Sample records for a1 proteases evidence

  1. Evidence of bovine immunoglobulin G1 (IgG1) protease activity in partially purified culture supernate of Pasteurella haemolytica A1.

    PubMed Central

    Lee, C W; Shewen, P E


    In the bovine respiratory tract, IgG1 is a major secretory immunoglobulin (Ig), and both IgG1 and IgG2 are believed to be important in defense against pneumonic pasteurellosis (shipping fever) in calves. Here we provide evidence for hydrolysis of IgG1 in the presence of partially purified culture supernate (ppCS) from the respiratory pathogen Pasteurella haemolytica A1. Bovine IgG1 was hydrolysed sequentially into three distinct bands (approximately 39, 12, and 7 kDa respectively). Furthermore, partial hydrolysis of bovine IgG2 was observed, but neither bovine IgA nor IgM were affected by incubation with ppCS. These findings suggest that the production of an IgG1-specific protease by P. haemolytica A1 may be a virulence mechanism contributing to the pathogenesis of bovine pneumonic pasteurellosis. Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. PMID:8785718

  2. Proteases.


    Barrett, A J


    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  3. Purification and characterization of an immunoglobulin A1 protease from Bacteroides melaninogenicus.

    PubMed Central

    Mortensen, S B; Kilian, M


    Attention has recently been focused on bacterial proteases with the capacity to cleave immunoglobulin A (IgA proteases) as possible pathogenic factors in bacterial meningitis, gonorrhoea, and destructive periodontal disease. Here, we describe a method for the rapid purification of a specific IgA1 protease from Bacteroides melaninogenicus. The IgA1 protease was purified 6,172-fold with a yield of 9% by ammonium sulfate precipitation, DEAE-ion exchange chromatography, and separation on a preparative TSK-G 3000SWG high-pressure gel permeation chromatography column. The enzyme was specific for human IgA1 and cleaved a prolyl-seryl peptide bond in the hinge region of the alpha 1 chain between residues 223 and 224. The molecular weight of the enzyme was 62,000, the isoelectric point was 5.0, and the Km was 3.4 X 10(-6). The enzyme was active over a broad pH range and had maximal activity at pH 5.0. B. melaninogenicus IgA1 protease was classified as a thiol protease on the basis of its inhibition by traditional protease inhibitors and the fact that it was active only under reducing conditions. Images PMID:6147309

  4. Proteolysis of bacterial membrane proteins by Neisseria gonorrhoeae type 2 immunoglobulin A1 protease.

    PubMed Central

    Shoberg, R J; Mulks, M H


    The immunoglobulin A1 (IgA1) proteases of Neisseria gonorrhoeae have been defined as having human IgA1 as their single permissive substrate. However, in recent years there have been reports of other proteins which are susceptible to the proteolytic activity of these enzymes. To examine the possibility that gonococcal membrane proteins are potential substrates for these enzymes, isolated outer and cytoplasmic membranes of N. gonorrhoeae were treated in vitro with exogenous pure IgA1 protease. Analysis of silver-stained sodium dodecyl sulfate-polyacrylamide gels of outer membranes indicated that there were two outer membrane proteins of 78 and 68 kDa which were cleaved by IgA1 protease in vitro in GCM 740 (a wild-type strain) and in two isogenic IgA1 protease-negative variants. Similar results were observed with a second gonococcal strain, F62, and its isogenic IgA1 protease-negative derivative. When GCM 740 cytoplasmic membranes were treated with protease, three minor proteins of 24.5, 23.5, and 21.5 kDa were cleaved. In addition, when outer membranes of Escherichia coli DH1 were treated with IgA1 protease, several proteins were hydrolyzed. While the identities of all of these proteolyzed proteins are unknown, the data presented indicate that there are several proteins found in the isolated membranes of gram-negative bacteria which are permissive in vitro substrates for gonococcal IgA1 protease. Images PMID:1713195

  5. IgA1 proteases of Haemophilus influenzae: cloning and characterization in Escherichia coli K-12.

    PubMed Central

    Bricker, J; Mulks, M H; Plaut, A G; Moxon, E R; Wright, A


    Haemophilus influenzae is one of several bacterial pathogens known to release IgA1 proteases into the extracellular environment. Each H. influenzae isolate produces one of at least three distinct types of these enzymes that differ in the specific peptide bond they cleave in the hinge region of human IgA1. We have isolated the gene specifying type 1 IgA1 protease from a total genomic library of H. influenzae, subcloned it into plasmid vectors, and introduced these vectors into Escherichia coli K-12. The enzyme synthesized by E. coli was active and had the same specificity as that of the H. influenzae donor. Unlike that of the donor, E. coli protease activity accumulated in the periplasm rather than being transported extracellularly. The position of the protease gene in H. influenzae DNA and its direction of transcription was approximated by deletion mapping. Tn5 insertions, and examination of the polypeptides synthesized by minicells. A 1-kilobase probe excised from the IgA1 protease gene hybridized with DNA restriction fragments of all H. influenzae serogroups but not with DNA of a nonpathogenic H. parainfluenzae species known to be IgA1 protease negative. Images PMID:6341996

  6. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.


    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  7. Protoporphyrins Enhance Oligomerization and Enzymatic Activity of HtrA1 Serine Protease

    PubMed Central

    Jo, Hakryul; Patterson, Victoria; Stoessel, Sean; Kuan, Chia-Yi; Hoh, Josephine


    High temperature requirement protein A1 (HtrA1), a secreted serine protease of the HtrA family, is associated with a multitude of human diseases. However, the exact functions of HtrA1 in these diseases remain poorly understood. We seek to unravel the mechanisms of HtrA1 by elucidating its interactions with chemical or biological modulators. To this end, we screened a small molecule library of 500 bioactive compounds to identify those that alter the formation of extracellular HtrA1 complexes in the cell culture medium. An initial characterization of two novel hits from this screen showed that protoporphyrin IX (PPP-IX), a precursor in the heme biosynthetic pathway, and its metalloporphyrin (MPP) derivatives fostered the oligomerization of HtrA1 by binding to the protease domain. As a result of the interaction with MPPs, the proteolytic activity of HtrA1 against Fibulin-5, a specific HtrA1 substrate in age-related macular degeneration (AMD), was increased. This physical interaction could be abolished by the missense mutations of HtrA1 found in patients with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Furthermore, knockdown of HtrA1 attenuated apoptosis induced by PPP-IX. These results suggest that PPP-IX, or its derivatives, and HtrA1 may function as co-factors whereby porphyrins enhance oligomerization and the protease activity of HtrA1, while active HtrA1 elevates the pro-apoptotic actions of porphyrin derivatives. Further analysis of this interplay may shed insights into the pathogenesis of diseases such as AMD, CARASIL and protoporphyria, as well as effective therapeutic development. PMID:25506911

  8. Proresolving Actions of Synthetic and Natural Protease Inhibitors Are Mediated by Annexin A1.


    Vago, Juliana P; Tavares, Luciana P; Sugimoto, Michelle A; Lima, Graziele Letícia N; Galvão, Izabela; de Caux, Thais R; Lima, Kátia M; Ribeiro, Ana Luíza C; Carneiro, Fernanda S; Nunes, Fernanda Freire C; Pinho, Vanessa; Perretti, Mauro; Teixeira, Mauro M; Sousa, Lirlândia P


    Annexin A1 (AnxA1) is a glucocorticoid-regulated protein endowed with anti-inflammatory and proresolving properties. Intact AnxA1 is a 37-kDa protein that may be cleaved in vivo at the N-terminal region by neutrophil proteases including elastase and proteinase-3, generating the 33-kDa isoform that is largely inactive. In this study, we investigated the dynamics of AnxA1 expression and the effects of synthetic (sivelestat [SIV]; Eglin) and natural (secretory leukocyte protease inhibitor [SLPI]; Elafin) protease inhibitors on the resolution of LPS-induced inflammation. During the settings of LPS inflammation AnxA1 cleavage associated closely with the peak of neutrophil and elastase expression and activity. SLPI expression increased during resolving phase of the pleurisy. Therapeutic treatment of LPS-challenge mice with recombinant human SLPI or Elafin accelerated resolution, an effect associated with increased numbers of apoptotic neutrophils in the pleural exudates, inhibition of elastase, and modulation of the survival-controlling proteins NF-κB and Mcl-1. Similar effects were observed with SIV, which dose-dependently inhibited neutrophil elastase and shortened resolution intervals. Mechanistically, SIV-induced resolution was caspase-dependent, associated to increased levels of intact AnxA1 and decreased expression of NF-κB and Mcl-1. The proresolving effect of antiproteases was also observed in a model of monosodium urate crystals-induced inflammation. SIV skewed macrophages toward resolving phenotypes and enhanced efferocytosis of apoptotic neutrophils. A neutralizing antiserum against AnxA1 and a nonselective antagonist of AnxA1 receptor abolished the accelerated resolution promoted by SIV. Collectively, these results show that elastase inhibition not only inhibits inflammation but actually promotes resolution, and this response is mediated by protection of endogenous intact AnxA1 with ensuing augmentation of neutrophil apoptosis.

  9. Immunoglobulins in Nasal Secretions of Healthy Humans: Structural Integrity of Secretory Immunoglobulin A1 (IgA1) and Occurrence of Neutralizing Antibodies to IgA1 Proteases of Nasal Bacteria

    PubMed Central

    Kirkeby, Line; Rasmussen, Trine Tang; Reinholdt, Jesper; Kilian, Mogens


    isolates were detected in secretions from five of the seven subjects but not in those from two subjects harboring IgA1 protease-producing S. mitis biovar 1. α-chain fragments different from Fcα and Fdα were detected in some samples, possibly reflecting nonspecific proteolytic activity of microbial or host origin. These results add to previous evidence for a role of secretory immunity in the defense of the nasal mucosa but do not help identify conditions under which bacterial IgA1 proteases may interfere with this defense. PMID:10618273

  10. Evidence for possible involvement of an elastolytic serine protease in aspergillosis.

    PubMed Central

    Kolattukudy, P E; Lee, J D; Rogers, L M; Zimmerman, P; Ceselski, S; Fox, B; Stein, B; Copelan, E A


    A number of isolates of Aspergillus fumigatus obtained from the hospital environment produced extracellular elastolytic activity. This activity was found to be catalyzed by a single 33-kDa protein which was purified and characterized to be a serine protease. A. fumigatus, when grown on the insoluble structural material obtained from murine and bovine lung, produced the same extracellular 33-kDa elastolytic protease, indicating that this enzyme is likely to be produced when the organism infects the lung. Polymerase chain reaction with an oligonucleotide primer based on the N-terminal amino acid sequence of the elastolytic enzyme yielded a cDNA which was cloned and sequenced. The active serine motif showed more similarity to subtilisin than to mammalian elastase. The amino acid sequence showed 80% identity to the alkaline protease from Aspergillus oryzae. Screening of hospital isolates of Aspergillus flavus showed great variation in the production of elastolytic activity and a much lower level of activity than that produced by A. fumigatus. The elastolytic protease from A. flavus was shown to be a serine protease susceptible to modification and inactivation by active serine and histidine-directed reagents. This protease cross-reacted with the antibodies prepared against the elastolytic protease from A. fumigatus. Immunogold localization of the elastolytic enzyme showed that A. fumigatus germinating and penetrating into the lungs of neutropenic mice secreted the elastolytic protease. An elastase-deficient mutant generated from a highly virulent isolate of A. fumigatus caused drastically reduced mortality when nasally introduced into the lung of neutropenic mice. All of the evidence suggests that extracellular elastolytic protease is a significant virulence factor in invasive aspergillosis. Images PMID:8500876

  11. Structural Evidence for Regulation and Specificity of Flaviviral Proteases and Evolution of the Flaviviridae Fold

    SciTech Connect

    Aleshin,A.; Shiryaev, S.; Strongin, A.; Liddington, R.


    Pathogenic members of the flavivirus family, including West Nile Virus (WNV) and Dengue Virus (DV), are growing global threats for which there are no specific treatments. The two-component flaviviral enzyme NS2B-NS3 cleaves the viral polyprotein precursor within the host cell, a process that is required for viral replication. Here, we report the crystal structure of WNV NS2B-NS3pro both in a substrate-free form and in complex with the trypsin inhibitor aprotinin/BPTI. We show that aprotinin binds in a substrate-mimetic fashion in which the productive conformation of the protease is fully formed, providing evidence for an 'induced fit' mechanism of catalysis and allowing us to rationalize the distinct substrate specificities of WNV and DV proteases. We also show that the NS2B cofactor of WNV can adopt two very distinct conformations and that this is likely to be a general feature of flaviviral proteases, providing further opportunities for regulation. Finally, by comparing the flaviviral proteases with the more distantly related Hepatitis C virus, we provide insights into the evolution of the Flaviviridae fold. Our work should expedite the design of protease inhibitors to treat a range of flaviviral infections.

  12. Serine protease HtrA1 accumulates in corneal transforming growth factor beta induced protein (TGFBIp) amyloid deposits

    PubMed Central

    Karring, Henrik; Poulsen, Ebbe Toftgaard; Runager, Kasper; Thøgersen, Ida B.; Klintworth, Gordon K.; Højrup, Peter


    Purpose Specific mutations in the transforming growth factor beta induced (TGFBI) gene are associated with lattice corneal dystrophy (LCD) type 1 and its variants. In this study, we performed an in-depth proteomic analysis of human corneal amyloid deposits associated with the heterozygous A546D mutation in TGFBI. Methods Corneal amyloid deposits and the surrounding corneal stroma were procured by laser capture microdissection from a patient with an A546D mutation in TGFBI. Proteins in the captured corneal samples and healthy corneal stroma were identified with liquid chromatography-tandem mass spectrometry and quantified by calculating exponentially modified Protein Abundance Index values. Mass spectrometry data were further compared for identifying enriched regions of transforming growth factor beta induced protein (TGFBIp/keratoepithelin/βig-h3) and detecting proteolytic cleavage sites in TGFBIp. Results A C-terminal fragment of TGFBIp containing residues Y571-R588 derived from the fourth fasciclin 1 domain (FAS1–4), serum amyloid P-component, apolipoprotein A-IV, clusterin, and serine protease HtrA1 were significantly enriched in the amyloid deposits compared to the healthy cornea. The proteolytic cleavage sites in TGFBIp from the diseased cornea are in accordance with the activity of serine protease HtrA1. We also identified small amounts of the serine protease kallikrein-14 in the amyloid deposits. Conclusions Corneal amyloid caused by the A546D mutation in TGFBI involves several proteins associated with other varieties of amyloidosis. The proteomic data suggest that the sequence 571-YHIGDEILVSGGIGALVR-588 contains the amyloid core of the FAS1–4 domain of TGFBIp and point at serine protease HtrA1 as the most likely candidate responsible for the proteolytic processing of amyloidogenic and aggregated TGFBIp, which explains the accumulation of HtrA1 in the amyloid deposits. With relevance to identifying serine proteases, we also found glia-derived nexin

  13. Helical apolipoproteins stabilize ATP-binding cassette transporter A1 by protecting it from thiol protease-mediated degradation.


    Arakawa, Reijiro; Yokoyama, Shinji


    ATP-binding cassette transporter (ABC) A1 was increased by apolipoprotein A-I without an increase of its message in THP-1 cells. The pulse label study demonstrated that apoA-I retarded degradation of ABCA1. Similar changes were demonstrated by apoA-II, but the effect of high density lipoprotein was almost negligible on the basis of equivalent protein concentration. Thiol protease inhibitors (leupeptin and N-acetyl-Leu-Leu-norleucinal (ALLN)) increased ABCA1 and slowed its decay in the cells, whereas none of the proteosome-specific inhibitor lactacystin, other protease inhibitors, or the lysosomal inhibitor NH(4)Cl showed such effects. The effects of apoA-I and ALLN were additive for the increase of ABCA1, and the apoA-I-mediated cellular lipid release was enhanced by ALLN. The data suggest that ABCA1 is rapidly degraded by a thiol protease(s) in the cells unless helical apolipoproteins in their lipid-free form stabilize ABCA1 by protecting it from protease-mediated degradation.

  14. Active-site gating regulates substrate selectivity in a chymotrypsin-like serine protease the structure of haemophilus influenzae immunoglobulin A1 protease.


    Johnson, Troy A; Qiu, Jiazhou; Plaut, Andrew G; Holyoak, Todd


    We report here the first structure of a member of the immunoglobulin A protease (IgAP) family at 1.75-A resolution. This protease is a founding member of the type V (autotransporter) secretion system and is considered a virulence determinant among the bacteria expressing the enzyme. The structure of the enzyme fits that of a classic autotransporter in which several unique domains necessary for protein function are appended to a central, 100-A-long beta-helical domain. The N-terminal domain of the IgAP is found to possess a chymotrypsin-like fold. However, this catalytic domain contains a unique loop D that extends over the active site acting as a lid, gating substrate access. The data presented provide a structural basis for the known ability of IgAPs to cleave only the proline/serine/threonine-rich hinge peptide unique to IgA1 (isotype 1) in the context of the intact fold of the immunoglobulin. Based upon the structural data, as well as molecular modeling, a model suggesting that the unique extended loop D in this IgAP sterically occludes the active-site binding cleft in the absence of immunoglobulin binding is presented. Only in the context of binding of the IgA1-Fc domain in a valley formed between the N-terminal protease domain and another domain appended to the beta-helix spine (domain 2) is the lid stabilized in an open conformation. The stabilization of this open conformation through Fc association subsequently allows access of the hinge peptide to the active site, resulting in recognition and cleavage of the substrate.

  15. Similar proportions of immunoglobulin A1 (IgA1) protease-producing streptococci in initial dental plaque of selectively IgA-deficient and normal individuals.

    PubMed Central

    Reinholdt, J; Friman, V; Kilian, M


    By comparing the initial colonization of cleaned teeth in immunoglobulin A (IgA)-deficient, IgM-compensating individuals with that in normal individuals, no significant difference in the proportion of IgA1 protease-producing streptococci was found. Thus, as one of several bacterial means of immune evasion, the ability to cleave secretory IgA1 does not appear essential to the successful adherence of oral streptococci. PMID:8359924

  16. Network Analyses Reveal Pervasive Functional Regulation Between Proteases in the Human Protease Web

    PubMed Central

    Fortelny, Nikolaus; Cox, Jennifer H.; Kappelhoff, Reinhild; Starr, Amanda E.; Lange, Philipp F.; Pavlidis, Paul; Overall, Christopher M.


    Proteolytic processing is an irreversible posttranslational modification affecting a large portion of the proteome. Protease-cleaved mediators frequently exhibit altered activity, and biological pathways are often regulated by proteolytic processing. Many of these mechanisms have not been appreciated as being protease-dependent, and the potential in unraveling a complex new dimension of biological control is increasingly recognized. Proteases are currently believed to act individually or in isolated cascades. However, conclusive but scattered biochemical evidence indicates broader regulation of proteases by protease and inhibitor interactions. Therefore, to systematically study such interactions, we assembled curated protease cleavage and inhibition data into a global, computational representation, termed the protease web. This revealed that proteases pervasively influence the activity of other proteases directly or by cleaving intermediate proteases or protease inhibitors. The protease web spans four classes of proteases and inhibitors and so links both recently and classically described protease groups and cascades, which can no longer be viewed as operating in isolation in vivo. We demonstrated that this observation, termed reachability, is robust to alterations in the data and will only increase in the future as additional data are added. We further show how subnetworks of the web are operational in 23 different tissues reflecting different phenotypes. We applied our network to develop novel insights into biologically relevant protease interactions using cell-specific proteases of the polymorphonuclear leukocyte as a system. Predictions from the protease web on the activity of matrix metalloproteinase 8 (MMP8) and neutrophil elastase being linked by an inactivating cleavage of serpinA1 by MMP8 were validated and explain perplexing Mmp8 −/− versus wild-type polymorphonuclear chemokine cleavages in vivo. Our findings supply systematically derived and

  17. Characterization of Bactrocera dorsalis serine proteases and evidence for their indirect role in insecticide tolerance.


