated that these two loci explain approximately 7% of variability in circulating Gd-IgA1 in Europeans, but only 2% in East Asians. Notably, the Gd-IgA1-increasing allele of rs13226913 is common in Europeans, but rare in East Asians. Moreover, rs13226913 represents a strong cis-eQTL for C1GALT1 that encodes the key enzyme responsible for the transfer of galactose to O-linked glycans on IgA1. By in vitro siRNA knock-down studies, we confirmed that mRNA levels of both C1GALT1 and C1GALT1C1 determine the rate of secretion of Gd-IgA1 in IgA1-producing cells. Our findings provide novel insights into the genetic regulation of O-glycosylation and are relevant not only to IgA nephropathy, but also to other complex traits associated with O-glycosylation defects, including inflammatory bowel disease, hematologic disease, and cancer. PMID:28187132

  8. GWAS for serum galactose-deficient IgA1 implicates critical genes of the O-glycosylation pathway.

    PubMed

    Kiryluk, Krzysztof; Li, Yifu; Moldoveanu, Zina; Suzuki, Hitoshi; Reily, Colin; Hou, Ping; Xie, Jingyuan; Mladkova, Nikol; Prakash, Sindhuri; Fischman, Clara; Shapiro, Samantha; LeDesma, Robert A; Bradbury, Drew; Ionita-Laza, Iuliana; Eitner, Frank; Rauen, Thomas; Maillard, Nicolas; Berthoux, Francois; Floege, Jürgen; Chen, Nan; Zhang, Hong; Scolari, Francesco; Wyatt, Robert J; Julian, Bruce A; Gharavi, Ali G; Novak, Jan

    2017-02-01

    Aberrant O-glycosylation of serum immunoglobulin A1 (IgA1) represents a heritable pathogenic defect in IgA nephropathy, the most common form of glomerulonephritis worldwide, but specific genetic factors involved in its determination are not known. We performed a quantitative GWAS for serum levels of galactose-deficient IgA1 (Gd-IgA1) in 2,633 subjects of European and East Asian ancestry and discovered two genome-wide significant loci, in C1GALT1 (rs13226913, P = 3.2 x 10-11) and C1GALT1C1 (rs5910940, P = 2.7 x 10-8). These genes encode molecular partners essential for enzymatic O-glycosylation of IgA1. We demonstrated that these two loci explain approximately 7% of variability in circulating Gd-IgA1 in Europeans, but only 2% in East Asians. Notably, the Gd-IgA1-increasing allele of rs13226913 is common in Europeans, but rare in East Asians. Moreover, rs13226913 represents a strong cis-eQTL for C1GALT1 that encodes the key enzyme responsible for the transfer of galactose to O-linked glycans on IgA1. By in vitro siRNA knock-down studies, we confirmed that mRNA levels of both C1GALT1 and C1GALT1C1 determine the rate of secretion of Gd-IgA1 in IgA1-producing cells. Our findings provide novel insights into the genetic regulation of O-glycosylation and are relevant not only to IgA nephropathy, but also to other complex traits associated with O-glycosylation defects, including inflammatory bowel disease, hematologic disease, and cancer.

  9. Recognition of galactose-deficient O-glycans in the hinge region of IgA1 by N-acetylgalactosamine-specific snail lectins: a comparative binding study†

    PubMed Central

    Gomes, Michelle M.; Suzuki, Hitoshi; Brooks, Monica T.; Tomana, Milan; Moldoveanu, Zina; Mestecky, Jiri; Julian, Bruce A.; Novak, Jan; Herr, Andrew B.

    2010-01-01

    Aberrancies in IgA1 glycosylation have been linked to the pathogenesis of IgA nephropathy (IgAN), a kidney disease characterized by deposits of IgA1-containing immune complexes in the glomerular mesangium. IgA1 from IgAN patients is characterized by the presence of galactose (Gal)-deficient O-glycans in the hinge region that can act as epitopes for anti-glycan IgG or IgA1 antibodies. The resulting circulating immune complexes are trapped in the glomerular mesangium of the kidney where they trigger localized inflammatory responses by activating mesangial cells. Certain lectins recognize the terminal N-acetylgalactosamine (GalNAc)-containing O-glycans on Gal-deficient IgA1 and can be potentially used as diagnostic tools. To better understand GalNAc recognition by these lectins, we have carried out binding studies to assess the interaction of Helix aspersa agglutinin (HAA) and Helix pomatia agglutinin (HPA) with Gal-deficient IgA1. Surface plasmon resonance spectroscopy revealed that both HAA and HPA bind to a Gal-deficient synthetic hinge-region glycopeptide (HR-GalNAc) as well as various aberrantly glycosylated IgA1 myeloma proteins. Despite having six binding sites, both HAA and HPA bind IgA1 in a functionally bivalent manner, with the apparent affinity for IgA1 related to the number of exposed GalNAc groups in the IgA1 hinge. Finally, HAA and HPA were shown to discriminate very effectively between the IgA1 secreted by cell lines derived from peripheral blood cells of patients with IgAN and of healthy controls. These studies provide insight into lectin recognition of the Gal-deficient IgA1 hinge region and lay the groundwork for the development of reliable diagnostic tools for IgAN. PMID:20507092

  10. Somatic Mutations Modulate Autoantibodies against Galactose-Deficient IgA1 in IgA Nephropathy.

    PubMed

    Huang, Zhi Qiang; Raska, Milan; Stewart, Tyler J; Reily, Colin; King, R Glenn; Crossman, David K; Crowley, Michael R; Hargett, Audra; Zhang, Zhixin; Suzuki, Hitoshi; Hall, Stacy; Wyatt, Robert J; Julian, Bruce A; Renfrow, Matthew B; Gharavi, Ali G; Novak, Jan

    2016-11-01

    Autoantibodies against galactose-deficient IgA1 drive formation of pathogenic immune complexes in IgA nephropathy. IgG autoantibodies against galactose-deficient IgA1 in patients with IgA nephropathy have a specific amino-acid sequence, Y1CS3, in the complementarity-determining region 3 of the heavy chain variable region compared with a Y1CA3 sequence in similar isotype-matched IgG from healthy controls. We previously found that the S3 residue is critical for binding galactose-deficient IgA1. To determine whether this difference is due to a rare germline sequence, we amplified and sequenced the corresponding germline variable region genes from peripheral blood mononuclear cells of seven patients with IgA nephropathy and six healthy controls from whom we had cloned single-cell lines secreting monoclonal IgG specific for galactose-deficient IgA1. Sanger DNA sequencing revealed that complementarity-determining region 3 in the variable region of the germline genes encoded the Y1C(A/V)3 amino-acid sequence. Thus, the A/V>S substitution in the complementarity-determining region 3 of anti-galactose-deficient-IgA1 autoantibodies of the patients with IgA nephropathy is not a rare germline gene variant. Modeling analyses indicated that the S3 hydroxyl group spans the complementarity-determining region 3 loop stem, stabilizing the adjacent β-sheet and stem structure, important features for effective binding to galactose-deficient IgA1. Understanding processes leading to production of the autoantibodies may offer new approaches to treat IgA nephropathy. Copyright © 2016 by the American Society of Nephrology.

  11. Galactose-Deficient IgA1 as a Candidate Urinary Polypeptide Marker of IgA Nephropathy?

    PubMed

    Suzuki, Hitoshi; Allegri, Landino; Suzuki, Yusuke; Hall, Stacy; Moldoveanu, Zina; Wyatt, Robert J; Novak, Jan; Julian, Bruce A

    2016-01-01

    In patients with IgA nephropathy (IgAN), circulatory IgA1 and IgA1 in mesangial deposits contain elevated amounts of galactose-deficient IgA1 (Gd-IgA1). We hypothesized that a fraction of Gd-IgA1 from the glomerular deposits and/or circulation may be excreted into the urine and thus represent a disease-specific biomarker. Levels of urinary IgA and Gd-IgA1 were determined in 207 patients with IgAN, 205 patients with other renal diseases, and 57 healthy controls, recruited in USA, Japan, and Italy. Urinary IgA was similarly elevated in patients with IgAN and renal-disease controls compared with healthy controls. However, urinary Gd-IgA1 levels were higher in patients with IgAN (IgAN, 28.0 ± 17.9; disease controls, 20.6 ± 17.4 units/mg urinary creatinine; P < 0.0001). Lectin western blotting data confirmed these results. In IgAN patients, levels of urinary Gd-IgA1 correlated with proteinuria (P < 0.001). When we purified IgA from serum and urine of an IgAN patient, the relative proportion of Gd-IgA1 to total IgA1 was higher in the urine compared with serum, suggesting selective excretion of Gd-IgA1 in IgAN. In summary, urinary excretion of Gd-IgA1 was elevated in patients with IgAN and the urinary Gd-IgA1 levels correlated with proteinuria. Urinary Gd-IgA1 may thus represent a disease-specific biomarker of IgAN.

  12. Galactose-Deficient IgA1 as a Candidate Urinary Polypeptide Marker of IgA Nephropathy?

    PubMed Central

    Allegri, Landino; Hall, Stacy; Wyatt, Robert J.

    2016-01-01

    In patients with IgA nephropathy (IgAN), circulatory IgA1 and IgA1 in mesangial deposits contain elevated amounts of galactose-deficient IgA1 (Gd-IgA1). We hypothesized that a fraction of Gd-IgA1 from the glomerular deposits and/or circulation may be excreted into the urine and thus represent a disease-specific biomarker. Levels of urinary IgA and Gd-IgA1 were determined in 207 patients with IgAN, 205 patients with other renal diseases, and 57 healthy controls, recruited in USA, Japan, and Italy. Urinary IgA was similarly elevated in patients with IgAN and renal-disease controls compared with healthy controls. However, urinary Gd-IgA1 levels were higher in patients with IgAN (IgAN, 28.0 ± 17.9; disease controls, 20.6 ± 17.4 units/mg urinary creatinine; P < 0.0001). Lectin western blotting data confirmed these results. In IgAN patients, levels of urinary Gd-IgA1 correlated with proteinuria (P < 0.001). When we purified IgA from serum and urine of an IgAN patient, the relative proportion of Gd-IgA1 to total IgA1 was higher in the urine compared with serum, suggesting selective excretion of Gd-IgA1 in IgAN. In summary, urinary excretion of Gd-IgA1 was elevated in patients with IgAN and the urinary Gd-IgA1 levels correlated with proteinuria. Urinary Gd-IgA1 may thus represent a disease-specific biomarker of IgAN. PMID:27647947

  13. Oxidative Stress and Galactose-Deficient IgA1 as Markers of Progression in IgA Nephropathy

    PubMed Central

    Camilla, Roberta; Suzuki, Hitoshi; Daprà, Valentina; Loiacono, Elisa; Peruzzi, Licia; Amore, Alessandro; Ghiggeri, Gian Marco; Mazzucco, Gianna; Scolari, Francesco; Gharavi, Ali G.; Appel, Gerald B.; Troyanov, Stéphan; Novak, Jan; Julian, Bruce A.

    2011-01-01

    Summary Background and objectives We assessed the activation of the oxidative stress pathway in patients with IgA nephropathy (IgAN), while evaluating the classic marker of the disease (galactose-deficient serum IgA1). Design, setting, participants, & measurements Sera from 292 patients and 69 healthy controls from Italy and the United States were assayed for advanced oxidation protein products (AOPPs), free sulfhydryl groups on albumin (SH-Alb), and IgA1 with galactose-deficient hinge-region O-glycans (Gd-IgA1). Gd-IgA1 was detected by binding to Helix aspersa agglutinin (HAA) and expressed as total Gd-IgA1 or as degree of galactose deficiency relative to a standard Gd-IgA1 myeloma protein (%HAA). Results Sera from IgAN patients showed higher levels of Gd-IgA1, %HAA, and AOPPs, but lower levels of SH-Alb in comparison to that from healthy controls. Serum levels of AOPPs significantly correlated with serum Gd-IgA1 and %HAA. The relationship between these biomarkers and clinical features at sampling and during follow-up was assessed in 62 patients with long-term follow-up. AOPPs and %HAA correlated with proteinuria at sampling and independently associated with subsequent proteinuria. Levels of AOPPs correlated with rate of decline in renal function after sampling. The combination of a high level of AOPPs and a high level of %HAA associated with decline in estimated GFR. Conclusions Serum levels of aberrantly glycosylated IgA1 are elevated and oxidative stress pathways are activated in patients with IgAN; the intensity of the stress correlated with expression and progression of the disease. We speculate that oxidative stress may modulate the nephrotoxicity of aberrantly glycosylated IgA1 in IgAN. PMID:21784819

  14. IgA1 immune complexes from pediatric patients with IgA nephropathy activate cultured human mesangial cells

    PubMed Central

    Raskova Kafkova, Leona; Suzuki, Hitoshi; Tomana, Milan; Matousovic, Karel; Brown, Rhubell; Hall, Stacy; Sanders, John T.; Eison, T. Matthew; Moldoveanu, Zina; Novak, Lea; Novak, Zdenek; Mayne, Richard; Julian, Bruce A.; Mestecky, Jiri; Wyatt, Robert J.

    2011-01-01

    Background. Circulating immune complexes (CIC) containing galactose (Gal)-deficient IgA1 from adults with IgA nephropathy (IgAN) induce proliferation of cultured mesangial cells, but activities of CIC from pediatric patients with the disease have not been studied. Methods. CIC of different sizes were isolated from sera of pediatric and adult IgAN patients and their effects on cultured human mesangial cells (MC) were assessed by measuring cellular proliferation, expression of IL-6 and IL-8 and laminin and phosphotyrosine signaling. Results. Large CIC from pediatric IgAN patients (>800 kDa) containing Gal-deficient IgA1 stimulated cellular proliferation, whereas in some patients, smaller CIC were inhibitory. Addition of stimulatory and inhibitory CIC to MC differentially altered phosphorylation patterns of three major tyrosine-phosphorylated proteins of molecular mass 37, 60 and 115 kDa. The stimulatory CIC transiently increased tyrosine-phosphorylation of the 37-kDa protein and decreased phosphorylation of the other two proteins, whereas the inhibitory CIC increased phosphorylation of all three proteins. Furthermore, we investigated the influence of IgA1-containing CIC from sera of children with IgAN with clinically active disease (i.e., abnormal urinalysis and/or serum creatinine concentration) or inactive disease (i.e., normal urinalysis and serum creatinine concentration) on the expression of IL-6 and IL-8 genes by mesangial cells. Real-time reverse transcription–polymerase chain reaction results showed that the CIC from a patient with active disease stimulated MC to express the two cytokine genes at higher levels than did the CIC from a patient with inactive disease. Moreover, stimulatory CIC increased production of the extracellular matrix protein laminin. Conclusion. These data indicate that sera of pediatric IgAN patients contain biologically active CIC with Gal-deficient IgA1. PMID:21828345

  15. IgA nephropathy and tonsils--an approach from the structure of IgA1 produced by tonsillar lymphocytes.

    PubMed

    Hiki, Yoshiyuki; Horie, Akeyo; Yasuda, Yoshinari; Iwase, Hitoo; Sugiyama, Satoshi

    2004-12-01

    Human immunoglobulin A1 (IgA1), which is the predominant subtype to be deposited in glomeruli in IgA nephropathy (IgAN), has a unique mucine-like structure in its hinge region. Namely, it contains O-glycans and proline-rich peptides We previously observed underglycosylation of the hinge region in serum and deposited IgA1 in IgAN. On the other hand, clinical development and exacerbation of IgAN are frequently preceded by episodes of upper respiratory tract infection, and palatine tonsils represent the predominant immunocompetent tissue of the upper respiratory tract. Therefore, we hypothesized that tonsils were one of the origins of glomerular IgA1 in IgAN, and investigated the O-glycan structure of IgA1 produced by tonsillar lymphocytes (tonsillar IgA1). A significant increase in asialo-agalacto type O-glycans was found in the tonsillar IgA1 hinge in IgAN. These results suggest that the tonsils produce underglycosylated IgA1 molecules, which enter the bloodstream and are then deposited in the glomeruli.

  16. Separation of Two Distinct O-Glycoforms of Human IgA1 by Serial Lectin Chromatography Followed by Mass Spectrometry O-Glycan Analysis.

    PubMed

    Lehoux, S; Ju, T

    2017-01-01

    Human immunoglobulin A1 (IgA1), which carries four to six mucin-type O-glycans (O-glycans) on its hinge region (HR), is the most abundant O-glycoprotein in plasma or serum. While normal O-glycans from hematopoietic-originated cells are core 1-based complex structures, many reports showed that the IgA1 from patients with IgA nephropathy (IgAN) carries undergalactosylated or truncated O-glycans such as the Tn antigen and its sialylated version the SialylTn (STn) antigen on the HR. Yet, there is still a debate whether Tn/STn on the HR of IgA1 is specific to the IgA1 from patients with IgAN since these antigens have also been seen in serum IgA1 of healthy individuals. An additional question is whether the O-glycans at all sites on the two HRs of one IgA1 molecule are homogeneous (either all normal or all Tn/STn) or heterogeneous (both normal and Tn/STn O-glycans). To address these questions, we conducted a systematic study on the O-glycans of plasma IgA1 from both IgAN patients and healthy controls using serial HPA and PNA lectin chromatography followed by western blotting and further analysis of O-glycans from HPA-bound and PNA-bound IgA1 fractions by mass spectrometry. Unexpectedly, we found that a variable minor fraction of IgA1 from both IgAN patients and healthy controls had Tn/STn antigens, and that the O-glycoprotein IgA1 molecules from most samples had only two distinct O-glycoforms: one major glycoform with homogeneous normal core 1-based O-glycans and one minor glycoform with homogeneous Tn/STn antigens. These results raised a serious question about the role of Tn/STn antigens on IgA1 in pathogenesis of IgAN, and there is a demand for a practical methodology that any laboratory can utilize to analyze the O-glycans of IgA1. Herein, we describe the methodology we developed in more detail. The method could also be applied to the analysis of any other O-glycosylated proteins.

  17. Identification and characterization of CMP-NeuAc:GalNAc-IgA1 α2,6-sialyltransferase in IgA1-producing cells

    PubMed Central

    Raska, Milan; Moldoveanu, Zina; Suzuki, Hitoshi; Brown, Rhubell; Kulhavy, Rose; Andrasi, Judit; Hall, Stacy; Vu, Huong L.; Carlsson, Frederic; Lindahl, Gunnar; Tomana, Milan; Julian, Bruce A.; Wyatt, Robert J.; Mestecky, Jiri; Novak, Jan

    2007-01-01

    Summary Glycosylation defects occur in several human diseases. In IgA nephropathy, IgA1 contains O-glycans that are galactose-deficient and consist mostly of core 1 α2,6 sialylated N-acetylgalactosamine, a configuration suspected to prevent β1,3 galactosylation. We confirmed the same aberrancy in IgA1 secreted by the human DAKIKI B cell line. Biochemical assays indicated CMP-NeuAc:GalNAc-IgA1 α2,6-sialyltransferase activity in this cell line. However, a candidate enzyme, ST6-GalNAcI, was not transcribed in DAKIKI cells, B cells isolated from blood, or Epstein-Barr virus (EBV)-immortalized IgA1-producing cells from the blood of IgAN patients and healthy controls. Instead, ST6-GalNAcII transcription was detected at a high level. Expression of the ST6-GalNAcII gene and activity of the CMP-NeuAc:GalNAc-IgA1 α2,6-sialyltransferase were higher in IgA1-producing cell lines from IgAN patients than in such cells from healthy controls. These data are the first evidence that human cells that lack ST6-GalNAcI can sialylate core 1 GalNAc-Ser/Thr. PMID:17418236

  18. Purification and characterization of an immunoglobulin A1 protease from Bacteroides melaninogenicus.

    PubMed Central

    Mortensen, S B; Kilian, M

    1984-01-01

    Attention has recently been focused on bacterial proteases with the capacity to cleave immunoglobulin A (IgA proteases) as possible pathogenic factors in bacterial meningitis, gonorrhoea, and destructive periodontal disease. Here, we describe a method for the rapid purification of a specific IgA1 protease from Bacteroides melaninogenicus. The IgA1 protease was purified 6,172-fold with a yield of 9% by ammonium sulfate precipitation, DEAE-ion exchange chromatography, and separation on a preparative TSK-G 3000SWG high-pressure gel permeation chromatography column. The enzyme was specific for human IgA1 and cleaved a prolyl-seryl peptide bond in the hinge region of the alpha 1 chain between residues 223 and 224. The molecular weight of the enzyme was 62,000, the isoelectric point was 5.0, and the Km was 3.4 X 10(-6). The enzyme was active over a broad pH range and had maximal activity at pH 5.0. B. melaninogenicus IgA1 protease was classified as a thiol protease on the basis of its inhibition by traditional protease inhibitors and the fact that it was active only under reducing conditions. Images PMID:6147309

  19. The Origin and Activities of IgA1-Containing Immune Complexes in IgA Nephropathy

    PubMed Central

    Knoppova, Barbora; Reily, Colin; Maillard, Nicolas; Rizk, Dana V.; Moldoveanu, Zina; Mestecky, Jiri; Raska, Milan; Renfrow, Matthew B.; Julian, Bruce A.; Novak, Jan

    2016-01-01

    IgA nephropathy (IgAN) is the most common primary glomerulonephritis, frequently leading to end-stage renal disease, as there is no disease-specific therapy. IgAN is diagnosed from pathological assessment of a renal biopsy specimen based on predominant or codominant IgA-containing immunodeposits, usually with complement C3 co-deposits and with variable presence of IgG and/or IgM. The IgA in these renal deposits is galactose-deficient IgA1, with less than a full complement of galactose residues on the O-glycans in the hinge region of the heavy chains. Research from the past decade led to the definition of IgAN as an autoimmune disease with a multi-hit pathogenetic process with contributing genetic and environmental components. In this process, circulating galactose-deficient IgA1 (autoantigen) is bound by antiglycan IgG or IgA (autoantibodies) to form immune complexes. Some of these circulating complexes deposit in glomeruli, and thereby activate mesangial cells and induce renal injury through cellular proliferation and overproduction of extracellular matrix components and cytokines/chemokines. Glycosylation pathways associated with production of the autoantigen and the unique characteristics of the corresponding autoantibodies in patients with IgAN have been uncovered. Complement likely plays a significant role in the formation and the nephritogenic activities of these complexes. Complement activation is mediated through the alternative and lectin pathways and probably occurs systemically on IgA1-containing circulating immune complexes as well as locally in glomeruli. Incidence of IgAN varies greatly by geographical location; the disease is rare in central Africa but accounts for up to 40% of native-kidney biopsies in eastern Asia. Some of this variation may be explained by genetically determined influences on the pathogenesis of the disease. Genome-wide association studies to date have identified several loci associated with IgAN. Some of these loci are associated

  20. The solution structures of native and patient monomeric human IgA1 reveal asymmetric extended structures: implications for function and IgAN disease

    PubMed Central

    Hui, Gar Kay; Wright, David W.; Vennard, Owen L.; Rayner, Lucy E.; Pang, Melisa; Yeo, See Cheng; Gor, Jayesh; Molyneux, Karen; Barratt, Jonathan; Perkins, Stephen J.

    2015-01-01

    Native IgA1, for which no crystal structure is known, contains an O-galactosylated 23-residue hinge region that joins its Fab and Fc regions. IgA nephropathy (IgAN) is a leading cause of chronic kidney disease in developed countries. Because IgA1 in IgAN often has a poorly O-galactosylated hinge region, the solution structures of monomeric IgA1 from a healthy subject and three IgAN patients with four different O-galactosylation levels were studied. Analytical ultracentrifugation showed that all four IgA1 samples were monomeric with similar sedimentation coefficients, s020,w. X-ray scattering showed that the radius of gyration (Rg) slightly increased with IgA1 concentration, indicating self-association, although their distance distribution curves, P(r), were unchanged with concentration. Neutron scattering indicated similar Rg values and P(r) curves, although IgA1 showed a propensity to aggregate in heavy water buffer. A new atomistic modelling procedure based on comparisons with 177000 conformationally-randomized IgA1 structures with the individual experimental scattering curves revealed similar extended Y-shaped solution structures for all four differentially-glycosylated IgA1 molecules. The final models indicated that the N-glycans at Asn263 were folded back against the Fc surface, the C-terminal tailpiece conformations were undefined and hinge O-galactosylation had little effect on the solution structure. The solution structures for full-length IgA1 showed extended hinges and the Fab and Fc regions were positioned asymmetrically to provide ample space for the functionally-important binding of two FcαR receptors to its Fc region. Whereas no link between O-galactosylation and the IgA1 solution structure was detected, an increase in IgA1 aggregation with reduced O-galactosylation may relate to IgAN. PMID:26268558

  1. CagA, a major virulence factor of Helicobacter pylori, promotes the production and underglycosylation of IgA1 in DAKIKI cells

    SciTech Connect

    Yang, Man; Li, Fu-gang; Xie, Xi-sheng; Wang, Shao-qing; Fan, Jun-ming

    2014-02-07

    Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells.

  2. Glyco-engineering for the production of recombinant IgA1 with distinct mucin-type O-glycans in plants.

    PubMed

    Dicker, Martina; Maresch, Daniel; Strasser, Richard

    2016-11-01

    IgA nephropathy (IgAN) is a common autoimmune disease that is characterized by formation and deposition of IgA1-containing immune complexes frequently leading to end-stage kidney disease. The IgA1 in these immune complexes carries aberrantly glycosylated O-glycans. In circulating IgA1 these galactose-deficient mucin-type O-glycans are bound by autoantibodies and thus, contribute to immune complex formation and pathogenesis. Even though the disease is associated with the overproduction of aberrant O-glycans on IgA1, specific structure-function-studies of mucin-type O-glycans are limited. Compared to other expression hosts, plants offer the opportunity for de novo synthesis of O-glycans on recombinant glycoproteins as they are lacking the mammalian O-glycosylation pathway. Recently, we demonstrated that Nicotiana benthamiana are suitable for the generation of distinct O-glycans on recombinant IgA1. Here, we expand our engineering repertoire by in planta generation of galactose-deficient and α2,6-sialylated O-glycans which are the prevailing glycans detected on IgA1 from patients with IgAN.

  3. Identification of Distinct Glycoforms of IgA1 in Plasma from Patients with Immunoglobulin A (IgA) Nephropathy and Healthy Individuals*

    PubMed Central

    Lehoux, Sylvain; Mi, Rongjuan; Aryal, Rajindra P.; Wang, Yingchun; Schjoldager, Katrine T.-B. G.; Clausen, Henrik; van Die, Irma; Han, Yoosun; Chapman, Arlene B.; Cummings, Richard D.; Ju, Tongzhong

    2014-01-01

    Immunoglobulin A nephropathy (IgAN) is the most common form of glomerulonephritis worldwide and is histologically characterized by the deposition of IgA1 and consequent inflammation in the glomerular mesangium. Prior studies suggested that serum IgA1 from IgAN patients contains aberrant, undergalactosylated O-glycans, for example, Tn antigen and its sialylated version, SialylTn (STn), but the mechanisms underlying aberrant O-glycosylation are not well understood. Here we have used serial lectin separation technologies, Western blot, enzymatic modifications, and mass spectrometry to explore whether there are different glycoforms of IgA1 in plasma from patients with IgAN and healthy individuals. Although total plasma IgA in IgAN patients was elevated ∼1.6-fold compared with that in healthy donors, IgA1 in all samples was unexpectedly separable into two distinct glycoforms: one with core 1 based O-glycans, and the other exclusively containing Tn/STn structures. Importantly, Tn antigen present on IgA1 from IgAN patients and controls was convertible into the core 1 structure in vitro by recombinant T-synthase. Our results demonstrate that undergalactosylation of O-glycans in IgA1 is not restricted to IgAN and suggest that in vivo inefficiency of T-synthase toward IgA1 in a subpopulation of B or plasma cells, as well as overall elevation of IgA, may contribute to IgAN pathogenesis. PMID:25071157

  4. ELISA analysis of IgA subclass antibodies to dietary antigens. Elevated IgA1 antibodies in children with coeliac disease.

    PubMed

    Kemp, M; Husby, S; Larsen, M L; Svehag, S E

    1988-01-01

    Enzyme immunoassays for the quantitation of IgA1 and IgA2 antibodies to dietary antigens were developed. Serum IgA1 antibodies to bovine serum albumin (BSA) were detectable in 2/30 healthy adults, in 3/26 healthy children, and at high levels in 8/11 children with coeliac disease, without relation to gluten exposure. IgA1 antibodies to ovalbumin (OA) and beta-lactoglobulin (BLG) at high titers were seen in one coeliac child but were otherwise low or absent. IgA2 antibodies to BSA were detectable in 28/48 healthy subjects and in 8/11 coeliac children. IgA2 antibodies to OA and BLG were measurable in a few samples from each group. IgA1 antibodies to the gluten component glycgli were found at low levels in 15/56 normal sera, and anti-glycgli antibodies of the IgA2 subclass in 14/48 sera from healthy persons, also at low levels. IgA1 anti-glycgli antibodies were measurable in 5/11 sera from CD patients on a gluten-free diet. Elevated levels of IgA1 anti-glycgli antibodies were detected in all sera from CD patients challenged with gluten, except in 1 patient with a markedly reduced serum IgA level. In contrast, the IgA2 anti-glycgli antibody levels were unaffected. Thus, increased levels of IgA antibodies to dietary protein antigens in childhood coeliac disease were observed only within the IgA1 isotype.

  5. Immunopathological features of palatine tonsil characteristic of IgA nephropathy: IgA1 localization in follicular dendritic cells.

    PubMed

    Kusakari, C; Nose, M; Takasaka, T; Yuasa, R; Kato, M; Miyazono, K; Fujita, T; Kyogoku, M

    1994-01-01

    IgA nephropathy (IgAN) is generally thought to be mediated by the glomerular deposition of circulating immune complexes containing IgA as the major antibody component. Upper respiratory infections and tonsillitis often precede IgAN, and in some cases tonsillectomy is effective for the treatment of IgAN. Thus, the tonsil seems to be a unique organ causing initial and/or progressive events to generate nephritogenic immune complexes in IgAN. In this study we focused on the analysis of immunopathological features of the palatine tonsil characteristic of IgAN patients by using an immunohistochemical technique. The IgA1 subclass was demonstrated in follicular dendritic cells (FDC) of the tonsil of IgAN patients, but not in FDC of non-IgAN controls. On the other hand, IgA2, IgG, IgM and C3 did not show any differences in distribution between the two groups. Moreover, the expression of decay-accelerating factor (DAF), an inhibitor of homologous complement activation, and transforming growth factor-beta 1 (TGF-beta 1), an inducer of antibody-producing cells to IgA class switching, in FDC and interdigitating dendritic cells of the tonsil, respectively, which was also clarified in this study for the first time, was found to be identically distributed in the two groups. These findings may support the idea that IgA1, possibly in an immune complex form, is trapped by FDC and plays an important role in the persistent activation of particular B cell repertoires responsible for the onset and/or progression of IgAN.

  6. Immunopathological features of palatine tonsil characteristic of IgA nephropathy: IgA1 localization in follicular dendritic cells.

    PubMed Central

    Kusakari, C; Nose, M; Takasaka, T; Yuasa, R; Kato, M; Miyazono, K; Fujita, T; Kyogoku, M

    1994-01-01

    IgA nephropathy (IgAN) is generally thought to be mediated by the glomerular deposition of circulating immune complexes containing IgA as the major antibody component. Upper respiratory infections and tonsillitis often precede IgAN, and in some cases tonsillectomy is effective for the treatment of IgAN. Thus, the tonsil seems to be a unique organ causing initial and/or progressive events to generate nephritogenic immune complexes in IgAN. In this study we focused on the analysis of immunopathological features of the palatine tonsil characteristic of IgAN patients by using an immunohistochemical technique. The IgA1 subclass was demonstrated in follicular dendritic cells (FDC) of the tonsil of IgAN patients, but not in FDC of non-IgAN controls. On the other hand, IgA2, IgG, IgM and C3 did not show any differences in distribution between the two groups. Moreover, the expression of decay-accelerating factor (DAF), an inhibitor of homologous complement activation, and transforming growth factor-beta 1 (TGF-beta 1), an inducer of antibody-producing cells to IgA class switching, in FDC and interdigitating dendritic cells of the tonsil, respectively, which was also clarified in this study for the first time, was found to be identically distributed in the two groups. These findings may support the idea that IgA1, possibly in an immune complex form, is trapped by FDC and plays an important role in the persistent activation of particular B cell repertoires responsible for the onset and/or progression of IgAN. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7507015

  7. Development and evaluation of indirect ELISAs for the detection of IgG, IgM and IgA1 against duck hepatitis A virus 1.

    PubMed

    Mao, Sai; Ou, XuMin; Zhu, DeKang; Chen, Shun; Ma, GuangPeng; Wang, MingShu; Jia, RenYong; Liu, MaFeng; Sun, KunFeng; Yang, Qiao; Wu, Ying; Chen, XiaoYue; Cheng, AnChun

    2016-11-01

    Duck hepatitis A virus 1 (DHAV-1) is the principal pathogen that causes duck viral hepatitis (DHV), a highly fatal infectious disease in ducklings. Given the importance of the humoral immune response in the clearance of DHAV-1, indirect enzyme-linked immunosorbent assays (I-ELISAs) to detect immune indices, including IgG, IgM and IgA1, were developed and evaluated in this study. The optimal concentrations of coating-antigen were 1.79μg/ml, 2.23μg/ml and 2.23μg/ml for IgG, IgM and IgA1, respectively. Meanwhile, the optimal dilutions of sera were 1:80, 1:40 and 1:40, respectively; and of the conjugates were 1:300, 1:1800 and 1:800, respectively. Based on these conditions, three linear regression equations, y=1.363+1.954x (r(2)=0.983), y=1.141+2.228x (r(2)=0.970) and y=1.103+1.559x (r(2)=0.995) were derived for IgG, IgM and IgA1, respectively. Analytical sensitivities of the new methods were 1:2560, 1:1280 and 1:640 for IgG, IgM and IgA1, respectively. The concordances between the I-ELISAs and serum-neutralization were 95.2% for IgG and IgA1, and 75% for IgM. Although there was a weak cross-reaction with DHAV-3 positive serum for the IgG and IgA1 tests, it didn't affect the ability to detect DHAV-1 specific antibodies. Thus, these new I-ELISAs were shown to be potentially convenient methods to survey the status of humoral immune response to DHAV-1.

  8. The Nonplanar Secretory IgA2 and Near Planar Secretory IgA1 Solution Structures Rationalize Their Different Mucosal Immune Responses*S⃞

    PubMed Central

    Bonner, Alexandra; Almogren, Adel; Furtado, Patricia B.; Kerr, Michael A.; Perkins, Stephen J.

