Science.gov

Sample records for a1 protease gene

  1. IgA1 proteases of Haemophilus influenzae: cloning and characterization in Escherichia coli K-12.

    PubMed Central

    Bricker, J; Mulks, M H; Plaut, A G; Moxon, E R; Wright, A

    1983-01-01

    Haemophilus influenzae is one of several bacterial pathogens known to release IgA1 proteases into the extracellular environment. Each H. influenzae isolate produces one of at least three distinct types of these enzymes that differ in the specific peptide bond they cleave in the hinge region of human IgA1. We have isolated the gene specifying type 1 IgA1 protease from a total genomic library of H. influenzae, subcloned it into plasmid vectors, and introduced these vectors into Escherichia coli K-12. The enzyme synthesized by E. coli was active and had the same specificity as that of the H. influenzae donor. Unlike that of the donor, E. coli protease activity accumulated in the periplasm rather than being transported extracellularly. The position of the protease gene in H. influenzae DNA and its direction of transcription was approximated by deletion mapping. Tn5 insertions, and examination of the polypeptides synthesized by minicells. A 1-kilobase probe excised from the IgA1 protease gene hybridized with DNA restriction fragments of all H. influenzae serogroups but not with DNA of a nonpathogenic H. parainfluenzae species known to be IgA1 protease negative. Images PMID:6341996

  2. Changes in expression of human serine protease HtrA1, HtrA2 and HtrA3 genes in benign and malignant thyroid tumors.

    PubMed

    Zurawa-Janicka, Dorota; Kobiela, Jarosław; Galczynska, Natalia; Stefaniak, Tomasz; Lipinska, Barbara; Lachinski, Andrzej; Skorko-Glonek, Joanna; Narkiewicz, Joanna; Proczko-Markuszewska, Monika; Sledzinski, Zbigniew

    2012-11-01

    Human HtrA proteins are serine proteases involved in essential physiological processes. HtrA1 and HtrA3 function as tumor suppressors and inhibitors of the TGF-β signaling pathway. HtrA2 regulates mitochondrial homeostasis and plays a pivotal role in the induction of apoptosis. The aim of the study was to determine whether the HtrA proteins are involved in thyroid carcinogenesis. We used the immunoblotting technique to estimate protein levels of HtrA1, HtrA2, long and short variants of HtrA3 (HtrA3-L and HtrA3-S) and TGF-β1 in tissues of benign and malignant thyroid lesions, and control groups. We found that the levels of HtrA2 and HtrA3-S were higher in thyroid malignant tumors compared to normal tissues and benign tumors. The HtrA3-L level was increased in malignant tumor tissues compared to benign tumor tissues and control tissues from patients with benign lesions, and elevated in normal tissues from patients with thyroid carcinoma compared to normal tissues from patients with benign lesions. We also compared levels of HtrA proteins in follicular thyroid carcinoma (FTC) and papillary thyroid carcinoma (PTC) and found that these types of carcinoma differed in the expression of HtrA3-S and HtrA1. These results indicate the implication of HtrA proteins in thyroid carcinogenesis suggest that HtrA3 variants may play different roles in cancer development, and that the increased HtrA3-L levels in thyroid tissue could be correlated with the development of malignant lesions. The TGF-β1 levels in tumor tissues were not significantly altered compared to control tissues.

  3. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage.

    PubMed

    Tchetina, Elena V; Markova, Galina A; Poole, A Robin; Zukor, David J; Antoniou, John; Makarov, Sergey A; Kuzin, Aleksandr N

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1-50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10-50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  4. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    PubMed Central

    Markova, Galina A.; Poole, A. Robin; Zukor, David J.; Antoniou, John; Makarov, Sergey A.; Kuzin, Aleksandr N.

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients. PMID:28042296

  5. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors

    PubMed Central

    2010-01-01

    Background The frequency of cyanobacterial blooms has increased worldwide, and these blooms have been claimed to be a major factor leading to the decline of the most important freshwater herbivores, i.e. representatives of the genus Daphnia. This suppression of Daphnia is partly attributed to the presence of biologically active secondary metabolites in cyanobacteria. Among these metabolites, protease inhibitors are found in almost every natural cyanobacterial bloom and have been shown to specifically inhibit Daphnia's digestive proteases in vitro, but to date no physiological responses of these serine proteases to cyanobacterial protease inhibitors in Daphnia have been reported in situ at the protein and genetic levels. Results Nine digestive proteases were detected in D. magna using activity-stained SDS-PAGE. Subsequent analyses by LC-MS/MS and database search led to the identification of respective protease genes. D. magna responded to dietary protease inhibitors by up-regulation of the expression of these respective proteases at the RNA-level and by the induction of new and less sensitive protease isoforms at the protein level. The up-regulation in response to dietary trypsin- and chymotrypsin-inhibitors ranged from 1.4-fold to 25.6-fold. These physiological responses of Daphnia, i.e. up-regulation of protease expression and the induction of isoforms, took place even after feeding on 20% cyanobacterial food for only 24 h. These physiological responses proved to be independent from microcystin effects. Conclusion Here for the first time it was shown in situ that a D. magna clone responds physiologically to dietary cyanobacterial protease inhibitors by phenotypic plasticity of the targets of these specific inhibitors, i.e. Daphnia gut proteases. These regulatory responses are adaptive for D. magna, as they increase the capacity for protein digestion in the presence of dietary protease inhibitors. The type and extent of these responses in protease expression might

  6. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  7. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  8. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  9. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  10. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  11. Genetic and biochemical analysis of gonococcal IgA1 protease: cloning in Escherichia coli and construction of mutants of gonococci that fail to produce the activity.

    PubMed Central

    Koomey, J M; Gill, R E; Falkow, S

    1982-01-01

    The biological significance of bacterial extracellular proteases that specifically cleave human IgA1 is unknown. We have prepared a gene bank of gonococcal chromosomal DNA in Escherichia coli K-12 using a cosmid cloning system. Among these clones, we have identified and characterized an E. coli strain that elaborates an extracellular endopeptidase that is indistinguishable from gonococcal IgA1 protease in its substrate specificity and action on human IgA1. Analysis of recombinant plasmids and examination of plasmid-specific peptides in minicells have shown that the IgA1 protease activity in E. coli is associated with expression of a Mr 140,000 peptide. We have isolated IgA1 protease-deficient mutants of Neisseria gonorrhoeae by reintroduction of physically defined deletions of the cloned gene into the gonococcal chromosome by transformation. Images PMID:6818556

  12. Purification and characterization of an immunoglobulin A1 protease from Bacteroides melaninogenicus.

    PubMed Central

    Mortensen, S B; Kilian, M

    1984-01-01

    Attention has recently been focused on bacterial proteases with the capacity to cleave immunoglobulin A (IgA proteases) as possible pathogenic factors in bacterial meningitis, gonorrhoea, and destructive periodontal disease. Here, we describe a method for the rapid purification of a specific IgA1 protease from Bacteroides melaninogenicus. The IgA1 protease was purified 6,172-fold with a yield of 9% by ammonium sulfate precipitation, DEAE-ion exchange chromatography, and separation on a preparative TSK-G 3000SWG high-pressure gel permeation chromatography column. The enzyme was specific for human IgA1 and cleaved a prolyl-seryl peptide bond in the hinge region of the alpha 1 chain between residues 223 and 224. The molecular weight of the enzyme was 62,000, the isoelectric point was 5.0, and the Km was 3.4 X 10(-6). The enzyme was active over a broad pH range and had maximal activity at pH 5.0. B. melaninogenicus IgA1 protease was classified as a thiol protease on the basis of its inhibition by traditional protease inhibitors and the fact that it was active only under reducing conditions. Images PMID:6147309

  13. Proteolysis of bacterial membrane proteins by Neisseria gonorrhoeae type 2 immunoglobulin A1 protease.

    PubMed Central

    Shoberg, R J; Mulks, M H

    1991-01-01

    The immunoglobulin A1 (IgA1) proteases of Neisseria gonorrhoeae have been defined as having human IgA1 as their single permissive substrate. However, in recent years there have been reports of other proteins which are susceptible to the proteolytic activity of these enzymes. To examine the possibility that gonococcal membrane proteins are potential substrates for these enzymes, isolated outer and cytoplasmic membranes of N. gonorrhoeae were treated in vitro with exogenous pure IgA1 protease. Analysis of silver-stained sodium dodecyl sulfate-polyacrylamide gels of outer membranes indicated that there were two outer membrane proteins of 78 and 68 kDa which were cleaved by IgA1 protease in vitro in GCM 740 (a wild-type strain) and in two isogenic IgA1 protease-negative variants. Similar results were observed with a second gonococcal strain, F62, and its isogenic IgA1 protease-negative derivative. When GCM 740 cytoplasmic membranes were treated with protease, three minor proteins of 24.5, 23.5, and 21.5 kDa were cleaved. In addition, when outer membranes of Escherichia coli DH1 were treated with IgA1 protease, several proteins were hydrolyzed. While the identities of all of these proteolyzed proteins are unknown, the data presented indicate that there are several proteins found in the isolated membranes of gram-negative bacteria which are permissive in vitro substrates for gonococcal IgA1 protease. Images PMID:1713195

  14. Serine protease HtrA1 accumulates in corneal transforming growth factor beta induced protein (TGFBIp) amyloid deposits

    PubMed Central

    Karring, Henrik; Poulsen, Ebbe Toftgaard; Runager, Kasper; Thøgersen, Ida B.; Klintworth, Gordon K.; Højrup, Peter

    2013-01-01

    Purpose Specific mutations in the transforming growth factor beta induced (TGFBI) gene are associated with lattice corneal dystrophy (LCD) type 1 and its variants. In this study, we performed an in-depth proteomic analysis of human corneal amyloid deposits associated with the heterozygous A546D mutation in TGFBI. Methods Corneal amyloid deposits and the surrounding corneal stroma were procured by laser capture microdissection from a patient with an A546D mutation in TGFBI. Proteins in the captured corneal samples and healthy corneal stroma were identified with liquid chromatography-tandem mass spectrometry and quantified by calculating exponentially modified Protein Abundance Index values. Mass spectrometry data were further compared for identifying enriched regions of transforming growth factor beta induced protein (TGFBIp/keratoepithelin/βig-h3) and detecting proteolytic cleavage sites in TGFBIp. Results A C-terminal fragment of TGFBIp containing residues Y571-R588 derived from the fourth fasciclin 1 domain (FAS1–4), serum amyloid P-component, apolipoprotein A-IV, clusterin, and serine protease HtrA1 were significantly enriched in the amyloid deposits compared to the healthy cornea. The proteolytic cleavage sites in TGFBIp from the diseased cornea are in accordance with the activity of serine protease HtrA1. We also identified small amounts of the serine protease kallikrein-14 in the amyloid deposits. Conclusions Corneal amyloid caused by the A546D mutation in TGFBI involves several proteins associated with other varieties of amyloidosis. The proteomic data suggest that the sequence 571-YHIGDEILVSGGIGALVR-588 contains the amyloid core of the FAS1–4 domain of TGFBIp and point at serine protease HtrA1 as the most likely candidate responsible for the proteolytic processing of amyloidogenic and aggregated TGFBIp, which explains the accumulation of HtrA1 in the amyloid deposits. With relevance to identifying serine proteases, we also found glia-derived nexin

  15. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  16. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    PubMed Central

    De Paolis, Francesca; Beghetto, Elisa; Spadoni, Andrea; Montagnani, Francesca; Felici, Franco; Oggioni, Marco R; Gargano, Nicola

    2007-01-01

    Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA) of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery. PMID:18088426

  17. The Multifaceted Poliovirus 2A Protease: Regulation of Gene Expression by Picornavirus Proteases

    PubMed Central

    Castelló, Alfredo; Álvarez, Enrique; Carrasco, Luis

    2011-01-01

    After entry into animal cells, most viruses hijack essential components involved in gene expression. This is the case of poliovirus, which abrogates cellular translation soon after virus internalization. Abrogation is achieved by cleavage of both eIF4GI and eIF4GII by the viral protease 2A. Apart from the interference of poliovirus with cellular protein synthesis, other gene expression steps such as RNA and protein trafficking between nucleus and cytoplasm are also altered. Poliovirus 2Apro is capable of hydrolyzing components of the nuclear pore, thus preventing an efficient antiviral response by the host cell. Here, we compare in detail poliovirus 2Apro with other viral proteins (from picornaviruses and unrelated families) as regard to their activity on key host factors that control gene expression. It is possible that future analyses to determine the cellular proteins targeted by 2Apro will uncover other cellular functions ablated by poliovirus infection. Further understanding of the cellular proteins hydrolyzed by 2Apro will add further insight into the molecular mechanism by which poliovirus and other viruses interact with the host cell. PMID:21541224

  18. Protoporphyrins Enhance Oligomerization and Enzymatic Activity of HtrA1 Serine Protease

    PubMed Central

    Jo, Hakryul; Patterson, Victoria; Stoessel, Sean; Kuan, Chia-Yi; Hoh, Josephine

    2014-01-01

    High temperature requirement protein A1 (HtrA1), a secreted serine protease of the HtrA family, is associated with a multitude of human diseases. However, the exact functions of HtrA1 in these diseases remain poorly understood. We seek to unravel the mechanisms of HtrA1 by elucidating its interactions with chemical or biological modulators. To this end, we screened a small molecule library of 500 bioactive compounds to identify those that alter the formation of extracellular HtrA1 complexes in the cell culture medium. An initial characterization of two novel hits from this screen showed that protoporphyrin IX (PPP-IX), a precursor in the heme biosynthetic pathway, and its metalloporphyrin (MPP) derivatives fostered the oligomerization of HtrA1 by binding to the protease domain. As a result of the interaction with MPPs, the proteolytic activity of HtrA1 against Fibulin-5, a specific HtrA1 substrate in age-related macular degeneration (AMD), was increased. This physical interaction could be abolished by the missense mutations of HtrA1 found in patients with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Furthermore, knockdown of HtrA1 attenuated apoptosis induced by PPP-IX. These results suggest that PPP-IX, or its derivatives, and HtrA1 may function as co-factors whereby porphyrins enhance oligomerization and the protease activity of HtrA1, while active HtrA1 elevates the pro-apoptotic actions of porphyrin derivatives. Further analysis of this interplay may shed insights into the pathogenesis of diseases such as AMD, CARASIL and protoporphyria, as well as effective therapeutic development. PMID:25506911

  19. Internalization and trafficking of nontypeable Haemophilus influenzae in human respiratory epithelial cells and roles of IgA1 proteases for optimal invasion and persistence.

    PubMed

    Clementi, Cara F; Håkansson, Anders P; Murphy, Timothy F

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells.

  20. Internalization and Trafficking of Nontypeable Haemophilus influenzae in Human Respiratory Epithelial Cells and Roles of IgA1 Proteases for Optimal Invasion and Persistence

    PubMed Central

    Clementi, Cara F.; Håkansson, Anders P.

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells. PMID:24218477

  1. IS195, an Insertion Sequence-Like Element Associated with Protease Genes in Porphyromonas gingivalis

    PubMed Central

    Lewis, Janina P.; Macrina, Francis L.

    1998-01-01

    Porphyromonas gingivalis is recognized as an important etiologic agent in adult and early-onset periodontal disease. Proteases produced by this organism contribute to its virulence in mice. Protease-encoding genes have been shown to contain multiple copies of repeated nucleotide sequences. These conserved sequences have also been found in hemagglutinin genes. In the process of studying the genetic loci containing the conserved repeated sequences, we have characterized a prtP gene homolog from P. gingivalis W83 encoding a cysteine protease with Lys-X specificity. However, this prtP gene was interrupted by an insertion sequence-like element which we designated IS195. Furthermore, IS195 and another element, IS1126, were present downstream of prtP gene homologs (kgp) found in P. gingivalis H66 and 381. IS195, a 1,068-bp insertion sequence-like element, contained 11-bp inverted repeats at its termini and was bordered by 9-bp direct repeats presumed to be a transposition-mediated target site duplication. Its central region contained one large open reading frame encoding a predicted 300-amino-acid protein which appeared to be a transposase. We isolated two naturally occurring variants of P. gingivalis W83, one carrying IS195 within the coding region of the prtP gene and another containing an intact prtP gene. Biochemical characterization revealed a lack of trypsin-like Lys-X specific proteolytic activity in the P. gingivalis W83 variant carrying the disrupted prtP gene. Studies using a mouse model revealed a reduction of virulence resulting from insertion of IS195 into the coding region of the prtP gene. An allelic-exchange mutant defective in the prtP gene also was constructed and tested in vivo. It displayed intermediate virulence compared to that of the wild-type and prtP::IS195 mutant strains. We conclude that the Lys-X cysteine protease contributes to virulence in soft tissue infections. PMID:9632563

  2. Proresolving Actions of Synthetic and Natural Protease Inhibitors Are Mediated by Annexin A1.

    PubMed

    Vago, Juliana P; Tavares, Luciana P; Sugimoto, Michelle A; Lima, Graziele Letícia N; Galvão, Izabela; de Caux, Thais R; Lima, Kátia M; Ribeiro, Ana Luíza C; Carneiro, Fernanda S; Nunes, Fernanda Freire C; Pinho, Vanessa; Perretti, Mauro; Teixeira, Mauro M; Sousa, Lirlândia P

    2016-02-15

    Annexin A1 (AnxA1) is a glucocorticoid-regulated protein endowed with anti-inflammatory and proresolving properties. Intact AnxA1 is a 37-kDa protein that may be cleaved in vivo at the N-terminal region by neutrophil proteases including elastase and proteinase-3, generating the 33-kDa isoform that is largely inactive. In this study, we investigated the dynamics of AnxA1 expression and the effects of synthetic (sivelestat [SIV]; Eglin) and natural (secretory leukocyte protease inhibitor [SLPI]; Elafin) protease inhibitors on the resolution of LPS-induced inflammation. During the settings of LPS inflammation AnxA1 cleavage associated closely with the peak of neutrophil and elastase expression and activity. SLPI expression increased during resolving phase of the pleurisy. Therapeutic treatment of LPS-challenge mice with recombinant human SLPI or Elafin accelerated resolution, an effect associated with increased numbers of apoptotic neutrophils in the pleural exudates, inhibition of elastase, and modulation of the survival-controlling proteins NF-κB and Mcl-1. Similar effects were observed with SIV, which dose-dependently inhibited neutrophil elastase and shortened resolution intervals. Mechanistically, SIV-induced resolution was caspase-dependent, associated to increased levels of intact AnxA1 and decreased expression of NF-κB and Mcl-1. The proresolving effect of antiproteases was also observed in a model of monosodium urate crystals-induced inflammation. SIV skewed macrophages toward resolving phenotypes and enhanced efferocytosis of apoptotic neutrophils. A neutralizing antiserum against AnxA1 and a nonselective antagonist of AnxA1 receptor abolished the accelerated resolution promoted by SIV. Collectively, these results show that elastase inhibition not only inhibits inflammation but actually promotes resolution, and this response is mediated by protection of endogenous intact AnxA1 with ensuing augmentation of neutrophil apoptosis.

  3. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    PubMed Central

    2010-01-01

    Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota. PMID:20416045

  4. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.

    PubMed

    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz

    2012-11-01

    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  5. Molecular cloning and characterization of an extracellular protease gene from Aeromonas hydrophila.

    PubMed Central

    Rivero, O; Anguita, J; Paniagua, C; Naharro, G

    1990-01-01

    A structural gene which codes for an extracellular protease in Aeromonas hydrophilia SO2/2 and D13 was cloned in Escherichia coli C600-1 by using pBR322 as a vector. The gene codes for a temperature-stable protease with a molecular mass of approximately 38,000 daltons. The protein was secreted to the periplasm of E. coli C600-1 and purified by osmotic shock. Cloned protease (P3) was identical in molecular mass and properties to the one purified from A. hydrophila SO2/2 culture supernatant as an extracellular product. Images PMID:2193924

  6. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice.

  7. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  8. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.

    PubMed

    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun

    2014-02-01

    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  9. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  10. Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.

    PubMed

    Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

    2015-02-01

    Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5 U mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39 kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90 °C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8 U mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry.

  11. Differential expression of conserved protease genes in crucifer-attacking pathovars of Xanthomonas campestris.

    PubMed

    Dow, J M; Fan, M J; Newman, M A; Daniels, M J

    1993-12-01

    Strains of Xanthomonas campestris pathovars armoraciae and raphani, which cause leaf spotting diseases in brassicas, produce a major extracellular protease in liquid culture which was partially purified. The protease (PRT 3) was a zinc-requiring metalloenzyme and was readily distinguishable from the two previously characterized proteases (PRT 1 and PRT 2) of X. campestris pv. campestris by the pattern of degradation of beta-casein and sensitivity to inhibitors. PRT 3 was produced at a low level in the vascular brassica pathogen X. campestris pv. campestris (five strains tested), in which PRT 1 and PRT 2 predominate. In contrast, expression of PRT 1, a serine protease, could not be detected in the six tested strains of the leaf spotting mesophyll pathogens. However, all these strains had DNA fragments which hybridized to a prtA probe and which probably carry a functional prtA (the structural gene for PRT 1). The structural gene for PRT 3 (prtC) was cloned by screening a genomic library of X. campestris pv. raphani in a protease-deficient X. campestris pv. campestris strain. Subcloning and Tn5 mutagenesis located the structural gene to 1.2 kb of DNA. DNA fragments which hybridized to the structural gene were found in all strains of the crucifer-attacking X. campestris pathovars tested as well as in a number of other pathovars. Experiments in which the pattern of protease production of the pathovars was manipulated by introduction of cloned genes into heterologous pathovars suggested that no determinative relationship exists between the pattern of protease gene expression and the (vascular or mesophyllic) mode of pathogenesis.

  12. Proteases and oxidant stress control organic dust induction of inflammatory gene expression in lung epithelial cells.

    PubMed

    Natarajan, Kartiga; Gottipati, Koteswara R; Berhane, Kiflu; Samten, Buka; Pendurthi, Usha; Boggaram, Vijay

    2016-10-22

    Persistant inflammatory responses to infectious agents and other components in organic dust underlie lung injury and development of respiratory diseases. Organic dust components responsible for eliciting inflammation and the mechanisms by which they cause lung inflammation are not fully understood. We studied the mechanisms by which protease activities in poultry dust extracts and intracellular oxidant stress induce inflammatory gene expression in A549 and Beas2B lung epithelial cells. The effects of dust extracts on inflammatory gene expression were analyzed by quantitative polymerase chain reaction (qPCR), enzyme linked immunosorbent (ELISA) and western blot assays. Oxidant stress was probed by dihydroethidium (DHE) labeling, and immunostaining for 4-hydroxynonenal (4-HNE). Effects on interleukin-8 (IL-8) promoter regulation were determined by transient transfection assay. Dust extracts contained trypsin and elastase activities, and activated protease activated receptor (PAR)-1 and -2. Serine protease inhibitors and PAR-1 or PAR-2 knockdown suppressed inflammatory gene induction. Dust extract induction of IL-8 gene expression was associated with increased DHE-fluorescence and 4-HNE staining, and antioxidants suppressed inflammatory gene induction. Protease inhibitors and antioxidants suppressed protein kinase C and NF-κB activation and induction of IL-8 promoter activity in cells exposed to dust extract. Our studies demonstrate that proteases and intracellular oxidants control organic dust induction of inflammatory gene expression in lung epithelial cells. Targeting proteases and oxidant stress may serve as novel approaches for the treatment of organic dust induced lung diseases. This is the first report on the involvement of oxidant stress in the induction of inflammatory gene expression by organic dust.

  13. Characterization, cloning, and heterologous expression of a subtilisin-like serine protease gene VlPr1 from Verticillium lecanii.

    PubMed

    Yu, Gang; Liu, Jin-Liang; Xie, Li-Qin; Wang, Xue-Liang; Zhang, Shi-Hong; Pan, Hong-Yu

    2012-12-01

    The entomopathogenic fungus Verticillium lecanii is a well-known biocontrol agent. V. lecanii produces subtilisin-like serine protease (Pr1), which is important in the biological control activity of some insect pests by degrading insect cuticles. In this study, a subtilisin-like serine protease gene VlPr1 was cloned from the fungus and the VlPr1 protein was expressed in Escherichia coli. The VlPr1 gene contains an open reading frame (ORF) interrupted by three short introns, and encodes a protein of 379 amino acids. Protein sequence analysis revealed high homology with subtilisin serine proteases. The molecular mass of the protease was 38 kDa, and the serine protease exhibited its maximal activity at 40°C and pH 9.0. Protease activity was also affected by Mg(2+) and Ca(2+) concentration. The protease showed inhibitory activity against several plant pathogens, especially towards Fusarium moniliforme.

  14. The effect of environmental conditions on expression of Bacteroides fragilis and Bacteroides thetaiotaomicron C10 protease genes

    PubMed Central

    2012-01-01

    Background Bacteroides fragilis and Bacteroides thetaiotaomicron are members of the normal human intestinal microbiota. However, both organisms are capable of causing opportunistic infections, during which the environmental conditions to which the bacteria are exposed change dramatically. To further explore their potential for contributing to infection, we have characterized the expression in B. thetaiotaomicron of four homologues of the gene encoding the C10 cysteine protease SpeB, a potent extracellular virulence factor produced by Streptococcus pyogenes. Results We identified a paralogous set of genes (btp genes) in the B. thetaiotaomicron genome, that were related to C10 protease genes we recently identified in B. fragilis. Similar to C10 proteases found in B. fragilis, three of the B. thetaiotaomicron homologues were transcriptionally coupled to genes encoding small proteins that are similar in structural architecture to Staphostatins, protease inhibitors associated with Staphopains in Staphylococcus aureus. The expression of genes for these C10 proteases in both B. fragilis and B. thetaiotaomicron was found to be regulated by environmental stimuli, in particular by exposure to oxygen, which may be important for their contribution to the development of opportunistic infections. Conclusions Genes encoding C10 proteases are increasingly identified in operons which also contain genes encoding proteins homologous to protease inhibitors. The Bacteroides C10 protease gene expression levels are responsive to different environmental stimuli suggesting they may have distinct roles in the bacterial-host interaction. PMID:22943521

  15. The effect of environmental conditions on expression of Bacteroides fragilis and Bacteroides thetaiotaomicron C10 protease genes.

    PubMed

    Thornton, Roibeard F; Murphy, Elizabeth C; Kagawa, Todd F; O'Toole, Paul W; Cooney, Jakki C

    2012-09-03

    Bacteroides fragilis and Bacteroides thetaiotaomicron are members of the normal human intestinal microbiota. However, both organisms are capable of causing opportunistic infections, during which the environmental conditions to which the bacteria are exposed change dramatically. To further explore their potential for contributing to infection, we have characterized the expression in B. thetaiotaomicron of four homologues of the gene encoding the C10 cysteine protease SpeB, a potent extracellular virulence factor produced by Streptococcus pyogenes. We identified a paralogous set of genes (btp genes) in the B. thetaiotaomicron genome, that were related to C10 protease genes we recently identified in B. fragilis. Similar to C10 proteases found in B. fragilis, three of the B. thetaiotaomicron homologues were transcriptionally coupled to genes encoding small proteins that are similar in structural architecture to Staphostatins, protease inhibitors associated with Staphopains in Staphylococcus aureus. The expression of genes for these C10 proteases in both B. fragilis and B. thetaiotaomicron was found to be regulated by environmental stimuli, in particular by exposure to oxygen, which may be important for their contribution to the development of opportunistic infections. Genes encoding C10 proteases are increasingly identified in operons which also contain genes encoding proteins homologous to protease inhibitors. The Bacteroides C10 protease gene expression levels are responsive to different environmental stimuli suggesting they may have distinct roles in the bacterial-host interaction.

  16. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.

    PubMed

    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan

    2016-04-01

    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  17. Helical apolipoproteins stabilize ATP-binding cassette transporter A1 by protecting it from thiol protease-mediated degradation.

    PubMed

    Arakawa, Reijiro; Yokoyama, Shinji

    2002-06-21

    ATP-binding cassette transporter (ABC) A1 was increased by apolipoprotein A-I without an increase of its message in THP-1 cells. The pulse label study demonstrated that apoA-I retarded degradation of ABCA1. Similar changes were demonstrated by apoA-II, but the effect of high density lipoprotein was almost negligible on the basis of equivalent protein concentration. Thiol protease inhibitors (leupeptin and N-acetyl-Leu-Leu-norleucinal (ALLN)) increased ABCA1 and slowed its decay in the cells, whereas none of the proteosome-specific inhibitor lactacystin, other protease inhibitors, or the lysosomal inhibitor NH(4)Cl showed such effects. The effects of apoA-I and ALLN were additive for the increase of ABCA1, and the apoA-I-mediated cellular lipid release was enhanced by ALLN. The data suggest that ABCA1 is rapidly degraded by a thiol protease(s) in the cells unless helical apolipoproteins in their lipid-free form stabilize ABCA1 by protecting it from protease-mediated degradation.

  18. Active-site gating regulates substrate selectivity in a chymotrypsin-like serine protease the structure of haemophilus influenzae immunoglobulin A1 protease.

    PubMed

    Johnson, Troy A; Qiu, Jiazhou; Plaut, Andrew G; Holyoak, Todd

    2009-06-12

    We report here the first structure of a member of the immunoglobulin A protease (IgAP) family at 1.75-A resolution. This protease is a founding member of the type V (autotransporter) secretion system and is considered a virulence determinant among the bacteria expressing the enzyme. The structure of the enzyme fits that of a classic autotransporter in which several unique domains necessary for protein function are appended to a central, 100-A-long beta-helical domain. The N-terminal domain of the IgAP is found to possess a chymotrypsin-like fold. However, this catalytic domain contains a unique loop D that extends over the active site acting as a lid, gating substrate access. The data presented provide a structural basis for the known ability of IgAPs to cleave only the proline/serine/threonine-rich hinge peptide unique to IgA1 (isotype 1) in the context of the intact fold of the immunoglobulin. Based upon the structural data, as well as molecular modeling, a model suggesting that the unique extended loop D in this IgAP sterically occludes the active-site binding cleft in the absence of immunoglobulin binding is presented. Only in the context of binding of the IgA1-Fc domain in a valley formed between the N-terminal protease domain and another domain appended to the beta-helix spine (domain 2) is the lid stabilized in an open conformation. The stabilization of this open conformation through Fc association subsequently allows access of the hinge peptide to the active site, resulting in recognition and cleavage of the substrate.

  19. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals.

    PubMed

    Wagstaff, Carol; Leverentz, Michael K; Griffiths, Gareth; Thomas, Brian; Chanasut, Usawadee; Stead, Anthony D; Rogers, Hilary J

    2002-02-01

    The functional life of the flower is terminated by senescence and/or abscission. Multiple processes contribute to produce the visible signs of petal wilting and inrolling that typify senescence, but one of the most important is that of protein degradation and remobilization. This is mediated in many species through protein ubiquitination and the action of specific protease enzymes. This paper reports the changes in protein and protease activity during development and senescence of Alstroemeria flowers, a Liliaceous species that shows very little sensitivity to ethylene during senescence and which shows perianth abscission 8-10 d after flower opening. Partial cDNAs of ubiquitin (ALSUQ1) and a putative cysteine protease (ALSCYP1) were cloned from Alstroemeria using degenerate PCR primers and the expression pattern of these genes was determined semi-quantitatively by RT-PCR. While the levels of ALSUQ1 only fluctuated slightly during floral development and senescence, there was a dramatic increase in the expression of ALSCYP1 indicating that this gene may encode an important enzyme for the proteolytic process in this species. Three papain class cysteine protease enzymes showing different patterns of activity during flower development were identified on zymograms, one of which showed a similar expression pattern to the cysteine protease cDNA.

  20. Similar proportions of immunoglobulin A1 (IgA1) protease-producing streptococci in initial dental plaque of selectively IgA-deficient and normal individuals.

    PubMed Central

    Reinholdt, J; Friman, V; Kilian, M

    1993-01-01

    By comparing the initial colonization of cleaned teeth in immunoglobulin A (IgA)-deficient, IgM-compensating individuals with that in normal individuals, no significant difference in the proportion of IgA1 protease-producing streptococci was found. Thus, as one of several bacterial means of immune evasion, the ability to cleave secretory IgA1 does not appear essential to the successful adherence of oral streptococci. PMID:8359924

  1. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from Stenotrophomonas maltophilia N4.

    PubMed

    Jankiewicz, Urszula; Larkowska, Ewa; Swiontek Brzezinska, Maria

    2016-06-01

    A rhizosphere strain of the bacterium Stenotrophomonas maltophilia N4 secretes the serine protease PN4, whose molecular mass is approximately 42 kDa. The optimal temperature for the enzyme activity of the 11-fold purified protein was 50°C and the optimal pH was 10.5. The activity of the enzyme was strongly inhibited by specific serine protease inhibitors, which allowed for its classification as an alkaline serine protease family. Ca(2+) ions stimulated the activity of the protease PN4, while Mg(2+) ions stabilized its activity, and Zn(2+) and Cd(2+) ions strongly inhibited its activity. The enzyme has broad substrate specificity. For example, it is able to hydrolyse casein, keratin, albumin, haemoglobin, and gelatin, as well as the insoluble modified substrates azure keratin and azocoll. The gene that encodes the 1740 bp precursor form of the enzyme (accession number: LC031815) was cloned. We then deduced that its amino acid sequence includes the region of the conserved domain of the S8 family of peptidases as well as the catalytic triad Asp/His/Ser. The bacterial culture fluid as well as the purified protease PN4 demonstrated biocidal activity with regard to the nematodes Caenorhabditis elegans and Panagrellus spp. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Protease Gene Duplication and Proteolytic Activity in Drosophila Female Reproductive Tracts

    PubMed Central

    Kelleher, Erin S.; Pennington, James E.

    2009-01-01

    Secreted proteases play integral roles in sexual reproduction in a broad range of taxa. In the genetic model Drosophila melanogaster, these molecules are thought to process peptides and activate enzymes inside female reproductive tracts, mediating critical postmating responses. A recent study of female reproductive tract proteins in the cactophilic fruit fly Drosophila arizonae, identified pervasive, lineage-specific gene duplication amongst secreted proteases. Here, we compare the evolutionary dynamics, biochemical nature, and physiological significance of secreted female reproductive serine endoproteases between D. arizonae and its congener D. melanogaster. We show that D. arizonae lower female reproductive tract (LFRT) proteins are significantly enriched for recently duplicated secreted proteases, particularly serine endoproteases, relative to D. melanogaster. Isolated lumen from D. arizonae LFRTs, furthermore, exhibits significant trypsin-like and elastase-like serine endoprotease acitivity, whereas no such activity is seen in D. melanogaster. Finally, trypsin- and elastase-like activity in D. arizonae female reproductive tracts is negatively regulated by mating. We propose that the intense proteolytic environment of the D. arizonae female reproductive tract relates to the extraordinary reproductive physiology of this species and that ongoing gene duplication amongst these proteases is an evolutionary consequence of sexual conflict. PMID:19546158

  3. Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

    SciTech Connect

    Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.

    2011-10-14

    Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.

  4. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  5. Functional diversification of a protease inhibitor gene in the genus Drosophila and its molecular basis.

    PubMed

    Börner, Stefan; Ragg, Hermann

    2008-05-31

    The mutually exclusive use of alternative reactive site loop (RSL) cassettes due to alternative splicing of serpin (serine protease inhibitor) gene transcripts is a widespread strategy to create target-selective protease inhibitors in the animal kingdom. Since molecular basis and evolution of serpin RSL cassette exon amplification and diversification are unexplored, the exon-intron organization of the serpin gene spn4 from 12 species of the genus Drosophila was studied. The analysis of the gene structures shows that both number and target enzyme specificities of Spn4 RSL cassettes are highly variable in fruit flies and includes inhibitor variants with novel antiproteolytic activities in some species, indicating that RSL diversity is the result of adaptive evolution. Comparative genomics suggests that interallelic gene conversion and/or recombination events contribute to RSL cassette exon amplification. Due to an intron that is located at the most suitable position within the RSL region, multiple inhibitors can be formed in an economic manner that are both efficient and target-selective, allowing fruit flies to control an astonishing variety of proteases with different cleavage chemistry and evolutionary ancestry.

  6. Transcriptional activation by heat and cold of a thiol protease gene in tomato. [Lycopersicon esculentum

    SciTech Connect

    Schaffer, M.A.; Fischer, R.L. )

    1990-08-01

    We previously determined that low temperature induces the accumulation in tomato (Lycopersicon esculentum) fruit of a cloned mRNA, designated C14, encoding a polypeptide related to thiol proteases. We now demonstrate that C14 mRNA accumulation is a response common to both high (40{degree}C) and low (4{degree}C) temperature stresses. Exposure of tomato fruit to 40{degree}C results in the accumulation of C14 mRNA, by 8 hours. This response is more rapid than that to 4{degree}C, but slower than the induction of many heat shock messages by 40{degree}C, and therefore unique. We have also studied the mechanism by which heat and cold exposure activate C14 gene expression. Both high and low temperature regulate protease gene expression through transcriptional induction of a single C14 gene. A hypothesis for the function of C14 thiol protease gene expression in response to heat and cold is discussed.

  7. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    PubMed Central

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  8. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.

    PubMed

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2014-02-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  9. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  10. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  11. The trimeric serine protease HtrA1 forms a cage-like inhibition complex with an anti-HtrA1 antibody.

    PubMed

    Ciferri, Claudio; Lipari, Michael T; Liang, Wei-Ching; Estevez, Alberto; Hang, Julie; Stawicki, Scott; Wu, Yan; Moran, Paul; Elliott, Mike; Eigenbrot, Charles; Katschke, Kenneth J; van Lookeren Campagne, Menno; Kirchhofer, Daniel

    2015-12-01

    High temperature requirement A1 (HtrA1) is a trypsin-fold serine protease implicated in the progression of age-related macular degeneration (AMD). Our interest in an antibody therapy to neutralize HtrA1 faces the complication that the target adopts a trimeric arrangement, with three active sites in close proximity. In the present study, we describe antibody 94, obtained from a human antibody phage display library, which forms a distinct macromolecular complex with HtrA1 and inhibits the enzymatic activity of recombinant and native HtrA1 forms. Using biochemical methods and negative-staining EM we were able to elucidate the molecular composition of the IgG94 and Fab94 complexes and the associated inhibition mechanism. The 246-kDa complex between the HtrA1 catalytic domain trimer (HtrA1_Cat) and Fab94 had a propeller-like organization with one Fab bound peripherally to each protomer. Low-resolution EM structures and epitope mapping indicated that the antibody binds to the surface-exposed loops B and C of the catalytic domain, suggesting an allosteric inhibition mechanism. The HtrA1_Cat-IgG94 complex (636 kDa) is a cage-like structure with three centrally located IgG94 molecules co-ordinating two HtrA1_Cat trimers and the six active sites pointing into the cavity of the cage. In both complexes, all antigen-recognition regions (paratopes) are found to bind one HtrA1 protomer and all protomers are bound by a paratope, consistent with the complete inhibition of enzyme activity. Therefore, in addition to its potential therapeutic usefulness, antibody 94 establishes a new paradigm of multimeric serine protease inhibition.

  12. Characterization of a Casuarina glauca nodule-specific subtilisin-like protease gene, a homolog of Alnus glutinosa ag12.

    PubMed

    Laplaze, L; Ribeiro, A; Franche, C; Duhoux, E; Auguy, F; Bogusz, D; Pawlowski, K

    2000-01-01

    In search of plant genes expressed during early interactions between Casuarina glauca and Frankia, we have isolated and characterized a C. glauca gene that has strong homology to subtilisin-like protease gene families of several plants including the actinorhizal nodulin gene ag12 of another actinorhizal plant, Alnus glutinosa. Based on the expression pattern of cg12 in the course of nodule development, it represents an early actinorhizal nodulin gene. Our results suggest that subtilisin-like proteases may be a common element in the process of infection of plant cells by Frankia in both Betulaceae (Alnus glutinosa) and Casuarinaceae (Casuarina glauca) symbioses.

  13. Occurrence and evolution of the paralogous zinc metalloproteases IgA1 protease, ZmpB, ZmpC, and ZmpD in Streptococcus pneumoniae and related commensal species.

    PubMed

    Bek-Thomsen, Malene; Poulsen, Knud; Kilian, Mogens

    2012-01-01

    The distribution, genome location, and evolution of the four paralogous zinc metalloproteases, IgA1 protease, ZmpB, ZmpC, and ZmpD, in Streptococcus pneumoniae and related commensal species were studied by in silico analysis of whole genomes and by activity screening of 154 representatives of 20 species. ZmpB was ubiquitous in the Mitis and Salivarius groups of the genus Streptococcus and in the genera Gemella and Granulicatella, with the exception of a fragmented gene in Streptococcus thermophilus, the only species with a nonhuman habitat. IgA1 protease activity was observed in all members of S. pneumoniae, S. pseudopneumoniae, S. oralis, S. sanguinis, and Gemella haemolysans, was variably present in S. mitis and S. infantis, and absent in S. gordonii, S. parasanguinis, S. cristatus, S. oligofermentans, S. australis, S. peroris, and S. suis. Phylogenetic analysis of 297 zmp sequences and representative housekeeping genes provided evidence for an unprecedented selection for genetic diversification of the iga, zmpB, and zmpD genes in S. pneumoniae and evidence of very frequent intraspecies transfer of entire genes and combination of genes. Presumably due to their adaptation to a commensal lifestyle, largely unaffected by adaptive mucosal immune factors, the corresponding genes in commensal streptococci have remained conserved. The widespread distribution and significant sequence diversity indicate an ancient origin of the zinc metalloproteases predating the emergence of the humanoid species. zmpB, which appears to be the ancestral gene, subsequently duplicated and successfully diversified into distinct functions, is likely to serve an important but yet unknown housekeeping function associated with the human host. The paralogous zinc metalloproteases IgA1 protease, ZmpB, ZmpC, and ZmpD have been identified as crucial for virulence of the human pathogen Streptococcus pneumoniae. This study maps the presence of the corresponding genes and enzyme activities in S

  14. Purification, characterization and gene cloning of Da-36, a novel serine protease from Deinagkistrodon acutus venom.

    PubMed

    Zheng, Ying; Ye, Feng-Ping; Wang, Jie; Liao, Guo-Yang; Zhang, Yun; Fan, Quan-Shui; Lee, Wen-Hui

    2013-06-01

    A serine protease termed Da-36 was isolated from crude venom of Deinagkistrodon acutus. The enzyme was a single chain protein with an apparent molecular weight of 36,000 on SDS-PAGE with an isoelectric point of 6.59. Da-36 could clot human plasma by cleaving the Aα, Bβ and γ chains of fibrinogen and also exhibited arginine esterase activity. The proteolytic activity of Da-36 toward TAME was strongly inhibited by PMSF and moderately affected by benzamidine and aprotinin, indicating that it was a serine protease. Meanwhile, Da-36 showed stability with wide temperature (20-50 °C) and pH value ranges (pH 6-10). Divalent metal ions of Ca(2+), Mg(2+), and Mn(2+) had no effects but Zn(2+) and Cu(2+) inhibited the arginine esterase activity of Da-36. Total DNA was extracted directly from the lyophilized crude venom and the gene (5.5 kbp) coding for Da-36 had been successfully cloned. Sequence analysis revealed that the Da-36 gene contained five exons and four introns. The mature Da-36 was encoded by four separate exons. The deduced mature amino acid sequence of Da-36 was in good agreement with the determined N-terminal sequence of the purified protein and shared high homology with other serine proteases isolated from different snake venoms. Blast search using amino acid sequence of Da-36 against public database revealed that Da-36 showed a maximal identity of 90% with both Dav-X (Swiss-Prot: Q9I8W9.1) and thrombin-like protein 1 (GenBank: AAW56608.1) from the same snake species, indicating that Da-36 is a novel serine protease.

  15. Characterization of a Clp Protease Gene Regulator and the Reaeration Response in Mycobacterium tuberculosis

    PubMed Central

    Sherrid, Ashley M.; Rustad, Tige R.; Cangelosi, Gerard A.; Sherman, David R.

    2010-01-01

    Mycobacterium tuberculosis (MTB) enters a non-replicating state when exposed to low oxygen tension, a condition the bacillus encounters in granulomas during infection. Determining how mycobacteria enter and maintain this state is a major focus of research. However, from a public health standpoint the importance of latent TB is its ability to reactivate. The mechanism by which mycobacteria return to a replicating state upon re-exposure to favorable conditions is not understood. In this study, we utilized reaeration from a defined hypoxia model to characterize the adaptive response of MTB following a return to favorable growth conditions. Global transcriptional analysis identified the ∼100 gene Reaeration Response, induced relative to both log-phase and hypoxic MTB. This response includes chaperones and proteases, as well as the transcription factor Rv2745c, which we characterize as a Clp protease gene regulator (ClgR) orthologue. During reaeration, genes repressed during hypoxia are also upregulated in a wave of transcription that includes genes crucial to transcription, translation and oxidative phosphorylation and culminates in bacterial replication. In sum, this study defines a new transcriptional response of MTB with potential relevance to disease, and implicates ClgR as a regulator involved in resumption of replication following hypoxia. PMID:20661284

  16. IgA1 Protease Treatment Reverses Mesangial Deposits and Hematuria in a Model of IgA Nephropathy.

    PubMed

    Lechner, Sebastian M; Abbad, Lilia; Boedec, Erwan; Papista, Christina; Le Stang, Marie-Bénédicte; Moal, Christelle; Maillard, Julien; Jamin, Agnès; Bex-Coudrat, Julie; Wang, Yong; Li, Aiqun; Martini, Paolo G V; Monteiro, Renato C; Berthelot, Laureline

    2016-09-01

    IgA nephropathy (IgAN), characterized by mesangial IgA1 deposits, is a leading cause of renal failure worldwide. IgAN pathogenesis involves circulating hypogalactosylated IgA1 complexed with soluble IgA Fc receptor I (sCD89) and/or anti-hypogalactosylated-IgA1 autoantibodies, but no specific treatment is available for IgAN. The absence of IgA1 and CD89 homologs in the mouse has precluded in vivo proof-of-concept studies of specific therapies targeting IgA1. However, the α1KI‑CD89Tg mouse model of IgAN, which expresses human IgA1 and human CD89, allows in vivo testing of recombinant IgA1 protease (IgA1‑P), a bacterial protein that selectively cleaves human IgA1. Mice injected with IgA1‑P (1-10 mg/kg) had Fc fragments of IgA1 in both serum and urine, associated with a decrease in IgA1-sCD89 complexes. Levels of mesangial IgA1 deposits and the binding partners of these deposits (sCD89, transferrin receptor, and transglutaminase 2) decreased markedly 1 week after treatment, as did the levels of C3 deposition, CD11b(+) infiltrating cells, and fibronectin. Antiprotease antibodies did not significantly alter IgA1‑P activity. Moreover, hematuria consistently decreased after treatment. In conclusion, IgA1‑P strongly diminishes human IgA1 mesangial deposits and reduces inflammation, fibrosis, and hematuria in a mouse IgAN model, and therefore may be a plausible treatment for patients with IgAN. Copyright © 2016 by the American Society of Nephrology.

  17. Immunoglobulins in Nasal Secretions of Healthy Humans: Structural Integrity of Secretory Immunoglobulin A1 (IgA1) and Occurrence of Neutralizing Antibodies to IgA1 Proteases of Nasal Bacteria

    PubMed Central

    Kirkeby, Line; Rasmussen, Trine Tang; Reinholdt, Jesper; Kilian, Mogens

    2000-01-01

    Certain bacteria, including overt pathogens as well as commensals, produce immunoglobulin A1 (IgA1) proteases. By cleaving IgA1, including secretory IgA1, in the hinge region, these enzymes may interfere with the barrier functions of mucosal IgA antibodies, as indicated by experiments in vitro. Previous studies have suggested that cleavage of IgA1 in nasal secretions may be associated with the development and perpetuation of atopic disease. To clarify the potential effect of IgA1 protease-producing bacteria in the nasal cavity, we have analyzed immunoglobulin isotypes in nasal secretions of 11 healthy humans, with a focus on IgA, and at the same time have characterized and quantified IgA1 protease-producing bacteria in the nasal flora of the subjects. Samples in the form of nasal wash were collected by using a washing liquid that contained lithium as an internal reference. Dilution factors and, subsequently, concentrations in undiluted secretions could thereby be calculated. IgA, mainly in the secretory form, was found by enzyme-linked immunosorbent assay to be the dominant isotype in all subjects, and the vast majority of IgA (median, 91%) was of the A1 subclass, corroborating results of previous analyses at the level of immunoglobulin-producing cells. Levels of serum-type immunoglobulins were low, except for four subjects in whom levels of IgG corresponded to 20 to 66% of total IgA. Cumulative levels of IgA, IgG, and IgM in undiluted secretions ranged from 260 to 2,494 (median, 777) μg ml−1. IgA1 protease-producing bacteria (Haemophilus influenzae, Streptococcus pneumoniae, or Streptococcus mitis biovar 1) were isolated from the nasal cavities of seven subjects at 2.1 × 103 to 7.2 × 106 CFU per ml of undiluted secretion, corresponding to 0.2 to 99.6% of the flora. Nevertheless, α-chain fragments characteristic of IgA1 protease activity were not detected in secretions from any subject by immunoblotting. Neutralizing antibodies to IgA1 proteases of autologous

  18. Characterization of a novel serine protease inhibitor gene from a marine metagenome.

    PubMed

    Jiang, Cheng-Jian; Hao, Zhen-Yu; Zeng, Rong; Shen, Pei-Hong; Li, Jun-Fang; Wu, Bo

    2011-01-01

    A novel serine protease inhibitor (serpin) gene designated as Spi1C was cloned via the sequenced-based screening of a metagenomic library from uncultured marine microorganisms. The gene had an open reading frame of 642 base pairs, and encoded a 214-amino acid polypeptide with a predicted molecular mass of about 28.7 kDa. The deduced amino acid sequence comparison and phylogenetic analysis indicated that Spi1C and some partial proteinase inhibitor I4 serpins were closely related. Functional characterization demonstrated that the recombinant Spi1C protein could inhibit a series of serine proteases. The Spi1C protein exhibited inhibitory activity against α-chymotrypsin and trypsin with K(i) values of around 1.79 × 10(-8) and 1.52 × 10(-8) M, respectively. No inhibition activity was exhibited against elastase. Using H-d-Phe-Pip-Arg-pNA as the chromogenic substrate, the optimum pH and temperature of the inhibition activity against trypsin were 7.0-8.0 and 25 °C, respectively. The identification of a novel serpin gene underscores the potential of marine metagenome screening for novel biomolecules.

  19. Thermodynamic analysis of unusually thermostable CutA1 protein from human brain and its protease susceptibility.

    PubMed

    Bagautdinov, Bagautdin; Matsuura, Yoshinori; Yamamoto, Hitoshi; Sawano, Masahide; Ogasahara, Kyoko; Takehira, Michiyo; Kunishima, Naoki; Katoh, Etsuko; Yutani, Katsuhide

    2015-03-01

    Unusually stable proteins are a disadvantage for the metabolic turnover of proteins in cells. The CutA1 proteins from Pyrococcus horikoshii and from Oryza sativa (OsCutA1) have unusually high denaturation temperatures (Td) of nearly 150 and 100 °C, respectively, at pH 7.0. It seemed that the CutA1 protein from the human brain (HsCutA1) also has a remarkably high stability. Therefore, the thermodynamic stabilities of HsCutA1 and its protease susceptibility were examined. The Td was remarkably high, being over 95 °C at pH 7.0. The unfolding Gibbs energy (ΔG(0)H2O) was 174 kJ/mol at 37 °C from the denaturant denaturation. The thermodynamic analysis showed that the unfolding enthalpy and entropy values of HsCutA1 were considerably lower than those of OsCutA1 with a similar stability to HsCutA1, which should be related to flexibility of the unstructured properties in both N- and C-terminals of HsCutA1. HsCutA1 was almost completely digested after 1-day incubation at 37 °C by subtilisin, although OsCutA1 was hardly digested at the same conditions. These results indicate that easily available fragmentation of HsCutA1 with remarkably high thermodynamic stability at the body temperature should be important for its protein catabolism in the human cells.

  20. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.

    PubMed

    Lin, X; Tang, J

    1990-01-25

    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  1. The Drosophila Stubble-stubbloid gene encodes an apparent transmembrane serine protease required for epithelial morphogenesis.

    PubMed Central

    Appel, L F; Prout, M; Abu-Shumays, R; Hammonds, A; Garbe, J C; Fristrom, D; Fristrom, J

    1993-01-01

    The Stubble-stubbloid (Sb-sbd) gene is required for hormone-dependent epithelial morphogenesis of imaginal discs of Drosophila, including the formation of bristles, legs, and wings. The gene has been cloned by using Sb-sbd-associated DNA lesions in a 20-kilobase (kb) region of a 263-kb genomic walk. The region specifies an approximately 3.8-kb transcript that is induced by the steroid hormone 20-hydroxyecdysone in imaginal discs cultured in vitro. The conceptually translated protein is an apparent 786-residue type II transmembrane protein (N terminus in, C terminus out), including an intracellular N-terminal domain of at least 35 residues and an extracellular C-terminal trypsin-like serine protease domain of 244 residues. Sequence analyses indicate that the Sb-sbd-encoded protease could activate itself by proteolytic cleavage. Consistent with the cell-autonomous nature of the Sb-sbd bristle phenotype, a disulfide bond between cysteine residues in the noncatalytic N-terminal fragment and the C-terminal catalytic fragment could tether the protease to the membrane after activation. Both dominant Sb and recessive sbd mutations affect the organization of microfilament bundles during bristle morphogenesis. We propose that the Sb-sbd product has a dual function. (i) It acts through its proteolytic extracellular domain to detach imaginal disc cells from extracellular matrices, and (ii) it transmits an outside-to-inside signal to its intracellular domain to modify the cytoskeleton and facilitate cell shape changes underlying morphogenesis. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7685111

  2. Genome-wide identification, evolutionary and expression analysis of the aspartic protease gene superfamily in grape

    PubMed Central

    2013-01-01

    Background Aspartic proteases (APs) are a large family of proteolytic enzymes found in almost all organisms. In plants, they are involved in many biological processes, such as senescence, stress responses, programmed cell death, and reproduction. Prior to the present study, no grape AP gene(s) had been reported, and their research on woody species was very limited. Results In this study, a total of 50 AP genes (VvAP) were identified in the grape genome, among which 30 contained the complete ASP domain. Synteny analysis within grape indicated that segmental and tandem duplication events contributed to the expansion of the grape AP family. Additional analysis between grape and Arabidopsis demonstrated that several grape AP genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grape and Arabidopsis. Phylogenetic relationships of the 30 VvAPs with the complete ASP domain and their Arabidopsis orthologs, as well as their gene and protein features were analyzed and their cellular localization was predicted. Moreover, expression profiles of VvAP genes in six different tissues were determined, and their transcript abundance under various stresses and hormone treatments were measured. Twenty-seven VvAP genes were expressed in at least one of the six tissues examined; nineteen VvAPs responded to at least one abiotic stress, 12 VvAPs responded to powdery mildew infection, and most of the VvAPs responded to SA and ABA treatments. Furthermore, integrated synteny and phylogenetic analysis identified orthologous AP genes between grape and Arabidopsis, providing a unique starting point for investigating the function of grape AP genes. Conclusions The genome-wide identification, evolutionary and expression analyses of grape AP genes provide a framework for future analysis of AP genes in defining their roles during stress response. Integrated synteny and phylogenetic analyses provide novel insight into the

  3. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.

    PubMed

    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J

    2016-12-01

    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  4. Critical COPD respiratory illness is linked to increased transcriptomic activity of neutrophil proteases genes

    PubMed Central

    2012-01-01

    essential role of neutrophil proteases in COPD patients with critical respiratory illness. Measurement and modulation of the expression of these genes could present an option for clinical monitoring and treatment of severe COPD exacerbations. PMID:22852767

  5. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.

    PubMed

    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G

    1989-06-01

    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  6. Frequency and patterns of protease gene resistance mutations in HIV-infected patients treated with lopinavir/ritonavir as their first protease inhibitor.

    PubMed

    Barber, Tristan J; Harrison, Linda; Asboe, David; Williams, Ian; Kirk, Stuart; Gilson, Richard; Bansi, Loveleen; Pillay, Deenan; Dunn, David

    2012-04-01

    Selection of protease mutations on antiretroviral therapy (ART) including a ritonavir-boosted protease inhibitor (PI) has been reported infrequently. Scarce data exist from long-term cohorts on resistance incidence or mutational patterns emerging to different PIs. We studied UK patients receiving lopinavir/ritonavir as their first PI, either while naive to ART or having previously received non-PI-based ART. Virological failure was defined as viral load ≥ 400 copies/mL after previous suppression <400 copies/mL, or failure to achieve <400 copies/mL during the first 6 months. pol sequences whilst failing lopinavir or within 30 days after stopping were analysed. Major and minor mutations (IAS-USA 2008-after exclusion of polymorphisms) were considered. Predicted susceptibility was determined using the Stanford HIVdb algorithm. Three thousand and fifty-six patients were followed for a median (IQR) of 14 (6-30) months, of whom 811 (27%) experienced virological failure. Of these, resistance test results were available on 291 (36%). One or more protease mutations were detected in 32 (11%) patients; the most frequent were I54V (n = 12), M46I (n = 11), V82A (n = 7) and L76V (n = 3). No association with viral subtype was evident. Many patients retained virus predicted to be susceptible to lopinavir (14, 44%), tipranavir (26, 81%) and darunavir (27, 84%). This study reflects the experience of patients in routine care. Selection of protease gene mutations by lopinavir/ritonavir occurred at a much higher rate than in clinical trials. The mutations observed showed only partial overlap with those previously identified by structural chemistry models, serial cell culture passage and genotype-phenotype analyses. There remained a low degree of predicted cross-resistance to other widely used PIs.