    Hou, Ming-Zhe; Shen, Guang-Mao; Wei, Dong; Li, Ya-Li; Dou, Wei; Wang, Jin-Jun


    The oriental fruit fly Bactrocera dorsalis (Hendel) causes devastating losses to agricultural crops world-wide and is considered to be an economically important pest. Little is known about the digestive enzymes such as serine proteases (SPs) in B. dorsalis, which are important both for energy supply and mitigation of fitness cost associated with insecticide tolerance. In this study, we identified five SP genes in the midgut of B. dorsalis, and the alignments of their deduced amino acid sequences revealed the presence of motifs conserved in the SP superfamily. Phylogenetic analyses with known SPs from other insect species suggested that three of them were trypsin-like proteases. Analyses of the expression profiles among the different developmental stages showed that all five genes were most abundant in larvae than in other stages. When larvae were continuously fed on diet containing 0.33 μg/g β-Cypermethrin, expression of all five genes were upregulated in the midgut but the larval development was delayed. Biochemical assays were consistent with the increased protease activity exhibited by SPs in the midgut after treatment with β-Cypermethrin. Taken together, these findings provide evidence for the hypothesis that enhanced SP activity may play an indirect role in relieving the toxicity stress of insecticide in B. dorsalis.

  18. Characterization of Bactrocera dorsalis Serine Proteases and Evidence for Their Indirect Role in Insecticide Tolerance

    PubMed Central

    Hou, Ming-Zhe; Shen, Guang-Mao; Wei, Dong; Li, Ya-Li; Dou, Wei; Wang, Jin-Jun


    The oriental fruit fly Bactrocera dorsalis (Hendel) causes devastating losses to agricultural crops world-wide and is considered to be an economically important pest. Little is known about the digestive enzymes such as serine proteases (SPs) in B. dorsalis, which are important both for energy supply and mitigation of fitness cost associated with insecticide tolerance. In this study, we identified five SP genes in the midgut of B. dorsalis, and the alignments of their deduced amino acid sequences revealed the presence of motifs conserved in the SP superfamily. Phylogenetic analyses with known SPs from other insect species suggested that three of them were trypsin-like proteases. Analyses of the expression profiles among the different developmental stages showed that all five genes were most abundant in larvae than in other stages. When larvae were continuously fed on diet containing 0.33 μg/g β-Cypermethrin, expression of all five genes were upregulated in the midgut but the larval development was delayed. Biochemical assays were consistent with the increased protease activity exhibited by SPs in the midgut after treatment with β-Cypermethrin. Taken together, these findings provide evidence for the hypothesis that enhanced SP activity may play an indirect role in relieving the toxicity stress of insecticide in B. dorsalis. PMID:24566149

  19. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.


    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard


    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  20. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    PubMed Central

    De Paolis, Francesca; Beghetto, Elisa; Spadoni, Andrea; Montagnani, Francesca; Felici, Franco; Oggioni, Marco R; Gargano, Nicola


    Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA) of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery. PMID:18088426

  1. Genetic and biochemical analysis of gonococcal IgA1 protease: cloning in Escherichia coli and construction of mutants of gonococci that fail to produce the activity.

    PubMed Central

    Koomey, J M; Gill, R E; Falkow, S


    The biological significance of bacterial extracellular proteases that specifically cleave human IgA1 is unknown. We have prepared a gene bank of gonococcal chromosomal DNA in Escherichia coli K-12 using a cosmid cloning system. Among these clones, we have identified and characterized an E. coli strain that elaborates an extracellular endopeptidase that is indistinguishable from gonococcal IgA1 protease in its substrate specificity and action on human IgA1. Analysis of recombinant plasmids and examination of plasmid-specific peptides in minicells have shown that the IgA1 protease activity in E. coli is associated with expression of a Mr 140,000 peptide. We have isolated IgA1 protease-deficient mutants of Neisseria gonorrhoeae by reintroduction of physically defined deletions of the cloned gene into the gonococcal chromosome by transformation. Images PMID:6818556

  2. The trimeric serine protease HtrA1 forms a cage-like inhibition complex with an anti-HtrA1 antibody.


    Ciferri, Claudio; Lipari, Michael T; Liang, Wei-Ching; Estevez, Alberto; Hang, Julie; Stawicki, Scott; Wu, Yan; Moran, Paul; Elliott, Mike; Eigenbrot, Charles; Katschke, Kenneth J; van Lookeren Campagne, Menno; Kirchhofer, Daniel


    High temperature requirement A1 (HtrA1) is a trypsin-fold serine protease implicated in the progression of age-related macular degeneration (AMD). Our interest in an antibody therapy to neutralize HtrA1 faces the complication that the target adopts a trimeric arrangement, with three active sites in close proximity. In the present study, we describe antibody 94, obtained from a human antibody phage display library, which forms a distinct macromolecular complex with HtrA1 and inhibits the enzymatic activity of recombinant and native HtrA1 forms. Using biochemical methods and negative-staining EM we were able to elucidate the molecular composition of the IgG94 and Fab94 complexes and the associated inhibition mechanism. The 246-kDa complex between the HtrA1 catalytic domain trimer (HtrA1_Cat) and Fab94 had a propeller-like organization with one Fab bound peripherally to each protomer. Low-resolution EM structures and epitope mapping indicated that the antibody binds to the surface-exposed loops B and C of the catalytic domain, suggesting an allosteric inhibition mechanism. The HtrA1_Cat-IgG94 complex (636 kDa) is a cage-like structure with three centrally located IgG94 molecules co-ordinating two HtrA1_Cat trimers and the six active sites pointing into the cavity of the cage. In both complexes, all antigen-recognition regions (paratopes) are found to bind one HtrA1 protomer and all protomers are bound by a paratope, consistent with the complete inhibition of enzyme activity. Therefore, in addition to its potential therapeutic usefulness, antibody 94 establishes a new paradigm of multimeric serine protease inhibition.

  3. IgA1 Protease Treatment Reverses Mesangial Deposits and Hematuria in a Model of IgA Nephropathy.


    Lechner, Sebastian M; Abbad, Lilia; Boedec, Erwan; Papista, Christina; Le Stang, Marie-Bénédicte; Moal, Christelle; Maillard, Julien; Jamin, Agnès; Bex-Coudrat, Julie; Wang, Yong; Li, Aiqun; Martini, Paolo G V; Monteiro, Renato C; Berthelot, Laureline


    IgA nephropathy (IgAN), characterized by mesangial IgA1 deposits, is a leading cause of renal failure worldwide. IgAN pathogenesis involves circulating hypogalactosylated IgA1 complexed with soluble IgA Fc receptor I (sCD89) and/or anti-hypogalactosylated-IgA1 autoantibodies, but no specific treatment is available for IgAN. The absence of IgA1 and CD89 homologs in the mouse has precluded in vivo proof-of-concept studies of specific therapies targeting IgA1. However, the α1KI‑CD89Tg mouse model of IgAN, which expresses human IgA1 and human CD89, allows in vivo testing of recombinant IgA1 protease (IgA1‑P), a bacterial protein that selectively cleaves human IgA1. Mice injected with IgA1‑P (1-10 mg/kg) had Fc fragments of IgA1 in both serum and urine, associated with a decrease in IgA1-sCD89 complexes. Levels of mesangial IgA1 deposits and the binding partners of these deposits (sCD89, transferrin receptor, and transglutaminase 2) decreased markedly 1 week after treatment, as did the levels of C3 deposition, CD11b(+) infiltrating cells, and fibronectin. Antiprotease antibodies did not significantly alter IgA1‑P activity. Moreover, hematuria consistently decreased after treatment. In conclusion, IgA1‑P strongly diminishes human IgA1 mesangial deposits and reduces inflammation, fibrosis, and hematuria in a mouse IgAN model, and therefore may be a plausible treatment for patients with IgAN. Copyright © 2016 by the American Society of Nephrology.

  4. Thermodynamic analysis of unusually thermostable CutA1 protein from human brain and its protease susceptibility.


    Bagautdinov, Bagautdin; Matsuura, Yoshinori; Yamamoto, Hitoshi; Sawano, Masahide; Ogasahara, Kyoko; Takehira, Michiyo; Kunishima, Naoki; Katoh, Etsuko; Yutani, Katsuhide


    Unusually stable proteins are a disadvantage for the metabolic turnover of proteins in cells. The CutA1 proteins from Pyrococcus horikoshii and from Oryza sativa (OsCutA1) have unusually high denaturation temperatures (Td) of nearly 150 and 100 °C, respectively, at pH 7.0. It seemed that the CutA1 protein from the human brain (HsCutA1) also has a remarkably high stability. Therefore, the thermodynamic stabilities of HsCutA1 and its protease susceptibility were examined. The Td was remarkably high, being over 95 °C at pH 7.0. The unfolding Gibbs energy (ΔG(0)H2O) was 174 kJ/mol at 37 °C from the denaturant denaturation. The thermodynamic analysis showed that the unfolding enthalpy and entropy values of HsCutA1 were considerably lower than those of OsCutA1 with a similar stability to HsCutA1, which should be related to flexibility of the unstructured properties in both N- and C-terminals of HsCutA1. HsCutA1 was almost completely digested after 1-day incubation at 37 °C by subtilisin, although OsCutA1 was hardly digested at the same conditions. These results indicate that easily available fragmentation of HsCutA1 with remarkably high thermodynamic stability at the body temperature should be important for its protein catabolism in the human cells.

  5. Protease inhibition by Heterodera glycines cyst content: evidence for effects on the Meloidogyne incognita proteasome

    USDA-ARS?s Scientific Manuscript database

    Proteases from Heterodera glycines and Meloidogyne incognita juveniles were inhibited by heat-stable content of H. glycines female cysts (HglCE), and by the plant polyphenol epigallocatechin gallate (EGCG). General protease activities detected using the nematode peptide KSAYMRFa were inhibited by EG...

  6. Crystallographic and kinetic evidence of allostery in a trypsin-like protease.


    Niu, Weiling; Chen, Zhiwei; Gandhi, Prafull S; Vogt, Austin D; Pozzi, Nicola; Pelc, Leslie A; Zapata, Fatima; Di Cera, Enrico


    Protein allostery is based on the existence of multiple conformations in equilibrium linked to distinct functional properties. Although evidence of allosteric transitions is relatively easy to identify by functional studies, structural detection of a pre-existing equilibrium between alternative conformations remains challenging even for textbook examples of allosteric proteins. Kinetic studies show that the trypsin-like protease thrombin exists in equilibrium between two conformations where the active site is either collapsed (E*) or accessible to substrate (E). However, structural demonstration that the two conformations exist in the same enzyme construct free of ligands has remained elusive. Here we report the crystal structure of the thrombin mutant N143P in the E form, which complements the recently reported structure in the E* form, and both the E and E* forms of the thrombin mutant Y225P. The side chain of W215 moves 10.9 Å between the two forms, causing a displacement of 6.6 Å of the entire 215-217 segment into the active site that in turn opens or closes access to the primary specificity pocket. Rapid kinetic measurements of p-aminobenzamidine binding to the active site confirm the existence of the E*-E equilibrium in solution for wild-type and the mutants N143P and Y225P. These findings provide unequivocal proof of the allosteric nature of thrombin and lend strong support to the recent proposal that the E*-E equilibrium is a key property of the trypsin fold.

  7. Internalization and trafficking of nontypeable Haemophilus influenzae in human respiratory epithelial cells and roles of IgA1 proteases for optimal invasion and persistence.


    Clementi, Cara F; Håkansson, Anders P; Murphy, Timothy F


    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells.

  8. Internalization and Trafficking of Nontypeable Haemophilus influenzae in Human Respiratory Epithelial Cells and Roles of IgA1 Proteases for Optimal Invasion and Persistence

    PubMed Central

    Clementi, Cara F.; Håkansson, Anders P.


    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells. PMID:24218477

  9. Occurrence and evolution of the paralogous zinc metalloproteases IgA1 protease, ZmpB, ZmpC, and ZmpD in Streptococcus pneumoniae and related commensal species.


    Bek-Thomsen, Malene; Poulsen, Knud; Kilian, Mogens


    The distribution, genome location, and evolution of the four paralogous zinc metalloproteases, IgA1 protease, ZmpB, ZmpC, and ZmpD, in Streptococcus pneumoniae and related commensal species were studied by in silico analysis of whole genomes and by activity screening of 154 representatives of 20 species. ZmpB was ubiquitous in the Mitis and Salivarius groups of the genus Streptococcus and in the genera Gemella and Granulicatella, with the exception of a fragmented gene in Streptococcus thermophilus, the only species with a nonhuman habitat. IgA1 protease activity was observed in all members of S. pneumoniae, S. pseudopneumoniae, S. oralis, S. sanguinis, and Gemella haemolysans, was variably present in S. mitis and S. infantis, and absent in S. gordonii, S. parasanguinis, S. cristatus, S. oligofermentans, S. australis, S. peroris, and S. suis. Phylogenetic analysis of 297 zmp sequences and representative housekeeping genes provided evidence for an unprecedented selection for genetic diversification of the iga, zmpB, and zmpD genes in S. pneumoniae and evidence of very frequent intraspecies transfer of entire genes and combination of genes. Presumably due to their adaptation to a commensal lifestyle, largely unaffected by adaptive mucosal immune factors, the corresponding genes in commensal streptococci have remained conserved. The widespread distribution and significant sequence diversity indicate an ancient origin of the zinc metalloproteases predating the emergence of the humanoid species. zmpB, which appears to be the ancestral gene, subsequently duplicated and successfully diversified into distinct functions, is likely to serve an important but yet unknown housekeeping function associated with the human host. The paralogous zinc metalloproteases IgA1 protease, ZmpB, ZmpC, and ZmpD have been identified as crucial for virulence of the human pathogen Streptococcus pneumoniae. This study maps the presence of the corresponding genes and enzyme activities in S

  10. Correlation Between Expression of High Temperature Requirement Serine Protease A1 (HtrA1) in Nucleus Pulposus and T2 Value of Magnetic Resonance Imaging.


    Li, Dapeng; Yue, Jiawei; Jiang, Lu; Huang, Yonghui; Sun, Jifu; Wu, Yan


    BACKGROUND Degrading enzymes play an important role in the process of disc degeneration. The objective of this study was to investigate the correlation between the expression of high temperature requirement serine protease A1 (HtrA1) in the nucleus pulposus and the T2 value of the nucleus pulposus region in magnetic resonance imaging (MRI). MATERIAL AND METHODS Thirty-six patients who had undergone surgical excision of the nucleus pulposus were examined by MRI before surgery. Pfirrmann grading of the target intervertebral disc was performed according to the sagittal T2-weighted imaging, and the T2 value of the target nucleus pulposus was measured according to the median sagittal T2 mapping. The correlation between the Pfirrmann grade and the T2 value was analyzed. The expression of HtrA1 in the nucleus pulposus was analyzed by RT-PCR and Western blot. The correlation between the expression of HtrA1 and the T2 value was analyzed. RESULTS The T2 value of the nucleus pulposus region was 33.11-167.91 ms, with an average of 86.64±38.73 ms. According to Spearman correlation analysis, there was a rank correlation between T2 value and Pfirrmann grade (P<0.0001), and the correlation coefficient (rs)=-0.93617. There was a linear correlation between the mRNA level of HtrA1 and T2 value in nucleus pulposus tissues (a=3.88, b=-0.019, F=112.63, P<0.0001), normalized regression coefficient=-0.88. There was a linear correlation between the expression level of HtrA1 protein and the T2 value in the nucleus pulposus tissues (a=3.30, b=-0.016, F=93.15, P<0.0001) and normalized regression coefficient=-0.86. CONCLUSIONS The expression of HtrA1 was strongly related to the T2 value, suggesting that HtrA1 plays an important role in the pathological process of intervertebral disc degeneration.

  11. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy

    PubMed Central

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming


    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN. PMID:27485391

  12. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy.


    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming


    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN.

  13. Evidence that hatching enzyme of the sea urchin Strongylocentrotus purpuratus is a chymotrypsin-like protease.


    Post, L L; Schuel, R; Schuel, H


    The sea urchin blastula secretes a hatching enzyme (HE) that dissolves the fertilization envelope. HE was collected from the supernatant seawater of cultures of hatched Strongylocentrotus purpuratus blastulae, and concentrated 20 times by ultrafiltration. The proteolytic activity of HE using casein as substrate was inhibited by the chymotrypsin inhibitors, chymostatin and N-tosyl-L-phenylalanine chloromethyl ketone. The activity was not inhibited by inhibitors (antipain, elastatinal, pepstatin, phosphoramidon, soybean trypsin inhibitor, and N alpha-p-tosyl-L-lysine chloromethyl ketone) of other types of proteases. HE did not hydrolyze the synthetic trypsin substrate, alpha-N-benzoyl-L-arginine ethyl ester, but did hydrolyze the synthetic substrate of chymotrypsin, N-benzoyl-L-tyrosine ethyl ester (BTEE). The BTEEase activity of HE was completely inhibited by the chymotrypsin inhibitors chymostatin and 2-nitro-4-carboxyphenyl N,N-diphenylcarbamate (NCDC). Chymostatin inhibited the natural hatching of sea urchin blastulae. Application of HE to freshly fertilized sea urchin eggs, 2 h after insemination, caused premature dispersal of the hardened fertilization envelope. Chymostatin and NCDC inhibited HE-induced lysis of the fertilization envelope, while inhibitors of other types of proteases were ineffective. These data suggest that sea urchin HE is a chymotrypsin-like protease we call "chymotrypsin."

  14. Evidence for inactivation of cysteine proteases by reactive carbonyls via glycation of active site thiols

    PubMed Central

    Zeng, Jingmin; Dunlop, Rachael A.; Rodgers, Kenneth J.; Davies, Michael J.


    Hyperglycaemia, triose phosphate decomposition and oxidation reactions generate reactive aldehydes in vivo. These compounds react non-enzymatically with protein side chains and N-terminal amino groups to give adducts and cross-links, and hence modified proteins. Previous studies have shown that free or protein-bound carbonyls inactivate glyceraldehyde-3-phosphate dehydrogenase with concomitant loss of thiol groups [Morgan, Dean and Davies (2002) Arch. Biochem. Biophys. 403, 259–269]. It was therefore hypothesized that modification of lysosomal cysteine proteases (and the structurally related enzyme papain) by free and protein-bound carbonyls may modulate the activity of these components of the cellular proteolytic machinery responsible for the removal of modified proteins and thereby contribute to a decreased removal of modified proteins from cells. It is shown that MGX (methylglyoxal), GO (glyoxal) and glycolaldehyde, but not hydroxyacetone and glucose, inhibit catB (cathepsin B), catL (cathepsin L) and catS (cathepsin S) activity in macrophage cell lysates, in a concentration-dependent manner. Protein-bound carbonyls produced similar inhibition with both cell lysates and intact macrophage cells. Inhibition was also observed with papain, with this paralleled by loss of the active site cysteine residue and formation of the adduct species S-carboxymethylcysteine, from GO, in a concentration-dependent manner. Inhibition of autolysis of papain by MGX, along with cross-link formation, was detected by SDS/PAGE. Treatment of papain and catS with the dialdehyde o-phthalaldehyde resulted in enzyme inactivation and an intra-molecular active site cysteine–lysine cross-link. These results demonstrate that reactive aldehydes inhibit cysteine proteases by modification of the active site cysteine residue. This process may contribute to the accumulation of modified proteins in tissues of people with diabetes and age-related pathologies, including atherosclerosis, cataract and

  15. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.


    Singh, Amanjot; Sahi, Chandan; Grover, Anil


    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice.

  16. Structural Evidence for Effectiveness of Darunavir and Two Related Antiviral Inhibitors against HIV-2 Protease

    SciTech Connect

    Kovalevsky, Andrey Y.; Louis, John M.; Aniana, Annie; Ghosh, Arun K.; Weber, Irene T.