    2009-01-01

    Secretory IgA (SIgA) is the most prevalent human antibody and is central to mucosal immunity. It exists as two subclasses, SIgA1 and SIgA2, where SIgA2 has a shorter hinge joining the Fab and Fc regions. Both forms of SIgA are predominantly dimeric and contain an additional protein called the secretory component (SC) that is attached during the secretory process and is believed to protect SIgA in harsh mucosal conditions. Here we locate the five SC domains relative to dimeric IgA2 within SIgA2 using constrained scattering modeling. The x-ray and sedimentation parameters showed that SIgA2 has an extended solution structure. The constrained modeling of SIgA2 was initiated using two IgA2 monomers that were positioned according to our best fit solution structure for dimeric IgA1. SC was best located along the convex edge of the Fc-Fc region. The best fit models showed that SIgA2 is significantly nonplanar in its structure, in distinction to our previous near planar SIgA1 structure. Both the shorter IgA2 hinges and the presence of SC appear to displace the four Fab regions out of the Fc plane in SIgA2. This may explain the noncovalent binding of SC in some SIgA2 molecules. This nonplanar structure is predicted to result in specific immune properties for SIgA2 and SIgA1. It may explain differences observed between the SIgA1 and SIgA2 subclasses in terms of their interactions with antigens, susceptibility to proteases, effects on receptors, and distribution in different tissues. The different structures account for the prevalence of both forms in mucosal secretions. PMID:19109255

  9. Vibration Induces BAFF Overexpression and Aberrant O-Glycosylation of IgA1 in Cultured Human Tonsillar Mononuclear Cells in IgA Nephropathy

    PubMed Central

    Ye, Muyao; Liu, Chan; Yan, Wenzhe; Peng, Xiaofei; He, Liyu; Liu, Hong; Liu, Fuyou

    2016-01-01

    Objective. To investigate the influence of in vitro vibratory stimulation of human tonsillar mononuclear cells (TMCs). Methods. Fourteen IgA nephropathy (IgAN) patients with chronic tonsillitis (CT) and 12 CT patients with no renal pathology were enrolled. Group A TMCs were collected after 24 hours of culture and used to determine baseline levels. TMCs in groups B, C, D, E, and F were exposed to vibratory stimulation (60 Hz) for 0 (as the control group), 1, 3, 5, and 10 minutes, respectively. Results. Baseline concentrations of B-cell-activation factor (BAFF) and IgA1, BAFF mRNA expression, and aberrant O-glycosylation IgA1 level were higher in the IgAN group as compared to that in the CT group, and all increased after vibratory stimulation. Baseline mRNA expressions of core β1,3-galactosyltransferase (C1GALT1) and core β1,3GalT-specific molecular chaperone (Cosmc) were lower in the IgAN group; the levels decreased further after vibratory stimulation. Conclusion. In patients with IgAN, vibratory stimulation of TMCs appears to induce IgA1 secretion through activation of BAFF release and to aberrant O-glycosylation IgA1 by suppressing C1GALT1 and Cosmc expression. In vitro vibratory stimulation of human TMCs mimics the vibratory simulation of palatine tonsils produced by vocal cords during phonation. PMID:27672662

  10. The possible involvement of intestine-derived IgA1: a case of IgA nephropathy associated with Crohn's disease.

    PubMed

    Terasaka, Tomohiro; Uchida, Haruhito A; Umebayashi, Ryoko; Tsukamoto, Keiko; Tanaka, Keiko; Kitagawa, Masashi; Sugiyama, Hitoshi; Tanioka, Hiroaki; Wada, Jun

    2016-09-05

    A link between IgA nephropathy and Crohn's disease has recently been reported. Other researchers hypothesize that intestine-derived IgA complexes deposit in glomerular mesangial cells, eliciting IgA nephropathy. Intestinal mucosal plasma cells mainly secrete IgA2. Nevertheless, IgA1 deposition is strongly implicated as being the primary cause of IgA nephropathy. A 46-year-old Japanese man developed IgA nephropathy 29 years ago, following tonsillectomy. As a result, a normal urinalysis was obtained. The patient previously suffered Crohn's disease followed by urinary occult blood and proteinuria six years ago. Exacerbation of IgA nephropathy was highly suspected. Therefore a renal biopsy was performed. A diagnosis of exacerbation of IgA nephropathy with mesangial cell proliferation and fibrotic cellular crescent was based upon the pathological findings. The patient exhibited a positive clinical course and eventually achieved a remission with immunosuppressive therapy including prednisolone treatment. Immunostaining for the detection of IgA subtypes was performed on both of his kidney and excised ileum. The results revealed IgA1 and IgA2 deposition by submucosal cells in intestine. Furthermore, IgA1 deposition of mesangial areas in the patient's kidney, indicated an association of IgA1 with the exacerbation of IgA nephropathy. This case represents the possibility that the intestine-derived IgA1 can be the origin of galactose-deficient IgA which is known to cause IgA nephropathy exacerbation.

  11. Related IgA1 and IgG producing cells in blood and diseased mucosa in ulcerative colitis

    PubMed Central

    Thoree, V C; Golby, S J C; Boursier, L; Hackett, M; Dunn-Walters, D K; Sanderson, J D; Spencer, J

    2002-01-01

    Background: Ulcerative colitis (UC) is a chronic inflammatory bowel disease in which the colonic mucosa is infiltrated with plasma cells producing IgG autoantibodies. It is not known whether this represents a local mucosal response which has switched to IgG or a peripheral response which may have been initiated by peripheral antigen which homed to the colonic mucosa. The clonal distribution of IgG secreting cells and isotype switched variants in UC is not known. Aims: To investigate the clonal distribution of mucosal IgG in UC and to search for related IgG and IgA secreting cells in normal and diseased mucosa and blood in UC. To investigate characteristics which may discriminate between the mucosal and peripheral repertoire in the normal mucosa and in UC. Patients: Blood and normal and diseased mucosa from two patients with UC were studied. Methods: Immunoglobulin gene analysis and clone specific polymerase chain reaction were used to study the clonal distribution and characteristics of IgG and related IgA in the mucosa and blood of patients with UC. Results: The IgG response in the mucosa of UC patients included widespread clones of cells that were present in both the diseased mucosa and blood but that were scarce in normal mucosa. Clonally related IgA class switch variants, all IgA1, were detected but also only in the diseased mucosa and blood. This suggests that these clones home preferentially to the diseased mucosa. We showed that JH1 usage was characteristic of the peripheral repertoire, and that examples of JH1 usage were observed in mucosal IgG in UC. Conclusions: Overall, these data are consistent with a model of UC in which a peripheral response is expressed and expanded in the colonic mucosa. PMID:12077090

  12. Complement-coated antibody-transfer (CCAT); serum IgA1 antibodies intercept and transport C4 and C3 fragments and preserve IgG1 deployment (PGD)†

    PubMed Central

    Boackle, Robert J.; Nguyen, Quang L.; Leite, Renata S.; Yang, Xiaofeng; Vesely, Jana

    2005-01-01

    In periodontal disease, IgG1 and IgA1 antibodies produced in situ deposit on antigens in the affected tissues. Thus, there is an interest in the effect of co-deposited IgA1 antibodies on complement activation by IgG1-immune complexes. In the present study, we first analyzed the effect of IgA1-immune complexes on complement using human IgA1 antibodies to dansyl (with dansylated human serum albumin serving as the immobilized antigen). It was observed that these IgA1-immune complexes when incubated for prolonged times with 33% human serum as a source of complement received C4b and C3b deposition. As C4b and C3b deposited on the IgA1 antibodies and on the antigenic surface, the complement-coated IgA1 antibodies departed. These fluid-phase complement-coated IgA1 antibodies were transferred to antigen-coated microtiter-ELISA plates, where they became bound to the antigens. Thus, the complement-coated IgA1 antibodies retained their antigen-binding function, especially as a proportion of their covalently bound C3b progressively degraded to iC3b and C3d. Genetically engineered carbohydrate-deficient mutant human IgA1 antibodies were used to assess the role of carbohydrate in accepting the C4b and C3b depositions, and these studies indicated that the carbohydrate on the Fc-region of IgA1 played a positive role. Another interesting finding generated by this study was that when IgA1 was co-deposited with IgG1 antibodies, and serum complement was added, the IgG1 antibodies tended to remain on the antigenic surface. The co-deposited IgA1 antibodies not only controlled (reduced) the rate of the consumption of the first component of complement (C1) and of classical complement pathway activation by IgG1-immune complexes (and therein reduced the rate of complement-mediated dissolution of the IgG1-immune complexes), but also the co-deposited IgA1 antibodies simultaneously intercepted/accepted C4b and C3b, then departed, as complement began to cover the antigenic surfaces. The process

  13. Effect of Immunosuppressive Drugs on the Changes of Serum Galactose-Deficient IgA1 in Patients with IgA Nephropathy

    PubMed Central

    Kim, Min Jeong; Schaub, Stefan; Molyneux, Karen; Koller, Michael T.; Stampf, Susanne; Barratt, Jonathan

    2016-01-01

    Galactose-deficient IgA1 (Gd-IgA1) and IgA-IgG complexes are known to play an important role in the pathogenesis of IgA nephropathy (IgAN). We aimed therefore to determine the impact of immunosuppression on the serum levels of Gd-IgA1, total IgA1 and IgA-IgG complexes in IgAN patients. In a retrospective study, serum samples from IgAN patients collected before transplantation (t0) and at 3- and 6-month posttransplant (t3 & t6) were used to measure the levels of Gd-IgA1, total IgA1 and IgA-IgG complexes. The area under the curves (AUC) of immunosuppressants was calculated by the plot of plasma trough level or dosage of each immunosuppressant versus time and was interpreted as the extent of drug exposure. Thirty-six out of 64 IgAN patients, who underwent kidney transplantation between 2005 and 2012, were enrolled. From t0 to t3, serum Gd-IgA1 and total IgA1 decreased significantly (24.7 AU (18.6–36.1) to 17.2 (13.1–29.5) (p<0.0001); 4.1 mg/ml (3.6–5.1) to 3.4 (3.0–4.1) (p = 0.0005)), whereas IgA-IgG complexes remained similar. From t3 to t6, Gd-IgA1 and IgA-IgG complexes significantly increased (17.2 AU (13.1–29.5) to 23.9 (16.8–32.0) (p = 0.0143); OD 0.16 (0.06–0.31) to 0.26 (0.14–0.35) (p = 0.0242)), while total IgA1 remained similar. According to median regression analysis, AUC of prednisone t0-6 was significantly associated with the decrease of Gd-IgA1 t0-6 (P = 0.01) and IgA1 t0-6 (p = 0.002), whereas AUC of tacrolimus t0-6 was associated with the decrease of IgA1 t0-6 (p = 0.02). AUC of prednisone t0-3 was associated with the decrease of IgA-IgG complexes t0-3 (p = 0.0036). The association of AUC prednisone t0-6 with Gd-IgA1 t0-6 remained highly significant after adjustment for other immunosuppressants (p = 0.0036). Serum levels of Gd-IgA1, total IgA1 and IgA-IgG in patients with IgAN vary according to the changing degrees of immunosuppression. The exposure to prednisone most clearly influenced the serum levels of Gd-IgA1. PMID:27930655

  14. Effect of Immunosuppressive Drugs on the Changes of Serum Galactose-Deficient IgA1 in Patients with IgA Nephropathy.

    PubMed

    Kim, Min Jeong; Schaub, Stefan; Molyneux, Karen; Koller, Michael T; Stampf, Susanne; Barratt, Jonathan

    2016-01-01

    Galactose-deficient IgA1 (Gd-IgA1) and IgA-IgG complexes are known to play an important role in the pathogenesis of IgA nephropathy (IgAN). We aimed therefore to determine the impact of immunosuppression on the serum levels of Gd-IgA1, total IgA1 and IgA-IgG complexes in IgAN patients. In a retrospective study, serum samples from IgAN patients collected before transplantation (t0) and at 3- and 6-month posttransplant (t3 & t6) were used to measure the levels of Gd-IgA1, total IgA1 and IgA-IgG complexes. The area under the curves (AUC) of immunosuppressants was calculated by the plot of plasma trough level or dosage of each immunosuppressant versus time and was interpreted as the extent of drug exposure. Thirty-six out of 64 IgAN patients, who underwent kidney transplantation between 2005 and 2012, were enrolled. From t0 to t3, serum Gd-IgA1 and total IgA1 decreased significantly (24.7 AU (18.6-36.1) to 17.2 (13.1-29.5) (p<0.0001); 4.1 mg/ml (3.6-5.1) to 3.4 (3.0-4.1) (p = 0.0005)), whereas IgA-IgG complexes remained similar. From t3 to t6, Gd-IgA1 and IgA-IgG complexes significantly increased (17.2 AU (13.1-29.5) to 23.9 (16.8-32.0) (p = 0.0143); OD 0.16 (0.06-0.31) to 0.26 (0.14-0.35) (p = 0.0242)), while total IgA1 remained similar. According to median regression analysis, AUC of prednisone t0-6 was significantly associated with the decrease of Gd-IgA1 t0-6 (P = 0.01) and IgA1 t0-6 (p = 0.002), whereas AUC of tacrolimus t0-6 was associated with the decrease of IgA1 t0-6 (p = 0.02). AUC of prednisone t0-3 was associated with the decrease of IgA-IgG complexes t0-3 (p = 0.0036). The association of AUC prednisone t0-6 with Gd-IgA1 t0-6 remained highly significant after adjustment for other immunosuppressants (p = 0.0036). Serum levels of Gd-IgA1, total IgA1 and IgA-IgG in patients with IgAN vary according to the changing degrees of immunosuppression. The exposure to prednisone most clearly influenced the serum levels of Gd-IgA1.

  15. Aberrantly glycosylated IgA1 in IgA nephropathy patients is recognized by IgG antibodies with restricted heterogeneity

    PubMed Central

    Suzuki, Hitoshi; Fan, Run; Zhang, Zhixin; Brown, Rhubell; Hall, Stacy; Julian, Bruce A.; Chatham, W. Winn; Suzuki, Yusuke; Wyatt, Robert J.; Moldoveanu, Zina; Lee, Jeannette Y.; Robinson, James; Tomana, Milan; Tomino, Yasuhiko; Mestecky, Jiri; Novak, Jan

    2009-01-01

    IgA nephropathy (IgAN) is characterized by circulating immune complexes composed of galactose-deficient IgA1 and a glycan-specific IgG antibody. These immune complexes deposit in the glomerular mesangium and induce the mesangioproliferative glomerulonephritis characteristic of IgAN. To define the precise specificities and molecular properties of the IgG antibodies, we generated EBV-immortalized IgG-secreting lymphocytes from patients with IgAN and found that the secreted IgG formed complexes with galactose-deficient IgA1 in a glycan-dependent manner. We cloned and sequenced the heavy- and light-chain antigen-binding domains of IgG specific for galactose-deficient IgA1 and identified an A to S substitution in the complementarity-determining region 3 of the variable region of the gene encoding the IgG heavy chain in IgAN patients. Furthermore, site-directed mutagenesis that reverted the residue to alanine reduced the binding of recombinant IgG to galactose-deficient IgA1. Finally, we developed a dot-blot assay for the glycan-specific IgG antibody that differentiated patients with IgAN from healthy and disease controls with 88% specificity and 95% sensitivity and found that elevated levels of this antibody in the sera of patients with IgAN correlated with proteinuria. Collectively, these findings indicate that glycan-specific antibodies are associated with the development of IgAN and may represent a disease-specific marker and potential therapeutic target. PMID:19478457

  16. Cloning and structural analysis of two highly divergent IgA isotypes, IgA1 and IgA2 from the duck billed platypus, Ornithorhynchus anatinus.

    PubMed

    Vernersson, M; Belov, K; Aveskogh, M; Hellman, L

    2010-01-01

    To trace the emergence of modern IgA isotypes during vertebrate evolution we have studied the immunoglobulin repertoire of a model monotreme, the platypus. Two highly divergent IgA-like isotypes (IgA1 and IgA2) were identified and their primary structures were determined from full-length cDNAs. A comparative analysis of the amino acid sequences for IgA from various animal species showed that the two platypus IgA isotypes form a branch clearly separated from their eutherian (placental) counterparts. However, they still conform to the general structure of eutherian IgA, with a hinge region and three constant domains. This indicates that the deletion of the second domain and the formation of a hinge region in IgA did occur very early during mammalian evolution, more than 166 million years ago. The two IgA isotypes in platypus differ in primary structure and appear to have arisen from a very early gene duplication, possibly preceding the metatherian eutherian split. Interestingly, one of these isotypes, IgA1, appears to be expressed in only the platypus, but is present in the echidna based on Southern blot analysis. The platypus may require a more effective mucosal immunity, with two highly divergent IgA forms, than the terrestrial echidna, due to its lifestyle, where it is exposed to pathogens both on land and in the water.

  17. Both IgA nephropathy and alcoholic cirrhosis feature abnormally glycosylated IgA1 and soluble CD89-IgA and IgG-IgA complexes: common mechanisms for distinct diseases.

    PubMed

    Tissandié, Emilie; Morelle, Willy; Berthelot, Laureline; Vrtovsnik, François; Daugas, Eric; Walker, Francine; Lebrec, Didier; Trawalé, Jean-Marie; Francoz, Claire; Durand, François; Moura, Ivan C; Paradis, Valérie; Moreau, Richard; Monteiro, Renato C

    2011-12-01

    Abnormalities of IgA arise in alcoholic cirrhosis, including mesangial IgA deposits with possible development of secondary IgA nephropathy (IgAN). Since little is known about circulating immune complexes in cases of secondary IgAN, we analyzed IgA-associated parameters in the serum of 32 patients with compensated or advanced alcoholic cirrhosis. Galactose deficiency and decreased sialylation of IgA1, as well as increased amounts of abnormally glycosylated polymeric IgA1, were detected in the serum of patients with advanced alcoholic cirrhosis. Moreover, aberrant IgA1 formed complexes with IgG and soluble CD89 in serum of patients with advanced alcoholic cirrhosis, similar to those found in primary IgAN. The IgA1 of alcoholic cirrhosis, however, had a modified N-glycosylation, not found in primary IgAN. In patients with alcoholic cirrhosis and IgAN, IgA deposits were associated with CD71 overexpression in mesangial areas, suggesting that CD71 might be involved in deposit formation. Although the IgA1 found in alcoholic cirrhosis bound more extensively to human mesangial cells than control IgA1, they differ from primary IgAN by not inducing mesangial cell proliferation. Thus, abnormally glycosylated IgA1 and soluble CD89-IgA and IgA-IgG complexes, features of primary IgAN, are also present in alcoholic cirrhosis. Hence, common mechanisms appear to be shared by diseases of distinct origins, indicating that common environmental factors may influence the development of IgAN.

  18. N-acetylgalactosamine exposure of serum IgA1 was associated with glomerulosclerosis and tubular atrophy/interstitial fibrosis of IgA nephropathy patients.

    PubMed

    Xu, Li-Xia; Ye, Zhi-Ming; Feng, Zhonglin; Xin, Gang; Zhang, Bin; Liu, Shuangxin; Li, Ruizhao; Li, Zhilian; Liang, Xinling; Shi, Wei

    2014-01-01

    Immunoglobulin A nephropathy (IgAN) is the most common glomerulonephritis with various histological and clinical phenotypes. N-acetylgalactosamine (GalNAc) exposure plays a pivotal role in the pathogenesis of IgAN. The aim of the current study is to investigate whether GalNAc exposure of serum IgA1 was associated with clinical and pathological manifestation of IgAN. Sera from 199 patients with biopsy proved IgAN were collected. Clinical and pathological manifestations were collected. Biotinylated Helix aspersa were used in ELISA to examine GalNAc exposure on IgA1 molecules. Patients were divided into two groups according to the GalNAc exposure rate less or more than 0.4. Age, gender, and serum creatinine were comparable between the two groups. Univariate analysis showed that significantly higher urinary protein excretion rate but less severe glomerular sclerosis and tubularinterstitial fibrosis were observed in the lower GalNAc exposure group. Multivariate regression analysis demonstrated that adjusted by age and gender, the GalNAc exposure rate more than 0.4 was a risk factor of glomerular sclerosis and tubularinterstitial fibrosis, OR*(95% CI) were 2.76 (1.19-6.37) and 2.49 (1.18-5.25), respectively. Immunoglobulin A nephropathy patients with lower proteinuria had higher GalNAc exposure rates. The GalNAc exposure rate more than 0.4 was a risk factor of severe chronic renal tissue change. © 2013 Asian Pacific Society of Nephrology.

  19. Serum under-O-glycosylated IgA1 level is not correlated with glomerular IgA deposition based upon heterogeneity in the composition of immune complexes in IgA nephropathy

    PubMed Central

    2014-01-01

    Background Although serum under-O-glycosylated IgA1 in IgA nephropathy (IgAN) patients may deposit more preferentially in glomeruli than heavily-O-glycosylated IgA1, the relationship between the glomerular IgA deposition level and the O-glycan profiles of serum IgA1 remains obscure. Methods Serum total under-O-glycosylated IgA1 levels were quantified in 32 IgAN patients by an enzyme-linked immunosorbent assay (ELISA) with Helix aspersa (HAA) lectin. Serum under-O-glycosylated polymeric IgA1 (pIgA1) was selectively measured by an original method using mouse Fcα/μ receptor (mFcα/μR) transfectant and flow cytometry (pIgA1 trap). The percentage area of IgA deposition in the whole glomeruli (Area-IgA) was quantified by image analysis on the immunofluorescence of biopsy specimens. Correlations were assessed between the Area-IgA and data from HAA-ELISA or pIgA1 trap. The relationships between clinical parameters and data from HAA-ELISA or pIgA1 trap were analyzed by data mining approach. Results While the under-O-glycosylated IgA1 levels in IgAN patients were significantly higher than those in healthy controls when measured (p < 0.05), there was no significant difference in under-O-glycosylated pIgA1. There was neither a correlation observed between the data from HAA-ELISA and pIgA1 trap (r2 = 0.09) in the IgAN patients (r2 = 0.005) nor was there a linear correlation between Area-IgA and data from HAA-ELISA or the pIgA1 trap (r2 = 0.005, 0.03, respectively). Contour plots of clinical parameters versus data from HAA-ELISA and the pIgA1 trap revealed that patients with a high score in each clinical parameter concentrated in specific areas, showing that patients with specific O-glycan profiles of IgA1 have similar clinical parameters. A decision tree analysis suggested that dominant immune complexes in glomeruli were consisted of: 1) IgA1-IgG and complements, 2) pIgA1 and complements, and 3) monomeric IgA1-IgA or aggregated monomeric IgA1. Conclusions

  20. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    PubMed Central

    De Paolis, Francesca; Beghetto, Elisa; Spadoni, Andrea; Montagnani, Francesca; Felici, Franco; Oggioni, Marco R; Gargano, Nicola

    2007-01-01

    Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA) of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery. PMID:18088426

  1. Serum Galactose-Deficient IgA1 Level Is Not Associated with Proteinuria in Children with IgA Nephropathy

    PubMed Central

    Hastings, M. Colleen; Afshan, Sabahat; Sanders, John T.; Kane, Oulimata; Eison, T. Matthew; Lau, Keith K.; Moldoveanu, Zina; Julian, Bruce A.; Novak, Jan; Wyatt, Robert J.

    2012-01-01

    Introduction. Percentage of galactose-deficient IgA1 (Gd-IgA1) relative to total IgA in serum was recently reported to correlate with proteinuria at time of sampling and during follow-up for pediatric and adult patients with IgA nephropathy. We sought to determine whether this association exists in another cohort of pediatric patients with IgA nephropathy. Methods. Subjects were younger than 18 years at entry. Blood samples were collected on one or more occasions for determination of serum total IgA and Gd-IgA1. Gd-IgA1 was expressed as serum level and percent of total IgA. Urinary protein/creatinine ratio was calculated for random specimens. Spearman's correlation coefficients assessed the relationship between study variables. Results. The cohort had 29 Caucasians and 11 African-Americans with a male : female ratio of 1.9 : 1. Mean age at diagnosis was 11.7 ± 3.7 years. No statistically significant correlation was identified between serum total IgA, Gd-IgA1, or percent Gd-IgA1 versus urinary protein/creatinine ratio determined contemporaneously with biopsy or between average serum Gd-IgA1 or average percent Gd-IgA1 and time-average urinary protein/creatinine ratio. Conclusion. The magnitude of proteinuria in this cohort of pediatric patients with IgA nephropathy was influenced by factors other than Gd-IgA1 level, consistent with the proposed multi-hit pathogenetic pathways for this renal disease. PMID:22754697

  2. Changes in Nephritogenic Serum Galactose-Deficient IgA1 in IgA Nephropathy following Tonsillectomy and Steroid Therapy

    PubMed Central

    Suzuki, Hitoshi; Sato, Daisuke; Kano, Tatsuya; Yanagawa, Hiroyuki; Matsuzaki, Keiichi; Horikoshi, Satoshi; Novak, Jan; Tomino, Yasuhiko

    2014-01-01

    Background Recent studies have shown that galactose-deficient IgA1 (GdIgA1) has an important role in the pathogenesis of IgA nephropathy (IgAN). Although emerging data suggest that serum GdIgA1 can be a useful non-invasive IgAN biomarker, the localization of nephritogenic GdIgA1-producing B cells remains unclear. Recent clinical and experimental studies indicate that immune activation tonsillar toll-like receptor (TLR) 9 may be involved in the pathogenesis of IgAN. Here we assessed the possibility of GdIgA1 production in the palatine tonsils in IgAN patients. Methods We assessed changes in serum GdIgA1 levels in IgAN patients with clinical remission of hematuria and proteinuria following combined tonsillectomy and steroid pulse therapy. Further, the association between clinical outcome and tonsillar TLR9 expression was evaluated. Results Patients (n = 37) were divided into two groups according to therapy response. In one group, serum GdIgA1 levels decreased after tonsillectomy (59%) alone, whereas in the other group most levels only decreased after the addition of steroid pulse therapy to tonsillectomy (41%). The former group showed significantly higher tonsillar TLR9 expression and better improvement in hematuria immediately after tonsillectomy than the latter group. Conclusions The present study indicates that the palatine tonsils are probably a major sites of GdIgA1-producing cells. However, in some patients these cells may propagate to other lymphoid organs, which may partially explain the different responses observed to tonsillectomy alone. These findings help to clarify some of the clinical observations in the management of IgAN, and may highlight future directions for research. PMID:24586974

  3. Elucidating heterogeneity of IgA1 hinge-region O-glycosylation by use of MALDI-TOF/TOF mass spectrometry: role of cysteine alkylation during sample processing

    PubMed Central

    Franc, Vojtěch; Řehulka, Pavel; Raus, Martin; Stulík, Jiří; Novak, Jan; Renfrow, Matthew B.; Šebela, Marek

    2013-01-01

    Determining disease-associated changes in protein glycosylation provides a better understanding of pathogenesis. This work focuses on human immunoglobulin A1 (IgA1), where aberrant O-glycosylation plays a key role in the pathogenesis of IgA nephropathy (IgAN). Normal IgA1 hinge region carries 3 to 6 O-glycans consisting of N-acetylgalactosamine (GalNAc) and galactose (Gal); both sugars may be sialylated. In IgAN patients, some O-glycans on a fraction of IgA1 molecules are Gal-deficient. Here we describe a sample preparation protocol with optimized cysteine alkylation of a Gal-deficient polymeric IgA1 myeloma protein prior to in-gel digestion and analysis of the digest by MALDI-TOF/TOF mass spectrometry (MS). Following a novel strategy, IgA1 hinge-region O-glycopeptides were fractionated by reversed-phase liquid chromatography using a microgradient device and identified by MALDI-TOF/TOF tandem MS (MS/MS). The acquired MS/MS spectra were interpreted manually and by means of our own software. This allowed assigning up to six O-glycosylation sites and demonstration, for the first time, of the distribution of isomeric O-glycoforms having the same molecular mass, but a different glycosylation pattern. The most abundant Gal-deficient O-glycoforms were GalNAc4Gal3 and GalNAc5Gal4 with one Gal-deficient site and GalNAc5Gal3 and GalNAc4Gal2 with two Gal-deficient sites. The most frequent Gal-deficient sites were at Ser230 and/or Thr236. PMID:23891555

  4. Solution structure determination of monomeric human IgA2 by X-ray and neutron scattering, analytical ultracentrifugation and constrained modelling: a comparison with monomeric human IgA1.

    PubMed

    Furtado, Patricia B; Whitty, Patrick W; Robertson, Alexis; Eaton, Julian T; Almogren, Adel; Kerr, Michael A; Woof, Jenny M; Perkins, Stephen J

    2004-05-14

    Immunoglobulin A (IgA), the most abundant human immunoglobulin, mediates immune protection at mucosal surfaces as well as in plasma. It exists as two subclasses IgA1 and IgA2, and IgA2 is found in at least two allotypic forms, IgA2m(1) or IgA2m(2). Compared to IgA1, IgA2 has a much shorter hinge region, which joins the two Fab and one Fc fragments. In order to assess its solution structure, monomeric recombinant IgA2m(1) was studied by X-ray and neutron scattering. Its Guinier X-ray radius of gyration R(G) is 5.18 nm and its neutron R(G) is 5.03 nm, both of which are significantly smaller than those for monomeric IgA1 at 6.1-6.2 nm. The distance distribution function P(r)for IgA2m(1) showed a broad peak with a subpeak and gave a maximum dimension of 17 nm, in contrast to the P(r) curve for IgA1, which showed two distinct peaks and a maximum dimension of 21 nm. The sedimentation coefficients of IgA1 and IgA2m(1) were 6.2S and 6.4S, respectively. These data show that the solution structure of IgA2m(1) is significantly more compact than IgA1. The complete monomeric IgA2m(1) structure was modelled using molecular dynamics to generate random IgA2 hinge structures, to which homology models for the Fab and Fc fragments were connected to generate 10,000 full models. A total of 104 compact best-fit IgA2m(1) models gave good curve fits. These best-fit models were modified by linking the two Fab light chains with a disulphide bridge that is found in IgA2m(1), and subjecting these to energy refinement to optimise this linkage. The averaged solution structure of the arrangement of the Fab and Fc fragments in IgA2m(1) was found to be predominantly T-shaped and flexible, but also included Y-shaped structures. The IgA2 models show full steric access to the two FcalphaRI-binding sites at the Calpha2-Calpha3 interdomain region in the Fc fragment. Since previous scattering modelling had shown that IgA1 also possessed a flexible T-shaped solution structure, such a T-shape may be

  5. Elevated Plasma α-Defensins (HNP1–3) Levels Correlated with IgA1 Glycosylation and Susceptibility to IgA Nephropathy

    PubMed Central

    Qi, Yuan-yuan; Zhou, Xu-jie; Cheng, Fa-juan

    2016-01-01

    Aim. IgA nephropathy (IgAN) is the most common form of glomerulonephritis. Recent genome-wide association study (GWAS) suggested that DEFA locus (which encodes α-defensins) may play a key role in IgAN. Methods. The levels of α-defensins in 169 IgAN patients and 83 healthy controls were tested by ELISA. Results. We observed that α-defensins human neutrophil peptides 1–3 (HNP1–3) in IgAN patients were elevated compared with healthy controls. The mean levels of α-defensins of 83 healthy controls and 169 IgAN patients were 50 ng/mL and 78.42 ng/mL. When the results were adjusted to the mean levels of α-defensins of IgAN patients, the percentage of individuals with high levels of α-defensins increased in IgAN patients (22.5%) compared to healthy controls (9.6%) (p = 0.013). The elevation of α-defensins in IgAN patients was independent of renal function or neutrophil count, which were major sources of α-defensins in circulation. More importantly, negative correlation was observed between galactose-deficient IgA1and α-defensins. Conclusion. As α-defensin is a lectin-like peptide, we speculated that it might be involved in IgA galactose deficiency. The data implied that patients with IgAN had higher plasma α-defensins levels and high α-defensins correlated with IgA galactose deficiency, further suggesting a pathogenic role of α-defensins in IgAN. PMID:27563166

  6. Active-site gating regulates substrate selectivity in a chymotrypsin-like serine protease the structure of haemophilus influenzae immunoglobulin A1 protease.

    PubMed

    Johnson, Troy A; Qiu, Jiazhou; Plaut, Andrew G; Holyoak, Todd

    2009-06-12

    We report here the first structure of a member of the immunoglobulin A protease (IgAP) family at 1.75-A resolution. This protease is a founding member of the type V (autotransporter) secretion system and is considered a virulence determinant among the bacteria expressing the enzyme. The structure of the enzyme fits that of a classic autotransporter in which several unique domains necessary for protein function are appended to a central, 100-A-long beta-helical domain. The N-terminal domain of the IgAP is found to possess a chymotrypsin-like fold. However, this catalytic domain contains a unique loop D that extends over the active site acting as a lid, gating substrate access. The data presented provide a structural basis for the known ability of IgAPs to cleave only the proline/serine/threonine-rich hinge peptide unique to IgA1 (isotype 1) in the context of the intact fold of the immunoglobulin. Based upon the structural data, as well as molecular modeling, a model suggesting that the unique extended loop D in this IgAP sterically occludes the active-site binding cleft in the absence of immunoglobulin binding is presented. Only in the context of binding of the IgA1-Fc domain in a valley formed between the N-terminal protease domain and another domain appended to the beta-helix spine (domain 2) is the lid stabilized in an open conformation. The stabilization of this open conformation through Fc association subsequently allows access of the hinge peptide to the active site, resulting in recognition and cleavage of the substrate.

  7. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy

    PubMed Central

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming

    2016-01-01

    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN. PMID:27485391

  8. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy.

    PubMed

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming

    2016-08-03

    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN.

  9. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease

    PubMed Central

    Murphy, Timothy F.; Kirkham, Charmaine; Jones, Megan M.; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M.

    2015-01-01

    Background. Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. Methods. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. Results. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Conclusions. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. PMID:25995193

  10. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease.

    PubMed

    Murphy, Timothy F; Kirkham, Charmaine; Jones, Megan M; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M

    2015-12-01

    Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  12. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  13. Protoporphyrins Enhance Oligomerization and Enzymatic Activity of HtrA1 Serine Protease

    PubMed Central

    Jo, Hakryul; Patterson, Victoria; Stoessel, Sean; Kuan, Chia-Yi; Hoh, Josephine

    2014-01-01

    High temperature requirement protein A1 (HtrA1), a secreted serine protease of the HtrA family, is associated with a multitude of human diseases. However, the exact functions of HtrA1 in these diseases remain poorly understood. We seek to unravel the mechanisms of HtrA1 by elucidating its interactions with chemical or biological modulators. To this end, we screened a small molecule library of 500 bioactive compounds to identify those that alter the formation of extracellular HtrA1 complexes in the cell culture medium. An initial characterization of two novel hits from this screen showed that protoporphyrin IX (PPP-IX), a precursor in the heme biosynthetic pathway, and its metalloporphyrin (MPP) derivatives fostered the oligomerization of HtrA1 by binding to the protease domain. As a result of the interaction with MPPs, the proteolytic activity of HtrA1 against Fibulin-5, a specific HtrA1 substrate in age-related macular degeneration (AMD), was increased. This physical interaction could be abolished by the missense mutations of HtrA1 found in patients with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Furthermore, knockdown of HtrA1 attenuated apoptosis induced by PPP-IX. These results suggest that PPP-IX, or its derivatives, and HtrA1 may function as co-factors whereby porphyrins enhance oligomerization and the protease activity of HtrA1, while active HtrA1 elevates the pro-apoptotic actions of porphyrin derivatives. Further analysis of this interplay may shed insights into the pathogenesis of diseases such as AMD, CARASIL and protoporphyria, as well as effective therapeutic development. PMID:25506911

  14. Proresolving Actions of Synthetic and Natural Protease Inhibitors Are Mediated by Annexin A1.

    PubMed

    Vago, Juliana P; Tavares, Luciana P; Sugimoto, Michelle A; Lima, Graziele Letícia N; Galvão, Izabela; de Caux, Thais R; Lima, Kátia M; Ribeiro, Ana Luíza C; Carneiro, Fernanda S; Nunes, Fernanda Freire C; Pinho, Vanessa; Perretti, Mauro; Teixeira, Mauro M; Sousa, Lirlândia P

    2016-02-15

    Annexin A1 (AnxA1) is a glucocorticoid-regulated protein endowed with anti-inflammatory and proresolving properties. Intact AnxA1 is a 37-kDa protein that may be cleaved in vivo at the N-terminal region by neutrophil proteases including elastase and proteinase-3, generating the 33-kDa isoform that is largely inactive. In this study, we investigated the dynamics of AnxA1 expression and the effects of synthetic (sivelestat [SIV]; Eglin) and natural (secretory leukocyte protease inhibitor [SLPI]; Elafin) protease inhibitors on the resolution of LPS-induced inflammation. During the settings of LPS inflammation AnxA1 cleavage associated closely with the peak of neutrophil and elastase expression and activity. SLPI expression increased during resolving phase of the pleurisy. Therapeutic treatment of LPS-challenge mice with recombinant human SLPI or Elafin accelerated resolution, an effect associated with increased numbers of apoptotic neutrophils in the pleural exudates, inhibition of elastase, and modulation of the survival-controlling proteins NF-κB and Mcl-1. Similar effects were observed with SIV, which dose-dependently inhibited neutrophil elastase and shortened resolution intervals. Mechanistically, SIV-induced resolution was caspase-dependent, associated to increased levels of intact AnxA1 and decreased expression of NF-κB and Mcl-1. The proresolving effect of antiproteases was also observed in a model of monosodium urate crystals-induced inflammation. SIV skewed macrophages toward resolving phenotypes and enhanced efferocytosis of apoptotic neutrophils. A neutralizing antiserum against AnxA1 and a nonselective antagonist of AnxA1 receptor abolished the accelerated resolution promoted by SIV. Collectively, these results show that elastase inhibition not only inhibits inflammation but actually promotes resolution, and this response is mediated by protection of endogenous intact AnxA1 with ensuing augmentation of neutrophil apoptosis.