  7. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.

    PubMed

    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C

    2016-08-01

    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  8. Detection of enterotoxin and protease genes among Hungarian clinical Bacteroides fragilis isolates.

    PubMed

    Sárvári, Károly Péter; Sóki, József; Iván, Miklós; Miszti, Cecília; Latkóczy, Krisztina; Melegh, Szilvia Zsóka; Urbán, Edit

    2017-07-25

    Bacteroides fragilis as a commensal bacterium is a member of the human intestinal flora, but as an opportunistic pathogen it can cause serious infections as well. Some of them, harbouring an enterotoxin gene (bft), may cause diarrhoea mainly in young children. Recently it has been shown that a member of C11 proteases called fragipain (fpn) can activate the enterotoxin, while C10 protease (bfp) is suspected of playing an important role in the invasiveness of the B. fragilis isolates. The objective of this study was to investigate the prevalence and distribution of the bft isotypes in 200 Hungarian B. fragilis isolates collected recently; and in a subset of 72 strains, we wanted to determine the prevalence of bfp1-4 and fpn genes in bft-positive and bft-negative strains. Using the MALDI-TOF MS cfiA identification project file, 19 B. fragilis strains belonging to Division II were identified and the presence of the cfiA gene was confirmed by RT-PCR. Twenty six (13.0%) B. fragilis isolates turned out to be bft gene positive by RT-PCR; 20 isolates harboured bft-1 and six bft-2 isotypes, but no bft-3 isotype containing strains were found. A melting curve analysis and the PCR-RFLP were performed to differentiate between the bft-1 and bft-2 isotypes confirmed by sequencing. Thirty eight strains harboured bfp1, 58 isolates contained bfp2 gene, while 17 isolates proved positive for bfp3. Morever, no bfp4 positive isolate was found, and some of the B. fragilis strains tested harboured two or three bfp isotypes simultaneously. Among the 26 bft-positive strains, 24 contained the fpn gene, which confirms the role of fragipain in the activation of B. fragilis enterotoxin. In experiments, a significant negative correlation between fpn and cfiA was demonstrated (p < 0.000), a positive correlation was found between bfp2 and fpn genes (p = 0.0000803), and a negative correlation between bfp2 and cfiA genes (p = 0.011). Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    USDA-ARS?s Scientific Manuscript database

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  10. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing

    2015-01-01

    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  11. Isolation of cDNA from Jacaratia mexicana encoding a mexicain-like cysteine protease gene.

    PubMed

    Ramos-Martínez, Erick M; Herrera-Ramírez, Alejandra C; Badillo-Corona, Jesús Agustín; Garibay-Orijel, Claudio; González-Rábade, Nuria; Oliver-Salvador, María Del Carmen

    2012-07-01

    Cysteine proteases (CPs) from the C1 family, which are similar to papain, can be found in animals and plants, as well as some viruses and prokaryotes. These enzymes have diverse physiological functions and are thus very attractive for science and industry. Jacaratia mexicana, a member of the Caricaceae plant family, contains several CPs, the principal being mexicain, found to favorably compete against papain for many industrial applications due to its high stability and specific activity. In this study, leaves of J. mexicana were used to isolate a CP-coding gene, similar to those that code for mexicain and chymomexicain. By using rapid amplification of cDNA ends (RACE) as well as oligonucleotide design from papain-like conserved amino acids (aa), a sequence of 1404 bp consisting of a 5' terminal untranslated region (UTR) of 153 bp, a 3' terminal UTR of 131 bp, with a polyadenylation (poly(A)) signal sequence and a poly(A) tail, and an open reading frame (ORF) of 1046 bp, was obtained by overlapping three partial sequences. Two full-length cDNA sequences that encode for mexicain-like proteases were cloned from mRNA (JmCP4 and JmCP5). JmCP4 is predicted to have an ORF of 1044 bp, which codifies for polypeptides that have a 26 aa signal peptide region, a 108 aa propeptide region and a mature enzyme of 214 aa. A 969 bp fragment (JmCP5) encodes for a partial sequence of a CP gene, without the signal peptide region but with a full-length propeptide region. The sequence analysis showed that this protease presented a high similarity to other plant CPs from J. mexicana, Vasconcellea cundinamarcensis, Vasconcellea stipulata, and Carica papaya, among others, mainly at the conserved catalytic site. Obtaining the sequence of this CP gene from J. mexicana provides an alternative for production in a standard system and could be an initial step towards the commercialization of this enzyme.

  12. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat Butte 86

    USDA-ARS?s Scientific Manuscript database

    The complement of genes encoding alpha-amylase/protease inhibitors expressed in Triticum aestivum cv. Butte 86 was characterized by transcript and proteomic analysis. Coding sequences for 18 distinct proteins were identified among a collection of expressed sequence tags (ESTs) from Butte 86 developi...

  13. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J

    1990-01-01

    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  14. Correlation Between Expression of High Temperature Requirement Serine Protease A1 (HtrA1) in Nucleus Pulposus and T2 Value of Magnetic Resonance Imaging.

    PubMed

    Li, Dapeng; Yue, Jiawei; Jiang, Lu; Huang, Yonghui; Sun, Jifu; Wu, Yan

    2017-04-22

    BACKGROUND Degrading enzymes play an important role in the process of disc degeneration. The objective of this study was to investigate the correlation between the expression of high temperature requirement serine protease A1 (HtrA1) in the nucleus pulposus and the T2 value of the nucleus pulposus region in magnetic resonance imaging (MRI). MATERIAL AND METHODS Thirty-six patients who had undergone surgical excision of the nucleus pulposus were examined by MRI before surgery. Pfirrmann grading of the target intervertebral disc was performed according to the sagittal T2-weighted imaging, and the T2 value of the target nucleus pulposus was measured according to the median sagittal T2 mapping. The correlation between the Pfirrmann grade and the T2 value was analyzed. The expression of HtrA1 in the nucleus pulposus was analyzed by RT-PCR and Western blot. The correlation between the expression of HtrA1 and the T2 value was analyzed. RESULTS The T2 value of the nucleus pulposus region was 33.11-167.91 ms, with an average of 86.64±38.73 ms. According to Spearman correlation analysis, there was a rank correlation between T2 value and Pfirrmann grade (P<0.0001), and the correlation coefficient (rs)=-0.93617. There was a linear correlation between the mRNA level of HtrA1 and T2 value in nucleus pulposus tissues (a=3.88, b=-0.019, F=112.63, P<0.0001), normalized regression coefficient=-0.88. There was a linear correlation between the expression level of HtrA1 protein and the T2 value in the nucleus pulposus tissues (a=3.30, b=-0.016, F=93.15, P<0.0001) and normalized regression coefficient=-0.86. CONCLUSIONS The expression of HtrA1 was strongly related to the T2 value, suggesting that HtrA1 plays an important role in the pathological process of intervertebral disc degeneration.

  15. Disruption of genes involved in CORVET complex leads to enhanced secretion of heterologous carboxylesterase only in protease deficient Pichia pastoris.

    PubMed

    Marsalek, Lukas; Gruber, Clemens; Altmann, Friedrich; Aleschko, Markus; Mattanovich, Diethard; Gasser, Brigitte; Puxbaum, Verena

    2017-02-23

    The methylotrophic yeast Pichia pastoris (Komagataella spp.) is a popular microbial host for the production of recombinant proteins. Previous studies have shown that mis-sorting to the vacuole can be a bottleneck during production of recombinant secretory proteins in yeast, however, no information was available for P. pastoris. In this work the authors have therefore generated vps (vacuolar protein sorting) mutant strains disrupted in genes involved in the CORVET (class C core vacuole/endosome tethering) complex at the early stages of endosomal sorting. Both Δvps8 and Δvps21 strains contained lower extracellular amounts of heterologous carboxylesterase (CES) compared to the control strain, which could be attributed to a high proteolytic activity present in the supernatants of CORVET engineered strains due to rerouting of vacuolar proteases. Serine proteases were identified to be responsible for this proteolytic degradation by liquid chromatography-mass spectrometry and protease inhibitor assays. Deletion of the major cellular serine protease Prb1 in Δvps8 and Δvps21 strains did not only rescue the extracellular CES levels, but even outperformed the parental CES strain (56 and 80% higher yields, respectively). Further deletion of Ybr139W, another serine protease, did not show a further increase in secretion levels. Higher extracellular CES activity and low proteolytic activity were detected also in fed batch cultivation of Δvps21Δprb1 strains, thus confirming that modifying early steps in the vacuolar pathway has a positive impact on heterologous protein secretion.

  16. Protease-activated receptor-2 induces proinflammatory cytokine and chemokine gene expression in canine keratinocytes.

    PubMed

    Maeda, Shingo; Maeda, Sadatoshi; Ohno, Koichi; Kaji, Noriyuki; Hori, Masatoshi; Fujino, Yasuhito; Tsujimoto, Hajime

    2013-05-15

    Although the molecular basis of the allergenicity remains to be fully elucidated, the ability of allergens to elicit allergic responses is at least partly attributed to their proteolytic activity. Protease-activated receptor-2 (PAR-2) is a G protein-coupled receptor that is activated by site-specific proteolysis by serine proteases and is known to mediate inflammatory processes in various tissues. In this study, we investigated the effects of trypsin, a major serine protease, and a human PAR-2 agonist peptide (SLIGKV-NH2) on proinflammatory cytokine and chemokine gene expression in the canine keratinocyte cell line CPEK. The expression of PAR-2 mRNA and protein in CPEK cells was detected by RT-PCR and Western blotting, respectively. The localization of PAR-2 in CPEK was examined by immunofluorescence. The mRNA expression levels of proinflammatory cytokines and chemokines were quantified by real-time RT-PCR. The free intracellular Ca(2+) concentration was measured using the Ca(2+)-sensitive fluorescent dye. CPEK cells constitutively expressed PAR-2 mRNA and protein. Stimulation of CPEK cells with trypsin induced significant upregulation of the mRNA expression levels of tumor necrosis factor alpha (TNF-α, P<0.05), granulocyte-macrophage colony-stimulating factor (GM-CSF, P<0.01), thymus and activation regulated chemokine (TARC/CCL17, P<0.01), and interleukin 8 (IL-8/CXCL8, P<0.01). Similarly, the PAR-2 agonist peptide increased the mRNA expression levels of TNF-α (P<0.05), GM-CSF (P<0.05), TARC/CCL17 (P<0.05), and IL-8/CXCL8 (P<0.05) in CPEK cells. Both trypsin and the PAR-2 agonist peptide increased the intracellular Ca(2+) concentration and PAR-2 internalization. These results suggest that PAR-2 activation can augment inflammatory cytokine and chemokine expression in canine keratinocytes, and it may initiate allergic inflammation through the proteolytic activity of allergens in canine atopic dermatitis. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Effects of Enterococcus faecalis fsr genes on production of gelatinase and a serine protease and virulence.

    PubMed

    Qin, X; Singh, K V; Weinstock, G M; Murray, B E

    2000-05-01

    Three agr-like genes (fsrA, fsrB, and fsrC, for Enterococcus faecalis regulator) were found upstream of the previously reported gelatinase gene (gelE) and a downstream putative serine protease gene (sprE; accession number Z12296) of Enterococcus faecalis OG1RF. The deduced amino acid sequence of fsrA shows 26% identity and 38% similarity to Staphylococcus aureus AgrA (the response regulator of the accessory gene regulator system in the agr locus), FsrB shows 23% identity and 41% similarity to S. aureus AgrB, and FsrC shows 23% identity and 36% similarity to S. aureus AgrC (the sensor transducer of Agr system). Northern blot analysis suggested that gelE and sprE are cotranscribed and that fsrB and fsrC are also cotranscribed in OG1RF. Northern blot analysis of fsrA, fsrB, fsrC, gelE, and sprE insertion mutants showed that fsrB, fsrC, gelE, and sprE are not expressed in fsrA, fsrB, and fsrC mutants, while insertion in an open reading frame further upstream of fsrA did not effect the expression of these genes, suggesting that agr-like genes may be autoregulated and that they regulate gelE and sprE expression, as further confirmed by complementation of fsr gene mutations with a 6-kb fragment which contains all three fsr genes in the shuttle vector, pAT18. Testing of 95 other isolates of E. faecalis showed that 62% produced gelatinase (Gel(+)), while 91% (including all Gel(+) strains) hybridized to a gelE probe; 71% (including all Gel(+) strains) hybridized to an fsr probe, corroborating the conclusion that both gelE and fsr are necessary for gelatinase production. Testing of fsrA, fsrB, and sprE mutants in a mouse peritonitis model showed that sprE and agr-like gene mutants resulted in highly significantly prolonged survival compared to the parent strain OG1RF, a finding similar to what we had previously shown for a gelE mutant. These results suggest that sprE and agr-like genes contribute to the virulence of E. faecalis OG1RF in this model.

  18. Novel zinc protease gene isolated from Dictyostelium discoideum is structurally related to mammalian leukotriene A4 hydrolase.

    PubMed

    Fan, D; Hou, L S

    2015-12-09

    The allantoicase (allC) gene of Dictyostelium discoideum allC RNAi mutant strain was silenced using the RNA interference technique. The mutant strain is motile, aggregated, and could not undergo further morphological development. The growth rate is high and the cells show a shortened cell cycle comparing with wild-type D. discoideum. However, the mechanisms regarding these actions remain unclear. mRNA differential display was used in this study to identify genetic differences. A novel D. discoideum gene (GenBank accession number: KC759140) encoding a new zinc protease was cloned. The amino acid sequence of the novel gene exhibited a conserved zinc-binding domain (HEX2HX18E) that allowed its classification into the M1 family of metallopeptidases. The gene encoded a 345-amino acid protein with a theoretical molecular mass of 39.69 kDa and a theoretical pI of 6.05. This protein showed strong homology with leukotriene A4 (LTA4) hydrolase of Homo sapiens (41% identity and 60% similarity at the amino acid level). By analyzing quantitative reverse transcription-polymerase chain reaction data, this zinc protease gene was more highly expressed in D. discoideum allC RNAi mutant type than in wild-type KAx-3 cells during the trophophase. The novel zinc protease gene may function as an LTA4 hydrolase and contribute to the shortening of the allC RNAi mutant cell cycle.

  19. Identification and Partial Characterization of Extracellular Aspartic Protease Genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384

    PubMed Central

    Reid, Vernita J.; Theron, Louwrens W.; du Toit, Maret

    2012-01-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence. PMID:22820332

  20. Identification and partial characterization of extracellular aspartic protease genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384.

    PubMed

    Reid, Vernita J; Theron, Louwrens W; du Toit, Maret; Divol, Benoit

    2012-10-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence.

  1. Mosaic-like organization of IgA protease genes in Neisseria gonorrhoeae generated by horizontal genetic exchange in vivo.

    PubMed Central

    Halter, R; Pohlner, J; Meyer, T F

    1989-01-01

    IgA protease is a putative virulence factor that exists in several allelic forms in Neisseria gonorrhoeae. However, extracellular secretion of these variant IgA proteases occurs by the same pathway involving three steps of autoproteolytic maturation from a large precursor. Two principal precursor types (H1 and H2) can be distinguished with respect to the location of autoproteolytic sites and the sizes of the mature products. By partial DNA sequence analysis, additional variations have been detected which are not unique to one particular gene; rather, otherwise unrelated iga genes often share homology, thus revealing a composite organization. In the context of other gonococcal features, this observation implies that recombination has occurred in vivo between iga genes of different strains, probably via the route of species-specific DNA transformation. This process may be of general significance for the modulation and the natural exchange of virulence properties among pathogenic Neisseriae. Images PMID:2511009

  2. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.

    PubMed

    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke

    2009-02-20

    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices.

  3. The Aspergillus nidulans xprF gene encodes a hexokinase-like protein involved in the regulation of extracellular proteases.

    PubMed Central

    Katz, M E; Masoumi, A; Burrows, S R; Shirtliff, C G; Cheetham, B F

    2000-01-01

    The extracellular proteases of Aspergillus nidulans are produced in response to limitation of carbon, nitrogen, or sulfur, even in the absence of exogenous protein. Mutations in the A. nidulans xprF and xprG genes have been shown to result in elevated levels of extracellular protease in response to carbon limitation. The xprF gene was isolated and sequence analysis indicates that it encodes a 615-amino-acid protein, which represents a new type of fungal hexokinase or hexokinase-like protein. In addition to their catalytic role, hexokinases are thought to be involved in triggering carbon catabolite repression. Sequence analysis of the xprF1 and xprF2 alleles showed that both alleles contain nonsense mutations. No loss of glucose or fructose phosphorylating activity was detected in xprF1 or xprF2 mutants. There are two possible explanations for this observation: (1) the xprF gene may encode a minor hexokinase or (2) the xprF gene may encode a protein with no hexose phosphorylating activity. Genetic evidence suggests that the xprF and xprG genes are involved in the same regulatory pathway. Support for this hypothesis was provided by the identification of a new class of xprG(-) mutation that suppresses the xprF1 mutation and results in a protease-deficient phenotype. PMID:11102357

  4. Type II Transmembrane Serine Protease Gene Variants Associate with Breast Cancer

    PubMed Central

    Luostari, Kaisa; Hartikainen, Jaana M.; Tengström, Maria; Palvimo, Jorma J.; Kataja, Vesa

    2014-01-01

    Type II transmembrane serine proteases (TTSPs) are related to tumor growth, invasion, and metastasis in cancer. Genetic variants in these genes may alter their function, leading to cancer onset and progression, and affect patient outcome. Here, 464 breast cancer cases and 370 controls were genotyped for 82 single-nucleotide polymorphisms covering eight genes. Association of the genotypes was estimated against breast cancer risk, breast cancer–specific survival, and survival in different treatment groups, and clinicopathological variables. SNPs in TMPRSS3 (rs3814903 and rs11203200), TMPRSS7 (rs1844925), and HGF (rs5745752) associated significantly with breast cancer risk (Ptrend = 0.008–0.042). SNPs in TMPRSS1 (rs12151195 and rs12461158), TMPRSS2 (rs2276205), TMPRSS3 (rs3814903), and TMPRSS7 (rs2399403) associated with prognosis (P = 0.004–0.046). When estimating the combined effect of the variants, the risk of breast cancer was higher with 4–5 alleles present compared to 0–2 alleles (P = 0.0001; OR, 2.34; 95% CI, 1.39–3.94). Women with 6–8 survival-associating alleles had a 3.3 times higher risk of dying of breast cancer compared to women with 1–3 alleles (P = 0.001; HR, 3.30; 95% CI, 1.58–6.88). The results demonstrate the combined effect of variants in TTSPs and their related genes in breast cancer risk and patient outcome. Functional analysis of these variants will lead to further understanding of this gene family, which may improve individualized risk estimation and development of new strategies for treatment of breast cancer. PMID:25029565

  5. Gene characterization of two digestive serine proteases in orange blossom wheat midge (Sitodiplosis mosellana)

    USDA-ARS?s Scientific Manuscript database

    Two full length cDNA sequences, encoding digestive serine proteases (designated as SmPROT-1 and SmPROT-2), were recovered from the midgut of the wheat midge, Sitodiplosis mosellana in an ongoing EST project. The deduced amino acid sequences shared homology with digestive serine proteases from insect...

  6. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy

    PubMed Central

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming

    2016-01-01

    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN. PMID:27485391

  7. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy.

    PubMed

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming

    2016-08-03

    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN.

  8. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Occurrence and Evolution of the Paralogous Zinc Metalloproteases IgA1 Protease, ZmpB, ZmpC, and ZmpD in Streptococcus pneumoniae and Related Commensal Species

    PubMed Central

    Bek-Thomsen, Malene; Poulsen, Knud; Kilian, Mogens

    2012-01-01

    ABSTRACT The distribution, genome location, and evolution of the four paralogous zinc metalloproteases, IgA1 protease, ZmpB, ZmpC, and ZmpD, in Streptococcus pneumoniae and related commensal species were studied by in silico analysis of whole genomes and by activity screening of 154 representatives of 20 species. ZmpB was ubiquitous in the Mitis and Salivarius groups of the genus Streptococcus and in the genera Gemella and Granulicatella, with the exception of a fragmented gene in Streptococcus thermophilus, the only species with a nonhuman habitat. IgA1 protease activity was observed in all members of S. pneumoniae, S. pseudopneumoniae, S. oralis, S. sanguinis, and Gemella haemolysans, was variably present in S. mitis and S. infantis, and absent in S. gordonii, S. parasanguinis, S. cristatus, S. oligofermentans, S. australis, S. peroris, and S. suis. Phylogenetic analysis of 297 zmp sequences and representative housekeeping genes provided evidence for an unprecedented selection for genetic diversification of the iga, zmpB, and zmpD genes in S. pneumoniae and evidence of very frequent intraspecies transfer of entire genes and combination of genes. Presumably due to their adaptation to a commensal lifestyle, largely unaffected by adaptive mucosal immune factors, the corresponding genes in commensal streptococci have remained conserved. The widespread distribution and significant sequence diversity indicate an ancient origin of the zinc metalloproteases predating the emergence of the humanoid species. zmpB, which appears to be the ancestral gene, subsequently duplicated and successfully diversified into distinct functions, is likely to serve an important but yet unknown housekeeping function associated with the human host. PMID:23033471

  10. A novel aspartic acid protease gene from pineapple fruit (Ananas comosus): cloning, characterization and relation to postharvest chilling stress resistance.

    PubMed

    Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H

    2013-11-15

    A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits. Copyright © 2013 Elsevier GmbH. All rights reserved.

  11. Accurate sampling and deep sequencing of the HIV-1 protease gene using a Primer ID.

    PubMed

    Jabara, Cassandra B; Jones, Corbin D; Roach, Jeffrey; Anderson, Jeffrey A; Swanstrom, Ronald

    2011-12-13

    Viruses can create complex genetic populations within a host, and deep sequencing technologies allow extensive sampling of these populations. Limitations of these technologies, however, potentially bias this sampling, particularly when a PCR step precedes the sequencing protocol. Typically, an unknown number of templates are used in initiating the PCR amplification, and this can lead to unrecognized sequence resampling creating apparent homogeneity; also, PCR-mediated recombination can disrupt linkage, and differential amplification can skew allele frequency. Finally, misincorporation of nucleotides during PCR and errors during the sequencing protocol can inflate diversity. We have solved these problems by including a random sequence tag in the initial primer such that each template receives a unique Primer ID. After sequencing, repeated identification of a Primer ID reveals sequence resampling. These resampled sequences are then used to create an accurate consensus sequence for each template, correcting for recombination, allelic skewing, and misincorporation/sequencing errors. The resulting population of consensus sequences directly represents the initial sampled templates. We applied this approach to the HIV-1 protease (pro) gene to view the distribution of sequence variation of a complex viral population within a host. We identified major and minor polymorphisms at coding and noncoding positions. In addition, we observed dynamic genetic changes within the population during intermittent drug exposure, including the emergence of multiple resistant alleles. These results provide an unprecedented view of a complex viral population in the absence of PCR resampling.

  12. A genetic locus closely linked to a protease inhibitor gene complex controls the level of multiple RNA transcripts.

    PubMed Central

    Hill, R E; Shaw, P H; Barth, R K; Hastie, N D

    1985-01-01

    The two major protease inhibitors in mouse plasma are alpha 1-protease inhibitor (alpha 1-PI), putative inhibitor of neutrophil elastase, and contrapsin, an inhibitor in vitro of trypsinlike proteases. We have shown by nucleotide sequence analysis that these two inhibitors are related (R. E. Hill, P. H. Shaw, P. A. Boyd, H. Baumann, and N. D. Hastie, Nature (London) 311:175-177, 1984). Here, we show that the contrapsin and alpha 1-PI genes are members of two different multigene families, each containing at least three genes in mice and rats. We established the chromosomal locations of these genes by analyzing the segregation of restriction fragment length polymorphisms in recombinant inbred mouse strains. These experiments show that the multiple genes in each family are clustered and that the two gene families are closely linked on chromosome 12. Thus the genes for contrapsin and alpha 1-PI are likely to have evolved by duplication of a common ancestral gene. The contrapsin multigene family codes for multiple mRNA transcripts in the liver. There is a genetic difference among inbred mouse strains in the regulation of two of these transcripts. In some inbred strains the transcripts are synthesized constitutively; in others they are induced by inflammation. We mapped in recombinant inbred strains the regulatory locus responsible for this genetic variation and found it is linked to the contrapsin multigene family, which suggests a cis-acting regulatory element. We also found that the contrapsin and the alpha 1-PI multigene families have acquired very different regulatory responses since the time of the gene duplication event. Images PMID:2427931

  13. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin

    2014-02-01

    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  14. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    NASA Astrophysics Data System (ADS)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  15. Isolation and gene expression analysis of a papain-type cysteine protease in thermogenic skunk cabbage (Symplocarpus renifolius).

    PubMed

    Ito-Inaba, Yasuko; Masuko, Hiromi; Watanabe, Masao; Inaba, Takehito

    2012-01-01

    Skunk cabbage (Symplocarpus renifolius) spadices contain abundant transcripts for cysteine protease (CP). From thermogenic spadices, we isolated SrCPA, a highly expressed CP gene that encoded a papain-type CP. SrCPA is structurally similar to other plant CPs, including the senescence-associated CPs found in aroids. The expression of SrCPA increased during floral development, and was observed in all floral tissues except for the stamens.

  16. The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes.

    PubMed

    Seralini, G E; Bérubé, D; Gagné, R; Hammond, G L

    1990-11-01

    Human corticosteroid binding globulin (CBG) cDNA fragments were radiolabeled and hybridized in situ to metaphase chromosome preparations. The results localized the CBG gene to the q31-q32.1 region of human chromosome 14. This location also contains the genes for two closely related serine protease inhibitors: alpha 1-proteinase inhibitor and alpha 1-antichymotrypsin. It is therefore likely that these genes evolved by duplication events, and it would appear that this region contains a series of functionally related genes.

  17. Molecular cloning, sequencing analysis, and chromosomal localization of the human protease inhibitor 4 (Kallistatin) gene (P14)

    SciTech Connect

    Chai, K.X.; Chao, J.; Chao, L.; Ward, D.C.

    1994-09-15

    The gene encoding human protease inhibitor 4 (kallistatin; gene symbol PI4), a novel serine proteinase inhibitor (serpin), has been isolated and completely sequenced. The kallistatin gene is 9618 bp in length and contains five exons and four introns. The structure and organization of the kallistatin gene are similar to those of the genes encoding {alpha}{sub 1}-antichymotrypsin. The kallistatin gene is also similar to the genes encoding rat and mouse kallikrein-binding proteins. The first exon of the kallistatin gene is a noncoding 89-bp fragment, as determined by primer extension. The fifth exon, which contains 308 bp of noncoding sequence, encodes the reactive center of kallistatin. In the 5`-flanking region of the kallistatin gene, 1125 bp have been sequenced and a consensus promoter segment with potential transcription regulatory sites, including CAAT and TATA boxes, an AP-2 binding site, a GC-rich region, a cAMP response element, and an AP-1 binding site, has been identified within this region. The kallistatin gene was localized by in situ hybridization to human chromosome 14q31-132.1, close to the serpin genes encoding {alpha}{sub 1}-antichymotrypsin, protein C inhibitor, {alpha}{sub 1}-antitrypsin, and corticosteroid-binding globulin. In a genomic DNA Southern blot, kallistatin-related genes were identified in monkey, mouse, rat, bovine, dog, cat, and a ground mole. The patterns of hybridization revealed clues of human serpin evolution. 34 refs., 6 figs.

  18. The natural killer cell serine protease gene Lmet1 maps to mouse chromosome 10

    SciTech Connect

    Thia, K.Y.T.; Smyth, M.J.; Jenkins, N.A.; Gilbert, D.J.; Copeland, N.G.

    1995-01-01

    Cytotoxic lymphocytes play a key role in immune responses against viruses and tumors. Lymphocyte-mediated cytolysis by both cytotoxic T lymphocytes (CTL) and natural killer (NK) cells is often associated with the formation of membrane lesions on target cells caused by exocytosis of cytoplasmic granule serine proteases and a pore-forming protein, perforin. A variety of granzymes have been found to reside within the cytoplasmic granules of cytotoxic lymphocytes, but unlike perforin, isolated serine proteases are not intrinsically lytic. However, a role for serine proteases in cellular cytotoxicity has been supported by the ability of protease inhibitors to completely abrogate lymphocyte cytotoxicity, and the demonstration that serine proteases can initiate DNA fragmentation in target cells transfected or pretreated with a sublytic concentration of perforin. Granzymes cloned in human, mouse, and rat encode four granzyme activities and all are expressed in either T cells, their thymic precursors, and/or NK cells. In particular, a rat granzyme that cleaves after methionine residues, but not phenylalanine residues and its human equivalent, human Met-ase 1, are unique granzymes with restricted expression in CD3-NK cells. 24 refs., 2 figs.

  19. Plasmodium vivax rhomboid-like protease 1 gene diversity in Thailand.

    PubMed

    Mataradchakul, Touchchapol; Uthaipibull, Chairat; Nosten, Francois; Vega-Rodriguez, Joel; Jacobs-Lorena, Marcelo; Lek-Uthai, Usa

    2017-10-01

    Plasmodium vivax infection remains a major public health problem, especially along the Thailand border regions. We examined the genetic diversity of this parasite by analyzing single-nucleotide polymorphisms (SNPs) of the P. vivax rhomboid-like protease 1 gene (Pvrom1) in parasites collected from western (Tak province, Thai-Myanmar border) and eastern (Chanthaburi province, Thai-Cambodia border) regions. Data were collected by a cross-sectional survey, consisting of 47 and 45 P. vivax-infected filter paper-spotted blood samples from the western and eastern regions of Thailand, respectively during September 2013 to May 2014. Extracted DNA was examined for presence of P. vivax using Plasmodium species-specific nested PCR. Pvrom1 gene was PCR amplified, sequenced and the SNP diversity was analyzed using F-STAT, DnaSP, MEGA and LIAN programs. Comparison of sequences of the 92 Pvrom1 831-base open reading frames with that of a reference sequence (GenBank acc. no. XM001615211) revealed 17 samples with a total of 8 polymorphic sites, consisting of singleton (exon 3, nt 645) and parsimony informative (exon 1, nt 22 and 39; exon 3, nt 336, 537 and 656; and exon 4, nt 719 and 748) sites, which resulted in six different deduced Pvrom1 variants. Non-synonymous to synonymous substitutions ratio estimated by the DnaSP program was 1.65 indicating positive selection, but the Z-tests of selection showed no significant deviations from neutrality for Pvrom1 samples from western region of Thailand. In addition McDonald Kreitman test (MK) showed not significant, and Fst values are not different between the two regions and the regions combined. Interestingly, only Pvrom1 exon 2 was the most conserved sequences among the four exons. The relatively high degree of Pvrom1 polymorphism suggests that the protein is important for parasite survival in face of changes in both insect vector and human populations. These polymorphisms could serve as a sensitive marker for studying plasmodial

  20. Cloning, nucleotide sequence, and expression of the Pasteurella haemolytica A1 glycoprotease gene.

    PubMed Central

    Abdullah, K M; Lo, R Y; Mellors, A

    1991-01-01

    Pasteurella haemolytica serotype A1 secretes a glycoprotease which is specific for O-sialoglycoproteins such as glycophorin A. The gene encoding the glycoprotease enzyme has been cloned in the recombinant plasmid pH1, and its nucleotide sequence has been determined. The gene (designated gcp) codes for a protein of 35.2 kDa, and an active enzyme protein of this molecular mass can be observed in Escherichia coli clones carrying pPH1. In vivo labeling of plasmid-encoded proteins in E. coli maxicells demonstrated the expression of a 35-kDa protein from pPH1. The amino-terminal sequence of the heterologously expressed protein corresponds to that predicted from the nucleotide sequence. The glycoprotease is a neutral metalloprotease, and the predicted amino acid sequence of the glycoprotease contains a putative zinc-binding site. The gene shows no significant homology with the genes for other proteases of procaryotic or eucaryotic origin. However, there is substantial homology between gcp and an E. coli gene, orfX, whose product is believed to function in the regulation of macromolecule biosynthesis. Images PMID:1885539

  1. Effects of dietary soybean stachyose and phytic acid on gene expressions of serine proteases in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Mi, Haifeng; Mai, Kangsen; Zhang, Wenbing; Wu, Chenglong; Cai, Yinghua

    2011-09-01

    Soybean stachyose (SBS) and phytic acid (PA) are anti-nutritional factors (ANF) which have deleterious effects on the growth and digestibility in fish. The present research studied the effects of dietary SBS and PA on the expression of three serine protease genes in the liver of Japanese flounder ( Paralichthys olivaceus). These genes are trypsinogen 1 (poTRY), elastase 1 (poEL) and chymotrypsinogen 1 (poCTRY). Eight artificial diets with graded levels of supplemented ANFs were formulated to 4 levels of SBS (0.00, 0.40, 0.80 and 1.50%), 4 levels of PA (0.00, 0.20, 0.40 and 0.80), respectively. Japanese flounder (initial weight 2.45 g ± 0.01 g) were fed with these diets for 10 weeks with three replications per treatment. At the end of 10 weeks, supplementation of 0.40% of dietary SBS or PA significantly increased the gene expression of poTRY and poCTRY ( P<0.05). The same level of dietary SBS significantly decreased the gene expression of poEL. In comparison with the control group (ANF-free), dietary PA (0.2% and 0.8%) significantly decreased the gene expression of poTRY, poCTRY and poEL ( P<0.05). However, excessive supplement of dietary SBS (1.5%) has no significant effects on these gene expressions ( P>0.05). These results suggested that dietary SBS and dietary PA could directly affect the serine protease genes at the transcriptional level in Japanese flounder, and these genes' expression was more sensitive to dietary PA than to SBS under the current experimental conditions.

  2. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    USDA-ARS?s Scientific Manuscript database

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  3. Characterization of a juvenile hormone-regulated chymotrypsin-like serine protease gene in Aedes aegypti mosquito.

    PubMed

    Bian, Guowu; Raikhel, Alexander S; Zhu, Jinsong

    2008-02-01

    After female mosquitoes ingest blood from vertebrate hosts, exopeptidases and endopeptidases are required for digesting blood proteins in the midgut into amino acids, which female mosquitoes use to build yolk proteins. These proteases are not always present in the midgut, and their diverse expression patterns suggest that production of these enzymes is highly regulated in order to meet specific physiological demands at various stages. Here we report identification of a serine-type protease, JHA15, in the yellow fever mosquito Aedes aegypti. This protein shares high sequence homology with chymotrypsins, and indeed exhibits specific chymotrypsin enzymatic activity. The JHA15 gene is expressed primarily in the midgut of adult female mosquitoes. Our results indicate that its transcription is activated by juvenile hormone in the newly emerged female adults. Although its mRNA profile is similar to that of the early trypsin gene, we found that JHA15 proteins were readily detected in the midgut epithelium cells of both non-blood-fed and blood-fed mosquitoes. Analysis of polysomal RNA further substantiated that synthesis of JHA15 occurs before and shortly after blood feeding. Knocking down expression of JHA15 resulted in no evident phenotypic changes, implying that functional redundancy exists among those proteolytic enzymes.

  4. Identification, Characterization and Down-Regulation of Cysteine Protease Genes in Tobacco for Use in Recombinant Protein Production

    PubMed Central

    Duwadi, Kishor; Chen, Ling; Menassa, Rima; Dhaubhadel, Sangeeta

    2015-01-01

    Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL)-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP) in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10) were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER), suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves. PMID:26148064

  5. Cloning and characteristic analysis of a novel aspartic protease gene Asp55 from Trichoderma asperellum ACCC30536.

    PubMed

    Dou, Kai; Wang, Zhiying; Zhang, Rongshu; Wang, Na; Fan, Haijuan; Diao, Guiping; Liu, Zhihua

    2014-12-01

    Proteases secreted by fungi belonging to the genus Trichoderma play important roles in biocontrol. In this study, the coding sequence and promoter region of the novel aspartic protease gene Asp55 were cloned from strain Trichoderma asperellum ACCC30536. Many cis-elements involved in phytopathogenic and environmental stress responses were identified in the Asp55 promoter region and may be recognized by MYB or WRKY transcription factors. The expression pattern of Asp55 under eight culture conditions was investigated by RT-qPCR. The expression level of Asp55 was up-regulated by poplar stem powder, Alternaria alternata cell wall fragments and A. alternata fermentation liquid, while it was down-regulated by carbon and nitrogen source starvation, and by powdered poplar leaves and roots. Additionally, the expression patterns of 15 genes encoding MYB transcription factors (Myb1 to Myb15) were also analyzed by RT-qPCR. Myb2 showed the most similar expression pattern with Asp55. The cDNA of Asp55 was expressed in Escherichia coli BL21, and recombinant ASP55 (rASP55) was purified. The purified rASP55 was evaluated for enzymatic activity and showed inhibitory effect on phytopathogenic A. alternata.

  6. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    PubMed

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  7. Cloning and targeted disruption, via Agrobacterium tumefaciens-mediated transformation, of a trypsin protease gene from the vascular wilt fungus Verticillium dahliae.

    PubMed

    Dobinson, Katherine F; Grant, Sandra J; Kang, Seogchan

    2004-02-01

    A gene encoding a trypsin protease was isolated from a tomato isolate of Verticillium dahliae. The gene, designated VTP1, contains two introns and is predicted to encode a protein of 256 amino acids. The gene is present in V. dahliae isolates from different host plants and in V. albo-atrum; weakly hybridizing sequences are present in V. tricorpus. VTP1 cDNA sequences were identified in a sequence tag analysis of genes expressed under growth conditions that promote microsclerotia development. Replacement of the gene, by Agrobacterium tumefaciens-mediated transformation (ATMT), with a mutant allele construct did not noticeably alter either pathogenicity or growth in culture. Searches of expressed sequence tag databases showed that, in addition to the VTP1 gene, V. dahliae contains two genes encoding subtilisin-like proteases similar to those produced by pathogenic Aspergillus spp. This is the first description of the application of ATMT to the molecular analysis of phytopathogenic Verticillium spp.

  8. Enhanced heterologous protein display on bacterial magnetic particles using a lon protease gene deletion mutant in Magnetospirillum magneticum AMB-1.

    PubMed

    Kanetsuki, Yuka; Tanaka, Tsuyoshi; Matsunaga, Tadashi; Yoshino, Tomoko

    2013-07-01

    Bacterial magnetic particles (BacMPs) produced by the magnetotactic bacterium Magnetospirillum magneticum AMB-1, are used as magnetic supports or carriers for a variety of biomedical and environmental applications. Although protein expression systems on BacMPs have been established in previous studies, the expression efficiency was dependent on the introduced protein sequences. Recombinant human proteins are often poorly expressed on BacMPs because of proteolytic degradation by endogenous proteases. We constructed a lon protease gene deletion mutant strain (Δlon) of M. magneticum AMB-1 by homologous recombination to increase the efficiency of functional protein display on BacMPs using Δlon host cells. Wild-type and Δlon-M. magneticum AMB-1 cells were transformed using expression plasmids for human proteins, thyroid-stimulating hormone receptor (TSHR) and the class II major histocompatibility complex (MHC II) molecules onto BacMPs. Although mRNA expression of both TSHR and MHC II was the same level in the wild-type and Δlon transformants, the protein expression levels in Δlon transformants were significantly increased versus wild-type cells. Furthermore, the amounts of two different human proteins on BacMPs were successfully improved. This phenomenon could be due to the reduction of the degradation of target proteins in the Δlon strain. This is the first report to construct a protease deletion mutant in magnetotactic bacteria. The Δlon strain is a useful host to provide BacMPs displaying target proteins for various experimental, and ultimately, clinical applications. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Comparison of HCV NS3 protease and NS5B polymerase inhibitor activity in 1a, 1b and 2a replicons and 2a infectious virus.

    PubMed

    Paulson, Matthew S; Yang, Huiling; Shih, I-hung; Feng, Joy Y; Mabery, Eric M; Robinson, Margaret F; Zhong, Weidong; Delaney, William E

    2009-08-01

    The hepatitis C virus infection system represents an important new tool for drug discovery. In this study, we compared the in vitro antiviral efficacy of several NS3 and NS5B inhibitors in genotype 1a, 1b, and 2a replicons and in the 2a infectious virus system. The nucleoside inhibitor 2'-C-methyl adenosine showed similar efficacy in each system tested. Three non-nucleoside inhibitors had small differences in potency between genotype 1a and 1b. In contrast, there was a dramatic loss of potency for these non-nucleoside inhibitors in the genotype 2a replicon, 2a infectious virus, and 2a NS5B biochemical assays. The protease inhibitor BILN-2061 had similar efficacy against 1a and 1b replicons but was 61-109-fold less potent against the 2a replicon and virus, respectively. VX-950, a covalent protease inhibitor, had similar efficacy (<3-fold changes in EC(50)) regardless of genotype or subtype. Importantly, we observed a significant correlation (p<0.0001) in antiviral potency between the 2a replicon and 2a infectious virus for all classes of compounds tested.

  10. Gene cloning, molecular modeling, and phylogenetics of serine protease P32 and serine carboxypeptidase SCP1 from nematophagous fungi Pochonia rubescens and Pochonia chlamydosporia.

    PubMed

    Larriba, Eduardo; Martín-Nieto, José; Lopez-Llorca, Luis Vicente

    2012-07-01

    The fungi Pochonia chlamydosporia and Pochonia rubescens are parasites of nematode eggs and thus are biocontrol agents of nematodes. Proteolytic enzymes such as the S8 proteases VCP1 and P32, secreted during the pathogenesis of nematode eggs, are major virulence factors in these fungi. Recently, expression of these enzymes and of SCP1, a new putative S10 carboxypeptidase, was detected during endophytic colonization of barley roots by these fungi. In our study, we cloned the genomic and mRNA sequences encoding P32 from P. rubescens and SCP1 from P. chlamydosporia. P32 showed a high homology with the serine proteases Pr1A from the entomopathogenic fungus Metarhizium anisopliae and VCP1 from P. chlamydosporia (86% and 76% identity, respectively). However, the catalytic pocket of P32 showed differences in the amino acids of the substrate-recognition sites compared with the catalytic pockets of Pr1A and VCP1 proteases. Phylogenetic analysis of P32 suggests a common ancestor with protease Pr1A. SCP1 displays the characteristic features of a member of the S10 family of serine proteases. Phylogenetic comparisons show that SCP1 and other carboxypeptidases from filamentous fungi have an origin different from that of yeast vacuolar serine carboxypeptidases. Understanding protease genes from nematophagous fungi is crucial for enhancing the biocontrol potential of these organisms.

  11. A nodule-specific gene encoding a subtilisin-like protease is expressed in early stages of actinorhizal nodule development.

    PubMed Central

    Ribeiro, A; Akkermans, A D; van Kammen, A; Bisseling, T; Pawlowski, K

    1995-01-01

    To identify genes specifically expressed during early stages of actinorhizal nodule development, a cDNA library made from poly(A) RNA from root nodules of Alnus glutinosa was screened differentially with nodule and root cDNA, respectively. Seven nodule-enhanced and four nodule-specific cDNA clones were isolated. By using in situ hybridization, two of the nodule-specific cDNAs were shown to be expressed at the highest levels in infected cells before the onset of nitrogen fixation; one of them, ag12 (A. glutinosa), was examined in detail. Sequencing showed that ag12 codes for a serine protease of the subtilisin (EC 3.4.21.14) family. Subtilisins previously appeared to be limited to microorganisms. However, subtilisin-like serine proteases have recently been found in archaebacteria, fungi, and yeasts as well as in mammals; a plant subtilisin has also been sequenced. In yeast and mammals, subtilases are responsible for processing peptide hormones. A homolog of ag12, ara12, was identified in Arabidopsis; it was expressed in all organs, and its expression levels were highest during silique development. Hence, our study shows that subtilases are also involved in both symbiotic and nonsymbiotic processes in plant development. PMID:7647567

  12. A nodule-specific gene encoding a subtilisin-like protease is expressed in early stages of actinorhizal nodule development.

    PubMed

    Ribeiro, A; Akkermans, A D; van Kammen, A; Bisseling, T; Pawlowski, K

    1995-06-01

    To identify genes specifically expressed during early stages of actinorhizal nodule development, a cDNA library made from poly(A) RNA from root nodules of Alnus glutinosa was screened differentially with nodule and root cDNA, respectively. Seven nodule-enhanced and four nodule-specific cDNA clones were isolated. By using in situ hybridization, two of the nodule-specific cDNAs were shown to be expressed at the highest levels in infected cells before the onset of nitrogen fixation; one of them, ag12 (A. glutinosa), was examined in detail. Sequencing showed that ag12 codes for a serine protease of the subtilisin (EC 3.4.21.14) family. Subtilisins previously appeared to be limited to microorganisms. However, subtilisin-like serine proteases have recently been found in archaebacteria, fungi, and yeasts as well as in mammals; a plant subtilisin has also been sequenced. In yeast and mammals, subtilases are responsible for processing peptide hormones. A homolog of ag12, ara12, was identified in Arabidopsis; it was expressed in all organs, and its expression levels were highest during silique development. Hence, our study shows that subtilases are also involved in both symbiotic and nonsymbiotic processes in plant development.

  13. Isolation and characterization of the hyperthermostable serine protease, pyrolysin, and its gene from the hyperthermophilic archaeon Pyrococcus furiosus.

    PubMed

    Voorhorst, W G; Eggen, R I; Geerling, A C; Platteeuw, C; Siezen, R J; Vos, W M

    1996-08-23

    The hyperthermostable serine protease pyrolysin from the hyperthermophilic archaeon Pyrococcus furiosus was purified from membrane fractions. Two proteolytically active fractions were obtained, designated high (HMW) and low (LMW) molecular weight pyrolysin, that showed immunological cross-reaction and identical NH2-terminal sequences in which the third residue could be glycosylated. The HMW pyrolysin showed a subunit mass of 150 kDa after acid denaturation. Incubation of HMW pyrolysin at 95 degrees C resulted in the formation of LMW pyrolysin, probably as a consequence of COOH-terminal autoproteolysis. The 4194-base pair pls gene encoding pyrolysin was isolated and characterized, and its transcription initiation site was identified. The deduced pyrolysin sequence indicated a prepro-enzyme organization, with a 1249-residue mature protein composed of an NH2-terminal catalytic domain with considerable homology to subtilisin-like serine proteases and a COOH-terminal domain that contained most of the 32 possible N-glycosylation sites. The archaeal pyrolysin showed highest homology with eucaryal tripeptidyl peptidases II on the amino acid level but a different cleavage specificity as shown by its endopeptidase activity toward caseins, casein fragments including alphaS1-casein and synthetic peptides.

  14. Molecular characterization of a gene encoding extracellular serine protease isolated from a subtilisin inhibitor-deficient mutant of Streptomyces albogriseolus S-3253.

    PubMed Central

    Taguchi, S; Odaka, A; Watanabe, Y; Momose, H

    1995-01-01

    An extracellular serine protease produced by a mutant, M1, derived from Streptomyces albogriseolus S-3253 that no longer produces a protease inhibitor (Streptomyces subtilisin inhibitor [SSI]) was isolated. A 20-kDa protein was purified by its affinity for SSI and designated SAM-P20. The amino acid sequence of the amino-terminal region of SAM-P20 revealed high homology with the sequences of Streptomyces griseus proteases A and B, and the gene sequence confirmed the relationships. The sequence also revealed a putative amino acid signal sequence for SAM-P20 that apparently functioned to allow secretion of SAM-P20 from Escherichia coli carrying the recombinant gene. SAM-P20 produced by E. coli cells was shown to be sensitive to SSI inhibition. PMID:7887600

  15. Effects of different dietary conditions on the expression of trypsin- and chymotrypsin-like protease genes in the digestive system of the migratory locust, Locusta migratoria.

    PubMed

    Spit, Jornt; Zels, Sven; Dillen, Senne; Holtof, Michiel; Wynant, Niels; Vanden Broeck, Jozef

    2014-05-01

    While technological advancements have recently led to a steep increase in genomic and transcriptomic data, and large numbers of protease sequences are being discovered in diverse insect species, little information is available about the expression of digestive enzymes in Orthoptera. Here we describe the identification of Locusta migratoria serine protease transcripts (cDNAs) involved in digestion, which might serve as possible targets for pest control management. A total of 5 putative trypsin and 15 putative chymotrypsin gene sequences were characterized. Phylogenetic analysis revealed that these are distributed among 3 evolutionary conserved clusters. In addition, we have determined the relative gene expression levels of representative members in the gut under different feeding conditions. This study demonstrated that the transcript levels for all measured serine proteases were strongly reduced after starvation. On the other hand, larvae of L. migratoria displayed compensatory effects to the presence of Soybean Bowman Birk (SBBI) and Soybean Trypsin (SBTI) inhibitors in their diet by differential upregulation of multiple proteases. A rapid initial upregulation was observed for all tested serine protease transcripts, while only for members belonging to class I, the transcript levels remained elevated after prolonged exposure. In full agreement with these results, we also observed an increase in proteolytic activity in midgut secretions of locusts that were accustomed to the presence of protease inhibitors in their diet, while no change in sensitivity to these inhibitors was observed. Taken together, this paper is the first comprehensive study on dietary dependent transcript levels of proteolytic enzymes in Orthoptera. Our data suggest that compensatory response mechanisms to protease inhibitor ingestion may have appeared early in insect evolution.

  16. Reducing Amyloid Plaque Burden via Ex Vivo Gene Delivery of an Aβ-Degrading Protease: A Novel Therapeutic Approach to Alzheimer Disease

    PubMed Central

    Hemming, Matthew L; Patterson, Michaela; Reske-Nielsen, Casper; Lin, Ling; Isacson, Ole; Selkoe, Dennis J

    2007-01-01

    Background Understanding the mechanisms of amyloid-β protein (Aβ) production and clearance in the brain has been essential to elucidating the etiology of Alzheimer disease (AD). Chronically decreasing brain Aβ levels is an emerging therapeutic approach for AD, but no such disease-modifying agents have achieved clinical validation. Certain proteases are responsible for the catabolism of brain Aβ in vivo, and some experimental evidence suggests they could be used as therapeutic tools to reduce Aβ levels in AD. The objective of this study was to determine if enhancing the clearance of Aβ in the brain by ex vivo gene delivery of an Aβ-degrading protease can reduce amyloid plaque burden. Methods and Findings We generated a secreted form of the Aβ-degrading protease neprilysin, which significantly lowers the levels of naturally secreted Aβ in cell culture. We then used an ex vivo gene delivery approach utilizing primary fibroblasts to introduce this soluble protease into the brains of β-amyloid precursor protein (APP) transgenic mice with advanced plaque deposition. Brain examination after cell implantation revealed robust clearance of plaques at the site of engraftment (72% reduction, p = 0.0269), as well as significant reductions in plaque burden in both the medial and lateral hippocampus distal to the implantation site (34% reduction, p = 0.0020; and 55% reduction, p = 0.0081, respectively). Conclusions Ex vivo gene delivery of an Aβ-degrading protease reduces amyloid plaque burden in transgenic mice expressing human APP. These results support the use of Aβ-degrading proteases as a means to therapeutically lower Aβ levels and encourage further exploration of ex vivo gene delivery for the treatment of Alzheimer disease. PMID:17760499

  17. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  18. Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes

    PubMed Central

    Dutta, Tushar K.; Papolu, Pradeep K.; Banakar, Prakash; Choudhary, Divya; Sirohi, Anil; Rao, Uma

    2015-01-01

    Root-knot nematodes (Meloidogyne incognita) cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco, and soybean) that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1), was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60–80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants. PMID:25883594

  19. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    PubMed

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress.

  20. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori.

    PubMed

    Zhao, Ping; Dong, Zhaoming; Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou

    2012-01-01

    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein.

  1. Genome-Wide Identification and Immune Response Analysis of Serine Protease Inhibitor Genes in the Silkworm, Bombyx mori

    PubMed Central

    Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou

    2012-01-01

    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein. PMID:22348050

  2. HDL/ApoA-1 infusion and ApoA-1 gene therapy in atherosclerosis

    PubMed Central

    Chyu, Kuang-Yuh; Shah, Prediman K.

    2015-01-01

    The HDL hypothesis stating that simply raising HDL cholesterol (HDL-C) may produce cardiovascular benefits has been questioned recently based on several randomized clinical trials using CETP inhibitors or niacin to raise HDL-C levels. However, extensive pre-clinical data support the vascular protective effects of administration of exogenous ApoA-1 containing preβ-HDL like particles. Several small proof-of-concept clinical trials using such HDL/ApoA-1 infusion therapy have shown encouraging results but definitive proof of efficacy must await large scale clinical trials. In addition to HDL infusion therapy an alternative way to exploit beneficial cardiovascular effects of HDL/ApoA-1 is to use gene transfer. Preclinical studies have shown evidence of benefit using this approach; however clinical validation is yet lacking. This review summarizes our current knowledge of the aforementioned strategies. PMID:26388776

  3. Cloning and Characterization of TPE4A, a Thiol-Protease Gene Induced during Ovary Senescence and Seed Germination in Pea1

    PubMed Central

    Cercós, Manuel; Santamaría, Salvador; Carbonell, Juan

    1999-01-01

    A cDNA clone encoding a thiol-protease (TPE4A) was isolated from senescent ovaries of pea (Pisum sativum) by reverse transcriptase-polymerase chain reaction. The deduced amino acid sequence of TPE4A has the conserved catalytic amino acids of papain. It is very similar to VSCYSPROA, a thiol-protease induced during seed germination in common vetch. TPE4A mRNA levels increase during the senescence of unpollinated pea ovaries and are totally suppressed by treatment with gibberellic acid. In situ hybridization indicated that TPE4A mRNA distribution in senescent pea ovaries is different from that of previously reported thiol-proteases induced during senescence, suggesting the involvement of different proteases in the mobilization of proteins from senescent pea ovaries. TPE4A is also induced during the germination of pea seeds, indicating that a single protease gene can be induced during two different physiological processes, senescence and germination, both of which require protein mobilization. PMID:10198093

  4. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  5. Use of a cloned multidrug resistance gene for coamplification and overproduction of major excreted protein, a transformation-regulated secreted acid protease

    SciTech Connect

    Kane, S.E.; Troen, B.R.; Gal, S.; Ueda, K.; Pastan, I.; Gottesman, M.M.

    1988-08-01

    Malignantly transformed mouse fibroblasts synthesize and secrete large amounts of major excreted protein (MEP), a 39,000-dalton precursor to an acid protease (cathepsin L). To evaluate the possible role of this protease in the transformed phenotype, the authors transfected cloned genes for mouse or human MEP into mouse MIH 3T3 cells with an expression vector for the dominant, selectable human multidrug resistance (MDR1) gene. The cotransfected MEP sequences were efficiently coamplified and transcribed during stepwise selection for multidrug resistance in colchicine. The transfected NIH 3T3 cell lines containing amplified MEP sequences synthesized as much MEP as did Kirsten sarcoma virus-transformed NIH 3T3 cells. The MEP synthesized by cells transfected with the cloned mouse and human MEP genes were also secreted. Elevated synthesis and secretion of MEP by NIH 3T3 cells did not change the nontransformed phenotype of these cells.

  6. Evidence of bovine immunoglobulin G1 (IgG1) protease activity in partially purified culture supernate of Pasteurella haemolytica A1.

    PubMed Central

    Lee, C W; Shewen, P E

    1996-01-01

    In the bovine respiratory tract, IgG1 is a major secretory immunoglobulin (Ig), and both IgG1 and IgG2 are believed to be important in defense against pneumonic pasteurellosis (shipping fever) in calves. Here we provide evidence for hydrolysis of IgG1 in the presence of partially purified culture supernate (ppCS) from the respiratory pathogen Pasteurella haemolytica A1. Bovine IgG1 was hydrolysed sequentially into three distinct bands (approximately 39, 12, and 7 kDa respectively). Furthermore, partial hydrolysis of bovine IgG2 was observed, but neither bovine IgA nor IgM were affected by incubation with ppCS. These findings suggest that the production of an IgG1-specific protease by P. haemolytica A1 may be a virulence mechanism contributing to the pathogenesis of bovine pneumonic pasteurellosis. Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. PMID:8785718

  7. Prorenin processing enzyme (PPE) produced by Baculovirus-infected Sf-9 insect cells: PPE is the cysteine protease encoded in the acMNPV gene.