    No drug has been targeted specifically for HIV-2 (human immunodeficiency virus type 2) infection despite its increasing prevalence worldwide. The antiviral HIV-1 (human immunodeficiency virus type 1) protease (PR) inhibitor darunavir and the chemically related GRL98065 and GRL06579A were designed with the same chemical scaffold and different substituents at P2 and P2' to optimize polar interactions for HIV-1 PR (PR1). These inhibitors are also effective antiviral agents for HIV-2-infected cells. Therefore, crystal structures of HIV-2 PR (PR2) complexes with the three inhibitors have been solved at 1.2-{angstrom} resolution to analyze the molecular basis for their antiviral potency. Unusually, the crystals were grown in imidazole and zinc acetate buffer, which formed interactions with the PR2 and the inhibitors. Overall, the structures were very similar to the corresponding inhibitor complexes of PR1 with an RMSD of 1.1 {angstrom} on main-chain atoms. Most hydrogen-bond and weaker C-H...O interactions with inhibitors were conserved in the PR2 and PR1 complexes, except for small changes in interactions with water or disordered side chains. Small differences were observed in the hydrophobic contacts for the darunavir complexes, in agreement with relative inhibition of the two PRs. These near-atomic-resolution crystal structures verify the inhibitor potency for PR1 and PR2 and will provide the basis for the development of antiviral inhibitors targeting PR2.

  17. Occurrence and Evolution of the Paralogous Zinc Metalloproteases IgA1 Protease, ZmpB, ZmpC, and ZmpD in Streptococcus pneumoniae and Related Commensal Species

    PubMed Central

    Bek-Thomsen, Malene; Poulsen, Knud; Kilian, Mogens


    ABSTRACT The distribution, genome location, and evolution of the four paralogous zinc metalloproteases, IgA1 protease, ZmpB, ZmpC, and ZmpD, in Streptococcus pneumoniae and related commensal species were studied by in silico analysis of whole genomes and by activity screening of 154 representatives of 20 species. ZmpB was ubiquitous in the Mitis and Salivarius groups of the genus Streptococcus and in the genera Gemella and Granulicatella, with the exception of a fragmented gene in Streptococcus thermophilus, the only species with a nonhuman habitat. IgA1 protease activity was observed in all members of S. pneumoniae, S. pseudopneumoniae, S. oralis, S. sanguinis, and Gemella haemolysans, was variably present in S. mitis and S. infantis, and absent in S. gordonii, S. parasanguinis, S. cristatus, S. oligofermentans, S. australis, S. peroris, and S. suis. Phylogenetic analysis of 297 zmp sequences and representative housekeeping genes provided evidence for an unprecedented selection for genetic diversification of the iga, zmpB, and zmpD genes in S. pneumoniae and evidence of very frequent intraspecies transfer of entire genes and combination of genes. Presumably due to their adaptation to a commensal lifestyle, largely unaffected by adaptive mucosal immune factors, the corresponding genes in commensal streptococci have remained conserved. The widespread distribution and significant sequence diversity indicate an ancient origin of the zinc metalloproteases predating the emergence of the humanoid species. zmpB, which appears to be the ancestral gene, subsequently duplicated and successfully diversified into distinct functions, is likely to serve an important but yet unknown housekeeping function associated with the human host. PMID:23033471

  18. Comparison of HCV NS3 protease and NS5B polymerase inhibitor activity in 1a, 1b and 2a replicons and 2a infectious virus.


    Paulson, Matthew S; Yang, Huiling; Shih, I-hung; Feng, Joy Y; Mabery, Eric M; Robinson, Margaret F; Zhong, Weidong; Delaney, William E


    The hepatitis C virus infection system represents an important new tool for drug discovery. In this study, we compared the in vitro antiviral efficacy of several NS3 and NS5B inhibitors in genotype 1a, 1b, and 2a replicons and in the 2a infectious virus system. The nucleoside inhibitor 2'-C-methyl adenosine showed similar efficacy in each system tested. Three non-nucleoside inhibitors had small differences in potency between genotype 1a and 1b. In contrast, there was a dramatic loss of potency for these non-nucleoside inhibitors in the genotype 2a replicon, 2a infectious virus, and 2a NS5B biochemical assays. The protease inhibitor BILN-2061 had similar efficacy against 1a and 1b replicons but was 61-109-fold less potent against the 2a replicon and virus, respectively. VX-950, a covalent protease inhibitor, had similar efficacy (<3-fold changes in EC(50)) regardless of genotype or subtype. Importantly, we observed a significant correlation (p<0.0001) in antiviral potency between the 2a replicon and 2a infectious virus for all classes of compounds tested.

  19. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.


    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  20. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.


    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  1. Changes in expression of human serine protease HtrA1, HtrA2 and HtrA3 genes in benign and malignant thyroid tumors.


    Zurawa-Janicka, Dorota; Kobiela, Jarosław; Galczynska, Natalia; Stefaniak, Tomasz; Lipinska, Barbara; Lachinski, Andrzej; Skorko-Glonek, Joanna; Narkiewicz, Joanna; Proczko-Markuszewska, Monika; Sledzinski, Zbigniew


    Human HtrA proteins are serine proteases involved in essential physiological processes. HtrA1 and HtrA3 function as tumor suppressors and inhibitors of the TGF-β signaling pathway. HtrA2 regulates mitochondrial homeostasis and plays a pivotal role in the induction of apoptosis. The aim of the study was to determine whether the HtrA proteins are involved in thyroid carcinogenesis. We used the immunoblotting technique to estimate protein levels of HtrA1, HtrA2, long and short variants of HtrA3 (HtrA3-L and HtrA3-S) and TGF-β1 in tissues of benign and malignant thyroid lesions, and control groups. We found that the levels of HtrA2 and HtrA3-S were higher in thyroid malignant tumors compared to normal tissues and benign tumors. The HtrA3-L level was increased in malignant tumor tissues compared to benign tumor tissues and control tissues from patients with benign lesions, and elevated in normal tissues from patients with thyroid carcinoma compared to normal tissues from patients with benign lesions. We also compared levels of HtrA proteins in follicular thyroid carcinoma (FTC) and papillary thyroid carcinoma (PTC) and found that these types of carcinoma differed in the expression of HtrA3-S and HtrA1. These results indicate the implication of HtrA proteins in thyroid carcinogenesis suggest that HtrA3 variants may play different roles in cancer development, and that the increased HtrA3-L levels in thyroid tissue could be correlated with the development of malignant lesions. The TGF-β1 levels in tumor tissues were not significantly altered compared to control tissues.

  2. Characterization of an extracellular subtilisin protease of Rhizopus microsporus and evidence for its expression during invasive rhinoorbital mycosis.


    Spreer, Annette; Rüchel, Reinhard; Reichard, Utz


    An endoprotease Arp (alkaline Rhizopus protease) was identified and purified to virtual homogeneity from the culture supernatant of an isolate of Rhizopus microsporus var. rhizopodiformis recovered from a non-fatal case of rhinoorbital mucormycosis. N-terminal sequencing of the mature native enzyme was obtained for the first 20 amino acids and revealed high homology to serine proteases of the subtilisin subfamily. Arp migrated in SDS-PAGE with an estimated molecular mass of 33 kDa and had a pI determined to be at pH 8.8. Arp is proteolytically active against various substrates, including elastin, over a broad pH range between 6 and 12 with an optimum at pH 10.5. After invasive mucormycosis, specific antibodies against Arp were detected in stored serum samples taken from the patient from whom the R. microsporus strain of this study had been isolated. Furthermore, in search of factors involved in thrombosis as a typical complication of mucormycosis, a procoagulatory effect of the enzyme has recently been shown. Altogether, these data substantiate the expression of Arp during human rhinoorbital mucormycosis and suggest a role of the enzyme in pathogenesis.

  3. Bacterial proteases in IBD and IBS.


    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk


    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  4. Evidence Supporting the 19 β-Strand Model for Tom40 from Cysteine Scanning and Protease Site Accessibility Studies*

    PubMed Central

    Lackey, Sebastian W. K.; Taylor, Rebecca D.; Go, Nancy E.; Wong, Annie; Sherman, E. Laura; Nargang, Frank E.


    Most proteins found in mitochondria are translated in the cytosol and enter the organelle via the TOM complex (translocase of the outer mitochondrial membrane). Tom40 is the pore forming component of the complex. Although the three-dimensional structure of Tom40 has not been determined, the structure of porin, a related protein, has been shown to be a β-barrel containing 19 membrane spanning β-strands and an N-terminal α-helical region. The evolutionary relationship between the two proteins has allowed modeling of Tom40 into a similar structure by several laboratories. However, it has been suggested that the 19-strand porin structure does not represent the native form of the protein. If true, modeling of Tom40 based on the porin structure would also be invalid. We have used substituted cysteine accessibility mapping to identify several potential β-strands in the Tom40 protein in isolated mitochondria. These data, together with protease accessibility studies, support the 19 β-strand model for Tom40 with the C-terminal end of the protein localized to the intermembrane space. PMID:24947507

  5. Clinical Evidence for the Role of Trichomonas vaginalis in Regulation of Secretory Leukocyte Protease Inhibitor in the Female Genital Tract

    PubMed Central

    Huppert, Jill S.; Huang, Bin; Chen, Chen; Dawood, Hassan Y.; Fichorova, Raina N.


    Background. Secretory leukocyte protease inhibitor (SLPI) is responsible for regulating inflammatory damage to and innate and adaptive immune responses in the vaginal mucosa. Depressed cervicovaginal SLPI levels have been correlated with both Trichomonas vaginalis infection and poor reproductive health outcomes. Methods. We measured levels of SLPI in 215 vaginal specimens collected from adolescent and young adult females aged 14–22 years. Log-transformed SLPI values were compared by analysis of variance or by an unpaired t test before and after adjustment for confounding effects through the propensity score method. Results. Females receiving hormonal contraceptives and those with an abnormal vaginal pH had lower SLPI levels as compared to their peers. After propensity score adjustment for race, behavioral factors, hormonal use, and other sexually transmitted infections (STIs), SLPI levels were lower in females with a positive T. vaginalis antigen test result, a vaginal pH >4.5, vaginal leukocytosis, and recurrent (vs initial) T. vaginalis infection, with the lowest levels observed in those with the highest T. vaginalis loads. Conclusions. The SLPI level was reduced by >50% in a T. vaginalis load–dependent manner. Future research should consider whether identifying and treating females with low levels of T. vaginalis infection (before they become wet mount positive) would prevent the loss of SLPI and impaired vaginal immunity. The SLPI level could be used as a vaginal-health marker to evaluate interventions and vaginal products. PMID:23355743

  6. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.


    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  7. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.


    Almonte, Antoine G; Sweatt, J David


    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  8. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior

    PubMed Central

    Almonte, Antoine G.; Sweatt, J. David


    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes—coagulation, inflammation, and digestion, for example—have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation. PMID:21782155

  9. Yeast extracellular proteases.


    Ogrydziak, D M


    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  10. Point-of-Care Hemoglobin A1c Testing: An Evidence-Based Analysis.



    The increasing prevalence of diabetes in Ontario means that there will be growing demand for hemoglobin A1c (HbA1c) testing to monitor glycemic control for the management of this chronic disease. Testing HbA1c where patients receive their diabetes care may improve system efficiency if the results from point-of-care HbA1c testing are comparable to those from laboratory HbA1c measurements. To review the correlation between point-of-care HbA1c testing and laboratory HbA1c measurement in patients with diabetes in clinical settings. The literature search included studies published between January 2003 and June 2013. Search terms included glycohemoglobin, hemoglobin A1c, point of care, and diabetes. Studies were included if participants had diabetes; if they compared point-of-care HbA1c devices (licensed by Health Canada and available in Canada) with laboratory HbA1c measurement (reference method); if they performed point-of-care HbA1c testing using capillary blood samples (finger pricks) and laboratory HbA1c measurement using venous blood samples within 7 days; and if they reported a correlation coefficient between point-of-care HbA1c and laboratory HbA1c results. Three point-of-care HbA1c devices were reviewed in this analysis: Bayer's A1cNow+, Bio-Rad's In2it, and Siemens' DCA Vantage. Five observational studies met the inclusion criteria. The pooled results showed a positive correlation between point-of-care HbA1c testing and laboratory HbA1c measurement (correlation coefficient, 0.967; 95% confidence interval, 0.960-0.973). Outcomes were limited to the correlation coefficient, as this was a commonly reported measure of analytical performance in the literature. Results should be interpreted with caution due to risk of bias related to selection of participants, reference standards, and the multiple steps involved in POC HbA1c testing. Moderate quality evidence showed a positive correlation between point-of-care HbA1c testing and laboratory HbA1c measurement. Five

  11. In vivo inhibition of cysteine proteases provides evidence for the involvement of 'senescence-associated vacuoles' in chloroplast protein degradation during dark-induced senescence of tobacco leaves.


    Carrión, Cristian A; Costa, María Lorenza; Martínez, Dana E; Mohr, Christina; Humbeck, Klaus; Guiamet, Juan J


    Breakdown of leaf proteins, particularly chloroplast proteins, is a massive process in senescing leaves. In spite of its importance in internal N recycling, the mechanism(s) and the enzymes involved are largely unknown. Senescence-associated vacuoles (SAVs) are small, acidic vacuoles with high cysteine peptidase activity. Chloroplast-targeted proteins re-localize to SAVs during senescence, suggesting that SAVs might be involved in chloroplast protein degradation. SAVs were undetectable in mature, non-senescent tobacco leaves. Their abundance, visualized either with the acidotropic marker Lysotracker Red or by green fluorescent protein (GFP) fluorescence in a line expressing the senescence-associated cysteine protease SAG12 fused to GFP, increased during senescence induction in darkness, and peaked after 2-4 d, when chloroplast dismantling was most intense. Increased abundance of SAVs correlated with higher levels of SAG12 mRNA. Activity labelling with a biotinylated derivative of the cysteine protease inhibitor E-64 was used to detect active cysteine proteases. The two apparently most abundant cysteine proteases of senescing leaves, of 40kDa and 33kDa were detected in isolated SAVs. Rubisco degradation in isolated SAVs was completely blocked by E-64. Treatment of leaf disks with E-64 in vivo substantially reduced degradation of Rubisco and leaf proteins. Overall, these results indicate that SAVs contain most of the cysteine protease activity of senescing cells, and that SAV cysteine proteases are at least partly responsible for the degradation of stromal proteins of the chloroplast.

  12. HbA1c as a Diagnostic Test for Diabetes Mellitus – Reviewing the Evidence

    PubMed Central

    Florkowski, Chris


    The evidence base in support of HbA1c as a diagnostic test for diabetes mellitus is focused on predicting a clinical outcome, considered to be the pinnacle of the Stockholm Hierarchy applied to reference intervals and clinical decision limits. In the case of diabetes, the major outcome of interest is the long term microvascular complications for which a large body of data has been accumulated, leading to the endorsement of HbA1c for diagnosis in many countries worldwide, with some variations in cut-offs and testing strategies. PMID:24151343

  13. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan


    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  14. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan


    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  15. Laboratory Detection of IZnCH_{3} (X^{1}A_{1}) : Further Evidence for Zinc Insertion

    NASA Astrophysics Data System (ADS)

    Bucchino, Matthew P.; Young, Justin P.; Sheridan, Phil M.; Ziurys, Lucy M.


    Millimeter-wave direct absorption techniques were used to record the pure rotational spectrum of IZnCH_{3} (X^{1}A_{1}). This species was produced by the reaction of zinc vapor with ICH_{3} in the presence of a DC discharge. Rotational transitions ranging from J = 109 {→} 108 to J = 122 {→} 121 were recorded for I^{64}ZnCH_{3} and I^{66}ZnCH_{3} in the frequency range of 250{-290} GHz. The Ka = 0{-4} components were measured for each transition, with the K-ladder structure and nuclear spin statistics indicative of a symmetric top. As with HZnCH_{3} (X^{1}A_{1}), the detection of IZnCH_{3} provides further evidence for a zinc insertion process.

  16. No evidence for disturbed COL1A1 and A2 expression in otosclerosis.


    Csomor, Péter; Liktor, Balázs; Liktor, Bálint; Sziklai, István; Karosi, Tamás


    Otosclerosis is a complex bone remodeling disorder of the human otic capsule that might be associated with various mutations of A1 and A2 alleles of type-I collagen. The study herein presented, investigates the possibilty of the genetic involvement of type-I collagen in the pathogenesis of histologically confirmed otosclerosis. A total of 55 ankylotic stapes footplates were analyzed. Cortical bone fragments (n = 30), incus (n = 3) and malleus (n = 2) specimens were employed as negative controls. Specimens were divided into two groups. The first group was processed using conventional H.E. hematoxylin-eosin (H.E.) staining and type-I collagen-specific immunofluorescent assay (IFA), while the second group was examined by COL1A1 and A2-specific RT-PCR. Otosclerotic- (n = 31) and non-otosclerotic stapes footplates (n = 9) as well as cortical bones (n = 20), incus (n = 2) and malleus specimens (n = 1) showed normal and quite similar A1 and A2 allele expression confirmed by IFA. RT-PCR analysis revealed normal and consistent mRNA expression of both alleles in each specimen. Expression levels and patterns of COL1A1/A2 alleles did not show significant correlation with the histological diagnosis of otosclerosis. Type-I collagen is a highly conserved structure protein, which plays a fundamental role in the integritiy of various connective tissues. Mutations of A1 and A2 alleles result in serious systemic disorders of the skeleton, tendons and skin. Since otosclerosis is an organ-specific disease, it is difficult to explain its genetic association with type-I collagen. In conclusion, we found no evidence supporting the putative link of COL1A1 and COL1A2 alleles with otosclerosis.

  17. Identification of cvSI-3 and evidence for the wide distribution and active evolution of the I84 family of protease inhibitors in mollusks.


    Xue, Qinggang; Beguel, Jean-Phillipe; Gauthier, Julie; La Peyre, Jerome


    Protease inhibitors are an extremely diverse group of proteins that control the proteolytic activities of proteases and play a crucial role in biological processes including host defenses. The I84 family of protease inhibitors in the MEROPS database currently consists of cvSI-1 and cvSI-2, two novel serine protease inhibitors purified and characterized from the eastern oyster Crassostrea virginica plasma and believed to play a role in host defense and disease resistance. In the present study, a third member of I84 family, named cvSI-3, was identified from C. virginica by cDNA cloning and sequencing. The full cvSI-3 cDNA was composed of 342 bp including a 255 bp open reading frame (ORF) that encodes an 84-amino acid peptide. The mature cvSI-3 molecule was predicted to have 68 amino acid residues after removal of a 16-amino acid signal peptide, with a calculated molecular mass of 7724.5 Da and a theoretical isoelectric point (pI) of 6.28. CvSI-3 amino acid sequence shared 41% identity with cvSI-2 and 37% identity with cvSI-1, which included 12 conserved cysteines. Quantitative real-time PCR determined that cvSI-3 gene expressed primarily in oyster digestive glands. Real-time PCR also detected that cvSI-1, cvSI-2 and cvSI-3 expression levels in digestive glands varied significantly, with cvSI-2 showing the highest expression level and cvSI-3 the lowest. Additionally, a significant correlation was detected between cvSI-2 and cvSI-3 mRNAs levels. Searches into sequence databases using cvSI-1, cvSI-2 and cvSI-3 as queries retrieved ESTs suggesting the possible existence of at least 9 more I84 family members in eastern oysters and of I84 family protease inhibitors in various bivalve and gastropod species. Moreover, orthologs of all C. virginica I84 family members or potential member genes were found to be present in the C. gigas genome, and their distributions among species provided important information about the evolution of the I84 family of protease inhibitors. It

  18. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage.


    Tchetina, Elena V; Markova, Galina A; Poole, A Robin; Zukor, David J; Antoniou, John; Makarov, Sergey A; Kuzin, Aleksandr N


    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1-50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10-50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  19. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    PubMed Central

    Markova, Galina A.; Poole, A. Robin; Zukor, David J.; Antoniou, John; Makarov, Sergey A.; Kuzin, Aleksandr N.


    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients. PMID:28042296

  20. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.


    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  1. Role of cockroach proteases in allergic disease.


    Page, Kristen


    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  2. Serine proteases inhibiting cyanopeptides.


    Radau, G


    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  3. Bacterial proteases and virulence.


    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne


    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  4. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae


    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  5. Evidence for the presence of lipid-free monomolecular apolipoprotein A-1 in plasma.