  15. Serine protease HtrA1 accumulates in corneal transforming growth factor beta induced protein (TGFBIp) amyloid deposits

    PubMed Central

    Karring, Henrik; Poulsen, Ebbe Toftgaard; Runager, Kasper; Thøgersen, Ida B.; Klintworth, Gordon K.; Højrup, Peter

    2013-01-01

    Purpose Specific mutations in the transforming growth factor beta induced (TGFBI) gene are associated with lattice corneal dystrophy (LCD) type 1 and its variants. In this study, we performed an in-depth proteomic analysis of human corneal amyloid deposits associated with the heterozygous A546D mutation in TGFBI. Methods Corneal amyloid deposits and the surrounding corneal stroma were procured by laser capture microdissection from a patient with an A546D mutation in TGFBI. Proteins in the captured corneal samples and healthy corneal stroma were identified with liquid chromatography-tandem mass spectrometry and quantified by calculating exponentially modified Protein Abundance Index values. Mass spectrometry data were further compared for identifying enriched regions of transforming growth factor beta induced protein (TGFBIp/keratoepithelin/βig-h3) and detecting proteolytic cleavage sites in TGFBIp. Results A C-terminal fragment of TGFBIp containing residues Y571-R588 derived from the fourth fasciclin 1 domain (FAS1–4), serum amyloid P-component, apolipoprotein A-IV, clusterin, and serine protease HtrA1 were significantly enriched in the amyloid deposits compared to the healthy cornea. The proteolytic cleavage sites in TGFBIp from the diseased cornea are in accordance with the activity of serine protease HtrA1. We also identified small amounts of the serine protease kallikrein-14 in the amyloid deposits. Conclusions Corneal amyloid caused by the A546D mutation in TGFBI involves several proteins associated with other varieties of amyloidosis. The proteomic data suggest that the sequence 571-YHIGDEILVSGGIGALVR-588 contains the amyloid core of the FAS1–4 domain of TGFBIp and point at serine protease HtrA1 as the most likely candidate responsible for the proteolytic processing of amyloidogenic and aggregated TGFBIp, which explains the accumulation of HtrA1 in the amyloid deposits. With relevance to identifying serine proteases, we also found glia-derived nexin

  16. Helical apolipoproteins stabilize ATP-binding cassette transporter A1 by protecting it from thiol protease-mediated degradation.

    PubMed

    Arakawa, Reijiro; Yokoyama, Shinji

    2002-06-21

    ATP-binding cassette transporter (ABC) A1 was increased by apolipoprotein A-I without an increase of its message in THP-1 cells. The pulse label study demonstrated that apoA-I retarded degradation of ABCA1. Similar changes were demonstrated by apoA-II, but the effect of high density lipoprotein was almost negligible on the basis of equivalent protein concentration. Thiol protease inhibitors (leupeptin and N-acetyl-Leu-Leu-norleucinal (ALLN)) increased ABCA1 and slowed its decay in the cells, whereas none of the proteosome-specific inhibitor lactacystin, other protease inhibitors, or the lysosomal inhibitor NH(4)Cl showed such effects. The effects of apoA-I and ALLN were additive for the increase of ABCA1, and the apoA-I-mediated cellular lipid release was enhanced by ALLN. The data suggest that ABCA1 is rapidly degraded by a thiol protease(s) in the cells unless helical apolipoproteins in their lipid-free form stabilize ABCA1 by protecting it from protease-mediated degradation.

  17. The trimeric serine protease HtrA1 forms a cage-like inhibition complex with an anti-HtrA1 antibody.

    PubMed

    Ciferri, Claudio; Lipari, Michael T; Liang, Wei-Ching; Estevez, Alberto; Hang, Julie; Stawicki, Scott; Wu, Yan; Moran, Paul; Elliott, Mike; Eigenbrot, Charles; Katschke, Kenneth J; van Lookeren Campagne, Menno; Kirchhofer, Daniel

    2015-12-01

    High temperature requirement A1 (HtrA1) is a trypsin-fold serine protease implicated in the progression of age-related macular degeneration (AMD). Our interest in an antibody therapy to neutralize HtrA1 faces the complication that the target adopts a trimeric arrangement, with three active sites in close proximity. In the present study, we describe antibody 94, obtained from a human antibody phage display library, which forms a distinct macromolecular complex with HtrA1 and inhibits the enzymatic activity of recombinant and native HtrA1 forms. Using biochemical methods and negative-staining EM we were able to elucidate the molecular composition of the IgG94 and Fab94 complexes and the associated inhibition mechanism. The 246-kDa complex between the HtrA1 catalytic domain trimer (HtrA1_Cat) and Fab94 had a propeller-like organization with one Fab bound peripherally to each protomer. Low-resolution EM structures and epitope mapping indicated that the antibody binds to the surface-exposed loops B and C of the catalytic domain, suggesting an allosteric inhibition mechanism. The HtrA1_Cat-IgG94 complex (636 kDa) is a cage-like structure with three centrally located IgG94 molecules co-ordinating two HtrA1_Cat trimers and the six active sites pointing into the cavity of the cage. In both complexes, all antigen-recognition regions (paratopes) are found to bind one HtrA1 protomer and all protomers are bound by a paratope, consistent with the complete inhibition of enzyme activity. Therefore, in addition to its potential therapeutic usefulness, antibody 94 establishes a new paradigm of multimeric serine protease inhibition.

  18. Thermodynamic analysis of unusually thermostable CutA1 protein from human brain and its protease susceptibility.

    PubMed

    Bagautdinov, Bagautdin; Matsuura, Yoshinori; Yamamoto, Hitoshi; Sawano, Masahide; Ogasahara, Kyoko; Takehira, Michiyo; Kunishima, Naoki; Katoh, Etsuko; Yutani, Katsuhide

    2015-03-01

    Unusually stable proteins are a disadvantage for the metabolic turnover of proteins in cells. The CutA1 proteins from Pyrococcus horikoshii and from Oryza sativa (OsCutA1) have unusually high denaturation temperatures (Td) of nearly 150 and 100 °C, respectively, at pH 7.0. It seemed that the CutA1 protein from the human brain (HsCutA1) also has a remarkably high stability. Therefore, the thermodynamic stabilities of HsCutA1 and its protease susceptibility were examined. The Td was remarkably high, being over 95 °C at pH 7.0. The unfolding Gibbs energy (ΔG(0)H2O) was 174 kJ/mol at 37 °C from the denaturant denaturation. The thermodynamic analysis showed that the unfolding enthalpy and entropy values of HsCutA1 were considerably lower than those of OsCutA1 with a similar stability to HsCutA1, which should be related to flexibility of the unstructured properties in both N- and C-terminals of HsCutA1. HsCutA1 was almost completely digested after 1-day incubation at 37 °C by subtilisin, although OsCutA1 was hardly digested at the same conditions. These results indicate that easily available fragmentation of HsCutA1 with remarkably high thermodynamic stability at the body temperature should be important for its protein catabolism in the human cells.

  19. Correlation Between Expression of High Temperature Requirement Serine Protease A1 (HtrA1) in Nucleus Pulposus and T2 Value of Magnetic Resonance Imaging.

    PubMed

    Li, Dapeng; Yue, Jiawei; Jiang, Lu; Huang, Yonghui; Sun, Jifu; Wu, Yan

    2017-04-22

    BACKGROUND Degrading enzymes play an important role in the process of disc degeneration. The objective of this study was to investigate the correlation between the expression of high temperature requirement serine protease A1 (HtrA1) in the nucleus pulposus and the T2 value of the nucleus pulposus region in magnetic resonance imaging (MRI). MATERIAL AND METHODS Thirty-six patients who had undergone surgical excision of the nucleus pulposus were examined by MRI before surgery. Pfirrmann grading of the target intervertebral disc was performed according to the sagittal T2-weighted imaging, and the T2 value of the target nucleus pulposus was measured according to the median sagittal T2 mapping. The correlation between the Pfirrmann grade and the T2 value was analyzed. The expression of HtrA1 in the nucleus pulposus was analyzed by RT-PCR and Western blot. The correlation between the expression of HtrA1 and the T2 value was analyzed. RESULTS The T2 value of the nucleus pulposus region was 33.11-167.91 ms, with an average of 86.64±38.73 ms. According to Spearman correlation analysis, there was a rank correlation between T2 value and Pfirrmann grade (P<0.0001), and the correlation coefficient (rs)=-0.93617. There was a linear correlation between the mRNA level of HtrA1 and T2 value in nucleus pulposus tissues (a=3.88, b=-0.019, F=112.63, P<0.0001), normalized regression coefficient=-0.88. There was a linear correlation between the expression level of HtrA1 protein and the T2 value in the nucleus pulposus tissues (a=3.30, b=-0.016, F=93.15, P<0.0001) and normalized regression coefficient=-0.86. CONCLUSIONS The expression of HtrA1 was strongly related to the T2 value, suggesting that HtrA1 plays an important role in the pathological process of intervertebral disc degeneration.

  20. Comparison of HCV NS3 protease and NS5B polymerase inhibitor activity in 1a, 1b and 2a replicons and 2a infectious virus.

    PubMed

    Paulson, Matthew S; Yang, Huiling; Shih, I-hung; Feng, Joy Y; Mabery, Eric M; Robinson, Margaret F; Zhong, Weidong; Delaney, William E

    2009-08-01

    The hepatitis C virus infection system represents an important new tool for drug discovery. In this study, we compared the in vitro antiviral efficacy of several NS3 and NS5B inhibitors in genotype 1a, 1b, and 2a replicons and in the 2a infectious virus system. The nucleoside inhibitor 2'-C-methyl adenosine showed similar efficacy in each system tested. Three non-nucleoside inhibitors had small differences in potency between genotype 1a and 1b. In contrast, there was a dramatic loss of potency for these non-nucleoside inhibitors in the genotype 2a replicon, 2a infectious virus, and 2a NS5B biochemical assays. The protease inhibitor BILN-2061 had similar efficacy against 1a and 1b replicons but was 61-109-fold less potent against the 2a replicon and virus, respectively. VX-950, a covalent protease inhibitor, had similar efficacy (<3-fold changes in EC(50)) regardless of genotype or subtype. Importantly, we observed a significant correlation (p<0.0001) in antiviral potency between the 2a replicon and 2a infectious virus for all classes of compounds tested.

  1. Mesangial cells from patients with IgA nephropathy have increased susceptibility to galactose-deficient IgA1.

    PubMed

    Ebefors, Kerstin; Liu, Peidi; Lassén, Emelie; Elvin, Johannes; Candemark, Emma; Levan, Kristina; Haraldsson, Börje; Nyström, Jenny

    2016-04-05

    IgA nephropathy (IgAN) is the most common glomerulonephritis in the world, affecting close to a million people. Circulating galactose-deficient IgA (gd-IgA), present in patients with IgAN, form immune complex deposits in the glomerular mesangium causing local proliferation and matrix expansion. Intriguing though, individuals having gd-IgA deposits in the kidneys do not necessarily have signs of glomerular disease. Recurrence of IgAN only occurs in less than half of transplanted patients with IgAN, indicating that gd-IgA is not the only factor driving the disease. We hypothesize that, in addition to IgA complexes, patients with IgAN possess a subtype of mesangial cells highly susceptible to gd-IgA induced cell proliferation. To test the hypothesis, we designed a technique to culture primary mesangial cells from renal biopsies obtained from IgAN patients and controls. The cell response to gd-IgA treatment was then measured both on gene and protein level and the proliferation rate of the cells in response to PDGF was investigated. When treated with gd-IgA, mesangial cells from patients with IgAN express and release more PDGF compared to controls. In addition, the mesangial cells from patients with IgAN were more responsive to treatment with PDGF resulting in an increased proliferation rate of the cells compared to control. Mesangial cells cultured from patients with IgAN expressed and released more IL-6 than controls and had a higher expression of matrix genes. Both mesangial cells derived from patients with IgAN and controls increased their expressed TGFβ1 and CCL5 when treated with gd-IgA. We conclude that mesangial cells derived from IgAN patients have a mesangioproliferative phenotype with increased reactivity to IgA and that these cellular intrinsic properties may be important for the development of IgA nephropathy.

  2. Evidence of bovine immunoglobulin G1 (IgG1) protease activity in partially purified culture supernate of Pasteurella haemolytica A1.

    PubMed Central

    Lee, C W; Shewen, P E

    1996-01-01

    In the bovine respiratory tract, IgG1 is a major secretory immunoglobulin (Ig), and both IgG1 and IgG2 are believed to be important in defense against pneumonic pasteurellosis (shipping fever) in calves. Here we provide evidence for hydrolysis of IgG1 in the presence of partially purified culture supernate (ppCS) from the respiratory pathogen Pasteurella haemolytica A1. Bovine IgG1 was hydrolysed sequentially into three distinct bands (approximately 39, 12, and 7 kDa respectively). Furthermore, partial hydrolysis of bovine IgG2 was observed, but neither bovine IgA nor IgM were affected by incubation with ppCS. These findings suggest that the production of an IgG1-specific protease by P. haemolytica A1 may be a virulence mechanism contributing to the pathogenesis of bovine pneumonic pasteurellosis. Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. PMID:8785718

  3. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  4. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  5. Changes in expression of human serine protease HtrA1, HtrA2 and HtrA3 genes in benign and malignant thyroid tumors.

    PubMed

    Zurawa-Janicka, Dorota; Kobiela, Jarosław; Galczynska, Natalia; Stefaniak, Tomasz; Lipinska, Barbara; Lachinski, Andrzej; Skorko-Glonek, Joanna; Narkiewicz, Joanna; Proczko-Markuszewska, Monika; Sledzinski, Zbigniew

    2012-11-01

    Human HtrA proteins are serine proteases involved in essential physiological processes. HtrA1 and HtrA3 function as tumor suppressors and inhibitors of the TGF-β signaling pathway. HtrA2 regulates mitochondrial homeostasis and plays a pivotal role in the induction of apoptosis. The aim of the study was to determine whether the HtrA proteins are involved in thyroid carcinogenesis. We used the immunoblotting technique to estimate protein levels of HtrA1, HtrA2, long and short variants of HtrA3 (HtrA3-L and HtrA3-S) and TGF-β1 in tissues of benign and malignant thyroid lesions, and control groups. We found that the levels of HtrA2 and HtrA3-S were higher in thyroid malignant tumors compared to normal tissues and benign tumors. The HtrA3-L level was increased in malignant tumor tissues compared to benign tumor tissues and control tissues from patients with benign lesions, and elevated in normal tissues from patients with thyroid carcinoma compared to normal tissues from patients with benign lesions. We also compared levels of HtrA proteins in follicular thyroid carcinoma (FTC) and papillary thyroid carcinoma (PTC) and found that these types of carcinoma differed in the expression of HtrA3-S and HtrA1. These results indicate the implication of HtrA proteins in thyroid carcinogenesis suggest that HtrA3 variants may play different roles in cancer development, and that the increased HtrA3-L levels in thyroid tissue could be correlated with the development of malignant lesions. The TGF-β1 levels in tumor tissues were not significantly altered compared to control tissues.

  6. Network Analyses Reveal Pervasive Functional Regulation Between Proteases in the Human Protease Web

    PubMed Central

    Fortelny, Nikolaus; Cox, Jennifer H.; Kappelhoff, Reinhild; Starr, Amanda E.; Lange, Philipp F.; Pavlidis, Paul; Overall, Christopher M.

    2014-01-01

    Proteolytic processing is an irreversible posttranslational modification affecting a large portion of the proteome. Protease-cleaved mediators frequently exhibit altered activity, and biological pathways are often regulated by proteolytic processing. Many of these mechanisms have not been appreciated as being protease-dependent, and the potential in unraveling a complex new dimension of biological control is increasingly recognized. Proteases are currently believed to act individually or in isolated cascades. However, conclusive but scattered biochemical evidence indicates broader regulation of proteases by protease and inhibitor interactions. Therefore, to systematically study such interactions, we assembled curated protease cleavage and inhibition data into a global, computational representation, termed the protease web. This revealed that proteases pervasively influence the activity of other proteases directly or by cleaving intermediate proteases or protease inhibitors. The protease web spans four classes of proteases and inhibitors and so links both recently and classically described protease groups and cascades, which can no longer be viewed as operating in isolation in vivo. We demonstrated that this observation, termed reachability, is robust to alterations in the data and will only increase in the future as additional data are added. We further show how subnetworks of the web are operational in 23 different tissues reflecting different phenotypes. We applied our network to develop novel insights into biologically relevant protease interactions using cell-specific proteases of the polymorphonuclear leukocyte as a system. Predictions from the protease web on the activity of matrix metalloproteinase 8 (MMP8) and neutrophil elastase being linked by an inactivating cleavage of serpinA1 by MMP8 were validated and explain perplexing Mmp8 −/− versus wild-type polymorphonuclear chemokine cleavages in vivo. Our findings supply systematically derived and

  7. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  8. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  9. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  10. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  11. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage.

    PubMed

    Tchetina, Elena V; Markova, Galina A; Poole, A Robin; Zukor, David J; Antoniou, John; Makarov, Sergey A; Kuzin, Aleksandr N

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1-50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10-50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  12. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    PubMed Central

    Markova, Galina A.; Poole, A. Robin; Zukor, David J.; Antoniou, John; Makarov, Sergey A.; Kuzin, Aleksandr N.

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients. PMID:28042296

  13. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  14. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  15. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  16. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  17. Protease inhibitor studies enrolling.

    PubMed

    1995-01-01

    The protease enzyme is essential for HIV to make copies of itself. So far, research has failed to find a protease inhibitor that works against HIV. It is believed that, regardless of what type of protease inhibitor someone takes, it will need to be supplemented with other anti-HIV drugs. Three protease inhibitors have thus far been found to be safe, although long-term effects are unknown. These drugs are saquinavir, ABT-538, and L-735,524 produced by Hoffman-LaRoche, Abbott, and Merck respectively. Clinical trials of saquinavir are promising but it has not been shown to be the knock-out drug needed. ABT-538 has high bioavailability, but studies are showing it can cause liver and eye damage. L-735,524 studies are showing that resistance develops quite quickly. Future studies at higher doses are expected. To obtain information on protease studies currently looking for participants, contact The Network. Information on other approved, alternative, and experimental drugs is also available.

  18. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  19. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  20. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  1. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  2. Rapid qualitative protease microassay (RPM).

    PubMed

    Mohan, S; Ma, P W K; Luthe, D S

    2005-09-30

    A rapid qualitative protease microassay (RPM) was developed as an alternative to conventional assays of cysteine protease activity in HPLC fractions. Using this technique protease activity in samples could be visually determined within 5 min. The method was sensitive to 3.3x10(-7) U/mL of papain and detected cysteine protease activity in dilute HPLC fractions with activity of 5.4x10(-5) U/mL. Because the method monitors the decolorization of Coomassie Brilliant Blue stained substrate, it can be modified to detect other classes of proteases.

  3. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  4. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  5. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  6. Multifunctional Mitochondrial AAA Proteases

    PubMed Central

    Glynn, Steven E.

    2017-01-01

    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle. PMID:28589125

  7. Protease signalling: the cutting edge

    PubMed Central

    Turk, Boris; Turk, Dus̆an; Turk, Vito

    2012-01-01

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research. PMID:22367392

  8. Protease signalling: the cutting edge.

    PubMed

    Turk, Boris; Turk, Dušan; Turk, Vito

    2012-04-04

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research.

  9. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  10. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  11. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  12. Proteases in gastrointestinal neoplastic diseases.

    PubMed

    Herszényi, L; Plebani, M; Carraro, P; De Paoli, M; Roveroni, G; Cardin, R; Foschia, F; Tulassay, Z; Naccarato, R; Farinati, F

    2000-02-15

    Cysteine and serine proteases are involved in cancer invasion and metastasis. In the past few years we investigated the tissue levels of these proteases in gastric cancer (GC), gastric precancerous changes (CAG), colorectal cancer (CRC) and the plasma and serum levels of proteases in several gastrointestinal tumours, using ELISA methods. Significantly higher antigen levels were found not only in GC tissue but also in CAG with respect to the levels found normal tissue; with respect to CAG, patients with dysplasia had higher levels than patients without dysplasia. The same findings were obtained in CRC. In general protease levels correlated with the major histomorphological parameters, such as grading and histotype in GC as well as in CRC. Tissue protease levels had a strong prognostic impact in GC, in which UPA was singled out by multivariate analysis as the major prognostic factor, and CRC. The plasma levels of urokinase-type plasminogen activator (UPA) and the serum levels of cathepsin B were significantly increased in patients with gastrointestinal tumours. In conclusions, cysteine and serine proteases may have a part not only in GC and CRC invasion and metastasis, but also in the progression of gastric precancerous changes into cancer. They are strong prognostic factors in GC and CRC. These proteases may also have a role as tumour markers in the early diagnosis of gastrointestinal tract tumours.

  13. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  14. Exogenous proteases for meat tenderization.

    PubMed

    Bekhit, Alaa A; Hopkins, David L; Geesink, Geert; Bekhit, Adnan A; Franks, Philip

    2014-01-01

    The use of exogenous proteases to improve meat tenderness has attracted much interest recently, with a view to consistent production of tender meat and added value to lower grade meat cuts. This review discusses the sources, characteristics, and use of exogenous proteases in meat tenderization to highlight the specificity of the proteases toward meat proteins and their impact on meat quality. Plant enzymes (such as papain, bromelain, and ficin) have been extensively investigated as meat tenderizers. New plant proteases (actinidin and zingibain) and microbial enzyme preparations have been of recent interest due to controlled meat tenderization and other advantages. Successful use of these enzymes in fresh meat requires their enzymatic kinetics and characteristics to be determined, together with an understanding of the impact of the surrounding environmental conditions of the meat (pH, temperature) on enzyme function. This enables the optimal conditions for tenderizing fresh meat to be established, and the elimination or reduction of any negative impacts on other quality attributes.

  15. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  16. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  17. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  18. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior

    PubMed Central

    Almonte, Antoine G.; Sweatt, J. David

    2011-01-01

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes—coagulation, inflammation, and digestion, for example—have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation. PMID:21782155

  19. The salt-sensitive structure and zinc inhibition of Borrelia burgdorferi protease BbHtrA.

    PubMed

    Russell, Theresa M; Tang, Xiaoling; Goldstein, Jason M; Bagarozzi, Dennis; Johnson, Barbara J B

    2016-02-01

    HtrA serine proteases are highly conserved and essential ATP-independent proteases with chaperone activity. Bacteria express a variable number of HtrA homologues that contribute to the virulence and pathogenicity of bacterial pathogens. Lyme disease spirochetes possess a single HtrA protease homologue, Borrelia burgdorferi HtrA (BbHtrA). Previous studies established that, like the human orthologue HtrA1, BbHtrA is proteolytically active against numerous extracellular proteins in vitro. In this study, we utilized size exclusion chromatography and blue native polyacrylamide gel electrophoresis (BN-PAGE) to demonstrate BbHtrA oligomeric structures that were substrate independent and salt sensitive. Examination of the influence of transition metals on the activity of BbHtrA revealed that this protease is inhibited by Zn(2+) > Cu(2+) > Mn(2+). Extending this analysis to two other HtrA proteases, E. coli DegP and HtrA1, revealed that all three HtrA proteases were reversibly inhibited by ZnCl2 at all micro molar concentrations examined. Commercial inhibitors for HtrA proteases are not available and physiologic HtrA inhibitors are unknown. Our observation of conserved zinc inhibition of HtrA proteases will facilitate structural and functional studies of additional members of this important class of proteases. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  20. Serine proteases in rodent hippocampus.

    PubMed

    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

    1998-09-04

    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  1. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  2. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  3. Microbial proteases: detection, production, and genetic improvement.

    PubMed

    Kasana, Ramesh Chand; Salwan, Richa; Yadav, Sudesh Kumar

    2011-08-01

    Microbial proteases are one of the important groups of industrially and commercially produced enzymes contributing approximately 2/3 of all enzyme sales. Though proteases are produced by many microorganisms, emphasis is on the microorganisms producing proteases with desired characters. As demand for novel proteases is increasing day by day the initial screening methods and assays for protease detection are of utmost importance. This review focuses attention on present status of knowledge on the various methods and protocols available for protease screening, detection, and quantification starting from plate assays to spectrophotometric, fluorometric, and nanoparticles based assays. The review will help in making strategies for exploitation of protease resources and improvement of enzymes to obtain more robust proteases.

  4. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  5. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  6. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  7. Proteases in Fas-mediated apoptosis.

    PubMed

    Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S

    1997-01-01

    Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.

  8. Immunoglobulin A1 and A2 subclass of salivary antibodies to Candida albicans in patients with oral candidosis.

    PubMed Central

    Jeganathan, S; Ufomata, D; Hobkirk, J A; Ivanyi, L

    1987-01-01

    Immunoglobulin A antibody titres to a cytoplasmic protein extract of Candida albicans were determined by ELISA in saliva from 20 patients with oral candidosis and 21 controls. Patients had significantly increased levels of salivary IgA anti-Candida antibodies when compared with controls (P less than 0.001). Antibody levels were associated with IgA1 subclass in 90% of the patients; in contrast, IgA2 subclass was predominant in 67% of the controls. Antifungal therapy resulted in significantly decreased IgA1 titres (P less than 0.05) whilst the mean IgA2 antibody titre remained unchanged. The results indicate that Candida infection may change the subclass pattern of salivary IgA antibodies. PMID:3322616

  9. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  10. Function and Regulation of SUMO Proteases

    PubMed Central

    Hickey, Christopher M.; Wilson, Nicole R.; Hochstrasser, Mark

    2013-01-01

    Covalent attachment of small ubiquitin-like modifier (SUMO) to proteins is highly dynamic, and both SUMO-protein conjugation and cleavage can be regulated. Protein desumoylation is performed by SUMO proteases, which control cellular mechanisms ranging from transcription and cell division to ribosome biogenesis. Recent advances include the discovery of two novel classes of SUMO proteases, insights regarding SUMO protease specificity, and revelations of previously unappreciated SUMO protease functions in several key cellular pathways. These developments, together with new connections between SUMO proteases and the recently discovered SUMO-targeted ubiquitin ligases (STUbLs), make this an exciting period for the study of these enzymes. PMID:23175280

  11. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  12. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  13. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  14. Serine Protease Activity of Calnuc

    PubMed Central

    Kanuru, Madhavi; Raman, Rajeev; Aradhyam, Gopala Krishna

    2013-01-01

    The functions of calnuc, a novel Ca2+-binding protein with multiple structural domains and diverse interacting partners, are yet unknown. We demonstrate unknown facets of calnuc, which is a serine protease in which Ser-378 of GXSXG motif, Asp-328 of DTG motif, and His-339 form the “catalytic triad,” locating the enzyme active site in the C-terminal region. Analogous to the active site of Zn2+ carboxypeptidases, calnuc has two high affinity (Kd ∼ 20 nm), well conserved Zn2+-binding sites near its N terminus, although it is inactive as a peptidase. Zn2+ binding allosterically and negatively regulates the serine protease activity of calnuc, inhibition being caused by an “open to close” change in its conformation not seen upon Ca2+ binding. Most strikingly, interaction with G protein α subunit completely inhibits the enzymatic activity of calnuc. We thus illustrate that G proteins and Zn2+ act as two “keys” that control enzymatic activity of calnuc, arresting it in “locked” state. Calnuc, therefore, exists dynamically in two different forms, (i) as a Ca2+-binding protein in Zn2+-bound form and (ii) as a protease in Zn2+-free form, commissioning it to perform multiple functions. PMID:23195954

  15. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  16. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  18. Secretion of proteases from Pasteurella multocida isolates.

    PubMed

    Negrete-Abascal, E; Tenorio, V R; de la Garza, M

    1999-01-01

    The capability of Pasteurella multocida to secrete proteases to the culture medium and their characterization were studied in five animal isolates (bovine, chicken, sheep, and two from pig). All the isolates produced proteases in a wide range of molecular mass. It is suggested that they are neutral metalloproteases, since they were optimally active between pH 6 and 7, inhibited by chelating agents but not by other protease inhibitors, and reactivated by calcium. Proteases from isolates were able to degrade IgG. Several proteins from supernatants of cultures precipitated with 70% (NH4)2SO4 of all the P. multocida isolates were recognized by a polyclonal antiserum raised against a purified protease from Actinobacillus pleuropneumoniae. Protease production might play an important role during tissue colonization and in P. multocida diseases.

  19. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  20. Structure and Mechanism of Rhomboid Protease*

    PubMed Central

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-01-01

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases. PMID:23585569

  1. [Isolation and properties of cysteine protease from Serratia proteamaculans 94].

    PubMed

    Mozhina, N V; Burmistrova, O A; Pupov, D V; Rudenskaia, G N; Dunaevskiĭ, Ia E; Demidiuk, I V; Kostrov, S V

    2008-01-01

    A new cysteine protease (SpCP) with a molecular mass of about 50 kDa and optimal functioning at pH 8.0 was isolated from the culture medium of a Serratia proteamaculans 94 psychrotolerant strain using affinity and gel permeation chromatography. The enzyme N terminal amino acid sequence (SPVEEAEGDGIVLDV-) exhibits a reliable similarity to N terminal sequences of gingipains R, cysteine proteases from Polphyromonas gingivalis. Unlike gingipains R, SpCP displays a double substrate specificity and cleaves bonds formed by carboxylic groups of Arg, hydrophobic amino acid residues (Val, Leu, Ala, Tyr, and Phe), Pro, and Gly. SpCP can also hydrolyze native collagen. The enzyme catalysis is effective in a wide range of temperatures. Kinetic studies of Z-Ala-Phe-Arg-pNA hydrolysis catalyzed by the protease at 4 and 37 degrees C showed that a decrease in temperature by more than 30 degrees C causes a 1.3-fold increase in the kcat/Km ratio. Thus, SpCP is an enzyme adapted to low positive temperatures. A protease displaying such properties was found in microorganisms of the Serratia genus for the first time and may serve as a virulent factor for these bacteria.

  2. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  3. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  4. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  5. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  6. Chemiluminescent probe for the in vitro detection of protease activity.

    PubMed

    Richard, Jean-Alexandre; Jean, Ludovic; Romieu, Anthony; Massonneau, Marc; Noack-Fraissignes, Pauline; Renard, Pierre-Yves

    2007-11-08

    A strategy involving the use of a self-immolative linker has been investigated for the chemiluminescent sensing of proteases. The reactive linker enabled the release of a 1,2-dioxetane light precursor. As a proof of principle, caspase-3, a key peptidase involved in apoptosis has been targeted. An in vitro assay has been carried out and proved the decomposition of the linker and the selectivity for caspase-3.

  7. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  8. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-01-31

    CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT...could be fully inhibited at a 1:1 molar ratio by the naturally-occuring proteinaceous trypsin inhibitors BBI from soybeans and CI from chickpeas ...substrates. These activities were fully inhibited by the proteinaceous trypsin-chymotrypsin inhibitors BBI from soybeans and CI from chickpeas when assayed

  9. Tissue Dissociation Enzyme Neutral Protease Assessment

    PubMed Central

    Breite, A.G.; Dwulet, F.E.; McCarthy, R.C.

    2010-01-01

    Neutral proteases, essential components of purified tissue dissociation enzymes required for successful human islet isolation, show variable activities and effects of substrate on their activities. Initially we used a spectrophotometric endpoint assay with azocasein substrate to measure neutral protease activity. After critical review of the results, we observed these data to be inconsistent and not correlating expected differences in specific activities between thermolysin and Bacillus polymyxa proteases. This observation led to the development of a fluorescent microplate assay using fluorescein isothyocyanate–conjugated bovine serum albumin (FITC-BSA) as the substrate. This simpler, more flexible method offered a homogeneous, kinetic enzyme assay allowing determination of steady state reaction rates of sample replicates at various dilutions. The assay had a linear range of 4- to 8-fold and interassay coefficients of variation for B polymyxa protease and thermolysin of <9% and <15%, respectively, which were lower than those using the spectrophotometric endpoint assay, namely, 54% and 36%, respectively. This format allowed for incorporation of enzyme inhibitors, as illustrated by addition of sulfhydryl protease inhibitors, which, consistent with earlier reports, strongly indicated that the main contaminant in purified collagenase preparations was clostripain. Determination of the specific activities for several purified neutral proteases showed that the B polymyxa and Clostridium histolyticum proteases had approximately 40% and 15% specific activities, respectively, of those obtained with purified thermolysin, indicating the different characteristics of neutral protease enzymes for cell isolation procedures. PMID:20692405

  10. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  11. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors

    PubMed Central

    2010-01-01

    Background The frequency of cyanobacterial blooms has increased worldwide, and these blooms have been claimed to be a major factor leading to the decline of the most important freshwater herbivores, i.e. representatives of the genus Daphnia. This suppression of Daphnia is partly attributed to the presence of biologically active secondary metabolites in cyanobacteria. Among these metabolites, protease inhibitors are found in almost every natural cyanobacterial bloom and have been shown to specifically inhibit Daphnia's digestive proteases in vitro, but to date no physiological responses of these serine proteases to cyanobacterial protease inhibitors in Daphnia have been reported in situ at the protein and genetic levels. Results Nine digestive proteases were detected in D. magna using activity-stained SDS-PAGE. Subsequent analyses by LC-MS/MS and database search led to the identification of respective protease genes. D. magna responded to dietary protease inhibitors by up-regulation of the expression of these respective proteases at the RNA-level and by the induction of new and less sensitive protease isoforms at the protein level. The up-regulation in response to dietary trypsin- and chymotrypsin-inhibitors ranged from 1.4-fold to 25.6-fold. These physiological responses of Daphnia, i.e. up-regulation of protease expression and the induction of isoforms, took place even after feeding on 20% cyanobacterial food for only 24 h. These physiological responses proved to be independent from microcystin effects. Conclusion Here for the first time it was shown in situ that a D. magna clone responds physiologically to dietary cyanobacterial protease inhibitors by phenotypic plasticity of the targets of these specific inhibitors, i.e. Daphnia gut proteases. These regulatory responses are adaptive for D. magna, as they increase the capacity for protein digestion in the presence of dietary protease inhibitors. The type and extent of these responses in protease expression might

  12. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  13. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  14. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  15. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  16. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  17. HIV-1 Protease: Structure, Dynamics and Inhibition

    SciTech Connect

    Louis, John M.; Ishima, R.; Torchia, D.A.; Weber, Irene T.

    2008-06-03

    The HIV-1 protease is synthesized as part of a large Gag-Pol precursor protein. It is responsible for its own release from the precursor and the processing of the Gag and Gag-Pol polyproteins into the mature structural and functional proteins required for virus maturation. Because of its indispensable role, the mature HIV-1 protease dimer has proven to be a successful target for the development of antiviral agents. In the last 5 years, a major emphasis in protease research has been to improve inhibitor design and treatment regimens.

  18. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  19. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application. Copyright © 2016 Asociación Española de Micología. Published by Elsevier Espana. All rights reserved.

  20. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  1. Studies on the specificity of the IgA-binding lectin, jacalin.

    PubMed

    Skea, D L; Christopoulous, P; Plaut, A G; Underdown, B J

    1988-01-01

    The interactions of IgA with the jackfruit lectin, jacalin, were investigated with regard to the specificity of jacalin for species and subclasses of IgA. It was found that jacalin selectively bound to human IgA1, but not to human IgA2, mouse IgA or rat IgA. Binding studies with human IgA1 fragments produced by different IgA1 proteases revealed that jacalin bound to galactose-terminal oligosaccharides in the hinge region of human IgA1. Affinity chromatography employing jacalin-Sepharose provided a means to separate the subclasses of IgA in human whey.

  2. Regulatory Characteristics of Bacillus pumilus Protease Promoters.

    PubMed

    Toymentseva, Anna A; Mascher, Thorsten; Sharipova, Margarita R

    2017-05-01

    Expression of extracellular protease genes of Bacilli is subject to regulation by many positive and negative regulators. Here we analyzed 5' regulatory regions of genes encoding proteolytic proteases AprBp, GseBp, and MprBp from Bacillus pumilus strain 3-19. Gfp fusion constructs with upstream genomic regions of different lengths were created for all three genes to identify their natural promoters (regulatory regions). Our results suggest that the aprBp gene, encoding the major subtilisin-like protease, has the most extensive promoter region of approximately 445 bp, while the minor protease genes encoding glutamyl endopeptidase (gseBp) and metalloproteinase (mprBp) are preceded by promoters of 150 and 250 bp in length, respectively. Promoter analysis of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporter fusion constructs in degU and spo0A mutants indicates a positive regulatory effect of DegU and Spo0A on protease expression, while the disruption of abrB, sinR, and scoC repressor genes did not significantly affect promoter activities of all protease genes. On the other hand, the expression of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporters increased 1.6- and 3.0-fold, respectively, in sigD-deficient cells, indicating that the prevention of motility gene expression promotes protease expression. Our results indicate that all examined regulators regulated serine proteases production in B. subtilis.