    PubMed

    Gotoh, Takeshi; Awa, Hirono; Kikuchi, Ken-Ichi; Nirasawa, Satoru; Takahashi, Saori

    2010-01-01

    In infection cultures of Spodoptera frugiperda (Sf-9) insect cells with a recombinant baculovirus, vhpR, carrying human preprorenin cDNA in the polyhedrin locus of Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), the expressed inactive recombinant human (rh)-prorenin is reported to be proteolytically processed to yield active rh-renin in the very late phase of culture (Takahashi et al., Biosci. Biotechnol. Biochem., 71, 2610-2613 (2007)). To identify the enzyme that catalyzes the processing of rh-prorenin, referred to as prorenin processing enzyme (PPE), we purified potential PPE from virus-infected Sf-9 culture supernatant by the use of an internally quenched fluorescent (IQF) substrate for PPE. The 32-kDa protein band agreed well with PPE activity on the final Mono Q FPLC. By N-terminal amino acid sequence analysis, the protein was revealed to be a cysteine protease encoded by the AcMNPV gene. Enzyme activity was inhibited by cysteine protease inhibitors but not by other protease inhibitors. When the purified rh-prorenin was incubated with the 32-kDa protein, renin activity appeared concomitant with the disappearance of rh-prorenin. The N-terminal amino acid sequence of the activated product was identical to that of the rh-renin that had accumulated in the infection cultures. These results indicate that the 32-kDa cysteine protease derived from the AcMNPV gene is the enzyme PPE of virus-infected Sf-9 cells.

  8. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  9. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

    PubMed

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  10. Expression characterization, genomic structure and function analysis of fish ubiquitin-specific protease 18 (USP18) genes.

    PubMed

    Chen, Chen; Zhang, Yi-Bing; Gui, Jian-Fang

    2015-10-01

    In mammals, USP18 (ubiquitin-specific protease 18) is an interferon (IFN) inducible protein and plays a role in regulation of IFN response upon viral infection. In this study, we first cloned a USP18 homologous gene from virally-infected crucian carp (Carassius auratus) blastula embryonic (CAB) cells, and later found in other fish species including zebrafish. All fish USP18 genes have 10 exons and 9 introns comparable to 11 exons and 10 introns in non-fish vertebrates. Expression analysis revealed that fish USP18 was significantly induced in vitro and in vivo by IFN and IFN stimuli. Using promoter-driven luciferase reporter assay system to explore the molecular mechanism underlying fish USP18 expression, fish USP18 was identified as a typical interferon (IFN)-stimulated gene (ISG). Intracellular poly(I:C)-triggered zebrafish USP18 expression was regulated through RLR-IFN pathway, which was consistent with the fact that fish USP18 gene promoter contained two typical IFN-stimulated response elements (ISREs). Further mutation assays revealed that the distant ISRE motif primarily contributed to the induction of zebrafish USP18 by fish IFN and IFN stimuli. Functionally, fish USP18 inhibited poly(I:C)- and IFN-triggered activation of a common ISRE-containing promoter, and attenuated transcriptional expression of some ISGs including Stat1 and PKZ by recombinant IFN. Finally, we found that fish USP18 protein was expressed in cytoplasm and exhibited an ability to interact with ISG15. These results indicate that fish USP18 likely exerts its function similar to mammalian homologs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Passive smoking, Cyp1A1 gene polymorphism and dysmenorrhea

    PubMed Central

    Liu, Hong; Yang, Fan; Li, Zhiping; Chen, Changzhong; Fang, Zhian; Wang, Lihua; Hu, Yonghua; Chen, Dafang

    2007-01-01

    Objective This study investigated whether the association between passive smoking exposure and dysmenorrhea is modified by two susceptibility genes, CYP1A1MspI and CYP1A1HincII. Methods This report includes 1645 (1124 no dysmenorrhea, 521 dysmenorrhea) nonsmoking and nondrinking newly wed female workers at Anqing, China between June 1997 and June 2000. Multiple logistic regression models were used to estimate the associations of passive smoking exposure and genetic susceptibility with dysmenorrhea, adjusting for perceived stress. Results When stratified by women genotype, the adjusted OR of dysmenorrhea was 1.6 (95%CI=1.3-2.1) for passive smoking group with Ile/Ile462 genotype, and 1.5 (95%CI=1.1-2.1) with C/C6235 genotype, compared to non passive smoking group, respectively. The data further showed that there was a significant combined effect between passive smoking and the CYP1A1 Msp1 C/C6235 and HincII Ile/Ile462 genotype (OR=2.6, 95%CI=1.3-5.2). Conclusion CYP1A1 MspI and HincII genotypes modified the association between passive smoking and dysmenorrhea. PMID:17566695

  12. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    PubMed Central

    2011-01-01

    Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI) had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be important for male reproduction. The recombinantly produced proteins are presumably bioactive, as demonstrated with similarly made BPTI, but may have a narrower spectrum of inhibition, as indicated by the lacking activity against eight proteases with differing specificity. Another possibility is that they have lost the protease inhibiting properties, which is typical of Kunitz domains, in

  13. The human granzyme A (HFSP, CTLA3) gene maps to 5q11-q12 and defines a new locus of the serine protease superfamily

    SciTech Connect

    Fink, T.M.; Lichter, P. ); Wekerle, H.; Zimmer, M.; Jenne, D.E. )

    1993-11-01

    Human granzyme A (HFSP, Hanukah factor serine protease; CTLA3, cytotoxic T-lymphocyte-associated serine esterase-3), a homodimeric, trypsin-like serine protease of 60 kDa found in granules of cytolytic T cells and natural killer cells, is implicated in lymphocyte-mediated target cell lysis. It contributes to DNA fragmentation in perforin (PRF1)-lysed target cells through an unknown mechanism. The authors have isolated a cosmid clone for the functional gene of human granzyme A and established its complete exon-intron map of 10 kb. Using an 11-kb subfragment of the cloned genomic DNA as a probe, they have identified the chromosomal position of human granzyme A on 5q11-q12. Thus, the human granzyme A gene falls into a region of homology between human chromosome 5 and mouse chromosome 13, band D, where the mouse granzyme A gene has been located previously. The granzyme A gene is not linked to known members of the large superfamily of serine proteases. 20 refs., 2 figs.

  14. Proteases in Fas-mediated apoptosis.

    PubMed

    Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S

    1997-01-01

    Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.

  15. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  16. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  17. Mutations in the helper component protease gene of zucchini yellow mosaic virus affect its ability to mediate aphid transmissibility.

    PubMed

    Huet, H; Gal-On, A; Meir, E; Lecoq, H; Raccah, B

    1994-06-01

    The nucleotide sequence of the helper component protease (HC-Pro) genes of three zucchini yellow mosaic virus (ZYMV) strains has been compared with that of a helper-deficient strain of ZYMV-HC. The comparisons revealed three unique deduced amino acid differences. Two of these mutations were located in regions which are conserved in other potyviruses. The role of these mutations in aphid transmissibility was examined by exchanging DNA fragments of part of the deficient HC-Pro gene with the respective section within the gene of the infectious full-length clone of the aphid-transmissible ZYMV. The first exchange included two of the three mutations, the first coding for a change from Asp to Gly (in a non-conserved region) and the second coding for a change from Arg to Ile [within the Phe-Arg-Asp-Lys (FRNK) conserved box]. This exchange resulted in a reduced transmission (20.6% for the mutated virus compared with 57.4% in the normal ZYMV when acquired from plants and 37.2% compared with 83.1%, respectively, when acquired from membranes). The second exchange incorporated a single mutation [conferring a change from Thr to Ala within the Pro-Thr-Lys (PTK) conserved box]. This single mutation resulted in almost total loss of HC activity in aphid transmission both from plants and from membranes. The Lys residue in the conserved Lys-Ile-Thr-Cys (KITC) box, which is related to loss of HC activity in potato virus Y, tobacco vein mottling virus and in the Michigan strain of ZYMV, is unchanged in the helper-deficient ZYMV. It is therefore proposed that more than one site in HC-Pro may be functionally related to aphid transmissibility. The possible reasons for the role of these mutations in helper activity in aphid transmission of ZYMV are discussed.

  18. The expression of a recombinant cry1Ac gene with subtilisin-like protease CDEP2 gene in acrystalliferous Bacillus thuringiensis by Red/ET homologous recombination.

    PubMed

    Xia, Liqiu; Zeng, Zhi; Ding, Xuezhi; Huang, Fan

    2009-10-01

    A novel cDNA encoding the subtilisin-like serine protease gene CDEP2 was isolated from Beauveria bassiana by reverse transcription polymerase chain reaction (RT-PCR). It contained an 1137 bp ORF that predicted a protein of 379 amino acids with M = 38863 Da and pI = 8.21. In an attempt to improve insecticidal activity, the CDEP2 gene and the cry1Ac gene from Bacillus thuringiensis were co-fused into the vector pHT315 as pHAc-CDEP2 plasmid by Red/ET homologous recombination. The co-fusion gene was attempted under the control of the native cry1Ac promoter. Plasmid pHAc-CDEP2 was electro-transformed into the B. thuringiensis subsp. kurstaki Cry(-)B. Analyzed by SDS-PAGE and Western blotting, the transformant Cry(-)B-pHAc-CDEP2 strain produced a 130 kDa Cry1Ac protein and 39 kDa CDEP2 protein. The 50% lethal concentration values (LC(50)) of Cry(-)B-pHAc-CDEP2 strain (8.5 microl/ml) to Helicoverpa armigera third instars larvae was clearly higher than the Cry(-)B-pHAc strain (16.7 microl/ml) at 72 h.

  19. Transcriptional Gene Silencing Maintained by OTS1 SUMO Protease Requires a DNA-Dependent Polymerase V-Dependent Pathway1[OPEN

    PubMed Central

    Liu, Lei; Yan, Xiaojing; Zhao, Yiqiang

    2017-01-01

    The expression of genes with aberrant structure is prevented at both the transcriptional and posttranscriptional regulation levels. Aberrant gene silencing at the posttranscriptional level is well studied; however, it is not well understood how aberrant genes are silenced at the transcriptional level. In this study, through genetic screening a transgenic report line that harbors an aberrant gene (35S-LUC, lacking 3′-untranslated region [3′-UTR]) and lacks luciferase (LUC) activity, we identify that the small ubiquitin-like modifier (SUMO) protease OTS1 gene is required for maintaining the silence of the reporter 35S-LUC and an endogenous mutator-like element MULE-F19G14 at the transcriptional level, which requires DNA-dependent RNA polymerase (Pol) V and DDR complex, but not Pol IV. The increased transcripts in ots1 mutants are terminated by the 3′-UTRs of downstream genes. In addition to ots1 mutations, mutations in several known or putative SUMO proteases and two SUMO E3 ligases, SIZ1 and MMS21, have similar effects on this silencing regulation. Taken together, our results reveal that the enzymes involved in the SUMOylation process restrain aberrant gene transcription by using a downstream gene 3′-UTR, and this regulation requires a functional Pol V-dependent pathway in Arabidopsis (Arabidopsis thaliana). PMID:27852949

  20. Multiple gains of spliceosomal introns in a superfamily of vertebrate protease inhibitor genes

    PubMed Central

    Ragg, Hermann; Kumar, Abhishek; Köster, Katharina; Bentele, Caterina; Wang, Yunjie; Frese, Marc-André; Prib, Natalie; Krüger, Olaf

    2009-01-01

    Background Intron gains reportedly are very rare during evolution of vertebrates, and the mechanisms underlying their creation are largely unknown. Previous investigations have shown that, during metazoan radiation, the exon-intron patterns of serpin superfamily genes were subject to massive changes, in contrast to many other genes. Results Here we investigated intron dynamics in the serpin superfamily in lineages pre- and postdating the split of vertebrates. Multiple intron gains were detected in a group of ray-finned fishes, once the canonical groups of vertebrate serpins had been established. In two genes, co-occurrence of non-standard introns was observed, implying that intron gains in vertebrates may even happen concomitantly or in a rapidly consecutive manner. DNA breakage/repair processes associated with genome compaction are introduced as a novel factor potentially favoring intron gain, since all non-canonical introns were found in a lineage of ray-finned fishes that experienced genomic downsizing. Conclusion Multiple intron acquisitions were identified in serpin genes of a lineage of ray-finned fishes, but not in any other vertebrates, suggesting that insertion rates for introns may be episodically increased. The co-occurrence of non-standard introns within the same gene discloses the possibility that introns may be gained simultaneously. The sequences flanking the intron insertion points correspond to the proto-splice site consensus sequence MAG↑N, previously proposed to serve as intron insertion site. The association of intron gains in the serpin superfamily with a group of fishes that underwent genome compaction may indicate that DNA breakage/repair processes might foster intron birth. PMID:19698129

  1. Inhibition of Epstein-Barr virus replication by small interfering RNA targeting the Epstein-Barr virus protease gene.

    PubMed

    Larrat, Sylvie; Morand, Patrice; Bas, Ariane; Vigne, Solenne; Crance, Jean-Marc; Boyer, Véronique; Nicod, Sandrine; Grossi, Laurence; Buisson, Marlyse; Burmeister, Wim P; Seigneurin, Jean-Marie; Germi, Raphaële

    2009-01-01

    The Epstein-Barr virus (EBV) protease (PR), coded by the BVRF2 gene, is essential for the maturation of the viral capsid and viral DNA packaging during the late stage of the EBV lytic cycle. Like the other herpesvirus serine PRs, EBV PR could be a target for the inhibition of EBV replication. To date, no data have been reported on the inhibition of EBV PR messenger RNA (mRNA) by small interfering RNA (siRNA). In this study, siRNAs targeting EBV PR were delivered to the epithelial 293 cell line stably transfected with the complete B95-8 EBV episome. EBV DNA and PR mRNA were quantified by real-time PCR in cells and supernatant, protein expression was assessed by immunoblotting, and production of EBV infectious particles in the culture medium was measured by Raji cell superinfection. The EBV PR mRNA within the cells was reduced by 73%, the PR protein by 35% and the amount of virus in the cell supernatant was drastically decreased by 86% or 95%, depending on the method. The strong effect of the siRNA targeting EBV PR on EBV replication attests to the crucial role played by EBV PR in the production of infectious particles and suggests that targeting this enzyme can be a new strategy against EBV-associated diseases where virus replication occurs.

  2. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control[W

    PubMed Central

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David

    2014-01-01

    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria. PMID:24879428

  3. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control.

    PubMed

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David

    2014-05-01

    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria.

  4. Mutagenesis of a novel gene in the prcA-prtP protease locus affects expression of Treponema denticola membrane complexes.

    PubMed

    Bian, Xue-Lin; Wang, Hong-Tao; Ning, Yu; Lee, Si Young; Fenno, J Christopher

    2005-02-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue.

  5. Mutagenesis of a Novel Gene in the prcA-prtP Protease Locus Affects Expression of Treponema denticola Membrane Complexes

    PubMed Central

    Bian, Xue-lin; Wang, Hong-tao; Ning, Yu; Lee, Si Young; Fenno, J. Christopher

    2005-01-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue. PMID:15664975

  6. Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis

    PubMed Central

    Barbieri, Giulia; Albertini, Alessandra M.; Ferrari, Eugenio; Sonenshein, Abraham L.

    2016-01-01

    ABSTRACT AprE and NprE are two major extracellular proteases in Bacillus subtilis whose expression is directly regulated by several pleiotropic transcriptional factors, including AbrB, DegU, ScoC, and SinR. In cells growing in a rich, complex medium, the aprE and nprE genes are strongly expressed only during the post-exponential growth phase; mutations in genes encoding the known regulators affect the level of post-exponential-phase gene expression but do not permit high-level expression during the exponential growth phase. Using DNA-binding assays and expression and mutational analyses, we have shown that the genes for both exoproteases are also under strong, direct, negative control by the global transcriptional regulator CodY. However, because CodY also represses scoC, little or no derepression of aprE and nprE was seen in a codY null mutant due to overexpression of scoC. Thus, CodY is also an indirect positive regulator of these genes by limiting the synthesis of a second repressor. In addition, in cells growing under conditions that activate CodY, a scoC null mutation had little effect on aprE or nprE expression; full effects of scoC or codY null mutations could be seen only in the absence of the other regulator. However, even the codY scoC double mutant did not show high levels of aprE and nprE gene expression during exponential growth phase in a rich, complex medium. Only a third mutation, in abrB, allowed such expression. Thus, three repressors can contribute to reducing exoprotease gene expression during growth in the presence of excess nutrients. IMPORTANCE The major Bacillus subtilis exoproteases, AprE and NprE, are important metabolic enzymes whose genes are subject to complex regulation by multiple transcription factors. We show here that expression of the aprE and nprE genes is also controlled, both directly and indirectly, by CodY, a global transcriptional regulator that responds to the intracellular pools of amino acids. Direct Cod

  7. Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

    NASA Astrophysics Data System (ADS)

    Hidayat, Habibi

    2017-03-01

    16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

  8. Mutations in the Reverse Transcriptase and Protease Genes of Human Immunodeficiency Virus-1 from Antiretroviral Naïve and Treated Pediatric Patients

    PubMed Central

    Bure, Dinesh; Makhdoomi, Muzamil A.; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A.; Singh, Ravinder; Kabra, Sushil K.; Luthra, Kalpana

    2015-01-01

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis. PMID:25674767

  9. Mutations in the reverse transcriptase and protease genes of human immunodeficiency virus-1 from antiretroviral naïve and treated pediatric patients.

    PubMed

    Bure, Dinesh; Makhdoomi, Muzamil A; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A; Singh, Ravinder; Kabra, Sushil K; Luthra, Kalpana

    2015-02-10

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis.

  10. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  11. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean.

    PubMed

    Katoch, Rajan; Singh, Sunil Kumar; Thakur, Neelam; Dutt, Som; Yadav, Sudesh Kumar; Shukle, Rich

    2014-08-10

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327 bp encoding 109 amino acids was cloned from rice bean seeds using degenerate primer set. BlastP search revealed that the RbTI encoded amino acid of approx 13.0 kDa and shared 99% homology each with BBI from Phaseolus parvulus, Vigna trilobata and Vigna vexilata. Phylogenetic tree also showed close relationship of RbTI with BBI from other members of Leguminaceae family. RbTI gene was further confirmed as intronless (GenBank accession no. KJ159908). The secondary and 3D-structural models for the RbTI were predicted with homology modeling. qRT-PCR studies revealed the highest RbTI expression in the seeds nearing maturity, whereas the low expression of the gene was noticed in young leaves. The isolated RbTI was successfully expressed in Escherichiacoli and the highest expression was recorded after 5.5h of induction. Study on the inhibitory activity of expressed protein against the gut proteases of Hessian fly larvae revealed 87% inhibition. The novel RbTI gene will further broaden the pool of plant defense genes and could be an ideal choice for developing transgenic crops resistant to insect pests with high economic value. In addition, it has the potential to be used as a probe for selection of insect- and pathogen-resistant genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. The protease inhibitor chagasin of Trypanosoma cruzi adopts an immunoglobulin-type fold and may have arisen by horizontal gene transfer.

    PubMed

    Rigden, D J; Monteiro, A C; Grossi de Sá, M F

    2001-08-24

    Chagasin, a protein from Trypanosoma cruzi, is the first member of a new family of tight binding cysteine protease inhibitors [Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C., Vannier-Santos, M.A. and Scharfstein, J. (2001) J. Cell Sci., in press] [corrected]. Despite its lack of significant sequence identity with known proteins, convincing structural models, using variable light chain templates, could be constructed on the basis of threading results. Experimental support for the final structure came from inhibition data for overlapping oligopeptides spanning the chagasin sequence. Chagasin therefore exemplifies a new protease inhibitor structural class and a new natural use for an immunoglobulin-like domain. Limited sequence resemblance suggests that chagasin may represent the result of a rare horizontal gene transfer from host to parasite.

  13. Genetic improvement of the nematicidal fungus Lecanicillium attenuatum against Heterodera glycines by expression of the Beauveria bassiana Cdep1 protease gene.

    PubMed

    Xie, Ming; Zhang, Yan-Jun; Zhang, Xiao-Lin; Peng, De-Liang; Yu, Wen-Bin; Li, Qian

    2016-07-01

    Lecanicillium attenuatum is an important nematophagous fungus with potential as a biopesticide against plant-parasitic nematodes. The Pr1A-like cuticle-degrading protease (Cdep1) gene originating from the entomopathogenic fungus Beauveria bassiana was transformed into the nematophagous fungus L. attenuatum using a polyethylene-glycol mediated protoplast-based transformation system. Protease activity was increased 0.64- to 1.63-fold 2-10d after growth in the transformed L. attenuatum. Inhibition of egg-hatching and J2 motility of soybean cyst nematodes (Heterodera glycines) by cell-free fungal culture filtrates were enhanced by 17-76% 2-14d and 43-152% 1-13d after incubation, respectively.

  14. Spink13, an Epididymis-specific Gene of the Kazal-type Serine Protease Inhibitor (SPINK) Family, Is Essential for the Acrosomal Integrity and Male Fertility*

    PubMed Central

    Ma, Li; Yu, Heguo; Ni, Zimei; Hu, Shuanggang; Ma, Wubin; Chu, Chen; Liu, Qiang; Zhang, Yonglian

    2013-01-01

    Sperm maturation involves numerous surface modifications by a variety of secreted proteins from epididymal epithelia. The sperm surface architecture depends on correct localization of its components and highlights the importance of the sequence of the proteolytic processing of the sperm surface in the epididymal duct. The presence of several protease inhibitors from different families is consistent with the hypothesis that correctly timed epididymal protein processing is essential for proper sperm maturation. Here we show that the rat (Rattus norvegicus) epididymis-specific gene Spink13, an androgen-responsive serine protease inhibitor, could bind to the sperm acrosome region. Furthermore, knockdown of Spink13 in vivo dramatically enhanced the acrosomal exocytosis during the process of capacitation and thus led to a significant reduction in male fertility, indicating that Spink13 was essential for sperm maturation. We conclude that blockade of SPINK13 may provide a new putative target for post-testicular male contraceptives. PMID:23430248

  15. The Gene of the Ubiquitin-Specific Protease 8 Is Frequently Mutated in Adenomas Causing Cushing's Disease.

    PubMed

    Perez-Rivas, Luis G; Theodoropoulou, Marily; Ferraù, Francesco; Nusser, Clara; Kawaguchi, Kohei; Stratakis, Constantine A; Faucz, Fabio Rueda; Wildemberg, Luiz E; Assié, Guillaume; Beschorner, Rudi; Dimopoulou, Christina; Buchfelder, Michael; Popovic, Vera; Berr, Christina M; Tóth, Miklós; Ardisasmita, Arif Ibrahim; Honegger, Jürgen; Bertherat, Jerôme; Gadelha, Monica R; Beuschlein, Felix; Stalla, Günter; Komada, Masayuki; Korbonits, Márta; Reincke, Martin

    2015-07-01

    We have recently reported somatic mutations in the ubiquitin-specific protease USP8 gene in a small series of adenomas of patients with Cushing's disease. To determine the prevalence of USP8 mutations and the genotype-phenotype correlation in a large series of patients diagnosed with Cushing's disease. We performed a retrospective, multicentric, genetic analysis of 134 functioning and 11 silent corticotroph adenomas using Sanger sequencing. Biochemical and clinical features were collected and examined within the context of the mutational status of USP8, and new mutations were characterized by functional studies. A total of 145 patients who underwent surgery for an ACTH-producing pituitary adenoma. Mutational status of USP8. Biochemical and clinical features included sex, age at diagnosis, tumor size, preoperative and postoperative hormonal levels, and comorbidities. We found somatic mutations in USP8 in 48 (36%) pituitary adenomas from patients with Cushing's disease but in none of 11 silent corticotropinomas. The prevalence was higher in adults than in pediatric cases (41 vs 17%) and in females than in males (43 vs 17%). Adults having USP8-mutated adenomas were diagnosed at an earlier age than those with wild-type lesions (36 vs 44 y). Mutations were primarily found in adenomas of 10 ± 7 mm and were inversely associated with the development of postoperative adrenal insufficiency. All the mutations affected the residues Ser718 or Pro720, including five new identified alterations. Mutations reduced the interaction between USP8 and 14-3-3 and enhanced USP8 activity. USP8 mutants diminished epidermal growth factor receptor ubiquitination and induced Pomc promoter activity in immortalized AtT-20 corticotropinoma cells. USP8 is frequently mutated in adenomas causing Cushing's disease, especially in those from female adult patients diagnosed at a younger age.

  16. The Gene of the Ubiquitin-Specific Protease 8 Is Frequently Mutated in Adenomas Causing Cushing's Disease

    PubMed Central

    Perez-Rivas, Luis G.; Theodoropoulou, Marily; Ferraù, Francesco; Nusser, Clara; Kawaguchi, Kohei; Stratakis, Constantine A.; Faucz, Fabio Rueda; Wildemberg, Luiz E.; Assié, Guillaume; Beschorner, Rudi; Dimopoulou, Christina; Buchfelder, Michael; Popovic, Vera; Berr, Christina M.; Tóth, Miklós; Ardisasmita, Arif Ibrahim; Honegger, Jürgen; Bertherat, Jerôme; Gadelha, Monica R.; Beuschlein, Felix; Stalla, Günter; Komada, Masayuki; Korbonits, Márta

    2015-01-01

    Context: We have recently reported somatic mutations in the ubiquitin-specific protease USP8 gene in a small series of adenomas of patients with Cushing's disease. Objective: To determine the prevalence of USP8 mutations and the genotype-phenotype correlation in a large series of patients diagnosed with Cushing's disease. Design: We performed a retrospective, multicentric, genetic analysis of 134 functioning and 11 silent corticotroph adenomas using Sanger sequencing. Biochemical and clinical features were collected and examined within the context of the mutational status of USP8, and new mutations were characterized by functional studies. Patients: A total of 145 patients who underwent surgery for an ACTH-producing pituitary adenoma. Main Outcomes Measures: Mutational status of USP8. Biochemical and clinical features included sex, age at diagnosis, tumor size, preoperative and postoperative hormonal levels, and comorbidities. Results: We found somatic mutations in USP8 in 48 (36%) pituitary adenomas from patients with Cushing's disease but in none of 11 silent corticotropinomas. The prevalence was higher in adults than in pediatric cases (41 vs 17%) and in females than in males (43 vs 17%). Adults having USP8-mutated adenomas were diagnosed at an earlier age than those with wild-type lesions (36 vs 44 y). Mutations were primarily found in adenomas of 10 ± 7 mm and were inversely associated with the development of postoperative adrenal insufficiency. All the mutations affected the residues Ser718 or Pro720, including five new identified alterations. Mutations reduced the interaction between USP8 and 14-3-3 and enhanced USP8 activity. USP8 mutants diminished epidermal growth factor receptor ubiquitination and induced Pomc promoter activity in immortalized AtT-20 corticotropinoma cells. Conclusions: USP8 is frequently mutated in adenomas causing Cushing's disease, especially in those from female adult patients diagnosed at a younger age. PMID:25942478

  17. Putative protease inhibitor gene discovery and transcript profiling during fruit development and leaf damage in grapefruit (Citrus paradisi Macf.).

    PubMed

    Shatters, Robert G; Bausher, Michael G; Hunter, Wayne B; Chaparro, José X; Dang, Phat M; Niedz, Randall P; Mayer, Richard T; McCollum, T Greg; Sinisterra, Xiomara

    2004-02-04

    Seven putative protease inhibitor (PPI) cDNAs, representing four protein families, were isolated from a grapefruit (Citrus paradisi Macf. Cv. Marsh) immature fruit flavedo cDNA library. Cloned open reading frames encoded proteins with similarity to, and protein signatures for: legume Kuntiz inhibitors (lkiL-1, lkiL-2, lkiL-3), potato trypsin inhibitor I (ptiIL-1), serpins (serpL-1), cystatins (cystL-1), and gamma thionins (gthL-1). Response of transcript abundance to fruit development and leaf wounding was determined for all but lkiL-1 using real-time RT-PCR. Immature leaves had the highest transcript levels for all PPIs. The gthL-1 transcript in immature leaves was the most abundant transcript but was absent from healthy mature leaves. In fruit flavedo, transcripts for all PPIs were most abundant in youngest fruit (<15 mm dia. fruit), and declined during development, but displayed different patterns of developmental change. Mechanical or Diaprepes root weevil (DRW) feeding damage to leaves caused a <10-fold reduction or had no effect on transcript level with the exception of gthL-1 which, as a result of damage, increased >50-fold in mature leaves and decreased >1400-fold in immature leaves. This developmental control of transcript response to wounding in a woody perennial is opposite of what has been observed for defensive proteinase inhibitors (PIs) in other plants (typically herbaceous and/or annual plants), where younger leaves typically invoke a higher defensive proteinase inhibitor transcript accumulation than older tissues. Except for gthL-1, the PPI transcripts were minimally responsive or unresponsive to wounding. Changes in PPI transcript levels suggest diverse roles for the products of these genes in citrus, with only gthL-1 responding in a defense-like manner.

  18. The rice OsSAG12-2 gene codes for a functional protease that negatively regulates stress-induced cell death.

    PubMed

    Singh, Subaran; Singh, Anupriya; Nandi, Ashis Kumar

    2016-09-01

    Senescence is the final stage of plant development. Although expression of most of the genes is suppressed during senescence, a set of genes referred as senescence-associated genes (SAGs) is induced. Arabidopsis thaliana SAG12 (AtSAG12) is one such gene that has been mostly studied for its strict association with senescence. AtSAG12 encodes a papain-like cysteine protease, expressed predominantly in senescence-associated vacuoles. Rice genome contains multiple AtSAG12 homologues (OsSAGs). OsSAG12-1, the closest structural homologue of AtSAG12, is a negative regulator of developmental and stress-induced cell death. Proteolytic activity has not been established for any SAG12 homologues in vitro. Here, we report that OsSAG12-2, the second structural homologue of AtSAG12 from rice, codes for a functional proteolytic enzyme. The recombinant OsSAG12-2 protein produced in Escherichia coli undergoes autolysis to generate a functional protease. The matured OsSAG12-2 protein shows 27 percent trypsin-equivalent proteolytic activity on azocasein substrate. Dark-induced senescence activates OsSAG12-2 expression. Down-regulation of OsSAG12-2 in the transgenic artificial miRNA lines results in enhanced salt- and UV-induced cell death, even though it does not affect cell viability in the stress-free condition. Our results show that OsSAG12-2 codes for a functional protease that negatively regulates stress-induced cell death in rice.

  19. An extracellular serine protease produced by Vibrio vulnificus NCIMB 2137, a metalloprotease-gene negative strain isolated from a diseased eel.

    PubMed

    Miyoshi, Shin-Ichi; Wang, Jiyou; Katoh, Keizo; Senoh, Mitsutoshi; Mizuno, Tamaki; Maehara, Yoko

    2012-04-01

    Vibrio vulnificus is a ubiquitous estuarine microorganism but causes fatal systemic infections in immunocompromised humans, cultured eels or shrimps. An extracellular metalloprotease VVP/VvpE has been reported to be a potential virulence factor of the bacterium; however, a few strains isolated from a diseased eel or shrimp were recently found to produce a serine protease termed VvsA, but not VVP/VvpE. In the present study, we found that these strains had lost the 80 kb genomic region including the gene encoding VVP/VvpE. We also purified VvsA from the culture supernatant through ammonium sulfate fractionation, gel filtration and ion-exchange column chromatography, and the enzyme was demonstrated to be a chymotrypsin-like protease, as well as those from some vibrios. The gene vvsA was shown to constitute an operon with a downstream gene vvsB, and several Vibrio species were found to have orthologues of vvsAB. These findings indicate that the genes vvp/vvpE and vvsAB might be mobile genetic elements.

  20. Biochemical and functional analysis of the YME1 gene product, an ATP and zinc-dependent mitochondrial protease from S. cerevisiae.

    PubMed Central

    Weber, E R; Hanekamp, T; Thorsness, P E

    1996-01-01

    Inactivation of YME1 in yeast causes several distinct phenotypes: an increased rate of DNA escape from mitochondria, temperature-sensitive growth on nonfermentable carbon sources, extremely slow growth when mitochondrial DNA is completely absent from the cell, and altered morphology of the mitochondrial compartment. The protein encoded by YME1, Yme1p, contains two highly conserved sequence elements, one implicated in the binding and hydrolysis of ATP, and the second characteristic of active site residues found in neutral, zinc-dependent proteases. Both the putative ATPase and zinc-dependent protease elements are necessary for the function of Yme1p as genes having mutations in critical residues of either of these motifs are unable to suppress any of the phenotypes exhibited by yme1 deletion strains. Yme1p co-fractionates with proteins associated with the mitochondrial inner membrane, is tightly associated with this membrane, and is oriented with the bulk of the protein facing the matrix. Unassembled subunit II of cytochrome oxidase is stabilized in yme1 yeast strains. The data support a model in which Yme1p is an ATP and zinc-dependent protease associated with the matrix side of the inner mitochondrial membrane. Subunit II of cytochrome oxidase, when not assembled into a higher order complex, is a likely substrate of Yme1p. Images PMID:8688560

  1. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease

    PubMed Central

    Murphy, Timothy F.; Kirkham, Charmaine; Jones, Megan M.; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M.

    2015-01-01

    Background. Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. Methods. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. Results. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Conclusions. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. PMID:25995193

  2. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease.

    PubMed

    Murphy, Timothy F; Kirkham, Charmaine; Jones, Megan M; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M

    2015-12-01

    Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  3. Network Analyses Reveal Pervasive Functional Regulation Between Proteases in the Human Protease Web

    PubMed Central

    Fortelny, Nikolaus; Cox, Jennifer H.; Kappelhoff, Reinhild; Starr, Amanda E.; Lange, Philipp F.; Pavlidis, Paul; Overall, Christopher M.

    2014-01-01

    Proteolytic processing is an irreversible posttranslational modification affecting a large portion of the proteome. Protease-cleaved mediators frequently exhibit altered activity, and biological pathways are often regulated by proteolytic processing. Many of these mechanisms have not been appreciated as being protease-dependent, and the potential in unraveling a complex new dimension of biological control is increasingly recognized. Proteases are currently believed to act individually or in isolated cascades. However, conclusive but scattered biochemical evidence indicates broader regulation of proteases by protease and inhibitor interactions. Therefore, to systematically study such interactions, we assembled curated protease cleavage and inhibition data into a global, computational representation, termed the protease web. This revealed that proteases pervasively influence the activity of other proteases directly or by cleaving intermediate proteases or protease inhibitors. The protease web spans four classes of proteases and inhibitors and so links both recently and classically described protease groups and cascades, which can no longer be viewed as operating in isolation in vivo. We demonstrated that this observation, termed reachability, is robust to alterations in the data and will only increase in the future as additional data are added. We further show how subnetworks of the web are operational in 23 different tissues reflecting different phenotypes. We applied our network to develop novel insights into biologically relevant protease interactions using cell-specific proteases of the polymorphonuclear leukocyte as a system. Predictions from the protease web on the activity of matrix metalloproteinase 8 (MMP8) and neutrophil elastase being linked by an inactivating cleavage of serpinA1 by MMP8 were validated and explain perplexing Mmp8 −/− versus wild-type polymorphonuclear chemokine cleavages in vivo. Our findings supply systematically derived and

  4. Interference with plastome gene expression and Clp protease activity in Arabidopsis triggers a chloroplast unfolded protein response to restore protein homeostasis.

    PubMed

    Llamas, Ernesto; Pulido, Pablo; Rodriguez-Concepcion, Manuel

    2017-09-01

    Disruption of protein homeostasis in chloroplasts impairs the correct functioning of essential metabolic pathways, including the methylerythritol 4-phosphate (MEP) pathway for the production of plastidial isoprenoids involved in photosynthesis and growth. We previously found that misfolded and aggregated forms of the first enzyme of the MEP pathway are degraded by the Clp protease with the involvement of Hsp70 and Hsp100/ClpC1 chaperones in Arabidopsis thaliana. By contrast, the combined unfolding and disaggregating actions of Hsp70 and Hsp100/ClpB3 chaperones allow solubilization and hence reactivation of the enzyme. The repair pathway is promoted when the levels of ClpB3 proteins increase upon reduction of Clp protease activity in mutants or wild-type plants treated with the chloroplast protein synthesis inhibitor lincomycin (LIN). Here we show that LIN treatment rapidly increases the levels of aggregated proteins in the chloroplast, unleashing a specific retrograde signaling pathway that up-regulates expression of ClpB3 and other nuclear genes encoding plastidial chaperones. As a consequence, folding capacity is increased to restore protein homeostasis. This sort of chloroplast unfolded protein response (cpUPR) mechanism appears to be mediated by the heat shock transcription factor HsfA2. Expression of HsfA2 and cpUPR-related target genes is independent of GUN1, a central integrator of retrograde signaling pathways. However, double mutants defective in both GUN1 and plastome gene expression (or Clp protease activity) are seedling lethal, confirming that the GUN1 protein is essential for protein homeostasis in chloroplasts.

  5. Intragenomic diversity of the V1 regions of 16S rRNA genes in high-alkaline protease-producing Bacillus clausii spp.

    PubMed

    Kageyama, Yasushi; Takaki, Yoshihiro; Shimamura, Shigeru; Nishi, Shinro; Nogi, Yuichi; Uchimura, Kohsuke; Kobayashi, Tohru; Hitomi, Jun; Ozaki, Katsuya; Kawai, Shuji; Ito, Susumu; Horikoshi, Koki

    2007-07-01

    Alkaliphilic Bacillus sp. strain KSM-K16, which produces high-alkaline M-protease, was characterized phenotypically, biochemically and genetically. This strain was identified as Bacillus clausii based on the results of taxonomic studies, including sequencing of the 16S rRNA gene and DNA-DNA hybridization. Seven rRNA operons in the genome were identified by pulsed-field gel electrophoresis. Sequencing of cloned 16S rRNA genes revealed two distinct types of variable region V1. Moreover, some cloned 16S rRNA genes in some of the reference strains of B. clausii had a V1 region of yet another type. The B. clausii strains could clearly be divided into at least two subgroups based on the frequencies of the types of cloned V1 sequence. Bacillus sp. strain KSM-K16 was found to be in a different phylogenetic position from other high-alkaline protease-producing strains of B. clausii.

  6. Mapping of Gene Expression Reveals CYP27A1 as a Susceptibility Gene for Sporadic ALS

    PubMed Central

    van Rheenen, Wouter; Franke, Lude; Jansen, Ritsert C.; van Es, Michael A.; van Vught, Paul W. J.; Blauw, Hylke M.; Groen, Ewout J. N.; Horvath, Steve; Estrada, Karol; Rivadeneira, Fernando; Hofman, Albert; Uitterlinden, Andre G.; Robberecht, Wim; Andersen, Peter M.; Melki, Judith; Meininger, Vincent; Hardiman, Orla; Landers, John E.; Brown, Robert H.; Shatunov, Aleksey; Shaw, Christopher E.; Leigh, P. Nigel; Al-Chalabi, Ammar; Ophoff, Roel A.

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive, neurodegenerative disease characterized by loss of upper and lower motor neurons. ALS is considered to be a complex trait and genome-wide association studies (GWAS) have implicated a few susceptibility loci. However, many more causal loci remain to be discovered. Since it has been shown that genetic variants associated with complex traits are more likely to be eQTLs than frequency-matched variants from GWAS platforms, we conducted a two-stage genome-wide screening for eQTLs associated with ALS. In addition, we applied an eQTL analysis to finemap association loci. Expression profiles using peripheral blood of 323 sporadic ALS patients and 413 controls were mapped to genome-wide genotyping data. Subsequently, data from a two-stage GWAS (3,568 patients and 10,163 controls) were used to prioritize eQTLs identified in the first stage (162 ALS, 207 controls). These prioritized eQTLs were carried forward to the second sample with both gene-expression and genotyping data (161 ALS, 206 controls). Replicated eQTL SNPs were then tested for association in the second-stage GWAS data to find SNPs associated with disease, that survived correction for multiple testing. We thus identified twelve cis eQTLs with nominally significant associations in the second-stage GWAS data. Eight SNP-transcript pairs of highest significance (lowest p = 1.27×10−51) withstood multiple-testing correction in the second stage and modulated CYP27A1 gene expression. Additionally, we show that C9orf72 appears to be the only gene in the 9p21.2 locus that is regulated in cis, showing the potential of this approach in identifying causative genes in association loci in ALS. This study has identified candidate genes for sporadic ALS, most notably CYP27A1. Mutations in CYP27A1 are causal to cerebrotendinous xanthomatosis which can present as a clinical mimic of ALS with progressive upper motor neuron loss, making it a plausible susceptibility gene for

  7. Association between uridin diphosphate glucuronosylotransferase 1A1 (UGT1A1) gene polymorphism and neonatal hyperbilirubinemia.

    PubMed

    Mazur-Kominek, Katarzyna; Romanowski, Tomasz; Bielawski, Krzysztof; Kiełbratowska, Bogumiła; Preis, Krzysztof; Domżalska-Popadiuk, Iwona; Słomińska-Frączek, Magdalena; Sznurkowska, Katarzyna; Renke, Joanna; Plata-Nazar, Katarzyna; Śledzińska, Karolina; Sikorska-Wiśniewska, Grażyna; Góra-Gębka, Magdalena; Liberek, Anna

    2017-01-01

    To assess the prevalence of UGT1A1*28 and UGT1A1*60 polymorphisms of UGT1A1 gene and their association with hyperbilirubinemia. The study was performed at a single centre - at the Department of Obstetrics of the Medical University of Gdansk in Poland. DNA was isolated from Guthrie cards of 171 infants. Only full term newborns (gestational age 38-42 weeks) were included in the study. Fluorescent molecular probes were used for UGT1A1 promoter variation analysis. The presence of UGT1A1*28 polymorphism was detected with a dual-probe system, and UGT1A1*60 with a SimpleProbe™. Homozygous UGT1A1*28 and UGT1A1*60 genotypes were detected in 14.6% and 20.5% of the newborns, respectively. Homozygous (G/G) genotypes of UGT1A1*60 polymorphism were found in all of the UGT1A1*28 (i.e. (TA)7/(TA)7) homozygotes. More than 80% (55/66) of the children with "wild" type UGT1A1*28 genotype (where no polymorphism was detected) (i.e. (TA)6/(TA)6) carried the "wild" (T/T) genotype of UGT1A1*60 as well. The UGT1A1*28 polymorphism was detected more often among neonates with elevated bilirubin. Hyperbilirubinemia was diagnosed more frequently in boys. Polymorphisms of the UGT1A1 gene frequently co-exist in neonates. The presence of UGT1A1*28 polymorphism and male gender seem to predispose to neonatal hyperbilirubinemia.

  8. Resistance mutations in protease gene at baseline are not related to virological failure in patients treated with darunavir/ritonavir monotherapy

    PubMed Central

    Gutierrez-Liarte, Angela; Gomez-Berrocal, Ana; Saez, Carmen; Valencia, Jorge; Santos, Ignacio; Sanz, Jesus

    2014-01-01

    Introduction Monotherapy with darunavir plus ritonavir (DRV/r) is a good maintenance strategy for suppressed HIV-infected patients. The clinical trials designed to prove the efficacy of PI/r do not include patients with resistance mutation in protease gene [1,2]. Sometimes in routine practice, basically to avoid NRTIs toxicity, monotherapy with DRV/r is used despite PI resistance mutations. The aim of this study is to know the effect of previous protease resistance mutation on DRV/r monotherapy efficacy. Materials and Methods We designed an observational cohort study of adults in treatment with DRV/r monotherapy in a tertiary Spanish hospital since 2011 to 2014. Demographic data and clinical outcomes were described. The analysis of efficacy was done according to the snapshot algorithm (defining virological failure as viral load >50 copies/mL, ITTe, at 48 and 96 weeks). We analyzed the difference of efficacy between patients with and without baseline resistance mutations at 48 and 96 weeks by using the χ2 test; and during the follow-up by using the Kaplan–Meier test. The statistical analysis was done with SPSS 17.0. Results Eighty-nine patients were included in the cohort but 14 were excluded because they had not reached more than six months with monotherapy. The cohort was composed mainly by men (78%), the medium age was 51 years (SD±10), 35% were MSM and 19% were former IDU. Twenty-four patients (35%) had a previous diagnosis of AIDS. The mean time taking NRTIs was 10.5 years (SD±5.4). Sixty-four patients (85%) had been treated with PI in the past. Previous failure with PI had been reported in 15 (20%). A resistance mutation test had been done at baseline in 45 patients (51%). Twenty-two patients (29%) had some mutations in protease gene, 10 patients (13%) had major mutations and 1 patient had some mutations of resistance for darunavir (I64V). At 48 weeks, 93% (CI 95% 86–98%) had VL<50 copies/mL, and 79% (CI 95% 67–89%) at 96 weeks. There were not

  9. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86

    PubMed Central

    2011-01-01

    Background Wheat grains accumulate a variety of low molecular weight proteins that are inhibitors of alpha-amylases and proteases and play an important protective role in the grain. These proteins have more balanced amino acid compositions than the major wheat gluten proteins and contribute important reserves for both seedling growth and human nutrition. The alpha-amylase/protease inhibitors also are of interest because they cause IgE-mediated occupational and food allergies and thereby impact human health. Results The complement of genes encoding alpha-amylase/protease inhibitors expressed in the US bread wheat Butte 86 was characterized by analysis of expressed sequence tags (ESTs). Coding sequences for 19 distinct proteins were identified. These included two monomeric (WMAI), four dimeric (WDAI), and six tetrameric (WTAI) inhibitors of exogenous alpha-amylases, two inhibitors of endogenous alpha-amylases (WASI), four putative trypsin inhibitors (CMx and WTI), and one putative chymotrypsin inhibitor (WCI). A number of the encoded proteins were identical or very similar to proteins in the NCBI database. Sequences not reported previously included variants of WTAI-CM3, three CMx inhibitors and WTI. Within the WDAI group, two different genes encoded the same mature protein. Based on numbers of ESTs, transcripts for WTAI-CM3 Bu-1, WMAI Bu-1 and WTAI-CM16 Bu-1 were most abundant in Butte 86 developing grain. Coding sequences for 16 of the inhibitors were unequivocally associated with specific proteins identified by tandem mass spectrometry (MS/MS) in a previous proteomic analysis of milled white flour from Butte 86. Proteins corresponding to WDAI Bu-1/Bu-2, WMAI Bu-1 and the WTAI subunits CM2 Bu-1, CM3 Bu-1 and CM16 Bu-1 were accumulated to the highest levels in flour. Conclusions Information on the spectrum of alpha-amylase/protease inhibitor genes and proteins expressed in a single wheat cultivar is central to understanding the importance of these proteins in both

  10. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat cultivar Butte 86.

    PubMed

    Altenbach, Susan B; Vensel, William H; Dupont, Frances M

    2011-07-20

    Wheat grains accumulate a variety of low molecular weight proteins that are inhibitors of alpha-amylases and proteases and play an important protective role in the grain. These proteins have more balanced amino acid compositions than the major wheat gluten proteins and contribute important reserves for both seedling growth and human nutrition. The alpha-amylase/protease inhibitors also are of interest because they cause IgE-mediated occupational and food allergies and thereby impact human health. The complement of genes encoding alpha-amylase/protease inhibitors expressed in the US bread wheat Butte 86 was characterized by analysis of expressed sequence tags (ESTs). Coding sequences for 19 distinct proteins were identified. These included two monomeric (WMAI), four dimeric (WDAI), and six tetrameric (WTAI) inhibitors of exogenous alpha-amylases, two inhibitors of endogenous alpha-amylases (WASI), four putative trypsin inhibitors (CMx and WTI), and one putative chymotrypsin inhibitor (WCI). A number of the encoded proteins were identical or very similar to proteins in the NCBI database. Sequences not reported previously included variants of WTAI-CM3, three CMx inhibitors and WTI. Within the WDAI group, two different genes encoded the same mature protein. Based on numbers of ESTs, transcripts for WTAI-CM3 Bu-1, WMAI Bu-1 and WTAI-CM16 Bu-1 were most abundant in Butte 86 developing grain. Coding sequences for 16 of the inhibitors were unequivocally associated with specific proteins identified by tandem mass spectrometry (MS/MS) in a previous proteomic analysis of milled white flour from Butte 86. Proteins corresponding to WDAI Bu-1/Bu-2, WMAI Bu-1 and the WTAI subunits CM2 Bu-1, CM3 Bu-1 and CM16 Bu-1 were accumulated to the highest levels in flour. Information on the spectrum of alpha-amylase/protease inhibitor genes and proteins expressed in a single wheat cultivar is central to understanding the importance of these proteins in both plant defense mechanisms and

  11. Expression of a Serine Protease Gene prC Is Up-Regulated by Oxidative Stress in the Fungus Clonostachys rosea: Implications for Fungal Survival

    PubMed Central

    Liu, Wen-Jing; Zhou, Wei; Tao, Nan; Tu, Hui-Hui; Huang, Xiao-Wei; Yang, Jin-Kui; Zhang, Ke-Qin

    2010-01-01

    Background Soil fungi face a variety of environmental stresses such as UV light, high temperature, and heavy metals. Adaptation of gene expression through transcriptional regulation is a key mechanism in fungal response to environmental stress. In Saccharomyces cerevisiae, the transcription factors Msn2/4 induce stress-mediated gene expression by binding to the stress response element. Previous studies have demonstrated that the expression of extracellular proteases is up-regulated in response to heat shock in fungi. However, the physiological significance of regulation of these extracellular proteases by heat shock remains unclear. The nematophagous fungus Clonostachys rosea can secret an extracellular serine protease PrC during the infection of nematodes. Since the promoter of prC has three copies of the stress response element, we investigated the effect of environmental stress on the expression of prC. Methodology/Principal Findings Our results demonstrated that the expression of prC was up-regulated by oxidants (H2O2 or menadione) and heat shock, most likely through the stress response element. After oxidant treatment or heat shock, the germination of conidia in the wild type strain was significantly higher than that in the prC mutant strain in the presence of nematode cuticle. Interestingly, the addition of nematode cuticle significantly attenuated the production of reactive oxygen species (ROS) induced by oxidants and heat shock in the wild type strain, but not in prC mutant strain. Moreover, low molecule weight (<3 kD) degradation products of nematode cuticle suppressed the inhibitory effect of conidial germination induced by oxidants and heat shock. Conclusions/Significance These results indicate that PrC plays a protective role in oxidative stress in C. rosea. PrC degrades the nematode cuticle to produce degradation products, which in turn offer a protective effect against oxidative stress by scavenging ROS. Our study reveals a novel strategy for fungi to

  12. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    PubMed Central

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  13. Cleavage of DAP5 by coxsackievirus B3 2A protease facilitates viral replication and enhances apoptosis by altering translation of IRES-containing genes.

    PubMed

    Hanson, P J; Ye, X; Qiu, Y; Zhang, H M; Hemida, M G; Wang, F; Lim, T; Gu, A; Cho, B; Kim, H; Fung, G; Granville, D J; Yang, D

    2016-05-01

    Cleavage of eukaryotic translation initiation factor 4G (eIF4G) by enterovirus proteases during infection leads to the shutoff of cellular cap-dependent translation, but does not affect the initiation of cap-independent translation of mRNAs containing an internal ribosome entry site (IRES). Death-associated protein 5 (DAP5), a structural homolog of eIF4G, is a translation initiation factor specific for IRES-containing mRNAs. Coxsackievirus B3 (CVB3) is a positive single-stranded RNA virus and a primary causal agent of human myocarditis. Its RNA genome harbors an IRES within the 5'-untranslated region and is translated by a cap-independent, IRES-driven mechanism. Previously, we have shown that DAP5 is cleaved during CVB3 infection. However, the protease responsible for cleavage, cleavage site and effects on the translation of target genes during CVB3 infection have not been investigated. In the present study, we demonstrated that viral protease 2A but not 3C is responsible for DAP5 cleavage, generating 45- and 52-kDa N- (DAP5-N) and C-terminal (DAP5-C) fragments, respectively. By site-directed mutagenesis, we found that DAP5 is cleaved at amino acid G434. Upon cleavage, DAP5-N largely translocated to the nucleus at the later time points of infection, whereas the DAP5-C largely remained in the cytoplasm. Overexpression of these DAP5 truncates demonstrated that DAP5-N retained the capability of initiating IRES-driven translation of apoptosis-associated p53, but not the prosurvival Bcl-2 (B-cell lymphoma 2) when compared with the full-length DAP5. Similarly, DAP5-N expression promoted CVB3 replication and progeny release; on the other hand, DAP5-C exerted a dominant-negative effect on cap-dependent translation. Taken together, viral protease 2A-mediated cleavage of DAP5 results in the production of two truncates that exert differential effects on protein translation of the IRES-containing genes, leading to enhanced host cell death.

  14. No association between COL3A1, COL6A1 or COL12A1 gene variants and range of motion.

    PubMed

    O'connell, Kevin; Posthumus, Michael; Collins, Malcolm

    2013-01-01

    Approximately 64-70% of the variability in joint range of motion (ROM) is heritable. A common variant within a type V collagen (COL5A1) gene is associated with joint range of motion. Like type V collagen, types III, VI and XII collagen are also involved in fibril assembly and/or diameter regulation. Mutations within the genes that encode these proteins, COL3A1, COL6A1 and COL12A1, also cause connective tissue hypermobility disorders and phenotypes. The aim of this study was to determine if variants within these genes are associated with measures of joint range of motion. Three hundred and fifty apparently healthy and physically active Caucasian participants were recruited. Anthropometric measurements were taken. Sit-and-reach (SR), straight leg raise (SLR) and total shoulder rotation (ShTR) range of motion were measured. All participants were genotyped for COL3A1 rs1800255, COL6A1 rs35796750 and COL12A1 rs970547. COL3A1 rs1800255, COL6A1 rs35796750 and COL12A1 rs970547 were not significantly associated with sit-and-reach, straight leg raise or total shoulder rotation range of motion. Furthermore, no significant age-genotype interaction effects were identified between the variants and range of motion measurements. None of the variants investigated in this study were significantly associated with any of the measures of range of motion used. Further studies are required to identify additional intrinsic and extrinsic factors that may determine range of motion, including the genetic component.

  15. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  16. Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12

    PubMed Central

    Liu, Jianting; Yang, Lifu; Xie, Guishui

    2017-01-01

    Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea. PMID:28166280

  17. A Rhomboid Protease Gene Deletion Affects a Novel Oligosaccharide N-Linked to the S-layer Glycoprotein of Haloferax volcanii*

    PubMed Central

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-01-01

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family. PMID:24596091

  18. A rhomboid protease gene deletion affects a novel oligosaccharide N-linked to the S-layer glycoprotein of Haloferax volcanii.

    PubMed

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-04-18

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family.

  19. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    PubMed

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products.

  20. Identification and characterization of KLK14, a novel kallikrein serine protease gene located on human chromosome 19q13.4 and expressed in prostate and skeletal muscle.

    PubMed

    Hooper, J D; Bui, L T; Rae, F K; Harvey, T J; Myers, S A; Ashworth, L K; Clements, J A

    2001-04-01

    The kallikreins are a subfamily of serine proteases encoded in human, mouse, and rat by highly conserved tightly clustered multigene families. Here we report the identification and characterization of KLK14, a novel kallikrein gene located within the human kallikrein locus at 19q13.4. KLK14 is approximately 5.4 kb in length spanning seven exons and, by Northern blot analysis, transcribes two alternative transcripts present only in prostate (1.5 kb) and skeletal muscle (1.9 kb). The protein product, K14, predicted to be a 251-amino-acid secreted serine protease with trypsin-like substrate specificity, is translated in vitro with a molecular mass of approximately 31 kDa. In situ hybridization revealed that, in prostate, KLK14 is expressed by both benign and malignant glandular epithelial cells, thus exhibiting an expression pattern similar to that of two other prostatic kallikreins, KLK2 and KLK3, which encode K2 and prostate-specific antigen, respectively. Copyright 2001 Academic Press.