    Miyazaki, Osamu; Ogihara, Jun; Fukamachi, Isamu; Kasumi, Takafumi


    The first step in reverse cholesterol transport is a process by which lipid-free or lipid-poor apoA-1 removes cholesterol from cells through the action of ATP binding cassette transporter A1 at the plasma membrane. However the structure and composition of lipid-free or -poor apoA-1 in plasma remains obscure. We previously obtained a monoclonal antibody (MAb) that specifically recognizes apoA-1 in preβ1-HDL, the smallest apoA-1-containing particle in plasma, which we used to establish a preβ1-HDL ELISA. Here, we purified preβ1-HDL from fresh normal plasma using said antibody, and analyzed the composition and structure. ApoA-1 was detected, but neither phospholipid nor cholesterol were detected in the purified preβ1-HDL. Only globular, not discoidal, particles were observed by electron microscopy. In nondenaturing PAGE, no difference in the mobility was observed between the purified preβ1-HDL and original plasma preβ1-HDL, or between the preβ1-HDL and lipid-free apoA-1 prepared by delipidating HDL. In sandwich ELISA using two anti-preβ1-HDL MAbs, reactivity with intact plasma preβ1-HDL was observed in ELISA using two MAbs with distinct epitopes but no reactivity was observed in ELISA using a single MAb, and the same phenomenon was observed with monomolecular lipid-free apoA-1. These results suggest that plasma preβ1-HDL is lipid-free monomolecular apoA-1.

  6. Evidence for the presence of lipid-free monomolecular apolipoprotein A-1 in plasma[S

    PubMed Central

    Miyazaki, Osamu; Ogihara, Jun; Fukamachi, Isamu; Kasumi, Takafumi


    The first step in reverse cholesterol transport is a process by which lipid-free or lipid-poor apoA-1 removes cholesterol from cells through the action of ATP binding cassette transporter A1 at the plasma membrane. However the structure and composition of lipid-free or -poor apoA-1 in plasma remains obscure. We previously obtained a monoclonal antibody (MAb) that specifically recognizes apoA-1 in preβ1-HDL, the smallest apoA-1-containing particle in plasma, which we used to establish a preβ1-HDL ELISA. Here, we purified preβ1-HDL from fresh normal plasma using said antibody, and analyzed the composition and structure. ApoA-1 was detected, but neither phospholipid nor cholesterol were detected in the purified preβ1-HDL. Only globular, not discoidal, particles were observed by electron microscopy. In nondenaturing PAGE, no difference in the mobility was observed between the purified preβ1-HDL and original plasma preβ1-HDL, or between the preβ1-HDL and lipid-free apoA-1 prepared by delipidating HDL. In sandwich ELISA using two anti-preβ1-HDL MAbs, reactivity with intact plasma preβ1-HDL was observed in ELISA using two MAbs with distinct epitopes but no reactivity was observed in ELISA using a single MAb, and the same phenomenon was observed with monomolecular lipid-free apoA-1. These results suggest that plasma preβ1-HDL is lipid-free monomolecular apoA-1. PMID:24304668

  7. No evidence for association between SLC11A1 and visceral leishmaniasis in India

    PubMed Central


    Background SLC11A1 has pleiotropic effects on macrophage function and remains a strong candidate for infectious disease susceptibility. 5' and/or 3' polymorphisms have been associated with tuberculosis, leprosy, and visceral leishmaniasis (VL). Most studies undertaken to date were under-powered, and none has been replicated within a population. Association with tuberculosis has replicated variably across populations. Here we investigate SLC11A1 and VL in India. Methods Nine polymorphisms (rs34448891, rs7573065, rs2276631, rs3731865, rs17221959, rs2279015, rs17235409, rs17235416, rs17229009) that tag linkage disequilibrium blocks across SLC11A1 were genotyped in primary family-based (313 cases; 176 families) and replication (941 cases; 992 controls) samples. Family- and population-based analyses were performed to look for association between SLC11A1 variants and VL. Quantitative RT/PCR was used to compare SLC11A1 expression in mRNA from paired splenic aspirates taken before and after treatment from 24 VL patients carrying different genotypes at the functional promoter GTn polymorphism (rs34448891). Results No associations were observed between VL and polymorphisms at SLC11A1 that were either robust to correction for multiple testing or replicated across primary and replication samples. No differences in expression of SLC11A1 were observed when comparing pre- and post-treatment samples, or between individuals carrying different genotypes at the GTn repeat. Conclusions This is the first well-powered study of SLC11A1 as a candidate for VL, which we conclude does not have a major role in regulating VL susceptibility in India. PMID:21599885

  8. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?


    Suleman, Louise


    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  9. Combining Cationic Liposomal Delivery with MPL-TDM for Cysteine Protease Cocktail Vaccination against Leishmania donovani : Evidence for Antigen Synergy and Protection

    PubMed Central

    Das, Amrita; Ali, Nahid


    Background With the paucity of new drugs and HIV co-infection, vaccination remains an unmet research priority to combat visceral leishmaniasis (VL) requiring strong cellular immunity. Protein vaccination often suffers from low immunogenicity and poor generation of memory T cells for long-lasting protection. Cysteine proteases (CPs) are immunogenic proteins and key mediators of cellular functions in Leishmania. Here, we evaluated the vaccine efficacies of CPs against VL, using cationic liposomes with Toll like receptor agonists for stimulating host immunity against L. donovani in a hamster model. Methodology/Principal Findings Recombinant CPs type I (cpb), II (cpa) and III (cpc) of L. donovani were tested singly and in combination as a triple antigen cocktail for antileishmanial vaccination in hamsters. We found the antigens to be highly immunoreactive and persistent anti-CPA, anti-CPB and anti-CPC antibodies were detected in VL patients even after cure. The liposome-entrapped CPs with monophosphoryl lipid A-Trehalose dicorynomycolate (MPL-TDM) induced significantly high nitric oxide (up to 4 fold higher than controls) mediated antileishmanial activity in vitro, and resulted in strong in vivo protection. Among the three CPs, CPC emerged as the most potent vaccine candidate in combating the disease. Interestingly, a synergistic increase in protection was observed with liposomal CPA, CPB and CPC antigenic cocktail which reduced the organ parasite burden by 1013–1016 folds, and increased the disease-free survival of >80% animals at least up to 6 months post infection. Robust secretion of IFN-γ and IL-12, along with concomitant downregulation of Th2 cytokines, was observed in cocktail vaccinates, even after 3 months post infection. Conclusion/Significance The present study is the first report of a comparative efficacy of leishmanial CPs and their cocktail using liposomal formulation with MPL-TDM against L. donovani. The level of protection attained has not been

  10. [Chloroplast Deg proteases].


    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz


    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  11. Protease inhibitor studies enrolling.



    The protease enzyme is essential for HIV to make copies of itself. So far, research has failed to find a protease inhibitor that works against HIV. It is believed that, regardless of what type of protease inhibitor someone takes, it will need to be supplemented with other anti-HIV drugs. Three protease inhibitors have thus far been found to be safe, although long-term effects are unknown. These drugs are saquinavir, ABT-538, and L-735,524 produced by Hoffman-LaRoche, Abbott, and Merck respectively. Clinical trials of saquinavir are promising but it has not been shown to be the knock-out drug needed. ABT-538 has high bioavailability, but studies are showing it can cause liver and eye damage. L-735,524 studies are showing that resistance develops quite quickly. Future studies at higher doses are expected. To obtain information on protease studies currently looking for participants, contact The Network. Information on other approved, alternative, and experimental drugs is also available.

  12. The site-2 protease.


    Rawson, Robert B


    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  13. Evidence for an A1-adenosine receptor in the guinea-pig atrium.

    PubMed Central

    Collis, M. G.


    1 The purpose of this study was to determine whether the adenosine receptor that mediates a decrease in the force of contraction of the guinea-pig atrium is of the A1- or A2-sub-type. 2 Concentration-response curves to adenosine and a number of 5'- and N6-substituted analogues were constructed and the order of potency of the purines was: 5'-N-cyclopropylcarboxamide adenosine (NCPCA) = 5'-N-ethylcarboxamide adenosine (NECA) greater than N6cyclohexyladenosine (CHA) greater than L-N6-phenylisopropyl adenosine (L-PIA) = 2-chloroadenosine- greater than adenosine greater than D-N6-phenylisopropyl adenosine (D-PIA). 3 The difference in potency between the stereoisomers D- and L-PIA was over 100 fold. 4 The adenosine transport inhibitor, dipyridamole, potentiated submaximal responses to adenosine but had no significant effect on those evoked by the other purines. 5 Theophylline antagonized responses evoked by all purines, and with D-PIA revealed a positive inotropic effect that was abolished by atenolol. 6 The results indicate the existence of an adenosine A1-receptor in the guinea-pig atrium. PMID:6297647

  14. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos


    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  15. Evidence for long-term neurotoxicity associated with methamphetamine abuse: A 1H MRS study.


    Ernst, T; Chang, L; Leonido-Yee, M; Speck, O


    To determine whether proton MRS (1H MRS) can detect long-term metabolite abnormalities in abstinent methamphetamine users. Methamphetamine is toxic to dopaminergic and serotonergic neurons in rodents; however, little data are available on the toxic effects of methamphetamine on the human brain. 1H MRS was performed in 26 abstinent methamphetamine abusers with a history of methamphetamine dependence (median total cumulative lifetime exposure, 3,640 g; median recency of last methamphetamine use, 4.25 months) and 24 healthy subjects without a history of drug abuse. Cerebral metabolite concentrations on 1H MRS were measured in the frontal cortex, frontal white matter, and basal ganglia. The concentration of N-acetylaspartate ([NA]), a neuronal marker, was reduced significantly (-5 to -6%) in the basal ganglia and frontal white matter of methamphetamine users compared with control subjects. The frontal white matter [NA] correlated inversely with the logarithm of the lifetime methamphetamine use. The methamphetamine users also showed significantly reduced total creatine in the basal ganglia (-8%), and increased choline-containing compounds ([CHO], +13%) and myo-inositol ([MI], +11%) in the frontal grey matter. The reduced [NA] on 1H MRS provides evidence for long-term neuronal damage in abstinent methamphetamine users.

  16. Proteases in bacterial pathogenesis.


    Ingmer, Hanne; Brøndsted, Lone


    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  17. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.


    Hughes, Valerie S; Page, Kristen


    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  18. Rapid qualitative protease microassay (RPM).


    Mohan, S; Ma, P W K; Luthe, D S


    A rapid qualitative protease microassay (RPM) was developed as an alternative to conventional assays of cysteine protease activity in HPLC fractions. Using this technique protease activity in samples could be visually determined within 5 min. The method was sensitive to 3.3x10(-7) U/mL of papain and detected cysteine protease activity in dilute HPLC fractions with activity of 5.4x10(-5) U/mL. Because the method monitors the decolorization of Coomassie Brilliant Blue stained substrate, it can be modified to detect other classes of proteases.


    PubMed Central

    Jemski, Joseph V.; Flick, John A.; Stinebring, Warren R.


    The results obtained in this study indicate that serum protease is not activated by either a rabbit or guinea pig antiovalbumin-ovalbumin system, in vitro. A precipitin reaction occurring in the presence of a serum protease precursor of three species (human, rabbit, and guinea pig) failed to activate the protease precursor. Furthermore, particulate material as preformed precipitates could not be shown to activate the protease of either human or rabbit serum or their euglobulin fractions. The material presented seems to be further evidence against the postulated role of serum protease in immunologic systems. PMID:13052811

  20. From proteases to proteomics

    PubMed Central

    Neurath, Hans


    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  1. From proteases to proteomics.


    Neurath, H


    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  2. Proteases in blood clotting.


    Walsh, Peter N; Ahmad, Syed S


    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  3. Multifunctional Mitochondrial AAA Proteases

    PubMed Central

    Glynn, Steven E.


    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle. PMID:28589125

  4. An in silico approach to understand the structure-function properties of a serine protease (Bacifrinase) from Bacillus cereus and experimental evidence to support the interaction of Bacifrinase with fibrinogen and thrombin.


    Bora, Bandana; Biswas, Akash Deep; Gurung, Arun Bahadur; Bhattacharjee, Atanu; Mattaparthi, Venkata Satish Kumar; Mukherjee, Ashis K


    Microbial fibrinogenolytic serine proteases find therapeutic applications in the treatment of thrombosis- and hyperfibrinogenemia-associated disorders. However, analysis of structure-function properties of an enzyme is utmost important before its commercial application. In this study, an attempt has been made to understand the structure of a fibrinogenolytic protease enzyme, "Bacifrinase" from Bacillus cereus strain AB01. From the molecular dynamics trajectory analysis, the modelled three-dimensional structure of the protease was found to be stable and the presence of a catalytic triad made up of Asp102, His83 and Ser195 suggests that it is a serine protease. To understand the mechanism of enzyme-substrate and enzyme-inhibitor interactions, the equilibrated protein was docked with human fibrinogen (the physiological substrate of this enzyme), human thrombin and with ten selective protease inhibitors. The Bacifrinase-chymostatin interaction was the strongest among the selected protease inhibitors. The serine protease inhibitor phenyl methane sulphonyl fluoride was found to interact with the Ser134 residue of Bacifrinase. Furthermore, protein-protein docking study revealed the fibrinogenolytic property of Bacifrinase and its interaction with Aα-, Bβ- and Cγ-chains human fibrinogen to a different extent. However, biochemical analysis showed that Bacifrinase did not hydrolyse the γ-chain of fibrinogen. The in silico and spectrofluorometric studies also showed interaction of Bacifrinase with thrombin as well as fibrinogen with a Kd value of 16.5 and .81 nM, respectively. Our findings have shed light on the salient structural features of Bacifrinase and confirm that it is a fibrinogenolytic serine protease.

  5. Evidence that cytochrome b{sub 5} acts as a redox donor in CYP17A1 mediated androgen synthesis

    SciTech Connect

    Duggal, Ruchia; Liu, Yilin; Gregory, Michael C.; Denisov, Ilia G.; Kincaid, James R.; Sligar, Stephen G.


    Cytochrome P450 17A1 (CYP17A1) is an important drug target for castration resistant prostate cancer. It is a bi-functional enzyme, catalyzing production of glucocorticoid precursors by hydroxylation of pregnene-nucleus, and androgen biosynthesis by a second C−C lyase step, at the expense of glucocorticoid production. Cytochrome b{sub 5} (cyt b{sub 5}) is known to be a key regulator of the androgen synthesis reaction in vivo, by a mechanism that is not well understood. Two hypotheses have been proposed for the mechanism by which cyt b{sub 5} increases androgen biosynthesis. Cyt b{sub 5} could act as an allosteric effector, binding to CYP17A1 and either changing its selective substrate affinity or altering the conformation of the P450 to increase the catalytic rate or decrease unproductive uncoupling channels. Alternatively, cyt b{sub 5} could act as a redox donor for supply of the second electron in the P450 cycle, reducing the oxyferrous complex to form the reactive peroxo-intermediate. To understand the mechanism of lyase enhancement by cyt b{sub 5}, we generated a redox-inactive form of cyt b{sub 5}, in which the heme is replaced with a Manganese-protoporphyrin IX (Mn-b{sub 5}), and investigated enhancement of androgen producing lyase reaction by CYP17A1. Given the critical significance of a stable membrane anchor for all of the proteins involved and the need for controlled stoichiometric ratios, we employed the Nanodisc system for this study. The redox inactive form was observed to have no effect on the lyase reaction, while reactions with the normal heme-iron containing cyt b{sub 5} were enhanced ∼5 fold as compared to reactions in the absence of cyt b{sub 5}. We also performed resonance Raman measurements on ferric CYP17A1 bound to Mn-b{sub 5}. Upon addition of Mn-b{sub 5} to Nanodisc reconstituted CYP17A1, we observed clear evidence for the formation of a b{sub 5}-CYP17A1 complex, as noted by changes in the porphyrin modes and alteration in the proximal

  6. Protease signalling: the cutting edge

    PubMed Central

    Turk, Boris; Turk, Dus̆an; Turk, Vito


    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research. PMID:22367392

  7. Protease signalling: the cutting edge.


    Turk, Boris; Turk, Dušan; Turk, Vito


    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research.

  8. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.


    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail


    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  9. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.


    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  10. Protease activity, localization and inhibition in the human hair follicle.


    Bhogal, R K; Mouser, P E; Higgins, C A; Turner, G A


    In humans, the process of hair shedding, referred to as exogen, is believed to occur independently of the other hair cycle phases. Although the actual mechanisms involved in hair shedding are not fully known, it has been hypothesized that the processes leading to the final step of hair shedding may be driven by proteases and/or protease inhibitor activity. In this study, we investigated the presence of proteases and protease activity in naturally shed human hairs and assessed enzyme inhibition activity of test materials. We measured enzyme activity using a fluorescence-based assay and protein localization by indirect immunohistochemistry (IHC). We also developed an ex vivo skin model for measuring the force required to pull hair fibres from skin. Our data demonstrate the presence of protease activity in the tissue material surrounding club roots. We also demonstrated the localization of specific serine protease protein expression in human hair follicle by IHC. These data provide evidence demonstrating the presence of proteases around the hair club roots, which may play a role during exogen. We further tested the hypothesis that a novel protease inhibitor system (combination of Trichogen) and climbazole) could inhibit protease activity in hair fibre club root extracts collected from a range of ethnic groups (U.K., Brazil, China, first-generation Mexicans in the U.S.A., Thailand and Turkey) in both males and females. Furthermore, we demonstrated that this combination is capable of increasing the force required to remove hair in an ex vivo skin model system. These studies indicate the presence of proteolytic activity in the tissue surrounding the human hair club root and show that it is possible to inhibit this activity with a combination of Trichogen and climbazole. This technology may have potential to reduce excessive hair shedding. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  11. Functional interplay between tetraspanins and proteases.


    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos


    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  12. Feces Derived Allergens of Tyrophagus putrescentiae Reared on Dried Dog Food and Evidence of the Strong Nutritional Interaction between the Mite and Bacillus cereus Producing Protease Bacillolysins and Exo-chitinases

    PubMed Central

    Erban, Tomas; Rybanska, Dagmar; Harant, Karel; Hortova, Bronislava; Hubert, Jan


    Tyrophagus putrescentiae (Schrank, 1781) is an emerging source of allergens in stored products and homes. Feces proteases are the major allergens of astigmatid mites (Acari: Acaridida). In addition, the mites are carriers of microorganisms and microbial adjuvant compounds that stimulate innate signaling pathways. We sought to analyze the mite feces proteome, proteolytic activities, and mite-bacterial interaction in dry dog food (DDF). Proteomic methods comprising enzymatic and zymographic analysis of proteases and 2D-E-MS/MS were performed. The highest protease activity was assigned to trypsin-like proteases; lower activity was assigned to chymotrypsin-like proteases, and the cysteine protease cathepsin B-like had very low activity. The 2D-E-MS/MS proteomic analysis identified mite trypsin allergen Tyr p3, fatty acid-binding protein Tyr p13 and putative mite allergens ferritin (Grp 30) and (poly)ubiquitins. Tyr p3 was detected at different positions of the 2D-E. It indicates presence of zymogen at basic pI, and mature-enzyme form and enzyme fragment at acidic pI. Bacillolysins (neutral and alkaline proteases) of Bacillus cereus symbiont can contribute to the protease activity of the mite extract. The bacterial exo-chitinases likely contribute to degradation of mite exuviae, mite bodies or food boluses consisting of chitin, including the peritrophic membrane. Thus, the chitinases disrupt the feces and facilitate release of the allergens. B. cereus was isolated and identified based on amplification and sequencing of 16S rRNA and motB genes. B. cereus was added into high-fat, high-protein (DDF) and low-fat, low-protein (flour) diets to 1 and 5% (w/w), and the diets palatability was evaluated in 21-day population growth test. The supplementation of diet with B. cereus significantly suppressed population growth and the suppressive effect was higher in the high-fat, high-protein diet than in the low-fat, low-protein food. Thus, B. cereus has to coexist with the mite in

  13. Feces Derived Allergens of Tyrophagus putrescentiae Reared on Dried Dog Food and Evidence of the Strong Nutritional Interaction between the Mite and Bacillus cereus Producing Protease Bacillolysins and Exo-chitinases.