  3. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  4. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  5. How proteases regulate bone morphogenesis.

    PubMed

    Ortega, Nathalie; Behonick, Danielle; Stickens, Dominique; Werb, Zena

    2003-05-01

    Matrix metalloproteinases (MMPs) degrade most components of the extracellular matrix (ECM), as well as many non-ECM molecules. MMPs participate in (1). degradation of ECM to allow cell migration; (2). alteration of the ECM microenvironment resulting in alteration in cellular behavior; (3). modulation of biologically active molecules by direct cleavage or release from ECM stores; (4). regulation of the activity of other proteases; and (5). cell attachment, proliferation, differentiation, and apoptosis. We have sought to understand the role of MMPs during development and tissue repair in transgenic mice. Endochondral bone formation presents a particularly interesting developmental challenge. During this process, an avascular tissue (cartilage) is converted into one of the most highly vascularized tissues (bone) in the vertebrate body. Ossification begins with invasion of the calcified hypertrophic cartilage by capillaries. Apoptosis of the terminal hypertrophic chondrocytes, degradation of the cartilage matrix, and deposition of bone matrix by osteoblasts accompanies neovascularization of the growth plate. Remodeling of ECM results in a cavity filled with vascular channels containing hematopoietic cells. Our results reveal that MMP9, MMP13, and vascular endothelial growth factor are key regulators for the remodeling of the skeletal tissues. They coordinate not only matrix degradation, but also the recruitment and differentiation of endothelial cells, osteoclasts, chondroclasts, and osteoprogenitors.

  6. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  7. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  8. Subclass and molecular form of immunoglobulin A antibodies to Actinobacillus actinomycetemcomitans in juvenile periodontitis.

    PubMed Central

    Brown, T A; Byres, L; Gardner, M; Van Dyke, T E

    1991-01-01

    Patients with juvenile periodontitis frequently have elevated levels of serum immunoglobulin A (IgA) antibodies to antigens of Actinobacillus actinomycetemcomitans. IgA occurs in two subclasses, IgA1 and IgA2, and in monomeric and polymeric forms. Because IgA1 is susceptible to cleavage by IgA1 proteases produced by microorganisms found at mucosal sites and in the gingival crevice, we wished to determine the IgA subclass distribution of antibodies to antigens of A. actinomycetemcomitans. The molecular form was examined because it may indicate the origin of the IgA and because the form differs in acute and chronic infections. There is also evidence that monomeric and polymeric IgA have different biological functions. Serum was taken from patients with juvenile periodontitis before and at intervals during and after initiation of therapy. IgA subclass distribution was determined against a sonic extracts of A. actinomycetemcomitans ATCC 2952a (serotype b) by using monoclonal anti-subclass reagents in an enzyme-linked immunosorbent assay. To determine the molecular form of the antibodies, sera were separated by high-performance liquid chromatography on a size-exclusion column. Fractions were assayed for antibody activity by the enzyme-linked immunosorbent assay, and described above. The results of the subclass analysis of the sera indicated that while both IgA1 and IgA2 antibodies to A. actinomycetemcomitans sonic extract are often found before, during, and after treatment, IgA1 antibodies dominated the response. There was a predominance of monomeric IgA1 antibodies to A. actinomycetemcomitans sonic extracts in most samples before, during, and after treatment. The monomeric form is consistent with what is seen in other chronic infections. The predominance of IgA1 antibodies implies that any protective effects of the IgA response to A. actinomycetemcomitans could be compromised by microbial IgA1 proteases. PMID:1997415

  9. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  10. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    USDA-ARS?s Scientific Manuscript database

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  11. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  12. The dimer interfaces of protease and extra-protease domains influence the activation of protease and the specificity of GagPol cleavage.

    PubMed

    Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.

  13. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  14. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  15. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  16. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  17. An enzymatic method for the determination of hemoglobinA(1C).

    PubMed

    Hirokawa, Kozo; Shimoji, Kazuhiko; Kajiyama, Naoki

    2005-07-01

    Fructosyl peptide oxidase is a flavoenzyme that catalyzes the oxidative deglycation of N-(1-deoxyfructosyl)-Val-His, a model compound of hemoglobin (Hb)A(1C). To develop an enzymatic method for the measurement of HbA(1C), we screened for a proper protease using N-(1-deoxyfructosyl)-hexapeptide as a substrate. Several proteases, including Neutral protease from Bacillus polymyxa, were found to release N-(1-deoxyfructosyl)-Val-His efficiently, however no protease was found to release N-(1-deoxyfructosyl)-Val. Neutral protease also digested HbA(1C) to release N-(1-deoxyfructosyl)-Val-His, and then the fructosyl peptide was detected using fructosyl peptide oxidase. The linear relationship was observed between the concentration of HbA(1C) and the absorbancy of fructosyl peptide oxidase reaction, hence this new method is a practical means for measuring HbA(1C.).

  18. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  19. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  20. Neutrophil serine proteases in antibacterial defense.

    PubMed

    Stapels, Daphne A C; Geisbrecht, Brian V; Rooijakkers, Suzan H M

    2015-02-01

    Neutrophil serine proteases (NSPs) are critical for the effective functioning of neutrophils and greatly contribute to immune protection against bacterial infections. Thanks to their broad substrate specificity, these chymotrypsin-like proteases trigger multiple reactions that are detrimental to bacterial survival such as direct bacterial killing, generation of antimicrobial peptides, inactivation of bacterial virulence factors and formation of neutrophil extracellular traps. Recently, the importance of NSPs in antibacterial defenses has been further underscored by discoveries of unique bacterial evasion strategies to combat these proteases. Bacteria can indirectly disarm NSPs by protecting bacterial substrates against NSP cleavage, but also produce inhibitory molecules that potently block NSPs. Here we review recent insights in the functional contribution of NSPs in host protection against bacterial infections and the elegant strategies that bacteria use to counteract these responses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  2. A cysteine protease of Dieffenbachia maculata.

    PubMed

    Chitre, A; Padmanabhan, S; Shastri, N V

    1998-12-01

    Plants of the genus Dieffenbachia, very popular as indoor ornamental plants, are known for their toxic as well as therapeutic properties. Their toxic manifestations have been partly attributed to their proteolytic activity. The work described in the present paper shows that stem leaves and petiole of Dieffenbachia maculata Schott, a commonly grown species, contain significant proteolytic activity, different parts showing different types of protease activities. Stem showed the highest enzyme activity and this protease was purified about 55 fold by solvent precipitation, gel filtration and ion exchange chromatography. The enzyme has a relative molecular mass of 61 kDa as determined by SDS-PAGE and has an optimum pH of 8.0 and optimum temperature of 50 degrees C. Effects of various substrates, inhibitors and activators indicate that the enzyme is a cysteine protease with leucylpeptidase activity.

  3. Serine Protease(s) Secreted by the Nematode Trichuris muris Degrade the Mucus Barrier

    PubMed Central

    Hasnain, Sumaira Z.; McGuckin, Michael A.; Grencis, Richard K.; Thornton, David J.

    2012-01-01

    The polymeric mucin component of the intestinal mucus barrier changes during nematode infection to provide not only physical protection but also to directly affect pathogenic nematodes and aid expulsion. Despite this, the direct interaction of the nematodes with the mucins and the mucus barrier has not previously been addressed. We used the well-established Trichuris muris nematode model to investigate the effect on mucins of the complex mixture of immunogenic proteins secreted by the nematode called excretory/secretory products (ESPs). Different regimes of T. muris infection were used to simulate chronic (low dose) or acute (high dose) infection. Mucus/mucins isolated from mice and from the human intestinal cell line, LS174T, were treated with ESPs. We demonstrate that serine protease(s) secreted by the nematode have the ability to change the properties of the mucus barrier, making it more porous by degrading the mucin component of the mucus gel. Specifically, the serine protease(s) acted on the N-terminal polymerising domain of the major intestinal mucin Muc2, resulting in depolymerisation of Muc2 polymers. Importantly, the respiratory/gastric mucin Muc5ac, which is induced in the intestine and is critical for worm expulsion, was protected from the depolymerising effect exerted by ESPs. Furthermore, serine protease inhibitors (Serpins) which may protect the mucins, in particular Muc2, from depolymerisation, were highly expressed in mice resistant to chronic infection. Thus, we demonstrate that nematodes secrete serine protease(s) to degrade mucins within the mucus barrier, which may modify the niche of the parasite to prevent clearance from the host or facilitate efficient mating and egg laying from the posterior end of the parasite that is in intimate contact with the mucus barrier. However, during a TH2-mediated worm expulsion response, serpins, Muc5ac and increased levels of Muc2 protect the barrier from degradation by the nematode secreted protease(s). PMID

  4. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  5. Saquinavir, the pioneer antiretroviral protease inhibitor.

    PubMed

    la Porte, Charles J L

    2009-10-01

    The treatment of HIV infection underwent a major change in 1995 when saquinavir was the first protease inhibitor introduced into the market. This drug made the use of combination therapy in the treatment of HIV possible and increased the success rate of treatment. This article will review recent literature on saquinavir to define its current role in HIV treatment, among the newer antiretroviral drugs. Scientific literature and conference presentations were evaluated for relevant information pertaining to saquinavir. Although underused, saquinavir has good efficacy and tolerability when compared to other protease inhibitors. The film-coated tablet formulation improved pill burden. Saquinavir still has potential in the treatment of adults, children and pregnant women.

  6. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  7. Detection of protease and protease activity using a single nanocrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2015-09-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  8. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  9. Tissue Factor, Protease Activated Receptors and Pathologic Heart Remodeling

    PubMed Central

    Antoniak, Silvio; Sparkenbaugh, Erica; Pawlinski, Rafal

    2015-01-01

    Tissue factor is the primary initiator of coagulation cascade and plays an essential role in hemostasis and thrombosis. In addition, tissue factor and coagulation proteases contribute to the many cellular responses via activation of protease activated receptors. Heart is the organ demonstrating high levels of constitutive tissue factor expression. This review focuses on the role of tissue factor, coagulation proteases and protease activated receptors in heart hemostasis and the pathological heart remodeling associated with myocardial infarction, viral myocarditis and hypertension. PMID:25104210

  10. Discovery and characterization of a novel plant pathogen protease

    USDA-ARS?s Scientific Manuscript database

    Chitinase modifying proteins are fungal proteases that attack specific plant defense chitinases. At least three unrelated types of proteases have evolved to have this function. They all truncate the targeted chitinases by cleaving near their amino termini, but each protease type targets a different ...

  11. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  12. Zika Virus Protease: An Antiviral Drug Target.

    PubMed

    Kang, CongBao; Keller, Thomas H; Luo, Dahai

    2017-10-01

    The recent outbreak of Zika virus (ZIKV) infection has caused global concern due to its link to severe damage to the brain development of foetuses and neuronal complications in adult patients. A worldwide research effort has been undertaken to identify effective and safe treatment and vaccination options. Among the proposed viral and host components, the viral NS2B-NS3 protease represents an attractive drug target due to its essential role in the virus life cycle. Here, we outline recent progress in studies on the Zika protease. Biochemical, biophysical, and structural studies on different protease constructs provide new insight into the structure and activity of the protease. The unlinked construct displays higher enzymatic activity and better mimics the native state of the enzyme and therefore is better suited for drug discovery. Furthermore, the structure of the free enzyme adopts a closed conformation and a preformed active site. The availability of a lead fragment hit and peptide inhibitors, as well as the attainability of soakable crystals, suggest that the unlinked construct is a promising tool for drug discovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  14. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  15. trans-Protease Activity and Structural Insights into the Active Form of the Alphavirus Capsid Protease

    PubMed Central

    Aggarwal, Megha; Dhindwal, Sonali; Kumar, Pravindra; Kuhn, Richard J.

    2014-01-01

    ABSTRACT The alphavirus capsid protein (CP) is a serine protease that possesses cis-proteolytic activity essential for its release from the nascent structural polyprotein. The released CP further participates in viral genome encapsidation and nucleocapsid core formation, followed by its attachment to glycoproteins and virus budding. Thus, protease activity of the alphavirus capsid is a potential antialphaviral target to arrest capsid release, maturation, and structural polyprotein processing. However, the discovery of capsid protease inhibitors has been hampered due to the lack of a suitable screening assay and of the crystal structure in its active form. Here, we report the development of a trans-proteolytic activity assay for Aura virus capsid protease (AVCP) based on fluorescence resonance energy transfer (FRET) for screening protease inhibitors. Kinetic parameters using fluorogenic peptide substrates were estimated, and the Km value was found to be 2.63 ± 0.62 μM while the kcat/Km value was 4.97 × 104 M−1 min−1. Also, the crystal structure of the trans-active form of AVCP has been determined to 1.81-Å resolution. Structural comparisons of the active form with the crystal structures of available substrate-bound mutant and inactive blocked forms of the capsid protease identify conformational changes in the active site, the oxyanion hole, and the substrate specificity pocket residues, which could be critical for rational drug design. IMPORTANCE The alphavirus capsid protease is an attractive antiviral therapeutic target. In this study, we have described the formerly unappreciated trans-proteolytic activity of the enzyme and for the first time have developed a FRET-based protease assay for screening capsid protease inhibitors. Our structural studies unveil the structural features of the trans-active protease, which has been previously proposed to exist in the natively unfolded form (M. Morillas, H. Eberl, F. H. Allain, R. Glockshuber, and E. Kuennemann, J

  16. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  17. A novel protease activity assay using a protease-responsive chaperone protein

    SciTech Connect

    Sao, Kentaro; Murata, Masaharu; Fujisaki, Yuri; Umezaki, Kaori; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki; Hashizume, Makoto

    2009-06-05

    Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

  18. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  19. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  20. A multifunctional protease inhibitor to regulate endolysosomal function.

    PubMed

    van Kasteren, Sander I; Berlin, Ilana; Colbert, Jeff D; Keane, Doreen; Ovaa, Huib; Watts, Colin

    2011-11-18

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin-pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses.

  1. Factors associated with virological rebound in HIV-infected patients receiving protease inhibitor monotherapy.

    PubMed

    Stöhr, Wolfgang; Dunn, David T; Arenas-Pinto, Alejandro; Orkin, Chloe; Clarke, Amanda; Williams, Ian; Johnson, Margaret; Beeching, Nicholas J; Wilkins, Edmund; Sanders, Karen; Paton, Nicholas I

    2016-11-13

    The Protease Inhibitor Monotherapy Versus Ongoing Triple Therapy (PIVOT) trial found that protease inhibitor monotherapy as a simplification strategy is well tolerated in terms of drug resistance but less effective than combination therapy in suppressing HIV viral load. We sought to identify factors associated with the risk of viral load rebound in this trial. PIVOT was a randomized controlled trial in HIV-positive adults with suppressed viral load for at least 24 weeks on combination therapy comparing a strategy of physician-selected ritonavir-boosted protease inhibitor monotherapy versus ongoing triple therapy. In participants receiving monotherapy, we analysed time to confirmed viral load rebound and its predictors using flexible parametric survival models. Of 290 participants initiating protease inhibitor monotherapy (80% darunavir, 14% lopinavir, and 6% other), 93 developed viral load rebound on monotherapy. The risk of viral load rebound peaked at 9 months after starting monotherapy and then declined to approximately 5 per 100 person-years from 18 months onwards. Independent predictors of viral load rebound were duration of viral load suppression before starting monotherapy (hazard ratio 0.81 per additional year <50 copies/ml; P < 0.001), CD4 cell count (hazard ratio 0.73 per additional 100 cells/μl for CD4 nadir; P = 0.008); ethnicity (hazard ratio 1.87 for nonwhite versus white, P = 0.025) but not the protease inhibitor agent used (P = 0.27). Patients whose viral load was analysed with the Roche TaqMan-2 assay had a 1.87-fold risk for viral load rebound compared with Abbott RealTime assay (P = 0.012). A number of factors can identify patients at low risk of rebound with protease inhibitor monotherapy, and this may help to better target those who may benefit from this management strategy.

  2. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  3. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  4. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  5. Orally administered proteases in aesthetic surgery.

    PubMed

    Dusková, M; Wald, M

    1999-01-01

    Increasing demand for shortening the sequel period after aesthetic surgery has led to comparative testing of optional approaches. Systemic enzyme therapy with its pharmacological effects represents a preventive and curative option for inflammatory process including healing. Excellent results were presented, namely, in the treatment of secondary lymphoedema. The incidence of hematoma, edema, and pain was followed, and the results were compared in a randomized group of 20 patients with upper eyelid blepharoplasty treated with proteases (Wobenzym drg) and in a similar group treated with systemic antiedema and hemostyptic therapy (Dicynone drg and Reparil drg). No undesirable side effects were observed. In addition, proteases apparently have no limitation for patients with the risk of concurrent cardiovascular, hepatic, or renal diseases.

  6. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  7. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  8. Tyrosine Phosphorylation of Botulinum Neurotoxin Protease Domains

    DTIC Science & Technology

    2012-06-01

    terminus in the enzyme’s substrate or product binding. Keywords: botulinum neurotoxin, tyrosine phosphorylation, zinc endoporotease, protease, clostridium ...associated membrane protein. These 150 kDa exotoxins are produced by strains of Clostridium botulinum as sevendistinct serotypes,designatedBoNT/A-G.After...A) anti-phosphotyrosine antibody Western blot (B). (A) Relative abundance of the m/z species representing phosphorylated LcB was plotted as a% of

  9. Dysregulation of Protease and Protease Inhibitors in a Mouse Model of Human Pelvic Organ Prolapse

    PubMed Central

    Budatha, Madhusudhan; Silva, Simone; Montoya, Teodoro Ignacio; Suzuki, Ayako; Shah-Simpson, Sheena; Wieslander, Cecilia Karin; Yanagisawa, Masashi; Word, Ruth Ann; Yanagisawa, Hiromi

    2013-01-01

    Mice deficient for the fibulin-5 gene (Fbln5−/−) develop pelvic organ prolapse (POP) due to compromised elastic fibers and upregulation of matrix metalloprotease (MMP)-9. Here, we used casein zymography, inhibitor profiling, affinity pull-down, and mass spectrometry to discover additional protease upregulated in the vaginal wall of Fbln5−/− mice, herein named V1 (25 kDa). V1 was a serine protease with trypsin-like activity similar to protease, serine (PRSS) 3, a major extrapancreatic trypsinogen, was optimum at pH 8.0, and predominantly detected in estrogenized vaginal epithelium of Fbln5−/− mice. PRSS3 was (a) localized in epithelial secretions, (b) detected in media of vaginal organ culture from both Fbln5−/− and wild type mice, and (c) cleaved fibulin-5 in vitro. Expression of two serine protease inhibitors [Serpina1a (α1-antitrypsin) and Elafin] was dysregulated in Fbln5−/− epithelium. Finally, we confirmed that PRSS3 was expressed in human vaginal epithelium and that SERPINA1 and Elafin were downregulated in vaginal tissues from women with POP. These data collectively suggest that the balance between proteases and their inhibitors contributes to support of the pelvic organs in humans and mice. PMID:23437119

  10. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  11. Antibacterial cysteine protease from Cissus quadrangularis L.

    PubMed

    Muthu, Sakthivel; Gopal, Venkatesh Babu; Karthik S, Narayan; Sivaji, Prabu; Malairaj, Sathuvan; Lakshmikanthan, Mythileeswari; Subramani, Nagaraj; Perumal, Palani

    2017-10-01

    An antibacterial Cp was extracted from the stem of Cissus quadrangularis and purified with a 5.39 fold increase in specific activity and 8.67% recovery. The molecular weight of the purified enzyme was estimated to be 39kDa by SDS-PAGE. The purified enzyme appeared as a single band on Native-PAGE. The optimum pH and temperature for protease activity were around 6.0 and 50°C respectively. The Cp showed pH stability from 3 to 10 and retained more than 90% of its relative protease activity. The addition of metal ions such as Mg(2+) and Ca(2+) also exhibited relative protease activity. Cp showed a potent antibacterial activity against pathogenic bacteria. About 4.74Uml(-1) of Cp from C. quadrangularis was tested for antibacterial activity against Bacillus cereus and Bacillus megaterium which subsequently showed zone of inhibition of 21 and 20mm respectively. Cp from C. quadrangularis degraded the peptidoglycan layer of bacteria by Cp was confirmed by transmission electron microscopic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  13. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  14. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  15. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  16. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  17. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  18. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  19. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  20. Structural determinants of tobacco vein mottling virus protease substrate specificity

    PubMed Central

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-01-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1′ position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters kcat and Km for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease. PMID:20862670

  1. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  2. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  3. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  4. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  5. A preliminary neutron diffraction analysis of Achromobacter protease I

    NASA Astrophysics Data System (ADS)

    Ohnishi, Yuki; Masaki, Takeharu; Yamada, Taro; Kurihara, Kazuo; Tanaka, Ichiro; Niimura, Nobuo

    2010-11-01

    Achromobacter protease I (API, E.C. 3.4.21.50) is one of the serine proteases produced by Achromobacter lyticus M497-1. API is distinct from the other tripsin type protease in its lysine specificity. The neutron structure analysis of catalytic triad with Trp169 and His210 was presented. His57 was double protonated and formed hydrogen bonds to Ser194Oγ and Asp113Oδ1, Oδ2.

  6. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  7. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  8. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  9. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  10. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  11. Purification of Pseudomonas aeruginosa proteases and microscopic characterization of pseudomonal protease-induced rabbit corneal damage.

    PubMed Central

    Kreger, A S; Gray, L D

    1978-01-01

    Extracellular proteases of three cornea-virulent strains of Pseudomonas aeruginosa were isolated by sequential ammonium sulfate precipitation, Ultrogel AcA 54 gel filtration, and flat-bed isoelectric focusing. The purity of the preparations was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis , thin-layer isoelectric focusing in polyacrylamide gel, immunodiffusion and immunoelectrophoretic procedures, and tests for the presence of other known pseudomonal products. Light and electron microscopic examination of rabbit corneal lesions observed 4 to 6 h after the intracorneal injection of submicrogram amounts of the proteases revealed: (i) degeneration and necrosis of epithelium, endothelium, and keratocytes, (ii) infiltration, degeneration, and necrosis of polymorphonuclear leukocytes, (iii) loss of the characteristic weblike pattern, colloidal iron staining, and ruthenium red staining of the stromal proteoglycan ground substance, (iv) dispersal of strucutrally normal appearing collagen fibrils, ground substance, (iv) dispersal of structurally normal appearing collagen fibrils, and (v) accumulation of plasma proteins and fibrin in the necrotic corneas. These structural alterations are very similar to those observed previously during experimental P. aeruginosa keratitis, and this similarity supports the idea that pseudomonal proteases are responsible, at least in part, for the rapid and extensive liquefaction necrosis characteristic of pseudomonal-induced keratitis. In addition, the results support the idea that pseudomonal proteases elicit severe corneal damage by causing the loss of the corneal proteoglycan ground substance, thus resulting in dispersal of undamaged collagen fibrils, weakening of the corneal stroma, and subsequent descemetocele formation and corneal perforation by the anterior chamber pressure. Images PMID:415981

  12. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  13. Protease sensing using nontoxic silicon quantum dots

    NASA Astrophysics Data System (ADS)

    Cheng, Xiaoyu; McVey, Benjamin F. P.; Robinson, Andrew B.; Longatte, Guillaume; O'Mara, Peter B.; Tan, Vincent T. G.; Thordarson, Pall; Tilley, Richard D.; Gaus, Katharina; Justin Gooding, John

    2017-08-01

    Herein is presented a proof-of-concept study of protease sensing that combines nontoxic silicon quantum dots (SiQDs) with Förster resonance energy transfer (FRET). The SiQDs serve as the donor and an organic dye as the acceptor. The dye is covalently attached to the SiQDs using a peptide linker. Enzymatic cleavage of the peptide leads to changes in FRET efficiency. The combination of interfacial design and optical imaging presented in this work opens opportunities for use of nontoxic SiQDs relevant to intracellular sensing and imaging.

  14. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  15. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  16. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  17. Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

    PubMed Central

    Sunil, Sujatha; Chauhan, Virander S; Malhotra, Pawan

    2008-01-01

    Background Plasmodium falciparum cysteine proteases (falcipains) play indispensable roles in parasite infection and development, especially in the process of host erythrocyte rupture/invasion and hemoglobin degradation. No detailed molecular analysis of transcriptional regulation of parasite proteases especially cysteine proteases has yet been reported. In this study, using a combination of transient transfection assays and electrophoretic mobility shift assays (EMSA), we demonstrate the presence of stage specific nuclear factors that bind to unique sequence elements in the 5'upstream regions of the falcipains and probably modulate the expression of cysteine proteases. Results Falcipains differ in their timing of expression and exhibit ability to compensate each other's functions at asexual blood stages of the parasite. Present study was undertaken to study the transcriptional regulation of falcipains. Transient transfection assay employing firefly luciferase as a reporter revealed that a ~1 kb sequence upstream of translational start site is sufficient for the functional transcriptional activity of falcipain-1 gene, while falcipain-2, -2' and -3 genes that exist within 12 kb stretch on chromosome 11 require ~2 kb upstream sequences for the expression of reporter luciferase activity. EMSA analysis elucidated binding of distinct nuclear factors to specific sequences within the 5'upstream regions of falcipain genes. Analysis of falcipains' 5'upstream regulatory regions did not reveal the presence of sequences known to bind general eukaryotic factors. However, we did find parasite specific sequence elements such as poly(dA) poly(dT) tracts, CCAAT boxes and a single 7 bp-G rich sequence, (A/G)NGGGG(C/A) in the 5' upstream regulatory regions of these genes, thereby suggesting the role(s) of Plasmodium specific transcriptional factors in the regulation of falcipain genes. Conclusion Taken together, these results suggest that expression of Plasmodium cysteine proteases is

  18. HIV-1 protease-substrate coevolution in nelfinavir resistance.

    PubMed

    Kolli, Madhavi; Ozen, Ayşegül; Kurt-Yilmaz, Nese; Schiffer, Celia A

    2014-07-01

    Resistance to various human immunodeficiency virus type 1 (HIV-1) protease inhibitors (PIs) challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. The virus accumulates mutations within the protease (PR) that render the PIs less potent. Occasionally, Gag sequences also coevolve with mutations at PR cleavage sites contributing to drug resistance. In this study, we investigated the structural basis of coevolution of the p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations by determining crystal structures of wild-type and NFV-resistant HIV-1 protease in complex with p1-p6 substrate peptide variants with L449F and/or S451N. Alterations of residue 30's interaction with the substrate are compensated by the coevolving L449F and S451N cleavage site mutations. This interdependency in the PR-p1-p6 interactions enhances intermolecular contacts and reinforces the overall fit of the substrate within the substrate envelope, likely enabling coevolution to sustain substrate recognition and cleavage in the presence of PR resistance mutations. Resistance to human immunodeficiency virus type 1 (HIV-1) protease inhibitors challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. Mutations in HIV-1 protease selected under the pressure of protease inhibitors render the inhibitors less potent. Occasionally, Gag sequences also mutate and coevolve with protease, contributing to maintenance of viral fitness and to drug resistance. In this study, we investigated the structural basis of coevolution at the Gag p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations. Our structural analysis reveals the interdependency of protease-substrate interactions and how coevolution may restore substrate recognition and cleavage in the presence of protease drug resistance mutations. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  20. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  1. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  2. Structural and functional analysis of human HtrA3 protease and its subdomains

    DOE PAGES

    Glaza, Przemyslaw; Osipiuk, Jerzy; Wenta, Tomasz; ...

    2015-06-25

    Human HtrA3 protease, which induces mitochondria-mediated apoptosis, can be a tumor suppressor and a potential therapeutic target in the treatment of cancer. However, there is little information about its structure and biochemical properties. HtrA3 is composed of an N-terminal domain not required for proteolytic activity, a central serine protease domain and a C-terminal PDZ domain. HtrA3S, its short natural isoform, lacks the PDZ domain which is substituted by a stretch of 7 C-terminal amino acid residues, unique for this isoform. This paper presents the crystal structure of the HtrA3 protease domain together with the PDZ domain (ΔN-HtrA3), showing that themore » protein forms a trimer whose protease domains are similar to those of human HtrA1 and HtrA2. The ΔN-HtrA3 PDZ domains are placed in a position intermediate between that in the flat saucer-like HtrA1 SAXS structure and the compact pyramidal HtrA2 X-ray structure. The PDZ domain interacts closely with the LB loop of the protease domain in a way not found in other human HtrAs. ΔN-HtrA3 with the PDZ removed (ΔN-HtrA3-ΔPDZ) and an N-terminally truncated HtrA3S (ΔN-HtrA3S) were fully active at a wide range of temperatures and their substrate affinity was not impaired. This indicates that the PDZ domain is dispensable for HtrA3 activity. As determined by size exclusion chromatography, ΔN-HtrA3 formed stable trimers while both ΔN-HtrA3-ΔPDZ and ΔN-HtrA3S were monomeric. This suggests that the presence of the PDZ domain, unlike in HtrA1 and HtrA2, influences HtrA3 trimer formation. The unique C-terminal sequence of ΔN-HtrA3S appeared to have little effect on activity and oligomerization. Additionally, we examined the cleavage specificity of ΔN-HtrA3. Results reported in this paper provide new insights into the structure and function of ΔN-HtrA3, which seems to have a unique combination of features among human HtrA proteases.« less

  3. Structural and functional analysis of human HtrA3 protease and its subdomains

    SciTech Connect

    Glaza, Przemyslaw; Osipiuk, Jerzy; Wenta, Tomasz; Zurawa-Janicka, Dorota; Jarzab, Miroslaw; Lesner, Adam; Banecki, Bogdan; Skorko-Glonek, Joanna; Joachimiak, Andrzej; Lipinska, Barbara; van Raaij, Mark J.

    2015-06-25

    Human HtrA3 protease, which induces mitochondria-mediated apoptosis, can be a tumor suppressor and a potential therapeutic target in the treatment of cancer. However, there is little information about its structure and biochemical properties. HtrA3 is composed of an N-terminal domain not required for proteolytic activity, a central serine protease domain and a C-terminal PDZ domain. HtrA3S, its short natural isoform, lacks the PDZ domain which is substituted by a stretch of 7 C-terminal amino acid residues, unique for this isoform. This paper presents the crystal structure of the HtrA3 protease domain together with the PDZ domain (ΔN-HtrA3), showing that the protein forms a trimer whose protease domains are similar to those of human HtrA1 and HtrA2. The ΔN-HtrA3 PDZ domains are placed in a position intermediate between that in the flat saucer-like HtrA1 SAXS structure and the compact pyramidal HtrA2 X-ray structure. The PDZ domain interacts closely with the LB loop of the protease domain in a way not found in other human HtrAs. ΔN-HtrA3 with the PDZ removed (ΔN-HtrA3-ΔPDZ) and an N-terminally truncated HtrA3S (ΔN-HtrA3S) were fully active at a wide range of temperatures and their substrate affinity was not impaired. This indicates that the PDZ domain is dispensable for HtrA3 activity. As determined by size exclusion chromatography, ΔN-HtrA3 formed stable trimers while both ΔN-HtrA3-ΔPDZ and ΔN-HtrA3S were monomeric. This suggests that the presence of the PDZ domain, unlike in HtrA1 and HtrA2, influences HtrA3 trimer formation. The unique C-terminal sequence of ΔN-HtrA3S appeared to have little effect on activity and oligomerization. Additionally, we examined the cleavage specificity of ΔN-HtrA3. Results reported in this paper provide new insights into the structure and function of ΔN-HtrA3, which seems to have a unique combination of features among human HtrA proteases.

  4. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  5. Sequence conservation, phylogenetic relationships, and expression profiles of nondigestive serine proteases and serine protease homologs in Manduca sexta

    PubMed Central

    Cao, Xiaolong; He, Yan; Hu, Yingxia; Zhang, Xiufeng; Wang, Yang; Zou, Zhen; Chen, Yunru; Blissard, Gary W.; Kanost, Michael R.; Jiang, Haobo

    2015-01-01

    Serine protease (SP) and serine protease homolog (SPH) genes in insects encode a large family of proteins involved in digestion, development, immunity, and other processes. While 68 digestive SPs and their close homologs are reported in a companion paper (Kuwar et al., 2015), we have identified 125 other SPs/SPHs in Manduca sexta and studied their structure, evolution, and expression. Fifty-two of them contain cystine-stabilized structures for molecular recognition, including clip, LDLa, Sushi, Wonton, TSP, CUB, Frizzle, and SR domains. There are nineteen groups of genes evolved from relatively recent gene duplication and sequence divergence. Thirty-five SPs and seven SPHs contain 1, 2 or 5 clip domains. Multiple sequence alignment and molecular modeling of the 54 clip domains have revealed structural diversity of these regulatory modules. Sequence comparison with their homologs in Drosophila melanogaster, Anopheles gambiae and Tribolium castaneum allows us to classify them into five subfamilies: A are SPHs with 1 or 5 group-3 clip domains, B are SPs with 1 or 2 group-2 clip domains, C, D1 and D2 are SPs with a single clip domain in group-1a, 1b and 1c, respectively. We have classified into six categories the 125 expression profiles of SP-related proteins in fat body, brain, midgut, Malpighian tubule, testis, and ovary at different stages, suggesting that they participate in various physiological processes. Through RNA-Seq-based gene annotation and expression profiling, as well as intragenomic sequence comparisons, we have established a framework of information for future biochemical research of nondigestive SPs and SPHs in this model species. PMID:25530503

  6. Mutation Patterns and Structural Correlates in Human Immunodeficiency Virus Type 1 Protease following Different Protease Inhibitor Treatments

    PubMed Central

    Wu, Thomas D.; Schiffer, Celia A.; Gonzales, Matthew J.; Taylor, Jonathan; Kantor, Rami; Chou, Sunwen; Israelski, Dennis; Zolopa, Andrew R.; Fessel, W. Jeffrey; Shafer, Robert W.

    2003-01-01

    Although many human immunodeficiency virus type 1 (HIV-1)-infected persons are treated with multiple protease inhibitors in combination or in succession, mutation patterns of protease isolates from these persons have not been characterized. We collected and analyzed 2,244 subtype B HIV-1 isolates from 1,919 persons with different protease inhibitor experiences: 1,004 isolates from untreated persons, 637 isolates from persons who received one protease inhibitor, and 603 isolates from persons receiving two or more protease inhibitors. The median number of protease mutations per isolate increased from 4 in untreated persons to 12 in persons who had received four or more protease inhibitors. Mutations at 45 of the 99 amino acid positions in the protease—including 22 not previously associated with drug resistance—were significantly associated with protease inhibitor treatment. Mutations at 17 of the remaining 99 positions were polymorphic but not associated with drug treatment. Pairs and clusters of correlated (covarying) mutations were significantly more likely to occur in treated than in untreated persons: 115 versus 23 pairs and 30 versus 2 clusters, respectively. Of the 115 statistically significant pairs of covarying residues in the treated isolates, 59 were within 8 Å of each other—many more than would be expected by chance. In summary, nearly one-half of HIV-1 protease positions are under selective drug pressure, including many residues not previously associated with drug resistance. Structural factors appear to be responsible for the high frequency of covariation among many of the protease residues. The presence of mutational clusters provides insight into the complex mutational patterns required for HIV-1 protease inhibitor resistance. PMID:12663790

  7. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  8. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  9. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    USDA-ARS?s Scientific Manuscript database

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  10. Construction, expression, and characterization of a novel fully activated recombinant single-chain hepatitis C virus protease.

    PubMed Central

    Taremi, S. S.; Beyer, B.; Maher, M.; Yao, N.; Prosise, W.; Weber, P. C.; Malcolm, B. A.