  1. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  2. Structure and Mechanism of Rhomboid Protease*

    PubMed Central

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-01-01

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases. PMID:23585569

  3. Identification of unannotated exons of low abundance transcripts in Drosophila melanogaster and cloning of a new serine protease gene upregulated upon injury

    PubMed Central

    Maia, Rafaela M; Valente, Valeria; Cunha, Marco AV; Sousa, Josane F; Araujo, Daniela D; Silva, Wilson A; Zago, Marco A; Dias-Neto, Emmanuel; Souza, Sandro J; Simpson, Andrew JG; Monesi, Nadia; Ramos, Ricardo GP; Espreafico, Enilza M; Paçó-Larson, Maria L

    2007-01-01

    Background The sequencing of the D.melanogaster genome revealed an unexpected small number of genes (~ 14,000) indicating that mechanisms acting on generation of transcript diversity must have played a major role in the evolution of complex metazoans. Among the most extensively used mechanisms that accounts for this diversity is alternative splicing. It is estimated that over 40% of Drosophila protein-coding genes contain one or more alternative exons. A recent transcription map of the Drosophila embryogenesis indicates that 30% of the transcribed regions are unannotated, and that 1/3 of this is estimated as missed or alternative exons of previously characterized protein-coding genes. Therefore, the identification of the variety of expressed transcripts depends on experimental data for its final validation and is continuously being performed using different approaches. We applied the Open Reading Frame Expressed Sequence Tags (ORESTES) methodology, which is capable of generating cDNA data from the central portion of rare transcripts, in order to investigate the presence of hitherto unnanotated regions of Drosophila transcriptome. Results Bioinformatic analysis of 1,303 Drosophila ORESTES clusters identified 68 sequences derived from unannotated regions in the current Drosophila genome version (4.3). Of these, a set of 38 was analysed by polyA+ northern blot hybridization, validating 17 (50%) new exons of low abundance transcripts. For one of these ESTs, we obtained the cDNA encompassing the complete coding sequence of a new serine protease, named SP212. The SP212 gene is part of a serine protease gene cluster located in the chromosome region 88A12-B1. This cluster includes the predicted genes CG9631, CG9649 and CG31326, which were previously identified as up-regulated after immune challenges in genomic-scale microarray analysis. In agreement with the proposal that this locus is co-regulated in response to microorganisms infection, we show here that SP212 is also up

  4. Effects of degU32(Hy), degQa and degR pleiotropic regulatory genes on the growth and protease fermentation of Bacillus subtilis Ki-2-132.

    PubMed

    Pan, Xue-Feng

    2006-04-01

    Effects of degU32 (Hy), degR genes from Bacillus subtilis 168 and degQa gene from Bacillus amyloliquefaciens on Bacillus subtilis Ki-2-132 cell growth, sporulation and protease fermentation were investigated by introducing these genes into B. subtilis Ki-2-132 chromosome and/or cytoplasm. Although the genes come from different species and strains, they showed pleiotropic effects in B. subtilis Ki-2-132. B. subtilis Ki-2-132degU32 (Hy) showed increased protease production, and when cooperating with degQa either in plasmid or in chromosome, further altered cell growth, increased protease production and affected the spore formation in a glucose and dosage dependent manner. By contrast, degR did not significantly affect the protease productivity in degU32 (Hy) mutant, consisting with that DegR was used to stabilise DegU-phosphate, which in degU32 (Hy) strain no longer further amplify the DegU-phosphate effect.

  5. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1. PMID:27679699

  6. CYP1A1, GCLC, AGT, AGTR1 gene-gene interactions in community-acquired pneumonia pulmonary complications.

    PubMed

    Salnikova, Lyubov E; Smelaya, Tamara V; Golubev, Arkadiy M; Rubanovich, Alexander V; Moroz, Viktor V

    2013-11-01

    This study was conducted to establish the possible contribution of functional gene polymorphisms in detoxification/oxidative stress and vascular remodeling pathways to community-acquired pneumonia (CAP) susceptibility in the case-control study (350 CAP patients, 432 control subjects) and to predisposition to the development of CAP complications in the prospective study. All subjects were genotyped for 16 polymorphic variants in the 14 genes of xenobiotics detoxification CYP1A1, AhR, GSTM1, GSTT1, ABCB1, redox-status SOD2, CAT, GCLC, and vascular homeostasis ACE, AGT, AGTR1, NOS3, MTHFR, VEGFα. Risk of pulmonary complications (PC) in the single locus analysis was associated with CYP1A1, GCLC and AGTR1 genes. Extra PC (toxic shock syndrome and myocarditis) were not associated with these genes. We evaluated gene-gene interactions using multi-factor dimensionality reduction, and cumulative gene risk score approaches. The final model which included >5 risk alleles in the CYP1A1 (rs2606345, rs4646903, rs1048943), GCLC, AGT, and AGTR1 genes was associated with pleuritis, empyema, acute respiratory distress syndrome, all PC and acute respiratory failure (ARF). We considered CYP1A1, GCLC, AGT, AGTR1 gene set using Set Distiller mode implemented in GeneDecks for discovering gene-set relations via the degree of sharing descriptors within a given gene set. N-acetylcysteine and oxygen were defined by Set Distiller as the best descriptors for the gene set associated in the present study with PC and ARF. Results of the study are in line with literature data and suggest that genetically determined oxidative stress exacerbation may contribute to the progression of lung inflammation.

  7. Identification of protease and rpoN-associated genes of uropathogenic Proteus mirabilis by negative selection in a mouse model of ascending urinary tract infection.

    PubMed

    Zhao, H; Li, X; Johnson, D E; Mobley, H L

    1999-01-01

    Proteus mirabilis, a motile gram-negative bacterium, is a principal cause of urinary tract infections in patients with functional or anatomical abnormalities of the urinary tract or those with urinary catheters in place. Thus far, virulence factors including urease, flagella, haemolysin, various fimbriae, IgA protease and a deaminase have been characterized based on the phenotypic traits conferred by these proteins. In this study, an attempt was made to identify new virulence genes of P. mirabilis that may not have identifiable phenotypes using the recently described technique of signature-tagged mutagenesis. A pool of chromosomal transposon mutants was made through conjugation and kanamycin/tetracycline selection; random insertion was confirmed by Southern blotting of chromosomal DNA isolated from 16 mutants using the aphA gene as a probe. From the total pool, 2.3% (9/397) auxotrophic mutants and 3.5% (14/397) swarming mutants were identified by screening on minimal salts agar and Luria agar plates, respectively. Thirty per cent of the mutants, found to have either no tag or an unamplifiable tag, were removed from the input pool. Then 10(7) c.f.u. from a 96-mutant pool (approximately 10(5) c.f.u. of each mutant) were used as an input pool to transurethrally inoculate seven CBA mice. After 2 d infection, bacteria were recovered from the bladders and kidneys and yielded about 10(5) c.f.u. as an output pool. Dot blot analysis showed that two of the 96 mutants, designated B2 and B5, could not be hybridized by signature tags amplified from the bladder output pool. Interrupted genes from these two mutants were cloned and sequenced. The interrupted gene in B2 predicts a polypeptide of 37.3 kDa that shares amino acid similarity with a putative protease or collagenase precursor. The gene in B5 predicts a polypeptide of 32.6 kDa that is very similar to that encoded by ORF284 of the rpoN operon controlling expression of nitrogen-regulated genes from several bacterial species

  8. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  9. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  10. The gene for the serpin thrombin inhibitor (P17), protease nexin I, is located on human chromosome 2q33-q35 and on syntenic regions in the mouse and sheep genomes

    SciTech Connect

    Carter, R.E.; Burkin, D.J.; Fournier, R.E.K.

    1995-05-01

    Protease nexin I (PNI) is the most important physiologic regulator of {alpha}-thrombin in tissues. PNI is highly expressed and developmentally regulated in the nervous system where it is concentrated at neuromuscular junctions and also central synapses in the hippocampus and striatum. Approximately 10% of identified proteins at mammalian neuromuscular junctions are serine protease inhibitors, consistent with their central role in balancing serine protease activity to develop, maintain, and remodel synapses. Southern blot hybridization of PNI cDNA to somatic cell hybrids placed the structural gene for PNI (locus PI7) on human chromosome 2q33-q35 and to syntenic chromosomes in the mouse (chromosome 1) and sheep (chromosome 2). 30 refs., 2 figs.

  11. Regulatory Characteristics of Bacillus pumilus Protease Promoters.

    PubMed

    Toymentseva, Anna A; Mascher, Thorsten; Sharipova, Margarita R

    2017-05-01

    Expression of extracellular protease genes of Bacilli is subject to regulation by many positive and negative regulators. Here we analyzed 5' regulatory regions of genes encoding proteolytic proteases AprBp, GseBp, and MprBp from Bacillus pumilus strain 3-19. Gfp fusion constructs with upstream genomic regions of different lengths were created for all three genes to identify their natural promoters (regulatory regions). Our results suggest that the aprBp gene, encoding the major subtilisin-like protease, has the most extensive promoter region of approximately 445 bp, while the minor protease genes encoding glutamyl endopeptidase (gseBp) and metalloproteinase (mprBp) are preceded by promoters of 150 and 250 bp in length, respectively. Promoter analysis of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporter fusion constructs in degU and spo0A mutants indicates a positive regulatory effect of DegU and Spo0A on protease expression, while the disruption of abrB, sinR, and scoC repressor genes did not significantly affect promoter activities of all protease genes. On the other hand, the expression of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporters increased 1.6- and 3.0-fold, respectively, in sigD-deficient cells, indicating that the prevention of motility gene expression promotes protease expression. Our results indicate that all examined regulators regulated serine proteases production in B. subtilis.

  12. Genomic organization of SLC3A1, a transporter gene mutated in cystinuria

    SciTech Connect

    Pras, E.; Sood, R.; Raben, N.

    1996-08-15

    The SLC3A1 gene encodes a transport protein for cystine and the dibasic amino acids. Recently mutations in this gene have been shown to cause cystinuria. We report the genomic structure and organization of SLC3A1, which is composed of 10 exons and spans nearly 45 kb. Until now screening for mutations in SLC3A1 has been based on RT-PCR amplification of illegitimate mRNA transcripts from white blood cells. In this report we provide primers for amplification of exons from genomic DNA, thus simplifying the process of screening for SLC3A1 mutations in cystinuria. 20 refs., 3 figs., 2 tabs.

  13. Expression of hurP, a Gene Encoding a Prospective Site 2 Protease, Is Essential for Heme-Dependent Induction of bhuR in Bordetella bronchiseptica▿

    PubMed Central

    King-Lyons, Natalie D.; Smith, Kelsy F.; Connell, Terry D.

    2007-01-01

    Expression of the hurIR bhuRSTUV heme utilization locus in Bordetella bronchiseptica is coordinately controlled by the global iron-dependent regulator Fur and the extracytoplasmic function sigma factor HurI. Activation of HurI requires transduction of a heme-dependent signal via HurI, HurR, and BhuR, a three-component heme-dependent regulatory system. In silico searches of the B. bronchiseptica genome to identify other genes that encode additional participants in this heme-dependent regulatory cascade revealed hurP, an open reading frame encoding a polypeptide with homology to (i) RseP, a site 2 protease (S2P) of Escherichia coli required for modifying the cytoplasmic membrane protein RseA, and (ii) YaeL, an S2P of Vibrio cholerae required for modification of the cytoplasmic membrane protein TcpP. A mutant of B. bronchiseptica defective for hurP was incapable of regulating expression of BhuR in a heme-dependent manner. Furthermore, the hurP mutant was unable to utilize hemin as a sole source of nutrient Fe. These defects in hemin utilization and heme-dependent induction of BhuR were restored when recombinant hurP (or recombinant rseP) was introduced into the mutant. Introduction of hurP into a yaeL mutant of V. cholerae also complemented its S2P defect. These data provided strong evidence that protease activity and cleavage site recognition was conserved in HurP, RseP, and YaeL. The data are consistent with a model in which HurP functionally modifies HurR, a sigma factor regulator that is essential for heme-dependent induction of bhuR. PMID:17586630

  14. PapR peptide maturation: role of the NprB protease in Bacillus cereus 569 PlcR/PapR global gene regulation

    PubMed Central

    Pomerantsev, Andrei P.; Pomerantseva, Olga M.; Camp, Andrew S.; Mukkamala, Radhika; Goldman, Stanley; Leppla, Stephen H.

    2009-01-01

    The global transcriptional regulator PlcR controls gene expression in Bacillus cereus and Bacillus thuringiensis. Activity of PlcR is regulated by PapR, the product of an open reading frame located immediately downstream of plcR. To be active in B. cereus, PapR must be secreted and then processed to the mature peptide by an unknown protease. This peptide is transported by an oligopeptide permease into the cell where it activates PlcR. In this study, we show that the neutral protease B (NprB) secreted by B. cereus 569 is required for extracellular PapR maturation. Purified recombinant NprB processed the synthetic PapR propeptide to produce a set of peptides derived from the C-terminal domain of PapR. Supplementation of growth media with synthetic PapR-derived C-terminal 5-, 7-, 8-, and 27-amino acid peptides caused activation of intracellular PlcR in a PapR-deficient strain of B. cereus 569 while only the 5- and 7-amino acid peptides activated PlcR in a nprB mutant. The maximum activity was found for the 7-mer peptide. However, even the 7-mer peptide could not activate PlcR with a C-terminal truncation of as few as six amino acids. This indicates that interactions of the C-terminal regions of both PlcR and PapR are important in transcriptional activation of the B. cereus 569 PlcR regulon. PMID:19159431

  15. Genotype-dependent expression of specific members of potato protease inhibitor gene families in different tissues and in response to wounding and nematode infection.

    PubMed

    Turrà, David; Bellin, Diana; Lorito, Matteo; Gebhardt, Christiane

    2009-05-01

    Protease inhibitors (PIs) are small ubiquitous proteins with a variety of biological functions in plants, including protein stabilization, modulation of apoptosis and defense against pathogens. Kunitz-like inhibitors (PKPIs) and proteinase inhibitors 1 (PI-1) are abundant in storage organs of potato plants and are up-regulated in other tissues in response to biotic and abiotic stress. However, little information is available on genotype-dependent regulation of individual PKPI group- and PI-1 genes. We isolated, sequenced and characterized four novel full-length PI-1 cDNAs (PPI3A2, PPI3A4, PPI2C4 and PPI2C1A) from Solanum tuberosum cv. Desirée. Specific primers were developed for PI-1 genes PPI3A2, PPI3B2 and PPI2C4 and the three PKPI homology groups A, B and C. Their expression profiles were studied by semi-quantitative RT-PCR in comparison with transcripts of the PI-1, Pin2 and PR1 gene families in various tissues, after wounding and Globodera rostochiensis infection of nematode-resistant genotypes P40 and LB7/4/c-I-7, and susceptible cv. Desirée. Individual PI-1 genes and PKPI homology groups were expressed in a tissue- and genotype-dependent manner after wounding and nematode infection. The differences in PI expression patterns were related to the intensity, type of inhibitors produced, and the kinetics of induction. Therefore, different genotype-environment combinations produce different sets of PI transcripts. Potato plants reacted to G. rostochiensis infection by modulating PKPI, PI-1 and Pin2, but not PR1 gene expression, suggesting that the jasmonic acid but not the salicylic acid defense signaling pathway is activated. PI expression profiles were not correlated with the resistance status of the potato genotype infected with G. rostochiensis.

  16. Single Nucleotide Variant rs2232710 in the Protein Z-Dependent Protease Inhibitor (ZPI, SERPINA10) Gene Is Not Associated with Deep Vein Thrombosis

    PubMed Central

    Gorski, Marcin M.; Lotta, Luca A.; Pappalardo, Emanuela; de Haan, Hugoline G.; Passamonti, Serena M.; van Hylckama Vlieg, Astrid; Martinelli, Ida; Peyvandi, Flora

    2016-01-01

    Rare mutations in PROC, PROS1 or SERPINC1 as well as common variants in F5, F2, F11 and SERPINC1 have been identified as risk factors for deep vein thrombosis (DVT). To identify novel genetic risk factors for DVT, we have developed and applied next-generation DNA sequencing (NGS) of the coding area of hemostatic and proinflammatory genes. Using this strategy, we previously identified a single nucleotide variant (SNV) rs6050 in the FGA gene and novel, rare SNVs in the ADAMTS13 gene associated with DVT. To identify novel coding variants in the genetic predisposition to DVT, we applied NGS analysis of the coding area of 186 hemostatic and proinflammatory genes in 94 DVT cases and 98 controls and we identified 18 variants with putative role in DVT. A group of 585 Italian idiopathic DVT patients and 550 healthy controls was used to genotype all the 18 risk-associated variants identified by NGS. Replication study in the Italian population identified the rs2232710 variant in the protein Z-dependent protease inhibitor (ZPI) gene to be associated with an increased risk of DVT (OR 2.74; 95% CI 1.33–5.65; P = 0.0045; Bonferroni P = 0.081). However, the rs2232710 SNV showed no association with DVT in two Dutch replication cohorts the LETS study (454 patients and 451 controls) and the MEGA study (3799 patients and 4399 controls), indicating that the rs2232710 variant is not a risk factor for DVT. PMID:26982741

  17. Identification of a single nucleotide promoter polymorphism regulating the transcription of ubiquitin specific protease 18 gene related to the resistance to porcine reproductive and respiratory syndrome virus infection.

    PubMed

    Li, Yanping; Sun, Yi; Xing, Feng; Kang, Li; Wang, Pengfei; Wang, Liyuan; Liu, Hao; Li, Yi; Jiang, Yunliang

    2014-12-15

    Porcine reproductive and respiratory syndrome (PRRS), characterized by reproductive failure in sows and respiratory disease and mortality in piglets, is a major infectious disease that causes great economic loss throughout the world. Previous studies revealed that the overexpression of porcine ubiquitin specific protease 18 (USP18) gene inhibits PRRSV replication in vitro. The objective of this study is to compare the promoter activity of USP18 in Chinese indigenous Dapulian (DPL) pigs and Duroc×Landrace×Yorkshire (DLY) commercial pigs and screen single nucleotide polymorphism (SNP) affecting porcine USP18 transcription. We found that the promoter activity was significantly higher in DPL pigs than DLY commercial pigs (p<0.05), deletion of the promoter from -1790 to -1314bp decreased the transcriptional activity by roughly 60% (p<0.05) and a SNP G-1533A in this region increased the mRNA expression both prior to and post PRRSV infection in MARC-145 cells. Population genetics analysis showed that allele A was only detected in Chinese pig breeds which are generally resistant to PRRSV. These results suggest that the SNP G-1533A polymorphism in the promoter region of porcine USP18 gene is a potential DNA marker for the resistance to PRRSV. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Ectopic expression of a grape aspartic protease gene, AP13, in Arabidopsis thaliana improves resistance to powdery mildew but increases susceptibility to Botrytis cinerea.

    PubMed

    Guo, Rongrong; Tu, Mingxing; Wang, Xianhang; Zhao, Jiao; Wan, Ran; Li, Zhi; Wang, Yuejin; Wang, Xiping

    2016-07-01

    The grape aspartic protease gene, AP13 was previously reported to be responsive, in Chinese wild Vitis quinquangularis cv. 'Shang-24', to infection by Erysiphe necator, the causal agent of powdery mildew disease, as well as to treatment with salicylic acid in V. labrusca×V. vinifera cv. 'Kyoho'. In the current study, we evaluated the expression levels of AP13 in 'Shang-24' in response to salicylic acid (SA), methyl jasmonate (MeJA) and ethylene (ET) treatments, as well as to infection by the necrotrophic fungus, Botrytis cinerea, and the transcript levels of VqAP13 decreased after B. cinerea infection and MeJA treatment, but increased following ET and SA treatments. Transgenic Arabidopsis thaliana lines over-expressing VqAP13 under the control of a constitutive promoter showed enhanced resistance to powdery mildew and to the bacterium Pseudomonas syringae pv. tomato DC3000, and accumulated more callose than wild type plants, while the resistance of transgenic A. thaliana lines to B. cinerea inoculation was reduced. In addition, the expression profiles of various disease resistance- related genes in the transgenic A. thaliana lines following infection by different pathogens were compared to the equivalent profiles in the wild type plants. The results suggest that VqAP13 action promotes the SA dependent signal transduction pathway, but suppresses the JA signal transduction pathway.

  19. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  20. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  1. Epistasis between serine protease inhibitor Kazal-type 5 (SPINK5) and thymic stromal lymphopoietin (TSLP) genes contributes to childhood asthma.

    PubMed

    Biagini Myers, Jocelyn M; Martin, Lisa J; Kovacic, Melinda Butsch; Mersha, Tesfaye B; He, Hua; Pilipenko, Valentina; Lindsey, Mark A; Ericksen, Mark B; Bernstein, David I; LeMasters, Grace K; Lockey, James E; Khurana Hershey, Gurjit K

    2014-10-01

    Epithelial genes have previously been associated with asthma but only explain a small fraction of heritability. In part, this might be due to epistasis, which is often not considered. We sought to determine independent and epistatic associations between filaggrin (FLG), serine protease inhibitor Kazal-type 5 (SPINK5), and thymic stromal lymphopoietin (TSLP) gene variants and childhood asthma. Using a candidate gene approach, we genotyped 29 variants in FLG, SPINK5, and TSLP in asthmatic, allergic, and nonallergic nonasthmatic white and black children participating in the well-phenotyped Greater Cincinnati Pediatric Clinic Repository. Associations with asthma were also assessed in 6 replication populations. We observed independent associations of variants in SPINK5 (P = .003) and TSLP (P = .006) with childhood asthma; a SPINK5 single nucleotide polymorphism was replicated. In subjects with 1 or more SPINK5 risk alleles, the absence of the TSLP protective minor alleles was associated with a significant increase in asthma (67% vs 53%, P = .0017). In contrast, the presence or absence of TSLP minor alleles did not affect asthma risk in subjects without the SPINK5 risk alleles. The SPINK5 and TSLP epistasis was replicated in a black population (P = .036) who did not display independent association with variants in these genes. Our results support epistasis between SPINK5 and TSLP, which contributes to childhood asthma. These findings emphasize the importance of using biology to inform analyses to identify genetic susceptibility to complex diseases. The results from our study have clinical relevance and support that the therapeutic effects of anti-TSLP therapy in asthmatic patients might be dependent on SPINK5 genotype. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. Positive selection in the SLC11A1 gene in the family Equidae.

    PubMed

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  3. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    PubMed

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  4. Wound healing genes and susceptibility to cutaneous leishmaniasis in Brazil: Role of COL1A1

    PubMed Central

    Almeida, Lucas; Oliveira, Joyce; Guimarães, Luiz Henrique; Carvalho, Edgar M; Blackwell, Jenefer M

    2015-01-01

    Previous studies have demonstrated a role for wound healing genes in resolution of cutaneous lesions caused by Leishmania spp. in both mice and humans, including the gene FLI1 encoding Friend leukaemia virus integration 1. Reduction of Fli1 expression in mice has been shown to result in up-regulation of collagen type I alpha 1 (Col1a1) and alpha 2 (Col1a2) genes and, conversely, in down-regulation of the matrix metalloproteinase 1 (Mmp1) gene, suggesting that Fli1 suppression is involved in activation of the profibrotic gene program. Here we examined single nucleotide polymorphisms (SNPs) in these genes as risk factors for cutaneous (CL) and mucosal leishmaniasis (ML), and leishmaniasis per se, caused by L. braziliensis in humans. SNPs were genotyped in 168 nuclear families (250 CL; 87 ML cases) and replicated in 157 families (402 CL; 39 ML cases). Family-based association tests (FBAT) showed the strongest association between SNPs rs1061237 (combined P=0.002) and rs2586488 (combined P=0.027) at COL1A1 and CL disease. This contributes to our further understanding of the role of wound healing in the resolution of CL disease, providing potential for therapies modulating COL1A1 via drugs acting on FLI1. PMID:25562121

  5. A Point Mutation in the FRNK Motif of the Potyvirus Helper Component-Protease Gene Alters Symptom Expression in Cucurbits and Elicits Protection Against the Severe Homologous Virus.

    PubMed

    Gal-On, A

    2000-05-01

    Sequence comparison had previously shown three amino acid changes in conserved motifs in the 455-amino acid sequence of the helper component-protease (HC-Pro) between a severe field strain of Zucchini yellow mosaic virus (ZYMV-NAT) and a mild field strain of ZYMV (ZYMV-WK). In this study, exchange of fragments and site-directed mutagenesis within the HC-Pro gene in an infectious clone of ZYMV enabled the effects of the mutations on symptom expression to be mapped. The substitution of Ile for Arg at position 180 in the conserved motif Phe-Arg-Asn-Lys (FRNK) of potyviruses was found to affect symptom expression. Infection of cucurbits with the engineered ZYMV (ZYMV-AG) that contained this mutation caused a dramatic symptom change from severe to mild in squash and to a symptom-free appearance in cucumber, melon, and watermelon. The Ile to Arg mutation was found to be stable, and no revertant virus was found after several passages through plants after long incubation periods. The AG strain was detected 4 days postinoculation and accumulated in cucurbits to a level and with kinetics similar to that of the wild-type ZYMV-AT strain. Cucurbit plants infected with the AG strain were protected against infection by the severe strain.

  6. Fibrochondrogenesis Results from Mutations in the COL11A1 Type XI Collagen Gene

    PubMed Central

    Tompson, Stuart W.; Bacino, Carlos A.; Safina, Nicole P.; Bober, Michael B.; Proud, Virginia K.; Funari, Tara; Wangler, Michael F.; Nevarez, Lisette; Ala-Kokko, Leena; Wilcox, William R.; Eyre, David R.; Krakow, Deborah; Cohn, Daniel H.

    2010-01-01

    Fibrochondrogenesis is a severe, autosomal-recessive, short-limbed skeletal dysplasia. In a single case of fibrochondrogenesis, whole-genome SNP genotyping identified unknown ancestral consanguinity by detecting three autozygous regions. Because of the predominantly skeletal nature of the phenotype, the 389 genes localized to the autozygous intervals were prioritized for mutation analysis by correlation of their expression with known cartilage-selective genes via the UCLA Gene Expression Tool, UGET. The gene encoding the α1 chain of type XI collagen (COL11A1) was the only cartilage-selective gene among the three candidate intervals. Sequence analysis of COL11A1 in two genetically independent fibrochondrogenesis cases demonstrated that each was a compound heterozygote for a loss-of-function mutation on one allele and a mutation predicting substitution for a conserved triple-helical glycine residue on the other. The parents who were carriers of missense mutations had myopia. Early-onset hearing loss was noted in both parents who carried a loss-of-function allele, suggesting COL11A1 as a locus for mild, dominantly inherited hearing loss. These findings identify COL11A1 as a locus for fibrochondrogenesis and indicate that there might be phenotypic manifestations among carriers. PMID:21035103

  7. Widely distributed mutations in the COL2A1 gene produce achondrogenesis type II/hypochondrogenesis.

    PubMed

    Körkkö, J; Cohn, D H; Ala-Kokko, L; Krakow, D; Prockop, D J

    2000-05-15

    The COL2A1 gene was assayed for mutations in genomic DNA from 12 patients with achondrogenesis type II/hypochondrogenesis. The exons and flanking sequences of the 54 exons in the COL2A1 gene were amplified by a series of specific primers using PCR. The PCR products were scanned for mutations by conformation sensitive gel electrophoresis, and PCR products that generated heteroduplex bands were then sequenced. Mutations in the COL2A1 gene were found in all 12 patients. Ten of the mutations were single base substitutions that converted a codon for an obligate glycine to a codon for an amino acid with a bulkier side chain. One of the mutations was a change in a consensus RNA splice site. Another was an 18-base pair deletion of coding sequences. The results confirmed previous indications that conformation sensitive gel electrophoresis is highly sensitive for detection of mutations in large and complex genes. They also demonstrate that most, if not all, patients with achondrogenesis type II/hypochondrogenesis have mutations in the COL2A1 gene.

  8. Congenital glucose-galactose malabsorption: a novel deletion within the SLC5A1 gene.

    PubMed

    Vallaeys, L; Van Biervliet, S; De Bruyn, G; Loeys, B; Moring, A S; Van Deynse, E; Cornette, L

    2013-03-01

    Glucose-galactose malabsorption (GGM) is an autosomal recessive disease caused by mutations in the Na(+)/glucose cotransporter gene SLC5A1 (OMIM 182380, phenotype number 606824). Patients with GGM present with neonatal onset of severe life-threatening diarrhoea and dehydration. We describe a 5-day-old girl with the typical clinical course of GGM. Our clinical diagnosis was confirmed by an abnormal chromatography of the stool and normal small bowel biopsies. Mutation analysis revealed a novel, homozygous deletion within exon 10 of the SLC5A1 gene, i.e. c.1107_1109 del AGT.

  9. Two different forms of lethal chondrodysplasias caused by COL2A1 gene mutations

    SciTech Connect

    Winterpacht, A.; Hilbert, K.; Schwarze, U.

    1994-09-01

    Two bone dysplasia families seem to be due to mutations in the type II procollagen gene (COL2A1): the so-called spondyloepiphyseal dysplasia congenita (SEDC) group with achondrogenesis II, hypochondrogenesis, SEDC, osteoarthrosis and the Stickler-Kniest pattern that include different forms of Kniest and Stickler dysplasia. Both groups comprise a clinical spectrum ranging from lethal to mild. COL2A1-mutations have been identified in lethal forms of the SEDC family but not in lethal forms of the Stickler/Kniest group. We now report a COL2A-1 mutation in an additional case of hypochondrogenesis (patient S) and in a lethal case of Kniest dysplasia (patient B). We amplified all 54 exons of the COL2A1 gene in both patients and screened the PCR products for mutations by SSCP analysis and sequencing. In patient B, we identified an 18 bp deletion in exon 34 which removes 6 amino acids from the mature protein. In patient S, we were able to identify a two base pair exchange (GG to AT) in exon 31, which leads to the very unusual conversion of Gly to Ile. To our knowledge, this is the first report of a Gly to Ile conversion in the COL2A1 gene, and the first report of a COL2A1 gene mutation in a lethal form of Kniest dysplasia. On the basis of the known COL2A1 gene mutations and the genotype-phenotype correlations established so far, we provide molecular data (an in frame deletion in patient B and a Gly conversion in patient S) that support their clinical classification as Kniest dysplasia and hypochondrogenesis, respectively.

  10. Use of buckwheat seed protease inhibitor gene for improvement of tobacco and potato plant resistance to biotic stress.

    PubMed

    Khadeeva, N V; Kochieva, E Z; Tcherednitchenko, M Yu; Yakovleva, E Yu; Sydoruk, K V; Bogush, V G; Dunaevsky, Y E; Belozersky, M A

    2009-03-01

    The possibility to use agrobacterial transformation of leaf discs to produce resistance to bacterial infections in tobacco and potato plants by introduction of a single gene encoding the serine proteinase inhibitor BWI-1a (ISP) from buckwheat seeds is shown. All studied PCR-positive transgenic plants exhibited antibacterial activity in biotests. It was shown that the presence of just a single gene of serine proteinase inhibitor provides sufficient protection at least against two bacterial phytopathogens, Pseudomonas syringae pv. tomato and Clavibacter michiganensis sbsp. michiganensis. The biotest including tobacco plant infection by the white wings butterfly in the green house has also demonstrated the existence of protective effect in transgenic tobacco plants. Significant genotypic variations in the protection efficiency were found between members of different genera of the same family (potato and tobacco) as well as between different lines of the same species. Northern blot analysis of four transgenic potato lines and three tobacco lines transformed by a vector plasmid containing the ISP gene of serine proteinases BWI-1a from buckwheat seeds has shown the presence of the expected size mRNA transcript.

  11. Organization of the methylamine utilization (mau) genes in Methylophilus methylotrophus W3A1-NS.

    PubMed Central

    Chistoserdov, A Y; McIntire, W S; Mathews, F S; Lidstrom, M E

    1994-01-01

    The organization of genes involved in utilization of methylamine (mau genes) was studied in Methylophilus methylotrophus W3A1. The strain used was a nonmucoid variant termed NS (nonslimy). The original mucoid strain was shown to be identical to the NS strains on the basis of chromosomal digest and hybridization patterns. An 8-kb PstI fragment of the chromosome from M. methylotrophus W3A1-NS encoding the mau genes was cloned and a 6,533-bp region was sequenced. Eight open reading frames were found inside the sequenced area. On the basis of a high level of sequence identity with the Mau polypeptides from Methylobacterium extorquens AM1, the eight open reading frames were identified as mauFBEDAGLM. The mau gene cluster from M. methylotrophus W3A1 is missing two genes, mauC (amicyanin) and mauJ (whose function is unknown), which have been found between mauA and mauG in all studied mau gene clusters. Mau polypeptides sequenced so far from five different bacteria show considerable identity. A mauA mutant of M. methylotrophus W3A1-NS that was constructed lost the ability to grow on all amines as sources of nitrogen but still retained the ability to grow on trimethylamine as a source of carbon. Thus, unlike M. extorquens AM1 and Methylobacillus flagellatum KT, M. methylotrophus W3A1-NS does not have an additional methylamine dehydrogenase system for amine oxidation. Using a promoter-probe vector, we identified a promoter upstream of mauF and used it to construct a potential expression vector, pAYC229. Images PMID:8021188

  12. Deletion of Braun lipoprotein and plasminogen-activating protease-encoding genes attenuates Yersinia pestis in mouse models of bubonic and pneumonic plague.

    PubMed

    van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K

    2014-06-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.

  13. Deletion of Braun Lipoprotein and Plasminogen-Activating Protease-Encoding Genes Attenuates Yersinia pestis in Mouse Models of Bubonic and Pneumonic Plague

    PubMed Central

    van Lier, Christina J.; Sha, Jian; Kirtley, Michelle L.; Cao, Anthony; Tiner, Bethany L.; Erova, Tatiana E.; Cong, Yingzi; Kozlova, Elena V.; Popov, Vsevolod L.; Baze, Wallace B.

    2014-01-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4+ and CD8+ T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection. PMID:24686064

  14. Binary and ternary combinations of anti-HIV protease inhibitors: effect on gene expression and functional activity of CYP3A4 and efflux transporters

    PubMed Central

    Kwatra, Deep; Vadlapudi, Aswani Dutt; Vadlapatla, Ramya Krishna; Khurana, Varun; Pal, Dhananjay; Mitra, Ashim K.

    2015-01-01

    Background The purpose of this study is to identify the effect of binary and ternary combinations of anti-HIV protease inhibitors (PIs) on the expression of metabolizing enzyme (CYP3A4) and efflux transporters [multidrug resistance-associated protein 2 (MRP2), P-glycoprotein (P-gp) and breast cancer resistant protein (BCRP)] in a model intestinal cell line (LS-180). Methods LS-180 cells were treated with various combinations of PIs (amprenavir, indinavir, saquinavir and lopinavir), and the mRNA expression levels of metabolizing enzyme and efflux transporters were measured using quantitative reverse transcription polymerase chain reaction. The alteration of gene expression was further correlated to the expression of nuclear hormone receptor PXR. Uptake of fluorescent and radioactive substrates was carried out to study the functional activity of these proteins. Cytotoxicity and adenosine triphosphate (ATP) assays were carried out to measure stress responses. Results Binary and ternary combinations of PIs appeared to modulate the expression of CYP3A4, MRP2, P-gp and BCRP in a considerable manner. Unlike the individual PIs, their binary combinations showed much greater induction of metabolizing enzyme and efflux proteins. However, such pronounced induction was not observed in the presence of ternary combinations. The observed trend of altered mRNA expression was found to correlate well with the change in expression levels of PXR. The gene expression was found to correlate with activity assays. Lack of cytotoxicity and ATP activity was observed in the treatment samples, suggesting that these alterations in expression levels were probably not stress responses. Conclusions In the present study, we demonstrated that combinations of drugs can have serious consequences toward the treatment of HIV infection by altering their bioavailability and disposition. PMID:24399676

  15. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  16. Association of COL2A1 Gene Polymorphism with Degenerative Lumbar Scoliosis

    PubMed Central

    Hwang, Dae Woo; Lee, Sang Hoon; Kim, Jung Youn; Kim, Dong Hwan

    2014-01-01

    Background Degenerative lumbar scoliosis (DLS) progresses with aging after 50-60 years, and the genetic association of DLS remains largely unclear. In this study, the genetic association between collagen type II alpha 1 (COL2A1) gene and DLS was investigated. Methods COL2A1 gene polymorphism was investigated in DLS subjects compared to healthy controls to investigate the possibility of its association with COL2A1 gene. Based on a single nucleotide polymorphism (SNP) database, SNP (rs2276454) in COL2A1 were selected and genotyped using direct sequencing in 51 patients with DLS and 235 healthy controls. The SNP effects were analyzed using three models of codominant, dominant, and recessive. Logistic regression models were calculated for odds ratios (ORs) with 95% confidence intervals (CIs) and corresponding p-values, controlling age and gender as co-variables. Results SNP (rs2276454) in COL2A1 was significantly associated with the degenerative lumbar scoliosis in the codominant (OR, 1.90; 95% CI, 1.17 to 3.10; p = 0.008) and dominant models (OR, 3.58; 95% CI, 1.59 to 9.29; p = 0.001). Conclusions The results suggest that COL2A1 is associated with the risk of DLS in Korean population. PMID:25436060

  17. Tsukamurella pulmonis bloodstream infection identified by secA1 gene sequencing.

    PubMed

    Pérez Del Molino Bernal, Inmaculada C; Cano, María E; García de la Fuente, Celia; Martínez-Martínez, Luis; López, Mónica; Fernández-Mazarrasa, Carlos; Agüero, Jesús

    2015-02-01

    Recurrent bloodstream infections caused by a Gram-positive bacterium affected an immunocompromised child. Tsukamurella pulmonis was the microorganism identified by secA1 gene sequencing. Antibiotic treatment in combination with removal of the subcutaneous port healed the patient. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. Tsukamurella pulmonis Bloodstream Infection Identified by secA1 Gene Sequencing

    PubMed Central

    Cano, María E.; García de la Fuente, Celia; Martínez-Martínez, Luis; López, Mónica; Fernández-Mazarrasa, Carlos

    2014-01-01

    Recurrent bloodstream infections caused by a Gram-positive bacterium affected an immunocompromised child. Tsukamurella pulmonis was the microorganism identified by secA1 gene sequencing. Antibiotic treatment in combination with removal of the subcutaneous port healed the patient. PMID:25520439

  19. Mutations in the SLC3A1 transporter gene in cystinuria

    SciTech Connect

    Pras, E.; Raben, N.; Aksentijevich, I.

    1995-06-01

    Cystinuria is an autosomal recessive disease characterized by the development of kidney stones. Guided by the identification of the SLC3A1 amino acid-transport gene on chromosome 2, we recently established genetic linkage of cystinuria to chromosome 2p in 17 families, without evidence for locus heterogeneity. Other authors have independently identified missense mutations in SLC3A1 in cystinuria patients. In this report we describe four additional cystinuria-associated mutations in this gene: a frameshift, a deletion, a transversion inducing a critical amino acid change, and a nonsense mutation. The latter stop codon was found in all of eight Ashkenazi Jewish carrier chromosomes examined. This report brings the number of disease-associated mutations in this gene to 10. We also assess the frequency of these mutations in our 17 cystinuria families. 24 refs., 4 figs., 1 tab.

  20. A novel osteoporosis model with ascorbic acid deficiency in Akr1A1 gene knockout mice

    PubMed Central

    Tu, Min-Yu; Lin, Wei-Yu; Röhrig, Theresa; Yang, Shang-Hsun; Lan, Ying-Wei; Chong, Kowit-Yu; Chen, Chuan-Mu

    2017-01-01

    The AKR1A1 protein is a member of the aldo-keto reductase superfamily that is responsible for the conversion of D-glucuronate to L-gulonate in the ascorbic acid (vitamin C) synthesis pathway. In a pCAG-eGFP transgenic mouse line that was produced by pronuclear microinjection, the integration of the transgene resulted in a 30-kb genomic DNA deletion, including the Akr1A1 gene, and thus caused the knockout (KO) of the Akr1A1 gene and targeting of the eGFP gene. The Akr1A1 KO mice (Akr1A1eGFP/eGFP) exhibited insufficient serum ascorbic acid levels, abnormal bone development and osteoporosis. Using micro-CT analysis, the results showed that the microarchitecture of the 12-week-old Akr1A1eGFP/eGFP mouse femur was shorter in length and exhibited less cortical bone thickness, enlargement of the bone marrow cavity and a complete loss of the trabecular bone in the distal femur. The femoral head and neck of the proximal femur also showed a severe loss of bone mass. Based on the decreased levels of serum osteocalcin and osteoblast activity in the Akr1A1eGFP/eGFP mice, the osteoporosis might be caused by impaired bone formation. In addition, administration of ascorbic acid to the Akr1A1eGFP/eGFP mice significantly prevented the condition of osteoporotic femurs and increased bone formation. Therefore, through ascorbic acid administration, the Akr1A1 KO mice exhibited controllable osteoporosis and may serve as a novel model for osteoporotic research. PMID:28060768

  1. Inhibitory Monoclonal Antibodies against Mouse Proteases Raised in Gene-Deficient Mice Block Proteolytic Functions in vivo

    PubMed Central

    Lund, Ida K.; Rasch, Morten G.; Ingvarsen, Signe; Pass, Jesper; Madsen, Daniel H.; Engelholm, Lars H.; Behrendt, Niels; Høyer-Hansen, Gunilla

    2012-01-01

    Identification of targets for cancer therapy requires the understanding of the in vivo roles of proteins, which can be derived from studies using gene-targeted mice. An alternative strategy is the administration of inhibitory monoclonal antibodies (mAbs), causing acute disruption of the target protein function(s). This approach has the advantage of being a model for therapeutic targeting. mAbs for use in mouse models can be obtained through immunization of gene-deficient mice with the autologous protein. Such mAbs react with both species-specific epitopes and epitopes conserved between species. mAbs against proteins involved in extracellular proteolysis, including plasminogen activators urokinase plasminogen activator (uPA), tissue-type plasminogen activator (tPA), their inhibitor PAI-1, the uPA receptor (uPAR), two matrix metalloproteinases (MMP9 and MMP14), as well as the collagen internalization receptor uPARAP, have been developed. The inhibitory mAbs against uPA and uPAR block plasminogen activation and thereby hepatic fibrinolysis in vivo. Wound healing, another plasmin-dependent process, is delayed by an inhibitory mAb against uPA in the adult mouse. Thromboembolism can be inhibited by anti-PAI-1 mAbs in vivo. In conclusion, function-blocking mAbs are well-suited for targeted therapy in mouse models of different diseases, including cancer. PMID:22754528

  2. Does the SLC40A1 gene modify HFE-related haemochromatosis phenotypes?

    PubMed

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Remacha, Angel F; Sardà, M Pilar; Felez, Jordi; Baiget, Montserrat

    2009-04-01

    Most hereditary haemochromatosis patients are homozygous for the C282Y mutation of the HFE gene. However, the phenotypic expression and clinical aggressiveness of the disease differs considerably from patient to patient. The main objective of this work was to study the role of variants in the SLC40A1 gene in the severity of iron overload and his clinical consequences in 100 Spanish probands homozygous for the C282Y mutation of the HFE gene. We performed automated sequencing of the coding regions, including intron-exon junctions of the SLC40A1 gene. We studied the association between polymorphisms in the SLC40A1 gene and median values of iron removed, taking into account statistical corrections for multiple comparisons. No pathogenic mutations in the SLC40A1 were detected. Five known single nucleotide polymorphisms (SNPs) were identified, and two of them were associated with phenotypic characteristics. IVS1-24 C>G was associated with the amount of iron removed and presence of liver disease: Of the 83 patients finally studied for this SNP, the amount of iron removed was above the median in 36 of 56 (64.3%) for C/C, in nine of 23(39.1%) for C/G and in zero of four (0%) for G/G patients (P=0.01). Liver damage was observed in 34 of 56 patients (60.7%) for C/C, in eight of 23 (34.8%) for C/G and in zero of four (0%) for G/G (P=0.01). Both associations remained significant at multivariate analysis (P=0.011 and P=0.023, respectively). IVS1-24 C>G on the ferroportin gene seems to be a genetic modifier for clinical aggressiveness of HFE1 haemochromatosis.

  3. Interleukin-1 controls the constitutive expression of the Cyp7a1 gene by regulating the expression of Cyp7a1 transcriptional regulators in the mouse liver.

    PubMed

    Kojima, Misaki; Ashino, Takashi; Yoshida, Takemi; Iwakura, Yoichiro; Degawa, Masakuni

    2011-01-01

    Our previous study using interleukin-1α/β-knockout (IL-1-KO) and wild-type (WT) mice demonstrated that IL-1 acts as a positive factor for constitutive gene expression of hepatic cytochrome P4507a1 (Cyp7a1). In this study, to clarify the role of IL-1 in the expression of the hepatic Cyp7a1 gene, we focused on Cyp7a1 transcriptional regulators such as α-fetoprotein transcription factor (FTF), liver X receptor α (LXRα), hepatocyte nuclear factor 4α (HNF4α) and small heterodimer partner (SHP) and examined the effects of IL-1 on their gene expression by real-time reverse-transcription polymerase chain reaction using IL-1-KO and WT mice. We observed no significant differences between sex-matched IL-1-KO and WT mice with regard to gene expression levels of FTF, LXRα, and HNF4α, all of which are positive transcriptional regulators for the Cyp7a1 gene. However, interindividual differences in hepatic FTF and LXRα expression were closely dependent on the gene expression level(s) of hepatic IL-1 and tumor necrosis factor-α (TNF-α), while interindividual differences in hepatic HNF4α were clearly correlated with the expression of IL-1, but not TNF-α. In contrast, the gene expression level of SHP, which is a negative transcriptional regulator of the Cyp7a1 gene through inhibition of FTF function, was higher in IL-1-KO mice than in sex-matched WT mice. These findings demonstrate that, like TNF-α, IL-1 positively controls the gene expression of Cyp7a1 transcriptional upregulators but, in contrast to the previously reported action of TNF-α, IL-1 also acts to downregulate SHP gene expression.

  4. Dietary cholesterol fails to stimulate the human cholesterol 7alpha-hydroxylase gene (CYP7A1) in transgenic mice.

    PubMed

    Agellon, Luis B; Drover, Victor A B; Cheema, Sukhinder K; Gbaguidi, G Franck; Walsh, Annemarie

    2002-06-07

    Dietary cholesterol has been shown to have a stimulatory effect on the murine cholesterol 7alpha-hydroxylase gene (Cyp7a1), but its effect on human cholesterol 7alpha-hydroxylase gene (CYP7A1) expression in vivo is not known. A transgenic mouse strain harboring the human CYP7A1 gene and homozygous for the disrupted murine Cyp7a1 gene was created. Cholesterol feeding increased the expression of the endogenous modified Cyp7a1 allele but failed to stimulate the human CYP7A1 transgene. In transfected hepatoma cells, 25-hydroxycholesterol increased murine Cyp7a1 gene promoter activity, whereas the human CYP7A1 gene promoter was unresponsive. Electrophoretic mobility shift assays demonstrated the interaction of the liver X receptor alpha (LXRalpha): retinoid X receptor (RXR) heterodimer, a transcription factor complex that is activated by oxysterols, with the murine Cyp7a1 gene promoter, whereas no binding to the human CYP7A1 gene promoter was detected. The results demonstrate that the human CYP7A1 gene is not stimulated by dietary cholesterol in the intact animal, and this is attributable to the inability of the CYP7A1 gene promoter to interact with LXRalpha:RXR.

  5. Evaluation of SLC11A1 as an inflammatory bowel disease candidate gene

    PubMed Central

    Crawford, Nigel PS; Eichenberger, Maurice R; Colliver, Daniel W; Lewis, Robert K; Cobbs, Gary A; Petras, Robert E; Galandiuk, Susan

    2005-01-01

    Background Significant evidence suggests that a promoter polymorphism withinthe gene SLC11A1 is involved in susceptibility to both autoimmune and infectious disorders. The aim of this study was to evaluate whether SLC11A1 has a role in the susceptibility to inflammatory bowel disease (IBD) by characterizing a promoter polymorphism within the gene and two short tandem repeat (STR) markers in genetic proximity to SLC11A1. Methods The studied population consisted of 484 Caucasians with IBD, 144 population controls, and 348 non-IBD-affected first-degree relatives of IBD patients. IBD subjects were re-categorized at the sub-disease phenotypic level to characterize possible SLC11A1 genotype-phenotype correlations. Polymorphic markers were amplified from germline DNA and typed using gel electrophoresis. Genotype-phenotype correlations were defined using case-control, haplotype, and family-based association studies. Results This study did not provide compelling evidence for SLC11A1 disease association; most significantly, there was no apparent evidence of SLC11A1 promoter allele association in the studied Crohn's disease population. Conclusion Our results therefore refute previous studies that have shown SLC11A1 promoter polymorphisms are involved in susceptibility to this form of IBD. PMID:15757519

  6. Profiling deleterious non-synonymous SNPs of smoker's gene CYP1A1.

    PubMed

    Ramesh, A Sai; Khan, Imran; Farhan, Md; Thiagarajan, Padma

    2013-01-01

    CYP1A1 gene belongs to the cytochrome P450 family and is known better as smokers' gene due to its hyperactivation as a consequence of long term smoking. The expression of CYP1A1 induces polycyclic aromatic hydrocarbon production in the lungs, which when over expressed, is known to cause smoking related diseases, such as cardiovascular pathologies, cancer, and diabetes. Single nucleotide polymorphisms (SNPs) are the simplest form of genetic variations that occur at a higher frequency, and are denoted as synonymous and non-synonymous SNPs on the basis of their effects on the amino acids. This study adopts a systematic in silico approach to predict the deleterious SNPs that are associated with disease conditions. It is inferred that four SNPs are highly deleterious, among which the SNP with rs17861094 is commonly predicted to be harmful by all tools. Hydrophobic (isoleucine) to hydrophilic (serine) amino acid variation was observed in the candidate gene. Hence, this investigation aims to characterize a candidate gene from 159 SNPs of CYP1A1.

  7. Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

    PubMed Central

    Sunil, Sujatha; Chauhan, Virander S; Malhotra, Pawan

    2008-01-01

    Background Plasmodium falciparum cysteine proteases (falcipains) play indispensable roles in parasite infection and development, especially in the process of host erythrocyte rupture/invasion and hemoglobin degradation. No detailed molecular analysis of transcriptional regulation of parasite proteases especially cysteine proteases has yet been reported. In this study, using a combination of transient transfection assays and electrophoretic mobility shift assays (EMSA), we demonstrate the presence of stage specific nuclear factors that bind to unique sequence elements in the 5'upstream regions of the falcipains and probably modulate the expression of cysteine proteases. Results Falcipains differ in their timing of expression and exhibit ability to compensate each other's functions at asexual blood stages of the parasite. Present study was undertaken to study the transcriptional regulation of falcipains. Transient transfection assay employing firefly luciferase as a reporter revealed that a ~1 kb sequence upstream of translational start site is sufficient for the functional transcriptional activity of falcipain-1 gene, while falcipain-2, -2' and -3 genes that exist within 12 kb stretch on chromosome 11 require ~2 kb upstream sequences for the expression of reporter luciferase activity. EMSA analysis elucidated binding of distinct nuclear factors to specific sequences within the 5'upstream regions of falcipain genes. Analysis of falcipains' 5'upstream regulatory regions did not reveal the presence of sequences known to bind general eukaryotic factors. However, we did find parasite specific sequence elements such as poly(dA) poly(dT) tracts, CCAAT boxes and a single 7 bp-G rich sequence, (A/G)NGGGG(C/A) in the 5' upstream regulatory regions of these genes, thereby suggesting the role(s) of Plasmodium specific transcriptional factors in the regulation of falcipain genes. Conclusion Taken together, these results suggest that expression of Plasmodium cysteine proteases is

  8. Association of angiotensin-converting enzyme, CYP46A1 genes polymorphism with senile cataract

    PubMed Central

    Raza, Syed Tasleem; Abbas, Shania; Chandra, Anu; Singh, Luxmi; Rizvi, Saliha; Mahdi, Farzana

    2017-01-01

    Background: Senile cataract is the most common type of cataract characterized by gradual progressive thickening of the lens of the eye. Previously, many studies investigated the association between genetic polymorphism and senile cataract. Angiotensin-converting enzyme (ACE) I/D polymorphism is the potential risk factor for many eye-related diseases such as retinopathy and glaucoma. CYP46A1 enzyme converts cholesterol to 24S-hydroxycholesterol; human lens' membranes contain the highest cholesterol content. Defects in enzymes of cholesterol metabolism can be associated with cataracts. Hence, the present study was carried out to investigate the association of ACE and CYP46A1 genes polymorphism with senile cataract cases and controls. Materials and Methods: ACE (rs 4646994) and CYP46A1 (rs 754203) genes polymorphism in cases and controls were evaluated by polymerase chain reaction and restriction fragment length polymorphism. Results: This study included 103 senile cataract cases (55 were males and 48 were females) and 102 controls (53 were males and 49 were females). Mean age of cases in this study was 52.02 ± 12.11 years while in control group 53.74 ± 11.87 years. Frequencies of ACE ID, DD, and II genotypes in senile cataract cases were 64.07%, 4.85%, and 31.06% and controls were 61.76%, 26.47%, and 11.76%, respectively. The CYP46A1 gene CT, CC, and TT genotype frequencies were 48.54%, 8.73%, and 42.71% in senile cataract cases and 28.43%, 3.92%, and 67.64% in healthy controls, respectively. ACE DD and II genotypes (P < 0.001,P = 0.0008) and CYP46A1 CT and TT genotypes (P = 0.003,P = 0.0003) were significantly associated with senile cataract cases compared to the controls. Conclusion: Findings of this study suggest that ACE and CYP46A1 genes polymorphism may be a predictive marker for early identification of population at risk of senile cataract. This potential role of ACE and CYP46A1 genes polymorphism as a marker of susceptibility to senile cataract needs

  9. Association of CYP1A1 gene polymorphism with chronic kidney disease: a case control study.

    PubMed

    Siddarth, Manushi; Datta, Sudip K; Ahmed, Rafat S; Banerjee, Basu D; Kalra, Om P; Tripathi, Ashok K

    2013-07-01

    CYP1A1 is an important xenobiotic metabolizing enzyme, present in liver and kidney. Expression of CYP1A1 enzyme increases manifold when kidney cells are exposed to nephrotoxins/chemicals leading to oxidative stress-induced cell damage. To study the association of CYP1A1 gene polymorphism in patients of chronic kidney disease with unknown etiology (CKDU), we recruited 334 CKDU patients and 334 age and sex matched healthy controls. CYP1A1*2A and *2C polymorphisms were studied by PCR-RFLP and allele specific-PCR respectively. Subjects carrying at least one mutant allele of CYP1A1*2A (TC, CC) and *2C (AG, GG) were shown to be associated with 1.4-2-fold increased risk of CKDU. Also, genotypic combinations of hetero-/homozygous mutants of CYP1A1*2A (TC, CC) with hetero-/homozygous mutant genotypes of CYP1A1*2C (AG, GG) i.e. TC/AG (p<0.01), TC/GG (p<0.05), CC/AG (p<0.05) and CC/GG (p<0.01) were associated with CKDU with an odd ratio ranging 1.8-3.3 times approximately. This study demonstrates association of CYP1A1 polymorphisms with CKDU. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  11. Association of Apolipoprotein A1 Gene Polymorphisms with Serum Lipid Spectrum in Adolescents in East Siberia.

    PubMed

    Bairova, T A; Kalyuzhnaya, O V; Dolgikh, V V; Trukhin, A A; Pervushina, O A; Darenskaya, M A; Kolesnikova, L I; Kolesnikov, S I

    2015-12-01

    We studied the incidence of genotypes of polymorphic alleles (-75)G>A and (+83)C>T of apolipoprotein A1 gene in healthy Russian adolescents, residents of East Siberia. Genotyping was carried out by PCR with subsequent restriction fragment length polymorphism analysis. The incidence of allele (-75)A was 22.5%, of allele (+83)T - 7.3%. Association of allele (-75) A with high blood cholesterol level was revealed.

  12. Chromosomal localisation and genetic variation of the SLC11A1 gene in goats (Capra hircus).

    PubMed

    Vacca, G M; Pazzola, M; Pisano, C; Carcangiu, V; Diaz, M L; Nieddu, M; Robledo, R; Mezzanotte, R; Dettori, M L

    2011-10-01

    The solute carrier family 11 member A1 (SLC11A1) gene is associated with resistance to infectious diseases. Chromosomal localisation, genomic regions corresponding to functional domains and the genetic variability of microsatellites in the 3' untranslated region (3'-UTR) of this gene were investigated in 427 goats (Capra hircus) of six breeds. Using dual colour fluorescence in situ hybridisation, SLC11A1 was localised to goat chromosome 2. Single strand conformation polymorphism was used to screen for polymorphisms in SLC11A1 exons 2, 10 and 15. There was no variation among goat breeds in the sarcoma homology 3 (SH3) binding motif, the protein kinase C phosphorylation site or the two N-linked glycosylation sites. Exon 15 exhibited variability due to the presence of two polymorphic microsatellites. Genotyping of the upstream guanine-thymine repeat (GTn) at 3'-UTR revealed eight alleles (GT11, GT12, GT14-GT19) in goats, whereas GT13 (present in cattle) was absent. Most goats carried the GT16 allele and no allele was found to be exclusive to only one breed. The coefficient of genetic differentiation value (G(ST)) was 0.084. This microsatellite appears to be an informative DNA marker for genetic linkage analysis in goats.