    Erban, Tomas; Rybanska, Dagmar; Harant, Karel; Hortova, Bronislava; Hubert, Jan


    Tyrophagus putrescentiae (Schrank, 1781) is an emerging source of allergens in stored products and homes. Feces proteases are the major allergens of astigmatid mites (Acari: Acaridida). In addition, the mites are carriers of microorganisms and microbial adjuvant compounds that stimulate innate signaling pathways. We sought to analyze the mite feces proteome, proteolytic activities, and mite-bacterial interaction in dry dog food (DDF). Proteomic methods comprising enzymatic and zymographic analysis of proteases and 2D-E-MS/MS were performed. The highest protease activity was assigned to trypsin-like proteases; lower activity was assigned to chymotrypsin-like proteases, and the cysteine protease cathepsin B-like had very low activity. The 2D-E-MS/MS proteomic analysis identified mite trypsin allergen Tyr p3, fatty acid-binding protein Tyr p13 and putative mite allergens ferritin (Grp 30) and (poly)ubiquitins. Tyr p3 was detected at different positions of the 2D-E. It indicates presence of zymogen at basic pI, and mature-enzyme form and enzyme fragment at acidic pI. Bacillolysins (neutral and alkaline proteases) of Bacillus cereus symbiont can contribute to the protease activity of the mite extract. The bacterial exo-chitinases likely contribute to degradation of mite exuviae, mite bodies or food boluses consisting of chitin, including the peritrophic membrane. Thus, the chitinases disrupt the feces and facilitate release of the allergens. B. cereus was isolated and identified based on amplification and sequencing of 16S rRNA and motB genes. B. cereus was added into high-fat, high-protein (DDF) and low-fat, low-protein (flour) diets to 1 and 5% (w/w), and the diets palatability was evaluated in 21-day population growth test. The supplementation of diet with B. cereus significantly suppressed population growth and the suppressive effect was higher in the high-fat, high-protein diet than in the low-fat, low-protein food. Thus, B. cereus has to coexist with the mite in

  14. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y


    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases. PMID:28405139

  15. Proteases from psychrotrophs: an overview.


    Kasana, Ramesh Chand


    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  16. Proteases in gastrointestinal neoplastic diseases.


    Herszényi, L; Plebani, M; Carraro, P; De Paoli, M; Roveroni, G; Cardin, R; Foschia, F; Tulassay, Z; Naccarato, R; Farinati, F


    Cysteine and serine proteases are involved in cancer invasion and metastasis. In the past few years we investigated the tissue levels of these proteases in gastric cancer (GC), gastric precancerous changes (CAG), colorectal cancer (CRC) and the plasma and serum levels of proteases in several gastrointestinal tumours, using ELISA methods. Significantly higher antigen levels were found not only in GC tissue but also in CAG with respect to the levels found normal tissue; with respect to CAG, patients with dysplasia had higher levels than patients without dysplasia. The same findings were obtained in CRC. In general protease levels correlated with the major histomorphological parameters, such as grading and histotype in GC as well as in CRC. Tissue protease levels had a strong prognostic impact in GC, in which UPA was singled out by multivariate analysis as the major prognostic factor, and CRC. The plasma levels of urokinase-type plasminogen activator (UPA) and the serum levels of cathepsin B were significantly increased in patients with gastrointestinal tumours. In conclusions, cysteine and serine proteases may have a part not only in GC and CRC invasion and metastasis, but also in the progression of gastric precancerous changes into cancer. They are strong prognostic factors in GC and CRC. These proteases may also have a role as tumour markers in the early diagnosis of gastrointestinal tract tumours.

  17. Enteric bacterial proteases in inflammatory bowel disease- pathophysiology and clinical implications.


    Carroll, Ian M; Maharshak, Nitsan


    Numerous reports have identified a dysbiosis in the intestinal microbiota in patients suffering from inflammatory bowel diseases (IBD), yet the mechanism(s) in which this complex microbial community initiates or perpetuates inflammation remains unclear. The purpose of this review is to present evidence for one such mechanism that implicates enteric microbial derived proteases in the pathogenesis of IBD. We highlight and discuss studies demonstrating that proteases and protease receptors are abundant in the digestive system. Additionally, we investigate studies demonstrating an association between increased luminal protease activity and activation of protease receptors, ultimately resulting in increased intestinal permeability and exacerbation of colitis in animal models as well as in human IBD. Proteases are essential for the normal functioning of bacteria and in some cases can serve as virulence factors for pathogenic bacteria. Although not classified as traditional virulence factors, proteases originating from commensal enteric bacteria also have a potential association with intestinal inflammation via increased enteric permeability. Reports of increased protease activity in stools from IBD patients support a possible mechanism for a dysbiotic enteric microbiota in IBD. A better understanding of these pathways and characterization of the enteric bacteria involved, their proteases, and protease receptors may pave the way for new therapeutic approaches for these diseases.

  18. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil


    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  19. Multiple classes of immune-related proteases associated with the cell death response in pepper plants.


    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil


    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense.

  20. Evidence of mutualism between two periodontal pathogens: co-operative haem acquisition by the HmuY haemophore of Porphyromonas gingivalis and the cysteine protease interpain A (InpA) of Prevotella intermedia.


    Byrne, D P; Potempa, J; Olczak, T; Smalley, J W


    Haem (iron protoporphyrin IX) is both an essential growth factor and a virulence regulator of the periodontal pathogens Porphyromonas gingivalis and Prevotella intermedia, which acquire it through the proteolytic degradation of haemoglobin and other haem-carrying plasma proteins. The haem-binding lipoprotein HmuY haemophore and the gingipain proteases of P. gingivalis form a unique synthrophic system responsible for capture of haem from haemoglobin and methaemalbumin. In this system, methaemoglobin is formed from oxyhaemoglobin by the activities of gingipain proteases and serves as a facile substrate from which HmuY can capture haem. This study examined the possibility of cooperation between HmuY and the cysteine protease interpain A (InpA) of Pr. intermedia in the haem acquisition process. Using UV-visible spectroscopy and polyacrylamide gel electrophoresis, HmuY was demonstrated to be resistant to proteolysis and so able to cooperate with InpA to extract haem from haemoglobin, which was proteolytically converted to methaemoglobin by the protease. Spectroscopic pH titrations showed that both the iron(II) and iron(III) protoporphyrin IX-HmuY complexes were stable over the pH range 4-10, demonstrating that the haemophore could function over a range of pH that may be encountered in the dental plaque biofilm. This is the first demonstration of a bacterial haemophore working in conjunction with a protease from another bacterial species to acquire haem from haemoglobin and may represent mutualism between P. gingivalis and Pr. intermedia co-inhabiting the periodontal pocket.

  1. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.


    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  2. Exogenous proteases for meat tenderization.


    Bekhit, Alaa A; Hopkins, David L; Geesink, Geert; Bekhit, Adnan A; Franks, Philip


    The use of exogenous proteases to improve meat tenderness has attracted much interest recently, with a view to consistent production of tender meat and added value to lower grade meat cuts. This review discusses the sources, characteristics, and use of exogenous proteases in meat tenderization to highlight the specificity of the proteases toward meat proteins and their impact on meat quality. Plant enzymes (such as papain, bromelain, and ficin) have been extensively investigated as meat tenderizers. New plant proteases (actinidin and zingibain) and microbial enzyme preparations have been of recent interest due to controlled meat tenderization and other advantages. Successful use of these enzymes in fresh meat requires their enzymatic kinetics and characteristics to be determined, together with an understanding of the impact of the surrounding environmental conditions of the meat (pH, temperature) on enzyme function. This enables the optimal conditions for tenderizing fresh meat to be established, and the elimination or reduction of any negative impacts on other quality attributes.

  3. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng


    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  4. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.


    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  5. The salt-sensitive structure and zinc inhibition of Borrelia burgdorferi protease BbHtrA.


    Russell, Theresa M; Tang, Xiaoling; Goldstein, Jason M; Bagarozzi, Dennis; Johnson, Barbara J B


    HtrA serine proteases are highly conserved and essential ATP-independent proteases with chaperone activity. Bacteria express a variable number of HtrA homologues that contribute to the virulence and pathogenicity of bacterial pathogens. Lyme disease spirochetes possess a single HtrA protease homologue, Borrelia burgdorferi HtrA (BbHtrA). Previous studies established that, like the human orthologue HtrA1, BbHtrA is proteolytically active against numerous extracellular proteins in vitro. In this study, we utilized size exclusion chromatography and blue native polyacrylamide gel electrophoresis (BN-PAGE) to demonstrate BbHtrA oligomeric structures that were substrate independent and salt sensitive. Examination of the influence of transition metals on the activity of BbHtrA revealed that this protease is inhibited by Zn(2+) > Cu(2+) > Mn(2+). Extending this analysis to two other HtrA proteases, E. coli DegP and HtrA1, revealed that all three HtrA proteases were reversibly inhibited by ZnCl2 at all micro molar concentrations examined. Commercial inhibitors for HtrA proteases are not available and physiologic HtrA inhibitors are unknown. Our observation of conserved zinc inhibition of HtrA proteases will facilitate structural and functional studies of additional members of this important class of proteases. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  6. Serine proteases in rodent hippocampus.


    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R


    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  7. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.


    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  8. Protease inhibition as new therapeutic strategy for GI diseases.


    Vergnolle, Nathalie


    The GI tract is the most exposed organ to proteases, both in physiological and pathophysiological conditions. For digestive purposes, the lumen of the upper GI tract contains large amounts of pancreatic proteases, but studies have also demonstrated increased proteolytic activity into mucosal tissues (both in the upper and lower GI tract), associated with pathological conditions. This review aims at outlining the evidences for dysregulated proteolytic homeostasis in GI diseases and the pathogenic mechanisms of increased proteolytic activity. The therapeutic potential of protease inhibition in GI diseases is discussed, with a particular focus on IBDs, functional GI disorders and colorectal cancer. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  9. Plant proteases for bioactive peptides release: A review.


    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y


    Proteins are a potential source of health-promoting biomolecules with medical, nutraceutical, and food applications. Nowadays, bioactive peptides production, its isolation, characterization, and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  10. Protease signaling in animal and plant-regulated cell death.


    Salvesen, Guy S; Hempel, Anne; Coll, Nuria S


    This review aims to highlight the proteases required for regulated cell death mechanisms in animals and plants. The aim is to be incisive, and not inclusive of all the animal proteases that have been implicated in various publications. The review also aims to focus on instances when several publications from disparate groups have demonstrated the involvement of an animal protease, and also when there is substantial biochemical, mechanistic and genetic evidence. In doing so, the literature can be culled to a handful of proteases, covering most of the known regulated cell death mechanisms: apoptosis, regulated necrosis, necroptosis, pyroptosis and NETosis in animals. In plants, the literature is younger and not as extensive as for mammals, although the molecular drivers of vacuolar death, necrosis and the hypersensitive response in plants are becoming clearer. Each of these death mechanisms has at least one proteolytic component that plays a major role in controlling the pathway, and sometimes they combine in networks to regulate cell death/survival decision nodes. Some similarities are found among animal and plant cell death proteases but, overall, the pathways that they govern are kingdom-specific with very little overlap. © 2015 FEBS.

  11. Cytomegalovirus protease targeted prodrug development.


    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L


    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  12. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.


    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M


    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  13. Microbial proteases: detection, production, and genetic improvement.


    Kasana, Ramesh Chand; Salwan, Richa; Yadav, Sudesh Kumar


    Microbial proteases are one of the important groups of industrially and commercially produced enzymes contributing approximately 2/3 of all enzyme sales. Though proteases are produced by many microorganisms, emphasis is on the microorganisms producing proteases with desired characters. As demand for novel proteases is increasing day by day the initial screening methods and assays for protease detection are of utmost importance. This review focuses attention on present status of knowledge on the various methods and protocols available for protease screening, detection, and quantification starting from plate assays to spectrophotometric, fluorometric, and nanoparticles based assays. The review will help in making strategies for exploitation of protease resources and improvement of enzymes to obtain more robust proteases.

  14. Evidence for the 2B1-2A1 electronic transition in chlorine dioxide from resonance Raman depolarization ratios

    NASA Astrophysics Data System (ADS)

    Reid, Philip J.; Esposito, Anthony P.; Foster, Catherine E.; Beckman, Robert A.


    The resonance Raman depolarization ratios of chlorine dioxide (OClO) dissolved in cyclohexane are measured and analyzed to establish the existence of a 2A1 excited state that is nearly degenerate with the optically stronger, 2A2 excited state. The depolarization ratio of the symmetric stretch fundamental transition is measured at several excitation wavelengths spanning the lowest-energy electronic transition centered at ˜360 nm. The depolarization ratio of this transition reaches a maximum value of 0.25±0.04 directly on resonance suggesting that scattered intensity is not derived from a single excited state. The depolarization ratios are modeled utilizing the time-dependent formalism for Raman scattering. This analysis demonstrates that the observed Raman depolarization ratios are derived from contributions of two excited states of 2A1 and 2A2 symmetry to the observed scattering. The results presented here support the emerging picture of OClO excited-state reaction dynamics in which photoexcitation to the 2A2 excited state is followed by internal conversion from this state to the 2A1 surface. Both the role of the 2A1 state in the photochemistry of OClO and the importance of this state in modeling resonance Raman intensities are discussed.

  15. CYP1A1 polymorphism interactions with smoking status in oral cancer risk: evidence from epidemiological studies.


    Yu, Kai-Tao; Ge, Cheng; Xu, Xiao-Fang; Zou, Jing-Cai; Zou, Xuan; Zhen, Shuai


    The cytochrome CYP1A1 gene has been implicated in the etiology of oral cancer. However, the results have been inconsistent. In this study, a meta-analysis was performed to clarify the associations of polymorphisms in CYP1A1 gene with oral cancer risk. Published literatures from PubMed, MEDLINE, EMBASE, and China National Knowledge infrastructure (CNKI) databases were retrieved. A total of 12 studies were included in this meta-analysis. We found that significant positive associations between CYP1A1*2A polymorphism and oral cancer risk in recessive model (CC vs. TC + TT, OR = 1.93), dominant model (CC + TC vs. TT, OR = 1.33), and additive model (CC vs. TT, OR = 1.97). In subgroup analysis based on the ethnicity of study population, significant associations were found in all three genetic models for Asians (recessive OR = 2.29, 95% CI =  .42-3.71; dominant OR = 1.54, 95% CI = 1.03-2.31; additive OR  2.39, 95% CI = 1.47-3.88) but not non-Asians. For the smoking stratification, the result indicated a significant association between CYP1A1*2A polymorphism and oral cancer among the smoking subjects (OR = 1.83, 95% CI = 1.47-2.26). This meta-analysis indicated a marked association of CYP1A1*2A polymorphisms with oral cancer risk, particularly among Asians, whereas there were significant interactions between the polymorphisms and cigarette smoking on oral cancer risk.

  16. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.


    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R


    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  17. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.


    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  18. Behavioral Effects of A1- and A2-Selective Adenosine Agonists and Antagonists: Evidence for Synergism and Antagonism

    PubMed Central



    The locomotor effects in mice of selective A1 and A2 adenosine agonists, antagonists and combinations of agonists were investigated using a computerized activity monitor. The A2-selective agonist 2-[(2-aminoethylamino)carbonylethylphenylethylamino]-5'-N-ethylcarboxamidoadenosine (APEC), an amine derivative of 2-(carboxyethylphenylethylamino)adenosine-5'-carboxamide, was a more potent locomotor depressant than its amide conjugates. The rank order of potency after i.p. injection for adenosine agonists was 5'-N-ethylcarboxamidoadenosine (NECA) (ED50, 5.8 nmol/kg) > APEC (ED50, 25 nmol/kg) > N6-cyclohexyladenosine (CHA) (ED50, 270 nmol/kg). An A1-selective, centrally acting, adenosine antagonist, 8-cyclopentyltheophylline (10 mg/kg), completely reversed the locomotor depressant effects of CHA (A1-selective) and NECA (nonselective) at doses of agonists as high as twice the ED50, and shifted the dose-response curves to the right, suggesting a primary involvement of A1 receptors. 8-cyclopentyltheophylline did not affect the depressant effects of APEC at the ED50, consistent with the A2-selectivity of APEC. The locomotor effects of APEC and CHA were completely reversed by theophylline, but not by the peripherally active 8-p-sulfophenyltheophylline, indicating central action of the adenosine agonists. The depressant effects of APEC, but not of NECA or CHA, were reversed significantly by an A2-selective adenosine receptor antagonist, 4-amino-8-chloro-1-phenyl-[1,2,4]triazol[4,3-a]quinoxaline. Low or subthreshold doses of CHA potentiated the depressant effects of APEC. A subthreshold dose of CHA did not alter the depressant effect of NECA, whereas a subthreshold dose of APEC increased the depressant effects of low doses of NECA. Thus, it appears that A1- and A2-selective adenosine agonists have separate central depressant effects, which can be potentiative. The relatively high potency of NECA in vivo could be due to a synergism between central A1 and A2receptor activation by

  19. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.


    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  20. Proteases in Fas-mediated apoptosis.


    Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S


    Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.

  1. Five families with arginine 519-cysteine mutation in COL2A1: evidence for three distinct founders.


    Bleasel, J F; Holderbaum, D; Brancolini, V; Moskowitz, R W; Considine, E L; Prockop, D J; Devoto, M; Williams, C J


    Arginine519-cysteine mutation in the type II procollagen gene (COL2A1) is known to be associated with mild spondyloepiphyseal dysplasia (SED) and precocious generalized osteoarthritis (OA). Five families have now been identified with this mutation. To determine whether a common founder was responsible for the mutation in these five families, we defined the haplotype of the mutation-bearing chromosome using four restriction fragment length polymorphisms (RFLPs) and the 3'-untranslated region VNTR. Haplotype frequencies were estimated for 69 control samples. Three distinct mutation-bearing haplotypes were identified, with three families sharing a common haplotype. For three distinct haplotypes to have derived from a single founder, three independent recombination events would have had to occur. Thus the arg519 codon appears to represent a possible site of recurrent mutations in COL2A1, an uncommon phenomenon in collagen genes.

  2. Structural determinants of MALT1 protease activity.


    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin


    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  3. Protease inhibitor in scorpion (Mesobuthus eupeus) venom prolongs the biological activities of the crude venom.


    Ma, Hakim; Xiao-Peng, Tang; Yang, Shi-Long; Lu, Qiu-Min; Lai, Ren


    It is hypothesized that protease inhibitors play an essential role in survival of venomous animals through protecting peptide/protein toxins from degradation by proteases in their prey or predators. However, the biological function of protease inhibitors in scorpion venoms remains unknown. In the present study, a trypsin inhibitor was purified and characterized from the venom of scorpion Mesobuthus eupeus, which enhanced the biological activities of crude venom components in mice when injected in combination with crude venom. This protease inhibitor, named MeKTT-1, belonged to Kunitz-type toxins subfamily. Native MeKTT-1 selectively inhibited trypsin with a Kivalue of 130 nmol·L(-1). Furthermore, MeKTT-1 was shown to be a thermo-stable peptide. In animal behavioral tests, MeKTT-1 prolonged the pain behavior induced by scorpion crude venom, suggesting that protease inhibitors in scorpion venom inhibited proteases and protect the functionally important peptide/protein toxins from degradation, consequently keeping them active longer. In conclusion, this was the first experimental evidence about the natural existence of serine protease inhibitor in the venom of scorpion Mesobuthus eupeus, which preserved the activity of venom components, suggests that scorpions may use protease inhibitors for survival. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  4. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.


    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz


    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  5. Taspase1: a 'misunderstood' protease with translational cancer relevance.


    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H


    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  6. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology


    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  7. Determination of the protease cleavage site repertoire—The RNase H but not the RT domain is essential for foamy viral protease activity

    SciTech Connect

    Spannaus, Ralf; Bodem, Jochen


    In contrast to orthoretroviruses, the foamy virus protease is only active as a protease-reverse transcriptase fusion protein and requires viral RNA for activation. Maturation of foamy viral proteins seems to be restricted to a single cleavage site in Gag and Pol. We provide evidence that unprocessed Gag is required for optimal infectivity, which is unique among retroviruses. Analyses of the cleavage site sequences of the Gag and Pol cleavage sites revealed a high similarity compared to those of Lentiviruses. We show that positions P2' and P2 are invariant and that Gag and Pol cleavage sites are processed with similar efficiencies. The RNase H domain is essential for protease activity, but can functionally be substituted by RNase H domains of other retroviruses. Thus, the RNase H domain might be involved in the stabilization of the protease dimer, while the RT domain is essential for RNA dependent protease activation. - Highlights: • Unprocessed Gag is required for optimal infectivity of foamy viruses. • Positions P2 and P2' are invariant in the foamy viral cleavage sites. • The RNaseH domain is essential for protease activity. • The RNaseH domains of other retroviruses support foamy viral protease activity.