    1998-01-01

    Efficient proteolytic processing of essential junctions of the hepatitis C virus (HCV) polyprotein requires a heterodimeric complex of the NS3 bifunctional protease/helicase and the NS4A accessory protein. A single-chain recombinant form of the protease has been constructed in which NS4A residues 21-32 (GSVVIVGRIILS) were fused in frame to the amino terminus of the NS3 protease domain (residues 3-181) through a tetrapeptide linker. The single-chain recombinant protease has been overexpressed as a soluble protein in E. coli and purified to homogeneity by a combination of metal chelate and size-exclusion chromatography. The single-chain recombinant protease domain shows full proteolytic activity cleaving the NS5A-5B synthetic peptide substrate, DTEDVVCCSMSYTWTGK with a Km and k(cat) of 20.0 +/- 2.0 microM and 9.6 +/- 2.0 min(-1), respectively; parameters identical to those of the authentic NS3(1-631)/NS4A(1-54) protein complex generated in eukaryotic cells (Sali DL et al., 1998, Biochemistry 37:3392-3401). PMID:9792101

  11. The Effectiveness of Negative Pressure Therapy in Diabetic Foot Ulcers with Elevated Protease Activity: A Case Series

    PubMed Central

    Izzo, Valentina; Meloni, Marco; Giurato, Laura; Ruotolo, Valeria; Uccioli, Luigi

    2017-01-01

    Objective: Despite several works have described the usefulness of negative pressure therapy (NPT) in the treatment of diabetic foot ulcers (DFUs), no studies have reported its ability in the proteases modulation in DFUs. The aim of this work was to evaluate the role of NPT as a protease-modulating treatment in DFUs. Approach: We conducted a prospective study of a series of diabetic patients affected by chronic DFUs. Each ulcer was assessed for matrix metalloproteinases (MMPs) activity with a protease status diagnostic test at the baseline and after 2 weeks of NPT. Results: Four patients were included. All patients had type 2 diabetes with a disease duration of ≈20 years. A1c was 79.5 ± 15.3 mmol/mol. Ulcer area was >5 cm2 in all cases. All wounds showed elevated protease activity (EPA) at the baseline. After 2 weeks, all patients showed a normalization of MMPs activity. Innovation: NPT showed its effectiveness in the reduction of EPA in chronic DFUs. Conclusion: This study confirms the role of NPT in the positive modulation of protease activity also in chronic DFUs. PMID:28116227

  12. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  13. The Degradome database: mammalian proteases and diseases of proteolysis.

    PubMed

    Quesada, Víctor; Ordóñez, Gonzalo R; Sánchez, Luis M; Puente, Xose S; López-Otín, Carlos

    2009-01-01

    The degradome is defined as the complete set of proteases present in an organism. The recent availability of whole genomic sequences from multiple organisms has led us to predict the contents of the degradomes of several mammalian species. To ensure the fidelity of these predictions, our methods have included manual curation of individual sequences and, when necessary, direct cloning and sequencing experiments. The results of these studies in human, chimpanzee, mouse and rat have been incorporated into the Degradome database, which can be accessed through a web interface at http://degradome.uniovi.es. The annotations about each individual protease can be retrieved by browsing catalytic classes and families or by searching specific terms. This web site also provides detailed information about genetic diseases of proteolysis, a growing field of great importance for multiple users. Finally, the user can find additional information about protease structures, protease inhibitors, ancillary domains of proteases and differences between mammalian degradomes.

  14. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  15. Protease-activated nanomaterials for targeted cancer theranostics.

    PubMed

    Chan, Yung-Chieh; Hsiao, Michael

    2017-09-01

    Cancer metastasis accompanies irreversible proteolysis. Malignant cells that abnormally express extracellular proteases usually lead to a poor outcome during cancer progression. The development of protease-activated drugs is an important goal. Moreover, the specific proteolytic mechanism can be used as a diagnostic strategy. Currently, nanotechnology for use in medication has been extensively developed to exploit the physical and chemical properties of nanoparticles. For example, to improve the efficacy of cancer therapy drugs, targeted delivery has been attempted by combining a targeting ligand with a nanoparticle. Multifunctional nanoparticles have been prepared for cancer therapy and diagnosis because of their advantages such as stable physical properties, drug carrying ability and potential specific targeting ability. In this review, we present reports on protease-activated nanoparticle design for cancer theranostics. We further describe recent protease-activated metalloprotease-based and cathepsin-based nanomaterials used in cancer nanotheranostics. Innovative protease-activated nanomaterials have significant potential for designing personalized treatment.

  16. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation. Copyright 2000 Academic Press.

  17. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  18. The New High Resolution Crystal Structure of NS2B-NS3 Protease of Zika Virus

    PubMed Central

    Badshah, Syed Lal; Naeem, Abdul; Mabkhot, Yahia

    2017-01-01

    Zika virus (ZIKV) is the cause of a significant viral disease affecting humans, which has spread throughout many South American countries and has also become a threat to Southeastern Asia. This commentary discusses the article “Crystal structure of unlinked NS2B-NS3 protease from Zika virus” published recently in the journal Science by Zhang et al. of Nanyang Technological University, Singapore. They resolved a 1.58 Å resolution structure of the NS2B-NS3 protease of ZIKV and demonstrated how peptide and non-peptide inhibitors interact with this structure, along with the different conformational states that were observed. This protease crystal structure offers new opportunities for the design and development of novel antiviral drugs used for the treatment and control of ZIKV. PMID:28075376

  19. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  20. Synthetic, structural mimetics of the β-hairpin flap of HIV-1 protease inhibit enzyme function.

    PubMed

    Chauhan, Jay; Chen, Shen-En; Fenstermacher, Katherine J; Naser-Tavakolian, Aurash; Reingewertz, Tali; Salmo, Rosene; Lee, Christian; Williams, Emori; Raje, Mithun; Sundberg, Eric; DeStefano, Jeffrey J; Freire, Ernesto; Fletcher, Steven

    2015-11-01

    Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Active Site Characterization of Proteases Sequences from Different Species of Aspergillus.

    PubMed

    Morya, V K; Yadav, Virendra K; Yadav, Sangeeta; Yadav, Dinesh

    2016-09-01

    A total of 129 proteases sequences comprising 43 serine proteases, 36 aspartic proteases, 24 cysteine protease, 21 metalloproteases, and 05 neutral proteases from different Aspergillus species were analyzed for the catalytically active site residues using MEROPS database and various bioinformatics tools. Different proteases have predominance of variable active site residues. In case of 24 cysteine proteases of Aspergilli, the predominant active site residues observed were Gln193, Cys199, His364, Asn384 while for 43 serine proteases, the active site residues namely Asp164, His193, Asn284, Ser349 and Asp325, His357, Asn454, Ser519 were frequently observed. The analysis of 21 metalloproteases of Aspergilli revealed Glu298 and Glu388, Tyr476 as predominant active site residues. In general, Aspergilli species-specific active site residues were observed for different types of protease sequences analyzed. The phylogenetic analysis of these 129 proteases sequences revealed 14 different clans representing different types of proteases with diverse active site residues.

  2. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  3. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  4. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  5. HIV-1 protease inhibitors in development.

    PubMed

    Rusconi, Stefano; La Seta Catamancio, Simona

    2002-03-01

    Several pharmaceutical companies have developed an increasing number of second generation protease inhibitors (PI) during the last few years. Many of these compounds have been in preclinical trials and some are now in clinical use. All drugs in this category have been designed to be well absorbed and overcome the crucial problem of cross-resistance within this class of compounds. Taking into account the rapid occurrence of PI cross-resistance, clinicians who are treating patients with the HIV-1 infection will need new active PIs in the near future. The clinical and antiviral efficacy of the new molecules versus the older PIs will be investigated through comparative trials that are likely to be completed over the next 12 months. These third-generation PIs currently in development will be the subject of our review.

  6. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  7. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Staphylococcal proteases aid in evasion of the human complement system

    PubMed Central

    Jusko, Monika; Potempa, Jan; Kantyka, Tomasz; Bielecka, Ewa; Miller, Halie K.; Kalinska, Magdalena; Dubin, Grzegorz; Garred, Peter; Shaw, Lindsey N.; Blom, Anna M.

    2014-01-01

    Staphylococcus aureus is an opportunistic pathogen that presents severe healthcare concerns due to the prevalence of multiple antibiotic resistant strains. New treatment strategies are urgently needed, which requires an understanding of disease causation mechanisms. Complement is one of the first lines of defense against bacterial pathogens, and S. aureus expresses several specific complement inhibitors. The effect of extracellular proteases from this bacterium on complement, however, has been the subject of limited investigation, except for a recent report regarding cleavage of the C3 component by aureolysin. We demonstrate here that four major extracellular proteases of S. aureus are potent complement inhibitors. Incubation of human serum with the cysteine proteases staphopain A and staphopain B, the serine protease V8, and the metalloproteinase aureolysin resulted in a drastic decrease in the haemolytic activity of serum; whereas two serine-protease like enzymes, SplD and SplE, had no effect. These four proteases were found to inhibit all pathways of complement due to the efficient degradation of several crucial components. Furthermore, S. aureus mutants lacking proteolytic enzymes were found to be more efficiently killed in human blood. Taken together, the major proteases of S. aureus appear to be important for pathogen-mediated evasion of the human complement system. PMID:23838186

  9. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  10. Cysteine Protease Inhibitors as Chemotherapy: Lessons from a Parasite Target

    NASA Astrophysics Data System (ADS)

    Selzer, Paul M.; Pingel, Sabine; Hsieh, Ivy; Ugele, Bernhard; Chan, Victor J.; Engel, Juan C.; Bogyo, Matthew; Russell, David G.; Sakanari, Judy A.; McKerrow, James H.

    1999-09-01

    Papain family cysteine proteases are key factors in the pathogenesis of cancer invasion, arthritis, osteoporosis, and microbial infections. Targeting this enzyme family is therefore one strategy in the development of new chemotherapy for a number of diseases. Little is known, however, about the efficacy, selectivity, and safety of cysteine protease inhibitors in cell culture or in vivo. We now report that specific cysteine protease inhibitors kill Leishmania parasites in vitro, at concentrations that do not overtly affect mammalian host cells. Inhibition of Leishmania cysteine protease activity was accompanied by defects in the parasite's lysosome/endosome compartment resembling those seen in lysosomal storage diseases. Colocalization of anti-protease antibodies with biotinylated surface proteins and accumulation of undigested debris and protease in the flagellar pocket of treated parasites were consistent with a pathway of protease trafficking from flagellar pocket to the lysosome/endosome compartment. The inhibitors were sufficiently absorbed and stable in vivo to ameliorate the pathology associated with a mouse model of Leishmania infection.

  11. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  12. Cold-adapted proteases as an emerging class of therapeutics.

    PubMed

    Fornbacke, Marcus; Clarsund, Mats

    2013-06-01

    Proteases have been used in medicine for several decades and are an established and well tolerated class of therapeutic agent. These proteases were sourced from mammals or bacteria that exist or have adapted to moderate temperatures (mesophilic organisms); however, proteases derived from organisms from cold environments-cold-adapted or psychrophilic proteases-generally have high specific activity, low substrate affinity, and high catalytic rates at low and moderate temperatures. Made possible by greater flexibility, psychrophilic enzymes interact with and transform the substrate at lower energy costs. Cold-adapted proteases have been used in a wide range of applications, including industrial functions, textiles, cleaning/hygiene products, molecular biology, environmental bioremediations, consumer food products, cosmetics, and pharmaceutical production. In addition to these applications, they have also shown promise as therapeutic modalities for cosmeceutical applications (by reducing glabellar [frown] lines) and a number of disease conditions, including bacterial infections (by disrupting biofilms to prevent bacterial infection), topical wound management (when used as a debridement agent to remove necrotic tissue and fibrin clots), oral/dental health management (by removing plaque and preventing periodontal disease), and in viral infections (by reducing the infectivity of viruses, such as human rhinovirus 16 and herpes simplex virus). Psychrophilic proteases with greater activity and stability (than the original organism-derived variant) have been developed; this coupled with available manufacturing recombinant production techniques suggests that cold-adapted proteases have a promising future as a distinct therapeutic class with diverse clinical applications.

  13. Expression and functions of proteases in vascular tissues.

    PubMed

    Petzold, H Earl; Zhao, Mingzhe; Beers, Eric P

    2012-05-01

    With the emergence of new models for wood formation and the increasing emphasis on improving the efficiency of cellulosic biofuel production, research on vascular tissue biology has intensified in recent years. Some of the most active areas of research focus on manipulating activity of enzymes in the cellulose, hemicellulose, pectin and lignin pathways. In addition, great strides have been made in the characterization of transcriptional networks controlling genes that affect differentiation, secondary cell wall synthesis and programmed cell death in xylem. Less attention has been devoted to the characterization of proteases that may be important regulators of post-translational events that affect vascular cell differentiation and function and cell wall composition. Several genes for proteases and components of the ubiquitin/26S proteasome pathway are upregulated in xylem and phloem and in cell culture systems for studying the differentiation of xylem tracheary elements (TEs). Although small molecule protease inhibitors have been used to explore the roles of proteases during the differentiation of cultured TEs, only a small number of vascular tissue-associated protease genes have been directly tested to determine whether they play roles in vascular tissue biology. In this report, we review roles for proteases in vascular cell differentiation and function as determined through the use of protease inhibitors and genetic analyses and conclude by identifying opportunities for future research in this area. Copyright © Physiologia Plantarum 2011.

  14. A proteomic approach for the discovery of protease substrates.

    PubMed

    Bredemeyer, Andrew J; Lewis, Renate M; Malone, James P; Davis, Alan E; Gross, Julia; Townsend, R Reid; Ley, Timothy J

    2004-08-10

    Standardized, comprehensive platforms for the discovery of protease substrates have been extremely difficult to create. Screens for protease specificity are now frequently based on the cleavage patterns of peptide substrates, which contain small recognition motifs that are required for the cleavage of the scissile bond within an active site. However, these studies do not identify in vivo substrates, nor can they lead to the definition of the macromolecular features that account for the biological specificity of proteases. To use properly folded proteins in a proteomic screen for protease substrates, we used 2D difference gel electrophoresis and tandem MS to identify substrates of an apoptosis-inducing protease, granzyme B. We confirmed the cleavage of procaspase-3, one of the key substrates of this enzyme, and identified several substrates that were previously unknown, as well as the cleavage site for one of these substrates. We were also able to observe the kinetics of substrate cleavage and cleavage product accumulation by using the 2D difference gel electrophoresis methodology. "Protease proteomics" may therefore represent an important tool for the discovery of the native substrates of a variety of proteases.

  15. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  16. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  17. The emerging role of coagulation proteases in kidney disease

    PubMed Central

    Madhusudhan, Thati; Kerlin, Bryce A.; Isermann, Berend

    2016-01-01

    A role of coagulation proteases in kidney disease beyond their function in normal haemostasis and thrombosis has long been suspected, and studies performed in the past 15 years have provided novel insights into the mechanisms involved. The expression of protease-activated receptors (PARs) in renal cells provides a molecular link between coagulation proteases and renal cell function and revitalizes research evaluating the role of haemostasis regulators in renal disease. Renal cell-specific expression and activity of coagulation proteases, their regulators and their receptors are dynamically altered during disease processes. Furthermore, renal inflammation and tissue remodelling are not only associated, but are causally linked with altered coagulation activation and protease-dependent signalling. Intriguingly, coagulation proteases signal through more than one receptor or induce formation of receptor complexes in a cell-specific manner, emphasizing context specificity. Understanding these cell-specific signalosomes and their regulation in kidney disease is crucial to unravelling the pathophysiological relevance of coagulation regulators in renal disease. In addition, the clinical availability of small molecule targeted anticoagulants as well as the development of PAR antagonists increases the need for in-depth knowledge of the mechanisms through which coagulation proteases might regulate renal physiology. PMID:26592189

  18. Protease activity, localization and inhibition in the human hair follicle.

    PubMed

    Bhogal, R K; Mouser, P E; Higgins, C A; Turner, G A

    2014-02-01

    In humans, the process of hair shedding, referred to as exogen, is believed to occur independently of the other hair cycle phases. Although the actual mechanisms involved in hair shedding are not fully known, it has been hypothesized that the processes leading to the final step of hair shedding may be driven by proteases and/or protease inhibitor activity. In this study, we investigated the presence of proteases and protease activity in naturally shed human hairs and assessed enzyme inhibition activity of test materials. We measured enzyme activity using a fluorescence-based assay and protein localization by indirect immunohistochemistry (IHC). We also developed an ex vivo skin model for measuring the force required to pull hair fibres from skin. Our data demonstrate the presence of protease activity in the tissue material surrounding club roots. We also demonstrated the localization of specific serine protease protein expression in human hair follicle by IHC. These data provide evidence demonstrating the presence of proteases around the hair club roots, which may play a role during exogen. We further tested the hypothesis that a novel protease inhibitor system (combination of Trichogen) and climbazole) could inhibit protease activity in hair fibre club root extracts collected from a range of ethnic groups (U.K., Brazil, China, first-generation Mexicans in the U.S.A., Thailand and Turkey) in both males and females. Furthermore, we demonstrated that this combination is capable of increasing the force required to remove hair in an ex vivo skin model system. These studies indicate the presence of proteolytic activity in the tissue surrounding the human hair club root and show that it is possible to inhibit this activity with a combination of Trichogen and climbazole. This technology may have potential to reduce excessive hair shedding. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  19. Spatially dependent activation of the patterning protease, Easter.

    PubMed

    LeMosy, Ellen K

    2006-04-17

    The dorsoventral axis of the Drosophila embryo is established by the activating cleavage of a signaling ligand by a serine protease, Easter, only on the ventral side of the embryo. Easter is the final protease in a serine protease cascade in which initial reaction steps appear not to be ventrally restricted, but where Easter activity is promoted ventrally through the action of a spatial cue at an unknown step in the pathway. Here, biochemical studies demonstrate that this spatial control occurs at or above the level of Easter zymogen activation, rather than through direct promotion of Easter's catalytic activity against the signaling ligand.

  20. [The extracellular proteases of the phytopathogenic bacterium Xanthomonas campestris].

    PubMed

    Kalashnikova, E E; Chernyshova, M P; Ignatov, V V

    2003-01-01

    The culture liquids of three Xanthomonas campestris pv. campestris strains were found to possess proteolytic activity. The culture liquid of strain B-611 with the highest proteolytic activity was fractionated by salting-out with ammonium sulfate, gel filtration, and ion-exchange chromatography. The electrophoretic analysis of active fractions showed the presence of two proteases in the culture liquid of strain B-611, the major of which being serine protease. The treatment of cabbage seedlings with the proteases augmented the activity of peroxidase in the cabbage roots by 28%.

  1. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  2. Identification of cysteine protease inhibitors that belong to cystatin family 1 in the cellular slime mold Dictyostelium discoideum.

    PubMed

    El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi

    2004-06-01

    Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.

  3. A Bacillus anthracis strain deleted for six proteases serves as an effective host for production of recombinant proteins.

    PubMed

    Pomerantsev, Andrei P; Pomerantseva, Olga M; Moayeri, Mahtab; Fattah, Rasem; Tallant, Cynthia; Leppla, Stephen H

    2011-11-01

    Bacillus anthracis produces a number of extracellular proteases that impact the integrity and yield of other proteins in the B. anthracis secretome. In this study we show that anthrolysin O (ALO) and the three anthrax toxin proteins, protective antigen (PA), lethal factor (LF), and edema factor (EF), produced from the B. anthracis Ames 35 strain (pXO1⁺, pXO2⁻), are completely degraded at the onset of stationary phase due to the action of proteases. An improved Cre-loxP gene knockout system was used to sequentially delete the genes encoding six proteases (InhA1, InhA2, camelysin, TasA, NprB, and MmpZ). The role of each protease in degradation of the B. anthracis toxin components and ALO was demonstrated. Levels of the anthrax toxin components and ALO in the supernatant of the sporulation defective, pXO1⁺ A35HMS mutant strain deleted for the six proteases were significantly increased and remained stable over 24 h. A pXO1-free variant of this six-protease mutant strain, designated BH460, provides an improved host strain for the preparation of recombinant proteins. As an example, BH460 was used to produce recombinant EF, which previously has been difficult to obtain from B. anthracis. The EF protein produced from BH460 had the highest in vivo potency of any EF previously purified from B. anthracis or Escherichia coli hosts. BH460 is recommended as an effective host strain for recombinant protein production, typically yielding greater than 10mg pure protein per liter of culture.

  4. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  5. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  6. Genome-wide identification and structure-function studies of proteases and protease inhibitors in Cicer arietinum (chickpea).

    PubMed

    Sharma, Ranu; Suresh, C G

    2015-01-01

    Proteases are a family of enzymes present in almost all living organisms. In plants they are involved in many biological processes requiring stress response in situations such as water deficiency, pathogen attack, maintaining protein content of the cell, programmed cell death, senescence, reproduction and many more. Similarly, protease inhibitors (PIs) are involved in various important functions like suppression of invasion by pathogenic nematodes, inhibition of spores-germination and mycelium growth of Alternaria alternata and response to wounding and fungal attack. As much as we know, no genome-wide study of proteases together with proteinaceous PIs is reported in any of the sequenced genomes till now. Phylogenetic studies and domain analysis of proteases were carried out to understand the molecular evolution as well as gene and protein features. Structural analysis was carried out to explore the binding mode and affinity of PIs for cognate proteases and prolyl oligopeptidase protease with inhibitor ligand. In the study reported here, a significant number of proteases and PIs were identified in chickpea genome. The gene expression profiles of proteases and PIs in five different plant tissues revealed a differential expression pattern in more than one plant tissue. Molecular dynamics studies revealed the formation of stable complex owing to increased number of protein-ligand and inter and intramolecular protein-protein hydrogen bonds. The genome-wide identification, characterization, evolutionary understanding, gene expression, and structural analysis of proteases and PIs provide a framework for future analysis when defining their roles in stress response and developing a more stress tolerant variety of chickpea. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Zebra chip disease decreases tuber (Solanum tuberosum L.) protein content by attenuating protease inhibitor levels and increasing protease activities.

    PubMed

    Kumar, G N Mohan; Knowles, Lisa O; Knowles, N Richard

    2015-11-01

    Zebra chip disease of potato decreases protease inhibitor levels resulting in enhanced serine-type protease activity, decreased protein content and altered protein profiles of fully mature tubers. Zebra-chip (ZC), caused by Candidatus Liberibacter solanacearum (CLso), is a relatively new disease of potato that negatively affects growth, yield, propagation potential, and fresh and process qualities of tubers. Diseased plants produce tubers with characteristic brown discoloration of vascular tissue accompanied by elevated levels of free amino acids and reducing sugars. Here we demonstrate that ZC disease induces selective protein catabolism in tubers through modulating protease inhibitor levels. Soluble protein content of tubers from CLso-infected plants was 33% lower than from non-infected plants and electrophoretic analyses revealed substantial reductions in major tuber proteins. Patatin (~40 kDa) and ser-, asp- (22 kDa) and cys-type (85 kDa) protease inhibitors were either absent or greatly reduced in ZC-afflicted tubers. In contrast to healthy (non-infected) tubers, the proteolytic activity in CLso infected tubers was high and the ability of extracts from infected tubers to inhibit trypsin (ser-type) and papain (cys-type) proteases greatly attenuated. Moreover, extracts from CLso-infected tubers rapidly catabolized proteins purified from healthy tubers (40 kDa patatin, 22 kDa protease inhibitors, 85 kDa potato multicystatin) when subjected to proteolysis individually. In contrast, crude extracts from non-infected tubers effectively inhibited the proteolytic activity from ZC-afflicted tubers. These results suggest that the altered protein profile of ZC afflicted tubers is largely due to loss of ser- and cys-type protease inhibitors. Further analysis revealed a novel PMSF-sensitive (ser) protease (ca. 80-120 kDa) in CLso infected tubers. PMSF abolished the proteolytic activities responsible for degrading patatin, the 22 kDa protease inhibitor(s) and potato

  8. Improving Viral Protease Inhibitors to Counter Drug Resistance

    PubMed Central

    Yilmaz, Nese Kurt; Swanstrom, Ronald; Schiffer, Celia A.

    2016-01-01

    Drug resistance is a major problem in health care, undermining therapy outcomes and necessitating novel approaches to drug design. Extensive studies on resistance to viral protease inhibitors, particularly those of HIV-1 and hepatitis C virus (HCV) protease, revealed a plethora of information on the structural and molecular mechanisms underlying resistance. These insights led to several strategies to improve viral protease inhibitors to counter resistance, such as exploiting the essential biological function and leveraging evolutionary constraints. Incorporation of these strategies into structure-based drug design can minimize vulnerability to resistance, not only for viral proteases but for other quickly evolving drug targets as well, toward designing inhibitors one step ahead of evolution to counter resistance with more intelligent and rational design. PMID:27090931

  9. Synergism of Selective Tumor Vascular Thrombosis and Protease Activated Prodrug

    DTIC Science & Technology

    2008-05-01

    Such a cytotoxin can be aldesleukin, 5- aminolevulinic acid, bleomycin sulfate, camptothecin, carboplatin, carmustine, cisplatin, cladribine, lyophilized... aminolevulinic acid, protoporphyrin IX, taxol or paclitaxel. In one embodiment, the prodrug is activated by asparaginyl proteases (e.g., legumain) and

  10. Inhibition of activity of the protease from bovine leukemia virus.

    PubMed

    Ménard, A; Leonard, R; Llido, S; Geoffre, S; Picard, P; Berteau, F; Precigoux, G; Hospital, M; Guillemain, B

    1994-06-13

    In view of the close similarity between bovine leukemia virus (BLV) and human T-cell leukemia virus type I (HTLV-I) we investigated the possibility of developing specific inhibitors of the proteases of these retroviruses using the purified enzyme from BLV. We tested the ability of this protease to specifically cleave various short oligopeptide substrates containing cleavage sites of BLV and HTLV-I proteases, as well as a recombinant BLV Gag precursor. The best substrate, a synthetic decapeptide bearing the natural cleavage site between the matrix and the capsid proteins of BLV Gag precursor polyprotein, was used to develop an inhibition assay. We determined the relative inhibitory effect of synthetic Gag precursor-like peptides in which the cleavable site was replaced by a non-hydrolyzable moiety. The encouraging inhibitory effect of these compounds indicates that potent non-peptidic inhibitors for retroviral proteases are not unattainable.

  11. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  12. Evaluation of trypanocidal activity of combinations of anti-sleeping sickness drugs with cysteine protease inhibitors.

    PubMed

    Steverding, Dietmar

    2015-01-01

    Chemotherapy of human African trypanosomiasis (HAT) is unsatisfactory because only a few drugs, with serious side effects and poor efficacy, are available. As drug combination regimes often achieve greater therapeutic efficacy than monotherapies, here the trypanocidal activity of the cysteine protease inhibitor K11777 in combination with current anti-HAT drugs using bloodstream forms of Trypanosoma brucei was investigated. Isobolographic analysis was used to determine the interaction between cysteine protease inhibitors (K11777, CA-074Me and CAA0225) and anti-HAT drugs (suramin, pentamidine, melarsoprol and eflornithine). Bloodstream forms of T. brucei were incubated in culture medium containing cysteine protease inhibitors or anti-HAT drugs alone or in combination at a 1:1 fixed-dose ratio. After 48 h incubation, live cells were counted, the 50% growth inhibition values determined and combination indices calculated. The general cytotoxicity of drug combinations was evaluated with human leukaemia HL-60 cells. Combinations of K11777 with suramin, pentamidine and melarsoprol showed antagonistic effects while with eflornithine a synergistic effect was observed. Whereas eflornithine antagonises with CA-074Me, an inhibitor inactivating the targeted TbCATL only under reducing conditions, it synergises with CAA0255, an inhibitor structurally related to CA-074Me which inactivates TbCATL independently of thiols. These findings indicate an essential role of thiols for the synergistic interaction between K11777 and eflornithine. Encouragingly, the K11777/eflornithine combination displayed higher trypanocidal than cytotoxic activity. The results of this study suggest that the combination of the cysteine protease inhibitor K11777 and eflornithine display promising synergistic trypanocidal activity that warrants further investigation of the drug combination as possible alternative treatment of HAT.

  13. Activity of purified hepatitis C virus protease NS3 on peptide substrates.

    PubMed Central

    Steinkühler, C; Urbani, A; Tomei, L; Biasiol, G; Sardana, M; Bianchi, E; Pessi, A; De Francesco, R

    1996-01-01

    The protease domain of the hepatitis C virus (HCV) protein NS3 was expressed in Escherichia coli, purified to homogeneity, and shown to be active on peptides derived from the sequence of the NS4A-NS4B junction. Experiments were carried out to optimize protease activity. Buffer requirements included the presence of detergent, glycerol, and dithiothreitol, pH between 7.5 and 8.5, and low ionic strength. C- and N-terminal deletion experiments defined a peptide spanning from the P6 to the P4' residue as a suitable substrate. Cleavage kinetics were subsequently measured by using decamer P6-P4' peptides corresponding to all intermolecular cleavage sites of the HCV polyprotein. The following order of cleavage efficiency, in terms of kcat/Km, was determined: NS5A-NS5B > NS4A-NS4B >> NS4B-NS5A. A 14-mer peptide containing residues 21 to 34 of the protease cofactor NS4A (Pep4A 21-34), when added in stoichiometric amounts, was shown to increase cleavage rates of all peptides, the largest effect (100-fold) being observed on the hydrolysis of the NS4B-NS5A decamer. From the kinetic analysis of cleavage data, we conclude that (i) primary structure is an important determinant of the efficiency with which each site is cleaved during polyprotein processing, (ii) slow cleavage of the NS4B-NS5A site in the absence of NS4A is due to low binding affinity of the enzyme for this site, and (iii) formation of a 1:1 complex between the protease and Pep4A 21-34 is sufficient and required for maximum activation. PMID:8794305

  14. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  15. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  16. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    2-0128 TITLE: ENGINEERING ENVIRONMENTALLY-STABLE PROTEASES TO SPECIFICALLY NEUTRALIZE PROTEIN TOXINS PRINCIPAL INVESTIGATOR: Philip N...Bryan CONTRACTING ORGANIZATION: Potomac Affinity Proteins , LLC NORTH POTOMAC MD 20878-2566 REPORT DATE: October 2013 TYPE OF REPORT...CONTRACT NUMBER ENGINEERING ENVIRONMENTALLY-STABLE PROTEASES TO SPECIFICALLY NEUTRALIZE PROTEIN TOXINS 5b. GRANT NUMBER W81XWH-10-2-0128 5c

  17. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  18. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  19. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  20. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  2. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  3. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  4. Phenotypic Analysis of Mice Lacking the Tmprss2-Encoded Protease

    PubMed Central

    Kim, Tom S.; Heinlein, Cynthia; Hackman, Robert C.; Nelson, Peter S.

    2006-01-01

    Tmprss2 encodes an androgen-regulated type II transmembrane serine protease (TTSP) expressed highly in normal prostate epithelium and has been implicated in prostate carcinogenesis. Although in vitro studies suggest protease-activated receptor 2 may be a substrate for TMPRSS2, the in vivo biological activities of TMPRSS2 remain unknown. We generated Tmprss2−/− mice by disrupting the serine protease domain through homologous recombination. Compared to wild-type littermates, Tmprss2−/− mice developed normally, survived to adulthood with no differences in protein levels of prostatic secretions, and exhibited no discernible abnormalities in organ histology or function. Loss of TMPRSS2 serine protease activity did not influence fertility, reduce survival, result in prostate hyperplasia or carcinoma, or alter prostatic luminal epithelial cell regrowth following castration and androgen replacement. Lack of an observable phenotype in Tmprss2−/− mice was not due to transcriptional compensation by closely related Tmprss2 homologs. We conclude that the lack of a discernible phenotype in Tmprss2−/− mice suggests functional redundancy involving one or more of the type II transmembrane serine protease family members or other serine proteases. Alternatively, TMPRSS2 may contribute a specialized but nonvital function that is apparent only in the context of stress, disease, or other systemic perturbation. PMID:16428450

  5. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  6. Phage display as a powerful tool to engineer protease inhibitors.

    PubMed

    Zani, Marie-Louise; Moreau, Thierry

    2010-11-01

    Since its introduction by Georges Smith some 25 years ago, phage display has proved to be a powerful molecular technique for selecting proteins with desired biological properties from huge libraries. Early on, various protease inhibitor scaffolds were displayed at the surface of filamentous phages to select new inhibitors with shifted specificities and enhanced affinities towards one or more target protease(s). The past two decades have seen a number of natural protease inhibitors subjected to phage display, mostly to shift and increase their inhibitory specificity, but also to explore the molecular mechanisms by which they interact with their cognate enzymes with low or very high selectivity. This review focuses on the major uses of phage display in the field of protein protease inhibitors. The exquisite molecular mechanisms by which natural protease inhibitors prevent unwanted or excessive proteolysis in cells and tissues are also examined along with some of the general principles underlying the way phage display is applied to these molecules. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  7. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases. PMID:28405139

  8. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  9. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  10. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  11. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  12. Bioinformatics perspective on rhomboid intramembrane protease evolution and function.

    PubMed

    Kinch, Lisa N; Grishin, Nick V

    2013-12-01

    Endopeptidase classification based on catalytic mechanism and evolutionary history has proven to be invaluable to the study of proteolytic enzymes. Such general mechanistic- and evolutionary- based groupings have launched experimental investigations, because knowledge gained for one family member tends to apply to the other closely related enzymes. The serine endopeptidases represent one of the most abundant and diverse groups, with their apparently successful proteolytic mechanism having arisen independently many times throughout evolution, giving rise to the well-studied soluble chemotrypsins and subtilisins, among many others. A large and diverse family of polytopic transmembrane proteins known as rhomboids has also evolved the serine protease mechanism. While the spatial structure, mechanism, and biochemical function of this family as intramembrane proteases has been established, the cellular roles of these enzymes as well as their natural substrates remain largely undetermined. While the evolutionary history of rhomboid proteases has been debated, sorting out the relationships among current day representatives should provide a solid basis for narrowing the knowledge gap between their biochemical and cellular functions. Indeed, some functional characteristics of rhomboid proteases can be gleaned from their evolutionary relationships. Finally, a specific case where phylogenetic profile analysis has identified proteins that contain a C-terminal processing motif (GlyGly-Cterm) as co-occurring with a set of bacterial rhomboid proteases provides an example of potential target identification through bioinformatics. This article is part of a Special Issue entitled: Intramembrane Proteases. © 2013.

  13. Mixture-based peptide libraries for identifying protease cleavage motifs.

    PubMed

    Turk, Benjamin E

    2009-01-01

    All proteases and peptidases are to some extent sequence-specific, in that one or more residues are preferred at particular positions surrounding the cleavage site in substrates. I describe here a general protocol for determining protease cleavage site preferences using mixture-based peptide libraries. Initially a completely random, amino-terminally capped peptide mixture is digested with the protease of interest, and the cleavage products are analyzed by automated Edman sequencing. The distribution of amino acids found in each sequencing cycle indicates which residues are preferred by the protease at positions downstream of the cleavage site. On the basis of these results, a second peptide library is designed that is partially degenerate and partially fixed sequence. Edman sequencing analysis of the cleavage products of this peptide mixture provides preferences amino-terminal to the scissile bond. As necessary, the process is reiterated until the full cleavage motif of the protease is known. Cleavage specificity data obtained with this method have been used to generate specific and efficient peptide substrates, to design potent and specific inhibitors, and to identify novel protease substrates.

  14. Direct Visualization of Protease Action on Collagen Triple Helical Structure

    PubMed Central

    Rosenblum, Gabriel; Van den Steen, Philippe E.; Cohen, Sidney R.; Bitler, Arkady; Brand, David D.; Opdenakker, Ghislain; Sagi, Irit

    2010-01-01

    Enzymatic processing of extracellular matrix (ECM) macromolecules by matrix metalloproteases (MMPs) is crucial in mediating physiological and pathological cell processes. However, the molecular mechanisms leading to effective physiological enzyme-ECM interactions remain elusive. Only scant information is available on the mode by which matrix proteases degrade ECM substrates. An example is the enzymatic degradation of triple helical collagen II fragments, generated by the collagenase MMP-8 cleavage, during the course of acute inflammatory conditions by gelatinase B/MMP-9. As is the case for many other matrix proteases, it is not clear how MMP-9 recognizes, binds and digests collagen in this important physiological process. We used single molecule imaging to directly visualize this protease during its interaction with collagen fragments. We show that the initial binding is mediated by the diffusion of the protease along the ordered helix on the collagen ¾ fragment, with preferential binding of the collagen tail. As the reaction progressed and prior to collagen degradation, gelatin-like morphologies resulting from the denaturation of the triple helical collagen were observed. Remarkably, this activity was independent of enzyme proteolysis and was accompanied by significant conformational changes of the working protease. Here we provide the first direct visualization of highly complex mechanisms of macromolecular interactions governing the enzymatic processing of ECM substrates by physiological protease. PMID:20585385

  15. Rapid enzymatic test for phenotypic HIV protease drug resistance.

    PubMed

    Hoffmann, Dieter; Assfalg-Machleidt, Irmgard; Nitschko, Hans; von der Helm, Klaus; Koszinowski, Ulrich; Machleidt, Werner

    2003-07-01

    A phenotypic resistance test based on recombinant expression of the active HIV protease in E. coli from patient blood samples was developed. The protease is purified in a rapid one-step procedure as active enzyme and tested for inhibition by five selected synthetic inhibitors (amprenavir, indinavir, nelfinavir, ritonavir, and saquinavir) used presently for chemotherapy of HIV-infected patients. The HPLC system used in a previous approach was replaced by a continuous fluorogenic assay suitable for high-throughput screening on microtiter plates. This reduces significantly the total assay time and allows the determination of inhibition constants (Ki). The Michaelis constant (Km) and the inhibition constant (Ki) of recombinant wild-type protease agree well with published data for cloned HIV protease. The enzymatic test was evaluated with recombinant HIV protease derived from eight HIV-positive patients scored from 'sensitive' to 'highly resistant' according to mutations detected by genotypic analysis. The measured Ki values correlate well with the genotypic resistance scores, but allow a higher degree of differentiation. The non-infectious assay enables a more rapid yet sensitive detection of HIV protease resistance than other phenotypic assays.