  13. The AtCathB3 gene, encoding a cathepsin B-like protease, is expressed during germination of Arabidopsis thaliana and transcriptionally repressed by the basic leucine zipper protein GBF1

    PubMed Central

    Wozny, Dorothee; Barrero-Sicilia, Cristina

    2014-01-01

    Protein hydrolysis plays an important role during seed germination and post-germination seedling establishment. In Arabidopsis thaliana, cathepsin B-like proteases are encoded by a gene family of three members, but only the AtCathB3 gene is highly induced upon seed germination and at the early post-germination stage. Seeds of a homozygous T-DNA insertion mutant in the AtCathB3 gene have, besides a reduced cathepsin B activity, a slower germination than the wild type. To explore the transcriptional regulation of this gene, we used a combined phylogenetic shadowing approach together with a yeast one-hybrid screening of an arrayed library of approximately 1200 transcription factor open reading frames from Arabidopsis thaliana. We identified a conserved CathB3-element in the promoters of orthologous CathB3 genes within the Brassicaceae species analysed, and, as its DNA-interacting protein, the G-Box Binding Factor1 (GBF1). Transient overexpression of GBF1 together with a PAtCathB3::uidA (β-glucuronidase) construct in tobacco plants revealed a negative effect of GBF1 on expression driven by the AtCathB3 promoter. In stable P35S::GBF1 lines, not only was the expression of the AtCathB3 gene drastically reduced, but a significant slower germination was also observed. In the homozygous knockout mutant for the GBF1 gene, the opposite effect was found. These data indicate that GBF1 is a transcriptional repressor of the AtCathB3 gene and affects the germination kinetics of Arabidopsis thaliana seeds. As AtCathB3 is also expressed during post-germination in the cotyledons, a role for the AtCathB3-like protease in reserve mobilization is also inferred. PMID:24600022

  14. The AtCathB3 gene, encoding a cathepsin B-like protease, is expressed during germination of Arabidopsis thaliana and transcriptionally repressed by the basic leucine zipper protein GBF1.

    PubMed

    Iglesias-Fernández, Raquel; Wozny, Dorothee; Iriondo-de Hond, Maite; Oñate-Sánchez, Luis; Carbonero, Pilar; Barrero-Sicilia, Cristina

    2014-05-01

    Protein hydrolysis plays an important role during seed germination and post-germination seedling establishment. In Arabidopsis thaliana, cathepsin B-like proteases are encoded by a gene family of three members, but only the AtCathB3 gene is highly induced upon seed germination and at the early post-germination stage. Seeds of a homozygous T-DNA insertion mutant in the AtCathB3 gene have, besides a reduced cathepsin B activity, a slower germination than the wild type. To explore the transcriptional regulation of this gene, we used a combined phylogenetic shadowing approach together with a yeast one-hybrid screening of an arrayed library of approximately 1200 transcription factor open reading frames from Arabidopsis thaliana. We identified a conserved CathB3-element in the promoters of orthologous CathB3 genes within the Brassicaceae species analysed, and, as its DNA-interacting protein, the G-Box Binding Factor1 (GBF1). Transient overexpression of GBF1 together with a PAtCathB3::uidA (β-glucuronidase) construct in tobacco plants revealed a negative effect of GBF1 on expression driven by the AtCathB3 promoter. In stable P35S::GBF1 lines, not only was the expression of the AtCathB3 gene drastically reduced, but a significant slower germination was also observed. In the homozygous knockout mutant for the GBF1 gene, the opposite effect was found. These data indicate that GBF1 is a transcriptional repressor of the AtCathB3 gene and affects the germination kinetics of Arabidopsis thaliana seeds. As AtCathB3 is also expressed during post-germination in the cotyledons, a role for the AtCathB3-like protease in reserve mobilization is also inferred.

  15. Alginate-Dependent Gene Expression Mechanism in Sphingomonas sp. Strain A1

    PubMed Central

    Hayashi, Chie; Takase, Ryuichi; Momma, Keiko; Maruyama, Yukie; Murata, Kousaku

    2014-01-01

    Sphingomonas sp. strain A1, a Gram-negative bacterium, directly incorporates alginate polysaccharide into the cytoplasm through a periplasmic alginate-binding protein-dependent ATP-binding cassette transporter. The polysaccharide is degraded to monosaccharides via the formation of oligosaccharides by endo- and exotype alginate lyases. The strain A1 proteins for alginate uptake and degradation are encoded in both strands of a genetic cluster in the bacterial genome and inducibly expressed in the presence of alginate. Here we show the function of the alginate-dependent transcription factor AlgO and its mode of action on the genetic cluster and alginate oligosaccharides. A putative gene within the genetic cluster seems to encode a transcription factor-like protein (AlgO). Mutant strain A1 (ΔAlgO mutant) cells with a disrupted algO gene constitutively produced alginate-related proteins. DNA microarray analysis indicated that wild-type cells inducibly transcribed the genetic cluster only in the presence of alginate, while ΔAlgO mutant cells constitutively expressed the genetic cluster. A gel mobility shift assay showed that AlgO binds to the specific intergenic region between algO and algS (algO-algS). Binding of AlgO to the algO-algS intergenic region diminished with increasing alginate oligosaccharides. These results demonstrated a novel alginate-dependent gene expression mechanism. In the absence of alginate, AlgO binds to the algO-algS intergenic region and represses the expression of both strands of the genetic cluster, while in the presence of alginate, AlgO dissociates from the algO-algS intergenic region via binding to alginate oligosaccharides produced through the lyase reaction and subsequently initiates transcription of the genetic cluster. This is the first report on the mechanism by which alginate regulates the expression of the gene cluster. PMID:24816607

  16. Effects of protease and non-starch polysaccharide enzyme on performance, digestive function, activity and gene expression of endogenous enzyme of broilers.

    PubMed

    Yuan, Lin; Wang, Mingfa; Zhang, Xiaotu; Wang, Zhixiang

    2017-01-01

    Three hundred one-day-old male broiler chickens (Ross-308) were fed corn-soybean basal diets containing non-starch polysaccharide (NSP) enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI) and average daily gain (ADG) were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05). Feed-to-gain ratio (FGR) was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05). Apparent digestibility of crude protein (ADCP) was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05). Cholecystokinin (CCK) level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05), but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05), respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05). However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05). The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05). Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased

  17. Effects of protease and non-starch polysaccharide enzyme on performance, digestive function, activity and gene expression of endogenous enzyme of broilers

    PubMed Central

    Wang, Mingfa; Zhang, Xiaotu; Wang, Zhixiang

    2017-01-01

    Three hundred one-day-old male broiler chickens (Ross-308) were fed corn-soybean basal diets containing non-starch polysaccharide (NSP) enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI) and average daily gain (ADG) were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05). Feed-to-gain ratio (FGR) was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05). Apparent digestibility of crude protein (ADCP) was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05). Cholecystokinin (CCK) level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05), but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05), respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05). However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05). The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05). Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased

  18. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    USDA-ARS?s Scientific Manuscript database

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  19. SLC11A1 (Formerly NRAMP1) gene polymorphisms associated with pediatric tuberculosis in China.

    PubMed

    Jin, Jing; Sun, Lin; Jiao, Weiwei; Zhao, Shunying; Li, Huimin; Guan, Xiaolei; Jiao, Anxia; Jiang, Zaifang; Shen, Adong

    2009-03-15

    Tuberculosis is an urgent public health problem caused by Mycobacterium tuberculosis infection. Many factors, including host genetic factors, are involved in tuberculosis pathogenesis. The SLC11A1 gene (formerly NRAMP1) is a primary candidate for association with tuberculosis susceptibility. We examined the association between SLC11A1 polymorphisms and susceptibility to tuberculosis in Han Chinese children. The study included 136 pediatric patients with tuberculosis and 435 pediatric control subjects. Polymerase chain reaction restriction fragment-length polymorphism analysis was performed with blood samples to distinguish allele genotypes of INT4 (a G-->C single nucleotide change in intron 4, 469 + 14G/C) and the 3'UTR (TGTG deletion in the 3' untranslated region, 1729 + 55del) in the SLC11A1 gene. Differences in genotype frequency were analyzed for patients with tuberculosis and control subjects. We did not identify any statistically significant differences between the tuberculosis and control groups with regard to the frequency of genotype variants G/C and C/C at the INT4 locus. The frequency of genotype variants (TGTG +/delete and TGTG delete/delete) was significantly higher in the tuberculosis group than in the control group at the 3'UTR locus. Differences in genotype distribution at the 3'UTR locus were only identified in female subjects, with a greater number of variant genotypes in the tuberculosis group. Variant genotypes at the 3'UTR locus in the SLC11A1 gene were associated with pediatric tuberculosis in Chinese patients. Patient sex may affect the outcome of M. tuberculosis infection in children.

  20. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  1. Gilbert and Crigler Najjar syndromes: an update of the UDP-glucuronosyltransferase 1A1 (UGT1A1) gene mutation database.

    PubMed

    Canu, Giulia; Minucci, Angelo; Zuppi, Cecilia; Capoluongo, Ettore

    2013-04-01

    UGT1A1 enzyme defects are responsible of both Gilbert syndrome (GS) and Crigler-Najjar syndrome (CNS). GS depends on a variant TATAA element (which contains two extra TA nucleotides as compared to the wild type genotype) in the UGT1A1 gene promoter resulting in a reduced gene expression. On the contrary, CNS forms are classified in two types depending on serum total bilirubin concentrations (STBC): the more severe (CNS-I) is characterized by high levels of STBC (342-684μmol/L), due to total deficiency of the UGT1A1 enzyme, while the milder one, namely CNS-II, is characterized by partial UGT1A1 deficiency with STBC ranging from 103 to 342μmol/L. GS and CNS are caused by genetic lesions involving a complex locus encoding the UGT1A1 gene. The present report provides an update of all reported UGT1A1 gene mutations associated to GS and CNS. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  3. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  4. Variation in the CYP19A1 gene and risk of colon and rectal cancer.

    PubMed

    Slattery, Martha L; Lundgreen, Abbie; Herrick, Jennifer S; Kadlubar, Susan; Caan, Bette J; Potter, John D; Wolff, Roger K

    2011-07-01

    CYP19A1, or aromatase, influences estrogen-metabolizing enzymes and may influence cancer risk. We examine variation in the CYP19A1 gene and risk of colorectal cancer using data from population-based case-control studies (colon n = 1,574 cases, 1,970 controls; rectal n = 791 cases, 999 controls). Four SNPs were statistically significantly associated with colon cancer and four were associated with rectal cancer. After adjustment for multiple comparisons, the AA genotype of rs12591359 was associated with an increased risk of colon cancer (OR 1.44 95% CI 1.16-1.80) and the AA genotype of rs2470144 was associated with a reduced risk of rectal cancer (OR 0.65 95% CI 0.50-0.84). Variants of CYP19A1 were associated with CIMP+ and CIMP+/KRAS2-mutated tumors. CT/TT genotypes of rs1961177 were significantly associated with an increased likelihood of a MSI+ colon tumor (OR 1.77 95% CI 1.26-2.37). We observed statistically significant interactions between genetic variation in NFκB1 and CYP19A1 for both colon and rectal cancer. Our data suggest the importance of CYP19A1 in the development of colon and rectal cancer and that estrogen may influence risk through an inflammation-related mechanism.

  5. Novel missense mutation of the UGT1A1 gene in Thai siblings with Gilbert's syndrome.

    PubMed

    Sutomo, Retno; Laosombat, Vichai; Sadewa, Ahmad Hamim; Yokoyama, Naoki; Nakamura, Hajime; Matsuo, Masafumi; Nishio, Hisahide

    2002-08-01

    Gilbert's syndrome is a common inherited disorder of bilirubin metabolism contributing to the development of neonatal jaundice and causing recurrent jaundice after the neonatal period. In the patients with Gilbert's syndrome, mutations have been reported in the promoter and exons of the uridine diphosphate-glucuronosyl transferase 1 (UGT1A1) gene on chromsome 2q37, which encodes bilirubin uridine diphosphate-glucuronosyltransferase. However, the genetic basis of Gilbert's syndrome, including its inheritance trait, remains to be clarified. Patients 1 and 2 were Thai sisters with Gilbert's syndrome. They had a history of prolonged neonatal jaundice and showed recurrent jaundice after their infancy, while the parents showed no symptoms. To search for the mutation in the patients, all exons of the UGT1A1 gene were amplified by polymerase chain reaction (PCR) and sequenced directly. The frequency of the mutation in controls was studied by PCR-restriction enzyme digestion method. The patients were homozygous for a novel single transition of T to C at nucleotide position 247 (exon 1), which would predict a substitution of leucine for phenylalanine at codon 83 of the enzyme protein. No other mutation was detected in any regions except exon 1. The parents with no symptoms showed heterozygosity for the mutation. Among the 110 Japanese controls, no homozygous individuals and three heterozygous individuals for the mutation were identified, giving a mutated allele frequency of 0.0136. A novel missense mutation in the UGT1A1 gene was identified in two Thai siblings with Gilbert's syndrome. The affected family showed that homozygosity for the mutation may lead to apparent symptoms and that the syndrome was inherited as an autosomal recessive trait. The mutation does not explain a high incidence of neonatal jaundice in Japan, because it is very rare in the Japanese population.

  6. Mutations in the SLC3A1 gene and the molecular basis of cystinuria

    SciTech Connect

    Pras, E.; Raben, N.; Aksentijevich, I.

    1994-09-01

    Cystinuria is an autosomal recessive disease characterized by excessive urinary excretion of cystine and the dibasic amino acids. The major clinical manifestation of the disease is the development of kidney stones due to the poor solubility of cystine in the urine. Approximately 1:60 Americans is a heterozygote for cystinuria; among Libyan Jews the carrier frequency is 1:25. Three types of carriers have been described based on urinary cystine levels in heterozygotes. We recently mapped the disease susceptibility locus to chromosome 2p in a panel of 17 Israeli and American families, without evidence for locus heterogeneity. Another group simultaneously identified six cystinuria-associated missense mutations in the SLC3A1 (rBAT, D2H) gene, which is found on chromosome 2. This gene encodes a protein in the renal tubular epithelium that resorbs filtered cystine from the urine. Here we report two additional SLC3A1 mutations associated with cystinuria in an American family. In one parent we found a single base insertion at position 1306, causing a frame shift and downstream premature stop codon, while in the other parent we found a deletion spanning at least the first half of the cDNA. Despite the fact that the parents had significantly altered or no messenger RNA from one allele, both exhibited normal urinary cystine levels. This observation suggests that in those heterozygotes who have increased urinary cystine levels, the mutant protein may interfere with the function of the normal SLC3A1 gene product. None of the eight known mutations were found in 16 other cystinuria families that we have screened, suggesting that many more mutations exist. We are currently screening these families for new mutations.

  7. Cloning and enhancing production of a detergent- and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800.

    PubMed

    Nguyen, Thao Thi; Quyen, Thi Dinh; Le, Hoang Thanh

    2013-09-10

    Nattokinases/Subtilisins (EC 3.4.21.62) belong to the second large family of serine proteases, which gain significant attention and play important role in many biotechnology processes. Thus, a number of nattokinases/subtilisins from various Bacillus species, especially from B. subtilis strains, extensively have been investigated to understand their biochemical and physical properties as well as to improve the production for industrial application. The purpose of this study was to clone a nattokinase gene from Bacillus subtilis strain VTCC-DVN-12-01, enhance its production in B. subtilis WB800, which is deficient in eight extracellular proteases and characterize its physicochemical properties for potential application in organic synthesis and detergent production. A gene coding for the nattokinase (Nk) from B. subtilis strain VTCC-DVN-12-01 consisted of an ORF of 1146 nucleotides, encoding a pre-pro-protein enzyme (30-aa pre-signal peptide, 76-aa pro-peptide and 275-aa mature protein with a predicted molecular mass of 27.7 kDa and pI 6.6). The nattokinase showed 98-99% identity with other nattokinases/subtilisins from B. subtilis strains in GenBank. Nk was expressed in B. subtilis WB800 under the control of acoA promoter at a high level of 600 mg protein per liter culture medium which is highest yield of proteins expressed in any extracellular-protease-deficient B. subtilis system till date. Nk was purified to homogeneity with 3.25 fold purification, a specific activity of 12.7 U/mg, and a recovery of 54.17%. The purified Nk was identified by MALDI-TOF mass spectrometry through three peptides, which showed 100% identity to corresponding peptides of the B. subtilis nattokinase (CAC41625). An optimal activity for Nk was observed at 65 °C and pH 9. The nattokinase was stable at temperature up to 50 °C and in pH range of 5-11 and retained more than 85% of its initial activity after incubation for 1 h. Mg2+ activated Nk up to 162% of its activity. The addition of

  8. An S receptor kinase gene in self-compatible Brassica napus has a 1-bp deletion.

    PubMed Central

    Goring, D R; Glavin, T L; Schafer, U; Rothstein, S J

    1993-01-01

    S locus glycoprotein (SLG) and S locus receptor kinase (SRK) cDNAs were isolated from an S allele present in a number of self-compatible Brassica napus lines. This A10 allele did not segregate with self-incompatibility in crosses involving other self-incompatible B. napus lines. The SLG-A10 cDNA was found to contain an intact open reading frame and was predicted to encode an SLG protein with sequence similarities to those previously associated with phenotypically strong self-incompatibility reactions. SLG-A10 transcripts were detected in the developing stigma at steady state levels even higher than those detected for SLG alleles linked with self-incompatibility. Analysis of the corresponding SRK-A10 cDNA showed that it was very similar to other S locus receptor kinase genes and was expressed predominantly in the stigma. However, a 1-bp deletion was detected in the SRK gene toward the 3' end of the SLG homology domain. This deletion would lead to premature termination of translation and the production of a truncated SRK protein. The A10 allele was determined to represent a B. oleracea S allele based on its segregation pattern with the B. oleracea S24 allele when both these alleles were present in the same B. napus background. These results suggest that a functional SRK gene is required for Brassica self-incompatibility. PMID:8518554

  9. Mutations in the HFE, TFR2, and SLC40A1 genes in patients with hemochromatosis.

    PubMed

    Del-Castillo-Rueda, Alejandro; Moreno-Carralero, María-Isabel; Cuadrado-Grande, Nuria; Alvarez-Sala-Walther, Luis-Antonio; Enríquez-de-Salamanca, Rafael; Méndez, Manuel; Morán-Jiménez, María-Josefa

    2012-10-15

    Hereditary hemochromatosis causes iron overload and is associated with a variety of genetic and phenotypic conditions. Early diagnosis is important so that effective treatment can be administered and the risk of tissue damage avoided. Most patients are homozygous for the c.845G>A (p.C282Y) mutation in the HFE gene; however, rare forms of genetic iron overload must be diagnosed using a specific genetic analysis. We studied the genotype of 5 patients who had hyperferritinemia and an iron overload phenotype, but not classic mutations in the HFE gene. Two patients were undergoing phlebotomy and had no iron overload, 1 with metabolic syndrome and no phlebotomy had mild iron overload, and 2 patients had severe iron overload despite phlebotomy. The patients' first-degree relatives also underwent the analysis. We found 5 not previously published mutations: c.-408_-406delCAA in HFE, c.1118G>A (p.G373D), c.1473G>A (p.E491E) and c.2085G>C (p.S695S) in TFR2; and c.-428_-427GG>TT in SLC40A1. Moreover, we found 3 previously published mutations: c.221C>T (p.R71X) in HFE; c.1127C>A (p.A376D) in TFR2; and c.539T>C (p.I180T) in SLC40A1. Four patients were double heterozygous or compound heterozygous for the mutations mentioned above, and the patient with metabolic syndrome was heterozygous for a mutation in the TFR2 gene. Our findings show that hereditary hemochromatosis is clinically and genetically heterogeneous and that acquired factors may modify or determine the phenotype.

  10. Association of the vitamin D metabolism gene CYP24A1 with coronary artery calcification

    PubMed Central

    Shen, Haiqing; Bielak, Lawrence F.; Ferguson, Jane F.; Streeten, Elizabeth A.; Yerges-Armstrong, Laura M.; Liu, Jie; Post, Wendy; O'Connell, Jeffery R.; Hixson, James E.; Kardia, Sharon L.R.; Sun, Yan V.; Jhun, Mina A.; Wang, Xuexia; Mehta, Nehal N.; Li, Mingyao; Koller, Daniel L.; Hakonarson, Hakan; Keating, Brendan J.; Rader, Daniel J.; Shuldiner, Alan R.; Peyser, Patricia A.; Reilly, Muredach P.; Mitchell, Braxton D.

    2010-01-01

    Objective The Vitamin D endocrine system is essential for calcium homeostasis, and low levels of vitamin D metabolites have been associated with cardiovascular disease risk. We hypothesized that DNA sequence variation in genes regulating vitamin D metabolism and signaling pathways might influence variation in coronary artery calcification (CAC). Methods and Results We genotyped single nucleotide polymorphisms (SNPs) in GC, CYP27B1, CYP24A1, and VDR and tested their association with CAC quantity, as measured by electron beam computed tomography. Initial association studies were carried out in a discovery sample comprised of 697 Amish subjects and SNPs nominally associated with CAC quantity (4 SNPs in CYP24A1, P = 0.008-0.00003) were then tested for association with CAC quantity in two independent cohorts of subjects of European Caucasian ancestry (Genetic Epidemiology Network of Arteriopathy (GENOA) Study (n = 916) and The Penn Coronary Artery Calcification (PennCAC) sample (n = 2,061)). One of the four SNPs, rs2762939, was associated with CAC quantity in both GENOA (P = 0.007) and PennCAC (P = 0.01). In all three populations the rs2762939 C allele was associated with lower CAC quantity. Meta-analysis for the association of this SNP with CAC quantity across all three studies yielded a P value of 2.9 × 10-6. Conclusion A common SNP in the CYP24A1 gene was associated with CAC quantity in three independent populations. This result suggests a role for vitamin D metabolism in the development of CAC quantity. PMID:20847308

  11. Structural analysis of the Drosophila rpA1 gene, a member of the eucaryotic 'A' type ribosomal protein family.

    PubMed Central

    Qian, S; Zhang, J Y; Kay, M A; Jacobs-Lorena, M

    1987-01-01

    The expression of ribosomal protein (r-protein) genes is uniquely regulated at the translational level during early development of Drosophila. Here we report results of a detailed analysis of the r-protein rpA1 gene. A cloned DNA sequence coding for rpA1 has been identified by hybrid-selected translation and amino acid composition analysis. The rpA1 gene was localized to polytene chromosome band 53CD. The nucleotide sequence of the rpA1 gene and its cDNA have been determined. rpA1 is a single copy gene and sequence comparison between the gene and its cDNA indicates that this r-protein gene is intronless. Allelic restriction site polymorphisms outside of the gene were observed, while the coding sequence is well conserved between two Drosophila strains. The protein has unusual domains rich in Ala and charged residues. The rpA1 is homologous to the "A" family of eucaryotic acidic r-proteins which are known to play a key role in the initiation and elongation steps of protein synthesis. Images PMID:3103101

  12. Contribution of the A. baumannii A1S_0114 Gene to the Interaction with Eukaryotic Cells and Virulence.

    PubMed

    Rumbo-Feal, Soraya; Pérez, Astrid; Ramelot, Theresa A; Álvarez-Fraga, Laura; Vallejo, Juan A; Beceiro, Alejandro; Ohneck, Emily J; Arivett, Brock A; Merino, María; Fiester, Steven E; Kennedy, Michael A; Actis, Luis A; Bou, Germán; Poza, Margarita

    2017-01-01

    Genetic and functional studies showed that some components of the Acinetobacter baumannii ATCC 17978 A1S_0112-A1S_0119 gene cluster are critical for biofilm biogenesis and surface motility. Recently, our group has shown that the A1S_0114 gene was involved in biofilm formation, a process related with pathogenesis. Confirming our previous results, microscopy images revealed that the ATCC 17978 Δ0114 derivative lacking this gene was unable to form a mature biofilm structure. Therefore, other bacterial phenotypes were analyzed to determine the role of this gene in the pathogenicity of A. baumannii ATCC 17978. The interaction of the ATCC 17978 parental strain and the Δ0114 mutant with A549 human alveolar epithelial cells was quantified revealing that the A1S_0114 gene was necessary for proper attachment to A549 cells. This dependency correlates with the negative effect of the A1S_0114 deletion on the expression of genes coding for surface proteins and pili-assembly systems, which are known to play a role in adhesion. Three different experimental animal models, including vertebrate and invertebrate hosts, confirmed the role of the A1S_0114 gene in virulence. All of the experimental infection assays indicated that the virulence of the ATCC 17978 was significantly reduced when this gene was inactivated. Finally, we discovered that the A1S_0114 gene was involved in the production of a small lipopeptide-like compound herein referred to as acinetin 505 (Ac-505). Ac-505 was isolated from ATCC 17978 spent media and its chemical structure was interpreted by mass spectrometry. Overall, our observations provide novel information on the role of the A1S_0114 gene in A. baumannii's pathobiology and lay the foundation for future work to determine the mechanisms by which Ac-505, or possibly an Ac-505 precursor, could execute critical functions as a secondary metabolite.

  13. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  14. A nuclear gene, erd1, encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not only induced by water stress but also developmentally up-regulated during senescence in Arabidopsis thaliana.

    PubMed

    Nakashima, K; Kiyosue, T; Yamaguchi-Shinozaki, K; Shinozaki, K

    1997-10-01

    A cDNA, ERD1, isolated from one-hour-dehydrated plants of Arabidopsis thaliana L. encodes a putative protein that is similar to the regulatory ATPase subunit (ClpA) of the Clp protease and contains a putative chloroplast-targeting transit-peptide at the N-terminus. A chimeric gene with the putative plastid-targeting sequence of the erd1 gene fused to the synthetic green-fluorescent protein (sGFP) gene was constructed and introduced into Arabidopsis protoplasts. The N-terminal region of the ERD1 protein directed the sGFP protein into the plastids of the protoplasts, and functioned as a transit peptide. Northern blot analysis indicated that expression of the erd1 gene was induced not only by water stress, such as dehydration and high salinity, but also by natural senescence and dark-induced etiolation. The erd1 gene was not strongly induced by exogenous abscisic acid. A chimeric gene with the 0.9 kb promoter region of the erd1 gene fused to the beta-glucuronidase (GUS) reporter gene was constructed, and tobacco plants transformed with the construct. The GUS reporter gene driven by the erd1 promoter was induced by dehydration and high salt stress at significant levels in the transgenic plants. The GUS gene was strongly expressed in older leaves without dehydration, and was induced by dark-induced etiolation. Furthermore, GUS activity was reduced by cytokinin treatment during dark-induced etiolation. These results indicate that expression of the erd1 gene is developmentally up-regulated by senescence as well as by water stress.

  15. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  16. Protease inhibitor studies enrolling.

    PubMed

    1995-01-01

    The protease enzyme is essential for HIV to make copies of itself. So far, research has failed to find a protease inhibitor that works against HIV. It is believed that, regardless of what type of protease inhibitor someone takes, it will need to be supplemented with other anti-HIV drugs. Three protease inhibitors have thus far been found to be safe, although long-term effects are unknown. These drugs are saquinavir, ABT-538, and L-735,524 produced by Hoffman-LaRoche, Abbott, and Merck respectively. Clinical trials of saquinavir are promising but it has not been shown to be the knock-out drug needed. ABT-538 has high bioavailability, but studies are showing it can cause liver and eye damage. L-735,524 studies are showing that resistance develops quite quickly. Future studies at higher doses are expected. To obtain information on protease studies currently looking for participants, contact The Network. Information on other approved, alternative, and experimental drugs is also available.

  17. A nonsense mutation in the COL7A1 gene causes epidermolysis bullosa in Vorderwald cattle.

    PubMed

    Pausch, Hubert; Ammermüller, Simon; Wurmser, Christine; Hamann, Henning; Tetens, Jens; Drögemüller, Cord; Fries, Ruedi

    2016-12-01

    The widespread use of individual sires for artificial insemination promotes the propagation of recessive conditions. Inadvertent matings between unnoticed carriers of deleterious alleles may result in the manifestation of fatal phenotypes in their progeny. Breeding consultants and farmers reported on Vorderwald calves with a congenital skin disease. The clinical findings in affected calves were compatible with epidermolysis bullosa. Pedigree analysis indicated autosomal recessive inheritance of epidermolysis bullosa in Vorderwald cattle. We genotyped two diseased and 41 healthy animals at 41,436 single nucleotide polymorphisms and performed whole-genome haplotype-based association testing, which allowed us to map the locus responsible for the skin disease to the distal end of bovine chromosome 22 (P = 8.0 × 10(-14)). The analysis of whole-genome re-sequencing data of one diseased calf, three obligate mutation carriers and 1682 healthy animals from various bovine breeds revealed a nonsense mutation (rs876174537, p.Arg1588X) in the COL7A1 gene that segregates with the disease. The same mutation was previously detected in three calves with dystrophic epidermolysis bullosa from the Rotes Höhenvieh cattle breed. We show that diseased animals from Vorderwald and Rotes Höhenvieh cattle are identical by descent for an 8.72 Mb haplotype encompassing rs876174537 indicating they inherited the deleterious allele from a recent common ancestor. Autosomal recessive epidermolysis bullosa in Vorderwald and Rotes Höhenvieh cattle is caused by a nonsense mutation in the COL7A1 gene. Our findings demonstrate that deleterious alleles may segregate across cattle populations without apparent admixture. The identification of the causal mutation now enables the reliable detection of carrier animals. Genome-based mating strategies can avoid inadvertent matings of carrier animals thereby preventing the birth of homozygous calves that suffer from a painful skin disease.

  18. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  19. Traumatic subarachnoid hemorrhage and the COL3A1 gene: emergence of a potential causal link.

    PubMed

    Pickup, Michael J; Pollanen, Michael S

    2011-06-01

    We describe two previously unreported associations in four cases. The first two cases demonstrate an association between segmental mediolytic arteriopathy and vascular Ehlers-Danlos syndrome. The second two cases illustrate an association between vascular Ehlers-Danlos syndrome and traumatic subarachnoid hemorrhage. In case 1, there was acute subarachnoid hemorrhage and mesenteric artery dissection. In case 2, there was an acute mesenteric artery dissection with intestinal infarction. In both cases 1 and 2, segmental mediolytic arteriopathy was found in the vertebral arteries. Cases 3 and 4 were sudden deaths from traumatic subarachnoid hemorrhage with intracranial vertebral artery rupture. Genetic testing in all four cases revealed point mutations in the type 3 procollagen gene (COL3A1), as observed in vascular Ehlers-Danlos syndrome. Based on the first two cases, we propose that segmental mediolytic arteriopathy may be a marker for this disease. We further suggest that vascular Ehlers-Danlos syndrome may be related to the pathogenesis of traumatic vertebral artery injury, in some cases. We recommend that cases of segmental mediolytic arteriopathy and traumatic subarachnoid hemorrhage undergo genetic testing for COL3A1 mutations.

  20. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  1. Expression and functions of proteases in vascular tissues.

    PubMed

    Petzold, H Earl; Zhao, Mingzhe; Beers, Eric P

    2012-05-01

    With the emergence of new models for wood formation and the increasing emphasis on improving the efficiency of cellulosic biofuel production, research on vascular tissue biology has intensified in recent years. Some of the most active areas of research focus on manipulating activity of enzymes in the cellulose, hemicellulose, pectin and lignin pathways. In addition, great strides have been made in the characterization of transcriptional networks controlling genes that affect differentiation, secondary cell wall synthesis and programmed cell death in xylem. Less attention has been devoted to the characterization of proteases that may be important regulators of post-translational events that affect vascular cell differentiation and function and cell wall composition. Several genes for proteases and components of the ubiquitin/26S proteasome pathway are upregulated in xylem and phloem and in cell culture systems for studying the differentiation of xylem tracheary elements (TEs). Although small molecule protease inhibitors have been used to explore the roles of proteases during the differentiation of cultured TEs, only a small number of vascular tissue-associated protease genes have been directly tested to determine whether they play roles in vascular tissue biology. In this report, we review roles for proteases in vascular cell differentiation and function as determined through the use of protease inhibitors and genetic analyses and conclude by identifying opportunities for future research in this area. Copyright © Physiologia Plantarum 2011.

  2. Structural organization of the human type VII collagen gene (COL7A1), composed of more exons than any previously characterized gene

    SciTech Connect

    Christiano, A.M.; Chung-Honet, L.C.; Greenspan, D.S.; Hoffman, G.G.; Lee, S.; Cheng, W. ); Uitto, J. )

    1994-05-01

    The human type VII collagen (COL7A1) gene is the locus for mutations in at least some cases of dystrophic epidermolysis bullosa. Here the authors describe the entire intron/exon organization of COL7A1, which is shown to have 118 exons, more than any previously described gene. Despite this complexity, COL7A1 is compact. Consisting of 31,132 bp from transcription start site to polyadenylation site, it is only about three times the size of type VII collagen mRNA. Thus, COL7A1 introns are small. A 71-nucleotide COL7A1 intron is the smallest intron yet reported in a collagen gene, and only one COL7A1 intron is greater than 1 kb in length. All exons in the COL7A1 triple helix coding region that do not begin with sequences corresponding to imperfections of the triple helix begin with intact codons for Gly residues of Gly-X-Y repeats. This is reminiscent of the structure of fibrillar rather than other nonfibrillar collagen genes. In addition, the COL7A1 triple helix coding region contains many exons of recurring sizes (e.g., 25 exons are 36 bp, 12 exons are 45 bp, 8 exons are 63 bp), suggesting an evolutionary origin distinct from those of other nonfibrillar collagen genes. Sequences from the 5[prime] portion of COL7A1 are presented along with the 3766-bp intergenic sequence, which separated COL7A1 from the upstream gene encoding the core I protein of the cytochrome bc[sub 1] complex. The COL7A1 promoter region is found to lack extensive homologies with promoter regions of other genes expressed primarily in skin. 60 refs., 5 figs., 1 tab.

  3. Transcription factor ATF-3 regulates allele variation phenotypes of the human SLC11A1 gene.

    PubMed

    Taka, Styliani; Gazouli, Maria; Politis, Panagotis K; Pappa, Kalliopi I; Anagnou, Nicholas P

    2013-03-01

    Genetic polymorphisms in the human solute carrier family 11 member 1 (SLC11A1) gene predispose to susceptibility to infectious/inflammatory diseases and cancer. Human susceptibility to these diseases exhibits allelic association with a polymorphic regulatory Z-DNA-forming microsatellite of a (GT/AC)n repeat. The carriage of different alleles may influence chromatin remodeling and accessibility by transcription factors. Of particular importance is the binding site for the Activating Protein 1 (AP-1) elements, (ATF-3 and c-Jun), adjacent to the 5' sequence of the Z-DNA-forming polymorphism. The aim of the study was to characterize the transcriptional mechanisms controlling different alleles of SLC11A1 expression by ATF-3 and c-Jun. Allele 2, [T(GT)5AC(GT)5AC(GT)10GGCAGA(G)6], and Allele 3, [T(GT)5AC(GT)5AC(GT)9GGCAGA(G)6], were subcloned into the PGL2Basic vector. Transient transfections of THP-1 cells with the constructs, in the presence or absence of pATF-3 were preformed. Luciferase expression was determined. To document the recruitment of ATF-3 and c-Jun, to the polymorphic promoter alleles in vivo, we performed ChIP assays with transient transfected THP-1 cells treated with or without lipopolyssacharides. Our data documented that ATF-3 suppresses the transcriptional activation of Allele-3, and this suppression is enhanced in the presence of lipopolyssacharides. Our findings suggest that ATF-3 and c-Jun may influence heritable variation in SLC11A1-dependent innate resistance to infection and inflammation both within and between populations.

  4. Interaction of the CYP1A1 gene polymorphism and smoking in non-small cell lung cancer susceptibility.

    PubMed

    Xie, Y Q; Chen, J M; Liu, Y

    2016-01-04

    Many studies have shown that genetic factors, environmental factors, and bad living habits, especially smoking, are risk factors for lung cancer. However, not all smokers develop lung cancer, which may be related to different genetic backgrounds. Currently, most research has investigated the GSTM1, XRCC1, XRCC3, CYP2D6, and C188T genes. Little research has been done on the cytochrome P450 (CYP) 1A1 gene, and results have varied. In addition, no results have been reported on the interactive effects of smoking and the CYP1A1 gene on lung cancer development. We used polymerase chain reaction restriction fragment length polymorphism to detect the CYP1A1 genotype, and investigate the effects of the CYP1A1 gene deletion and smoking alone, and in combination, on non-small cell lung cancer susceptibility. We enrolled 150 non-small cell lung cancer patients and 150 healthy control subjects. Subjects' smoking habits and CYP1A1 gene polymorphism were analyzed to investigate their role in the occurrence of lung cancer. The CYP1A1 gene deletion was found in 73.3% of non-small cell lung cancer patients and 20.0% of healthy subjects. The OR value was 2.28 (P < 0.05). Among smoking subjects, 77.8% exhibited non-small cell lung cancer, significantly higher than the 27.3% in non-smokers (P < 0.05). The OR value for the interaction of smoking and CYP1A1 gene deletion was 5.60, larger than the product of their individual OR values. The CYP1A1 gene deletion is a lung cancer risk factor, and interacts with smoking in non-small cell lung cancer development.

  5. The C2H2-type transcription factor, FlbC, is involved in the transcriptional regulation of Aspergillus oryzae glucoamylase and protease genes specifically expressed in solid-state culture.

    PubMed

    Tanaka, Mizuki; Yoshimura, Midori; Ogawa, Masahiro; Koyama, Yasuji; Shintani, Takahiro; Gomi, Katsuya

    2016-07-01

    Aspergillus oryzae produces a large amount of secreted proteins in solid-state culture, and some proteins such as glucoamylase (GlaB) and acid protease (PepA) are specifically produced in solid-state culture, but rarely in submerged culture. From the disruption mutant library of A. oryzae transcriptional regulators, we successfully identified a disruption mutant showing an extremely low production level of GlaB but a normal level of α-amylase production. This strain was a disruption mutant of the C2H2-type transcription factor, FlbC, which is reported to be involved in the regulation of conidiospore development. Disruption mutants of other upstream regulators comprising a conidiation regulatory network had no apparent effect on GlaB production in solid-state culture. In addition to GlaB, the production of acid protease in solid-state culture was also markedly decreased by flbC disruption. Northern blot analyses revealed that transcripts of glaB and pepA were significantly decreased in the flbC disruption strain. These results suggested that FlbC is involved in the transcriptional regulation of genes specifically expressed under solid-state cultivation conditions, possibly independent of the conidiation regulatory network.

  6. Bilirubin UDP-Glucuronosyltransferase 1A1 (UGT1A1) Gene Promoter Polymorphisms and HPRT, Glycophorin A, and Micronuclei Mutant Frequencies in Human Blood

    SciTech Connect

    Grant, D; Hall, I J; Eastmond, D; Jones, I M; Bell, D A

    2004-10-06

    A dinucleotide repeat polymorphism (5-, 6-, 7-, or 8-TA units) has been identified within the promoter region of UDP-glucuronosyltransferase 1A1 gene (UGT1A1). The 7-TA repeat allele has been associated with elevated serum bilirubin levels that cause a mild hyperbilirubinemia (Gilbert's syndrome). Studies suggest that promoter transcriptional activity of UGT1A1 is inversely related to the number of TA repeats and that unconjugated bilirubin concentration increases directly with the number of TA repeat elements. Because bilirubin is a known antioxidant, we hypothesized that UGT1A1 repeats associated with higher bilirubin may be protective against oxidative damage. We examined the effect of UGT1A1 genotype on somatic mutant frequency in the hypoxanthine-guanine phosphoribosyl-transferase (HPRT) gene in human lymphocytes and the glycophorin A (GPA) gene of red blood cells (both N0, NN mutants), and the frequency of lymphocyte micronuclei (both kinetochore (K) positive or micronuclei K negative) in 101 healthy smoking and nonsmoking individuals. As hypothesized, genotypes containing 7-TA and 8-TA displayed marginally lower GPA{_}NN mutant frequency relative to 5/5, 5/6, 6/6 genotypes (p<0.05). In contrast, our analysis showed that lower expressing UGT1A1 alleles (7-TA and 8-TA) were associated with modestly increased HPRT mutation frequency (p<0.05) while the same low expression genotypes were not significantly associated with micronuclei frequencies (K-positive or K-negative) when compared to high expression genotypes (5-TA and 6-TA). We found weak evidence that UGT1A1 genotypes containing 7-TA and 8-TA were associated with increased GPA{_}N0 mutant frequency relative to 5/5, 5/6, 6/6 genotypes (p<0.05). These data suggest that UGT1A1 genotype may modulate somatic mutation of some types, in some cell lineages, by a mechanism not involving bilirubin antioxidant activity. More detailed studies examining UGT1A1 promoter variation, oxidant/antioxidant balance and genetic

  7. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  8. Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders.

    PubMed

    Correia, Catarina T; Conceição, Inês C; Oliveira, Bárbara; Coelho, Joana; Sousa, Inês; Sequeira, Ana F; Almeida, Joana; Café, Cátia; Duque, Frederico; Mouga, Susana; Roberts, Wendy; Gao, Kun; Lowe, Jennifer K; Thiruvahindrapuram, Bhooma; Walker, Susan; Marshall, Christian R; Pinto, Dalila; Nurnberger, John I; Scherer, Stephen W; Geschwind, Daniel H; Oliveira, Guiomar; Vicente, Astrid M

    2014-04-10

    Validating the potential pathogenicity of copy number variants (CNVs) identified in genome-wide studies of autism spectrum disorders (ASD) requires detailed assessment of case/control frequencies, inheritance patterns, clinical correlations, and functional impact. Here, we characterize a small recurrent duplication in the annexin A1 (ANXA1) gene, identified by the Autism Genome Project (AGP) study. From the AGP CNV genomic screen in 2,147 ASD individuals, we selected for characterization an ANXA1 gene duplication that was absent in 4,964 population-based controls. We further screened the duplication in a follow-up sample including 1,496 patients and 410 controls, and evaluated clinical correlations and family segregation. Sequencing of exonic/downstream ANXA1 regions was performed in 490 ASD patients for identification of additional variants. The ANXA1 duplication, overlapping the last four exons and 3'UTR region, had an overall prevalence of 11/3,643 (0.30%) in unrelated ASD patients but was not identified in 5,374 controls. Duplication carriers presented no distinctive clinical phenotype. Family analysis showed neuropsychiatric deficits and ASD traits in multiple relatives carrying the duplication, suggestive of a complex genetic inheritance. Sequencing of exonic regions and the 3'UTR identified 11 novel changes, but no obvious variants with clinical significance. We provide multilevel evidence for a role of ANXA1 in ASD etiology. Given its important role as mediator of glucocorticoid function in a wide variety of brain processes, including neuroprotection, apoptosis, and control of the neuroendocrine system, the results add ANXA1 to the growing list of rare candidate genetic etiological factors for ASD.

  9. Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders

    PubMed Central

    2014-01-01

    Background Validating the potential pathogenicity of copy number variants (CNVs) identified in genome-wide studies of autism spectrum disorders (ASD) requires detailed assessment of case/control frequencies, inheritance patterns, clinical correlations, and functional impact. Here, we characterize a small recurrent duplication in the annexin A1 (ANXA1) gene, identified by the Autism Genome Project (AGP) study. Methods From the AGP CNV genomic screen in 2,147 ASD individuals, we selected for characterization an ANXA1 gene duplication that was absent in 4,964 population-based controls. We further screened the duplication in a follow-up sample including 1,496 patients and 410 controls, and evaluated clinical correlations and family segregation. Sequencing of exonic/downstream ANXA1 regions was performed in 490 ASD patients for identification of additional variants. Results The ANXA1 duplication, overlapping the last four exons and 3’UTR region, had an overall prevalence of 11/3,643 (0.30%) in unrelated ASD patients but was not identified in 5,374 controls. Duplication carriers presented no distinctive clinical phenotype. Family analysis showed neuropsychiatric deficits and ASD traits in multiple relatives carrying the duplication, suggestive of a complex genetic inheritance. Sequencing of exonic regions and the 3’UTR identified 11 novel changes, but no obvious variants with clinical significance. Conclusions We provide multilevel evidence for a role of ANXA1 in ASD etiology. Given its important role as mediator of glucocorticoid function in a wide variety of brain processes, including neuroprotection, apoptosis, and control of the neuroendocrine system, the results add ANXA1 to the growing list of rare candidate genetic etiological factors for ASD. PMID:24720851

  10. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  11. Human uterus myoma and gene expression profiling: A novel in vitro model for studying secretory leukocyte protease inhibitor-mediated tumor invasion.

    PubMed

    Mikami, Yoshikazu; Fukushima, Atsushi; Komiyama, Yusuke; Iwase, Takashi; Tsuda, Hiromasa; Higuchi, Yasuhiko; Hayakawa, Satoshi; Kuyama, Kayo; Komiyama, Kazuo

    2016-08-28

    Secretory leukocyte protease inhibitor (SLPI) is a serine protease inhibitor that diminishes tissue destruction during inflammation. A recent report revealed high levels of SLPI expression in the oral carcinoma cell. In addition, overexpression of SLPI up-regulates metastasis in lung carcinoma cells. On the other hand, matrix metalloproteinases (MMPs) are proteinases that participate in extracellular matrix degradation. SLPI and MMPs are involved as accelerators of the tumor invasion process; however, their exact roles are not fully understood. Understanding the mechanism of tumor invasion requires models that take the effect of microenvironmental factors into account. In one such in vitro model, different carcinoma cells have been shown to invade myoma tissue in highly distinct patterns. We have used this myoma model, as it provides a more natural stroma-like environment, to investigate the role of SLPI in tumor invasion. Our results indicate that the model provides a relevant matrix for tumor invasion studies, and that SLPI is important for the invasion of oral carcinoma Ca9-22 cells in conjunction with MMPs. Furthermore, using bioinformatics analysis, we have identified candidates as key molecules involved in SLPI-mediated tumor invasion. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  13. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  14. Chimeric CYP21A1P/CYP21A2 genes identified in Czech patients with congenital adrenal hyperplasia.

    PubMed

    Vrzalová, Zuzana; Hrubá, Zuzana; Hrabincová, Eva Sťahlová; Vrábelová, Slávka; Votava, Felix; Koloušková, Stanislava; Fajkusová, Lenka

    2011-01-01

    Congenital adrenal hyperplasia (CAH) comprises a group of autosomal recessive disorders caused by an enzymatic deficiency which impairs the biosynthesis of cortisol and, in the majority of severe cases, also the biosynthesis of aldosterone. Approximately 95% of all CAH cases are caused by mutations in the steroid 21-hydroxylase gene (CYP21A2). The CYP21A2 gene and its inactive pseudogene (CYP21A1P) are located within the HLA class III region of the major histocompatibility complex (MHC) locus on chromosome 6p21.3. In this study, we describe chimeric CYP21A1P/CYP21A2 genes detected in our patients with 21-hydroxylase deficiency (21OHD). Chimeric CYP21A1P/CYP21A2 genes were present in 171 out of 508 mutated CYP21A2 alleles (33.8%). We detected four types of chimeric CYP21A1P/CYP21A2 genes: three of them have been described previously as CH-1, CH-3, CH-4, and one type is novel. The novel chimeric gene, termed CH-7, was detected in 21.4% of the mutant alleles. Possible causes of CYP21A1P/CYP21A2 formation are associated with 1) high recombination rate in the MHC locus, 2) high recombination rate between highly homologous genes and pseudogenes in the CYP21 gene area, and 3) the existence of chi-like sequences and repetitive minisatellite consensus sequences in CYP21A2 and CYP21A1P which play a role in promoting genetic recombination.

  15. Unique mutation portraits and frequent COL2A1 gene alteration in chondrosarcoma

    PubMed Central

    Totoki, Yasushi; Yoshida, Akihiko; Hosoda, Fumie; Nakamura, Hiromi; Hama, Natsuko; Ogura, Koichi; Yoshida, Aki; Fujiwara, Tomohiro; Arai, Yasuhito; Toguchida, Junya; Tsuda, Hitoshi; Miyano, Satoru; Kawai, Akira

    2014-01-01

    Chondrosarcoma is the second most frequent malignant bone tumor. However, the etiological background of chondrosarcomagenesis remains largely unknown, along with details on molecular alterations and potential therapeutic targets. Massively parallel paired-end sequencing of whole genomes of 10 primary chondrosarcomas revealed that the process of accumulation of somatic mutations is homogeneous irrespective of the pathological subtype or the presence of IDH1 mutations, is unique among a range of cancer types, and shares significant commonalities with that of prostate cancer. Clusters of structural alterations localized within a single chromosome were observed in four cases. Combined with targeted resequencing of additional cartilaginous tumor cohorts, we identified somatic alterations of the COL2A1 gene, which encodes an essential extracellular matrix protein in chondroskeletal development, in 19.3% of chondrosarcoma and 31.7% of enchondroma cases. Epigenetic regulators (IDH1 and YEATS2) and an activin/BMP signal component (ACVR2A) were recurrently altered. Furthermore, a novel FN1-ACVR2A fusion transcript was observed in both chondrosarcoma and osteochondromatosis cases. With the characteristic accumulative process of somatic changes as a background, molecular defects in chondrogenesis and aberrant epigenetic control are primarily causative of both benign and malignant cartilaginous tumors. PMID:25024164

  16. Cell-mass structures expressing the aromatase gene Cyp19a1 lead to ovarian cavities in Xenopus laevis.

    PubMed

    Mawaribuchi, Shuuji; Ikeda, Nozomi; Fujitani, Kazuko; Ito, Yuzuru; Onuma, Yasuko; Komiya, Tohru; Takamatsu, Nobuhiko; Ito, Michihiko

    2014-10-01

    The African clawed frog, Xenopus laevis, has a ZZ/ZW-type sex-determination system. We previously reported that a W-linked gene, Dm-W, can determine development as a female. However, the mechanisms of early sex differentiation remain unclear. We used microarrays to screen for genes with sexually dimorphic expression in ZZ and ZW gonads during early sex differentiation in X laevis and found several steroidogenic genes. Importantly, the steroid 17α-hydroxylase gene Cyp17a1 and the aromatase gene Cyp19a1 were highly expressed in ZZ and ZW gonads, respectively, just after sex determination. At this stage, we found that Cyp17a1, Cyp19a1, or both were expressed in the ZZ and ZW gonads in a unique mass-in-line structure, in which several masses of cells, each surrounded by a basement membrane, were aligned along the anteroposterior axis. In fact, during sex differentiation, ovarian cavities formed inside each mass of Cyp17a1- and Cyp19a1-positive cells in the ZW gonads. However, the mass-in-line structure disappeared during testicular development in the ZZ testes. These results suggested that the mass-in-line structure found in both ZZ and ZW gonads just after sex determination might be formed in advance to produce ovarian cavities and then oocytes. Consequently, we propose a view that the default sex may be female in the morphological aspect of gonads in X laevis.

  17. A Missense Mutation in the Mouse Col2a1 Gene Causes Spondyloepiphyseal Dysplasia Congenita, Hearing Loss, and Retinoschisis

    PubMed Central

    DONAHUE, LEAH RAE; CHANG, BO; MOHAN, SUBBURAMAN; MIYAKOSHI, NAO; WERGEDAL, JON E; BAYLINK, DAVID J; HAWES, NORMAN L; ROSEN, CLIFFORD J; WARD-BAILEY, PATRICIA; ZHENG, QING Y; BRONSON, RODERICK T; JOHNSON, KENNETH R; DAVISSON, MURIEL T

    2010-01-01

    A missense mutation in the mouse Col2a1 gene has been discovered, resulting in a mouse phenotype with similarities to human spondyloepiphyseal dysplasia (SED) congenita. In addition, SED patients have been identified with a similar molecular mutation in human COL2A1. This mouse model offers a useful tool for molecular and biological studies of bone development and pathology. Introduction A new mouse autosomal recessive mutation has been discovered and named spondyloepiphyseal dysplasia congenita (gene symbol sedc). Materials and Methods Homozygous sedc mice can be identified at birth by their small size and shortened trunk. Adults have shortened noses, dysplastic vertebrae, femora, and tibias, plus retinoschisis and hearing loss. The mutation was mapped to Chr15, and Col2a1 was identified as a candidate gene. Results Sequence analyses revealed that the affected gene is Col2a1, which has a missense mutation at exon 48 causing an amino acid change of arginine to cysteine at position 1417. Two human patients with spondyloepiphyseal dysplasia (SED) congenita have been reported with the same amino acid substitution at position 789 in the human COL2A1 gene. Conclusions Thus, sedc/sedc mice provide a valuable model of human SED congenita with molecular and phenotypic homology. Further biochemical analyses, molecular modeling, and cell culture studies using sedc/sedc mice could provide insight into mechanisms of skeletal development dependent on Col2a1 and its role in fibril formation and cartilage template organization. PMID:12968670

  18. Novel gain of function mutation in the SLC40A1 gene associated with hereditary haemochromatosis type 4.

    PubMed

    Chen, S-R; Yang, L-Q; Chong, Y-T; Jie, Y-S; Wu, Y-K; Yang, J; Lin, G-L; Li, X-H

    2015-06-01

    Here we report the case of a 69-year-old Chinese Han woman who presented with liver cirrhosis, diabetes mellitus, skin hyperpigmentation, hyperferritinaemia and high transferrin saturation. Subsequent genetic analyses identified a novel heterozygous mutation (p.Cys326Phe) in the SLC40A1 gene. This is the first report regarding a SLC40A1 mutation in the Chinese Han population and provides novel clinical evidence for the importance of p.Cys326 in SLC40A1 gene function.

  19. Effects of variant UDP-glucuronosyltransferase 1A1 gene, glucose-6-phosphate dehydrogenase deficiency and thalassemia on cholelithiasis

    PubMed Central

    Huang, Yang-Yang; Huang, Ching-Shui; Yang, Sien-Sing; Lin, Min-Shung; Huang, May-Jen; Huang, Ching-Shan

    2005-01-01

    AIM: To test the hypothesis that the variant UDP-glucuronosyltransferase 1A1 (UGT1A1) gene, glucose-6-phosphate dehydrogenase (G6PD) deficiency, and thalassemia influence bilirubin metabolism and play a role in the development of cholelithiasis. METHODS: A total of 372 Taiwan Chinese with cholelithiasis who had undergone cholecystectomy and 293 healthy individuals were divided into case and control groups, respectively. PCR and restriction fragment length polymorphism were used to analyze the promoter area and nucleotides 211, 686, 1 091, and 1 456 of the UGT1A1 gene for all subjects and the gene variants for thalassemia and G6PD deficiency. RESULTS: Variation frequencies for the cholelithiasis patients were 16.1%, 25.8%, 5.4%, and 4.3% for A(TA)6 TAA/A(TA)7TAA (6/7), heterozygosity within the coding region, compound heterozygosity, and homozygosity of the UGT1A1 gene, respectively. Comparing the case and control groups, a statistically significant difference in frequency was demonstrated for the homozygous variation of the UGT1A1 gene (P = 0.012, χ2 test), but not for the other variations. Further, no difference was demonstrated in a between-group comparison of the incidence of G6PD deficiency and thalassemia (2.7% vs 2.4% and 5.1% vs 5.1%, respectively). The bilirubin levels for the cholelithiasis patients with the homozygous variant-UGT1A1 gene were significantly different from the control analog (18.0 ± 6.5 and 12.7 ± 2.9 μmol/L, respectively; P<0.001, Student’s t test). CONCLUSION: Our results show that the homozygous variation in the UGT1A1 gene is a risk factor for the development of cholelithiasis in Taiwan Chinese. PMID:16237771

  20. Rapid qualitative protease microassay (RPM).

    PubMed

    Mohan, S; Ma, P W K; Luthe, D S

    2005-09-30

    A rapid qualitative protease microassay (RPM) was developed as an alternative to conventional assays of cysteine protease activity in HPLC fractions. Using this technique protease activity in samples could be visually determined within 5 min. The method was sensitive to 3.3x10(-7) U/mL of papain and detected cysteine protease activity in dilute HPLC fractions with activity of 5.4x10(-5) U/mL. Because the method monitors the decolorization of Coomassie Brilliant Blue stained substrate, it can be modified to detect other classes of proteases.

  1. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  2. Genome-wide identification and structure-function studies of proteases and protease inhibitors in Cicer arietinum (chickpea).

    PubMed

    Sharma, Ranu; Suresh, C G

    2015-01-01

    Proteases are a family of enzymes present in almost all living organisms. In plants they are involved in many biological processes requiring stress response in situations such as water deficiency, pathogen attack, maintaining protein content of the cell, programmed cell death, senescence, reproduction and many more. Similarly, protease inhibitors (PIs) are involved in various important functions like suppression of invasion by pathogenic nematodes, inhibition of spores-germination and mycelium growth of Alternaria alternata and response to wounding and fungal attack. As much as we know, no genome-wide study of proteases together with proteinaceous PIs is reported in any of the sequenced genomes till now. Phylogenetic studies and domain analysis of proteases were carried out to understand the molecular evolution as well as gene and protein features. Structural analysis was carried out to explore the binding mode and affinity of PIs for cognate proteases and prolyl oligopeptidase protease with inhibitor ligand. In the study reported here, a significant number of proteases and PIs were identified in chickpea genome. The gene expression profiles of proteases and PIs in five different plant tissues revealed a differential expression pattern in more than one plant tissue. Molecular dynamics studies revealed the formation of stable complex owing to increased number of protein-ligand and inter and intramolecular protein-protein hydrogen bonds. The genome-wide identification, characterization, evolutionary understanding, gene expression, and structural analysis of proteases and PIs provide a framework for future analysis when defining their roles in stress response and developing a more stress tolerant variety of chickpea. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. A Bacillus anthracis strain deleted for six proteases serves as an effective host for production of recombinant proteins.