  8. Genetic evidence for a pathogenic role for the vitamin D3 metabolizing enzyme CYP24A1 in multiple sclerosis.


    Ramasamy, Adaikalavan; Trabzuni, Daniah; Forabosco, Paola; Smith, Colin; Walker, Robert; Dillman, Allissa; Sveinbjornsdottir, Sigurlaug; Hardy, John; Weale, Michael E; Ryten, Mina


    Multiple sclerosis (MS) is a common disease of the central nervous system and a major cause of disability amongst young adults. Genome-wide association studies have identified many novel susceptibility loci including rs2248359. We hypothesized that genotypes of this locus could increase the risk of MS by regulating expression of neighboring gene, CYP24A1 which encodes the enzyme responsible for initiating degradation of 1,25-dihydroxyvitamin D3. We investigated this hypothesis using paired gene expression and genotyping data from three independent datasets of neurologically healthy adults of European descent. The UK Brain Expression Consortium (UKBEC) consists of post-mortem samples across 10 brain regions originating from 134 individuals (1231 samples total). The North American Brain Expression Consortium (NABEC) consists of cerebellum and frontal cortex samples from 304 individuals (605 samples total). The brain dataset from Heinzen and colleagues consists of prefrontal cortex samples from 93 individuals. Additionally, we used gene network analysis to analyze UKBEC expression data to understand CYP24A1 function in human brain. The risk allele, rs2248359-C, is strongly associated with increased expression of CYP24A1 in frontal cortex (p-value=1.45×10(-13)), but not white matter. This association was replicated using data from NABEC (p-value=7.2×10(-6)) and Heinzen and colleagues (p-value=1.2×10(-4)). Network analysis shows a significant enrichment of terms related to immune response in eight out of the 10 brain regions. The known MS risk allele rs2248359-C increases CYP24A1 expression in human brain providing a genetic link between MS and vitamin D metabolism, and predicting that the physiologically active form of vitamin D3 is protective. Vitamin D3's involvement in MS may relate to its immunomodulatory functions in human brain. Medical Research Council UK; King Faisal Specialist Hospital and Research Centre, Saudi Arabia; Intramural Research Program of the

  9. Function and Regulation of SUMO Proteases

    PubMed Central

    Hickey, Christopher M.; Wilson, Nicole R.; Hochstrasser, Mark


    Covalent attachment of small ubiquitin-like modifier (SUMO) to proteins is highly dynamic, and both SUMO-protein conjugation and cleavage can be regulated. Protein desumoylation is performed by SUMO proteases, which control cellular mechanisms ranging from transcription and cell division to ribosome biogenesis. Recent advances include the discovery of two novel classes of SUMO proteases, insights regarding SUMO protease specificity, and revelations of previously unappreciated SUMO protease functions in several key cellular pathways. These developments, together with new connections between SUMO proteases and the recently discovered SUMO-targeted ubiquitin ligases (STUbLs), make this an exciting period for the study of these enzymes. PMID:23175280

  10. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi


    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  11. Hubble Space Telescope Spectroscopic Evidence for a 1 X 10 9 Msun Black Hole in NGC 4594

    NASA Astrophysics Data System (ADS)

    Kormendy, John; Bender, Ralf; Ajhar, Edward A.; Dressler, Alan; Faber, S. M.; Gebhardt, Karl; Grillmair, Carl; Lauer, Tod R.; Richstone, Douglas; Tremaine, Scott


    The discovery by Kormendy of a M• ~= 109 Msolar massive dark object (MDO) in NGC 4594 is confirmed with higher resolution spectroscopy from the Canada-France-Hawaii Telescope (CFHT) and the Hubble Space Telescope (HST). CFHT measurements with the Subarcsecond Imaging Spectrograph improve the resolution from sigma * = 0."40 to 0."27 Gaussian dispersion radius of the point-spread function (PSF). The apparent central velocity dispersion rises from sigma = 250 +/- 7 km s-1 to sigma = 286 +/- 7 km s-1. As observed with the COSTAR-corrected HST, the Faint Object Spectrograph, and a 0."21 aperture, sigma = 321 +/- 7 km s-1 is still higher, and the central rotation curve is very steep. The highest-M• published dynamical model fits the new observations reasonably well when "observed" at HST resolution. The spatial resolution has now improved by a factor of ~5 since the discovery measurements, and the case for a black hole (BH) has strengthened correspondingly. We confirm that NGC 4594 has a Seyfert spectrum; H alpha is ~5200 km s-1 wide at zero intensity. However, gas velocities are lower than the circular velocities implied by the stars, so they cannot be used to test the BH case in NGC 4594. The gas may be in a ring, or it may be associated with patchy dust. HST images with the Wide Field and Planetary Camera 2 show dust at some aperture positions. NGC 4594 appears to have a bright point nucleus. However, the central absorption-line strengths are low, consistent with dilution by enough nonthermal light to explain the "nucleus." There is no evidence for a distinct nuclear star cluster. NGC 4594 is similar to M87, which also has a nonthermal nuclear source, and not to M31 and NGC 3115, which have quiescent BHs and nuclear star clusters.

  12. Characterization of a New S8 serine Protease from Marine Sedimentary Photobacterium sp. A5–7 and the Function of Its Protease-Associated Domain

    PubMed Central

    Li, Hui-Juan; Tang, Bai-Lu; Shao, Xuan; Liu, Bai-Xue; Zheng, Xiao-Yu; Han, Xiao-Xu; Li, Ping-Yi; Zhang, Xi-Ying; Song, Xiao-Yan; Chen, Xiu-Lan


    Bacterial extracellular proteases are important for bacterial nutrition and marine sedimentary organic nitrogen degradation. However, only a few proteases from marine sedimentary bacteria have been characterized. Some subtilases have a protease-associated (PA) domain inserted in the catalytic domain. Although structural analysis and deletion mutation suggests that the PA domain in subtilases is involved in substrate binding, direct evidence to support this function is still absent. Here, a protease, P57, secreted by Photobacterium sp. A5-7 isolated from marine sediment was characterized. P57 could hydrolyze casein, gelatin and collagen. It showed the highest activity at 40°C and pH 8.0. P57 is a new subtilase, with 63% sequence identity to the closest characterized protease. Mature P57 contains a catalytic domain and an inserted PA domain. The recombinant PA domain from P57 was shown to have collagen-binding ability, and Phe349 and Tyr432 were revealed to be key residues for collagen binding in the PA domain. This study first shows direct evidence that the PA domain of a subtilase can bind substrate, which provides a better understanding of the function of the PA domain of subtilases and bacterial extracellular proteases from marine sediment. PMID:28066343

  13. Characterization of a New S8 serine Protease from Marine Sedimentary Photobacterium sp. A5-7 and the Function of Its Protease-Associated Domain.


    Li, Hui-Juan; Tang, Bai-Lu; Shao, Xuan; Liu, Bai-Xue; Zheng, Xiao-Yu; Han, Xiao-Xu; Li, Ping-Yi; Zhang, Xi-Ying; Song, Xiao-Yan; Chen, Xiu-Lan


    Bacterial extracellular proteases are important for bacterial nutrition and marine sedimentary organic nitrogen degradation. However, only a few proteases from marine sedimentary bacteria have been characterized. Some subtilases have a protease-associated (PA) domain inserted in the catalytic domain. Although structural analysis and deletion mutation suggests that the PA domain in subtilases is involved in substrate binding, direct evidence to support this function is still absent. Here, a protease, P57, secreted by Photobacterium sp. A5-7 isolated from marine sediment was characterized. P57 could hydrolyze casein, gelatin and collagen. It showed the highest activity at 40°C and pH 8.0. P57 is a new subtilase, with 63% sequence identity to the closest characterized protease. Mature P57 contains a catalytic domain and an inserted PA domain. The recombinant PA domain from P57 was shown to have collagen-binding ability, and Phe349 and Tyr432 were revealed to be key residues for collagen binding in the PA domain. This study first shows direct evidence that the PA domain of a subtilase can bind substrate, which provides a better understanding of the function of the PA domain of subtilases and bacterial extracellular proteases from marine sediment.

  14. Nelfinavir: fourth protease inhibitor approved.



    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  15. The non-death role of metacaspase proteases.


    Shrestha, Amit; Megeney, Lynn A


    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  16. Immunogold electron microscopic evidence of in situ formation of homo- and heteromeric purinergic adenosine A1 and P2Y2 receptors in rat brain

    PubMed Central


    Background Purines such as adenosine and ATP are now generally recognized as the regulators of many physiological functions, such as neurotransmission, pain, cardiac function, and immune responses. Purines exert their functions via purinergic receptors, which are divided into adenosine and P2 receptors. Recently, we demonstrated that the Gi/o-coupled adenosine A1 receptor (A1R) and Gq/11-coupled P2Y2 receptor (P2Y2R) form a heteromeric complex with unique pharmacology in co-transfected human embryonic kidney cells (HEK293T). However, the heteromeric interaction of A1R and P2Y2R in situ in brain is still largely unknown. Findings In the present study, we visualized the surface expression and co-localization of A1R and P2Y2R in both transfected HEK293T cells and in rat brain by confocal microscopy and more precisely by immunogold electron microscopy. Immunogold electron microscopy showed the evidence for the existence of homo- and hetero-dimers among A1R and P2Y2R at the neurons in cortex, cerebellum, and particularly cerebellar Purkinje cells, also supported by co-immunoprecipitation study. Conclusion The results suggest that evidence for the existence of homo- and hetero-dimers of A1R and P2Y2R, not only in co-transfected cultured cells, but also in situ on the surface of neurons in various brain regions. While the homo-dimerization ratios displayed similar patterns in all three regions, the rates of hetero-dimerization were prominent in hippocampal pyramidal cells among the three regions. PMID:21114816

  17. Immunogold electron microscopic evidence of in situ formation of homo- and heteromeric purinergic adenosine A1 and P2Y2 receptors in rat brain.


    Namba, Kazunori; Suzuki, Tokiko; Nakata, Hiroyasu


    Purines such as adenosine and ATP are now generally recognized as the regulators of many physiological functions, such as neurotransmission, pain, cardiac function, and immune responses. Purines exert their functions via purinergic receptors, which are divided into adenosine and P2 receptors. Recently, we demonstrated that the Gi/o-coupled adenosine A1 receptor (A1R) and Gq/11-coupled P2Y2 receptor (P2Y2R) form a heteromeric complex with unique pharmacology in co-transfected human embryonic kidney cells (HEK293T). However, the heteromeric interaction of A1R and P2Y2R in situ in brain is still largely unknown. In the present study, we visualized the surface expression and co-localization of A1R and P2Y2R in both transfected HEK293T cells and in rat brain by confocal microscopy and more precisely by immunogold electron microscopy. Immunogold electron microscopy showed the evidence for the existence of homo- and hetero-dimers among A1R and P2Y2R at the neurons in cortex, cerebellum, and particularly cerebellar Purkinje cells, also supported by co-immunoprecipitation study. The results suggest that evidence for the existence of homo- and hetero-dimers of A1R and P2Y2R, not only in co-transfected cultured cells, but also in situ on the surface of neurons in various brain regions. While the homo-dimerization ratios displayed similar patterns in all three regions, the rates of hetero-dimerization were prominent in hippocampal pyramidal cells among the three regions.

  18. Serine Protease Activity of Calnuc

    PubMed Central

    Kanuru, Madhavi; Raman, Rajeev; Aradhyam, Gopala Krishna


    The functions of calnuc, a novel Ca2+-binding protein with multiple structural domains and diverse interacting partners, are yet unknown. We demonstrate unknown facets of calnuc, which is a serine protease in which Ser-378 of GXSXG motif, Asp-328 of DTG motif, and His-339 form the “catalytic triad,” locating the enzyme active site in the C-terminal region. Analogous to the active site of Zn2+ carboxypeptidases, calnuc has two high affinity (Kd ∼ 20 nm), well conserved Zn2+-binding sites near its N terminus, although it is inactive as a peptidase. Zn2+ binding allosterically and negatively regulates the serine protease activity of calnuc, inhibition being caused by an “open to close” change in its conformation not seen upon Ca2+ binding. Most strikingly, interaction with G protein α subunit completely inhibits the enzymatic activity of calnuc. We thus illustrate that G proteins and Zn2+ act as two “keys” that control enzymatic activity of calnuc, arresting it in “locked” state. Calnuc, therefore, exists dynamically in two different forms, (i) as a Ca2+-binding protein in Zn2+-bound form and (ii) as a protease in Zn2+-free form, commissioning it to perform multiple functions. PMID:23195954

  19. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo


    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  20. Characterization of 18 new mutations in COL7A1 in recessive dystrophic epidermolysis bullosa provides evidence for distinct molecular mechanisms underlying defective anchoring fibril formation.

    PubMed Central

    Hovnanian, A; Rochat, A; Bodemer, C; Petit, E; Rivers, C A; Prost, C; Fraitag, S; Christiano, A M; Uitto, J; Lathrop, M; Barrandon, Y; de Prost, Y


    We have characterized 21 mutations in the type VII collagen gene (COL7A1) encoding the anchoring fibrils, 18 of which were not previously reported, in patients from 15 unrelated families with recessive dystrophic epidermolysis bullosa (RDEB). COL7A1 mutations in both alleles were identified by screening the 118 exons of COL7A1 and flanking intron regions. Fourteen mutations created premature termination codons (PTCs) and consisted of nonsense mutations, small insertions, deletions, and splice-site mutations. A further seven mutations predicted glycine or arginine substitutions in the collagenous domain of the molecule. Two mutations were found in more than one family reported in this study, and six of the seven missense mutations showed clustering within exons 72-74 next to the hinge region of the protein. Patients who were homozygous or compound heterozygotes for mutations leading to PTCs displayed both absence or drastic reduction of COL7A1 transcripts and undetectable type VII collagen protein in skin. In contrast, missense mutations were associated with clearly detectable COL7A1 transcripts and with normal or reduced expression of type VII collagen protein at the dermo/epidermal junction. Our results provide evidence for at least two distinct molecular mechanisms underlying defective anchoring fibril formation in RDEB: one involving PTCs leading to mRNA instability and absence of protein synthesis, the other implicating missense mutations resulting in the synthesis of type VII collagen polypeptide with decreased stability and/or altered function. Genotype-phenotype correlations suggested that the nature and location of these mutations are important determinants of the disease phenotype and showed evidence for interfamilial phenotypic variability. Images Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 PMID:9326325

  1. Advances in protease engineering for laundry detergents.


    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich


    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Structure and mechanism of rhomboid protease.


    Ha, Ya; Akiyama, Yoshinori; Xue, Yi


    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  3. Secretion of proteases from Pasteurella multocida isolates.


    Negrete-Abascal, E; Tenorio, V R; de la Garza, M


    The capability of Pasteurella multocida to secrete proteases to the culture medium and their characterization were studied in five animal isolates (bovine, chicken, sheep, and two from pig). All the isolates produced proteases in a wide range of molecular mass. It is suggested that they are neutral metalloproteases, since they were optimally active between pH 6 and 7, inhibited by chelating agents but not by other protease inhibitors, and reactivated by calcium. Proteases from isolates were able to degrade IgG. Several proteins from supernatants of cultures precipitated with 70% (NH4)2SO4 of all the P. multocida isolates were recognized by a polyclonal antiserum raised against a purified protease from Actinobacillus pleuropneumoniae. Protease production might play an important role during tissue colonization and in P. multocida diseases.

  4. Biofluid proteases profiling in diabetes mellitus.


    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui


    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  5. Structure and Mechanism of Rhomboid Protease*

    PubMed Central

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi


    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases. PMID:23585569

  6. [Isolation and properties of cysteine protease from Serratia proteamaculans 94].


    Mozhina, N V; Burmistrova, O A; Pupov, D V; Rudenskaia, G N; Dunaevskiĭ, Ia E; Demidiuk, I V; Kostrov, S V


    A new cysteine protease (SpCP) with a molecular mass of about 50 kDa and optimal functioning at pH 8.0 was isolated from the culture medium of a Serratia proteamaculans 94 psychrotolerant strain using affinity and gel permeation chromatography. The enzyme N terminal amino acid sequence (SPVEEAEGDGIVLDV-) exhibits a reliable similarity to N terminal sequences of gingipains R, cysteine proteases from Polphyromonas gingivalis. Unlike gingipains R, SpCP displays a double substrate specificity and cleaves bonds formed by carboxylic groups of Arg, hydrophobic amino acid residues (Val, Leu, Ala, Tyr, and Phe), Pro, and Gly. SpCP can also hydrolyze native collagen. The enzyme catalysis is effective in a wide range of temperatures. Kinetic studies of Z-Ala-Phe-Arg-pNA hydrolysis catalyzed by the protease at 4 and 37 degrees C showed that a decrease in temperature by more than 30 degrees C causes a 1.3-fold increase in the kcat/Km ratio. Thus, SpCP is an enzyme adapted to low positive temperatures. A protease displaying such properties was found in microorganisms of the Serratia genus for the first time and may serve as a virulent factor for these bacteria.

  7. Antimicrobial proteins and peptides in human lung diseases: A friend and foe partnership with host proteases.


    Lecaille, Fabien; Lalmanach, Gilles; Andrault, Pierre-Marie


    Lung antimicrobial proteins and peptides (AMPs) are major sentinels of innate immunity by preventing microbial colonization and infection. Nevertheless bactericidal activity of AMPs against Gram-positive and Gram-negative bacteria is compromised in patients with chronic obstructive pulmonary disease (COPD), cystic fibrosis (CF) and asthma. Evidence is accumulating that expression of harmful human serine proteases, matrix metalloproteases and cysteine cathepsins is markedely increased in these chronic lung diseases. The local imbalance between proteases and protease inhibitors compromises lung tissue integrity and function, by not only degrading extracellular matrix components, but also non-matrix proteins. Despite the fact that AMPs are somewhat resistant to proteolytic degradation, some human proteases cleave them efficiently and impair their antimicrobial potency. By contrast, certain AMPs may be effective as antiproteases. Host proteases participate in concert with bacterial proteases in the degradation of key innate immunity peptides/proteins and thus may play immunomodulatory activities during chronic lung diseases. In this context, the present review highlights the current knowledge and recent discoveries on the ability of host enzymes to interact with AMPs, providing a better understanding of the role of human proteases in innate host defense.