  16. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  17. Purification and Properties of Mucor pusillus Acid Protease1

    PubMed Central

    Somkuti, G. A.; Babel, F. J.

    1968-01-01

    The protease produced by Mucor pusillus was recovered from a wheat bran medium by treatment with ammonium sulfate, ethyl alcohol, gel filtration and ion-exchange chromatography. The yield of the enzyme was 55%. The overall increase in the specific activity of the protease was 34-fold. The purified protease was most active at pH 3.8 and 5.6 against hemoglobin and casein, respectively. Optimal hydrolysis of casein was observed at 55 C. The enzyme was stable from pH 3.0 to 6.0. Enzyme inactivated by metal ions was reactivated by ethylenediaminetetraacetate and o-phenanthroline. Reducing agents and thiol poisons had no effect on the protease, suggesting that free sulfhydryl groups were not required for enzyme activity. Diisopropyl fluorophosphate did not inhibit the protease, indicating the probable absence of serine in the active center. The Michaelis-Menten constant for casein was 0.357%. Electrophoretic analysis of active protein recovered by ion-exchange chromatography showed that the protease preparation was homogeneous. Images PMID:5646628

  18. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  19. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  20. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  1. Protease production by different thermophilic fungi.

    PubMed

    Macchione, Mariana M; Merheb, Carolina W; Gomes, Eleni; da Silva, Roberto

    2008-03-01

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi--Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37--using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  2. Fluoride Does Not Inhibit Enamel Protease Activity

    PubMed Central

    Tye, C.E.; Antone, J.V.; Bartlett, J.D.

    2011-01-01

    Fluorosed enamel can be porous, mottled, discolored, hypomineralized, and protein-rich if the enamel matrix is not completely removed. Proteolytic processing by matrix metalloproteinase-20 (MMP20) and kallikrein-4 (KLK4) is critical for enamel formation, and homozygous mutation of either protease results in hypomineralized, protein-rich enamel. Herein, we demonstrate that the lysosomal proteinase cathepsin K is expressed in the enamel organ in a developmentally defined manner that suggests a role for cathepsin K in degrading re-absorbed enamel matrix proteins. We therefore asked if fluoride directly inhibits the activity of MMP20, KLK4, dipeptidyl peptidase I (DPPI) (an in vitro activator of KLK4), or cathepsin K. Enzyme kinetics were studied with quenched fluorescent peptides with purified enzyme in the presence of 0–10 mM NaF, and data were fit to Michaelis-Menten curves. Increasing concentrations of known inhibitors showed decreases in enzyme activity. However, concentrations of up to 10 mM NaF had no effect on KLK4, MMP20, DPPI, or cathepsin K activity. Our results show that fluoride does not directly inhibit enamel proteolytic activity. PMID:21118795

  3. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).

    PubMed

    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia

    2011-07-01

    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  4. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.

    PubMed

    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  5. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  6. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  7. Efficacy of protease inhibitor from marine Streptomyces sp. VITBVK2 against Leishmania donovani - An in vitro study.

    PubMed

    Sreedharan, Veena; Bhaskara Rao, K V

    2017-03-01

    In the present study the leishmanicidal effect of potential protease inhibitor producing marine actinobacterial isolate has been investigated against Leishmania donovani, the causative agent of visceral leishmaniasis. Among 89 marine actinobacteria isolated from a salt pan in Kanyakumari, only one isolate (BVK2) showed 97% of protease inhibition activity against trypsin. Moderate to high protease inhibitor activity was shown by isolate BVK2 on proteinase (30%) and chymotrypsin (85%). In optimization study for protease inhibitor production glucose as carbon source and casein as nitrogen source showed the best activity. In the in-vitro Fluorescence-activated cell sorting (FACS) assay, 100 μg/ml of BVK2 extract was active against amastigotes in infected J774A.1 macrophages and showed 87% of parasitic inhibition. The isolate BVK2 showed significant anti-parasitic activity with an IC50 of 27.1 μg/ml after double doses were administered. The potential isolate was identified by molecular 16S rRNA gene sequencing as Streptomyces sp. VITBVK2. The results obtained suggest that the marine actinobacterial extract which have novel metabolites can be considered as a potential source for the development of drugs.

  8. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  9. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  10. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  11. HIV-1 protease-induced apoptosis

    PubMed Central

    2014-01-01

    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  12. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  13. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  14. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  15. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  16. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  17. Modeling and structural analysis of PA clan serine proteases

    PubMed Central

    2012-01-01

    Background Serine proteases account for over a third of all known proteolytic enzymes; they are involved in a variety of physiological processes and are classified into clans sharing structural homology. The PA clan of endopeptidases is the most abundant and over two thirds of this clan is comprised of the S1 family of serine proteases, which bear the archetypal trypsin fold and have a catalytic triad in the order Histidine, Aspartate, Serine. These proteases have been studied in depth and many three dimensional structures have been experimentally determined. However, these structures mostly consist of bacterial and animal proteases, with a small number of plant and fungal proteases and as yet no structures have been determined for protozoa or archaea. The core structure and active site geometry of these proteases is of interest for many applications. This study investigated the structural properties of different S1 family serine proteases from a diverse range of taxa using molecular modeling techniques. Results Our predicted models from protozoa, archaea, fungi and plants were combined with the experimentally determined structures of 16 S1 family members and used for analysis of the catalytic core. Amino acid sequences were submitted to SWISS-MODEL for homology-based structure prediction or the LOOPP server for threading-based structure prediction. Predicted models were refined using INSIGHT II and SCRWL and validated against experimental structures. Investigation of secondary structures and electrostatic surface potential was performed using MOLMOL. The structural geometry of the catalytic core shows clear deviations between taxa, but the relative positions of the catalytic triad residues were conserved. Some highly conserved residues potentially contributing to the stability of the structural core were identified. Evolutionary divergence was also exhibited by large variation in secondary structure features outside the core, differences in overall amino acid

  18. Hydrophobic core flexibility modulates enzyme activity in HIV-1 protease

    PubMed Central

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.; Bolon, Daniel N. A.; Schiffer, Celia A.

    2012-01-01

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity. PMID:22295904

  19. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  20. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  1. Protease production by Burkholderia pseudomallei and virulence in mice.

    PubMed

    Gauthier, Y P; Thibault, F M; Paucod, J C; Vidal, D R

    2000-02-05

    The aim of this study was to assess protease production and virulence of various Burkholderia pseudomallei strains. Protease activity was evaluated in filtrates from cultures grown for 50 h in TSB Dialysate by azocasein hydrolysis, and expressed as absorbancy at 405 nm. Virulence was assessed in 8 weeks old SWISS mice, by intraperitoneal injection of 6-6 x 10(5) CFU, and the LD50 was calculated after 30 days by the method of Reed and Muench. The lethal activity was studied for five strains of B. pseudomallei and the type strains of Burkholderia pseudomallei, Burkholderia mallei, and Burkholderia cepacia. The three type strains appeared to be low protease producers (A405 = 0.11, 0.09 and 0.00, respectively) and avirulent. The two more virulent B. pseudomallei strains exhibited significantly different LD50, 3.5 x 10(2) (IPP 6068 VIR) versus 2.1 x 10(5) CFU/mouse (40/97), and protease activities (A405 = 0.046 and 0.79, respectively). Moreover, the avirulent parent of IPP 6068 (AG), was a better protease producer than the 6068 VIR strain, A405 = 0.26 versus 0.046. These results suggest that there is no correlation between virulence and level of exoproteolytic activity, when B. pseudomallei is injected to mice via the intraperitoneal route.

  2. Plant proteases for bioactive peptides release: A review.

    PubMed

    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y

    2017-04-10

    Proteins are a potential source of health-promoting biomolecules with medical, nutraceutical, and food applications. Nowadays, bioactive peptides production, its isolation, characterization, and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  3. Protease signaling in animal and plant-regulated cell death.

    PubMed

    Salvesen, Guy S; Hempel, Anne; Coll, Nuria S

    2016-07-01

    This review aims to highlight the proteases required for regulated cell death mechanisms in animals and plants. The aim is to be incisive, and not inclusive of all the animal proteases that have been implicated in various publications. The review also aims to focus on instances when several publications from disparate groups have demonstrated the involvement of an animal protease, and also when there is substantial biochemical, mechanistic and genetic evidence. In doing so, the literature can be culled to a handful of proteases, covering most of the known regulated cell death mechanisms: apoptosis, regulated necrosis, necroptosis, pyroptosis and NETosis in animals. In plants, the literature is younger and not as extensive as for mammals, although the molecular drivers of vacuolar death, necrosis and the hypersensitive response in plants are becoming clearer. Each of these death mechanisms has at least one proteolytic component that plays a major role in controlling the pathway, and sometimes they combine in networks to regulate cell death/survival decision nodes. Some similarities are found among animal and plant cell death proteases but, overall, the pathways that they govern are kingdom-specific with very little overlap. © 2015 FEBS.

  4. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  5. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.

    2012-09-11

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  6. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  7. Emerging roles for diverse intramembrane proteases in plant biology.

    PubMed

    Adam, Zach

    2013-12-01

    Progress in the field of regulated intramembrane proteolysis (RIP) in recent years has made its impact on plant biology as well. Although this field within plant research is still in its infancy, some interesting observations have started to emerge. Gene encoding orthologs of rhomboid proteases, site-2 proteases (S2P), presenilin/γ-secretases, and signal peptide peptidases are found in plant genomes and some of these gene products were identified in different plant cell membranes. The lack of chloroplast-located rhomboid proteases was associated with reduced fertility and aberrations in flower morphology. Mutations in homologues of S2P resulted in chlorophyll deficiency and impaired chloroplast development. An S2P was also implicated in the response to ER stress through cleavage of ER-membrane bZIP transcription factors, allowing their migration to the nucleus and activation of the transcription of BiP chaperones. Other membrane-bound transcription factors of the NAC and PHD families were also demonstrated to undergo RIP and relocalization to the nucleus. These and other new data are expected to shed more light on the roles of intramembrane proteases in plant biology in the future. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Current trends and challenges in proteomic identification of protease substrates.

    PubMed

    Vizovišek, Matej; Vidmar, Robert; Fonović, Marko; Turk, Boris

    2016-03-01

    Proteolytic cleavage is a ubiquitous, irreversible, posttranslational modification that changes protein structure and function and plays an important role in numerous physiological and pathological processes. Over the last decade, proteases have become increasingly important clinical targets because many of their inhibitors are already used in the clinic or in various stages of clinical testing. Therefore, a better understanding of protease action and their repertoires of physiological substrates can not only provide an important insight into their mechanisms of action but also open a path toward novel drug design. Historically, proteases and their substrates were mainly studied on a case-by-case basis, but recent advancements in mass spectrometry-based proteomics have enabled proteolysis studies on a global scale. Because there are many different types of proteases that can operate in various cellular contexts, multiple experimental approaches for their degradomic characterization had to be developed. The present paper reviews the mass spectrometry-based approaches for determining the proteolytic events in complex biological samples. The methodologies for substrate identification and the determination of protease specificity are discussed, with a special focus on terminomic strategies, which combine peptide labeling and enrichment. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  9. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  10. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.

    2013-01-01

    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  11. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  12. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  13. Evolution of Primary Protease Inhibitor Resistance Mutations during Protease Inhibitor Salvage Therapy

    PubMed Central

    Kantor, Rami; Fessel, W. Jeffrey; Zolopa, Andrew R.; Israelski, Dennis; Shulman, Nancy; Montoya, Jose G.; Harbour, Michael; Schapiro, Jonathan M.; Shafer, Robert W.

    2002-01-01

    In order to track the evolution of primary protease inhibitor (PI) resistance mutations in human immunodeficiency virus type 1 (HIV-1) isolates, baseline and follow-up protease sequences were obtained from patients undergoing salvage PI therapy who presented initially with isolates containing a single primary PI resistance mutation. Among 78 patients meeting study selection criteria, baseline primary PI resistance mutations included L90M (42% of patients), V82A/F/T (27%), D30N (21%), G48V (6%), and I84V (4%). Despite the switching of treatment to a new PI, primary PI resistance mutations present at the baseline persisted in 66 of 78 (85%) patients. D30N persisted less frequently than L90M (50% versus 100%, respectively; P < 0.001) and V82A/F/T (50% versus 81%, respectively; P = 0.05). HIV-1 isolates from 38 (49%) patients failing PI salvage therapy developed new primary PI resistance mutations including L90M, I84V, V82A, and G48V. Common combinations of primary and secondary PI resistance mutations after salvage therapy included mutations at amino acid positions 10, 82, and 46 and/or 54 in 16 patients; 10, 90, and 71 and/or 73 in 14 patients; 10, 73, 84, 90, and 46 and/or 54 in 5 patients; 10, 48, and 82 in 5 patients; and 30, 88 and 90 in 5 patients. In summary, during salvage PI therapy, most HIV-1 isolates with a single primary PI resistance mutation maintained their original mutations, and 49% developed additional primary PI resistance mutations. The persistence of L90M, V82A/F/T, G48V, and I84V during salvage therapy suggests that these mutations play a role in clinical resistance to multiple PIs. PMID:11897594

  14. From nonpeptide toward noncarbon protease inhibitors: Metallacarboranes as specific and potent inhibitors of HIV protease

    PubMed Central

    Cígler, Petr; Kožíšek, Milan; Řezáčová, Pavlína; Brynda, Jíří; Otwinowski, Zbyszek; Pokorná, Jana; Plešek, Jaromír; Grüner, Bohumír; Dolečková-Marešová, Lucie; Máša, Martin; Sedláček, Juraj; Bodem, Jochen; Kräusslich, Hans-Georg; Král, Vladimír; Konvalinka, Jan

    2005-01-01

    HIV protease (PR) represents a prime target for rational drug design, and protease inhibitors (PI) are powerful antiviral drugs. Most of the current PIs are pseudopeptide compounds with limited bioavailability and stability, and their use is compromised by high costs, side effects, and development of resistant strains. In our search for novel PI structures, we have identified a group of inorganic compounds, icosahedral metallacarboranes, as candidates for a novel class of nonpeptidic PIs. Here, we report the potent, specific, and selective competitive inhibition of HIV PR by substituted metallacarboranes. The most active compound, sodium hydrogen butylimino bis-8,8-[5-(3-oxa-pentoxy)-3-cobalt bis(1,2-dicarbollide)]di-ate, exhibited a Ki value of 2.2 nM and a submicromolar EC50 in antiviral tests, showed no toxicity in tissue culture, weakly inhibited human cathepsin D and pepsin, and was inactive against trypsin, papain, and amylase. The structure of the parent cobalt bis(1,2-dicarbollide) in complex with HIV PR was determined at 2.15 Å resolution by protein crystallography and represents the first carborane-protein complex structure determined. It shows the following mode of PR inhibition: two molecules of the parent compound bind to the hydrophobic pockets in the flap-proximal region of the S3 and S3′ subsites of PR. We suggest, therefore, that these compounds block flap closure in addition to filling the corresponding binding pockets as conventional PIs. This type of binding and inhibition, chemical and biological stability, low toxicity, and the possibility to introduce various modifications make boron clusters attractive pharmacophores for potent and specific enzyme inhibition. PMID:16227435

  15. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  16. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  17. (Processing and targeting of the thiol protease aleurain)

    SciTech Connect

    Rogers, J.C.

    1990-01-01

    Our goal for work during the past two years under this Grant was to characterize the barley thiol protease, aleurain, to determine if it is secreted or retained intracellularly in aleurone cells, and to begin to elucidate structural features that might control targeting of the protein to its final destination. We have shown that aleurain is synthesized as a proenzyme with two N-linked oligosaccharide chains, one high mannose-type and one complex-type. Aleurain undergoes processing to mature form by removal of an Nterminal prosegment, and is retained intracellularly; it cannot be detected among proteins secreted from aleurone cells. Treatment of aleurone cells with tunicamycin to prevent glycosylation of aleurain does not prevent processing of the unglycosylated form. The N-terminal portion of aleurain's prosegment is homologous to the comparable region in two yeast vacuolar proteases, where that region is known to contain the signal necessary for targeting the proteases to the vacuole. 18 refs., 7 figs.

  18. Protease inhibition as new therapeutic strategy for GI diseases.

    PubMed

    Vergnolle, Nathalie

    2016-07-01

    The GI tract is the most exposed organ to proteases, both in physiological and pathophysiological conditions. For digestive purposes, the lumen of the upper GI tract contains large amounts of pancreatic proteases, but studies have also demonstrated increased proteolytic activity into mucosal tissues (both in the upper and lower GI tract), associated with pathological conditions. This review aims at outlining the evidences for dysregulated proteolytic homeostasis in GI diseases and the pathogenic mechanisms of increased proteolytic activity. The therapeutic potential of protease inhibition in GI diseases is discussed, with a particular focus on IBDs, functional GI disorders and colorectal cancer. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  19. Cleaning protocols for crystallization robots: preventing protease contamination.

    PubMed

    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard

    2015-01-01

    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  20. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  1. Protease-specific nanosensors for magnetic resonance imaging.

    PubMed

    Schellenberger, Eyk; Rudloff, Franziska; Warmuth, Carsten; Taupitz, Matthias; Hamm, Bernd; Schnorr, Jörg

    2008-12-01

    Imaging of enzyme activity is a central goal of molecular imaging. With the introduction of fluorescent smart probes, optical imaging has become the modality of choice for experimental in vivo detection of enzyme activity. Here, we present a novel high-relaxivity nanosensor that is suitable for in vivo imaging of protease activity by magnetic resonance imaging. Upon specific protease cleavage, the nanoparticles rapidly switch from a stable low-relaxivity stealth state to become adhesive, aggregating high-relaxivity particles. To demonstrate the principle, we chose a cleavage motif of matrix metalloproteinase 9 (MMP-9), an enzyme important in inflammation, atherosclerosis, tumor progression, and many other diseases with alterations of the extracellular matrix. On the basis of clinically tested very small iron oxide particles (VSOP), the MMP-9-activatable protease-specific iron oxide particles (PSOP) have a hydrodynamic diameter of only 25 nm. PSOP are rapidly activated, resulting in aggregation and increased T2*-relaxivity.

  2. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  3. New therapeutic strategies in HCV: second-generation protease inhibitors.

    PubMed

    Clark, Virginia C; Peter, Joy A; Nelson, David R

    2013-02-01

    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance. © 2012 John Wiley & Sons A/S.

  4. Tobacco Etch Virus protease: A shortcut across biotechnologies.

    PubMed

    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca

    2016-08-10

    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  5. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  6. Purification and properties of serine protease from Halobacterium halobium.

    PubMed Central

    Izotova, L S; Strongin, A Y; Chekulaeva, L N; Sterkin, V E; Ostoslavskaya, V I; Lyublinskaya, L A; Timokhina, E A; Stepanov, V M

    1983-01-01

    Pure extracellular serine protease was isolated from the culture filtrate of Halobacterium halobium by bacitracin-Sepharose affinity chromatography. The enzyme activity was completely and irreversibly lost if the NaCl concentration fell below 2 M. The protease consists of one polypeptide chain with a molecular weight of 41,000. It is characteristically enriched in Asx and Glx content, whereas the level of basic amino acids in the enzyme molecule is unusually low. The protease shows a preference for leucine in the carboxylic side of the scissile bond of the substrate, cleaving the B-chain of oxidized bovine insulin only at the Leu15-Tyr16 bond and liberating p-nitroaniline from L-pyroglutamyl-L-alanyl-L-alanyl-L-leucine-p-nitroanilide. PMID:6348027

  7. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  8. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  9. Protease inhibitor therapy in children with perinatally acquired HIV infection.

    PubMed

    Rutstein, R M; Feingold, A; Meislich, D; Word, B; Rudy, B

    1997-10-01

    To review the short-term response and safety of protease inhibitor therapy in HIV-infected children. Retrospective chart review of open-label protease inhibitor-containing combination therapy. Two urban pediatric HIV centers. Twenty-eight HIV-infected children were prescribed 30 protease inhibitor-containing antiretroviral therapy combinations. The median age at initiation of protease inhibitor antiretroviral therapy was 79 months. Patients had been on previous antiretroviral therapy for a mean of 45.5 months. Of the 28 children who completed at least 1 month of therapy, 26 experienced marked virologic and immunologic improvement (mean maximal decrease in viral load 1.90 log10 copies/ml; SD, 0.8; mean maximal rise in CD4+ lymphocytes of 279 x 10(6)/l; SD, 300 x 10(6)/l). Eleven patients achieved a viral nadir of < 400 copies/ml, and seven sustained this level of viral suppression for a mean of 6 months. Indinavir use was associated with a high incidence of renal side-effects, including two patients who developed interstitial nephritis. Two patients on ritonavir experienced a significant elevation of liver enzymes. Protease inhibitor therapy was associated with substantial short-term virologic and immunologic improvement in this primarily heavily pretreated cohort, with 25% maintaining a viral load of < 400 copies/ml after 6 months of therapy. There was a significant rate of adverse events. Pharmacokinetic and safety data are needed to guide aggressive antiretroviral therapy in HIV-infected children, and further treatment options are required for those failing or intolerant to the available protease inhibitors.

  10. Taspase1: a 'misunderstood' protease with translational cancer relevance.

    PubMed

    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H

    2016-06-30

    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  11. The chlamydial protease CPAF: important or not, important for what?

    PubMed

    Häcker, Georg

    2014-05-01

    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  12. Glycosyl part identified within Balanites aegyptiaca fruit protease.

    PubMed

    Beka, R G; Guiama, V D; Delmont, A; Donn, P; Slomianny, M-C; Libouga, D G; Mbofung, C M; Guillochon, D; Vercaigne-Marko, D

    2011-10-01

    The many milk-clotting proteases from plant are glycosylated; attachment of monosaccharides to enzyme is an advantage for its activity and stability. In this study, gas chromatography coupled to mass spectrometry-electrospray ionization was used to identify glycans bond to proteases purified from Balanites aegyptiaca fruits pulp through cation exchange chromatography. Carbohydrates were identified according to the retention time and the ion at m/z after derivation by heptafluorobutyric acid. The chromatograms obtained from monosaccharides analysis revealed the presence of galactose, mannose, arabinose, xylose, rhamnose and glucuronic acid. The mass spectrometry-electrospray ionization spectra corroborated these findings. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Regulation by proteolysis: energy-dependent proteases and their targets.

    PubMed Central

    Gottesman, S; Maurizi, M R

    1992-01-01

    A number of critical regulatory proteins in both prokaryotic and eukaryotic cells are subject to rapid, energy-dependent proteolysis. Rapid degradation combined with control over biosynthesis provides a mechanism by which the availability of a protein can be limited both temporally and spatially. Highly unstable regulatory proteins are involved in numerous biological functions, particularly at the commitment steps in developmental pathways and in emergency responses. The proteases involved in energy-dependent proteolysis are large proteins with the ability to use ATP to scan for appropriate targets and degrade complete proteins in a processive manner. These cytoplasmic proteases are also able to degrade many abnormal proteins in the cell. PMID:1480111

  14. [Cytokines and proteases involved in pathogenesis of COPD].

    PubMed

    Yamaya, Atsuyo; Osanai, Kazuhiro

    2011-10-01

    COPD is characterized by persistence of chronic inflammation in small airways and alveoli. Macrophages, neutrophils, and a specialized subset of T lymphocytes orchestrate the mild inflammation. This article focuses on humoral factors such as cytokines and chemokines that recruit these inflammatory and immune cells to the lungs, and proteases/antiproteases that ultimately cause structural derangement in the terminal respiratory zones. In addition to the classical protease and antiprotease imbalance hypothesis, alveolar homeostasis abnormality that comes from imbalance of lung constitutional cell apoptosis and regeneration may play a role in emphysema development. Also, autoimmunity to elastin degradation products may take part in the disease.

  15. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  16. Identification of Genotypic Changes in Human Immunodeficiency Virus Protease That Correlate with Reduced Susceptibility to the Protease Inhibitor Lopinavir among Viral Isolates from Protease Inhibitor-Experienced Patients

    PubMed Central

    Kempf, Dale J.; Isaacson, Jeffrey D.; King, Martin S.; Brun, Scott C.; Xu, Yi; Real, Kathryn; Bernstein, Barry M.; Japour, Anthony J.; Sun, Eugene; Rode, Richard A.

    2001-01-01

    The association of genotypic changes in human immunodeficiency virus (HIV) protease with reduced in vitro susceptibility to the new protease inhibitor lopinavir (previously ABT-378) was explored using a panel of viral isolates from subjects failing therapy with other protease inhibitors. Two statistical tests showed that specific mutations at 11 amino acid positions in protease (L10F/I/R/V, K20M/R, L24I, M46I/L, F53L, I54L/T/V, L63P, A71I/L/T/V, V82A/F/T, I84V, and L90M) were associated with reduced susceptibility. Mutations at positions 82, 54, 10, 63, 71, and 84 were most closely associated with relatively modest (4- and 10-fold) changes in phenotype, while the K20M/R and F53L mutations, in conjunction with multiple other mutations, were associated with >20- and >40-fold-reduced susceptibility, respectively. The median 50% inhibitory concentrations (IC50) of lopinavir against isolates with 0 to 3, 4 or 5, 6 or 7, and 8 to 10 of the above 11 mutations were 0.8-, 2.7-, 13.5-, and 44.0-fold higher, respectively, than the IC50 against wild-type HIV. On average, the IC50 of lopinavir increased by 1.74-fold per mutation in isolates containing three or more mutations. Each of the 16 viruses that displayed a >20-fold change in susceptibility contained mutations at residues 10, 54, 63, and 82 and/or 84, along with a median of three mutations at residues 20, 24, 46, 53, 71, and 90. The number of protease mutations from the 11 identified in these analyses (the lopinavir mutation score) may be useful for the interpretation of HIV genotypic resistance testing with respect to lopinavir-ritonavir (Kaletra) regimens and may provide insight into the genetic barrier to resistance to lopinavir-ritonavir in both antiretroviral therapy-naive and protease inhibitor-experienced patients. PMID:11462018

  17. Identification of the cysteine protease Amb a 11 as a novel major allergen from short ragweed.

    PubMed

    Bouley, Julien; Groeme, Rachel; Le Mignon, Maxime; Jain, Karine; Chabre, Henri; Bordas-Le Floch, Véronique; Couret, Marie-Noëlle; Bussières, Laetitia; Lautrette, Aurélie; Naveau, Marie; Baron-Bodo, Véronique; Lombardi, Vincent; Mascarell, Laurent; Batard, Thierry; Nony, Emmanuel; Moingeon, Philippe

    2015-10-01

    Allergy to pollen from short ragweed (Ambrosia artemisiifolia) is a serious and expanding health problem in the United States and in Europe. We sought to investigate the presence of undescribed allergens in ragweed pollen. Ragweed pollen proteins were submitted to high-resolution gel electrophoresis and tested for IgE reactivity by using sera from 92 American or European donors with ragweed allergy. Pollen transcriptome sequencing, mass spectrometry (MS), and recombinant DNA technologies were applied to characterize new IgE-binding proteins. High-resolution IgE immunoblotting experiments revealed that 50 (54%) of 92 patients with ragweed allergy were sensitized to a 37-kDa allergen distinct from Amb a 1. The full-length cDNA sequence for this molecule was obtained by means of PCR cloning after MS sequencing of the protein combined with ragweed pollen RNA sequencing. The purified allergen, termed Amb a 11, was fully characterized by MS and confirmed to react with IgEs from 66% of patients. This molecule is a 262-amino-acid thiol protease of the papain family expressed as a combination of isoforms and glycoforms after proteolytic removal of N- and C-terminal propeptides from a proform. Three-dimensional modeling revealed a high structural homology with known cysteine proteases, including the mite Der p 1 allergen. The protease activity of Amb a 11, as well as its capacity to activate basophils from patients with ragweed allergy, were confirmed. The production of a nonglycosylated recombinant form of Amb a 11 in Escherichia coli established that glycosylation is not required for IgE binding. We identified the cysteine protease Amb a 11 as a new major allergen from ragweed pollen. Given the similar physicochemical properties shared by the 2 major allergens, we hypothesize that part of the allergenic activity previously ascribed to Amb a 1 is rather borne by Amb a 11. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All

  18. Effects of eye rubbing on the levels of protease, protease activity and cytokines in tears: relevance in keratoconus.

    PubMed

    Balasubramanian, Sivaraman A; Pye, David C; Willcox, Mark D P

    2013-03-01

    Proteases, protease activity and inflammatory molecules in tears have been found to be relevant in the pathogenesis of keratoconus. We sought to determine the influence of eye rubbing on protease expression, protease activity and concentration of inflammatory molecules in tears. Basal tears were collected from normal volunteers before and after 60 seconds of experimental eye rubbing. The total amount of matrix metalloproteinase (MMP)-13 and inflammatory molecules interleukin (IL)-6 and tumour necrosis factor (TNF)-α in the tear samples were measured using specific enzyme-linked immunosorbent assays (ELISA). Tear collagenase activity was investigated using a specific activity assay. The concentrations of MMP-13 (51.9 ± 34.3 versus 63 ± 36.8 pg/ml, p = 0.006), IL-6 (1.24 ± 0.98 versus 2.02 ± 1.52 pg/ml, p = 0.004) and TNF-α (1.16 ± 0.74 versus 1.44 ± 0.66 pg/ml, p = 0.003) were significantly increased in normal subjects after eye rubbing. The experimental eye rub did not alter significantly the collagenase activity (5.02 ± 3 versus 7.50 ± 3.90 fluorescent intensity units, p = 0.14) of tears. Eye rubbing for 60 seconds increased the level of tear MMP-13, IL-6 and TNF-α in normal study subjects. This increase in protease, protease activity and inflammatory mediators in tears after eye rubbing may be exacerbated even further during persistent and forceful eye rubbing seen in people with keratoconus and this in turn may contribute to the progression of the disease. © 2013 The Authors. Clinical and Experimental Optometry © 2013 Optometrists Association Australia.

  19. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases

    PubMed Central

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers. PMID:22461953

  20. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  1. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  2. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  3. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  4. Emerging technologies for protease engineering: New tools to clear out disease.

    PubMed

    Guerrero, Jennifer L; Daugherty, Patrick S; O'Malley, Michelle A

    2017-01-01

    Proteases regulate many biological processes through their ability to activate or inactive their target substrates. Because proteases catalytically turnover proteins and peptides, they present unique opportunities for use in biotechnological and therapeutic applications. However, many proteases are capable of cleaving multiple physiological substrates. Therefore their activity, expression, and localization are tightly controlled to prevent unwanted proteolysis. Currently, the use of protease therapeutics has been limited to a handful of proteases with narrow substrate specificities, which naturally limits their toxicity. Wider application of proteases is contingent upon the development of methods for engineering protease selectivity, activity, and stability. Recent advances in the development of high-throughput, bacterial and yeast-based methods for protease redesign have yielded protease variants with novel specificities, reduced toxicity, and increased resistance to inhibitors. Here, we highlight new tools for protease engineering, including methods suitable for the redesign of human secreted proteases, and future opportunities to exploit the catalytic activity of proteases for therapeutic benefit. Biotechnol. Bioeng. 2017;114: 33-38. © 2016 Wiley Periodicals, Inc.

  5. Specific and efficient cleavage of fusion proteins by recombinant plum pox virus NIa protease.

    PubMed

    Zheng, Nuoyan; Pérez, José de Jesús; Zhang, Zhonghui; Domínguez, Elvira; Garcia, Juan Antonio; Xie, Qi

    2008-02-01

    Site-specific proteases are the most popular kind of enzymes for removing the fusion tags from fused target proteins. Nuclear inclusion protein a (NIa) proteases obtained from the family Potyviridae have become promising due to their high activities and stringencies of sequences recognition. NIa proteases from tobacco etch virus (TEV) and tomato vein mottling virus (TVMV) have been shown to process recombinant proteins successfully in vitro. In this report, recombinant PPV (plum pox virus) NIa protease was employed to process fusion proteins with artificial cleavage site in vitro. Characteristics such as catalytic ability and affecting factors (salt, temperature, protease inhibitors, detergents, and denaturing reagents) were investigated. Recombinant PPV NIa protease expressed and purified from Escherichia coli demonstrated efficient and specific processing of recombinant GFP and SARS-CoV nucleocapsid protein, with site F (N V V V H Q black triangle down A) for PPV NIa protease artificially inserted between the fusion tags and the target proteins. Its catalytic capability is similar to those of TVMV and TEV NIa protease. Recombinant PPV NIa protease reached its maximal proteolytic activity at approximately 30 degrees C. Salt concentration and only one of the tested protease inhibitors had minor influences on the proteolytic activity of PPV NIa protease. Recombinant PPV NIa protease was resistant to self-lysis for at least five days.

  6. A Mycobacterium avium subsp. paratuberculosis Predicted Serine Protease Is Associated with Acid Stress and Intraphagosomal Survival

    PubMed Central

    Kugadas, Abirami; Lamont, Elise A.; Bannantine, John P.; Shoyama, Fernanda M.; Brenner, Evan; Janagama, Harish K.; Sreevatsan, Srinand

    2016-01-01

    The ability to maintain intra-cellular pH is crucial for bacteria and other microbes to survive in diverse environments, particularly those that undergo fluctuations in pH. Mechanisms of acid resistance remain poorly understood in mycobacteria. Although, studies investigating acid stress in M. tuberculosis are gaining traction, few center on Mycobacterium avium subsp. paratuberculosis (MAP), the etiological agent of chronic enteritis in ruminants. We identified a MAP acid stress response network involved in macrophage infection. The central node of this network was MAP0403, a predicted serine protease that shared an 86% amino acid identity with MarP in M. tuberculosis. Previous studies confirmed MarP as a serine protease integral to maintaining intra-bacterial pH and survival in acid in vitro and in vivo. We show that MAP0403 is upregulated in infected macrophages and MAC-T cells that coincided with phagosome acidification. Treatment of mammalian cells with bafilomcyin A1, a potent inhibitor of phagosomal vATPases, diminished MAP0403 transcription. MAP0403 expression was also noted in acidic medium. A surrogate host, M. smegmatis mc2 155, was designed to express MAP0403 and when exposed to either macrophages or in vitro acid stress had increased bacterial cell viability, which corresponds to maintenance of intra-bacterial pH in acidic (pH = 5) conditions, compared to the parent strain. These data suggest that MAP0403 may be the equivalent of MarP in MAP. Future studies confirming MAP0403 as a serine protease and exploring its structure and possible substrates are warranted. PMID:27597934

  7. Purification and partial characterization of thiol protease inhibitors from embryos of the brine shrimp Artemia.

    PubMed

    Warner, A H; Sonnenfeld-Karcz, M J

    1992-01-01

    Thiol protease inhibitor (TPI) proteins in embryos of the brine shrimp Artemia were purified to apparent homogeneity and several of their properties were studied. Four protein fractions containing thiol protease inhibitor activity were obtained by high performance liquid chromatography of Artemia embryo proteins on a C-18 reverse-phase column and these were designated as TPI-1a, -1b, -2, and -3. Acrylamide gel electrophoresis showed that TPI-1a and TPI-1b each consisted of two bands of 11.8 and 13.6 kilodaltons (kDa), while TPI-2 and TPI-3 consisted of only one band of 12.5 kDa. Isoelectric focusing experiments demonstrated that TPI-3 contained one band at pH 5.3, while both TPI-1b and TPI-2 yielded bands at pH 5.2 and 5.3. TPI-1a did not yield any major bands. Amino acid composition analyses of the Artemia TPI proteins showed them to be remarkably similar to one another. All were rich in valine and aspartic and glutamic acids, and devoid of cysteine. Partial trypsin digestion of TPI-1b, TPI-2, and TPI-3 yielded several peptides with identical mobilities on a reverse-phase column and several other peptides with different mobilities, suggesting that the multiple forms of Artemia TPIs may have originated from the same parental protein. N-terminal amino acid sequence analyses of TPI-3 suggest that Artemia TPI proteins are members of the type I cystatin family of protease inhibitors.