    PubMed

    Pomerantsev, Andrei P; Pomerantseva, Olga M; Moayeri, Mahtab; Fattah, Rasem; Tallant, Cynthia; Leppla, Stephen H

    2011-11-01

    Bacillus anthracis produces a number of extracellular proteases that impact the integrity and yield of other proteins in the B. anthracis secretome. In this study we show that anthrolysin O (ALO) and the three anthrax toxin proteins, protective antigen (PA), lethal factor (LF), and edema factor (EF), produced from the B. anthracis Ames 35 strain (pXO1⁺, pXO2⁻), are completely degraded at the onset of stationary phase due to the action of proteases. An improved Cre-loxP gene knockout system was used to sequentially delete the genes encoding six proteases (InhA1, InhA2, camelysin, TasA, NprB, and MmpZ). The role of each protease in degradation of the B. anthracis toxin components and ALO was demonstrated. Levels of the anthrax toxin components and ALO in the supernatant of the sporulation defective, pXO1⁺ A35HMS mutant strain deleted for the six proteases were significantly increased and remained stable over 24 h. A pXO1-free variant of this six-protease mutant strain, designated BH460, provides an improved host strain for the preparation of recombinant proteins. As an example, BH460 was used to produce recombinant EF, which previously has been difficult to obtain from B. anthracis. The EF protein produced from BH460 had the highest in vivo potency of any EF previously purified from B. anthracis or Escherichia coli hosts. BH460 is recommended as an effective host strain for recombinant protein production, typically yielding greater than 10mg pure protein per liter of culture.

  4. Alternative splicing in the human gene for the core protein A1 generates another hnRNP protein.

    PubMed Central

    Buvoli, M; Cobianchi, F; Bestagno, M G; Mangiarotti, A; Bassi, M T; Biamonti, G; Riva, S

    1990-01-01

    The human hnRNP core protein A1 (34 kd) is encoded by a 4.6 kb gene split into 10 exons. Here we show that the A1 gene can be differentially spliced by the addition of an extra exon. The new transcript encodes a minor protein of the hnRNP complex, here defined A1B protein, with a calculated mol. wt of 38 kd, that coincides with a protein previously designated as B2 by some authors. In vitro translation of the mRNAs selected by hybridization with A1 cDNA produced two proteins of 34 and 38 kd; Northern blot analysis of poly(A)+ RNA from HeLa cells revealed that the abundance of the A1B mRNA was approximately 5% that of A1. The A1B protein was detected by Western blotting with an anti-A1 monoclonal antibody both in enriched preparations of basic hnRNP proteins and in 40S hnRNP particles. The A1B protein exhibits a significantly higher affinity than A1 for ssDNA. The recombinant A1B protein, expressed in Escherichia coli, shows the same electrophoretic mobility and charge as the cellular one. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:1691095

  5. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  6. Cloning and enhancing production of a detergent- and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800

    PubMed Central

    2013-01-01

    Background Nattokinases/Subtilisins (EC 3.4.21.62) belong to the second large family of serine proteases, which gain significant attention and play important role in many biotechnology processes. Thus, a number of nattokinases/subtilisins from various Bacillus species, especially from B. subtilis strains, extensively have been investigated to understand their biochemical and physical properties as well as to improve the production for industrial application. The purpose of this study was to clone a nattokinase gene from Bacillus subtilis strain VTCC-DVN-12-01, enhance its production in B. subtilis WB800, which is deficient in eight extracellular proteases and characterize its physicochemical properties for potential application in organic synthesis and detergent production. Results A gene coding for the nattokinase (Nk) from B. subtilis strain VTCC-DVN-12-01 consisted of an ORF of 1146 nucleotides, encoding a pre-pro-protein enzyme (30-aa pre-signal peptide, 76-aa pro-peptide and 275-aa mature protein with a predicted molecular mass of 27.7 kDa and pI 6.6). The nattokinase showed 98-99% identity with other nattokinases/subtilisins from B. subtilis strains in GenBank. Nk was expressed in B. subtilis WB800 under the control of acoA promoter at a high level of 600 mg protein per liter culture medium which is highest yield of proteins expressed in any extracellular-protease-deficient B. subtilis system till date. Nk was purified to homogeneity with 3.25 fold purification, a specific activity of 12.7 U/mg, and a recovery of 54.17%. The purified Nk was identified by MALDI-TOF mass spectrometry through three peptides, which showed 100% identity to corresponding peptides of the B. subtilis nattokinase (CAC41625). An optimal activity for Nk was observed at 65°C and pH 9. The nattokinase was stable at temperature up to 50°C and in pH range of 5–11 and retained more than 85% of its initial activity after incubation for 1 h. Mg2+ activated Nk up to 162% of its activity

  7. A novel SLC12A1 gene mutation associated with hyperparathyroidism, hypercalcemia, nephrogenic diabetes insipidus, and nephrocalcinosis in four patients.

    PubMed

    Wongsaengsak, Sariya; Vidmar, Alaina P; Addala, Ananta; Kamil, Elaine S; Sequeira, Paola; Fass, Benjamin; Pitukcheewanont, Pisit

    2017-04-01

    Solute Carrier Family 12 member 1 (SLC12A1) gene encodes the sodium-potassium-chloride co-transporter (NKCC2) at the apical membrane of the thick ascending loop of Henle (TAL). Bartter's syndrome (BS) type I is a rare, autosomal recessive, renal tubular disorder associated with mutation of the SLC12A1 gene. Presenting features include: hypokalemic metabolic alkalosis, hypercalciuria and nephrocalcinosis. The many allelic variants reported present with a spectrum of phenotypes, biochemical abnormalities and clinical severities. However, to date, only two reports have described hyperparathyroidism and hypercalcemia in patients with SLC12A1 gene mutations. We describe 4 patients with 4 novel mutation variants in the SLC12A1 gene (c.735C>G, c.1137del, c.2498-2499del, and c.1833delT) presenting with variable degrees of hyperparathyroidism, hypercalcemia, hypokalemic metabolic alkalosis, nephrocalcinosis, and nephrogenic diabetes insipidus. The link between calcium and parathyroid hormone abnormalities in patients with SLC12A1 mutations is unclear; the cases described suggest an association between primary hyperparathyroidism and loss of function mutation of SLC12A1, which may result in an aberrant threshold of the calcium sensing receptor at the level of the kidney.

  8. Interspecific and intraspecific gene variability in a 1-Mb region containing the highest density of NBS-LRR genes found in the melon genome.

    PubMed

    González, Víctor M; Aventín, Núria; Centeno, Emilio; Puigdomènech, Pere

    2014-12-17

    Plant NBS-LRR -resistance genes tend to be found in clusters, which have been shown to be hot spots of genome variability. In melon, half of the 81 predicted NBS-LRR genes group in nine clusters, and a 1 Mb region on linkage group V contains the highest density of R-genes and presence/absence gene polymorphisms found in the melon genome. This region is known to contain the locus of Vat, an agronomically important gene that confers resistance to aphids. However, the presence of duplications makes the sequencing and annotation of R-gene clusters difficult, usually resulting in multi-gapped sequences with higher than average errors. A 1-Mb sequence that contains the largest NBS-LRR gene cluster found in melon was improved using a strategy that combines Illumina paired-end mapping and PCR-based gap closing. Unknown sequence was decreased by 70% while about 3,000 SNPs and small indels were corrected. As a result, the annotations of 18 of a total of 23 NBS-LRR genes found in this region were modified, including additional coding sequences, amino acid changes, correction of splicing boundaries, or fussion of ORFs in common transcription units. A phylogeny analysis of the R-genes and their comparison with syntenic sequences in other cucurbits point to a pattern of local gene amplifications since the diversification of cucurbits from other families, and through speciation within the family. A candidate Vat gene is proposed based on the sequence similarity between a reported Vat gene from a Korean melon cultivar and a sequence fragment previously absent in the unrefined sequence. A sequence refinement strategy allowed substantial improvement of a 1 Mb fragment of the melon genome and the re-annotation of the largest cluster of NBS-LRR gene homologues found in melon. Analysis of the cluster revealed that resistance genes have been produced by sequence duplication in adjacent genome locations since the divergence of cucurbits from other close families, and through the

  9. Cardiac AAV9-S100A1 gene therapy rescues postischemic heart failure in a preclinical large animal model

    PubMed Central

    Pleger, Sven T.; Shan, Changguang; Ksienzyk, Jan; Bekeredjian, Raffi; Boekstegers, Peter; Hinkel, Rabea; Schinkel, Stefanie; Leuchs, Barbara; Ludwig, Jochen; Qiu, Gang; Weber, Christophe; Kleinschmidt, Jürgen A.; Raake, Philip; Koch, Walter J.; Katus, Hugo A.; Müller, Oliver J.; Most, Patrick

    2014-01-01

    As a prerequisite to clinical application, we determined the long-term therapeutic effectiveness and safety of adeno-associated viral (AAV) S100A1 gene therapy in a preclinical, large animal model of heart failure. S100A1, a positive inotropic regulator of myocardial contractility, becomes depleted in failing cardiomyocytes in humans and various animal models, and myocardial-targeted S100A1 gene transfer rescues cardiac contractile function by restoring sarcoplasmic reticulum calcium Ca2+ handling in acutely and chronically failing hearts in small animal models. We induced heart failure in domestic pigs by balloon-occlusion of the left circumflex coronary artery, resulting in myocardial infarction. After 2 weeks, when the pigs displayed significant left ventricular contractile dysfunction, we administered through retrograde coronary venous delivery, AAV9-S100A1 to the left ventricular non-infarcted myocardium. AAV9-luciferase and saline treatment served as control. At 14 weeks, both control groups showed significantly decreased myocardial S100A1 protein expression along with progressive deterioration of cardiac performance and left ventricular remodeling. AAV9-S100A1 treatment prevented and reversed this phenotype by restoring cardiac S100A1 protein levels. S100A1 treatment normalized cardiomyocyte Ca2+ cycling, sarcoplasmic reticulum calcium handling and energy homeostasis. Transgene expression was restricted to cardiac tissue and extra-cardiac organ function was uncompromised indicating a favorable safety profile. This translational study shows the pre-clinical feasibility, long-term therapeutic effectiveness and a favorable safety profile of cardiac AAV9-S100A1 gene therapy in a preclinical model of heart failure. Our study presents a strong rational for a clinical trial of S100A1 gene therapy for human heart failure that could potentially complement current strategies to treat end-stage heart failure. PMID:21775667

  10. Dysregulation of Protease and Protease Inhibitors in a Mouse Model of Human Pelvic Organ Prolapse

    PubMed Central

    Budatha, Madhusudhan; Silva, Simone; Montoya, Teodoro Ignacio; Suzuki, Ayako; Shah-Simpson, Sheena; Wieslander, Cecilia Karin; Yanagisawa, Masashi; Word, Ruth Ann; Yanagisawa, Hiromi

    2013-01-01

    Mice deficient for the fibulin-5 gene (Fbln5−/−) develop pelvic organ prolapse (POP) due to compromised elastic fibers and upregulation of matrix metalloprotease (MMP)-9. Here, we used casein zymography, inhibitor profiling, affinity pull-down, and mass spectrometry to discover additional protease upregulated in the vaginal wall of Fbln5−/− mice, herein named V1 (25 kDa). V1 was a serine protease with trypsin-like activity similar to protease, serine (PRSS) 3, a major extrapancreatic trypsinogen, was optimum at pH 8.0, and predominantly detected in estrogenized vaginal epithelium of Fbln5−/− mice. PRSS3 was (a) localized in epithelial secretions, (b) detected in media of vaginal organ culture from both Fbln5−/− and wild type mice, and (c) cleaved fibulin-5 in vitro. Expression of two serine protease inhibitors [Serpina1a (α1-antitrypsin) and Elafin] was dysregulated in Fbln5−/− epithelium. Finally, we confirmed that PRSS3 was expressed in human vaginal epithelium and that SERPINA1 and Elafin were downregulated in vaginal tissues from women with POP. These data collectively suggest that the balance between proteases and their inhibitors contributes to support of the pelvic organs in humans and mice. PMID:23437119

  11. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  12. First cases of pyridoxine-dependent epilepsy in Bulgaria: novel mutation in the ALDH7A1 gene.

    PubMed

    Tincheva, Savina; Todorov, Tihomir; Todorova, Albena; Georgieva, Ralica; Stamatov, Dimitar; Yordanova, Iglika; Kadiyska, Tanya; Georgieva, Bilyana; Bojidarova, Maria; Tacheva, Genoveva; Litvinenko, Ivan; Mitev, Vanyo

    2015-12-01

    Pyridoxine-dependent epilepsy (PDE) is a rare autosomal recessive disorder characterized by intractable seizures in neonates and infants. The seizures cannot be controlled with antiepileptic medications but respond both clinically and electrographically to large daily supplements of pyridoxine (vitamin B6). PDE is caused by mutations in the ALDH7A1 gene. Molecular genetic analysis of the ALDH7A1 gene was performed in seven patients, referred with clinical diagnosis of PDE. Mutations were detected in a dizygotic twin pair and a non-related boy with classical form of PDE. Direct sequencing of the ALDH7A1 gene revealed one novel (c.297delG, p.Trp99*) and two already reported (c.328C>T, p.Arg110*; c.584A>G, p.Asn195Ser) mutations. Here, we report the first genetically proven cases of PDE in Bulgaria.

  13. [Study on enhancing sensitivity of SPC-A1 cells to chemotherapy by Livin isoform-specific gene silencing].

    PubMed

    Sun, Jianguo; Liao, Rongxia; Chen, Zhengtang; Wang, Zhixin; Zhang, Qing; Hu, Yide

    2007-12-20

    As a new member of inhibitor of apoptosis protein(IAP) family,Livin,especially Livin α,is known to be involved in occurrence and development of lung cancer.Livin is an important mechanism of chemotherapy resistance of lung cancer cell.The aim of this study is to set up Livin isoform(α & β)-specific gene silencing system in SPC-A1 cells by gene transfection and RNA interference(RNAi),and to explore the different functions and value of the isoforms in enhancing chemosensitivity of SPC-A1 cells. Livinα+β,Livinα and Livinβ specific siRNA were expressed stably in SPC-A1 cells,respectively.MTT was performed to study sensitivity of the cells to chemotherapy drugs.In vivo experiment was performed to test sensitivity of mouse bearing tumor to cisplatin after gene silencing of Livin. After silencing of Livinα+β,Livinα and Livinβ genes,sensitivity of SPC-A1 cells to many chemotherapy drugs(including cisplatin,carboplatin,cyclophosphamide and adriblastine) was markedly increased(P < 0.05).Among them,gene silencing of Livinα+β showed the strongest enhancement effect on chemosensitivity of SPC-A1 cells(P < 0.01).Animal experiment showed that tumor inhibition rate of pSilencer-Livinα+β,pSilencer-Livinα and pSilencer-Livinβ groups was 146.1%,130.7% and 110.5%,respectively. The results suggest that Livin isoform,especially Livinα+β is hopeful to be a molecular target for increasing sensitivity of lung cancer cell to chemotherapy.Gene silencing may be a new means of gene therapy for non-small cell lung cancer.

  14. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  15. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  16. Structure of the human type XIX collagen (COL19A1) gene, which suggests it has arisen from an ancestor gene of the FACIT family.

    PubMed

    Khaleduzzaman, M; Sumiyoshi, H; Ueki, Y; Inoguchi, K; Ninomiya, Y; Yoshioka, H

    1997-10-15

    Type XIX collagen is a newly discovered member of the FACIT (fibril-associated collagens with interrupted triple helices) group of extracellular matrix proteins. Based on the primary structure, type XIX collagen is thought to act as a cross-bridge between fibrils and other extracellular matrix molecules. Here we describe the complete exon/intron organization of COL19A1 and show that it contains 51 exons, spanning more than 250 kb of genomic DNA. The comparison of exon structures of COL19A1 and other FACIT family genes revealed several similarities among these genes. The structure of exons encoding the noncollagenous (NC) 1-collagenous (COL) 1-NC 2-COL 2-NC 3-COL 3-NC 4 domain of the alpha1(XIX) chain is similar to that of the NC 1-COL 1-NC 2-COL 3-NC 3 domain of the alpha2(IX) chain except for the NC 3 domain of alpha1(XIX). The exons encoding the COL 5-NC 6 domain of alpha1(XIX) are also similar to those of the COL 3-NC 4 domain of alpha1(IX) chain. Previously, COL19A1 was mapped to human chromosome 6q12-q14, where COL9A1 is also located. Likewise, the present work shows that the mouse Col19a1 gene is located on mouse chromosome 1, region A3, where Col9a1 has also been mapped. Taken together, the data suggest that COL19A1 and COL9A1 (Col19a1 and Col9a1) were duplicated from the same ancestor gene of the FACIT family. Three CA repeat markers with high heterozygosity were found in COL19A1. These markers may be useful for linkage analysis of age-related inheritable diseases involved in eyes and/or brain.

  17. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  18. Multifunctional Mitochondrial AAA Proteases

    PubMed Central

    Glynn, Steven E.

    2017-01-01

    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle. PMID:28589125

  19. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  20. Multiple classes of immune-related proteases associated with the cell death response in pepper plants.

    PubMed

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense.

  1. Sequence conservation, phylogenetic relationships, and expression profiles of nondigestive serine proteases and serine protease homologs in Manduca sexta

    PubMed Central

    Cao, Xiaolong; He, Yan; Hu, Yingxia; Zhang, Xiufeng; Wang, Yang; Zou, Zhen; Chen, Yunru; Blissard, Gary W.; Kanost, Michael R.; Jiang, Haobo

    2015-01-01

    Serine protease (SP) and serine protease homolog (SPH) genes in insects encode a large family of proteins involved in digestion, development, immunity, and other processes. While 68 digestive SPs and their close homologs are reported in a companion paper (Kuwar et al., 2015), we have identified 125 other SPs/SPHs in Manduca sexta and studied their structure, evolution, and expression. Fifty-two of them contain cystine-stabilized structures for molecular recognition, including clip, LDLa, Sushi, Wonton, TSP, CUB, Frizzle, and SR domains. There are nineteen groups of genes evolved from relatively recent gene duplication and sequence divergence. Thirty-five SPs and seven SPHs contain 1, 2 or 5 clip domains. Multiple sequence alignment and molecular modeling of the 54 clip domains have revealed structural diversity of these regulatory modules. Sequence comparison with their homologs in Drosophila melanogaster, Anopheles gambiae and Tribolium castaneum allows us to classify them into five subfamilies: A are SPHs with 1 or 5 group-3 clip domains, B are SPs with 1 or 2 group-2 clip domains, C, D1 and D2 are SPs with a single clip domain in group-1a, 1b and 1c, respectively. We have classified into six categories the 125 expression profiles of SP-related proteins in fat body, brain, midgut, Malpighian tubule, testis, and ovary at different stages, suggesting that they participate in various physiological processes. Through RNA-Seq-based gene annotation and expression profiling, as well as intragenomic sequence comparisons, we have established a framework of information for future biochemical research of nondigestive SPs and SPHs in this model species. PMID:25530503

  2. Combination effect of cytochrome P450 1A1 gene polymorphisms on uterine leiomyoma: A case-control study

    PubMed Central

    Salimi, Saeedeh; Sajadian, Mojtaba; Khodamian, Maryam; Yazdi, Atefeh; Rezaee, Soodabeh; Mohammadpour-Gharehbagh, Abbas; Mokhtari, Mojgan; Yaghmaie, Minoo

    2016-01-01

    Uterine leiomyoma (UL) is an estrogen-dependent neoplasm of the uterus, and estrogen metabolizing enzymes affect its progression. This study aimed to evaluate the association between two single-nucleotide polymorphisms of cytochrome P450 1A1 (CYP1A1) gene and UL risk. The study consisted of 105 patients with UL and 112 healthy women as controls. Ile462Val (A/G) and Asp449Asp (T/C) polymorphisms of CYP1A1 gene were analyzed by DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism methods, respectively. The findings indicated no association between Ile462Val (A/G) and Asp449Asp (T/C) polymorphisms of CYP1A1 gene and UL (p < 0.05). However, the combination effect of TT/AG genotypes of the Asp449Asp (T/C) and Ile462Val (A/G) polymorphisms was associated with 4.3-fold higher risk of UL. In addition, haplotype analysis revealed that TG haplotype of the Asp449Asp (T/C) and Ile462Val (A/G) polymorphisms could increase the UL risk nearly 4.9-fold. Asp449Asp (T/C) and Ile462Val (A/G) polymorphisms of CYP1A1 gene were not associated with UL susceptibility; however, the combination of the TT/AG genotypes and TG haplotype could increase the UL risk. PMID:27333216

  3. A metagenomic alkaline protease from saline habitat: cloning, over-expression and functional attributes.

    PubMed

    Purohit, Megha K; Singh, Satya P

    2013-02-01

    Metagenomics has opened new horizon to unlock the biotechnological potential for novel enzymes. An alkaline protease gene was obtained from the total environmental DNA extracted from a saline habitat. After cloning and sequencing, it was identified that the protease gene related to uncultivable bacteria (HM219181). The protease was over expressed at 6h of induction with optimum induction at 1mM IPTG and 27°C. The purified enzyme was characterized with respect to various factors; temperature, pH, NaCl and chemical denaturant. The sequence analysis indicated a hydrophobic tendency of the protein, while the predicted 3D structure indicated the enzyme as a serine protease.

  4. P2X7 and NRAMP1/SLC11 A1 gene polymorphisms in Mexican mestizo patients with pulmonary tuberculosis

    PubMed Central

    Niño-Moreno, P; Portales-Pérez, D; Hernández-Castro, B; Portales-Cervantes, L; Flores-Meraz, V; Baranda, L; Gómez-Gómez, A; Acuña-Alonzo, V; Granados, J; González-Amaro, R

    2007-01-01

    Tuberculosis remains one of the most important infectious diseases worldwide. Several studies have suggested that genetic factors may affect susceptibility to tuberculosis, but the specific genes involved have not yet been fully characterized. NRAMP1/SLC11 A1 and P2X7 genes have been linked to increased risk for tuberculosis in some African and Asiatic populations. To explore the potential role of these genes in the susceptibility to pulmonary tuberculosis in a Mexican mestizo population, we evaluated the association of D543N and 3′-UTR polymorphisms in NRAMP1/SLC11 A1 and − 762 and A1513C polymorphisms in P2X7 genes with the risk for tuberculosis. Polymerase chain reaction (PCR) amplification of genomic DNA followed by restriction fragment length polymorphism analysis, and allelic-specific PCR was employed. We found no significant differences in allelic frequency in NRAMP1/SLC11 A1 gene polymorphisms in 94 patients with tuberculosis compared to 100 healthy contacts. Similarly, no significant association of the P2X7−762 gene polymorphism with tuberculosis was detected. In contrast, the P2X7 A1513C polymorphism was associated significantly with tuberculosis (P= 0·02, odds ratio = 5·28, 95% CI, 0·99–37·69), an association that had not been reported previously. However, when the function of P2X7 was assessed by an l-selectin loss assay, we did not find significant differences in patients compared to healthy contacts or between PPD+ and PPD– control individuals. This study further supports the complex role of P2X7 gene in host regulation of Mycobacterium tuberculosis infection, and demonstrates that different associations of gene polymorphisms and tuberculosis are found in distinct racial populations. PMID:17493019

  5. Polymorphisms of STS gene and SULT2A1 gene and neurosteroid levels in Han Chinese boys with attention-deficit/hyperactivity disorder: an exploratory investigation

    PubMed Central

    Wang, Liang-Jen; Chan, Wen-Ching; Chou, Miao-Chun; Chou, Wen-Jiun; Lee, Min-Jing; Lee, Sheng-Yu; Lin, Pao-Yen; Yang, Yi-Hsin; Yen, Cheng-Fang

    2017-01-01

    This study examined the relationships among polymorphisms of the STS gene and SULT2A1 gene, dehydroepiandrosterone (DHEA) and its sulfated form (DHEA-S), and characteristics of attention-deficit/hyperactivity disorder (ADHD). We used cheek swabs to obtain the genomic DNA of 200 ADHD male probands (mean age: 8.7 years), 192 patients’ mothers and 157 patients’ fathers. Three SNPs in the STS gene (rs6639786, rs2270112, and rs17268988) and one SNP in the SULT2A1 gene (rs182420) were genotyped. Saliva samples were collected from the ADHD patients to analyze DHEA and DHEA-S levels. The behavioral symptoms were evaluated with the Swanson, Nolan, and Pelham, and Version IV Scale for ADHD (SNAP-IV), and the neuropsychological function was assessed using the Conners’ Continuous Performance Tests (CPT). We found the C allele of rs2270112 within the STS gene to be over-transmitted in males with ADHD. Polymorphisms of rs182420 within the SULT2A1 gene were not associated with ADHD. In addition, the C allele carriers of rs2270112 demonstrated significantly higher DHEA-S levels than the G allele carriers. Levels of DHEA were positively correlated with attention as measured by the CPT. These findings support a potential role in the underlying biological pathogenesis of ADHD with regard to STS polymorphisms and neurosteroid levels. PMID:28367959

  6. Polymorphisms of STS gene and SULT2A1 gene and neurosteroid levels in Han Chinese boys with attention-deficit/hyperactivity disorder: an exploratory investigation.

    PubMed

    Wang, Liang-Jen; Chan, Wen-Ching; Chou, Miao-Chun; Chou, Wen-Jiun; Lee, Min-Jing; Lee, Sheng-Yu; Lin, Pao-Yen; Yang, Yi-Hsin; Yen, Cheng-Fang

    2017-04-03

    This study examined the relationships among polymorphisms of the STS gene and SULT2A1 gene, dehydroepiandrosterone (DHEA) and its sulfated form (DHEA-S), and characteristics of attention-deficit/hyperactivity disorder (ADHD). We used cheek swabs to obtain the genomic DNA of 200 ADHD male probands (mean age: 8.7 years), 192 patients' mothers and 157 patients' fathers. Three SNPs in the STS gene (rs6639786, rs2270112, and rs17268988) and one SNP in the SULT2A1 gene (rs182420) were genotyped. Saliva samples were collected from the ADHD patients to analyze DHEA and DHEA-S levels. The behavioral symptoms were evaluated with the Swanson, Nolan, and Pelham, and Version IV Scale for ADHD (SNAP-IV), and the neuropsychological function was assessed using the Conners' Continuous Performance Tests (CPT). We found the C allele of rs2270112 within the STS gene to be over-transmitted in males with ADHD. Polymorphisms of rs182420 within the SULT2A1 gene were not associated with ADHD. In addition, the C allele carriers of rs2270112 demonstrated significantly higher DHEA-S levels than the G allele carriers. Levels of DHEA were positively correlated with attention as measured by the CPT. These findings support a potential role in the underlying biological pathogenesis of ADHD with regard to STS polymorphisms and neurosteroid levels.

  7. Protease signalling: the cutting edge

    PubMed Central

    Turk, Boris; Turk, Dus̆an; Turk, Vito

    2012-01-01

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research. PMID:22367392

  8. Protease signalling: the cutting edge.

    PubMed

    Turk, Boris; Turk, Dušan; Turk, Vito

    2012-04-04

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research.

  9. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  10. Premature termination codons in the Type VII collagen gene (COL7A1) underlie severe, mutilating recessive dystrophic epidermolysis bullosa

    SciTech Connect

    Christiano, A.M.; Uitto, J. ); Anhalt, G. ); Gibbons, S.; Bauer, E.A. )

    1994-05-01

    Epidermolysis bullosa (EB) is a group of heritable mechano-bullous skin diseases classified into three major categories on the basis of the level of tissue separation within the dermal-epidermal basement membrane zone. The most severe, dystrophic (scarring) forms of EB demonstrate blister formation below the cutaneous basement membrane at the level of the anchoring fibrils. Ultrastructural observations of altered anchoring fibrils and genetic linkage to the gene encoding type VII collagen (COL7A1), the major component of anchoring fibrils, have implicated COL7A1 as the candidate gene in the dystrophic forms of EB. The authors have recently cloned the entire cDNA and gene for human COL7A1, which has been mapped to 3p21. In this study, they describe mutations in four COL7A1 alleles in three patients with severe, mutilating recessive dystrophic EB (Hallopeau-Siemens type, HS-RDEB). Each of these mutations resulted in a premature termination codon (PTC) in the amino-terminal portion of COL7A1. One of the patients was a compound heterozygote for two different mutations. The heterozygous carriers showed an [approximately] 50% reduction in anchoring fibrils, yet were clinically unaffected. Premature termination codons in both alleles of COL7A1 may thus be a major underlying cause of the severe, recessive dystrophic forms of EB. 40 refs., 8 figs.

  11. 211 G to a variation of UDP-glucuronosyl transferase 1A1 gene and neonatal breastfeeding jaundice.

    PubMed

    Chou, Hung-Chieh; Chen, Mei-Huei; Yang, Hwai-I; Su, Yi-Ning; Hsieh, Wu-Shiun; Chen, Chien-Yi; Chen, Huey-Ling; Chang, Mei-Hwei; Tsao, Po-Nien

    2011-02-01

    Breastfeeding jaundice is a common problem in neonates who were exclusively breastfed, but its pathogenesis is still unclear. The uridine diphosphate glucuronosyl transferase 1A1 (UGT1A1) gene polymorphism was shown to contribute to the development of neonatal hyperbilirubinemia. We hypothesize that the variation of UGT1A1 gene may contribute to neonatal breastfeeding jaundice. We prospectively enrolled 688 near-term and term infants who were exclusively breastfed (BF group) or were supplemented by infant formula partially (SF group) before onset of hyperbilirubinemia. Genotyping of the promoter and exon1 of UGT1A1 was performed in all neonates. Neonates in BF group had a significantly higher maximal body weight loss ratio, peak bilirubin level, and a greater incidence of hyperbilirubinemia than those in SF group. Neonates with nucleotide 211 GA or AA variation in UGT1A1 genotypes had higher peak serum bilirubin levels and higher incidence of hyperbilirubinemia than WTs (GG). This phenomenon was only seen in BF group but not in SF group when subset analysis was performed. This suggests that neonates who carry the nucleotide 211 GA or AA variation within coding region in UGT1A1 gene are more susceptible to develop early-onset neonatal breastfeeding jaundice.

  12. Expression and Sequence Evolution of Aromatase cyp19a1 and Other Sexual Development Genes in East African Cichlid Fishes

    PubMed Central

    Böhne, Astrid; Heule, Corina; Boileau, Nicolas; Salzburger, Walter

    2013-01-01

    Sex determination mechanisms are highly variable across teleost fishes and sexual development is often plastic. Nevertheless, downstream factors establishing the two sexes are presumably conserved. Here, we study sequence evolution and gene expression of core genes of sexual development in a prime model system in evolutionary biology, the East African cichlid fishes. Using the available five cichlid genomes, we test for signs of positive selection in 28 genes including duplicates from the teleost whole-genome duplication, and examine the expression of these candidate genes in three cichlid species. We then focus on a particularly striking case, the A- and B-copies of the aromatase cyp19a1, and detect different evolutionary trajectories: cyp19a1A evolved under strong positive selection, whereas cyp19a1B remained conserved at the protein level, yet is subject to regulatory changes at its transcription start sites. Importantly, we find shifts in gene expression in both copies. Cyp19a1 is considered the most conserved ovary-factor in vertebrates, and in all teleosts investigated so far, cyp19a1A and cyp19a1B are expressed in ovaries and the brain, respectively. This is not the case in cichlids, where we find new expression patterns in two derived lineages: the A-copy gained a novel testis-function in the Ectodine lineage, whereas the B-copy is overexpressed in the testis of the speciest-richest cichlid group, the Haplochromini. This suggests that even key factors of sexual development, including the sex steroid pathway, are not conserved in fish, supporting the idea that flexibility in sexual determination and differentiation may be a driving force of speciation. PMID:23883521

  13. Expression Profile of the Schistosoma japonicum Degradome Reveals Differential Protease Expression Patterns and Potential Anti-schistosomal Intervention Targets

    PubMed Central

    Liu, Shuai; Cai, Pengfei; Piao, Xianyu; Hou, Nan; Zhou, Xiaosu; Wu, Chuang; Wang, Heng; Chen, Qijun

    2014-01-01

    Blood fluke proteases play pivotal roles in the processes of invasion, nutrition acquisition, immune evasion, and other host-parasite interactions. Hundreds of genes encoding putative proteases have been identified in the recently published schistosome genomes. However, the expression profiles of these proteases in Schistosoma species have not yet been systematically analyzed. We retrieved and culled the redundant protease sequences of Schistosoma japonicum, Schistosoma mansoni, Echinococcus multilocularis, and Clonorchis sinensis from public databases utilizing bioinformatic approaches. The degradomes of the four parasitic organisms and Homo sapiens were then comparatively analyzed. A total of 262 S. japonicum protease sequences were obtained and the expression profiles generated using whole-genome microarray. Four main clusters of protease genes with different expression patterns were identified: proteases up-regulated in hepatic schistosomula and adult worms, egg-specific or predominantly expressed proteases, cercaria-specific or predominantly expressed proteases, and constantly expressed proteases. A subset of protease genes with different expression patterns were further validated using real-time quantitative PCR. The present study represents the most comprehensive analysis of a degradome in Schistosoma species to date. These results provide a firm foundation for future research on the specific function(s) of individual proteases and may help to refine anti-proteolytic strategies in blood flukes. PMID:25275570

  14. Molecular demonstration of SLC4A1 gene deletion in two Mexican patients with Southeast Asian ovalocytosis.

    PubMed

    Ramos-Kuri, Manuel; Carrillo Farga, Joaquín; Zúñiga, Joaquín; Amador Guerrero, María Teresa; Granados, Julio; Estrada, Francisco J

    2005-06-01

    We describe the finding of two Mexican patients with a specific 27-bp deletion in the solute carrier family 4 gene (SLC4A1delta27) (also known as the band 3 gene found on chromosome 17q21-q22), characteristic of Southeast Asian ovalocytosis (SAO). The patients were asymptomatic, and the initial diagnosis was made by microscopic observation of the presence of typical stomatocytic ovalocytes. The gene deletion was confirmed by PCR and DNA sequencing. Both patients were heterozygous for the deletion. One patient is from Tabasco state, in southeastern Mexico, a malaria-endemic zone. The other patient is from Mexico City, which is not a malaria-endemic area. Their families have no non-Mexican ancestors and their previous generations were born in Mexico. Both patients carry the HLA-B*3501 subtype, characteristic of Amerindians and Asian populations. Familial and HLA data led us to conclude that these two patients are the first report of SLC4A1delta27 in Amerindians. The nucleotide analysis showing a perfect match sequence between Southeast Asian and Mexican patients suggests, but does not prove, that the Mexican gene is not a de novo mutation. Instead, this gene might be the result of migration of individuals with Asian ancestry into the Mexican gene pool. We are looking for other families with the mutation to detect, by HLA analysis, the ancient ethnic origin of these patients.

  15. Cloning, expression pattern and promoter functional analysis of cyp19a1a gene in miiuy croaker.

    PubMed

    Huang, Wei; Yang, Pan; Lv, Zhenming; Wu, Changwen; Gui, Jianfang; Lou, Bao

    2017-09-05

    Gonadal-specific aromatase encoded by cyp19a1a is the important enzyme controlling estrogen biosynthesis in teleosts. In the present study, the cDNA sequence of cyp19a1a was cloned and characterized from miiuy croaker Miichthys miiuy. The cDNA encoded a protein of 519 amino acids with five structural regions. Higher identities of amino acid sequences and conserved structural regions were found between Mmcyp19a1a and other cyp19a1a genes. In addition, Mmcyp19a1a was clustered together with other seawater fishes. Immunohistochemical analysis revealed that Mmcyp19a1a was localized exclusively in the cytoplasmic of thecal and granulosa cells surrounding the oocytes. Both the protein and mRNA levels of Mmcyp19a1a were increased significantly at the stage III follicles (mid-vitellogenic) and then decreased along with vitellogenesis. Interestingly, strong immunoreactive signals were also detected in the supporting cells of connective tissues during ovarian development. A 1777bp promoter fragment of Mmcyp19a1a was also isolated, and functional analysis using an EGFP reporter fusion in zebrafish larvae presented positive signals in the above of yolk sac, where is the region of pronephros and germ plasm occur. The Mmcyp19a1a:EGFP expression pattern was generally consistent with the endogenous cyp19a1a genesis. These results indicate that the Mmcyp19a1a gene plays an important role during vitellogenesis and oocyte maturation. The constructor of Mmcyp19a1a:EGFP may provide a useful tool for genetic analysis of gonad development in teleost. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. SSCP and segregation analysis of the human type X collagen gene (COL10A1) in heritable forms of chondrodysplasia

    SciTech Connect

    Sweetman, W.A.; Rash, B.; Thomas, J.T.; Boot-Handford, R.; Grant, M.E.; Wallis, G.A. ); Sykes, B. ); Beighton, P. ); Hecht, J.T. ); Zabell, B. )

    1992-10-01

    Type X collagen is a homotrimeric, short chain, nonfibrillar collagen that is expressed exclusively by hypertrophic chondrocytes at the sites of endochondral ossification. The distribution and pattern of expression of the type X collagen gene (COL10A1) suggests that mutations altering the structure and synthesis of the protein may be responsible for causing heritable forms of chondrodysplasia. The authors investigated whether mutations within the human COL10A1 gene were responsible for causing the disorders achondroplasia, hypochondroplasia, pseudoachondroplasia, and thanatophoric dysplasia, by analyzing the coding regions of the gene by using PCR and the single-stranded conformational polymorphism technique. By this approach, seven sequence changes were identified within and flanking the coding regions of the gene of the affected persons. The authors demonstrated that six of these sequence changes were not responsible for causing these forms of chondrodysplasia but were polymorphic in nature. The sequence changes were used to demonstrate discordant segregation between the COL10A1 locus and achondroplasia and pseudoachondroplasia, in nuclear families. This lack of segregation suggests that mutations within or near the COL101A1 locus are not responsible for these disorders. The seventh sequence change resulted in a valine-to-methionine substitution in the carboxyl-terminal domain of the molecule and was identified in only two hypochondroplasic individuals from a single family. Segregation analysis in this family was inconclusive, and the significance of this substitution remains uncertain. 47 refs., 3 figs., 2 tabs.

  17. IL-1 regulates the Cyp7a1 gene and serum total cholesterol level at steady state in mice.

    PubMed

    Kojima, Misaki; Ashino, Takashi; Yoshida, Takemi; Iwakura, Yoichiro; Sekimoto, Masashi; Degawa, Masakuni

    2009-02-06

    We examined the role of hepatic interleukin (IL)-1alpha/beta in serum total cholesterol homeostasis using male and female IL-1-knockout (KO) mice and wild-type (WT) mice. Serum total cholesterol level was higher in males than in females in WT and KO mice. The difference between sexes was closely correlated with the difference in gene expression level of cholesterol 7alpha-hydroxylase (Cyp7a1), a rate-limiting enzyme for bile acid synthesis. No significant sex difference in gene expression level of 3-hydroxy-3-methylglutaryl-CoA reductase, a rate-limiting enzyme for cholesterol synthesis, was observed in WT mice. Interestingly, the gene expression level of hepatic Cyp7a1 was lower in KO mice than in sex-matched WT mice, while the serum total cholesterol level was the opposite. The present findings demonstrate that IL-1alpha and IL-1beta are positive regulators for the Cyp7a1 gene in steady-state mice and that Cyp7a1 is one of the factors that mediate the difference in serum total cholesterol level between sexes.

  18. Argument within a Scientific Debate: The Case of the DRD2 A1 Allele as a Gene for Alcoholism.

    ERIC Educational Resources Information Center

    Wastyn, Ronald O.; Wastyn, M. Linda

    1997-01-01

    Investigates how opposing parties advanced arguments to the scientific community about the validity of DRD2 A1 allele as a gene causing alcoholism. Demonstrates to what extent scientists debate each other in journals by advancing opposing viewpoints with rigor and insight. Reveals what it means when scientists label a discovery in terms of finding…

  19. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  20. A novel splicing mutation in COL1A1 gene caused type I osteogenesis imperfecta in a Chinese family.

    PubMed

    Peng, Hao; Zhang, Yuhui; Long, Zhigao; Zhao, Ding; Guo, Zhenxin; Xue, Jinjie; Xie, Zhiguo; Xiong, Zhimin; Xu, Xiaojuan; Su, Wei; Wang, Bing; Xia, Kun; Hu, Zhengmao

    2012-07-10

    Osteogenesis imperfect (OI) is a heritable connective tissue disorder with bone fragility as a cardinal manifestation, accompanied by short stature, dentinogenesis imperfecta, hyperlaxity of ligaments and skin, blue sclerae and hearing loss. Dominant form of OI is caused by mutations in the type I procollagen genes, COL1A1/A2. Here we identified a novel splicing mutation c.3207+1G>A (GenBank ID: JQ236861) in the COL1A1 gene that caused type I OI in a Chinese family. RNA splicing analysis proved that this mutation created a new splicing site at c.3200, and then led to frameshift. This result further enriched the mutation spectrum of type I procollagen genes. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Epigenetic inactivation of the dioxin-responsive cytochrome P4501A1 gene in human prostate cancer.

    PubMed

    Okino, Steven T; Pookot, Deepa; Li, Long-Cheng; Zhao, Hong; Urakami, Shinji; Shiina, Hiroaki; Igawa, Mikio; Dahiya, Rajvir

    2006-08-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD; dioxin) is a toxic environmental contaminant that works through dioxin response elements (DRE) to activate gene expression. We tested the hypothesis that cancer-related epigenetic changes suppress dioxin activation of the cytochrome P4501A1 (CYP1A1) gene. 5-Aza-2'-deoxycytidine (5-aza-CdR), an inhibitor of DNA methylation, increases TCDD-inducible CYP1A1 mRNA expression in cancerous LNCaP cells but not in noncancerous PWR-1E and RWPE-1 cells (all human prostate cell lines). Bisulfite DNA sequencing shows that the TCDD-responsive CYP1A1 enhancer is highly methylated in LNCaP cells but not in RWPE-1 cells. In vivo footprinting experiments reveal that unmethylated DRE sites do not bind protein in response to TCDD in LNCaP cells, whereas inducible DRE occupancy occurs in RWPE-1 cells. Pretreatment of LNCaP cells with 5-aza-CdR partially restores TCDD-inducible DRE occupancy, showing that DNA methylation indirectly suppresses DRE occupancy. Chromatin immunoprecipitation experiments reveal that LNCaP cells lack trimethyl histone H3 lysine 4, a mark of active genes, on the CYP1A1 regulatory region, whereas this histone modification is prevalent in PWR-1E and RWPE-1 cells. We also analyzed CYP1A1 enhancer methylation in human prostate tissue DNA. We do not detect CYP1A1 enhancer methylation in 30 DNA samples isolated from noncancerous prostate tissue. In contrast, 11 of 30 prostate tumor DNA samples have detectable CYP1A1 enhancer methylation, indicating that it is hypermethylated in prostate tumors. This is the first report that shows that CYP1A1 is aberrantly hypermethylated in human prostate cancer and has an altered, inaccessible chromatin structure that suppresses its dioxin responsiveness.

  2. Relationship between histopathological status of the Helicobacter pylori infected patients and proteases of H. pylori in isolates carrying diverse virulence genotypes.

    PubMed

    Gharibi, Somayyeh; Falsafi, Tahereh; Alebouyeh, Masoud; Farzi, Nastaran; Vaziri, Farzam; Zali, Mohamad Reza

    2017-09-01

    Helicobacter pylori is the main cause of several gastroduodenal diseases in Humans. Among various virulence factors of H. pylori, proteases may also be involved in its pathogenicity. In this study, relationship between proteolytic activity of H. pylori strains and histopathological changes of the stomach was investigated in the patients infected with strains carrying diverse virulence factors. H. pylori strains were isolated from the biopsies of 116 patients who referred to hospital for their gastroduodenal disorders, in Tehran, Iran. Biopsies were sent to microbiology and pathology laboratories for further analysis. All the suspected grown colonies were characterized by both biochemical tests and polymerase chain reaction (PCR). Presence of seven protease genes, htrA, clpP, hp0169, hp1012, hp0382, hp1350 and hp1435, and distinct allelic variants of H. pylori virulence factors, cagA, vacA, iceA, babA2 and sabA, were analyzed in each strain. Protease activity of the strains was assessed using spectrophotometric assay. Furthermore, association between diversity in protease genes and virulence genes, protease activity, as well as pathological changes was estimated statistically. Proteases genes, htrA, clpP, hp0169, hp1012, hp0382, hp1350, hp1435, were detected among 100%, 100%, 98%, 98%, 98%, 98%, and 8% of fifty H. pylori strains isolated from the patients, respectively. Status of cagA, vacA s1, vacA s2, vacA m1, vacA m2, iceA1, iceA2, babA2 and sabA genes in isolates were 64%, 68%, 30%, 26%, 74%, 48%, 52%, 100%, and 96%, respectively. Predominant (84%) combined status for protease genes was: htrA/clpP/hp0169/hp1012/hp0382/hP1350/hp1435, while the prevalent combined status (16%) for virulence genes was: cagA+/vacA s1m2/iceA1(+)/sabA(+)/babA2(+). Although most of the strains (91.4%) presented moderate protease activity in vitro, lowest activity was measured in strains isolated from the patients with chronic gastritis (4.25%). Present study provide the new data

  3. Significance and mechanism of CYP7a1 gene regulation during the acute phase of liver regeneration.

    PubMed

    Zhang, Lisheng; Huang, Xiongfei; Meng, Zhipeng; Dong, Bingning; Shiah, Steven; Moore, David D; Huang, Wendong

    2009-02-01

    Cholesterol 7alpha-hydroxylase (CYP7a1) is the rate-limiting enzyme in the classic pathway of bile acid synthesis. Expression of CYP7a1 is regulated by a negative feedback pathway of bile acid signaling. Previous studies have suggested that bile acid signaling is also required for normal liver regeneration, and CYP7a1 expression is strongly repressed after 70% partial hepatectomy (PH). Both the effect of CYP7a1 suppression on liver regrowth and the mechanism by which 70% PH suppresses CYP7a1 expression are unknown. Here we show that liver-specific overexpression of an exogenous CYP7a1 gene impaired liver regeneration after 70% PH, which was accompanied by increased hepatocyte apoptosis and liver injury. CYP7a1 expression was initially suppressed after 70% PH in an farnesoid X receptor/ small heterodimer partner-independent manner; however, both farnesoid X receptor and small heterodimer partner were required to regulate CYP7a1 expression at the later stage of liver regeneration. c-Jun N-terminus kinase and hepatocyte growth factor signaling pathways are activated during the acute phase of liver regeneration. We determined that hepatocyte growth factor and c-Jun N-terminus kinase pathways were involved in the suppressing of the CYP7a1 expression in the acute phase of live regeneration. Taken together, our results provide the significance that CYP7a1 suppression is required for liver protection after 70% PH and there are two distinct phases of CYP7a1 gene regulation during liver regeneration.

  4. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  5. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene.

    PubMed

    Czub, Barbara; Shah, Amna Z; Alfano, Giovanna; Kruczek, Przemysław M; Chakarova, Christina F; Bhattacharya, Shomi S

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS.

  6. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene

    PubMed Central

    Czub, Barbara; Shah, Amna Z.; Alfano, Giovanna; Kruczek, Przemysław M.; Chakarova, Christina F.; Bhattacharya, Shomi S.

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS. PMID:26872363

  7. ShRNA-mediated silencing of the ubiquitin-specific protease 22 gene restrained cell progression and affected the Akt pathway in nasopharyngeal carcinoma

    PubMed Central

    Zhuang, Ya-Jing; Liao, Zhi-Wei; Yu, Hong-wei; Song, Xian-Lu; Liu, Yuan; Shi, Xing-Yuan; Lin, Xiao-dan; Zhou, Tong-Chong

    2015-01-01

    Ubiquitin-specific protease 22 (USP22) is closely related with poor prognosis of cancer patients. However, the role of USP22 expression in nasopharyngeal carcinoma (NPC) has not been determined. The main aim of this study was to determine the role of USP22 in the pathologic processes of NPC. Immunohistochemistry (IHC), western blot (WB), and real-time polymerase chain reaction (RT-PCR) were used to measure the expression of USP22 in cell lines and tissues of NPC in comparison with expression in non-cancerous cells and tissues. USP22-specific short hairpin RNA (shRNA) was used to knock down USP22 expression in the NPC cell line CNE-1 and CNE-2. Furthermore, the impact of USP22 in cellular proliferation, growth, and cell cycle were detected respectively. WB was used to determine the role of USP22 in the AKT/GSK-3/Cyclin signaling pathway. The expression levels of USP22 were remarkably higher in NPC cell lines and tissues. With cell counting and the MTS assay, cellular growth and proliferation progression of USP22 knockdown cell line was shown to be effectively restrained. The USP22 silencing both in CNE-1 and CNE-2 cells caused them to accumulate in the G0/G1 phase of the cell cycle. USP22 knockdown was also found to modulate the AKT/GSK-3/Cyclin pathway, resulting in downregulation of p-AKT, p-GSK-3β, and cyclinD1. This study suggests that USP22 plays a critical regulatory role in the pathologic processes of NPC, and that it may be a potential biological treatment target in the future. PMID:25482932

  8. Mutational Spectrum of CYP24A1 Gene in a Cohort of Italian Patients with Idiopathic Infantile Hypercalcemia.

    PubMed

    Gigante, Maddalena; Santangelo, Luisa; Diella, Sterpeta; Caridi, Gianluca; Argentiero, Lucia; D''Alessandro, Maria Michela; Martino, Marida; Stea, Emma Diletta; Ardissino, Gianluigi; Carbone, Vincenza; Pepe, Silvana; Scrutinio, Domenico; Maringhini, Silvio; Ghiggeri, Gian Marco; Grandaliano, Giuseppe; Giordano, Mario; Gesualdo, Loreto

    2016-01-01

    Loss-of-function mutations in the CYP24A1 gene, which encodes the vitamin D-24 hydroxylase, have been recognized as a cause of elevated 1,25-dihydroxyvitamin D concentrations, hypercalcemia, hypercalciuria, nephrocalcinosis and nephrolithiasis in infants and adults. As only a case report describing 2 adult patients has been reported in Italian population, we report here the mutation analysis of CYP24A1 gene in an Italian cohort of 12 pediatric and adult patients with idiopathic infantile hypercalcemia (IIH). We performed mutational screening of CYP24A1 gene in a cohort of 12 Italian patients: 8 children with nephrocalcinosis, hypercalcemia and PTH levels <10 pg/ml and 4 adult patients with nephrolithiasis, mild hypercalcemia and PTH levels <10 pg/ml from 11 unrelated Italian families. Clinical and biochemical data were collected. Genomic DNA was extracted from peripheral blood leucocytes using standard methods, and whole coding sequence of CYP24A1 gene was analysed in all patients and family members by polymerase chain reaction and direct sequencing. The potential pathogenicity of the newly identified missense mutations was evaluated by 3 different in silico approaches (Sorting Intolerant from Tolerant, Polyphen and Mutation Taster) and by comparative analysis in 14 different species using ClustalW software. CYP24A1 bi-allelic mutations were found in 8 individuals from 7 Italian families (7/11; 64%). Overall, 6 different CYP24A1 mutations, including one small deletion (p.Glu143del), 4 missense mutations (p.Leu148Pro; p.Arg396Trp; p.Pro503Leu; p.Glu383Gln) and one nonsense mutation (p.Tyr220*) were identified. Two out of 6 mutations (p.Tyr220* and p.Pro503Leu) were not previously described. Moreover, a new CYP24A1 variant was identified by genetic screening of asymptomatic controls. To the best of our knowledge, this is the first report of a CYP24A1 molecular analysis performed in an Italian cohort of adult and pediatric Italian patients. This study (1) confirms

  9. Molecular Characterization of Rice OsLCB2a1 Gene and Functional Analysis of its Role in Insect Resistance

    PubMed Central

    Begum, Mahfuj A.; Shi, Xiao-Xiao; Tan, Ye; Zhou, Wen-Wu; Hannun, Yusuf; Obeid, Lina; Mao, Cungui; Zhu, Zeng-Rong

    2016-01-01

    In plants, sphingolipids, such as long-chain bases (LCBs), act as bioactive molecules in stress responses. Until now, it is still not clear if these lipids are involved in biotic stress responses to herbivore. Herein we report that a rice LCB gene, OsLCB2a1 encoding a subunit of serine palmitoyltransferase (SPT), a key enzyme responsible for the de novo biosynthesis of sphingolipids, plays a critical role in plant defense response to the brown planthopper (BPH) attack and that its up-regulation protects plants from herbivore infestation. Transcripts of OsLCB2a1 gene in rice seedlings were increased at 4 h, but decreased at 8–24 h after BPH attack. Sphingolipid measurement profiling revealed that overexpression of OsLCB2a1 in Arabidopsis thaliana increased trihydroxylated LCB phytosphingosine (t18:0) and phytoceramide by 1.7 and 1.3-fold, respectively, compared with that of wild type (WT) plants. Transgenic Arabidopsis plants also showed higher callose and wax deposition in leaves than that of WT. Overexpression of OsLCB2a1 gene in A. thaliana reduced the population size of green peach aphid (Myzus persicae). Moreover, the electrical penetration graph (EPG) results indicated that the aphids encounter resistance factors while reaching for the phloem on the transgenic plants. The defense response genes related to salicylic acid signaling pathway, remained uplgulated in the OsLCB2a1-overexpressing transgenic plants. Our data highlight the key functions of OsLCB2a1 in biotic stress response in plants. PMID:27990147

  10. Molecular Characterization of Rice OsLCB2a1 Gene and Functional Analysis of its Role in Insect Resistance.

    PubMed

    Begum, Mahfuj A; Shi, Xiao-Xiao; Tan, Ye; Zhou, Wen-Wu; Hannun, Yusuf; Obeid, Lina; Mao, Cungui; Zhu, Zeng-Rong

    2016-01-01

    In plants, sphingolipids, such as long-chain bases (LCBs), act as bioactive molecules in stress responses. Until now, it is still not clear if these lipids are involved in biotic stress responses to herbivore. Herein we report that a rice LCB gene, OsLCB2a1 encoding a subunit of serine palmitoyltransferase (SPT), a key enzyme responsible for the de novo biosynthesis of sphingolipids, plays a critical role in plant defense response to the brown planthopper (BPH) attack and that its up-regulation protects plants from herbivore infestation. Transcripts of OsLCB2a1 gene in rice seedlings were increased at 4 h, but decreased at 8-24 h after BPH attack. Sphingolipid measurement profiling revealed that overexpression of OsLCB2a1 in Arabidopsis thaliana increased trihydroxylated LCB phytosphingosine (t18:0) and phytoceramide by 1.7 and 1.3-fold, respectively, compared with that of wild type (WT) plants. Transgenic Arabidopsis plants also showed higher callose and wax deposition in leaves than that of WT. Overexpression of OsLCB2a1 gene in A. thaliana reduced the population size of green peach aphid (Myzus persicae). Moreover, the electrical penetration graph (EPG) results indicated that the aphids encounter resistance factors while reaching for the phloem on the transgenic plants. The defense response genes related to salicylic acid signaling pathway, remained uplgulated in the OsLCB2a1-overexpressing transgenic plants. Our data highlight the key functions of OsLCB2a1 in biotic stress response in plants.