  8. Protease activation of the entomocidal protoxin of Bacillus thuringiensis subsp. kurstaki.

    PubMed Central

    Andrews, R E; Bibilos, M M; Bulla, L A


    Two isolates of Bacillus thuringiensis subsp. kurstaki were examined which produced different levels of intracellular proteases. Although the crystals from both strains had comparable toxicity, one of the strains, LB1, had a strong polypeptide band at 68,000 molecular weight in the protein from the crystal; in the other, HD251, no such band was evident. When the intracellular proteases in both strains were measured, strain HD251 produced less than 10% of the proteolytic activity found in LB1. These proteases were primarily neutral metalloproteases, although low levels of other proteases were detected. In LB1, the synthesis of protease increased as the cells began to sporulate; however, in HD251, protease activity appeared much later in the sporulation cycle. The protease activity in strain LB1 was very high when the cells were making crystal toxin, whereas in HD251 reduced proteolytic activity was present during crystal toxin synthesis. The insecticidal toxin (molecular weight, 68,000) from both strains could be prepared by cleaving the protoxin (molecular weight, 135,000) with trypsin, followed by ion-exchange chromatography. The procedure described gave quantitative recovery of toxic activity, and approximately half of the total protein was recovered. Calculations show that these results correspond to stoichiometric conversion of protoxin to insecticidal toxin. The toxicities of whole crystals, soluble crystal protein, and purified toxin from both strains were comparable. Images PMID:3909962

  9. Protease activation of the entomocidal protoxin of Bacillus thuringiensis subsp. kurstaki.


    Andrews, R E; Bibilos, M M; Bulla, L A


    Two isolates of Bacillus thuringiensis subsp. kurstaki were examined which produced different levels of intracellular proteases. Although the crystals from both strains had comparable toxicity, one of the strains, LB1, had a strong polypeptide band at 68,000 molecular weight in the protein from the crystal; in the other, HD251, no such band was evident. When the intracellular proteases in both strains were measured, strain HD251 produced less than 10% of the proteolytic activity found in LB1. These proteases were primarily neutral metalloproteases, although low levels of other proteases were detected. In LB1, the synthesis of protease increased as the cells began to sporulate; however, in HD251, protease activity appeared much later in the sporulation cycle. The protease activity in strain LB1 was very high when the cells were making crystal toxin, whereas in HD251 reduced proteolytic activity was present during crystal toxin synthesis. The insecticidal toxin (molecular weight, 68,000) from both strains could be prepared by cleaving the protoxin (molecular weight, 135,000) with trypsin, followed by ion-exchange chromatography. The procedure described gave quantitative recovery of toxic activity, and approximately half of the total protein was recovered. Calculations show that these results correspond to stoichiometric conversion of protoxin to insecticidal toxin. The toxicities of whole crystals, soluble crystal protein, and purified toxin from both strains were comparable.

  10. Bacterial proteases: targets for diagnostics and therapy.


    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J


    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  11. Nucleotide sequences encoding a thermostable alkaline protease


    Wilson, D.B.; Lao, G.


    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  12. Nucleotide sequences encoding a thermostable alkaline protease


    Wilson, David B.; Lao, Guifang


    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  13. A Phytophthora infestans Cystatin-Like Protein Targets a Novel Tomato Papain-Like Apoplastic Protease1[W][OA

    PubMed Central

    Tian, Miaoying; Win, Joe; Song, Jing; van der Hoorn, Renier; van der Knaap, Esther; Kamoun, Sophien


    There is emerging evidence that the proteolytic machinery of plants plays important roles in defense against pathogens. The oomycete pathogen Phytophthora infestans, the agent of the devastating late blight disease of tomato (Lycopersicon esculentum) and potato (Solanum tuberosum), has evolved an arsenal of protease inhibitors to overcome the action of host proteases. Previously, we described a family of 14 Kazal-like extracellular serine protease inhibitors from P. infestans. Among these, EPI1 and EPI10 bind and inhibit the pathogenesis-related (PR) P69B subtilisin-like serine protease of tomato. Here, we describe EPIC1 to EPIC4, a new family of P. infestans secreted proteins with similarity to cystatin-like protease inhibitor domains. Among these, the epiC1 and epiC2 genes lacked orthologs in Phytophthora sojae and Phytophthora ramorum, were relatively fast-evolving within P. infestans, and were up-regulated during infection of tomato, suggesting a role during P. infestans-host interactions. Biochemical functional analyses revealed that EPIC2B interacts with and inhibits a novel papain-like extracellular cysteine protease, termed Phytophthora Inhibited Protease 1 (PIP1). Characterization of PIP1 revealed that it is a PR protein closely related to Rcr3, a tomato apoplastic cysteine protease that functions in fungal resistance. Altogether, this and earlier studies suggest that interplay between host proteases of diverse catalytic families and pathogen inhibitors is a general defense-counterdefense process in plant-pathogen interactions. PMID:17085509

  14. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.


    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  15. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A


    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  16. Developmentally linked changes in proteases and protease inhibitors suggest a role for potato multicystatin in regulating protein content of potato tubers.


    Weeda, Sarah M; Mohan Kumar, G N; Richard Knowles, N


    The soluble protein fraction of fully developed potato (Solanum tuberosum L.) tubers is dominated by patatin, a 40 kD storage glycoprotein, and protease inhibitors. Potato multicystatin (PMC) is a multidomain Cys-type protease inhibitor. PMC effectively inhibits degradation of patatin by tuber proteases in vitro. Herein we show that changes in PMC, patatin concentration, activities of various proteases, and their gene expression are temporally linked during tuber development, providing evidence that PMC has a role in regulating tuber protein content in vivo. PMC was barely detectable in non-tuberized stolons. PMC transcript levels increased progressively during tuberization, concomitant with a 40-fold increase in PMC concentration (protein basis) as tubers developed to 10 g fresh wt. Further increases in PMC were comparatively modest (3.7-fold) as tubers developed to full maturity (250 g). Protease activity declined precipitously as PMC levels increased during tuberization. Proteolytic activity was highest in non-tuberized stolons and fell substantially through the 10-g fresh wt stage. Cys-type proteases dominated the pre-tuberization and earliest stages of tuber development. Increases in patatin transcript levels during tuberization were accompanied by a notable lag in patatin accumulation. Patatin did not begin to accumulate substantially on a protein basis until tubers had reached the 10-g stage, wherein protease activity had been inhibited by approximately 60%. These results indicate that a threshold level of PMC (ca. 3 microg tuber(-1), 144 ng mg(-1) protein) is needed to favor patatin accumulation. Collectively, these results are consistent with a role for PMC in facilitating the accumulation of proteins in developing tubers by inhibiting Cys-type proteases.

  17. Chemiluminescent probe for the in vitro detection of protease activity.


    Richard, Jean-Alexandre; Jean, Ludovic; Romieu, Anthony; Massonneau, Marc; Noack-Fraissignes, Pauline; Renard, Pierre-Yves


    A strategy involving the use of a self-immolative linker has been investigated for the chemiluminescent sensing of proteases. The reactive linker enabled the release of a 1,2-dioxetane light precursor. As a proof of principle, caspase-3, a key peptidase involved in apoptosis has been targeted. An in vitro assay has been carried out and proved the decomposition of the linker and the selectivity for caspase-3.

  18. Approaches for Analyzing the Roles of Mast Cells and Their Proteases In Vivo

    PubMed Central

    Galli, Stephen J.; Tsai, Mindy; Marichal, Thomas; Tchougounova, Elena; Reber, Laurent L.; Pejler, Gunnar


    The roles of mast cells in health and disease remain incompletely understood. While the evidence that mast cells are critical effector cells in IgE-dependent anaphylaxis and other acute IgE-mediated allergic reactions seems unassailable, studies employing various mice deficient in mast cells or mast cell-associated proteases have yielded divergent conclusions about the roles of mast cells or their proteases in certain other immunological responses. Such “controversial” results call into question the relative utility of various older versus newer approaches to ascertain the roles of mast cells and mast cell proteases in vivo. This review discusses how both older and more recent mouse models have been used to investigate the functions of mast cells and their proteases in health and disease. We particularly focus on settings in which divergent conclusions about the importance of mast cells and their proteases have been supported by studies that employed different models of mast cell or mast cell protease deficiency. We think that two major conclusions can be drawn from such findings: (1) no matter which models of mast cell or mast cell protease deficiency one employs, the conclusions drawn from the experiments always should take into account the potential limitations of the models (particularly abnormalities affecting cell types other than mast cells) and (2) even when analyzing a biological response using a single model of mast cell or mast cell protease deficiency, details of experimental design are critical in efforts to define those conditions under which important contributions of mast cells or their proteases can be identified. PMID:25727288

  19. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease

    PubMed Central

    Murphy, Timothy F.; Kirkham, Charmaine; Jones, Megan M.; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M.


    Background. Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. Methods. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. Results. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Conclusions. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. PMID:25995193

  20. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease.


    Murphy, Timothy F; Kirkham, Charmaine; Jones, Megan M; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M


    Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail:

  1. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.


    Huston, Wilhelmina M


    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  2. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology


    CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT...could be fully inhibited at a 1:1 molar ratio by the naturally-occuring proteinaceous trypsin inhibitors BBI from soybeans and CI from chickpeas ...substrates. These activities were fully inhibited by the proteinaceous trypsin-chymotrypsin inhibitors BBI from soybeans and CI from chickpeas when assayed

  3. Tissue Dissociation Enzyme Neutral Protease Assessment

    PubMed Central

    Breite, A.G.; Dwulet, F.E.; McCarthy, R.C.


    Neutral proteases, essential components of purified tissue dissociation enzymes required for successful human islet isolation, show variable activities and effects of substrate on their activities. Initially we used a spectrophotometric endpoint assay with azocasein substrate to measure neutral protease activity. After critical review of the results, we observed these data to be inconsistent and not correlating expected differences in specific activities between thermolysin and Bacillus polymyxa proteases. This observation led to the development of a fluorescent microplate assay using fluorescein isothyocyanate–conjugated bovine serum albumin (FITC-BSA) as the substrate. This simpler, more flexible method offered a homogeneous, kinetic enzyme assay allowing determination of steady state reaction rates of sample replicates at various dilutions. The assay had a linear range of 4- to 8-fold and interassay coefficients of variation for B polymyxa protease and thermolysin of <9% and <15%, respectively, which were lower than those using the spectrophotometric endpoint assay, namely, 54% and 36%, respectively. This format allowed for incorporation of enzyme inhibitors, as illustrated by addition of sulfhydryl protease inhibitors, which, consistent with earlier reports, strongly indicated that the main contaminant in purified collagenase preparations was clostripain. Determination of the specific activities for several purified neutral proteases showed that the B polymyxa and Clostridium histolyticum proteases had approximately 40% and 15% specific activities, respectively, of those obtained with purified thermolysin, indicating the different characteristics of neutral protease enzymes for cell isolation procedures. PMID:20692405

  4. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.


    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  5. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.


    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles


    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  6. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors

    PubMed Central


    Background The frequency of cyanobacterial blooms has increased worldwide, and these blooms have been claimed to be a major factor leading to the decline of the most important freshwater herbivores, i.e. representatives of the genus Daphnia. This suppression of Daphnia is partly attributed to the presence of biologically active secondary metabolites in cyanobacteria. Among these metabolites, protease inhibitors are found in almost every natural cyanobacterial bloom and have been shown to specifically inhibit Daphnia's digestive proteases in vitro, but to date no physiological responses of these serine proteases to cyanobacterial protease inhibitors in Daphnia have been reported in situ at the protein and genetic levels. Results Nine digestive proteases were detected in D. magna using activity-stained SDS-PAGE. Subsequent analyses by LC-MS/MS and database search led to the identification of respective protease genes. D. magna responded to dietary protease inhibitors by up-regulation of the expression of these respective proteases at the RNA-level and by the induction of new and less sensitive protease isoforms at the protein level. The up-regulation in response to dietary trypsin- and chymotrypsin-inhibitors ranged from 1.4-fold to 25.6-fold. These physiological responses of Daphnia, i.e. up-regulation of protease expression and the induction of isoforms, took place even after feeding on 20% cyanobacterial food for only 24 h. These physiological responses proved to be independent from microcystin effects. Conclusion Here for the first time it was shown in situ that a D. magna clone responds physiologically to dietary cyanobacterial protease inhibitors by phenotypic plasticity of the targets of these specific inhibitors, i.e. Daphnia gut proteases. These regulatory responses are adaptive for D. magna, as they increase the capacity for protein digestion in the presence of dietary protease inhibitors. The type and extent of these responses in protease expression might

  7. Evidence for defect-induced superconductivity up to 49 K in (C a1 -xRx) F e2A s2

    NASA Astrophysics Data System (ADS)

    Deng, L. Z.; Lv, B.; Zhao, K.; Wei, F. Y.; Xue, Y. Y.; Wu, Z.; Chu, C. W.


    To explore the origin of the unusual nonbulk superconductivity with a Tc up to 49 K reported in the rare-earth-doped CaF e2A s2 , the chemical composition, magnetization, specific heat, resistivity, and annealing effect are systematically investigated on nominal (C a1 -xRx) F e2A s2 single crystals with different x and R =La , Ce, Pr, and Nd. All display a doping-independent Tc once superconductivity is induced, a doping-dependent low field superconducting volume fraction f , and a large magnetic anisotropy η in the superconducting state, suggesting a rather inhomogeneous superconducting state in an otherwise microscale homogenous superconductor. The wavelength dispersive spectroscopy and specific heat show the presence of defects that are closely related to f , regardless of the R involved. The magnetism further reveals that the defects are mainly superparamagnetic clusters for R =Ce , Pr, and Nd with strong intercluster interactions, implying that defects are locally self-organized. Annealing at 500 °C, without varying the doping level x , suppresses f profoundly but not the Tc. The above observations provide evidence for the crucial role of defects in the occurrence of the unusually high Tc˜49 K in (C a1 -xRx) F e2A s2 and are consistent with the interface-enhanced superconductivity recently proposed.

  8. Caffeine prevents kidney stone formation by translocation of apical surface annexin A1 crystal-binding protein into cytoplasm: In vitro evidence

    PubMed Central

    Peerapen, Paleerath; Thongboonkerd, Visith


    Recent large 3 cohorts have shown that caffeinated beverage consumption was associated with lower risk of kidney stone disease. However, its protective mechanisms remained unknown and had not been previously investigated. We thus evaluated protective effects of caffeine (1 μM–10 mM) on calcium oxalate monohydrate (COM) kidney stone formation, using crystallization, crystal growth, cell-crystal adhesion, Western blotting, and immunofluorescence assays. The results showed that caffeine reduced crystal number but, on the other hand, increased crystal size, resulting in unchanged crystal mass, consistent with crystal growth that was not affected by caffeine. However, caffeine significantly decreased crystal-binding capacity of MDCK renal tubular cells in a dose-dependent manner. Western blotting and immunofluorescence study of COM crystal-binding proteins revealed significantly decreased level of annexin A1 on apical surface and its translocation into cytoplasm of the caffeine-treated cells, but no significant changes in other COM crystal-binding proteins (annexin A2, α-enolase, HSP70, and HSP90) were observed. Moreover, caffeine decreased intracellular [Ca2+] but increased [Ca2+] secretory index. Taken together, our findings showed an in vitro evidence of the protective mechanism of caffeine against kidney stone formation via translocation of annexin A1 from apical surface into cytoplasm to reduce the crystal-binding capacity of renal tubular epithelial cells. PMID:27924845

  9. Millimeter-Wave Studies of the Isotopologues of IZnCH3(X1A1): Geometric Parameters and Evidence for Zinc Insertion

    NASA Astrophysics Data System (ADS)

    Bucchino, Matthew; Young, Justin; Sheridan, Phillip; Ziurys, Lucy


    The laboratory detection of gas-phase IZnCH3 (X1A1), using millimeter-wave direct absorption methods, was reported previously. This work has been extended by the measurement of the pure rotational spectrum of several isotopolgues: I64ZnCH3, I66ZnCH3, I64ZnCD3, and I64Zn13CH3. These species were all created by the reaction of zinc vapor with CH3I, CD3I, or 13CH3I in the presence of a DC discharge. The zinc isotopolgues were observed in natural abundance. Rotational transitions in the range 256{-293} GHz (J = 109 {←} 108 to J = 132 {←} 131, for K = 0 to 6) have been recorded for each species. From these measurements, an r0 structure has been determined. This structure was found to be in good agreement with previous DFT calculations. Interestingly, the 110.2° Zn - C - H bond angle of IZnCH3 is identical to that of the hydrogen substituted zinc insertion complex HZnCH3 (X1A1). These data are further evidence that IZnCH3 is not created by the generation of free radical fragments, but by the direct insertion of atomic zinc into the C - I bond of iodomethane.

  10. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.


    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun


    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  11. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo


    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  12. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola


    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  13. The prototype foamy virus protease is active independently of the integrase domain

    PubMed Central


    Background Recently, contradictory results on foamy virus protease activity were published. While our own results indicated that protease activity is regulated by the viral RNA, others suggested that the integrase is involved in the regulation of the protease. Results To solve this discrepancy we performed additional experiments showing that the protease-reverse transcriptase (PR-RT) exhibits protease activity in vitro and in vivo, which is independent of the integrase domain. In contrast, Pol incorporation, and therefore PR activity in the viral context, is dependent on the integrase domain. To further analyse the regulation of the protease, we incorporated Pol in viruses by expressing a GagPol fusion protein, which supported near wild-type like infectivity. A GagPR-RT fusion, lacking the integrase domain, also resulted in wild-type like Gag processing, indicating that the integrase is dispensable for viral Gag maturation. Furthermore, we demonstrate with a trans-complementation assays that the PR in the context of the PR-RT protein supports in trans both, viral maturation and infectivity. Conclusion We provide evidence that the FV integrase is required for Pol encapsidation and that the FV PR activity is integrase independent. We show that an active PR can be encapsidated in trans as a GagPR-RT fusion protein. PMID:22574974

  14. The cysteine-rich domain regulates ADAM protease function in vivo.


    Smith, Katherine M; Gaultier, Alban; Cousin, Helene; Alfandari, Dominique; White, Judith M; DeSimone, Douglas W


    ADAMs are membrane-anchored proteases that regulate cell behavior by proteolytically modifying the cell surface and ECM. Like other membrane-anchored proteases, ADAMs contain candidate "adhesive" domains downstream of their metalloprotease domains. The mechanism by which membrane-anchored cell surface proteases utilize these putative adhesive domains to regulate protease function in vivo is not well understood. We address this important question by analyzing the relative contributions of downstream extracellular domains (disintegrin, cysteine rich, and EGF-like repeat) of the ADAM13 metalloprotease during Xenopus laevis development. When expressed in embryos, ADAM13 induces hyperplasia of the cement gland, whereas ADAM10 does not. Using chimeric constructs, we find that the metalloprotease domain of ADAM10 can substitute for that of ADAM13, but that specificity for cement gland expansion requires a downstream extracellular domain of ADAM13. Analysis of finer resolution chimeras indicates an essential role for the cysteine-rich domain and a supporting role for the disintegrin domain. These and other results reveal that the cysteine-rich domain of ADAM13 cooperates intramolecularly with the ADAM13 metalloprotease domain to regulate its function in vivo. Our findings thus provide the first evidence that a downstream extracellular adhesive domain plays an active role in regulating ADAM protease function in vivo. These findings are likely relevant to other membrane-anchored cell surface proteases.

  15. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T


    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  16. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira


    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  17. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.


    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati


    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  18. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis


    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  19. HIV-1 Protease: Structure, Dynamics and Inhibition

    SciTech Connect

    Louis, John M.; Ishima, R.; Torchia, D.A.; Weber, Irene T.


    The HIV-1 protease is synthesized as part of a large Gag-Pol precursor protein. It is responsible for its own release from the precursor and the processing of the Gag and Gag-Pol polyproteins into the mature structural and functional proteins required for virus maturation. Because of its indispensable role, the mature HIV-1 protease dimer has proven to be a successful target for the development of antiviral agents. In the last 5 years, a major emphasis in protease research has been to improve inhibitor design and treatment regimens.

  20. Inactivation of Streptococcus pyogenes extracellular cysteine protease significantly decreases mouse lethality of serotype M3 and M49 strains.

    PubMed Central

    Lukomski, S; Sreevatsan, S; Amberg, C; Reichardt, W; Woischnik, M; Podbielski, A; Musser, J M


    Cysteine proteases have been implicated as important virulence factors in a wide range of prokaryotic and eukaryotic pathogens, but little direct evidence has been presented to support this notion. Virtually all strains of the human bacterial pathogen Streptococcus pyogenes express a highly conserved extracellular cysteine protease known as streptococcal pyrogenic exotoxin B (SpeB). Two sets of isogenic strains deficient in SpeB cysteine protease activity were constructed by integrational mutagenesis using nonreplicating recombinant plasmids containing a truncated segment of the speB gene. Immunoblot analyses and enzyme assays confirmed that the mutant derivatives were deficient in expression of enzymatically active SpeB cysteine protease. To test the hypothesis that the cysteine protease participates in host mortality, we assessed the ability of serotype M3 and M49 wild-type strains and isogenic protease-negative mutants to cause death in outbred mice after intraperitoneal inoculation. Compared to wild-type parental organisms, the serotype M3 speB mutant lost virtually all ability to cause mouse death (P < 0.00001), and similarly, the virulence of the M49 mutant was detrimentally altered (P < 0.005). The data unambiguously demonstrate that the streptococcal enzyme is a virulence factor, and thereby provide additional evidence that microbial cysteine proteases are critical in host-pathogen interactions. PMID:9169486

  1. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.