  8. Determining Membrane Protein Topology Using Fluorescence Protease Protection (FPP).

    PubMed

    White, Carl; Nixon, Alex; Bradbury, Neil A

    2015-04-20

    The correct topology and orientation of integral membrane proteins are essential for their proper function, yet such information has not been established for many membrane proteins. A simple technique called fluorescence protease protection (FPP) is presented, which permits the determination of membrane protein topology in living cells. This technique has numerous advantages over other methods for determining protein topology, in that it does not require the availability of multiple antibodies against various domains of the membrane protein, does not require large amounts of protein, and can be performed on living cells. The FPP method employs the spatially confined actions of proteases on the degradation of green fluorescent protein (GFP) tagged membrane proteins to determine their membrane topology and orientation. This simple approach is applicable to a wide variety of cell types, and can be used to determine membrane protein orientation in various subcellular organelles such as the mitochondria, Golgi, endoplasmic reticulum and components of the endosomal/recycling system. Membrane proteins, tagged on either the N-termini or C-termini with a GFP fusion, are expressed in a cell of interest, which is subject to selective permeabilization using the detergent digitonin. Digitonin has the ability to permeabilize the plasma membrane, while leaving intracellular organelles intact. GFP moieties exposed to the cytosol can be selectively degraded through the application of protease, whereas GFP moieties present in the lumen of organelles are protected from the protease and remain intact. The FPP assay is straightforward, and results can be obtained rapidly.

  9. Design, synthesis, and activity of nanocellulosic protease sensors

    USDA-ARS?s Scientific Manuscript database

    Here we contrast the molecular assembly, and biochemical utility of nanocellulosic materials prepared from cotton and wood as protease sensors. The cotton-based nanocellulosic substrates were prepared in a variety of ways to produce nanocrystals, films and aerogels, which were derivatized with eithe...

  10. Structure of Rhomboid Protease in a Lipid Environment

    PubMed Central

    Vinothkumar, Kutti R.

    2011-01-01

    Structures of the prokaryotic homologue of rhomboid proteases reveal a core of six transmembrane helices, with the active-site residues residing in a hydrophilic cavity. The native environment of rhomboid protease is a lipid bilayer, yet all the structures determined thus far are in a nonnative detergent environment. There remains a possibility of structural artefacts arising from the use of detergents. In an attempt to address the effect of detergents on the structure of rhomboid protease, crystals of GlpG, an Escherichia coli rhomboid protease in a lipid environment, were obtained using two alternative approaches. The structure of GlpG refined to 1. 7-Å resolution was obtained from crystals grown in the presence of lipid bicelles. This structure reveals well-ordered and partly ordered lipid molecules forming an annulus around the protein. Lipid molecules adapt to the surface features of protein and arrange such that they match the hydrophobic thickness of GlpG. Virtually identical two-dimensional crystals were also obtained after detergent removal by dialysis. A comparison of an equivalent structure determined in a completely delipidated detergent environment provides insights on how detergent substitutes for lipid. A detergent molecule is also observed close to the active site, helping to postulate a model for substrate binding and hydrolysis in rhomboids. PMID:21256137

  11. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  12. Protease Inhibitors Do Not Affect Antibody Responses to Pneumococcal Vaccination.

    PubMed

    De La Rosa, Indhira; Munjal, Iona M; Rodriguez-Barradas, Maria; Yu, Xiaoying; Pirofski, Liise-Anne; Mendoza, Daniel

    2016-06-01

    HIV(+) subjects on optimal antiretroviral therapy have persistently impaired antibody responses to pneumococcal vaccination. We explored the possibility that this effect may be due to HIV protease inhibitors (PIs). We found that in humans and mice, PIs do not affect antibody production in response to pneumococcal vaccination. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  14. Botulinum neurotoxin: a deadly protease with applications to human medicine

    USDA-ARS?s Scientific Manuscript database

    Botulinum neurotoxins (BoNTs) are some of the most potent biological toxins to humans. They are synthesized by the gram-positive, spore-forming bacterium Clostridium botulinum. BoNT is secreted from the bacterium as a ~150 kDa polypeptide which is cleaved by bacterial or host proteases into a ~50 kD...

  15. Lon protease: A key enzyme controlling mitochondrial bioenergetics in cancer.

    PubMed

    Quirós, Pedro M; Bárcena, Clea; López-Otín, Carlos

    2014-01-01

    We have recently explored the in vivo functional and oncologic relevance of Lon protease (LONP1), an enzyme involved in mitochondrial quality control. We found that LONP1 is an essential protein for life and that it also performs a critical function in tumorigenesis by regulating the bioenergetics of cancer cells.

  16. Protease inhibitors interfere with the necessary factors of carcinogenesis.

    PubMed

    Troll, W

    1989-05-01

    Many tumor promoters are inflammatory agents that stimulate the formation of oxygen radicals (.O2-) and hydrogen peroxide (H2O2) in phagocytic neutrophils. The neutrophils use the oxygen radicals to kill bacteria, which are recognized by the cell membrane of phagocytic cells causing a signal to mount the oxygen response. The tumor promoter isolated from croton oil, 12-O-tetradecanoylphorbol-13-acetate (TPA), mimics the signal, causing an oxygen radical release that is intended to kill bacteria; instead, it injures cells in the host. Oxygen radicals cause single strand breaks in DNA and modify DNA bases. These damaging reactions appear to be related to tumor promotion, as three types of chemopreventive agents, retinoids, onion oil, and protease inhibitors, suppress the induction of oxygen radicals in phagocytic neutrophils and suppress tumor promotion in skin cancer in mice. Protease inhibitors also suppress breast and colon cancers in mice. Protease inhibitors capable of inhibiting chymotrypsin show a greater suppression of the oxygen effect and are better suppressors of tumor promotion. In addition, oxygen radicals may be one of the many agents that cause activation of oncogenes. Since retinoids and protease inhibitors suppress the expression of the ras oncogene in NIH 3T3 cells, NIH 3T3 cells may serve as a relatively facile model for finding and measuring chemopreventive agents that interfere with the carcinogenic process.

  17. Ca(2+)-dependent protease I from Allomyces arbuscula.

    PubMed

    Ojha, M

    1996-01-05

    A monomeric Ca(2+)-dependent protease (CDP I) of 39 kDa active at neutral pH has been purified from the aquatic fungus Allomyces arbuscula. The enzyme elutes at NaCl molarity of 0.07 M from the DEAE (DE52)-cellulose columns in contrast to the second Ca(2+)-dependent protease (CDP II) characterized earlier which elutes at 0.18 M NaCl. The enzyme has no basal activity in the absence of Ca2+ and requires 1.7 mM Ca2+ for half maximum activation of the in vitro enzyme activity. The enzyme prefers substrates with Arg in P1 position but this specificity also depends strongly on the nature of the subsite residues, for example Pro in P2 position. The enzyme is glycosylated and contains essential cysteine residues in the active site. It appears to be an atypical cysteine protease as it is inactivated to varying degree with some serine protease inhibitors.

  18. Purification and characterization of a pineapple crown leaf thiol protease.

    PubMed

    Singh, L Rupachandra; Devi, Th Premila; Devi, S Kunjeshwori

    2004-02-01

    A thiol protease was isolated and purified from the crown leaf of pineapple, Ananas comosus (L.) Merr. cv. Queen, by an immunoaffinity procedure. After the purification to electrophoretic homogeneity, the enzyme was characterized with respect to some of its physico-chemical and kinetic properties. The molecular weight of the protease (22.4-22.9 kDa), Km (97 microM) and kcat (8.8 s(-1)) for its esterolytic cleavage of the synthetic protease substrate N(alpha)-CBZ-L-lysine p-nitrophenyl ester, the concentration of its thiol activator L-cysteine required for half maximal activation A0.5 (9.9 microM), optimum pH (6.5) for its proteolytic action on azocasein, T(1/2) (60 degrees C) for inactivation by heating the enzyme (35.5 microg protein/mL) in citrate buffer pH 6.0 for 15 min, and SH-group content (0.98 mol/mol enzyme) were determined. Most of these physicochemical and kinetic properties were found to be similar to those of the already well-characterized stem bromelain (EC 3.4.22.32). Thus, the immunoaffinity purified crown leaf protease appeared to be closely related to stem bromelain.

  19. A novel serine protease inhibitor from Bungarus fasciatus venom.

    PubMed

    Lu, Jia; Yang, Hailong; Yu, Haining; Gao, Weikai; Lai, Ren; Liu, Jingze; Liang, Xingcai

    2008-03-01

    By Sephadex G-50 gel filtration, cation-exchange CM-Sephadex C-25 chromatography and reversed phase high-performance liquid chromatography (HPLC), a novel serine protease inhibitor named bungaruskunin was purified and characterized from venom of Bungarus fasciatus. Its cDNA was also cloned from the cDNA library of B. fasciatus venomous glands. The predicted precursor is composed of 83 amino acid (aa) residues including a 24-aa signal peptide and a 59-aa mature bungaruskunin. Bungaruskunin showed maximal similarity (64%) with the predicted serine protease inhibitor blackelin deduced from the cDNA sequence of the red-bellied black snake Pseudechis porphyriacus. Bungaruskunin is a Kunitz protease inhibitor with a conserved Kunitz domain and could exert inhibitory activity against trypsin, chymotrypsin, and elastase. By screening the cDNA library, two new B chains of beta-bungarotoxin are also identified. The overall structures of bungaruskunin and beta-bungarotoxin B chains are similar; especially they have highly conserved signal peptide sequences. These findings strongly suggest that snake Kunitz/BPTI protease inhibitors and neurotoxic homologs may have originated from a common ancestor.

  20. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  1. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  2. H1-A, a compound isolated from Fusarium oxysporum inhibits hepatitis C virus (HCV) NS3 serine protease.

    PubMed

    Yang, Li-Yuan; Lin, Jun; Zhou, Bin; Liu, Yan-Gang; Zhu, Bao-Quan

    2016-04-01

    The present study was aimed to isolate the active compounds from the fermentation products of Fusarium oxysporum, which had hepatitis C virus (HCV) NS3 protease inhibitory activity. A bioactive compound was isolated by reverse-phase silica-gel column chromatography, silica-gel column chromatography, semi-preparative reverse-phase High Performance Liquid Chromatography (HPLC), and then its molecular structure was elucidated based on the spectrosopic analysis. As a result, the compound (H1-A, 1) Ergosta-5, 8 (14), 22-trien-7-one, 3-hydroxy-,(3β, 22E) was isolated and identified. To the best of our knowledge, this was the first report on the isolation of H1-A from microorganisms with the inhibitory activity of NS3 protease. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  3. Mast Cell Proteases as Protective and Inflammatory Mediators

    PubMed Central

    Caughey, George H.

    2014-01-01

    Proteases are the most abundant class of proteins produced by mast cells. Many of these are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which include cross-linking of high affinity IgE receptor FcεRI by IgE bound to multivalent allergen. Understanding and separating the functions of the proteases is important because expression differs among mast cells in different tissue locations. Differences between laboratory animals and humans in protease expression also influence the degree of confidence with which results obtained in animal models of mast cell function can be extrapolated to humans. The inflammatory potential of mast cell proteases was the first aspect of their biology to be explored and has received the most attention, in part because some of them—notably tryptases and chymases—are biomarkers of local and systemic mast cell degranulation and anaphylaxis. Although some of the proteases indeed augment allergic inflammation and are potential targets for inhibition to treat asthma and related allergic disorders, they are protective and even anti-inflammatory in some settings. For example, mast cell tryptases may protect from serious bacterial lung infections and may limit the “rubor” component of inflammation caused by vasodilating neuropeptides in the skin. Chymases help to maintain intestinal barrier function and to expel parasitic worms, and may support blood pressure during anaphylaxis by generating angiotensin II. In other life-or-death examples, carboxypeptidase A3 and other mast cell peptidases limit systemic toxicity of endogenous peptides like endothelin and neurotensin during septic peritonitis, and inactivate venom-associated peptides. On the other hand, mast cell peptidase-mediated destruction of protective cytokines, like IL-6, can enhance mortality from sepsis. Peptidases released from mast cells also influence non-mast cell proteases, such as by activating matrix metalloproteinase cascades

  4. Effects of cysteine protease inhibitors on rabbit cathepsin D maturation

    SciTech Connect

    Samarel, A.M.; Ferguson, A.G.; Decker, R.S.; Lesch, M. )

    1989-12-01

    To examine the effects of cysteine protease inhibitors on cathepsin D intracellular transport, proteolytic processing, and secretion, primary cultures of rabbit cardiac fibroblasts were grown to confluence and exposed to media containing leupeptin, E 64, or chloroquine. Cathepsin D maturation was then evaluated in pulse-chase biosynthetic labeling experiments. None of the three agents affected the charge modification of procathepsin D within the Golgi apparatus. However, all three agents interfered with the subsequent proteolytic processing of procathepsin D isoforms to active cathepsin D. Both leupeptin and E 64 caused the intracellular accumulation of large amounts of a Mr 51,000 processing intermediate. Trace amounts of this intermediate were also detected in chloroquine-treated cells. Combined activity assay and radioimmunoassay of cell lysates indicated that this partially processed form of cathepsin D possessed proteolytic activity. Whereas low medium concentrations of leupeptin (10-100 microM) but not E 64 appeared to stimulate procathepsin D secretion, neither agent appeared to have a major effect on the rate of proenzyme secretion at doses required to inhibit proteolytic maturation (1-10 mM). Furthermore, pretreatment of cells with 10 mM leupeptin appeared only to delay, but not prevent, the intracellular transport of cathepsin D to lysosomes. In contrast, chloroquine increased procathepsin D secretion in a dose-dependent manner, diverting the majority of newly synthesized procathepsin D from the intracellular protease(s) responsible for proteolytic processing. These results suggest that cysteine proteases participate in the proteolytic maturation of procathepsin D during the transport of newly synthesized enzyme to lysosomes, but cysteine protease-mediated proteolytic processing is not required for cathepsin D activation or lysosomal translocation.

  5. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  6. Highly efficient and easy protease-mediated protein purification.

    PubMed

    Last, Daniel; Müller, Janett; Dawood, Ayad W H; Moldenhauer, Eva J; Pavlidis, Ioannis V; Bornscheuer, Uwe T

    2016-02-01

    As both research on and application of proteins are rarely focused on the resistance towards nonspecific proteases, this property remained widely unnoticed, in particular in terms of protein purification and related fields. In the present study, diverse aspects of protease-mediated protein purification (PMPP) were explored on the basis of the complementary proteases trypsin and proteinase K as well as the model proteins green fluorescent protein (GFP) from Aequorea victoria, lipase A from Candida antarctica (CAL-A), a transaminase from Aspergillus fumigatus (AspFum), quorum quenching lactonase AiiA from Bacillus sp., and an alanine dehydrogenase from Thermus thermophilus (AlaDH). While GFP and AiiA were already known to be protease resistant, the thermostable enzymes CAL-A, AspFum, and AlaDH were selected due to the documented correlation between thermostability and protease resistance. As proof of principle for PMPP, recombinant GFP remained unaffected whereas most Escherichia coli (E. coli) host proteins were degraded by trypsin. PMPP was highly advantageous compared to the widely used heat-mediated purification of commercial CAL-A. The resistance of AspFum towards trypsin was improved by rational protein design introducing point mutation R20Q. Trypsin also served as economical and efficient substitute for site-specific endopeptidases for the removal of a His-tag fused to AiiA. Moreover, proteolysis of host enzymes with interfering properties led to a strongly improved sensitivity and accuracy of the NADH assay in E. coli cell lysate for AlaDH activity measurements. Thus, PMPP is an attractive alternative to common protein purification methods and facilitates also enzyme characterization in cell lysate.

  7. Crystal Structures of Yellowtail Ascites Virus VP4 Protease

    PubMed Central

    Chung, Ivy Yeuk Wah; Paetzel, Mark

    2013-01-01

    Yellowtail ascites virus (YAV) is an aquabirnavirus that causes ascites in yellowtail, a fish often used in sushi. Segment A of the YAV genome codes for a polyprotein (pVP2-VP4-VP3), where processing by its own VP4 protease yields the capsid protein precursor pVP2, the ribonucleoprotein-forming VP3, and free VP4. VP4 protease utilizes the rarely observed serine-lysine catalytic dyad mechanism. Here we have confirmed the existence of an internal cleavage site, preceding the VP4/VP3 cleavage site. The resulting C-terminally truncated enzyme (ending at Ala716) is active, as shown by a trans full-length VP4 cleavage assay and a fluorometric peptide cleavage assay. We present a crystal structure of a native active site YAV VP4 with the internal cleavage site trapped as trans product complexes and trans acyl-enzyme complexes. The acyl-enzyme complexes confirm directly the role of Ser633 as the nucleophile. A crystal structure of the lysine general base mutant (K674A) reveals the acyl-enzyme and empty binding site states of VP4, which allows for the observation of structural changes upon substrate or product binding. These snapshots of three different stages in the VP4 protease reaction mechanism will aid in the design of anti-birnavirus compounds, provide insight into previous site-directed mutagenesis results, and contribute to understanding of the serine-lysine dyad protease mechanism. In addition, we have discovered that this protease contains a channel that leads from the enzyme surface (adjacent to the substrate binding groove) to the active site and the deacylating water. PMID:23511637

  8. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  9. Intramembrane protease RasP boosts protein production in Bacillus.

    PubMed

    Neef, Jolanda; Bongiorni, Cristina; Goosens, Vivianne J; Schmidt, Brian; van Dijl, Jan Maarten

    2017-04-04

    The microbial cell factory Bacillus subtilis is a popular industrial platform for high-level production of secreted technical enzymes. Nonetheless, the effective secretion of particular heterologous enzymes remains challenging. Over the past decades various studies have tackled this problem, and major improvements were achieved by optimizing signal peptides or removing proteases involved in product degradation. On the other hand, serious bottlenecks in the protein export process per se remained enigmatic, especially for protein secretion at commercially significant levels by cells grown to high density. The aim of our present study was to assess the relevance of the intramembrane protease RasP for high-level protein production in B. subtilis. Deletion of the rasP gene resulted in reduced precursor processing and extracellular levels of the overproduced α-amylases AmyE from B. subtilis and AmyL from Bacillus licheniformis. Further, secretion of the overproduced serine protease BPN' from Bacillus amyloliquefaciens was severely impaired in the absence of RasP. Importantly, overexpression of rasP resulted in threefold increased production of a serine protease from Bacillus clausii, and 2.5- to 10-fold increased production of an AmyAc α-amylase from Paenibacillus curdlanolyticus, depending on the culture conditions. Of note, growth defects due to overproduction of the two latter enzymes were suppressed by rasP-overexpression. Here we show that an intramembrane protease, RasP, sets a limit to high-level production of two secreted heterologous enzymes that are difficult to produce in the B. subtilis cell factory. This finding was unexpected and suggests that proteolytic membrane sanitation is key to effective enzyme production in Bacillus.

  10. The Multifaceted Poliovirus 2A Protease: Regulation of Gene Expression by Picornavirus Proteases

    PubMed Central

    Castelló, Alfredo; Álvarez, Enrique; Carrasco, Luis

    2011-01-01

    After entry into animal cells, most viruses hijack essential components involved in gene expression. This is the case of poliovirus, which abrogates cellular translation soon after virus internalization. Abrogation is achieved by cleavage of both eIF4GI and eIF4GII by the viral protease 2A. Apart from the interference of poliovirus with cellular protein synthesis, other gene expression steps such as RNA and protein trafficking between nucleus and cytoplasm are also altered. Poliovirus 2Apro is capable of hydrolyzing components of the nuclear pore, thus preventing an efficient antiviral response by the host cell. Here, we compare in detail poliovirus 2Apro with other viral proteins (from picornaviruses and unrelated families) as regard to their activity on key host factors that control gene expression. It is possible that future analyses to determine the cellular proteins targeted by 2Apro will uncover other cellular functions ablated by poliovirus infection. Further understanding of the cellular proteins hydrolyzed by 2Apro will add further insight into the molecular mechanism by which poliovirus and other viruses interact with the host cell. PMID:21541224

  11. IS195, an Insertion Sequence-Like Element Associated with Protease Genes in Porphyromonas gingivalis

    PubMed Central

    Lewis, Janina P.; Macrina, Francis L.

    1998-01-01

    Porphyromonas gingivalis is recognized as an important etiologic agent in adult and early-onset periodontal disease. Proteases produced by this organism contribute to its virulence in mice. Protease-encoding genes have been shown to contain multiple copies of repeated nucleotide sequences. These conserved sequences have also been found in hemagglutinin genes. In the process of studying the genetic loci containing the conserved repeated sequences, we have characterized a prtP gene homolog from P. gingivalis W83 encoding a cysteine protease with Lys-X specificity. However, this prtP gene was interrupted by an insertion sequence-like element which we designated IS195. Furthermore, IS195 and another element, IS1126, were present downstream of prtP gene homologs (kgp) found in P. gingivalis H66 and 381. IS195, a 1,068-bp insertion sequence-like element, contained 11-bp inverted repeats at its termini and was bordered by 9-bp direct repeats presumed to be a transposition-mediated target site duplication. Its central region contained one large open reading frame encoding a predicted 300-amino-acid protein which appeared to be a transposase. We isolated two naturally occurring variants of P. gingivalis W83, one carrying IS195 within the coding region of the prtP gene and another containing an intact prtP gene. Biochemical characterization revealed a lack of trypsin-like Lys-X specific proteolytic activity in the P. gingivalis W83 variant carrying the disrupted prtP gene. Studies using a mouse model revealed a reduction of virulence resulting from insertion of IS195 into the coding region of the prtP gene. An allelic-exchange mutant defective in the prtP gene also was constructed and tested in vivo. It displayed intermediate virulence compared to that of the wild-type and prtP::IS195 mutant strains. We conclude that the Lys-X cysteine protease contributes to virulence in soft tissue infections. PMID:9632563

  12. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.

    PubMed

    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard

    2004-05-04

    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  13. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  14. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  15. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  16. STUDIES ON THE ACTIVATION OF SERUM PROTEASE BY AN ANTIGEN-ANTIBODY SYSTEM

    PubMed Central

    Jemski, Joseph V.; Flick, John A.; Stinebring, Warren R.

    1953-01-01

    The results obtained in this study indicate that serum protease is not activated by either a rabbit or guinea pig antiovalbumin-ovalbumin system, in vitro. A precipitin reaction occurring in the presence of a serum protease precursor of three species (human, rabbit, and guinea pig) failed to activate the protease precursor. Furthermore, particulate material as preformed precipitates could not be shown to activate the protease of either human or rabbit serum or their euglobulin fractions. The material presented seems to be further evidence against the postulated role of serum protease in immunologic systems. PMID:13052811

  17. The threonine protease activity of testes-specific protease 50 (TSP50) is essential for its function in cell proliferation.

    PubMed

    Li, Yu-Yin; Bao, Yong-Li; Song, Zhen-Bo; Sun, Lu-Guo; Wu, Ping; Zhang, Yu; Fan, Cong; Huang, Yan-Xin; Wu, Yin; Yu, Chun-Lei; Sun, Ying; Zheng, Li-Hua; Wang, Guan-Nan; Li, Yu-Xin

    2012-01-01

    Testes-specific protease 50 (TSP50), a newly discovered threonine enzyme, has similar amino acid sequences and enzymatic structures to those of many serine proteases. It may be an oncogene. TSP50 is up-regulated in breast cancer epithelial cells, and ectopic expression of TSP50 in TSP50-deficient Chinese hamster ovary (CHO) cells has been found to promote cell proliferation. However, the mechanisms by which TSP50 exerts its growth-promoting effects are not yet fully understood. To delineate whether the threonine protease activity of TSP50 is essential to its function in cell proliferation, we constructed and characterized a mutant TSP50, called TSP50 T310A, which was identified as a protease-dead mutant of TSP50. By a series of proliferation analyses, colony formation assays and apoptosis analyses, we showed that T310A mutation significantly depresses TSP50-induced cell proliferation in vitro. Next, the CHO stable cell line expressing either wild-type or T310A mutant TSP50 was injected subcutaneously into nude mice. We found that the T310A mutation could abolish the tumorigenicity of TSP50 in vivo. A mechanism investigation revealed that the T310A mutation prevented interaction between TSP50 and the NF-κBIκBα complex, which is necessary for TSP50 to perform its function in cell proliferation. Our data highlight the importance of threonine 310, the most critical protease catalytic site in TSP50, to TSP50-induced cell proliferation and tumor formation.

  18. Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

    PubMed Central

    Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2015-01-01

    Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

  19. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  20. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  1. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  2. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  3. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  4. Development of marine biotechnology as a resource for novel proteases and their role in modern biotechnology.

    PubMed

    Homaei, Ahmad; Lavajoo, Fatemeh; Sariri, Reyhaneh

    2016-07-01

    Marine environment consists of the largest sources diversified genetic pool of material with an enormous potential for a wide variety of enzymes including proteases. A protease hydrolyzes the peptide bond and most of proteases possess many industrial applications. Marine proteases differ considerably from those found in internal or external organs of invertebrates and vertebrates. In common with all enzymes, external factors such as temperature, pH and type of media are important for the activity, catalytic efficiency, stability and proper functioning of proteases. In this review valuable characteristics of proteases in marine organisms and their applications are gathered from a wide literature survey. Considering their biochemical significance and their increasing importance in biotechnology, a thorough understanding of marine proteases functioning could be of prime importance. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Redefining the concept of protease-activated receptors: cathepsin S evokes itch via activation of Mrgprs

    PubMed Central

    Reddy, Vemuri B.; Sun, Shuohao; Azimi, Ehsan; Elmariah, Sarina B.; Dong, Xinzhong; Lerner, Ethan A.

    2015-01-01

    Sensory neurons expressing Mas-related G protein coupled receptors (Mrgprs) mediate histamine-independent itch. We show that the cysteine protease cathepsin S activates MrgprC11 and evokes receptor-dependent scratching in mice. In contrast to its activation of conventional protease-activated receptors, cathepsin S mediated activation of MrgprC11 did not involve the generation of a tethered ligand. We demonstrate further that different cysteine proteases selectively activate specific mouse and human Mrgpr family members. This expansion of our understanding by which proteases interact with GPCRs redefines the concept of what constitutes a protease-activated receptor. The findings also implicate proteases as ligands to members of this orphan receptor family while providing new insights into how cysteine proteases contribute to itch. PMID:26216096

  6. Production of plant proteases in vivo and in vitro--a review.

    PubMed

    González-Rábade, Nuria; Badillo-Corona, Jesús Agustín; Aranda-Barradas, Juan Silvestre; Oliver-Salvador, María Del Carmen

    2011-01-01

    In the latest two decades, the interest received by plant proteases has increased significantly. Plant enzymes such as proteases are widely used in medicine and the food industry. Some proteases, like papain, bromelain and ficin are used in various processes such as brewing, meat softening, milk-clotting, cancer treatment, digestion and viral disorders. These enzymes can be obtained from their natural source or through in vitro cultures, in order to ensure a continuous source of plant enzymes. The focus of this review will be the production of plant proteases both in vivo and in vitro, with particular emphasis on the different types of commercially important plant proteases that have been isolated and characterized from naturally grown plants. In vitro approaches for the production of these proteases is also explored, focusing on the techniques that do not involve genetic transformation of the plants and the attempts that have been made in order to enhance the yield of the desired proteases.

  7. Cysteine protease cathepsins and matrix metalloproteinases in the development of abdominal aortic aneurysms

    PubMed Central

    Qin, Yanwen; Cao, Xu; Yang, Yaoguo; Shi, Guo-Ping

    2013-01-01

    Both cysteine protease cathepsins and matrix metalloproteinases are implicated in the pathogenesis of abdominal aortic aneurysms (AAAs) in humans and animals. Blood and aortic tissues from humans or animals with AAAs contain much higher levels of these proteases, and often lower levels of their endogenous inhibitors, than do blood and aortic tissues from healthy subjects. Protease- and protease inhibitor-deficient mice and synthetic protease inhibitors have affirmed that cysteinyl cathepsins and matrix metalloproteinases both participate directly in AAA development in several experimental model systems. Here, we summarize our current understanding of how proteases contribute to the pathogenesis of AAA, and discuss whether proteases or their inhibitors may serve as diagnostic biomarkers or potential therapeutic targets for this common human arterial disease. PMID:23259477

  8. Robust substrate profiling method reveals striking differences in specificities of serum and lung fluid proteases.

    PubMed

    Watson, Douglas S; Jambunathan, Kalyani; Askew, David S; Kodukula, Krishna; Galande, Amit K

    2011-08-01

    Proteases are candidate biomarkers and therapeutic targets for many diseases. Sensitive and robust techniques are needed to quantify proteolytic activities within the complex biological milieu. We hypothesized that a combinatorial protease substrate library could be used effectively to identify similarities and differences between serum and bronchoalveolar lavage fluid (BALF), two body fluids that are clinically important for developing targeted therapies and diagnostics. We used a concise library of fluorogenic probes to map the protease substrate specificities of serum and BALF from guinea pigs. Differences in the proteolytic fingerprints of the two fluids were striking: serum proteases cleaved substrates containing cationic residues and proline, whereas BALF proteases cleaved substrates containing aliphatic and aromatic residues. Notably, cleavage of proline-containing substrates dominated all other protease activities in both human and guinea pig serum. This substrate profiling approach provides a foundation for quantitative comparisons of protease specificities between complex biological samples.

  9. Studies of membrane topology of mitochondrial cholesterol hydroxylases CYPs 27A1 and 11A1

    PubMed Central

    Mast, Natalia; Liao, Wei-Li; Turko, Illarion V.

    2010-01-01

    Mitochondrial cytochrome P450 enzymes (CYP or P450, EC 1.14.13.15) play an important role in metabolism of cholesterol. CYP27A1 hydroxylates cholesterol at position 27 and, thus, initiates cholesterol removal from many extrahepatic tissues. CYP11A1 is a steroidogenic P450 that converts cholesterol to pregnenolone, the first step in the biosynthesis of all steroid hormones. We utilized a new approach to study membrane topology of CYPs 27A1 and 11A1. This approach involves heterologous expression of membrane-bound P450 in E. coli, isolation of the P450-containing E. coli membranes, treatment of the membranes with protease, removal of the digested soluble portion and extraction of the membrane-associated peptides, which are then identified by mass spectrometry. By using this approach, we found four membrane-interacting peptides in CYP27A1, and two peptides in CYP11A1. Peptides in CYP27A1 represent a contiguous portion of the polypeptide chain (residues 210-251) corresponding to the putative F-G loop and adjacent portions of the F and G helices. Peptides in CYP11A1 are from the putative F-G loop (residues 218-225) and the C-terminal portion of the G helix (residues 238-250). This data is consistent with those obtained previously by us and others and provide new information about membrane topology of CYPs 27A1 and 11A1. PMID:18791760

  10. A1C test

    MedlinePlus

    HbA1C test; Glycated hemoglobin test; Glycohemoglobin test; Hemoglobin A1C; Diabetes - A1C; Diabetic - A1C ... gov/pubmed/26696680 . Chernecky CC, Berger BJ. Glycosylated hemoglobin (GHb, glycohemoglobin, glycated hemoglobin, HbA1a, HbA1b, HbA1c - blood. ...

  11. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  12. Cold Denaturation of the HIV-1 Protease Monomer.

    PubMed

    Rösner, Heike I; Caldarini, Martina; Prestel, Andreas; Vanoni, Maria A; Broglia, Ricardo A; Aliverti, Alessandro; Tiana, Guido; Kragelund, Birthe B

    2017-02-28

    The human immunodeficiency virus-1 (HIV-1) protease is a complex protein that in its active form adopts a homodimer dominated by β-sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1 protease that is populated above 0 °C and therefore directly accessible to various spectroscopic approaches. Using nuclear magnetic resonance secondary chemical shifts, temperature coefficients, and protein dynamics, we suggest that the cold-denatured state populates a compact wet globule containing transient non-native-like α-helical elements. From the linearity of the temperature coefficients and the hydrodynamic radii, we propose that the overall architecture of the cold-denatured state is maintained over the temperature range studied.

  13. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  14. Intestinal proteases of free-living and parasitic astigmatid mites.

    PubMed

    Holt, Deborah C; Burgess, Stewart T G; Reynolds, Simone L; Mahmood, Wajahat; Fischer, Katja

    2013-02-01

    Among arthropod pests, mites are responsible for considerable damage to crops, humans and other animals. However, detailed physiological data on these organisms remain sparse, mainly because of their small size but possibly also because of their extreme diversity. Focusing on intestinal proteases, we draw together information from three distinct mite species that all feed on skin but have separately adapted to a free-living, a strictly ecto-parasitic and a parasitic lifestyle. A wide range of studies involving immunohistology, molecular biology, X-ray crystallography and enzyme biochemistry of mite gut proteases suggests that these creatures have diverged considerably as house dust mites, sheep scab mites and scabies mites. Each species has evolved a particular variation of a presumably ancestral repertoire of digestive enzymes that have become specifically adapted to their individual environmental requirements.

  15. Sustainable enzymatic preparation of polyaspartate using a bacterial protease.

    PubMed

    Soeda, Yasuyuki; Toshima, Kazunobu; Matsumura, Shuichi

    2003-01-01

    Diethyl l-aspartate was polymerized by a bacterial protease from Bacillus subtilis (BS) in organic solvent at a temperature between 30 and 50 degrees C to yield alpha-linked poly(ethyl l-aspartate) having an M(w) of up to 3700 and a maximum polymer yield of 85%. The best polymerization conditions were the 40 degrees C polymerization of diethyl l-aspartate using 30% protease BS containing 4.5 vol % water in acetonitrile for 2 days. Poly(ethyl l-aspartate) was readily depolymerized by the enzyme into the oligomeric and monomeric l-aspartate in aqueous acetonitrile. Poly(sodium aspartate) prepared by the saponification of poly(ethyl l-aspartate) was readily biodegradable by activated sludge obtained from the municipal sewage treatment plant. Also, poly(sodium aspartate) was depolymerized by the hydrolase enzyme into the monomeric aspartate. These results may indicate the sustainable chemical recycling and biorecycling of this polymer.

  16. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  17. Some properties of the protease from Aspergillus terricola.

    PubMed

    Zaikina, N A; Shataeva, L K; Elinov, N P; Samsonov, G V

    1975-11-21

    The protease from Aspergillus terricola (terrilytin) was isolated and purified by the ion exchange method and by gel chromatography. The data on its molecular weight, isoelectric point, N-terminal amino acids were described. The protease included polysaccharide which stabilized the enzyme activity under the storage and lyophylization. Polysaccharides isolated from different fungi and yeasts were found to stabilize and activate terrilytin rising the affinity of enzyme to substrate. Terrilytin was revealed to exhibit the thrombolytic effect and expressive affinity to the fibrin in comparison with other substrates of high and low molecular weight. The enzyme showed the antigenic activity. From immune rabbit sera 7S gamma-globulins inhibiting proteolysis of caseine and 19S gamma-globulins activating the proteolysis of fibrin and fibrinogen by terrilytin were isolated by gel chromatography.

  18. Keratinolytic protease: a green biocatalyst for leather industry.

    PubMed

    Fang, Zhen; Yong, Yang-Chun; Zhang, Juan; Du, Guocheng; Chen, Jian

    2017-09-18

    Depilation/unhairing is the crucial but heavy pollution process in leather industry. Traditional inorganic sulfide treatment was the most widely used depilation technique in the past decades, which was usually detrimental to leather quality and resulted in serious environmental pollution. Using biocatalysts to substitute inorganic sulfide showed great advantages in environment protection and unhairing efficiency. Keratinolytic protease is one of the excellent biocatalysts to hydrolyze disulfide bond-rich proteins of hair and has little damage to leather. Biological treatment with keratinolytic proteases could largely reduce the quantity and toxicity of wastewater effluent from the leather industry. But low thermostability and substrate specificity or specific activity of these enzymes limited their practical application. Therefore, recent progresses on protein engineering strategies (site-directed mutagenesis, protein fusion, N/C-terminus truncation, and domain swapping) used to enhance the keratinolytic enzyme performance were presented.