  11. Effect of Cyp27A1 gene dosage on atherosclerosis development in ApoE-knockout mice

    PubMed Central

    Zurkinden, Line; Solcà, Curzio; Vögeli, Isabelle A.; Vogt, Bruno; Ackermann, Daniel; Erickson, Sandra K.; Frey, Felix J.; Sviridov, Dmitri; Escher, Geneviève

    2014-01-01

    In humans, sterol 27-hydroxylase (CYP27A1) deficiency leads to cholesterol deposition in tendons and vasculature. Thus, in addition to its role in bile acid synthesis, where it converts cholesterol to 27-hydroxycholesterol (27-OHC), CYP27A1 may also be atheroprotective. Cyp27A1-deficient (Cyp27A1−/−) mice were crossed with apolipoprotein E (apoE)-deficient mice. Cyp27A1+/+/apoE−/− [ApoE-knockout (KO)], Cyp27A1+/−/apoE−/− heterozygous (het), and Cyp27A1−/−/apoE−/− [double-knockout (DKO)] mice were challenged with a Western diet (WD) for 3 and 6 mo. ApoE-KO mice fed a chow diet or a WD were used as the control. The severity of atherosclerosis in DKO mice was reduced 10-fold. Compared with the control, the DKO mice had no 27-OHC, total plasma cholesterol and low-density lipoprotein and very low density lipoprotein (LDL/VLDL) concentrations were reduced 2-fold, and HDL was elevated 2-fold. Expression of hepatic CYP7A1, CYP3A, and CYP8B1 were 5- to 10-fold higher. 3-Hydroxy-3-methyl-glutaryl-CoA reductase (HMGR) activity increased 4-fold. Fecal cholesterol was increased. In contrast, het mice fed a WD developed accelerated atherosclerosis and severe skin lesions, possibly because of reduced reverse cholesterol transport due to diminished 27-OHC production. CYP27A1 activity is involved in the control of cholesterol homeostasis and development of atherosclerosis with a distinct gene dose-dependent effect.—Zurkinden, L., Solcà, C., Vögeli, I. A., Vogt, B., Ackermann, D., Erickson, S. K., Frey, F. J., Sviridov, D., Escher, G. Effect of Cyp27A1 gene dosage on atherosclerosis development in ApoE-knockout mice. PMID:24327605

  12. Systems Analysis of a Mouse Xenograft Model Reveals Annexin A1 as a Regulator of Gene Expression in Tumor Stroma

    PubMed Central

    Yi, Ming

    2012-01-01

    Annexin A1 is a multi functional molecule which is involved in inflammation, innate and adaptive immune systems, tumor progression and metastasis. We have previously showed the impaired tumor growth, metastasis, angiogenesis and wound healing in annexin A1 knockout mice. While tumor is a piece of heterogeneous mass including not only malignant tumor cells but also the stroma, the importance of the tumor stroma for tumor progression and metastasis is becoming increasingly clear. The tumor stroma is comprised by various components including extracellular matrix and non-malignant cells in the tumor, such as endothelial cells, fibroblasts, immune cells, inflammatory cells. Based on our previous finding of pro-angiogenic functions for annexin A1 in vascular endothelial cell sprouting, wound healing, tumor growth and metastasis, and the previously known properties for annexin A1 in immune cells and inflammation, this study hypothesized that annexin A1 is a key functional player in tumor development, linking the various components in tumor stroma by its actions in endothelial cells and immune cells. Using systems analysis programs commercially available, this paper further compared the gene expression between tumors from annexin A1 wild type mice and annexin A1 knockout mice and found a list of genes that significantly changed in the tumor stroma that lacked annexin A1. This revealed annexin A1 to be an effective regulator in tumor stroma and suggested a mechanism that annexin A1 affects tumor development and metastasis through interaction with the various components in the microenvironment surrounding the tumor cells. PMID:23077482

  13. Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes.

    PubMed

    Chamorro, Cristina; Mencía, Angeles; Almarza, David; Duarte, Blanca; Büning, Hildegard; Sallach, Jessica; Hausser, Ingrid; Del Río, Marcela; Larcher, Fernando; Murillas, Rodolfo

    2016-04-05

    Clonal gene therapy protocols based on the precise manipulation of epidermal stem cells require highly efficient gene-editing molecular tools. We have combined adeno-associated virus (AAV)-mediated delivery of donor template DNA with transcription activator-like nucleases (TALE) expressed by adenoviral vectors to address the correction of the c.6527insC mutation in the COL7A1 gene, causing recessive dystrophic epidermolysis bullosa in a high percentage of Spanish patients. After transduction with these viral vectors, high frequencies of homology-directed repair were found in clones of keratinocytes derived from a recessive dystrophic epidermolysis bullosa (RDEB) patient homozygous for the c.6527insC mutation. Gene-edited clones recovered the expression of the COL7A1 transcript and collagen VII protein at physiological levels. In addition, treatment of patient keratinocytes with TALE nucleases in the absence of a donor template DNA resulted in nonhomologous end joining (NHEJ)-mediated indel generation in the vicinity of the c.6527insC mutation site in a large proportion of keratinocyte clones. A subset of these indels restored the reading frame of COL7A1 and resulted in abundant, supraphysiological expression levels of mutant or truncated collagen VII protein. Keratinocyte clones corrected both by homology-directed repair (HDR) or NHEJ were used to regenerate skin displaying collagen VII in the dermo-epidermal junction.

  14. [Mutation analysis and prenatal diagnosis of COL1A1 gene in a Chinese family with type I osteogenesis imperfecta].

    PubMed

    Zhang, Hui; Wu, Dong; Hou, Qiaofang; Liu, Zhiyou; Qin, Litao; Liao, Shixiu

    2014-12-01

    To detect mutation of COL1A1 gene in a Chinese family affected with type I osteogenesis imperfecta (OI) and to provide prenatal diagnosis for a fetus at 17th gestational week. Polymerase chain reaction, DNA sequencing and restriction endonuclease analysis were used to verify the detected mutation among other members of the family and 100 healthy controls. No mutation has been detected in the COL1A2 gene in all of the subjects. A heterozygous mutation c.104-1G>C was identified in the COL1A1 gene among all patients from this family. The same mutation was not found in other members from the family and the 100 healthy controls. The mutation was not found in the fetus, and was verified to be a new mutation according to the type I collagen mutation database. The c.104-1G>C mutation of the COL1A1 gene probably underlies the type I osteogenesis imperfecta in this family. Under the premise of a clear genetic diagnosis, prenatal diagnosis may be provided to reduce the risk for the disease.

  15. Gene Editing for the Efficient Correction of a Recurrent COL7A1 Mutation in Recessive Dystrophic Epidermolysis Bullosa Keratinocytes

    PubMed Central

    Chamorro, Cristina; Mencía, Angeles; Almarza, David; Duarte, Blanca; Büning, Hildegard; Sallach, Jessica; Hausser, Ingrid; Del Río, Marcela; Larcher, Fernando; Murillas, Rodolfo

    2016-01-01

    Clonal gene therapy protocols based on the precise manipulation of epidermal stem cells require highly efficient gene-editing molecular tools. We have combined adeno-associated virus (AAV)-mediated delivery of donor template DNA with transcription activator-like nucleases (TALE) expressed by adenoviral vectors to address the correction of the c.6527insC mutation in the COL7A1 gene, causing recessive dystrophic epidermolysis bullosa in a high percentage of Spanish patients. After transduction with these viral vectors, high frequencies of homology-directed repair were found in clones of keratinocytes derived from a recessive dystrophic epidermolysis bullosa (RDEB) patient homozygous for the c.6527insC mutation. Gene-edited clones recovered the expression of the COL7A1 transcript and collagen VII protein at physiological levels. In addition, treatment of patient keratinocytes with TALE nucleases in the absence of a donor template DNA resulted in nonhomologous end joining (NHEJ)-mediated indel generation in the vicinity of the c.6527insC mutation site in a large proportion of keratinocyte clones. A subset of these indels restored the reading frame of COL7A1 and resulted in abundant, supraphysiological expression levels of mutant or truncated collagen VII protein. Keratinocyte clones corrected both by homology-directed repair (HDR) or NHEJ were used to regenerate skin displaying collagen VII in the dermo-epidermal junction. PMID:27045209

  16. cDNA cloning and chromosomal mapping of the mouse type VII collagen gene (Col7a1): Evidence for rapid evolutionary divergence of the gene

    SciTech Connect

    Li, Kehua; Christiano, A.M.; Chu, Mon Li; Uitto, J. Thomas Jefferson Univ., Philadelphia, PA ); Copeland, N.G.; Gilbert, D.J. )

    1993-06-01

    Type VII collagen is the major component of anchoring fibrils, critical attachment structures at the dermal-epidermal basement membrane zone. Genetic linkage analyses with recently cloned human type VII collagen cDNAs have indicated that the corresponding gene, COL7A1, is the candidate gene in the dystrophic forms of epidermolysis bullosa. To gain insight into the evolutionary conservation of COL7A1, in this study the authors have isolated mouse type VII collagen cDNAs by screening a mouse epidermal keratinocyte cDNA library with a human COL7A1 cDNA. Two overlapping mouse cDNAs were isolated, and Northern hybridization of mouse epidermal keratinocyte RNA with one of them revealed the presence of a mRNA transcript of [approximately]9.5 kb, the approximate size of the human COL7A1 mRNA. Nucleotide sequencing of the mouse cDNAs revealed a 2760-bp open reading frame that encodes the 5[prime] half of the collagenous domain and a segment of the NC-1, the noncollagenous amino-terminal domain of type VII collagen. Comparison of the mouse amino acid sequences with the corresponding human sequences deduced from cDNAs revealed 82.5% identity. The evolutionary divergence of the gene was relatively rapid in comparison to other collagen genes. Despite the high degree of sequence variation, several sequences, including the size and the position of noncollagenous imperfections and interruptions within the Gly-X-Y repeat sequence, were precisely conserved. Finally, the mouse Col7a1 gene was located by interspecific backcross mapping to mouse Chromosome 9, a region that corresponds to human chromosome 3p21, the position of human COL7Al. This assignment confirms and extends the relationship between the mouse and the human chromosomes in this region of the genome. 33 refs., 5 figs., 1 tab.

  17. Purple-leaved Ficus lyrata plants produced by overexpressing a grapevine VvMybA1 gene.

    PubMed

    Zhao, Jietang; Li, Zhijian T; Chen, Juan; Henny, Richard J; Gray, Dennis J; Chen, Jianjun

    2013-11-01

    This study established an efficient method of regenerating plants of Ficus lyrata and producing purple-leaved F. lyrata plants through genetic transformation using a VvMybA1 gene of grapevine. Ficus lyrata, a species with unique violin- or guitar-shaped leaves, was regenerated from leaf-derived calli cultured on Murashige and Skoog (MS) basal medium supplemented with 4.5 μM N-phenyl-N'-1, 2, 3-thiadiazol-5-yl urea (TDZ) and 0.5 μM α-naphthalene acetic acid (NAA). Leaf discs were inoculated with Agrobacterium tumefaciens strain EHA 105 harboring a binary vector DEAT that contains the VvMybA1 gene and neomycin phosphotransferase (npt II) gene and subsequently cultured on the established regeneration medium supplemented with 100 mg l(-1) kanamycin. Results showed that 87.5 % of the leaf discs produced kanamycin-resistant callus, and 68.8 % of them produced adventitious shoots. Transgenic plants with three leaf colors including green, green-purple, and purple were produced. Regular and quantitative real-time PCR analyses confirmed the integration of transgenes into the host genome. Semi-quantitative RT-PCR analysis indicated that the VvMybA1 gene was responsible for the purple-colored phenotype. Purple-leaved plants with strong color stability grew vigorously in a greenhouse. This study illustrated the feasibility of using a genetically engineered VvMybA1 gene for drastic modification of leaf color of an important woody ornamental plant.

  18. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    PubMed

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT)n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p < 0.005 and OR = 0.30 (0.19-0.48)). No significant relation was found between P2X7 (-762 C/T and 1513 A/C) gene polymorphism and oropharyngeal tularemia in this study (p > 0.05).

  19. Age-related expression profile of the SLC27A1 gene in chicken tissues.

    PubMed

    Wang, Yan; Zhu, Qing; Zhao, Xiao-Ling; Yao, Yong-Gang; Liu, Yi-Ping

    2011-11-01

    The solute carrier family 27 (SLC27, also known as fatty acid transport proteins [FATPs]) plays important biological roles in cells. However, there is no report about the expression profile of SLC27 member in chicken. In this study, we quantified the expression of SLC27A1 (FATP1) mRNA in a mountainous black-boned chicken breed (MB) and a commercial meat type chicken breed (S01), to discern the tissue and age-related specific expression pattern and their potential involvement in fat deposition and muscle fatty acid metabolism. Real-time quantitative PCR assays were developed for accurate measurement of SLC27A1 mRNA levels in different tissues from chicken with different ages (0-12 weeks). Expression of SLC27A1 mRNA was detected in all tissues examined. There was a significantly age-related change of the SLC27A1 mRNAs in heart, breast muscle (BMW), leg muscle (LMW), liver, and abdominal fat (AF) tissues (P < 0.05). The breast muscle and leg muscle tissues had the highest expression of SLC27A1 mRNA than the other tissues from the same individual at 0, 2 and 4 weeks. The overall SLC27A1 mRNA level exhibited a "rise-decline" developmental change in all tissues except for breast muscle, subcutaneous fat, and brain. The S01 chicken had a higher expression of the SLC27A1 mRNA in breast muscle, subcutaneous fat, and heart tissues than the MB chicken. Our results showed that the expression of SLC27A1 mRNA in chicken tissues exhibits specific developmental changes and age-related patterns.

  20. The SLC4A1 gene is under differential selective pressure in primates infected by Plasmodium falciparum and related parasites.

    PubMed

    Steiper, Michael E; Walsh, Fiona; Zichello, Julia M

    2012-07-01

    Malaria is a disease caused by Plasmodium parasites and is responsible for high mortality in humans. This disease is caused by four different species of Plasmodium though the main source of mortality is Plasmodium falciparum. Humans have a number of genetic adaptations that act to combat Plasmodium. One adaptation is a deletion in the SLC4A1 gene that leads to Southeast Asian ovalocytosis (SAO). There is evidence that SAO erythrocytes are resistant to multiple Plasmodium species. Here we analyze SLC4A1 in 23 primates and mammals to test for differential selective pressures among different primate lineages. Because primates are infected with both human Plasmodium parasites and their relatives, this analysis can be used to test which human Plasmodium parasite is the likely target of SAO. A significantly different pattern of molecular evolution was found in humans and African apes, species that are infected by P. falciparum and its relatives. This effect was restricted to the cytosolic domain of the SLC4A1 gene. The evidence is consistent with a different selective regime operating on this gene domain in humans and African apes, when compared to other primates and mammals. Alternatively, this pattern is consistent with a relaxation of selection or weak adaptive evolution operating on a small number of amino acids. The adaptive interpretation of the results is consistent with the SAO allele of the SLC4A1 gene interacting with P. falciparum in humans, rather than other Plasmodium parasites. However, additional investigation of the relationship between SLC4A1 variants and Plasmodium in humans and African apes is required to test whether the different selective regime in humans and African apes is due to natural selection or relaxed constraint. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Sequence variants in COL4A1 and COL4A2 genes in Ecuadorian families with keratoconus

    PubMed Central

    Karolak, Justyna A.; Kulinska, Karolina; Nowak, Dorota M.; Pitarque, Jose A.; Molinari, Andrea; Rydzanicz, Malgorzata; Bejjani, Bassem A.

    2011-01-01

    Purpose Keratoconus (KTCN) is a non-inflammatory, usually bilateral disorder of the eye which results in the conical shape and the progressive thinning of the cornea. Several studies have suggested that genetic factors play a role in the etiology of the disease. Several loci were previously described as possible candidate regions for familial KTCN; however, no causative mutations in any genes have been identified for any of these loci. The purpose of this study was to evaluate role of the collagen genes collagen type IV, alpha-1 (COL4A1) and collagen type IV, alpha-2 (COL4A2) in KTCN in Ecuadorian families. Methods COL4A1 and COL4A2 in 15 Ecuadorian KTCN families were examined with polymerase chain reaction amplification, and direct sequencing of all exons, promoter and intron-exon junctions was performed. Results Screening of COL4A1 and COL4A2 revealed numerous alterations in coding and non-coding regions of both genes. We detected three missense substitutions in COL4A1: c.19G>C (Val7Leu), c.1663A>C (Thr555Pro), and c.4002A>C (Gln1334His). Five non-synonymous variants were identified in COL4A2: c.574G>T (Val192Phe), c.1550G>A (Arg517Lys), c.2048G>C (Gly683Ala), c.2102A>G (Lys701Arg), and c.2152C>T (Pro718Ser). None of the identified sequence variants completely segregated with the affected phenotype. The Gln1334His variant was possibly damaging to protein function and structure. Conclusions This is the first mutation screening of COL4A1 and COL4A2 genes in families with KTCN and linkage to a locus close to these genes. Analysis of COL4A1 and COL4A2 revealed no mutations indicating that other genes are involved in KTCN causation in Ecuadorian families. PMID:21527998

  2. Regulation of CYP1A1 gene expression by the antioxidant tert-butylhydroquinone.

    PubMed

    Schreiber, Thomas D; Köhle, Christoph; Buckler, Felicitas; Schmohl, Stefan; Braeuning, Albert; Schmiechen, Alexander; Schwarz, Michael; Münzel, Peter A

    2006-07-01

    CYP1A1, a major phase I enzyme, plays an important role in the metabolism of polycyclic aromatic hydrocarbons and in the chemical activation of xenobiotics to carcinogenic derivatives. The phenolic antioxidant tert-butylhydroquinone (tBHQ), often used as a food preservative, is generally considered to act only as a mono-functional inducer of phase II enzymes, thereby exerting chemo-protection. However, we recently observed that tBHQ elevated the activity of an aryl hydrocarbon receptor (AhR) response element (DRE)-driven luciferase reporter in human colon carcinoma cells (Caco-2). Therefore, we studied the effects of tBHQ on the activity of a DRE-driven reporter, CYP1A1 mRNA expression, and CYP1A enzyme activity in Caco-2 cells and human HepG2 hepatoma cells. We found tBHQ caused induction of reporter activity and CYP1A1 expression and activity in Caco-2 and HepG2 cells. Moreover, tBHQ combined with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) increased reporter activity and mRNA expression in Caco-2 cells in an additive manner. By contrast, tBHQ decreased TCDD-mediated induction of reporter activity and CYP1A1 mRNA expression in HepG2 cells. Resveratrol, an AhR antagonist, repressed the induction of CYP1A1 by tBHQ. Cotransfection of HepG2 cells with a dominant negative AhR nuclear translocator mutant abolished the tBHQ-induced CYP1A1 reporter activity. These findings indicate that CYP1A1 may be induced by the antioxidant tBHQ via an AhR-dependent mechanism.

  3. Intergenic Sequence between Arabidopsis Caseinolytic Protease B-Cytoplasmic/Heat Shock Protein100 and Choline Kinase Genes Functions as a Heat-Inducible Bidirectional Promoter1[C][W][OPEN

    PubMed Central

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-01-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position −517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. PMID:25281707

  4. Identification and characterization of a novel heat shock transcription factor gene, GmHsfA1, in soybeans (Glycine max).

    PubMed

    Zhu, Baoge; Ye, Chunjiang; Lü, Huiying; Chen, Xiaojun; Chai, Guohua; Chen, Jiannan; Wang, Chao

    2006-05-01

    Plants have a large family of HSFs with different roles in the heat shock response that mediate the expression of HSP regulated genes. The HSF encoding genes are easily identified by their highly conserved modular structure and motifs. In the present study, a putative GmHsfA1 was identified and characterized from the soybean expressed sequence tag (EST) database by sequence comparison with the functionally well-characterized LpHsfA1 and rapid amplification of cDNA ends (RACE). Multiple alignment showed that the amino acid sequence of GmHSFA1, matching best with LpHSFA1 (52.2% similarity), was obviously different from that of each of several HSFA1s from other plant species. The GmHsfA1 has a constitutive expression profile in the different tissues examined. The overexpression of GmHsfA1 in transgenic soybean plants led to the activation of GmHsp70 under normal temperature and the overexpression of GmHsp70 under high temperature. Furthermore, transgenic soybean plants with GmHsfA1 overexpression showed obvious enhancement of thermotolerance under heat stress in comparison with non-transgenic plants. The experimental results suggested that GmHSFA1 is a novel and functional heat-shock transcription factor.

  5. Association of the candidate gene SLC1A1 and obsessive-compulsive disorder in Han Chinese population.

    PubMed

    Wu, Haisu; Wang, Xuemei; Yu, Shunying; Wang, Dongxiang; Chen, Jianhua; Jiang, Kaida; Zhu, Liping; Xiao, Zeping; Fralick, Drew

    2013-10-30

    This case-control study enrolled 578 obsessive-compulsive disorder (OCD) patients and 649 controls and genotyped rs10491734, rs2228622, rs301430 and rs301443 to replicate association of the SLC1A1 gene with OCD in ethnic Han Chinese. The G-A-C-G and G-G-T-C haplotypes were found to be significantly associated with OCD in overall samples, male samples and female samples.

  6. Association of ATP-Binding Cassette Transporter A1 Gene Polymorphisms in Type 2 Diabetes Mellitus among Malaysians.

    PubMed

    Haghvirdizadeh, Polin; Ramachandran, Vasudevan; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian; Ismail, Patimah

    2015-01-01

    Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K), rs1800977 (C69T), and rs9282541 (R230C) polymorphisms Malaysian subjects. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG (P < 0.05). There was a significant association between HOM of R219K (P = 0.005), among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K (P = 0.003). But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians.

  7. Association of ATP-Binding Cassette Transporter A1 Gene Polymorphisms in Type 2 Diabetes Mellitus among Malaysians

    PubMed Central

    Haghvirdizadeh, Polin; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian

    2015-01-01

    Background. Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K), rs1800977 (C69T), and rs9282541 (R230C) polymorphisms Malaysian subjects. Methods. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. Results. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG (P < 0.05). There was a significant association between HOM of R219K (P = 0.005), among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K (P = 0.003). But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. Conclusion. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians. PMID:26451383

  8. Novel Insights into 46,XY Disorders of Sex Development due to NR5A1 Gene Mutation.

    PubMed

    Werner, Ralf; Mönig, Isabel; August, Julia; Freiberg, Clemens; Lünstedt, Ralf; Reiz, Benedikt; Wünsch, Lutz; Holterhus, Paul-Martin; Kulle, Alexandra; Döhnert, Ulla; Wudy, Stefan A; Richter-Unruh, Annette; Thorns, Christoph; Hiort, Olaf

    2015-01-01

    The differential diagnosis of 46,XY disorders of sex development (DSD) is based on the distinction between forms of gonadal dysgenesis and disorders of androgen biosynthesis and action. However, clinical and endocrine evaluations are often not conclusive. Here, we describe an adolescent female with hirsutism and hyperandrogenization at puberty. Her karyotype was 46,XY, and clinical investigation demonstrated clitoromegaly, but no uterine remnants were detected. Histology of the gonads revealed a testicular structure with a Sertoli-cell-only pattern. Endocrine evaluation showed hypergonadotropic hypogonadism, and the Sertoli cell markers inhibin B and anti-Müllerian hormone were also low. Several molecular genetic studies were initiated. While analyses of the androgen receptor gene, the SRD5A2 gene and HSD17B3 gene were uninformative, a novel p.L230R mutation was found in the NR5A1 gene. A mutant construct proved a severe dysfunction of this variant in functional analysis after recreation and transfection into HeLa cells. We conclude that the NR5A1 p.L230R mutation most likely leads to a spatial and time-dependent Leydig cell and Sertoli cell dysfunction during development not causing the classical gonadal dysgenesis phenotype. This case demonstrates that the current classification should be updated to encompass the overlapping phenotypes of some genetic conditions within 46,XY DSD.

  9. Efficacy of protease inhibitor from marine Streptomyces sp. VITBVK2 against Leishmania donovani - An in vitro study.

    PubMed

    Sreedharan, Veena; Bhaskara Rao, K V

    2017-03-01

    In the present study the leishmanicidal effect of potential protease inhibitor producing marine actinobacterial isolate has been investigated against Leishmania donovani, the causative agent of visceral leishmaniasis. Among 89 marine actinobacteria isolated from a salt pan in Kanyakumari, only one isolate (BVK2) showed 97% of protease inhibition activity against trypsin. Moderate to high protease inhibitor activity was shown by isolate BVK2 on proteinase (30%) and chymotrypsin (85%). In optimization study for protease inhibitor production glucose as carbon source and casein as nitrogen source showed the best activity. In the in-vitro Fluorescence-activated cell sorting (FACS) assay, 100 μg/ml of BVK2 extract was active against amastigotes in infected J774A.1 macrophages and showed 87% of parasitic inhibition. The isolate BVK2 showed significant anti-parasitic activity with an IC50 of 27.1 μg/ml after double doses were administered. The potential isolate was identified by molecular 16S rRNA gene sequencing as Streptomyces sp. VITBVK2. The results obtained suggest that the marine actinobacterial extract which have novel metabolites can be considered as a potential source for the development of drugs.

  10. Ubiquitin-specific protease (USP26) gene alterations associated with male infertility and recurrent pregnancy loss (RPL) in Iranian infertile patients.

    PubMed

    Asadpor, U; Totonchi, M; Sabbaghian, M; Hoseinifar, H; Akhound, M R; Zari Moradi, Sh; Haratian, K; Sadighi Gilani, M A; Gourabi, H; Mohseni Meybodi, A

    2013-07-01

    The human X chromosome is enriched with testis-specific genes that may be crucial for male fertility. Mutations in USP26 gene have been proposed to be associated with male infertility. Moreover, the importance of the ubiquitin pathway during different stages of mammalian fertilization and even embryo development has been addressed. Some mutations and haplotypes on this gene have been proposed to be associated with male infertility. In this study, five different mutations on USP26 were investigated: 1737 G > A, 1090 C > T, 370-371ins ACA, 494 T > C and 1423 C > T. The study included 166 infertile men with non-obstructive azoospermia, 72 male partners of couples who had previously experienced ≥3 clinical first trimester spontaneous abortions and 60 fertile men. Besides family history of reproduction, hormonal evaluation and semen analysis were performed. DNA was extracted from blood samples. PCR-SSCP, PCR-RFLP and PCR Product Cloning methods were used and resumed by sequencing to insure about the mutations. Moreover, USP26 gene expression was studied by Real-Time PCR after RNA extraction followed by cDNA synthesis from 24 testis biopsies in obstructive and non-obstructive azoospermia patients. The results indicate that there is a haplotype between three observed mutations in Iranian population include: 370-371insACA, 1423C > T and 494 T > C. This haplotype was seen in control group as well. Surprisingly, total frequency of mutations in men with history of idiopathic RPL and azoospermic cases were significantly higher than that of in control groups (p < 0.05). Serum testosterone concentrations and testicular volume did not differ in the mutation positive group compared with the non-mutation group. About the USP26 gene expression, there is a significant difference between the expression levels of obstructive azoospermia, complete maturation arrest samples and SCO samples (P < 0.05). According to our results, the USP26 gene may play

  11. Polymorphic variation of CYP1A1 and CYP1B1 genes in a Haryana population.

    PubMed

    Giri, Shiv Kumar; Yadav, Anita; Kumar, Anil; Dev, Kapil; Gulati, Sachin; Gupta, Ranjan; Aggarwal, Neeraj; Gautam, Sanjeev Kumar

    2013-12-01

    Cytochrome P450 (CYP) 1A1 and CYP1B1 are important phase I xenobiotic metabolizing enzymes involved in the metabolism of numbers of toxins, endogenous hormones, and pharmaceutical drugs. Polymorphisms in these phase I genes can alter enzyme activity and are known to be associated with cancer susceptibility related to environmental toxins and hormone exposure. Their genotypes may also display ethnicity-dependent population frequencies. The present study was aimed to determine the frequencies of commonly known functional polymorphisms of CYP1A1 and CYP1B1 genes in a Haryana state population of North India. The allelic frequency of CYP1A1 polymorphism m1 (MspI) was 29.65% and m2 (Ile(462)Val) was 24.85%. The frequency of CYP1B1 polymorphism m1 (Val(432)Leu) was 45.85% and m2 (Asn(453)Ser) was 16.2%. We observed inter- and intra-ethnic variation in the frequency distribution of these polymorphisms. Analysis of polymorphisms in these genes might help in predicting the risk of cancer. Our results emphasize the need for more such studies in high-risk populations.

  12. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  13. Population structure of Banana bract mosaic virus reveals recombination and negative selection in the helper component protease (HC-Pro) gene.

    PubMed

    Balasubramanian, V; Sukanya, R S; Anuradha, C; Selvarajan, R

    2014-12-01

    Banana bract mosaic virus (BBrMV) is a serious constraint in the production of banana and plantain in India. In this study, we have cloned, sequenced and analyzed the helper component proteinase (HC-Pro) gene of 22 isolates from India and compared with previously reported BBrMV isolates. Sequence identity of BBrMV isolates encoding HC-Pro gene, were 92-100 % both at the nucleotide (nt) and amino acid level. Phylogenetic analysis based on nt sequences of non recombinant isolates showed that TN15, TN9 and TN24 formed one cluster and all the remaining isolates formed into another cluster. Different functional motifs in the central region of HC-Pro gene of BBrMV isolates were found conserved. Four potential recombinants with a total of 15 breakpoints were mostly observed at the N and a few from C terminal regions. The codon based selection analysis revealed that most of the codons were under purifying or negative selection except a codon at position 74 which was under positive selection. It is likely that recombination identified in Indian BBrMV isolates, along with strong purifying selection, enhances the speed of elimination of deleterious mutations in the HC-Pro gene. This study suggested that negative selection and recombination were important evolutionary factors driving the genetic diversification and population structure of Indian BBrMV isolates. To the best of our knowledge, this is the first report on the diversity analysis and occurrence of recombination in the HC-Pro gene of BBrMV.

  14. Overexpression of the Ubiquitin-Specific Protease 7 Resulting from Transfection or Mutations in the ICP0 Binding Site Accelerates Rather than Depresses Herpes Simplex Virus 1 Gene Expression

    PubMed Central

    Kalamvoki, Maria; Gu, Haidong

    2012-01-01

    Earlier studies reported that ICP0, a key regulatory protein encoded by herpes simplex virus 1 (HSV-1), binds ubiquitin-specific protease 7 (USP7). The fundamental conclusion of these studies is that depletion of USP7 destabilized ICP0, that ICP0 mediated the degradation of USP7, and that amino acid substitutions in ICP0 that abolished binding to USP7 significantly impaired the ability of HSV-1 to replicate. We show here that, indeed, depletion of USP7 leads to reduction of ICP0 and that USP7 is degraded in an ICP0-dependent manner. However, overexpression of USP7 or substitution in ICP0 of a single amino acid to abolish binding to USP7 accelerated the accumulation of viral mRNAs and proteins at early times after infection and had no deleterious effect on virus yields. A clue as to why USP7 is degraded emerged from the observation that, notwithstanding the accelerated expression of viral genes, the plaques formed by the mutant virus were very small, implying a defect in virus transmission from cell to cell. PMID:22993145

  15. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  16. A specific collagen type II gene (COL2A1) mutation presenting as spondyloperipheral dysplasia

    SciTech Connect

    Zabel, B.; Hilbert, K.; Spranger, J.; Winterpacht, A.; Stoeb, H.; Superti-Furga, A.

    1996-05-03

    We report on a patient with a skeletal dysplasia characterized by short stature, spondylo-epiphyseal involvement, and brachydactyly E-like changes. This condition has been described as spondyloperipheral dysplasia and the few published cases suggest autosomal dominant inheritance with considerable clinical variability. We found our sporadic case to be due to a collagen type II defect resulting from a specific COL2A1 mutation. This mutation is the first to be located at the C-terminal outside the helical domain of COL2A1. A frameshift as consequence of a 5 bp duplication in exon 51 leads to a stop codon. The resulting truncated C-propeptide region seems to affect helix formation and produces changes of chondrocyte morphology, collagen type II fibril structure and cartilage matrix composition. Our case with its distinct phenotype adds another chondrodysplasia to the clinical spectrum of type II collagenopathies. 16 refs., 4 figs.

  17. [Relationship between CYP1A1 gene polymorphisms and urinary 1-hydroxypyrene levels in coke oven workers].

    PubMed

    Nie, Ji-sheng; Zhang, Hong-mei; Sun, Jian-ya; Zeng, Ping; Zhang, Ling; Niu, Qiao

    2009-05-01

    To study the associations of CYP1A1 gene polymorphisms with levels of urinary 1-hydroxypyrene among coke oven workers. 223 male workers from a coke plant (76, 82 and 65 workers in oven top group, oven-side group and oven-bottom group respectively) and 119 controls without occupational polycyclic aromatic hydrocarbons exposure were selected. The MspI gene polymorphism in CYP1A1 3' flanking region and the genotypes at I462V site in exon 7 of CYP1A1 were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific amplification (ASA). The urinary 1-hydroxypyrene of coke oven workers in oven-top, oven-side and oven-bottom (3.77+/-0.64, 3.57+/-0.49, 3.26+/-0.80 micromol/mol Cr) were significantly higher than controls (2.80+/-1.02 micromol/mol Cr) (P<0.01). The urinary 1-hydroxypyrene was not significantly different among MspI genotypes in CYP1A1 3' flanking region (P>0.05). In oven-top group and oven-side group, the subjects with Val/Val genotype in exon 7 of CYP1A1 had significantly higher urinary 1-hydroxypyrene levels than those with Ile/Val or Ile/Ile genotype, and urinary 1-hydroxypyrene of Ile-Val genotype were also significantly higher than Ile/Ile genotype (P<0.01). Multivariate logistic regression analysis showed that the coke oven workers (OR in oven top group, oven-side group and oven-bottom group was 24.926, 4.226 and 6.729 respectively) and subjects with m2/m2 genotype in CYP1A1 3' flanking region (OR=4.031) or with Val/Val or Ile/Val genotype in exon 7 of CYP1A1 (OR were 5.524 and 3.811) had elevated urinary 1-hydroxypyrene (greater than 95 percentile of control group, 3.876 micromol/mol Cr). BAP concentration of work environment contributes to the elevated urinary 1-hydroxypyrene levels, and the exposed BAP levels were regulated by the CYP1A1 MspI and I462V genotypes. Genetic polymorphism of CYP1A1 gene could be a susceptible biomarker in coke oven workers which was involved in the individual susceptibility

  18. Knockdown of col22a1 gene in zebrafish induces a muscular dystrophy by disruption of the myotendinous junction.

    PubMed

    Charvet, Benjamin; Guiraud, Alexandre; Malbouyres, Marilyne; Zwolanek, Daniela; Guillon, Emilie; Bretaud, Sandrine; Monnot, Catherine; Schulze, Jörg; Bader, Hannah L; Allard, Bruno; Koch, Manuel; Ruggiero, Florence

    2013-11-01

    The myotendinous junction (MTJ) is the major site of force transfer in skeletal muscle, and defects in its structure correlate with a subset of muscular dystrophies. Col22a1 encodes the MTJ component collagen XXII, the function of which remains unknown. Here, we have cloned and characterized the zebrafish col22a1 gene and conducted morpholino-based loss-of-function studies in developing embryos. We showed that col22a1 transcripts localize at muscle ends when the MTJ forms and that COLXXII protein integrates the junctional extracellular matrix. Knockdown of COLXXII expression resulted in muscular dystrophy-like phenotype, including swimming impairment, curvature of embryo trunk/tail, strong reduction of twitch-contraction amplitude and contraction-induced muscle fiber detachment, and provoked significant activation of the survival factor Akt. Electron microscopy and immunofluorescence studies revealed that absence of COLXXII caused a strong reduction of MTJ folds and defects in myoseptal structure. These defects resulted in reduced contractile force and susceptibility of junctional extracellular matrix to rupture when subjected to repeated mechanical stress. Co-injection of sub-phenotypic doses of morpholinos against col22a1 and genes of the major muscle linkage systems showed a synergistic gene interaction between col22a1 and itga7 (α7β1 integrin) that was not observed with dag1 (dystroglycan). Finally, pertinent to a conserved role in humans, the dystrophic phenotype was rescued by microinjection of recombinant human COLXXII. Our findings indicate that COLXXII contributes to the stabilization of myotendinous junctions and strengthens skeletal muscle attachments during contractile activity.

  19. Correlative study of peripheral ATP1A1 gene expression level to anxiety severity score on major depressive disorder patients.

    PubMed

    Zhao, Jingjie; Guo, Xu; Du, Yi; Han, Yu; Wang, Yongzhi; Li, Li; Qian, Jialin; Li, Mingzhen; Wu, Huijuan; Golden, Teresa; Wu, Ning

    2016-11-01

    Major depressive disorder (MDD) frequently co-occurs with other psychiatric problems. Our previous study showed that ATP1A1 gene expression level was significantly decreased in MDD patients. This research explores the potential correlations between the ATP1A1 expression level reduction and MDD patients' clinical manifestation. All participant patients were diagnosed by Diagnostic and Statistical Manual of Mental Disorders - 4th edition (DSM-IV). Hamilton rating scale for depression (HAM-D) and anxiety (HAM-A) were applied to group patients into different categories. ATP1A1 expression level was measured by reverse transcript real-time polymerase chain reaction. ATP1A1 expression levels of all MDD subgroups showed significant reduction compared to the control group (p<0.01). Further, the trend of ATP1A1 expression level reduction is significantly related to MDD patients' HAM-A scores (p<0.01). However, there was no significance between ATP1A1 level and HAM-D scores (p>0.05). ATP1A1 expression level reduction is related to MDD anxiety score, which may be an explanation for the clinical manifestations and the underlining physiological mechanisms.

  20. OCD candidate gene SLC1A1/EAAT3 impacts basal ganglia-mediated activity and stereotypic behavior.

    PubMed

    Zike, Isaac D; Chohan, Muhammad O; Kopelman, Jared M; Krasnow, Emily N; Flicker, Daniel; Nautiyal, Katherine M; Bubser, Michael; Kellendonk, Christoph; Jones, Carrie K; Stanwood, Gregg; Tanaka, Kenji Fransis; Moore, Holly; Ahmari, Susanne E; Veenstra-VanderWeele, Jeremy

    2017-05-30

    Obsessive-compulsive disorder (OCD) is a chronic, disabling condition with inadequate treatment options that leave most patients with substantial residual symptoms. Structural, neurochemical, and behavioral findings point to a significant role for basal ganglia circuits and for the glutamate system in OCD. Genetic linkage and association studies in OCD point to SLC1A1, which encodes the neuronal glutamate/aspartate/cysteine transporter excitatory amino acid transporter 3 (EAAT3)/excitatory amino acid transporter 1 (EAAC1). However, no previous studies have investigated EAAT3 in basal ganglia circuits or in relation to OCD-related behavior. Here, we report a model of Slc1a1 loss based on an excisable STOP cassette that yields successful ablation of EAAT3 expression and function. Using amphetamine as a probe, we found that EAAT3 loss prevents expected increases in (i) locomotor activity, (ii) stereotypy, and (iii) immediate early gene induction in the dorsal striatum following amphetamine administration. Further, Slc1a1-STOP mice showed diminished grooming in an SKF-38393 challenge experiment, a pharmacologic model of OCD-like grooming behavior. This reduced grooming is accompanied by reduced dopamine D1 receptor binding in the dorsal striatum of Slc1a1-STOP mice. Slc1a1-STOP mice also exhibit reduced extracellular dopamine concentrations in the dorsal striatum both at baseline and following amphetamine challenge. Viral-mediated restoration of Slc1a1/EAAT3 expression in the midbrain but not in the striatum results in partial rescue of amphetamine-induced locomotion and stereotypy in Slc1a1-STOP mice, consistent with an impact of EAAT3 loss on presynaptic dopaminergic function. Collectively, these findings indicate that the most consistently associated OCD candidate gene impacts basal ganglia-dependent repetitive behaviors.

  1. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  2. Proteases in gastrointestinal neoplastic diseases.

    PubMed

    Herszényi, L; Plebani, M; Carraro, P; De Paoli, M; Roveroni, G; Cardin, R; Foschia, F; Tulassay, Z; Naccarato, R; Farinati, F

    2000-02-15

    Cysteine and serine proteases are involved in cancer invasion and metastasis. In the past few years we investigated the tissue levels of these proteases in gastric cancer (GC), gastric precancerous changes (CAG), colorectal cancer (CRC) and the plasma and serum levels of proteases in several gastrointestinal tumours, using ELISA methods. Significantly higher antigen levels were found not only in GC tissue but also in CAG with respect to the levels found normal tissue; with respect to CAG, patients with dysplasia had higher levels than patients without dysplasia. The same findings were obtained in CRC. In general protease levels correlated with the major histomorphological parameters, such as grading and histotype in GC as well as in CRC. Tissue protease levels had a strong prognostic impact in GC, in which UPA was singled out by multivariate analysis as the major prognostic factor, and CRC. The plasma levels of urokinase-type plasminogen activator (UPA) and the serum levels of cathepsin B were significantly increased in patients with gastrointestinal tumours. In conclusions, cysteine and serine proteases may have a part not only in GC and CRC invasion and metastasis, but also in the progression of gastric precancerous changes into cancer. They are strong prognostic factors in GC and CRC. These proteases may also have a role as tumour markers in the early diagnosis of gastrointestinal tract tumours.

  3. Further characterization of a highly attenuated Yersinia pestis CO92 mutant deleted for the genes encoding Braun lipoprotein and plasminogen activator protease in murine alveolar and primary human macrophages.

    PubMed

    van Lier, Christina J; Tiner, Bethany L; Chauhan, Sadhana; Motin, Vladimir L; Fitts, Eric C; Huante, Matthew B; Endsley, Janice J; Ponnusamy, Duraisamy; Sha, Jian; Chopra, Ashok K

    2015-03-01

    We recently characterized the Δlpp Δpla double in-frame deletion mutant of Yersinia pestis CO92 molecularly, biologically, and immunologically. While Braun lipoprotein (Lpp) activates toll-like receptor-2 to initiate an inflammatory cascade, plasminogen activator (Pla) protease facilitates bacterial dissemination in the host. The Δlpp Δpla double mutant was highly attenuated in evoking bubonic and pneumonic plague, was rapidly cleared from mouse organs, and generated humoral and cell-mediated immune responses to provide subsequent protection to mice against a lethal challenge dose of wild-type (WT) CO92. Here, we further characterized the Δlpp Δpla double mutant in two murine macrophage cell lines as well as in primary human monocyte-derived macrophages to gauge its potential as a live-attenuated vaccine candidate. We first demonstrated that the Δpla single and the Δlpp Δpla double mutant were unable to survive efficiently in murine and human macrophages, unlike WT CO92. We observed that the levels of Pla and its associated protease activity were not affected in the Δlpp single mutant, and, likewise, deletion of the pla gene from WT CO92 did not alter Lpp levels. Further, our study revealed that both Lpp and Pla contributed to the intracellular survival of WT CO92 via different mechanisms. Importantly, the ability of the Δlpp Δpla double mutant to be phagocytized by macrophages, to stimulate production of tumor necrosis factor-α and interleukin-6, and to activate the nitric oxide killing pathways of the host cells remained unaltered when compared to the WT CO92-infected macrophages. Finally, macrophages infected with either the WT CO92 or the Δlpp Δpla double mutant were equally efficient in their uptake of zymosan particles as determined by flow cytometric analysis. Overall, our data indicated that although the Δlpp Δpla double mutant of Y. pestis CO92 was highly attenuated, it retained the ability to elicit innate and subsequent acquired immune

  4. Polymorphisms in the cytochrome P450 genes CYP1A2, CYP1B1, CYP3A4, CYP3A5, CYP11A1, CYP17A1, CYP19A1 and colorectal cancer risk

    PubMed Central

    Bethke, Lara; Webb, Emily; Sellick, Gabrielle; Rudd, Matthew; Penegar, Stephen; Withey, Laura; Qureshi, Mobshra; Houlston, Richard

    2007-01-01

    Background Cytochrome P450 (CYP) enzymes have the potential to affect colorectal cancer (CRC) risk by determining the genotoxic impact of exogenous carcinogens and levels of sex hormones. Methods To investigate if common variants of CYP1A2, CYP1B1, CYP3A4, CYP3A5, CYP11A1, CYP17A1 and CYP19A1 influence CRC risk we genotyped 2,575 CRC cases and 2,707 controls for 20 single nucleotide polymorphisms (SNPs) that have not previously been shown to have functional consequence within these genes. Results There was a suggestion of increased risk, albeit insignificant after correction for multiple testing, of CRC for individuals homozygous for CYP1B1 rs162558 and heterozygous for CYP1A2 rs2069522 (odds ratio [OR] = 1.36, 95% confidence interval [CI]: 1.03–1.80 and OR = 1.34, 95% CI: 1.00–1.79 respectively). Conclusion This study provides some support for polymorphic variation in CYP1A2 and CYP1B1 playing a role in CRC susceptibility. PMID:17615053

  5. GWAS for serum galactose-deficient IgA1 implicates critical genes of the O-glycosylation pathway

    PubMed Central

    Kiryluk, Krzysztof; Moldoveanu, Zina; Suzuki, Hitoshi; Reily, Colin; Hou, Ping; Xie, Jingyuan; Mladkova, Nikol; Prakash, Sindhuri; Fischman, Clara; Shapiro, Samantha; Bradbury, Drew; Ionita-Laza, Iuliana; Eitner, Frank; Rauen, Thomas; Maillard, Nicolas; Floege, Jürgen; Chen, Nan; Zhang, Hong; Scolari, Francesco; Wyatt, Robert J.; Julian, Bruce A.; Gharavi, Ali G.; Novak, Jan

    2017-01-01

    Aberrant O-glycosylation of serum immunoglobulin A1 (IgA1) represents a heritable pathogenic defect in IgA nephropathy, the most common form of glomerulonephritis worldwide, but specific genetic factors involved in its determination are not known. We performed a quantitative GWAS for serum levels of galactose-deficient IgA1 (Gd-IgA1) in 2,633 subjects of European and East Asian ancestry and discovered two genome-wide significant loci, in C1GALT1 (rs13226913, P = 3.2 x 10−11) and C1GALT1C1 (rs5910940, P = 2.7 x 10−8). These genes encode molecular partners essential for enzymatic O-glycosylation of IgA1. We demonstrated that these two loci explain approximately 7% of variability in circulating Gd-IgA1 in Europeans, but only 2% in East Asians. Notably, the Gd-IgA1-increasing allele of rs13226913 is common in Europeans, but rare in East Asians. Moreover, rs13226913 represents a strong cis-eQTL for C1GALT1 that encodes the key enzyme responsible for the transfer of galactose to O-linked glycans on IgA1. By in vitro siRNA knock-down studies, we confirmed that mRNA levels of both C1GALT1 and C1GALT1C1 determine the rate of secretion of Gd-IgA1 in IgA1-producing cells. Our findings provide novel insights into the genetic regulation of O-glycosylation and are relevant not only to IgA nephropathy, but also to other complex traits associated with O-glycosylation defects, including inflammatory bowel disease, hematologic disease, and cancer. PMID:28187132

  6. A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

    SciTech Connect

    Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko; Ishikawa, Osamu; Motegi, Sei-ichiro

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primers from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.

  7. GWAS for serum galactose-deficient IgA1 implicates critical genes of the O-glycosylation pathway.

    PubMed

    Kiryluk, Krzysztof; Li, Yifu; Moldoveanu, Zina; Suzuki, Hitoshi; Reily, Colin; Hou, Ping; Xie, Jingyuan; Mladkova, Nikol; Prakash, Sindhuri; Fischman, Clara; Shapiro, Samantha; LeDesma, Robert A; Bradbury, Drew; Ionita-Laza, Iuliana; Eitner, Frank; Rauen, Thomas; Maillard, Nicolas; Berthoux, Francois; Floege, Jürgen; Chen, Nan; Zhang, Hong; Scolari, Francesco; Wyatt, Robert J; Julian, Bruce A; Gharavi, Ali G; Novak, Jan

    2017-02-01

    Aberrant O-glycosylation of serum immunoglobulin A1 (IgA1) represents a heritable pathogenic defect in IgA nephropathy, the most common form of glomerulonephritis worldwide, but specific genetic factors involved in its determination are not known. We performed a quantitative GWAS for serum levels of galactose-deficient IgA1 (Gd-IgA1) in 2,633 subjects of European and East Asian ancestry and discovered two genome-wide significant loci, in C1GALT1 (rs13226913, P = 3.2 x 10-11) and C1GALT1C1 (rs5910940, P = 2.7 x 10-8). These genes encode molecular partners essential for enzymatic O-glycosylation of IgA1. We demonstrated that these two loci explain approximately 7% of variability in circulating Gd-IgA1 in Europeans, but only 2% in East Asians. Notably, the Gd-IgA1-increasing allele of rs13226913 is common in Europeans, but rare in East Asians. Moreover, rs13226913 represents a strong cis-eQTL for C1GALT1 that encodes the key enzyme responsible for the transfer of galactose to O-linked glycans on IgA1. By in vitro siRNA knock-down studies, we confirmed that mRNA levels of both C1GALT1 and C1GALT1C1 determine the rate of secretion of Gd-IgA1 in IgA1-producing cells. Our findings provide novel insights into the genetic regulation of O-glycosylation and are relevant not only to IgA nephropathy, but also to other complex traits associated with O-glycosylation defects, including inflammatory bowel disease, hematologic disease, and cancer.

  8. Functional role and tobacco smoking effects on methylation of CYP1A1 gene in prostate cancer

    PubMed Central

    Kato, Taku; Hashimoto, Yutaka; Yamamura, Soichiro; Fukuhara, Shinichiro; Wong, Darryn K.; Shiina, Marisa; Imai-Sumida, Mitsuho; Majid, Shahana; Saini, Sharanjot; Shiina, Hiroaki; Nakajima, Koichi; Deng, Guoren; Dahiya, Rajvir; Tanaka, Yuichiro

    2016-01-01

    Cytochrome P450 (CYP) 1A1 is a phase I enzyme that can activate various compounds into reactive forms and thus, may contribute to carcinogenesis. In this study, we investigated the expression, methylation status, and functional role of CYP1A1 on prostate cancer cells. Increased expression of CYP1A1 was observed in all cancer lines (PC-3, LNCaP, and DU145) compared to BPH-1 (P < 0.05); and was enhanced further by 5-aza-2′-deoxycytidine treatment (P < 0.01). Methylation-specific PCR (MSP) and sequencing of bisulfite-modified DNA of the xenobiotic response element (XRE) enhancer site XRE-1383 indicated promoter methylation as a regulator of CYP1A1 expression. In tissue, microarrays showed higher immunostaining of CYP1A1 in prostate cancer than normal and benign prostatic hyperplasia (BPH; P < 0.001), and methylation analyses in clinical specimens revealed significantly lower methylation levels in cancer compared to BPH at all enhancer sites analyzed (XRE-1383, XRE-983, XRE-895; P < 0.01). Interestingly, smoking affected the XRE-1383 site where the methylation level was much lower in cancer tissues from smokers than non-smokers (P < 0.05). CYP1A1 levels are thus increased in prostate cancer and to determine the functional effect of CYP1A1 on cells, we depleted the gene in LNCaP and DU145 by siRNA. We observe that CYP1A1 knockdown decreased cell proliferation (P < 0.05) and increased apoptosis (P < 0.01) in both cell lines. We analyzed genes affected by CYP1A1 silencing and found that apoptosis-related BCL2 was significantly down-regulated. This study supports an oncogenic role for CYP1A1 in prostate cancer via promoter hypomethylation that is influenced by tobacco smoking, indicating CYP1A1 to be a promising target for prostate cancer treatment. PMID:27203547

  9. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    PubMed

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  10. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  11. Eight mutations including 5 novel ones in the COL1A1 gene in Czech patients with osteogenesis imperfecta.

    PubMed

    Hruskova, Lucie; Fijalkowski, Igor; Van Hul, Wim; Marik, Ivo; Mortier, Geert; Martasek, Pavel; Mazura, Ivan

    2016-09-01

    Osteogenesis imperfecta (OI), also called brittle bone disease, is a clinically and genetically heterogeneous disorder characterized by decreased bone density. Autosomal dominant forms result from mutations in either the COL1A1 (collagen type I alpha-1 chain) or COL1A2 (collagen type I alpha-2 chain) genes encoding the type I collagen. The aim of this study was to identify mutations and allelic variants of the COL1A1 gene in patients with osteogenesis imperfecta (OI). Molecular genetic analysis of the COL1A1 gene was performed in a cohort of 34 patients with OI. The DNA samples were analysed by PCR and Sanger sequencing. DNA changes in coding sequences of the gene were compared with Type 1 Collagen Mutation Database. Genetic variants resulting in either quantitatively or structurally defective protein production were found in 6 unrelated patients. Four identified mutations are connected to decreased protein production (Tyr47X, Arg131X, Arg415X, Gln1341X), 2 result in amino acid substitution (Cys61Phe, Pro1186Ala) and the last affects splicing (c.1057-1G>T). Further, one silent mutation (Gly794Gly) was detected. No protein analysis was performed. Of the 8 identified mutations, 5 were novel and have not been reported before. Only one causes substitution of glycine located within the Gly-X-Y triplets in the triple helical domain. Two mutations are located in major ligand binding regions (MLBR) which are important for bone strength and flexibility. Although the genotype-phenotype correlation is still unclear, our findings should contribute to elucidating this relationship in patients diagnosed with OI.

  12. Association of vdr, cyp27b1, cyp24a1 and mthfr gene polymorphisms with oral lichen planus risk.

    PubMed

    Kujundzic, Bojan; Zeljic, Katarina; Supic, Gordana; Magic, Marko; Stanimirovic, Dragan; Ilic, Vesna; Jovanovic, Barbara; Magic, Zvonko

    2016-05-01

    The current study investigated the association between VDR EcoRV (rs4516035), FokI (rs2228570), ApaI (rs7975232) and TaqI (rs731236), CYP27B1 (rs4646536), CYP24A1 (rs2296241), and MTHFR (rs1801133) gene polymorphisms and risk of oral lichen planus (OLP) occurrence. The study group consisted of 65 oral lichen planus patients and 100 healthy blood donors in the control group. Single nucleotide polymorphisms were genotyped by real time PCR or PCR-restriction fragment length polymorphism (RFLP) method. Heterozygous as well as mutated genotype of vitamin D receptor (VDR) FokI (rs2228570) polymorphism was associated with increased oral lichen planus risk in comparison with wild type genotype (odds ratio (OR) = 3.877, p = 0.017, OR = 38.153, p = 0.001, respectively). A significantly decreased OLP risk was observed for heterozygous genotype of rs2296241 polymorphism in CYP24A1 gene compared with the wild type form (OR = 0.314, p = 0.012). VDR gene polymorphisms ApaI and TaqI were in linkage disequilibrium (D' = 0.71, r(2) = 0.22). Identified haplotype AT was associated with decreased OLP risk (OR = 0.592, p = 0.047). Our results highlight the possible important role of VDR FokI (rs2228570) and CYP24A1 rs2296241 gene polymorphisms for oral lichen planus susceptibility. Identification of new molecular biomarkers could potentially contribute to determination of individuals with OLP predisposition.

  13. Significant association between common polymorphisms in the aromatase gene CYP19A1 and bone mineral density in postmenopausal women.

    PubMed

    Mullin, B H; Carter, K W; Lewis, J R; Ingley, E; Wilson, S G; Prince, R L

    2011-12-01

    17β-Estradiol is important in maintaining bone structure, and regulation of its synthesis plays an important role in the development of postmenopausal osteoporosis. We and others have demonstrated associations between variation in the CYP19A1 gene (encoding aromatase) and areal bone mineral density (aBMD) phenotypes in women. In the present study 33 tag polymorphisms were genotyped across the CYP19A1 gene in a population of 1,185 Caucasian postmenopausal women to test the association between sequence variations, total DXA hip aBMD, and circulating 17β-estradiol levels. An in silico bioinformatics analysis was performed for single nucleotide polymorphisms (SNPs) associated with aBMD to identify putative functional effects, while linkage disequilibrium analysis of these SNPs was undertaken with previously published sequence variants. Five SNPs located in the central third of the gene were strongly associated with total-hip aBMD after adjustment for age (P = 0.006-0.013). A haplotype analysis of these five SNPs revealed an association between the haplotype C-G-G-G-C and increased aBMD (P = 0.008) and the haplotype A-A-A-A-A and a decreased aBMD (P = 0.021). The haplotype frequency was 9.0% for C-G-G-G-C and 15.4% for A-A-A-A-A, with the variation in mean total-hip aBMD explained by the haplotype analyses being 5% and 7%, respectively. None of these polymorphisms was significantly associated with circulating 17β-estradiol levels. In conclusion, common genetic variations within the CYP19A1 gene are significantly associated with aBMD in postmenopausal Caucasian women.