  19. Bacterial proteases: production, isolation and utilization in animal nutrition.

    PubMed

    Michalík, I; Szabová, E; Poláková, A; Urminská, D

    1997-01-01

    Under conditions of submerged fermentation of Bacillus licheniformis strain L-3 in 15-L MBR-Schulzer bioreactor, the maximum production of proteolytic enzymes was achieved in the nutrient medium which contained 1% milk powder, 0.3% yeast autolysate, 0.5% corn starch and malt (20 ml per 100 ml of the medium). The preparation obtained of extracellular alkaline bacterial Ser-protease of the subtilisin type is characterized by optimum pH 9.8-10.2 good up to a temperature stability (65 degrees C) and has molecular weight cca of 26 kDa. The use of chemical mutagens (HNO2, 5-bromouracil) has enabled to select new strains (L-3N and L-3U) whose protease activity is 1.8-2.2 times higher as compared to the original Bacillus licheniformis strain L-3. The addition of these enzymes to the fodder has a positive effect on the retention of nitrogen substances.

  20. Acquisition of accurate data from intramolecular quenched fluorescence protease assays.

    PubMed

    Arachea, Buenafe T; Wiener, Michael C

    2017-04-01

    The Intramolecular Quenched Fluorescence (IQF) protease assay utilizes peptide substrates containing donor-quencher pairs that flank the scissile bond. Following protease cleavage, the dequenched donor emission of the product is subsequently measured. Inspection of the IQF literature indicates that rigorous treatment of systematic errors in observed fluorescence arising from inner-filter absorbance (IF) and non-specific intermolecular quenching (NSQ) is incompletely performed. As substrate and product concentrations vary during the time-course of enzyme activity, iterative solution of the kinetic rate equations is, generally, required to obtain the proper time-dependent correction to the initial velocity fluorescence data. Here, we demonstrate that, if the IQF assay is performed under conditions where IF and NSQ are approximately constant during the measurement of initial velocity for a given initial substrate concentration, then a simple correction as a function of initial substrate concentration can be derived and utilized to obtain accurate initial velocity data for analysis.

  1. A fungal protease allergen provokes airway hyperresponsiveness in asthma

    PubMed Central

    Balenga, Nariman A.; Klichinsky, Michael; Xie, Zhihui; Chan, Eunice C.; Zhao, Ming; Jude, Joseph; Laviolette, Michel; Panettieri, Reynold A.; Druey, Kirk M.

    2015-01-01

    Asthma, a common disorder that affects more than 250 million people worldwide, is defined by exaggerated bronchoconstriction to inflammatory mediators including acetylcholine, bradykinin, and histamine—also termed airway hyper-responsiveness Nearly 10% of people with asthma have severe, treatment-resistant disease, which is frequently associated with IgE sensitization to ubiquitous fungi, typically Aspergillus fumigatus. Here we show that a major Aspergillus fumigatus allergen, Asp f13, which is a serine protease, alkaline protease 1 (Alp 1), promotes airway hyper-responsiveness by infiltrating the bronchial submucosa and disrupting airway smooth muscle cell-extracellular matrix interactions. Alp 1-mediated extracellular matrix degradation evokes pathophysiological RhoA-dependent Ca2+ sensitivity and bronchoconstriction. These findings support a pathogenic mechanism in asthma and other lung diseases associated with epithelial barrier impairment, whereby airway smooth muscle cells respond directly to inhaled environmental allergens to generate airway hyper-responsiveness. PMID:25865874

  2. Quantum study of HIV-1 protease-bridge water interaction

    NASA Astrophysics Data System (ADS)

    Duan, Li L.; Tong, Yan; Mei, Ye; Zhang, Qing G.; Zhang, John Z. H.

    2007-10-01

    We present a fully quantum mechanical calculation for binding interaction between HIV-1 protease (PR) and the water molecule W301 which bridges the flaps of the protease with the inhibitors of PR. The quantum calculation is made possible by applying a recently developed molecular fractionation with conjugate caps (MFCC) method which divides a protein molecule into capped amino acid-based fragments and their conjugate caps. These individual fragments are properly treated to preserve the chemical property of bonds that are cut. Ab initio methods at HF, B3LYP, and MP2 levels with a fixed basis set 6-31+G* have been employed in the present calculation. The MFCC calculation produces a quantum mechanical interaction "map" representing interactions between individual residues of PR and W301. This enables a detailed quantitative analysis on binding of W301 to specific residues of PR at quantum mechanical level.

  3. Self-cleavable chemiluminescent probes suitable for protease sensing.

    PubMed

    Richard, Jean-Alexandre; Jean, Ludovic; Schenkels, Caroline; Massonneau, Marc; Romieu, Anthony; Renard, Pierre-Yves

    2009-07-21

    A new generation of dioxetane-based chemiluminescent substrates suitable for detecting protease activities is described. Our strategy involves the use of a self-cleavable spacer as the key molecular component of these protease-sensitive chemiluminescent probes. Among the assayed strategies, the PABA (para-aminobenzylic alcohol) linker associated with an ether linkage enables the release of the light-emitting phenolic 1,2-dioxetane moiety through an enzyme-initiated domino reaction. To validate this strategy, two proteolytic enzymes were chosen: penicillin amidase and caspase-3, and the corresponding self-cleavable chemiluminescent substrates were synthesised. Their evaluation using an in vitro assay has enabled us to prove the decomposition of the linker under physiological conditions and the selectivity for the targeted enzyme.

  4. Protease Substrate Profiling by N-Terminal COFRADIC.

    PubMed

    Staes, An; Van Damme, Petra; Timmerman, Evy; Ruttens, Bart; Stes, Elisabeth; Gevaert, Kris; Impens, Francis

    2017-01-01

    Detection of (neo-)N-terminal peptides is essential for identifying protease cleavage sites . We here present an update of a well-established and efficient selection method for enriching N-terminal peptides out of peptide mixtures: N-terminal COFRADIC (COmbined FRActional DIagonal Chromatography). This method is based on the old concept of diagonal chromatography, which involves a peptide modification step in between otherwise identical chromatographic separations, with this modification step finally allowing for the isolation of N-terminal peptides by longer retention of non-N-terminal peptides on the resin. N-terminal COFRADIC has been successfully applied in many protease-centric studies, as well as for studies on protein alpha-N-acetylation and on characterizing alternative translation initiation events.

  5. A high molecular weight protease in liver cytosol.

    PubMed

    Rose, I A; Warms, J V; Hershko, A

    1979-09-10

    A high molecular weight (greater than 400,000) protease active with [3H]leucine-labeled globin has been found in the postmicrosomal fraction of mouse kidney, brain, heart, spleen, and tumor cells and is most active in liver. The presence in liver was unexpected because liver cytosol is very ineffective in the breakdown of endogenous, labeled proteins. The enzyme has a number of properties that distinguish it from known cathepsins in addition to its high molecular weight. It is most active at pH approximately 7.5. When purified, it is unstable above 20 degrees C and is stabilized by metal chelating agents such as citrate, creatine-P, and glycerate-3-P. It is an -SH protease, but its thermal instability is not affected by 1 mM dithiothreitol. The enzyme is not lysosomal.

  6. Botulinum neurotoxin A protease: discovery of natural product exosite inhibitors.

    PubMed

    Silhár, Peter; Capková, Katerina; Salzameda, Nicholas T; Barbieri, Joseph T; Hixon, Mark S; Janda, Kim D

    2010-03-10

    A new mechanistic class of BoNT/A zinc metalloprotease inhibitors, from Echinacea, exemplified by the natural product d-chicoric acid (I1) is disclosed. A detailed evaluation of chicoric acid's mechanism of inhibition reveals that the inhibitor binds to an exosite, displays noncompetitive partial inhibition, and is synergistic with a competitive active site inhibitor when used in combination. Other components found in Echinacea, I3 and I4, were also inhibitors of the protease.

  7. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  8. Macrophage endosomes contain proteases which degrade endocytosed protein ligands.

    PubMed

    Diment, S; Stahl, P

    1985-12-05

    Rabbit alveolar macrophages rapidly internalize and degrade mannosylated bovine serum albumin (125I-mannose-BSA). Trichloroacetic acid-soluble degradation products appear in the cells as early as 6 min after uptake at 37 degrees C, and in the extracellular medium after 10 min. Incubation of endocytic vesicles containing this ligand in isotonic buffers at pH 7.4 + ATP resulted in intravesicular proteolysis, which was inhibited by monensin, nigericin, or ammonium chloride. At pH 5.0, degradation proceeded rapidly and was abolished by lysis of the vesicles with 0.1% Triton X-100. Readdition of lysosomes to the incubation mixture did not increase the rate of prelysosomal degradation. Proteolysis of 125I-mannose-BSA was optimal at pH 4.5, and inhibited by low concentrations of the cathepsin D inhibitor pepstatin A. After subcellular fractionation of the macrophages on Percoll gradients, 125I-mannose-BSA sedimented with prelysosomal vesicles and was not transported to secondary lysosomes. Addition of pepstatin A to extracellular medium during internalization of prebound 125I-mannose-BSA partially inhibited degradation of ligand, and resulted in transfer of undegraded 125I-mannose-BSA to lysosomes after 20 min. Using 125I-bovine serum albumin as a substrate for the protease in the presence of 0.1% Triton X-100, we have shown that as much as 36% of the total pepstatin A-sensitive activity sediments with nonlysosomal membranes. After intraendosomal iodination using lactoperoxidase, a labeled protease was isolated by affinity chromatography on pepstatin-agarose. The labeled protease, which had a subunit size of 46 kDa, was detected in endocytic vesicles after 5 min of internalization. These results suggest that a cathepsin D-like protease is responsible for the degradation of 125I-mannose-BSA in macrophages, and that this ligand is degraded in a prelysosomal vesicle.

  9. ENaC regulation by proteases and shear stress

    PubMed Central

    Shi, Shujie; Carattino, Marcelo D.; Hughey, Rebecca P.; Kleyman, Thomas R.

    2013-01-01

    Epithelial Na+ channels (ENaCs) are comprised of subunits that have large extracellular regions linked to membrane spanning domains where the channel pore and gate reside. A variety of external factors modify channel activity by interacting at sites within extracellular regions that lead to conformational changes that are transmitted to the channel gate and alter channel open probability. Our review addresses two external factors that have important roles in regulating channel activity, proteases and laminar shear stress. PMID:23547932

  10. Epsilon substituted lysinol derivatives as HIV-1 protease inhibitors.

    PubMed

    Jones, Kristen L G; Holloway, M Katharine; Su, Hua-Poo; Carroll, Steven S; Burlein, Christine; Touch, Sinoeun; DiStefano, Daniel J; Sanchez, Rosa I; Williams, Theresa M; Vacca, Joseph P; Coburn, Craig A

    2010-07-15

    A series of HIV-1 protease inhibitors containing an epsilon substituted lysinol backbone was synthesized. Two novel synthetic routes using N-boc-L-glutamic acid alpha-benzyl ester and 2,6-diaminopimelic acid were developed. Incorporation of this epsilon substituent enabled access to the S2 pocket of the enzyme, affording high potency inhibitors. Modeling studies and synthetic efforts suggest the potency increase is due to both conformational bias and van der Waals interactions with the S2 pocket.

  11. Cryogenic changes in proteases and antiprotease activities of buffalo (Bubalus bubalis) and cattle (Bos taurus) semen.

    PubMed

    Gurupriya, Vijayasaraswathy S; Divyashree, Bannur C; Roy, Sudhir C

    2014-02-01

    The postthaw motility and fertility of buffalo and cattle semen is reduced when they are cryopreserved for artificial insemination. In the present study, an attempt was made to characterize the cryogenic changes in proteases and antiprotease activities (APA) of buffalo and cattle semen because these proteolysis regulators have been reported to be associated with sperm motility and fertility. Buffalo sperm demonstrated at least two major proteases of 45 and 42 kDa and three minor proteases of 95, 52, and 33 kDa. Similarly, cattle sperm demonstrated three major proteases of 62, 45, and 42 kDa and two minor proteases of 85 and 78 kDa. Buffalo seminal plasma demonstrated at least three major proteases of 78, 68, and 62 kDa and one minor protease of 98 kDa and cattle seminal plasma demonstrated one major protease of 68 kDa and two minor proteases of 78 and 75 kDa. Except for the 45 kDa protease, most of the previously mentioned proteases were found to be metalloproteinases. Compared with fresh sperm, cryopreserved buffalo and cattle sperm demonstrated a major protease band of 52/49 kDa and the activity of this protease reduced progressively with the duration of cryopreservation. On the contrary, compared with the fresh seminal plasma, cryopreserved buffalo and cattle semen extenders displayed the presence of a new protease band of 45 kDa and demonstrated that this protease activity was leaked from buffalo and cattle cryopreserved spermatozoa. Buffalo and cattle seminal plasmas displayed at least two major APA of 86 and 26 kDa. Compared with buffalo, cattle seminal plasma demonstrated significantly greater APA. Thus, the present study demonstrated the presence of an array of proteases and APA in buffalo and cattle semen and the activities of which changed during cryopreservation. The leakage of the specific protease activity and changes in the proteases and APA might be attributed to reduced motility and fertility of cryopreserved semen in these species. Copyright

  12. Boosted protease inhibitors and the electrocardiographic measures of QT and PR durations

    PubMed Central

    Soliman, Elsayed Z.; Lundgren, Jens D.; Roediger, Mollie P.; Duprez, Daniel A.; Temesgen, Zelalem; Bickel, Markus; Shlay, Judith C.; Somboonwit, Charurut; Reiss, Peter; Stein, James H.; Neaton, James D.

    2011-01-01

    Background There are contradictory reports regarding the effects of protease inhibitors on the ECG measures of QT and PR interval durations. The effect of interrupting use of protease inhibitors on QT and PR progression is also unknown. Methods This analysis included 3719 participants from the Strategies for Management of Antiretroviral Therapy (SMART) study, of whom 1879 were randomized to receive intermittent antiretroviral therapy (ART) (drug conservation group), whereas the rest received these drugs continuously (viral suppression group). Linear regression analysis was used to compare four ritonavir-boosted protease inhibitor (protease inhibitor/r) regimens [saquinavir (SQV/r), lopinavir (LPV/r), atazanavir (ATV/r), and other protease inhibitor/r], and nonboosted protease inhibitor regimens with nonnucleoside reverse transcriptase inhibitor (NNRTI) regimens for Bazett’s (QTcB) and Fredericia’s (QTcF) heart rate corrected QT and PR. Changes in QTcB, QTcF, and PR after 12 and 24 months of randomization were compared in the drug conservation group and viral suppression group. Results Average levels of QTcB, QTcF, and PR duration at entry were 415, 406, and 158 ms. At study entry, 49% of participants were taking an NNRTI (no protease inhibitor)-based regimen and 31% were prescribed a boosted protease inhibitor, the most common being LPV/r. After adjustment for baseline factors, QTcB and QTcF levels did not vary by boosted protease inhibitor group (P = 0.26 and P = 0.34, respectively). For those given any of the boosted protease inhibitors, QTcB was 1.5 ms lower than the NNRTI group (P = 0.04). Both boosted and nonboosted protease inhibitor-containing regimens were significantly associated (P <0.01 for each) with longer PR intervals compared to the NNRTI group. After adjustment, the difference between boosted protease inhibitors and the NNRTI group was 5.11 ms (P <0.01); for nonboosted protease inhibitors, this difference was 3.00 ms (P <0.01). Following ART

  13. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  14. Conformational study of a putative HLTV-1 retroviral protease inhibitor.

    PubMed

    Llido, S; d'Estaintot, B L; Dautant, A; Geoffre, S; Picard, P; Precigoux, G

    1993-05-01

    The crystal structure of prolyl-glutaminyl-valyl-statyl-alanyl-leucine (Pro-Gln-Val-Sta-Ala-Leu, C(32)H(57)N(7)0(9).5H(2)0, M(r) = 683.9 + 90.1), a putative HTLV-1 protease inhibitor based on one of the consensus retroviral protease cleavage sequences, and containing the statine residue [(4S,3S)-4-amino-3-hydroxy-6-methylheptanoic acid], has been determined by X-ray diffraction. The same molecule has been modelled in the active site of the HTLV-1 protease and both conformations have been compared. The peptide crystallizes as a pentahydrate in space group P2(1) with a = 10.874(2), b = 9.501(2), c = 21.062(5) A, beta = 103.68 (1) degrees, Z = 2, V= 2114.3 A(3), D(x) = 1.21 g cm(-3), micro = 8.02 cm(-1), T= 293 K, lambda(Cu Kalpha) = 1.5418 A. The structure has been refined to an R value of 0.070 for 2152 observed reflections. The peptide main chain can be described as extended and adopts the usual zigzag conformation from the prolyl to the statyl residue. The main difference in conformation between the individual observed and modelled molecules is located on the Sta, Ala and Leu residues with the main chain of the modelled molecule rotated by about 180 degrees as compared to the observed conformation in the crystal state.

  15. [Extracellular proteases of mycelial fungi as participants of pathogenic processes].

    PubMed

    Dunaevskiĭ, Ia E; Matveeva, A R; Fatkhullina, G N; Beliakova, G A; Kolomiets, T M; Kovalenko, E D; Belozerskiĭ, M A

    2008-01-01

    The interest in proteases secreted by mycelial fungi is due to several reasons of which one of the most important is their involvement in the initiation and development of the pathogenic process. A comparison of saprophytic and phytopathogenic mycelial fungi revealed one characteristic feature, namely, the appearance of a new trypsin-like activity in phytopathogens that is absent in saprophytes. To clear up the question of whether the degree of pathogenicity of a fungus is related to the activity of secreted trypsin-like protease, several species of Fusarium of various pathogenicity were compared. In two species, F. sporotrichioides (which causes ear fusa-riosis of rye) and F. heterosporum (the causative agent of root rot in wheat), a clear correlation between the activity and pathogenicity was revealed: the more pathogenetic F. sporotrichioides exhibited a higher extracellular trypsin-like activity than the less pathogenetic species F. heterosporum. Thus, the presence of trypsin-like activity in a saprotroph-pathogen pair may be an indicator of the pathogenicity of a fungus; in some cases, the value of this activity may indicate the degree of its pathogenicity. This suggests that trypsin-like proteases specific to phytopathogens are directly involved in the pathogenetic process, probably, through interaction with the "sentry" protein or the product of the resistance gene.

  16. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  17. Pathogen-secreted proteases activate a novel plant immune pathway.

    PubMed

    Cheng, Zhenyu; Li, Jian-Feng; Niu, Yajie; Zhang, Xue-Cheng; Woody, Owen Z; Xiong, Yan; Djonović, Slavica; Millet, Yves; Bush, Jenifer; McConkey, Brendan J; Sheen, Jen; Ausubel, Frederick M

    2015-05-14

    Mitogen-activated protein kinase (MAPK) cascades play central roles in innate immune signalling networks in plants and animals. In plants, however, the molecular mechanisms of how signal perception is transduced to MAPK activation remain elusive. Here we report that pathogen-secreted proteases activate a previously unknown signalling pathway in Arabidopsis thaliana involving the Gα, Gβ, and Gγ subunits of heterotrimeric G-protein complexes, which function upstream of an MAPK cascade. In this pathway, receptor for activated C kinase 1 (RACK1) functions as a novel scaffold that binds to the Gβ subunit as well as to all three tiers of the MAPK cascade, thereby linking upstream G-protein signalling to downstream activation of an MAPK cascade. The protease-G-protein-RACK1-MAPK cascade modules identified in these studies are distinct from previously described plant immune signalling pathways such as that elicited by bacterial flagellin, in which G proteins function downstream of or in parallel to an MAPK cascade without the involvement of the RACK1 scaffolding protein. The discovery of the new protease-mediated immune signalling pathway described here was facilitated by the use of the broad host range, opportunistic bacterial pathogen Pseudomonas aeruginosa. The ability of P. aeruginosa to infect both plants and animals makes it an excellent model to identify novel immunoregulatory strategies that account for its niche adaptation to diverse host tissues and immune systems.

  18. Staphylococcus aureus Induces Increased Serine Protease Activity in Keratinocytes.

    PubMed

    Williams, Michael R; Nakatsuji, Teruaki; Sanford, James A; Vrbanac, Alison F; Gallo, Richard L

    2017-02-01

    Bacteria that reside on the skin can influence the behavior of the cutaneous immune system, but the mechanisms responsible for these effects are incompletely understood. Colonization of the skin by Staphylococcus aureus (S. aureus) is increased in atopic dermatitis and can result in increased severity of the disease. In this study, we show that S. aureus stimulates human keratinocytes to increase their endogenous protease activity, including specific increases in trypsin activity. This increased protease activity coincided with increased expression of mRNA for kallikreins (KLKs), with KLK6, 13, and 14 showing the greatest induction after exposure to S. aureus. Suppression of mRNA for these KLKs in keratinocytes by targeted small interfering RNA silencing before S. aureus exposure blocked the increase in protease activity. Keratinocytes exposed to S. aureus showed enhanced degradation of desmoglein-1 and filaggrin, whereas small interfering RNA for KLK6, KLK13, and KLK14 partially blocked this degradation. These data illustrate how S. aureus directly influences the skin barrier integrity by stimulating endogenous proteolytic activity and defines a previously unknown mechanism by which S. aureus may influence skin diseases. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Knots can impair protein degradation by ATP-dependent proteases.

    PubMed

    San Martín, Álvaro; Rodriguez-Aliaga, Piere; Molina, José Alejandro; Martin, Andreas; Bustamante, Carlos; Baez, Mauricio

    2017-09-12

    ATP-dependent proteases translocate proteins through a narrow pore for their controlled destruction. However, how a protein substrate containing a knotted topology affects this process remains unknown. Here, we characterized the effects of the trefoil-knotted protein MJ0366 from Methanocaldococcus jannaschii on the operation of the ClpXP protease from Escherichia coli ClpXP completely degrades MJ0366 when pulling from the C-terminal ssrA-tag. However, when a GFP moiety is appended to the N terminus of MJ0366, ClpXP releases intact GFP with a 47-residue tail. The extended length of this tail suggests that ClpXP tightens the trefoil knot against GFP, which prevents GFP unfolding. Interestingly, if the linker between the knot core of MJ0366 and GFP is longer than 36 residues, ClpXP tightens and translocates the knot before it reaches GFP, enabling the complete unfolding and degradation of the substrate. These observations suggest that a knot-induced stall during degradation of multidomain proteins by AAA proteases may constitute a novel mechanism to produce partially degraded products with potentially new functions.

  20. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  1. Enhanced Thermostability of a Fungal Alkaline Protease by Different Additives

    PubMed Central

    Nirmal, Nilesh P.; Laxman, R. Seeta

    2014-01-01

    A fungal strain (Conidiobolus brefeldianus MTCC 5184) isolated from plant detritus secreted a high activity alkaline protease. Thermostability studies of the fungal alkaline protease (FAP) revealed that the protease is stable up to 50°C with 40% residual activity after one hour. Effect of various additives such as sugars, sugar alcohols, polyols, and salts, on the thermostability of FAP was evaluated. Among the additives tested, glycerol, mannitol, xylitol, sorbitol, and trehalose were found to be very effective in increasing the stability of FAP, which was found to be concentration dependent. Fivefold increase in residual activity of FAP was observed in the presence of trehalose (50%) and sorbitol (50%) at 50°C for 4 h, compared to FAP without additive. Other additives like calcium at 20 mM and 10–15% ammonium sulphate showed lower stability improvement than trehalose and sorbitol. NaCl, MgCl2, K2HPO4, and glycine were found to be poor stabilizers and showed only a marginal improvement. PEG 6000 did not show any increase in stability but was found to be slightly inhibitory. PMID:25105022

  2. New roles for perforins and proteases in apicomplexan egress.

    PubMed

    Roiko, Marijo S; Carruthers, Vern B

    2009-10-01

    Egress is a pivotal step in the life cycle of intracellular pathogens initiating the transition from an expiring host cell to a fresh target cell. While much attention has been focused on understanding cell invasion by intracellular pathogens, recent work is providing a new appreciation of mechanisms and therapeutic potential of microbial egress. This review highlights recent insight into cell egress by apicomplexan parasites and emerging contributions of membranolytic and proteolytic secretory products, along with host proteases. New findings suggest that Toxoplasma gondii secretes a pore-forming protein, TgPLP1, during egress that facilitates parasite escape from the cell by perforating the parasitophorous membrane. Also, in a cascade of proteolytic events, Plasmodium falciparum late-stage schizonts activate and secrete a subtilisin, PfSUB1, which processes enigmatic putative proteases called serine-repeat antigens that contribute to merozoite egress. A new report also suggests that calcium-activated host proteases called calpains aid parasite exit, possibly by acting upon the host cytoskeleton. Together these discoveries reveal important new molecular players involved in the principal steps of egress by apicomplexans.

  3. Protease-activated receptors in kidney disease progression.

    PubMed

    Palygin, Oleg; Ilatovskaya, Daria V; Staruschenko, Alexander

    2016-12-01

    Protease-activated receptors (PARs) are members of a well-known family of transmembrane G protein-coupled receptors (GPCRs). Four PARs have been identified to date, of which PAR1 and PAR2 are the most abundant receptors, and have been shown to be expressed in the kidney vascular and tubular cells. PAR signaling is mediated by an N-terminus tethered ligand that can be unmasked by serine protease cleavage. The receptors are activated by endogenous serine proteases, such as thrombin (acts on PARs 1, 3, and 4) and trypsin (PAR2). PARs can be involved in glomerular, microvascular, and inflammatory regulation of renal function in both normal and pathological conditions. As an example, it was shown that human glomerular epithelial and mesangial cells express PARs, and these receptors are involved in the pathogenesis of crescentic glomerulonephritis, glomerular fibrin deposition, and macrophage infiltration. Activation of these receptors in the kidney also modulates renal hemodynamics and glomerular filtration rate. Clinical studies further demonstrated that the concentration of urinary thrombin is associated with glomerulonephritis and type 2 diabetic nephropathy; thus, molecular and functional mechanisms of PARs activation can be directly involved in renal disease progression. We briefly discuss here the recent literature related to activation of PAR signaling in glomeruli and the kidney in general and provide some examples of PAR1 signaling in glomeruli podocytes. Copyright © 2016 the American Physiological Society.

  4. Protease activity in cockroach and basidiomycete allergen extracts.

    PubMed

    Wongtim, S; Lehrer, S B; Salvaggio, J E; Horner, W E

    1993-01-01

    Inherent proteolytic activity was estimated in cockroach and basidiomycete extracts by quantifying acid soluble peptides that were released by incubating extracts with 1% bovine serum albumin as measured by Lowry (Sigma). Reference proteases released 740 (Proteinase K, 0.1 U), 248 (Trypsin, 1.0 U), and 533 micrograms/ml (Pronase, 0.5 U) of soluble peptides. American whole body cockroach extract (0.1 mg dry weight) released 330 micrograms/ml of soluble peptides, representing 13 trypsin equivalent units (TEU)/mg. Extracts from spores of the mushroom Pleurotus ostreatus released 230 micrograms/ml (0.9 TEU/mg) and Pleurotus cap extract released 112 micrograms/ml (0.5 TEU/mg). Mycelium of Pleurotus and the mushroom Psilocybe cubensis and spores of Psilocybe and the puffball Calvatia cyathiformis showed negligible amounts of proteolytic activity. The protease inhibitor phenylmethylsulfonyl flouride reduced the proteolytic activity of American whole body cockroach extract by 80% (@1 mM) and the inhibitor ethylene diaminetetraacetic acid inhibited the proteolytic activity of Pleurotus spores by 95% (@1 mM). Loss of allergen activity as determined by RAST inhibition and immunoprinting correlated with protease activity. Thus, in the preparation and handling of allergen extracts, one should employ conditions that minimize proteolysis.

  5. Transient heterogeneity in extracellular protease production by Bacillus subtilis.

    PubMed

    Veening, Jan-Willem; Igoshin, Oleg A; Eijlander, Robyn T; Nijland, Reindert; Hamoen, Leendert W; Kuipers, Oscar P

    2008-01-01

    The most sophisticated survival strategy Bacillus subtilis employs is the differentiation of a subpopulation of cells into highly resistant endospores. To examine the expression patterns of non-sporulating cells within heterogeneous populations, we used buoyant density centrifugation to separate vegetative cells from endospore-containing cells and compared the transcriptome profiles of both subpopulations. This demonstrated the differential expression of various regulons. Subsequent single-cell analyses using promoter-gfp fusions confirmed our microarray results. Surprisingly, only part of the vegetative subpopulation highly and transiently expresses genes encoding the extracellular proteases Bpr (bacillopeptidase) and AprE (subtilisin), both of which are under the control of the DegU transcriptional regulator. As these proteases and their degradation products freely diffuse within the liquid growth medium, all cells within the clonal population are expected to benefit from their activities, suggesting that B. subtilis employs cooperative or even altruistic behavior. To unravel the mechanisms by which protease production heterogeneity within the non-sporulating subpopulation is established, we performed a series of genetic experiments combined with mathematical modeling. Simulations with our model yield valuable insights into how population heterogeneity may arise by the relatively long and variable response times within the DegU autoactivating pathway.

  6. Transient heterogeneity in extracellular protease production by Bacillus subtilis

    PubMed Central

    Veening, Jan-Willem; Igoshin, Oleg A; Eijlander, Robyn T; Nijland, Reindert; Hamoen, Leendert W; Kuipers, Oscar P

    2008-01-01

    The most sophisticated survival strategy Bacillus subtilis employs is the differentiation of a subpopulation of cells into highly resistant endospores. To examine the expression patterns of non-sporulating cells within heterogeneous populations, we used buoyant density centrifugation to separate vegetative cells from endospore-containing cells and compared the transcriptome profiles of both subpopulations. This demonstrated the differential expression of various regulons. Subsequent single-cell analyses using promoter-gfp fusions confirmed our microarray results. Surprisingly, only part of the vegetative subpopulation highly and transiently expresses genes encoding the extracellular proteases Bpr (bacillopeptidase) and AprE (subtilisin), both of which are under the control of the DegU transcriptional regulator. As these proteases and their degradation products freely diffuse within the liquid growth medium, all cells within the clonal population are expected to benefit from their activities, suggesting that B. subtilis employs cooperative or even altruistic behavior. To unravel the mechanisms by which protease production heterogeneity within the non-sporulating subpopulation is established, we performed a series of genetic experiments combined with mathematical modeling. Simulations with our model yield valuable insights into how population heterogeneity may arise by the relatively long and variable response times within the DegU autoactivating pathway. PMID:18414485

  7. Luminal Cathepsin G and Protease-Activated Receptor 4

    PubMed Central

    Dabek, Marta; Ferrier, Laurent; Roka, Richard; Gecse, Krisztina; Annahazi, Anita; Moreau, Jacques; Escourrou, Jean; Cartier, Christel; Chaumaz, Gilles; Leveque, Mathilde; Ait-Belgnaoui, Afifa; Wittmann, Tibor; Theodorou, Vassilia; Bueno, Lionel

    2009-01-01

    Impairment of the colonic epithelial barrier and neutrophil infiltration are common features of inflammatory bowel disease. Luminal proteases affect colonic permeability through protease-activated receptors (PARs). We evaluated: (i) whether fecal supernatants from patients with ulcerative colitis (UC) trigger alterations of colonic paracellular permeability and inflammation, and (ii) the roles of cathepsin G (Cat-G), a neutrophil serine protease, and its selective receptor, PAR4, in these processes. Expression levels of both PAR4 and Cat-G were determined in colonic biopsies from UC and healthy subjects. The effects of UC fecal supernatants on colonic paracellular permeability were measured in murine colonic strips. Involvement of Cat-G and PAR4 was evaluated using pepducin P4pal-10 and specific Cat-G inhibitor (SCGI), respectively. In addition, the effect of PAR4-activating peptide was assessed. UC fecal supernatants, either untreated or pretreated with SCGI, were infused into mice, and myeloperoxidase activity was determined. PAR4 was found to be overexpressed in UC colonic biopsies. Increased colonic paracellular permeability that was triggered by UC fecal supernatants was blocked by both SCGI (77%) and P4pal-10 (85%). Intracolonic infusion of UC fecal supernatants into mice increased myeloperoxidase activity. This effect was abolished by SCGI. These observations support that both Cat-G and PAR4 play key roles in generating and/or amplifying relapses in UC and provide a rationale for the development of new therapeutic agents in the treatment of this disease. PMID:19528350

  8. Protease-triggered siRNA delivery vehicles.

    PubMed

    Rozema, David B; Blokhin, Andrei V; Wakefield, Darren H; Benson, Jonathan D; Carlson, Jeffrey C; Klein, Jason J; Almeida, Lauren J; Nicholas, Anthony L; Hamilton, Holly L; Chu, Qili; Hegge, Julia O; Wong, So C; Trubetskoy, Vladimir S; Hagen, Collin M; Kitas, Eric; Wolff, Jon A; Lewis, David L

    2015-07-10

    The safe and efficacious delivery of membrane impermeable therapeutics requires cytoplasmic access without the toxicity of nonspecific cytoplasmic membrane lysis. We have developed a mechanism for control of cytoplasmic release which utilizes endogenous proteases as a trigger and results in functional delivery of small interfering RNA (siRNA). The delivery approach is based on reversible inhibition of membrane disruptive polymers with protease-sensitive substrates. Proteolytic hydrolysis upon endocytosis restores the membrane destabilizing activity of the polymers thereby allowing cytoplasmic access of the co-delivered siRNA. Protease-sensitive polymer masking reagents derived from polyethylene glycol (PEG), which inhibit membrane interactions, and N-acetylgalactosamine, which targets asialoglycoprotein receptors on hepatocytes, were synthesized and used to formulate masked polymer-siRNA delivery vehicles. The size, charge and stability of the vehicles enable functional delivery of siRNA after subcutaneous administration and, with modification of the targeting ligand, have the potential for extrahepatic targeting. Copyright © 2015. Published by Elsevier B.V.

  9. Chloroplast Proteases: Updates on Proteolysis within and across Suborganellar Compartments.

    PubMed

    Nishimura, Kenji; Kato, Yusuke; Sakamoto, Wataru

    2016-08-01

    Chloroplasts originated from the endosymbiosis of ancestral cyanobacteria and maintain transcription and translation machineries for around 100 proteins. Most endosymbiont genes, however, have been transferred to the host nucleus, and the majority of the chloroplast proteome is composed of nucleus-encoded proteins that are biosynthesized in the cytosol and then imported into chloroplasts. How chloroplasts and the nucleus communicate to control the plastid proteome remains an important question. Protein-degrading machineries play key roles in chloroplast proteome biogenesis, remodeling, and maintenance. Research in the past few decades has revealed more than 20 chloroplast proteases, which are localized to specific suborganellar locations. In particular, two energy-dependent processive proteases of bacterial origin, Clp and FtsH, are central to protein homeostasis. Processing endopeptidases such as stromal processing peptidase and thylakoidal processing peptidase are involved in the maturation of precursor proteins imported into chloroplasts by cleaving off the amino-terminal transit peptides. Presequence peptidases and organellar oligopeptidase subsequently degrade the cleaved targeting peptides. Recent findings have indicated that not only intraplastidic but also extraplastidic processive protein-degrading systems participate in the regulation and quality control of protein translocation across the envelopes. In this review, we summarize current knowledge of the major chloroplast proteases in terms of type, suborganellar localization, and diversification. We present details of these degradation processes as case studies according to suborganellar compartment (envelope, stroma, and thylakoids). Key questions and future directions in this field are discussed. © 2016 American Society of Plant Biologists. All Rights Reserved.

  10. Detergent-compatible proteases: microbial production, properties, and stain removal analysis.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2015-01-01

    Proteases are one of the most important commercial enzymes used in various industrial domains such as detergent and leather industries. The alkaline proteases as well as other detergent-compatible enzymes such as lipases and amylases serve now as the key components in detergent formulations. They break down various stains during fabric washing. The search for detergent-compatible proteases with better properties is a continuous exercise. The current trend is to use detergent-compatible proteases that are stable over a wide temperature range. Although the proteases showing stability at elevated pH have the capacity to be used in detergent formulations, their usage can be significant if they are also stable and compatible with detergent and detergent ingredients, and also able to remove protein stains. Despite the existence of some reviews on alkaline proteases, there is no specification for the use of alkaline proteases as detergent additives. The present review describes the detergent-compatible proteases tested as detergent additives. An overview was provided for screening, optimization, purification, and properties of detergent compatible proteases, with an emphasis on the stability and compatibility of the alkaline proteases with the detergent and detergent compounds, as well as stain removal examination methods.

  11. Haloperidol-based irreversible inhibitors of the HIV-1 and HIV-2 proteases.

    PubMed