  14. Mesomelia-Synostoses Syndrome Results from Deletion of SULF1 and SLCO5A1 Genes at 8q13

    PubMed Central

    Isidor, Bertrand; Pichon, Olivier; Redon, Richard; Day-Salvatore, Debra; Hamel, Antoine; Siwicka, Karolina A.; Bitner-Glindzicz, Maria; Heymann, Dominique; Kjellén, Lena; Kraus, Cornelia; Leroy, Jules G.; Mortier, Geert R.; Rauch, Anita; Verloes, Alain; David, Albert; Le Caignec, Cédric

    2010-01-01

    Mesomelia-synostoses syndrome (MSS) or mesomelic dysplasia with acral synostoses Verloes-David-Pfeiffer type is a rare autosomal-dominant disorder characterized by mesomelic limb shortening, acral synostoses, and multiple congenital malformations. So far, five patients in four unrelated families have been reported worldwide with MMS. By using whole-genome oligonucleotide array CGH, we have identified an interstitial deletion at 8q13 in all patients. The deletions vary from 582 Kb to 738 Kb in size, but invariably encompass only two genes: SULF1, encoding the heparan sulfate 6-O-endosulfatase 1, and SLCO5A1, encoding the solute carrier organic anion transporter family member 5A1. SULF1 acts as a regulator of numerous growth factors in skeletal embryonic development whereas the function of SLCO5A1 is yet unknown. Breakpoint sequence analyses performed in two families showed nonrecurrent deletions. Real-time quantitative RT-PCR analysis showed the highest levels of SULF1 transcripts in human osteoblasts and cartilage whereas SLCO5A1 was highly expressed in human fetal and adult brain and heart. Our results strongly suggest that haploinsufficiency of SULF1 contributes to this mesomelic chondrodysplasia, highlighting the critical role of endosulfatase in human skeletal development. Codeletion of SULF1 and SLCO5A1—which does not result from a low-copy repeats (LCRs)-mediated recombination event in at least two families—was found in all patients, so we suggest that haploinsufficiency of SULF1 combined with haploinsufficiency of SLCO5A1 (or the altered expression of a neighboring gene through position effect) could be necessary in the pathogenesis of MSS. PMID:20602915

  15. Effect of Cyp27A1 gene dosage on atherosclerosis development in ApoE-knockout mice.

    PubMed

    Zurkinden, Line; Solcà, Curzio; Vögeli, Isabelle A; Vogt, Bruno; Ackermann, Daniel; Erickson, Sandra K; Frey, Felix J; Sviridov, Dmitri; Escher, Geneviève

    2014-03-01

    In humans, sterol 27-hydroxylase (CYP27A1) deficiency leads to cholesterol deposition in tendons and vasculature. Thus, in addition to its role in bile acid synthesis, where it converts cholesterol to 27-hydroxycholesterol (27-OHC), CYP27A1 may also be atheroprotective. Cyp27A1-deficient (Cyp27A1(-/-)) mice were crossed with apolipoprotein E (apoE)-deficient mice. Cyp27A1(+/+)/apoE(-/-) [ApoE-knockout (KO)], Cyp27A1(+/-)/apoE(-/-) heterozygous (het), and Cyp27A1(-/-)/apoE(-/-) [double-knockout (DKO)] mice were challenged with a Western diet (WD) for 3 and 6 mo. ApoE-KO mice fed a chow diet or a WD were used as the control. The severity of atherosclerosis in DKO mice was reduced 10-fold. Compared with the control, the DKO mice had no 27-OHC, total plasma cholesterol and low-density lipoprotein and very low density lipoprotein (LDL/VLDL) concentrations were reduced 2-fold, and HDL was elevated 2-fold. Expression of hepatic CYP7A1, CYP3A, and CYP8B1 were 5- to 10-fold higher. 3-Hydroxy-3-methyl-glutaryl-CoA reductase (HMGR) activity increased 4-fold. Fecal cholesterol was increased. In contrast, het mice fed a WD developed accelerated atherosclerosis and severe skin lesions, possibly because of reduced reverse cholesterol transport due to diminished 27-OHC production. CYP27A1 activity is involved in the control of cholesterol homeostasis and development of atherosclerosis with a distinct gene dose-dependent effect.

  16. [Analysis of association of Col1a1 gene alleles with the development of osteoporosis].

    PubMed

    Moskalenko, M V; Aseev, M V; Zazerskaia, I E; Kotova, S M; Ivashchenko, T E; Baranov, V S

    2002-12-01

    Allele frequencies of the G-->T polymorphism at the regulatory region of the Collal gene in the population of the northwestern Russia (control group) and in osteoporotic patients were estimated by the RFLP method based on PCR-mediated site-directed mutagenesis. Three patient groups with radiologically confirmed osteoporosis were examined. Group 1 consisted of 64 patients with severe osteoporosis complicated by fractures (SO); group 2 included 15 children with idiopathic osteoporosis (IO); group 3 consisted of 98 women with postmenopausal osteoporosis developed at the background of estradiol-deficiency state (PMO). The frequency of functionally defective allele s in the control group was 16.7%. It was statistically different from that in the SO patients (48.4%) (P < 0.01) and in the IO children (40%) (P < 0.01). The frequency of allele s in the PMO patients constituted 23.0% and it was similar to that in the control group (P > 0.05). Analysis of the Collal alleles provides early detection of the individuals with hereditary predisposition to osteoporosis and prophylaxis of the disease at the presymptomatic stage.

  17. IFN-λ gene polymorphisms as predictive factors in chronic hepatitis C treatment-naive patients without access to protease inhibitors.

    PubMed

    Olmedo, Daniele Blasquez; Cader, Samária Ali; Porto, Luís Cristóvão

    2015-10-01

    The single nucleotides polymorphisms analyses in the regions near the IL28B gene in patients chronically infected with genotype 1 hepatitis C virus (HCV) are an important predictive factor for sustained virological response (SVR). The aim was to assess the predictive value of the polymorphisms of the IL28B/IFNL3 gene in patients chronically infected with genotype 1 for the viral clearance obtained after initial treatment including admixed populations. A systematic review was conducted, using a meta-analysis in the PubMed, Embase, LILACS, and SCIELO using MesH and DECS in 42 studies. The parameters were IL28B polymorphisms, rs12979860, rs8099917, and rs12980275, SVR ratio, and OR (odds ratio). OR and confidence Interval of 95% (95%CI), were calculated by fixed or random effects models. Heterogeneity, sensitivity analysis, and publication bias were also performed. Significant differences were noted between carriers groups with the major versus minor allele at rs12979860 CC versus CT/TT-genotype (OR = 4.18; 95%CI = 3.37-5.17), rs8099917 TT versus TG/GG-genotype (OR = 4.07; 95%CI = 2.94-5.63), and rs12980275 AA versus AA/AG-genotype (OR = 5.34; 95%CI = 1.60-17.82). There was selection bias in the rs8099917 analysis (Egger's regression P = 0.049), which reversed after performing a sensitivity analysis (P = 0.510). The incorporation of SNP analyses in IL28B/IFNL3 gene during the diagnosis process in Brazil should be used as a complementary tool to determine the appropriate treatment for HCV genotype 1. Here, we confirm that the rs12979860 CC, rs8099917 TT, and rs12980275 AA genotype-carriers have favorable responses to standard therapy, including two studies with Brazilian population, and this information should be considered.

  18. Transplastomic Nicotiana benthamiana plants expressing multiple defence genes encoding protease inhibitors and chitinase display broad-spectrum resistance against insects, pathogens and abiotic stresses.

    PubMed

    Chen, Peng-Jen; Senthilkumar, Rajendran; Jane, Wann-Neng; He, Yong; Tian, Zhihong; Yeh, Kai-Wun

    2014-05-01

    Plastid engineering provides several advantages for the next generation of transgenic technology, including the convenient use of transgene stacking and the generation of high expression levels of foreign proteins. With the goal of generating transplastomic plants with multiresistance against both phytopathogens and insects, a construct containing a monocistronic patterned gene stack was transformed into Nicotiana benthamiana plastids harbouring sweet potato sporamin, taro cystatin and chitinase from Paecilomyces javanicus. Transplastomic lines were screened and characterized by Southern/Northern/Western blot analysis for the confirmation of transgene integration and respective expression level. Immunogold localization analyses confirmed the high level of accumulation proteins that were specifically expressed in leaf and root plastids. Subsequent functional bioassays confirmed that the gene stacks conferred a high level of resistance against both insects and phytopathogens. Specifically, larva of Spodoptera litura and Spodoptera exigua either died or exhibited growth retardation after ingesting transplastomic plant leaves. In addition, the inhibitory effects on both leaf spot diseases caused by Alternaria alternata and soft rot disease caused by Pectobacterium carotovorum subsp. carotovorum were markedly observed. Moreover, tolerance to abiotic stresses such as salt/osmotic stress was highly enhanced. The results confirmed that the simultaneous expression of sporamin, cystatin and chitinase conferred a broad spectrum of resistance. Conversely, the expression of single transgenes was not capable of conferring such resistance. To the best of our knowledge, this is the first study to demonstrate an efficacious stacked combination of plastid-expressed defence genes which resulted in an engineered tolerance to various abiotic and biotic stresses. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  19. A novel splice site mutation of CRYBA3/A1 gene associated with congenital cataract in a Chinese family

    PubMed Central

    Wu, Meng-Han; Yu, Yin-Hui; Hao, Qin-Long; Gong, Xiao-Hua; Yao, Ke

    2017-01-01

    AIM To identify the disease-causing mutation responsible for the presence of congenital cataract in a Chinese family. METHODS The study recruited a four-generation Chinese pedigree affected by autosomal dominant congenital cataract (ADCC). Family history and the history of cataract extraction were recorded. Blood samples were collected from individuals for DNA extraction. Direct sequencing of congenital cataract-associated genes was performed. Single-strand conformational polymorphism and bioinformatic analysis were conducted to further study the mutation. RESULTS Direct sequencing revealed a novel splice site mutation of c.30-2 A>G in the CRYBA3/A1 gene. The mutation co-segregated within all affected individuals in the family and was not found in unaffected members or 100 unrelated normal controls. These results were further confirmed by single-strand conformational polymorphism and bioinformatic analysis using the Human Splicing Finder and MaxEnt online software and Annovar computer software. CONCLUSION c.30-2 A>G mutation of CRYBA3/A1 gene is a novel mutation and broadens the genetic spectrum of ADCC. PMID:28149769

  20. Emerging roles for diverse intramembrane proteases in plant biology.

    PubMed

    Adam, Zach

    2013-12-01

    Progress in the field of regulated intramembrane proteolysis (RIP) in recent years has made its impact on plant biology as well. Although this field within plant research is still in its infancy, some interesting observations have started to emerge. Gene encoding orthologs of rhomboid proteases, site-2 proteases (S2P), presenilin/γ-secretases, and signal peptide peptidases are found in plant genomes and some of these gene products were identified in different plant cell membranes. The lack of chloroplast-located rhomboid proteases was associated with reduced fertility and aberrations in flower morphology. Mutations in homologues of S2P resulted in chlorophyll deficiency and impaired chloroplast development. An S2P was also implicated in the response to ER stress through cleavage of ER-membrane bZIP transcription factors, allowing their migration to the nucleus and activation of the transcription of BiP chaperones. Other membrane-bound transcription factors of the NAC and PHD families were also demonstrated to undergo RIP and relocalization to the nucleus. These and other new data are expected to shed more light on the roles of intramembrane proteases in plant biology in the future. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Dioxin-dependent activation of murine Cyp1a-1 gene transcription requires protein kinase C-dependent phosphorylation.

    PubMed Central

    Carrier, F; Owens, R A; Nebert, D W; Puga, A

    1992-01-01

    Transcriptional activation of the murine Cyp1a-1 (cytochrome P(1)450) gene by inducers such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (dioxin) requires the aromatic hydrocarbon (Ah) receptor and the interaction of an inducer-receptor complex with one or more of the Ah-responsive elements (AhREs) located about 1 kb upstream from the transcriptional initiation site. We find that treatment of mouse hepatoma Hepa-1 cells with 2-aminopurine, an inhibitor of protein kinase activity, inhibits CYP1A1 mRNA induction by TCDD as well as the concomitant increase in CYP1A1 enzyme activity. Formation of DNA-protein complexes between the Ah receptor and its AhRE target is also inhibited by 2-aminopurine, as determined by gel mobility shift assays. Phosphorylation is required for the formation of Ah receptor-specific complexes, since in vitro dephosphorylation of nuclear extracts from TCDD-treated Hepa-1 cells abolishes the capacity of the Ah receptor to form specific complexes with its cognate AhRE sequences. To determine whether any one of several known protein kinases was involved in the transcriptional regulation of the Cyp1a-1 gene, we treated Hepa-1 cells with nine other protein kinase inhibitors prior to induction with TCDD; nuclear extracts from these cells were analyzed for their capacity to form specific DNA-protein complexes. Only extracts from cells treated with staurosporine, a protein kinase C inhibitor, were unable to form these complexes. In addition, staurosporine completely inhibited CYP1A1 mRNA induction by TCDD. Depletion of protein kinase C by prolonged treatment with phorbol ester led to the complete suppression of CYP1A1 mRNA induction by TCDD. We conclude that (i) phosphorylation is necessary for the formation of a transcriptional complex and for transcriptional activation of the Cyp1a-1 gene; (ii) the phosphorylation site(s) exists on at least one of the proteins constituting the transcriptional complex, possibly the Ah receptor itself; and (iii) the

  2. Exogenous proteases for meat tenderization.

    PubMed

    Bekhit, Alaa A; Hopkins, David L; Geesink, Geert; Bekhit, Adnan A; Franks, Philip

    2014-01-01

    The use of exogenous proteases to improve meat tenderness has attracted much interest recently, with a view to consistent production of tender meat and added value to lower grade meat cuts. This review discusses the sources, characteristics, and use of exogenous proteases in meat tenderization to highlight the specificity of the proteases toward meat proteins and their impact on meat quality. Plant enzymes (such as papain, bromelain, and ficin) have been extensively investigated as meat tenderizers. New plant proteases (actinidin and zingibain) and microbial enzyme preparations have been of recent interest due to controlled meat tenderization and other advantages. Successful use of these enzymes in fresh meat requires their enzymatic kinetics and characteristics to be determined, together with an understanding of the impact of the surrounding environmental conditions of the meat (pH, temperature) on enzyme function. This enables the optimal conditions for tenderizing fresh meat to be established, and the elimination or reduction of any negative impacts on other quality attributes.

  3. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  4. Discovery, evaluation and distribution of haplotypes and new alleles of the Photoperiod-A1 gene in wheat.

    PubMed

    Muterko, Alexandr; Kalendar, Ruslan; Cockram, James; Balashova, Irina

    2015-05-01

    Photoperiod response in wheat is determined to a large extent by the homoeologous series of Photoperiod 1 (Ppd1) genes. In this study, Ppd-A1 genomic sequences from the 5' UTR and promoter region were analysed in 104 accessions of six tetraploid wheat species (Triticum dicoccoides, T. dicoccum, T. turgidum, T. polonicum, T. carthlicum, T. durum) and 102 accessions of six hexaploid wheat species (T. aestivum, T. compactum, T. sphaerococcum, T. spelta, T. macha, T. vavilovii). This data was supplemented with in silico analysis of publicly available sequences from 46 to 193 accessions of diploid and tetraploid wheat, respectively. Analysis of a region of the Ppd-A1 promoter identified thirteen haplotypes, which were divided in two haplogroups. Distribution of the Ppd-A1 haplogroups and haplotypes in wheat species, and their geographical distributions were analysed. Polymerase chain reaction combined with a heteroduplex mobility assay was subsequently used to efficiently discriminate between Ppd-A1 alleles, allowing identification of the Ppd-A1b haplotypes and haplogroups. The causes of anomalous migration of Ppd-A1 heteroduplexes in gels were found to be the localization of mismatches relative to the center of fragment, the cumulative effect of neighbouring polymorphic sites, and the location of mismatches within A/T-tracts. Analysis of the Ppd-A1 5' UTR in hexaploid wheat revealed a novel mutation within the "photoperiod critical" region in a subset of T. compactum accessions. This putative photoperiod insensitive allele (designated Ppd-A1a.4) includes a 684 bp deletion which spans region in common with deletions previously identified in other photoperiod insensitive Ppd1 alleles.

  5. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  6. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas

    PubMed Central

    Fraile, Julia M.; Ordóñez, Gonzalo R.; Quirós, Pedro M.; Astudillo, Aurora; Galván, José A.; Colomer, Dolors; López-Otín, Carlos; Freije, José M.P.; Puente, Xose S.

    2013-01-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  7. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas.

    PubMed

    Fraile, Julia M; Ordóñez, Gonzalo R; Quirós, Pedro M; Astudillo, Aurora; Galván, José A; Colomer, Dolors; López-Otín, Carlos; Freije, José M P; Puente, Xose S

    2013-11-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  8. The COL5A1 gene is associated with increased risk of anterior cruciate ligament ruptures in female participants.

    PubMed

    Posthumus, Michael; September, Alison V; O'Cuinneagain, Dion; van der Merwe, Willem; Schwellnus, Martin P; Collins, Malcolm

    2009-11-01

    Anterior cruciate ligament ruptures, especially to young female athletes, are a cause of major concern in the sports medicine fraternity. The major structural constituents of ligaments are collagens, specifically types I and V. Recently, the gene that encodes for the alpha1 chain of type I collagen (COL1A1) has been shown to be associated with an increased risk of cruciate ligament ruptures. The COL5A1 gene, which encodes for the alpha1 chain of type V collagen, has been shown to be associated with Achilles tendon injuries. The study was conducted to determine (1) if 2 sequence variants (BstUI and DpnII restriction fragment length polymorphisms [RFLPs]) within the COL5A1 gene are associated with an increased risk of anterior cruciate ligament ruptures, and (2) if there were any gender-specific positive associations between the 2 COL5A1 sequence variants and risk of anterior cruciate ligament ruptures. Case control study; Level of evidence, 3. A total of 129 white participants (38 women) with surgically diagnosed anterior cruciate ligament ruptures and 216 physically active control participants (84 women) without any history of ACL injury were included in this case-control genetic association study. All participants were genotyped for the COL5A1 BstUI and DpnII RFLPs. There was a significant difference in the BstUI RFLP genotype frequency between the anterior cruciate ligament rupture and physically active control groups among the female participants, but not the male participants. The CC genotype in the female participants was significantly underrepresented in the anterior cruciate ligament rupture group compared with the controls (27.4% vs 5.6%; odds ratio = 6.6; 95% confidence interval, 1.5-29.7; P = .006). There were no differences in the DpnII RFLP genotype distributions between the anterior cruciate ligament rupture and physically active control groups. The CC genotype of the COL5A1 BstUI RFLP was underrepresented in female participants with anterior cruciate

  9. The autism-related gene SNRPN regulates cortical and spine development via controlling nuclear receptor Nr4a1

    PubMed Central

    Li, Huiping; Zhao, Pingping; Xu, Qiong; Shan, Shifang; Hu, Chunchun; Qiu, Zilong; Xu, Xiu

    2016-01-01

    The small nuclear ribonucleoprotein polypeptide N (SNRPN) gene, encoding the RNA-associated SmN protein, duplications or deletions of which are strongly associated with neurodevelopmental disabilities. SNRPN-coding protein is highly expressed in the brain. However, the role of SNRPN protein in neural development remains largely unknown. Here we showed that the expression of SNRPN increased markedly during postnatal brain development. Overexpression or knockdown of SNRPN in cortical neurons impaired neurite outgrowth, neuron migration, and the distribution of dendritic spines. We found that SNRPN regulated the expression level of Nr4a1, a critical nuclear receptor during neural development, in cultured primary cortical neurons. The abnormal spine development caused by SNRPN overexpression could be fully rescued by Nr4a1 co-expression. Importantly, we found that either knockdown of Nr4a1 or 3, 3′- Diindolylmethane (DIM), an Nr4a1 antagonist, were able to rescue the effects of SNRPN knockdown on neurite outgrowth of embryonic cortical neurons, providing the potential therapeutic methods for SNRPN deletion disorders. We thus concluded that maintaining the proper level of SNRPN is critical in cortical neurodevelopment. Finally, Nr4a1 may serve as a potential drug target for SNRPN-related neurodevelopmental disabilities, including Prader-Willi syndrome (PWS) and autism spectrum disorders (ASDs). PMID:27430727

  10. The Daiokanzoto (TJ-84) Kampo Formulation Reduces Virulence Factor Gene Expression in Porphyromonas gingivalis and Possesses Anti-Inflammatory and Anti-Protease Activities

    PubMed Central

    Fournier-Larente, Jade; Azelmat, Jabrane; Yoshioka, Masami; Hinode, Daisuke; Grenier, Daniel

    2016-01-01

    Kampo formulations used in Japan to treat a wide variety of diseases and to promote health are composed of mixtures of crude extracts from the roots, bark, leaves, and rhizomes of a number of herbs. The present study was aimed at identifying the beneficial biological properties of Daiokanzoto (TJ-84), a Kampo formulation composed of crude extracts of Rhubarb rhizomes and Glycyrrhiza roots, with a view to using it as a potential treatment for periodontal disease. Daiokanzoto dose-dependently inhibited the expression of major Porphyromonas gingivalis virulence factors involved in host colonization and tissue destruction. More specifically, Daiokanzoto reduced the expression of the fimA, hagA, rgpA, and rgpB genes, as determined by quantitative real-time PCR. The U937-3xκB-LUC monocyte cell line transfected with a luciferase reporter gene was used to evaluate the anti-inflammatory properties of Daiokanzoto. Daiokanzoto attenuated the P. gingivalis-mediated activation of the NF-κB signaling pathway. It also reduced the secretion of pro-inflammatory cytokines (IL-6 and CXCL8) by lipopolysaccharide-stimulated oral epithelial cells and gingival fibroblasts. Lastly, Daiokanzoto, dose-dependently inhibited the catalytic activity of matrix metalloproteinases (-1 and -9). In conclusion, the present study provided evidence that Daiokanzoto shows potential for treating and/or preventing periodontal disease. The ability of this Kampo formulation to act on both bacterial pathogens and the host inflammatory response, the two etiological components of periodontal disease, is of high therapeutic interest. PMID:26859747

  11. Bacillus anthracis sin Locus and Regulation of Secreted Proteases ▿ †

    PubMed Central

    Pflughoeft, Kathryn J.; Sumby, Paul; Koehler, Theresa M.

    2011-01-01

    Bacillus anthracis shares many regulatory loci with the nonpathogenic Bacillus species Bacillus subtilis. One such locus is sinIR, which in B. subtilis controls sporulation, biofilm formation, motility, and competency. As B. anthracis is not known to be motile, to be naturally competent, or to readily form biofilms, we hypothesized that the B. anthracis sinIR regulon is distinct from that of B. subtilis. A genome-wide expression microarray analysis of B. anthracis parental and sinR mutant strains indicated limited convergence of the B. anthracis and B. subtilis SinR regulons. The B. anthracis regulon includes homologues of some B. subtilis SinR-regulated genes, including the signal peptidase gene sipW near the sinIR locus and the sporulation gene spoIIE. The B. anthracis SinR protein also negatively regulates transcription of genes adjacent to the sinIR locus that are unique to the Bacillus cereus group species. These include calY and inhA1, structural genes for the metalloproteases camelysin and immune inhibitor A1 (InhA1), which have been suggested to be associated with virulence in B. cereus and B. anthracis, respectively. Electrophoretic mobility shift assays revealed direct binding of B. anthracis SinR to promoter DNA from strongly regulated genes, such as calY and sipW, but not to the weakly regulated inhA1 gene. Assessment of camelysin and InhA1 levels in culture supernates from sinR-, inhA1-, and calY-null mutants showed that the concentration of InhA1 in the culture supernatant is inversely proportional to the concentration of camelysin. Our data are consistent with a model in which InhA1 protease levels are controlled at the transcriptional level by SinR and at the posttranslational level by camelysin. PMID:21131488

  12. Identification of a novel heterozygous mutation in exon 50 of the COL1A1 gene causing osteogenesis imperfecta

    PubMed Central

    Aftab, S A S; Reddy, N; Owen, N L; Pollitt, R; Harte, A; McTernan, P G; Tripathi, G; Barber, T M

    2013-01-01

    Summary A 19-year-old woman was diagnosed with osteogenesis imperfecta (OI). She had sustained numerous low-trauma fractures throughout her childhood, including a recent pelvic fracture (superior and inferior ramus) following a low-impact fall. She had the classical blue sclerae, and dual energy X-ray absorptiometry (DEXA) bone scanning confirmed low bone mass for her age in the lumbar spine (Z-score was −2.6). However, despite these classical clinical features, the diagnosis of OI had not been entertained throughout the whole of her childhood. Sequencing of her genomic DNA revealed that she was heterozygous for the c.3880_3883dup mutation in exon 50 of the COL1A1 gene. This mutation is predicted to result in a frameshift at p.Thr1295, and truncating stop codon 3 amino acids downstream. To our knowledge, this mutation has not previously been reported in OI. Learning points OI is a rare but important genetic metabolic bone and connective tissue disorder that manifests a diverse clinical phenotype that includes recurrent low-impact fractures.Most mutations that underlie OI occur within exon 50 of the COL1A1 gene (coding for protein constituents of type 1 pro-collagen).The diagnosis of OI is easily missed in its mild form. Early diagnosis is important, and there is a need for improved awareness of OI among health care professionals.OI is a diagnosis of exclusion, although the key diagnostic criterion is through genetic testing for mutations within the COL1A1 gene.Effective management of OI should be instituted through a multidisciplinary team approach that includes a bone specialist (usually an endocrinologist or rheumatologist), a geneticist, an audiometrist and a genetic counsellor. Physiotherapy and orthopaedic surgery may also be required. PMID:24616757

  13. Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes.

    PubMed

    Amemiya-Kudo, Michiyo; Shimano, Hitoshi; Hasty, Alyssa H; Yahagi, Naoya; Yoshikawa, Tomohiro; Matsuzaka, Takashi; Okazaki, Hiroaki; Tamura, Yoshiaki; Iizuka, Yoko; Ohashi, Ken; Osuga, Jun-ichi; Harada, Kenji; Gotoda, Takanari; Sato, Ryuichiro; Kimura, Satoshi; Ishibashi, Shun; Yamada, Nobuhiro

    2002-08-01

    Recent studies on the in vivo roles of the sterol regulatory element binding protein (SREBP) family indicate that SREBP-2 is more specific to cholesterogenic gene expression whereas SREBP-1 targets lipogenic genes. To define the molecular mechanism involved in this differential regulation, luciferase-reporter gene assays were performed in HepG2 cells to compare the transactivities of nuclear SREBP-1a, -1c, and -2 on a battery of SREBP-target promoters containing sterol regulatory element (SRE), SRE-like, or E-box sequences. The results show first that cholesterogenic genes containing classic SREs in their promoters are strongly and efficiently activated by both SREBP-1a and SREBP-2, but not by SREBP-1c. Second, an E-box containing reporter gene is much less efficiently activated by SREBP-1a and -1c, and SREBP-2 was inactive in spite of its ability to bind to the E-box. Third, promoters of lipogenic enzymes containing variations of SRE (SRE-like sequences) are strongly activated by SREBP-1a, and only modestly and equally by both SREBP-1c and -2. Finally, substitution of the unique tyrosine residue within the basic helix-loop-helix (bHLH) portion of nuclear SREBPs with arginine, the conserved residue found in all other bHLH proteins, abolishes the transactivity of all SREBPs for SRE, and conversely results in markedly increased activity of SREBP-1 but not activity of SREBP-2 for E-boxes. These data demonstrate the different specificity and affinity of nuclear SREBP-1 and -2 for different target DNAs, explaining a part of the mechanism behind the differential in vivo regulation of cholesterogenic and lipogenic enzymes by SREBP-1 and -2, respectively.

  14. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  15. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior

    PubMed Central

    Almonte, Antoine G.; Sweatt, J. David

    2011-01-01

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes—coagulation, inflammation, and digestion, for example—have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation. PMID:21782155

  16. Identification of a Novel Mutation in the COL2A1 Gene in a Chinese Family with Spondyloepiphyseal Dysplasia Congenita

    PubMed Central

    Huang, Xiangjun; Deng, Xiong; Xu, Hongbo; Wu, Song; Yuan, Lamei; Yang, Zhijian; Yang, Yan; Deng, Hao

    2015-01-01

    Spondyloepiphyseal dysplasia congenita (SEDC) is an autosomal dominant chondrodysplasia characterized by disproportionate short-trunk dwarfism, skeletal and vertebral deformities. Exome sequencing and Sanger sequencing were performed in a Chinese Han family with typical SEDC, and a novel mutation, c.620G>A (p.Gly207Glu), in the collagen type II alpha-1 gene (COL2A1) was identified. The mutation may impair protein stability, and lead to dysfunction of type II collagen. Family-based study suggested that the mutation is a de novo mutation. Our study extends the mutation spectrum of SEDC and confirms genotype-phenotype relationship between mutations at glycine in the triple helix of the alpha-1(II) chains of the COL2A1 and clinical findings of SEDC, which may be helpful in the genetic counseling of patients with SEDC. PMID:26030151

  17. The salt-sensitive structure and zinc inhibition of Borrelia burgdorferi protease BbHtrA.

    PubMed

    Russell, Theresa M; Tang, Xiaoling; Goldstein, Jason M; Bagarozzi, Dennis; Johnson, Barbara J B

    2016-02-01

    HtrA serine proteases are highly conserved and essential ATP-independent proteases with chaperone activity. Bacteria express a variable number of HtrA homologues that contribute to the virulence and pathogenicity of bacterial pathogens. Lyme disease spirochetes possess a single HtrA protease homologue, Borrelia burgdorferi HtrA (BbHtrA). Previous studies established that, like the human orthologue HtrA1, BbHtrA is proteolytically active against numerous extracellular proteins in vitro. In this study, we utilized size exclusion chromatography and blue native polyacrylamide gel electrophoresis (BN-PAGE) to demonstrate BbHtrA oligomeric structures that were substrate independent and salt sensitive. Examination of the influence of transition metals on the activity of BbHtrA revealed that this protease is inhibited by Zn(2+) > Cu(2+) > Mn(2+). Extending this analysis to two other HtrA proteases, E. coli DegP and HtrA1, revealed that all three HtrA proteases were reversibly inhibited by ZnCl2 at all micro molar concentrations examined. Commercial inhibitors for HtrA proteases are not available and physiologic HtrA inhibitors are unknown. Our observation of conserved zinc inhibition of HtrA proteases will facilitate structural and functional studies of additional members of this important class of proteases. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  18. Modification of nitrogen remobilization, grain fill and leaf senescence in maize (Zea mays) by transposon insertional mutagenesis in a protease gene.

    PubMed

    Donnison, Iain S; Gay, Alan P; Thomas, Howard; Edwards, Keith J; Edwards, David; James, Caron L; Thomas, Ann M; Ougham, Helen J

    2007-01-01

    A maize (Zea mays) senescence-associated legumain gene, See2beta, was characterized at the physiological and molecular levels to determine its role in senescence and resource allocation. A reverse-genetics screen of a maize Mutator (Mu) population identified a Mu insertion in See2beta. Maize plants homozygous for the insertion were produced. These See2 mutant and sibling wild-type plants were grown under high or low quantities of nitrogen (N). The early development of both genotypes was similar; however, tassel tip and collar emergence occurred earlier in the mutant. Senescence of the mutant leaves followed a similar pattern to that of wild-type leaves, but at later sampling points mutant plants contained more chlorophyll than wild-type plants and showed a small extension in photosynthetic activity. Total plant weight was higher in the wild-type than in the mutant, and there was a genotype x N interaction. Mutant plants under low N maintained cob weight, in contrast to wild-type plants under the same treatment. It is concluded, on the basis of transposon mutagenesis, that See2beta has an important role in N-use and resource allocation under N-limited conditions, and a minor but significant function in the later stages of senescence.

  19. CYP7A1 Gene Polymorphism Located in the 5′ Upstream Region Modifies the Risk of Coronary Artery Disease

    PubMed Central

    Iwanicki, Tomasz; Balcerzyk, Anna; Niemiec, Pawel; Nowak, Tomasz; Ochalska-Tyka, Anna; Krauze, Jolanta; Kosiorz-Gorczynska, Sylwia; Grzeszczak, Wladyslaw; Zak, Iwona

    2015-01-01

    Background. 7-Alpha cholesterol hydroxylase (CYP7A1), the first enzyme of classic conversion pathway leading from cholesterol to bile acids synthesis, is encoded by CYP7A1 gene. Its single nucleotide polymorphisms (SNPs) influence serum lipid levels and may be related to impaired lipid profile leading to coronary artery disease (CAD). The aim of the present study was to analyze the possible association between the rs7833904 CYP7A1 polymorphism and premature CAD. Material and Methods. Serum lipid levels and rs7833904 SNP were determined in 419 subjects: 200 patients with premature CAD and 219 age and sex matched controls. Results. The A allele carrier state was associated with CAD (OR = 1.76, 95% CI; 1.14–2.71, P = 0.014). The effect was even stronger in the male subgroups (OR = 2.16, 95% CI; 1.28–3.65, P = 0.003). There was no effect in the females. Risk factors of CAD and clinical phenotype of atherosclerosis were not associated with genotype variants of the rs7833904 SNP. Lipid profiles also did not differ significantly between individual genotypes. Conclusion. The CYP7A1 rs7833904 polymorphism may modify the risk of CAD. This effect is especially strong in male subjects. The studied polymorphism does not significantly influence serum lipid levels, in the present study. PMID:25944972

  20. Down-regulation of the CYP19A1 gene in cumulus cells of infertile women with endometriosis.

    PubMed

    Barcelos, Ionara Diniz E S; Donabella, Flávia Capello; Ribas, Cristiana Padovan; Meola, Juliana; Ferriani, Rui Alberto; de Paz, Cláudia Cristina Paro; Navarro, Paula A

    2015-05-01

    Aromatase plays a fundamental role in the establishment of oocyte quality, which might be compromised in infertile women with endometriosis. The expression of the CYP19A1 gene (that encodes aromatase) was compared in cumulus cells and oestradiol concentrations in the follicular fluid of infertile women with and without endometriosis submitted to ovarian stimulation for intracytoplasmic sperm injection. Cumulus cells were isolated and the expression of the CYP19A1 was quantitated through real-time polymerase chain reaction. Oestradiol concentrations in follicular fluid were measured by chemiluminescence immunoassay. A lower expression of the CYP19A1 in the cumulus cells of infertile women with endometriosis was observed compared with controls (0.17 ± 0.13 and 0.56 ± 0.12, respectively), and no significant difference in the follicular fluid oestradiol concentrations was observed between groups. Our results show reduced expression of the CYP19A1 in cumulus cells of infertile women with endometriosis, which may play a role in the pathogenesis of endometriosis-related infertility.

  1. CYP7A1 gene polymorphism located in the 5' upstream region modifies the risk of coronary artery disease.

    PubMed

    Iwanicki, Tomasz; Balcerzyk, Anna; Niemiec, Pawel; Nowak, Tomasz; Ochalska-Tyka, Anna; Krauze, Jolanta; Kosiorz-Gorczynska, Sylwia; Grzeszczak, Wladyslaw; Zak, Iwona

    2015-01-01

    7-Alpha cholesterol hydroxylase (CYP7A1), the first enzyme of classic conversion pathway leading from cholesterol to bile acids synthesis, is encoded by CYP7A1 gene. Its single nucleotide polymorphisms (SNPs) influence serum lipid levels and may be related to impaired lipid profile leading to coronary artery disease (CAD). The aim of the present study was to analyze the possible association between the rs7833904 CYP7A1 polymorphism and premature CAD. Serum lipid levels and rs7833904 SNP were determined in 419 subjects: 200 patients with premature CAD and 219 age and sex matched controls. The A allele carrier state was associated with CAD (OR = 1.76, 95% CI; 1.14-2.71, P = 0.014). The effect was even stronger in the male subgroups (OR = 2.16, 95% CI; 1.28-3.65, P = 0.003). There was no effect in the females. Risk factors of CAD and clinical phenotype of atherosclerosis were not associated with genotype variants of the rs7833904 SNP. Lipid profiles also did not differ significantly between individual genotypes. The CYP7A1 rs7833904 polymorphism may modify the risk of CAD. This effect is especially strong in male subjects. The studied polymorphism does not significantly influence serum lipid levels, in the present study.

  2. Polymorphisms and allele frequencies of glutathione S-transferases A1 and P1 genes in the Polish population.

    PubMed

    Skrzypczak-Zielinska, M; Zakerska-Banaszak, O; Tamowicz, B; Sobieraj, I; Drweska-Matelska, N; Szalata, M; Slomski, R; Mikstacki, A

    2015-03-31

    Glutathione S-transferases (GST) A1 and P1 are crucial enzymes involved in the biotransformation of drugs, carcinogens, and toxins, and their activity may influence drug response, susceptibility to diseases, and carcinogenesis. The genes encoding these enzymes, GSTA1 and GSTP1, have been examined in many studies because of their genetic variability, which may affect enzymatic activity. The goal of this study was to determine the distribution of the alleles GSTA1*A/*B and GSTP1*A, *B, and *C in the Polish population. A total of 160 subjects from the Polish population were genotyped for 2 polymorphisms (I105V and A114V) in the GSTP1 gene using pyrosequencing. The promoter region of the GSTA1 gene was screened using sequencing. The detected variants were subjected to haplotype analysis. We found that the distribution of the alleles GSTA1*A/*B and GSTP1*A, *B, and *C in the Polish population correspond to the results of studies in Caucasians. Furthermore, we identified additional single nucleotide polymorphisms, excluding 3 well-known changes (G-52A, C-69T, T-567G), which are linked to alleles GSTA1*A/*B, that affect enzyme activity. A total of 4 haplotypes were identified in 160 Polish individuals.

  3. Root proteases: reinforced links between nitrogen uptake and mobilization and drought tolerance.

    PubMed

    Kohli, Ajay; Narciso, Joan Onate; Miro, Berta; Raorane, Manish

    2012-05-01

    Integral subcellular and cellular functions ranging from gene expression, protein targeting and nutrient supply to cell differentiation and cell death require proteases. Plants have unique organelles such as chloroplasts composed of unique proteins that carry out the unique process of photosynthesis. Hence, along with proteases common across kingdoms, plants contain unique proteases. Improved knowledge on proteases can lead to a better understanding of plant development, differentiation and death. Because of their importance in multiple processes, plant proteases are actively studied. However, root proteases specifically are not as well studied. The associated rhizosphere, organic matter and/or inorganic matter make roots a difficult system. Yet recent research conclusively demonstrated the occurrence of endocytosis of proteins, peptides and even microbes by root cells, which, hitherto known for specialized pathogenesis or symbiosis, was unsuspected for nutrient uptake. These results reinforced the importance of root proteases in endocytosis or root exudate-mediated nutrient uptake. Rhizoplane, rhizosphere or in planta protease action on proteins, peptides and microbes generates sources of nitrogen, especially during abiotic stresses such as drought. This article highlights the recent research on root proteases for nitrogen uptake and the connection of the two to drought-tolerance mechanisms. Drought-induced proteases in rice roots, as known from rice expression databases, are discussed for future research on certain M50, Deg, FtsH, AMSH and deubiquitination proteases. The recent emphasis on linking drought and plant hydraulics to nutrient metabolism is illustrated and connected to the value of a systematic study of root proteases in crop improvement. Copyright © Physiologia Plantarum 2012.

  4. Glucagon and cAMP inhibit cholesterol 7alpha-hydroxylase (CYP7A1) gene expression in human hepatocytes: discordant regulation of bile acid synthesis and gluconeogenesis.

    PubMed

    Song, Kwang-Hoon; Chiang, John Y L

    2006-01-01

    The gene encoding cholesterol 7alpha-hydroxylase (CYP7A1) is tightly regulated to control bile acid synthesis and maintain lipid homeostasis. Recent studies in mice suggest that bile acid synthesis is regulated by the fasted-to-fed cycle, and fasting induces CYP7A1 gene expression in parallel to the induction of peroxisome proliferators-activated receptor gamma co-activator 1alpha (PGC-1alpha) and phosphoenolpyruvate carboxykinase (PEPCK). How glucagon regulates CYP7A1 gene expression in the human liver is not clear. Here we show that glucagon and cyclic adenosine monophosphate (cAMP) strongly repressed CYP7A1 mRNA expression in human primary hepatocytes. Reporter assays confirmed that cAMP and protein kinase A (PKA) inhibited human CYP7A1 gene transcription, in contrast to their stimulation of the PEPCK gene. Mutagenesis analysis identified a PKA-responsive region located within the previously identified HNF4alpha binding site in the human CYP7A1 promoter. Glucagon and cAMP increased HNF4alpha phosphorylation and reduced the amount of HNF4alpha present in CYP7A1 chromatin. Our findings suggest that glucagon inhibited CYP7A1 gene expression via PKA phosphorylation of HNF4alpha, which lost its ability to bind the CYP7A1 gene and resulted in inhibition of human CYP7A1 gene transcription. In conclusion, this study unveils a species difference in nutrient regulation of the human and mouse CYP7A1 gene and suggests a discordant regulation of bile acid synthesis and gluconeogenesis by glucagon in human livers during fasting.

  5. Genome-wide association study identifies ALDH7A1 as a novel susceptibility gene for osteoporosis.

    PubMed

    Guo, Yan; Tan, Li-Jun; Lei, Shu-Feng; Yang, Tie-Lin; Chen, Xiang-Ding; Zhang, Feng; Chen, Yuan; Pan, Feng; Yan, Han; Liu, Xiaogang; Tian, Qing; Zhang, Zhi-Xin; Zhou, Qi; Qiu, Chuan; Dong, Shan-Shan; Xu, Xiang-Hong; Guo, Yan-Fang; Zhu, Xue-Zhen; Liu, Shan-Lin; Wang, Xiang-Li; Li, Xi; Luo, Yi; Zhang, Li-Shu; Li, Meng; Wang, Jin-Tang; Wen, Ting; Drees, Betty; Hamilton, James; Papasian, Christopher J; Recker, Robert R; Song, Xiao-Ping; Cheng, Jing; Deng, Hong-Wen

    2010-01-08

    Osteoporosis is a major public health problem. It is mainly characterized by low bone mineral density (BMD) and/or low-trauma osteoporotic fractures (OF), both of which have strong genetic determination. The specific genes influencing these phenotypic traits, however, are largely unknown. Using the Affymetrix 500K array set, we performed a case-control genome-wide association study (GWAS) in 700 elderly Chinese Han subjects (350 with hip OF and 350 healthy matched controls). A follow-up replication study was conducted to validate our major GWAS findings in an independent Chinese sample containing 390 cases with hip OF and 516 controls. We found that a SNP, rs13182402 within the ALDH7A1 gene on chromosome 5q31, was strongly associated with OF with evidence combined GWAS and replication studies (P = 2.08x10(-9), odds ratio = 2.25). In order to explore the target risk factors and potential mechanism underlying hip OF risk, we further examined this candidate SNP's relevance to hip BMD both in Chinese and Caucasian populations involving 9,962 additional subjects. This SNP was confirmed as consistently associated with hip BMD even across ethnic boundaries, in both Chinese and Caucasians (combined P = 6.39x10(-6)), further attesting to its potential effect on osteoporosis. ALDH7A1 degrades and detoxifies acetaldehyde, which inhibits osteoblast proliferation and results in decreased bone formation. Our findings may provide new insights into the pathogenesis of osteoporosis.

  6. Stop Codon Polymorphisms in the Human SLC9A1 Gene Disrupt or Compromise Na+/H+ Exchanger Function

    PubMed Central

    Li, Xiuju; Augustine, Aruna; Chen, Shuo; Fliegel, Larry

    2016-01-01

    The NHE1 isoform of the mammalian Na+/H+ exchanger is a ubiquitous plasma membrane protein that regulates intracellular pH in mammalian cells by removing one intracellular proton in exchange for one extracellular sodium. Deletion of the NHE1 gene (SLC9A1) affects the growth and motor ability of mice and humans but mutations and polymorphisms of the gene are only beginning to be characterized. NHE1 has a cytosolic C-terminal regulatory tail of approximately 315 amino acids and a 500 amino acid membrane domain. We examined the functional effects of three human stop codon mutations at amino acids 321, 449 and 735 in comparison with a mutant that had a shortened tail region (543 stop codon). The short mutants, 321, 449 and 543 stop codon mutant proteins, lost NHE1 activity and expression, and did not target to the plasma membrane. Protein for these short mutants was more rapidly degraded than the wild type and 735 ending proteins. The 735 terminating mutant, with the membrane domain and much of the cytosolic tail, had reduced protein expression and activity. The results demonstrate that early stop codon polymorphisms have significant and deleterious effects on the activity of the SLC9A1 protein product. The 735-NHE1 mutant, without the last 80 amino acids, had more minor defects. Surprisingly, retention of a proximal 43 amino acids adjacent to the membrane domain did little to maintain NHE1 expression, targeting and activity. PMID:27636896

  7. Molecular Cloning and Expression Profile of a Halloween Gene Encoding Cyp307A1 From the Seabuckthorn Carpenterworm, Holcocerus hippophaecolus

    PubMed Central

    Zhou, Jiao; Zhang, Haolin; Li, Juan; Sheng, Xia; Zong, Shixiang; Luo, Youqing; Nagaoka, Kentaro; Weng, Qiang; Watanabe, Gen; Taya, Kazuyoshi

    2013-01-01

    20-Hydroxyecdyone, an active form of ecdysteroid, is the key hormone in insect growth and development. Halloween genes encode ecdysteroidogenic enzymes, including cytochrome P450 monooxygenase. CYP307A1 (spook) is accepted as an enzyme acting in the so-called ‘black box’ that includes a series of hypothetical and unproven reactions that finally result in the oxidation of 7-dehydrocholesterol to diketol. In this study, the Holcocerus hippophaecolus Hua (Lepidoptera: Cossidae) CYP307A1 (HhSpo) gene was identified and characterized. The obtained cDNA sequence was 2084 base pairs with an open reading frame of 537 animo acids, in which existed conserved motifs of CYP450 enzymes. The transcript profiles of HhSpo were analyzed in various tissues of final instar larvae. The highest expression was observed in the prothoracic gland, while expression level was low but significant in other tissues. These results suggest that the sequence character and expression profile of HhSpo were well conserved and provided the basic information for its functional analysis. PMID:23909572

  8. Molecular cloning and expression profile of a Halloween gene encoding Cyp307A1 from the seabuckthorn carpenterworm, Holcocerus hippophaecolus.

    PubMed

    Zhou, Jiao; Zhang, Haolin; Li, Juan; Sheng, Xia; Zong, Shixiang; Luo, Youqing; Nagaoka, Kentaro; Weng, Qiang; Watanabe, Gen; Taya, Kazuyoshi

    2013-01-01

    20-Hydroxyecdyone, an active form of ecdysteroid, is the key hormone in insect growth and development. Halloween genes encode ecdysteroidogenic enzymes, including cytochrome P450 monooxygenase. CYP307A1 (spook) is accepted as an enzyme acting in the so-called 'black box' that includes a series of hypothetical and unproven reactions that finally result in the oxidation of 7-dehydrocholesterol to diketol. In this study, the Holcocerus hippophaecolus Hua (Lepidoptera: Cossidae) CYP307A1 (HhSpo) gene was identified and characterized. The obtained cDNA sequence was 2084 base pairs with an open reading frame of 537 animo acids, in which existed conserved motifs of CYP450 enzymes. The transcript profiles of HhSpo were analyzed in various tissues of final instar larvae. The highest expression was observed in the prothoracic gland, while expression level was low but significant in other tissues. These results suggest that the sequence character and expression profile of HhSpo were well conserved and provided the basic information for its functional analysis.

  9. Mutations in the COL5A1 gene are causal in the Ehlers-Danlos syndromes I and II

    SciTech Connect

    De Paepe, A.; Nuytinck, L.; Naeyaert, J.M.

    1997-03-01

    The Ehlers-Danlos syndrome (EDS) is a heterogeneous connective-tissue disorder of which at least nine subtypes are recognized. Considerable clinical overlap exists between the EDS I and II subtypes, suggesting that both are allelic disorders. Recent evidence based on linkage and transgenic mice studies suggest that collagen V is causally involved in human EDS. Collagen V forms heterotypic fibrils with collagen I in many tissues and plays an important role in collagen I fibrillogenesis. We have identified a mutation in COL5A1, the gene encoding the pro{alpha}1(V) collagen chain, segregating with EDS I in a four-generation family. The mutation causes the substitution of the most 5{prime} cysteine residue by a serine within a highly conserved sequence of the pro{alpha}1(V) C-propeptide domain and causes reduction of collagen V by preventing incorporation of the mutant pro{alpha}1 (V) chains in the collagen V trimers. In addition, we have detected splicing defects in the COL5A1 gene in a patient with EDS I and in a family with EDS II. These findings confirm the causal role of collagen V in at least a subgroup of EDS I, prove that EDS I and II are allelic conditions, and represent a, so far, unique example of a human collagen disorder caused by substitution of a highly conserved cysteine residue in the C-propeptide domain of a fibrillar collagen. 30 refs., 6 figs., 2 tabs.

  10. Assessing the identity and expression level of the cytochrome P450 20A1 (CYP20A1) gene in the BPA-, BDE-47, and WAF-exposed copepods Tigriopus japonicus and Paracyclopina nana.

    PubMed

    Han, Jeonghoon; Kim, Duck-Hyun; Seo, Jung Soo; Kim, Il-Chan; Nelson, David R; Puthumana, Jayesh; Lee, Jae-Seong

    2017-03-01

    CYP20A1 is a member of the cytochrome P450 (CYP) superfamily, identified as an orphan P450 without any assigned biological function; hence, its continued status as an "orphan" gene. In order to address this shortcoming in our understanding of this superfamily, we sought to characterize the CYP20A1 gene in the copepods Tigriopus japonicus (Tj-CYP20A1) and Paracyclopina nana (Pn-CYP20A1) at their mRNA transcriptional level. We assessed the response of this gene's expression in various developmental stages and in response to treatment with bisphenol A (BPA), 2, 2', 4, 4'-tetrabromodiphenyl ether (BDE-47), and water accommodated fractions (WAFs) of crude oil. As shown in the vertebrate CYP20A1, both Tj-CYP20A1 and Pn-CYP20A1 contained characteristic conserved motifs and domain regions (I helix, K helix and heme-binding motifs) with unusual amino acid sequences apparent in their gene structure. Also molecular characterization of the putative responsive elements in the promoter regions was performed. We observed transcriptional up-regulation of these genes during post-embryonic developmental stages including sex-specific up-regulation in adults. In addition, concentration- and time-dependent mRNA transcripts in response to xenobiotics (BPA, BDE-47, and WAFs) were seen. This study focuses on the molecular elucidation of CYP20A1 genes and their interactions with xenobiotics in the copepods T. japonicus and P. nana that provides important insight into the biological importance of CYP20A1 in invertebrates.

  11. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure.

    PubMed

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B; Enghild, Jan J; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium.

  12. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  13. Expression of a symbiosis-specific gene in Symbiodinium type A1 associated with coral, nudibranch and giant clam larvae

    PubMed Central

    Voolstra, C. R.; Castro, C. B.; Pires, D. O.; Calderon, E. N.; Sumida, P. Y. G.

    2017-01-01

    Symbiodinium are responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. However, little is known about the molecular signals involved in the establishment of this symbiosis and whether it initiates during host larval development. To address this question, we monitored the expression of a putative symbiosis-specific gene (H+-ATPase) in Symbiodinium A1 ex hospite and in association with larvae of a scleractinian coral (Mussismilia hispida), a nudibranch (Berghia stephanieae) and a giant clam (Tridacna crocea). We acquired broodstock for each host, induced spawning and cultured the larvae. Symbiodinium cells were offered and larval samples taken for each host during the first 72 h after symbiont addition. In addition, control samples including free-living Symbiodinium and broodstock tissue containing symbionts for each host were collected. RNA extraction and RT-PCR were performed and amplified products cloned and sequenced. Our results show that H+-ATPase was expressed in Symbiodinium associated with coral and giant clam larvae, but not with nudibranch larvae, which digested the symbionts. Broodstock tissue for coral and giant clam also expressed H+-ATPase, but not the nudibranch tissue sample. Our results of the expression of H+-ATPase as a marker gene suggest that symbiosis between Symbiodinium and M. hispida and T. crocea is established during host larval development. Conversely, in the case of B. stephanieae larvae, evidence does not support a mutualistic relationship. Our study supports the utilization of H+-ATPase expression as a marker for assessing Symbiodinium–invertebrate relationships with applications for the differentiation of symbiotic and non-symbiotic associations. At the same time, insights from a single marker gene approach are limited and future studies should direct the identification of additional symbiosis-specific genes, ideally from both symbiont and host. PMID

  14. Expression of a symbiosis-specific gene in Symbiodinium type A1 associated with coral, nudibranch and giant clam larvae.

    PubMed

    Mies, M; Voolstra, C R; Castro, C B; Pires, D O; Calderon, E N; Sumida, P Y G

    2017-05-01

    Symbiodinium are responsible for the majority of primary production in coral reefs and found in a mutualistic symbiosis with multiple animal phyla. However, little is known about the molecular signals involved in the establishment of this symbiosis and whether it initiates during host larval development. To address this question, we monitored the expression of a putative symbiosis-specific gene (H(+)-ATPase) in Symbiodinium A1 ex hospite and in association with larvae of a scleractinian coral (Mussismilia hispida), a nudibranch (Berghia stephanieae) and a giant clam (Tridacna crocea). We acquired broodstock for each host, induced spawning and cultured the larvae. Symbiodinium cells were offered and larval samples taken for each host during the first 72 h after symbiont addition. In addition, control samples including free-living Symbiodinium and broodstock tissue containing symbionts for each host were collected. RNA extraction and RT-PCR were performed and amplified products cloned and sequenced. Our results show that H(+)-ATPase was expressed in Symbiodinium associated with coral and giant clam larvae, but not with nudibranch larvae, which digested the symbionts. Broodstock tissue for coral and giant clam also expressed H(+)-ATPase, but not the nudibranch tissue sample. Our results of the expression of H(+)-ATPase as a marker gene suggest that symbiosis between Symbiodinium and M. hispida and T. crocea is established during host larval development. Conversely, in the case of B. stephanieae larvae, evidence does not support a mutualistic relationship. Our study supports the utilization of H(+)-ATPase expression as a marker for assessing Symbiodinium-invertebrate relationships with applications for the differentiation of symbiotic and non-symbiotic associations. At the same time, insights from a single marker gene approach are limited and future studies should direct the identification of additional symbiosis-specific genes, ideally from both symbiont and host.

  15. Differential Response of Extracellular Proteases of Trichoderma Harzianum Against Fungal Phytopathogens.

    PubMed

    Sharma, Vivek; Salwan, Richa; Sharma, Prem N

    2016-09-01

    In the present study, production of extracellular proteases by Trichoderma harzianum was evaluated based on the relative gene expression and spectrophotometric assay. The fungal isolates were grown in Czapek Dox Broth medium supplemented with deactivated mycelium of plant fungal pathogens such as Fusarium oxysporum, Colletotrichum capsici, Gloeocercospora sorghi, and Colletotrichum truncatum. The maximum protease activity was detected after 48 h of incubation against Colletotrichum spp. Similarly in qRT-PCR, the relative gene expression of four proteases varied from 48 to 96 h against host pathogens in a time-independent manner. Among proteases, statistically significant upregulation of asp, asp, and srp was observed against Colletotrichum spp., followed by F. oxysporum. But in the case of pepM22, maximum upregulation was observed against F. oxysporum. The variation in enzyme assay and qRT-PCR of proteases at different time intervals against various fungal phytopathogens could be due to the limitation of using casein as a substrate for all types of proteases or protease-encoding transcripts selected for qRT-PCR, which may not be true representative of total protease activity.

  16. Genetic evidence that mutations in the COL1A1, COL1A2, COL3A1, or COL5A2 collagen genes are not responsible for mitral valve prolapse.

    PubMed Central

    Henney, A M; Tsipouras, P; Schwartz, R C; Child, A H; Devereux, R B; Leech, G J

    1989-01-01

    DNA markers were used to assess the segregation of genes encoding the collagen types that predominate in the mitral valve (types I, III, and V) in two family pedigrees that are phenotypically different but showed dominantly inherited mitral valve prolapse. The inheritance of these markers was compared with the segregation of the phenotype for mitral valve prolapse in both families. In one family it was shown that the COL1A1, COL1A2, COL3A1, and COL5A2 genes segregated independently of the phenotype; in the other family the results for COL1A1, COL1A2, and COL5A2 were similar but analysis at the COL3A1 locus was not possible. These data indicate that in these families mitral valve prolapse does not arise from a defect in one of these collagen genes. PMID:2930668

  17. Ezetimibe: A biomarker for efficacy of liver directed UGT1A1 gene therapy for inherited hyperbilirubinemia.

    PubMed

    Montenegro-Miranda, Paula S; Sneitz, Nina; de Waart, D Rudi; Ten Bloemendaal, Lysbeth; Duijst, Suzanne; de Knegt, Robert J; Beuers, Ulrich; Finel, Moshe; Bosma, Piter J

    2012-08-01

    As recently demonstrated in patients with factor IX deficiency, adeno-associated virus (AAV)-mediated liver-directed therapy is a viable option for inherited metabolic liver disorders. Our aim is to treat Crigler-Najjar syndrome type I (CN I), an inherited severe unconjugated hyperbilirubinemia, as a rare recessive inherited disorder. Because the number of patients eligible for this approach is small, the efficacy can only be demonstrated by a beneficial effect on the pathophysiology in individual patients. Serum bilirubin levels in potential candidates have been monitored since birth, providing an indication of their pathophysiology. Adjuvant phototherapy to prevent brain damage reduces serum unconjugated bilirubin (UCB) levels in CN I patients to the level seen in the milder form of the disease, CN type II. This therapy increases the excretion of UCB, thereby complicating the use of UCB and conjugated bilirubin levels in serum as biomarkers for the gene therapy we try to develop. Therefore, a suitable biomarker that is not affected by phototherapy is currently needed. To this end, we have investigated whether estradiol, ethinylestradiol or ezetimibe could be used as markers for uridine 5'-di-phospho-glucuronosyltransferase isoform 1A1 (UGT1A1) activity restored by AAV gene therapy in Gunn rats, a relevant animal model for CN I. Of these compounds, ezetimibe appeared most suitable because its glucuronidation rate in untreated control Gunn rats is low. Subsequently, ezetimibe glucuronidation was studied in both untreated and AAV-treated Gunn rats and the results suggest that it may serve as a useful serum marker for restored hepatic UGT1A1 activity.

  18. Serine proteases in rodent hippocampus.

    PubMed

    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

    1998-09-04

    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  19. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug developm