    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  2. Secreted fungal aspartic proteases: A review.


    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia


    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application. Copyright © 2016 Asociación Española de Micología. Published by Elsevier Espana. All rights reserved.

  3. Regulatory Characteristics of Bacillus pumilus Protease Promoters.


    Toymentseva, Anna A; Mascher, Thorsten; Sharipova, Margarita R


    Expression of extracellular protease genes of Bacilli is subject to regulation by many positive and negative regulators. Here we analyzed 5' regulatory regions of genes encoding proteolytic proteases AprBp, GseBp, and MprBp from Bacillus pumilus strain 3-19. Gfp fusion constructs with upstream genomic regions of different lengths were created for all three genes to identify their natural promoters (regulatory regions). Our results suggest that the aprBp gene, encoding the major subtilisin-like protease, has the most extensive promoter region of approximately 445 bp, while the minor protease genes encoding glutamyl endopeptidase (gseBp) and metalloproteinase (mprBp) are preceded by promoters of 150 and 250 bp in length, respectively. Promoter analysis of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporter fusion constructs in degU and spo0A mutants indicates a positive regulatory effect of DegU and Spo0A on protease expression, while the disruption of abrB, sinR, and scoC repressor genes did not significantly affect promoter activities of all protease genes. On the other hand, the expression of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporters increased 1.6- and 3.0-fold, respectively, in sigD-deficient cells, indicating that the prevention of motility gene expression promotes protease expression. Our results indicate that all examined regulators regulated serine proteases production in B. subtilis.

  4. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology


    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  5. Acid protease production in fungal root endophytes.


    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin


    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  6. How proteases regulate bone morphogenesis.


    Ortega, Nathalie; Behonick, Danielle; Stickens, Dominique; Werb, Zena


    Matrix metalloproteinases (MMPs) degrade most components of the extracellular matrix (ECM), as well as many non-ECM molecules. MMPs participate in (1). degradation of ECM to allow cell migration; (2). alteration of the ECM microenvironment resulting in alteration in cellular behavior; (3). modulation of biologically active molecules by direct cleavage or release from ECM stores; (4). regulation of the activity of other proteases; and (5). cell attachment, proliferation, differentiation, and apoptosis. We have sought to understand the role of MMPs during development and tissue repair in transgenic mice. Endochondral bone formation presents a particularly interesting developmental challenge. During this process, an avascular tissue (cartilage) is converted into one of the most highly vascularized tissues (bone) in the vertebrate body. Ossification begins with invasion of the calcified hypertrophic cartilage by capillaries. Apoptosis of the terminal hypertrophic chondrocytes, degradation of the cartilage matrix, and deposition of bone matrix by osteoblasts accompanies neovascularization of the growth plate. Remodeling of ECM results in a cavity filled with vascular channels containing hematopoietic cells. Our results reveal that MMP9, MMP13, and vascular endothelial growth factor are key regulators for the remodeling of the skeletal tissues. They coordinate not only matrix degradation, but also the recruitment and differentiation of endothelial cells, osteoclasts, chondroclasts, and osteoprogenitors.

  7. PCSK9: an enigmatic protease.


    Lopez, Dayami


    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  8. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |


    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  9. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham


    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  10. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    USDA-ARS?s Scientific Manuscript database

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  11. Further Evidence for the JuSt Program as Treatment for Insomnia in Adolescents: Results from a 1-Year Follow-Up Study

    PubMed Central

    Roeser, Karolin; Schwerdtle, Barbara; Kübler, Andrea; Schlarb, Angelika A.


    Study Objectives: Insomnia in adolescence adversely affects young people's current and future functioning, as well as their mental and physical health. Thus, effective and economic treatment is invaluable. The present study evaluated a 6-session multimodal group therapy, JuSt, for adolescents suffering from insomnia including cognitive-behavioral elements and clinical hypnosis. Methods: Participants (n = 19, 68.4% female) were aged 11–16 years and suffered from insomnia. Sleep onset latency (SOL), time spent awake time after sleep onset (WASO), and sleep efficiency (SE) were measured with sleep logs before and after treatment, and at 3-, 6-, and 12-month follow-up. Results: Compared to baseline, SOL and WASO significantly decreased, while there was a significant increase in SE and the feeling of being rested after the JuSt treatment. At 12-month follow-up, all parameters were still significantly different from their baseline level. The long-term effect sizes were at least as large as the short-term effects, indicating a stable improvement. Conclusions: These results suggest that the JuSt program represents a potent intervention to sustainably reduce insomniac complaints in adolescents. Given the unselected nature of our sample, a broad indication can be assumed. To further evaluate the program's efficacy, randomized controlled trials should be conducted. Citation: Roeser K, Schwerdtle B, Kübler A, Schlarb AA. Further evidence for the just program as treatment for insomnia in adolescents: results from a 1-year follow-up study. J Clin Sleep Med 2016;12(2):257–262. PMID:26446249

  12. Mice Deficient in the Gene for Cytochrome P450 (CYP)1A1 Are More Susceptible Than Wild-Type to Hyperoxic Lung Injury: Evidence for Protective Role of CYP1A1 Against Oxidative Stress

    PubMed Central

    Wang, Lihua; Wang, Gangduo; Couroucli, Xanthi I.; Shivanna, Binoy; Welty, Stephen E.; Barrios, Roberto; Khan,  M. Firoze; Nebert, Daniel W.; Roberts, L. Jackson; Moorthy, Bhagavatula


    Hyperoxia contributes to acute lung injury in diseases such as acute respiratory distress syndrome in adults and bronchopulmonary dysplasia in premature infants. Cytochrome P450 (CYP)1A1 has been shown to modulate hyperoxic lung injury. The mechanistic role(s) of CYP1A1 in hyperoxic lung injury in vivo is not known. In this investigation, we hypothesized that Cyp1a1(–/–) mice would be more susceptible to hyperoxic lung injury than wild-type (WT) mice, and that the protective role of CYP1A1 is in part due to CYP1A1-mediated decrease in the levels of reactive oxygen species-mediated lipid hydroperoxides, e.g., F2-isoprostanes/isofurans, leading to attenuation of oxidative damage. Eight- to ten-week-old male WT (C57BL/6J) or Cyp1a1(–/–) mice were exposed to hyperoxia (>95% O2) or room air for 24–72 h. The Cyp1a1(–/–) mice were more susceptible to oxygen-mediated lung damage and inflammation than WT mice, as evidenced by increased lung weight/body weight ratio, lung injury, neutrophil infiltration, and augmented expression of IL-6. Hyperoxia for 24–48 h induced CYP1A expression at the mRNA, protein, and enzyme levels in liver and lung of WT mice. Pulmonary F2-isoprostane and isofuran levels were elevated in WT mice after hyperoxia for 24 h. On the other hand, Cyp1a1(–/–) mice showed higher levels after 48–72 h of hyperoxia exposure compared to WT mice. Our results support the hypothesis that CYP1A1 protects against hyperoxic lung injury by decreasing oxidative stress. Future research could lead to the development of novel strategies for prevention and/or treatment of acute lung injury. PMID:24893714

  13. Intervention for hyperlipidemia associated with protease inhibitors.


    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J


    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  14. The dimer interfaces of protease and extra-protease domains influence the activation of protease and the specificity of GagPol cleavage.


    Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H


    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.

  15. Genetic evidence that mutations in the COL1A1, COL1A2, COL3A1, or COL5A2 collagen genes are not responsible for mitral valve prolapse.

    PubMed Central

    Henney, A M; Tsipouras, P; Schwartz, R C; Child, A H; Devereux, R B; Leech, G J


    DNA markers were used to assess the segregation of genes encoding the collagen types that predominate in the mitral valve (types I, III, and V) in two family pedigrees that are phenotypically different but showed dominantly inherited mitral valve prolapse. The inheritance of these markers was compared with the segregation of the phenotype for mitral valve prolapse in both families. In one family it was shown that the COL1A1, COL1A2, COL3A1, and COL5A2 genes segregated independently of the phenotype; in the other family the results for COL1A1, COL1A2, and COL5A2 were similar but analysis at the COL3A1 locus was not possible. These data indicate that in these families mitral valve prolapse does not arise from a defect in one of these collagen genes. PMID:2930668

  16. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum


    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  17. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H


    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  18. Lysosomal protease expression in mature enamel.


    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D


    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  19. Bacterial proteases, untapped antimicrobial drug targets.


    Culp, Elizabeth; Wright, Gerard D


    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  20. The function of the DegP (HtrA) protein: Protease versus chaperone.


    Chang, Zengyi


    The DegP (or HtrA) is a highly conserved family of proteins functioning in all living organisms. It was initially identified as a protease functioning in the periplasmic space of the Gram-negative bacterial cells. It was later reported to also exhibit chaperone activity and thus has been designated as a bifunctional protein. However, recent studies demonstrated that in living cells it more likely functions only as a protease with hardly detectable chaperone activities. In this review, I will summarize the evidences clarifying that DegP more likely only functions as a protease rather than as a chaperone in cells. © 2016 IUBMB Life, 68(11):904-907, 2016. © 2016 International Union of Biochemistry and Molecular Biology.

  1. Interaction of hnRNP A1 with snRNPs and pre-mRNAs: evidence for a possible role of A1 RNA annealing activity in the first steps of spliceosome assembly.

    PubMed Central

    Buvoli, M; Cobianchi, F; Riva, S


    The in vitro interaction of recombinant hnRNP A1 with purified snRNPs and with pre-mRNAs was investigated. We show that protein A1 can stably bind U2 and U4 snRNP but not U1. Oligo-RNAse H cleavage of U2 nucleotides involved in base pairing with the branch site, totally eliminates the A1-U2 interaction. RNase T1 protection and immunoprecipitation experiments demonstrate that recombinant protein A1 specifically binds the 3'-end regions of both beta-globin and Ad-2 introns. However, while on the beta-globin intron only binding to the polypyrimidine tract was observed, on the Ad-2 intron a 32 nt fragment encompassing the branch point and the AG splice-site dinucleotide was bound and protected. Such protection was drastically reduced in the presence of U2 snRNP. Altogether these results indicate that protein A1 can establish a different pattern of association with different pre-mRNAs and support the hypothesis that this protein could play a role in the annealing of U2 to the branch site and hence in the early events of pre-splicing complex assembly. Images PMID:1329035

  2. Serine Protease Catalysis: A Computational Study of Tetrahedral Intermediates and Inhibitory Adducts.


    Ngo, Phong D; Mansoorabadi, Steven O; Frey, Perry A


    Peptide boronic acids and peptidyl trifluoromethyl ketones (TFKs) inhibit serine proteases by forming monoanionic, tetrahedral adducts to serine in the active sites. Investigators regard these adducts as analogs of monoanionic, tetrahedral intermediates. Density functional theory (DFT) calculations and fractional charge analysis show that tetrahedral adducts of model peptidyl TFKs are structurally and electrostatically very similar to corresponding tetrahedral intermediates. In contrast, the DFT calculations show the structures and electrostatic properties of analogous peptide boronate adducts to be significantly different. The peptide boronates display highly electrostatically positive boron, with correspondingly negative ligands in the tetrahedra. In addition, the computed boron-oxygen and boron-carbon bond lengths in peptide boronates (which are identical or very similar to the corresponding bonds in a peptide boronate adduct of α-lytic protease determined by X-ray crystallography at subangstrom resolution) are significantly longer than the corresponding bond lengths in model tetrahedral intermediates. Since protease-peptidyl TFKs incorporate low-barrier hydrogen bonds (LBHBs) between an active site histidine and aspartate, while the protease-peptide boronates do not, these data complement the spectroscopic and chemical evidence for the participation of LBHBs in catalysis by serine proteases. Moreover, while the potency of these classes of inhibitors can be correlated to the structures of the peptide moieties, the present results indicate that the strength of their bonds to serine contribute significantly to their inhibitory properties.

  3. The Hypervariable Amino-Terminus of P1 Protease Modulates Potyviral Replication and Host Defense Responses

    PubMed Central

    Pasin, Fabio; Simón-Mateo, Carmen; García, Juan Antonio


    The replication of many RNA viruses involves the translation of polyproteins, whose processing by endopeptidases is a critical step for the release of functional subunits. P1 is the first protease encoded in plant potyvirus genomes; once activated by an as-yet-unknown host factor, it acts in cis on its own C-terminal end, hydrolyzing the P1-HCPro junction. Earlier research suggests that P1 cooperates with HCPro to inhibit host RNA silencing defenses. Using Plum pox virus as a model, we show that although P1 does not have a major direct role in RNA silencing suppression, it can indeed modulate HCPro function by its self-cleavage activity. To study P1 protease regulation, we used bioinformatic analysis and in vitro activity experiments to map the core C-terminal catalytic domain. We present evidence that the hypervariable region that precedes the protease domain is predicted as intrinsically disordered, and that it behaves as a negative regulator of P1 proteolytic activity in in vitro cleavage assays. In viral infections, removal of the P1 protease antagonistic regulator is associated with greater symptom severity, induction of salicylate-dependent pathogenesis-related proteins, and reduced viral loads. We suggest that fine modulation of a viral protease activity has evolved to keep viral amplification below host-detrimental levels, and thus to maintain higher long-term replicative capacity. PMID:24603811

  4. An enzymatic method for the determination of hemoglobinA(1C).


    Hirokawa, Kozo; Shimoji, Kazuhiko; Kajiyama, Naoki


    Fructosyl peptide oxidase is a flavoenzyme that catalyzes the oxidative deglycation of N-(1-deoxyfructosyl)-Val-His, a model compound of hemoglobin (Hb)A(1C). To develop an enzymatic method for the measurement of HbA(1C), we screened for a proper protease using N-(1-deoxyfructosyl)-hexapeptide as a substrate. Several proteases, including Neutral protease from Bacillus polymyxa, were found to release N-(1-deoxyfructosyl)-Val-His efficiently, however no protease was found to release N-(1-deoxyfructosyl)-Val. Neutral protease also digested HbA(1C) to release N-(1-deoxyfructosyl)-Val-His, and then the fructosyl peptide was detected using fructosyl peptide oxidase. The linear relationship was observed between the concentration of HbA(1C) and the absorbancy of fructosyl peptide oxidase reaction, hence this new method is a practical means for measuring HbA(1C.).

  5. Cleavage entropy as quantitative measure of protease specificity.


    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R


    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  6. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.


    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  7. Neutrophil serine proteases in antibacterial defense.


    Stapels, Daphne A C; Geisbrecht, Brian V; Rooijakkers, Suzan H M


    Neutrophil serine proteases (NSPs) are critical for the effective functioning of neutrophils and greatly contribute to immune protection against bacterial infections. Thanks to their broad substrate specificity, these chymotrypsin-like proteases trigger multiple reactions that are detrimental to bacterial survival such as direct bacterial killing, generation of antimicrobial peptides, inactivation of bacterial virulence factors and formation of neutrophil extracellular traps. Recently, the importance of NSPs in antibacterial defenses has been further underscored by discoveries of unique bacterial evasion strategies to combat these proteases. Bacteria can indirectly disarm NSPs by protecting bacterial substrates against NSP cleavage, but also produce inhibitory molecules that potently block NSPs. Here we review recent insights in the functional contribution of NSPs in host protection against bacterial infections and the elegant strategies that bacteria use to counteract these responses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Insect response to plant defensive protease inhibitors.


    Zhu-Salzman, Keyan; Zeng, Rensen


    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  9. A cysteine protease of Dieffenbachia maculata.


    Chitre, A; Padmanabhan, S; Shastri, N V


    Plants of the genus Dieffenbachia, very popular as indoor ornamental plants, are known for their toxic as well as therapeutic properties. Their toxic manifestations have been partly attributed to their proteolytic activity. The work described in the present paper shows that stem leaves and petiole of Dieffenbachia maculata Schott, a commonly grown species, contain significant proteolytic activity, different parts showing different types of protease activities. Stem showed the highest enzyme activity and this protease was purified about 55 fold by solvent precipitation, gel filtration and ion exchange chromatography. The enzyme has a relative molecular mass of 61 kDa as determined by SDS-PAGE and has an optimum pH of 8.0 and optimum temperature of 50 degrees C. Effects of various substrates, inhibitors and activators indicate that the enzyme is a cysteine protease with leucylpeptidase activity.

  10. HIV-1 Protease in the Fission Yeast Schizosaccharomyces pombe.


    Benko, Zsigmond; Elder, Robert T; Li, Ge; Liang, Dong; Zhao, Richard Y


    HIV-1 protease (PR) is an essential viral enzyme. Its primary function is to proteolyze the viral Gag-Pol polyprotein for production of viral enzymes and structural proteins and for maturation of infectious viral particles. Increasing evidence suggests that PR cleaves host cellular proteins. However, the nature of PR-host cellular protein interactions is elusive. This study aimed to develop a fission yeast (Schizosaccharomyces pombe) model system and to examine the possible interaction of HIV-1 PR with cellular proteins and its potential impact on cell proliferation and viability. A fission yeast strain RE294 was created that carried a single integrated copy of the PR gene in its chromosome. The PR gene was expressed using an inducible nmt1 promoter so that PR-specific effects could be measured. HIV-1 PR from this system cleaved the same indigenous viral p6/MA protein substrate as it does in natural HIV-1 infections. HIV-1 PR expression in fission yeast cells prevented cell proliferation and induced cellular oxidative stress and changes in mitochondrial morphology that led to cell death. Both these PR activities can be prevented by a PR-specific enzymatic inhibitor, indinavir, suggesting that PR-mediated proteolytic activities and cytotoxic effects resulted from enzymatic activities of HIV-1 PR. Through genome-wide screening, a serine/threonine kinase, Hhp2, was identified that suppresses HIV-1 PR-induced protease cleavage and cell death in fission yeast and in mammalian cells, where it prevented PR-induced apoptosis and cleavage of caspase-3 and caspase-8. This is the first report to show that HIV-1 protease is functional as an enzyme in fission yeast, and that it behaves in a similar manner as it does in HIV-1 infection. HIV-1 PR-induced cell death in fission yeast could potentially be used as an endpoint for mechanistic studies, and this system could be used for developing a high-throughput system for drug screenings.

  11. Serine Protease(s) Secreted by the Nematode Trichuris muris Degrade the Mucus Barrier

    PubMed Central

    Hasnain, Sumaira Z.; McGuckin, Michael A.; Grencis, Richard K.; Thornton, David J.


    The polymeric mucin component of the intestinal mucus barrier changes during nematode infection to provide not only physical protection but also to directly affect pathogenic nematodes and aid expulsion. Despite this, the direct interaction of the nematodes with the mucins and the mucus barrier has not previously been addressed. We used the well-established Trichuris muris nematode model to investigate the effect on mucins of the complex mixture of immunogenic proteins secreted by the nematode called excretory/secretory products (ESPs). Different regimes of T. muris infection were used to simulate chronic (low dose) or acute (high dose) infection. Mucus/mucins isolated from mice and from the human intestinal cell line, LS174T, were treated with ESPs. We demonstrate that serine protease(s) secreted by the nematode have the ability to change the properties of the mucus barrier, making it more porous by degrading the mucin component of the mucus gel. Specifically, the serine protease(s) acted on the N-terminal polymerising domain of the major intestinal mucin Muc2, resulting in depolymerisation of Muc2 polymers. Importantly, the respiratory/gastric mucin Muc5ac, which is induced in the intestine and is critical for worm expulsion, was protected from the depolymerising effect exerted by ESPs. Furthermore, serine protease inhibitors (Serpins) which may protect the mucins, in particular Muc2, from depolymerisation, were highly expressed in mice resistant to chronic infection. Thus, we demonstrate that nematodes secrete serine protease(s) to degrade mucins within the mucus barrier, which may modify the niche of the parasite to prevent clearance from the host or facilitate efficient mating and egg laying from the posterior end of the parasite that is in intimate contact with the mucus barrier. However, during a TH2-mediated worm expulsion response, serpins, Muc5ac and increased levels of Muc2 protect the barrier from degradation by the nematode secreted protease(s). PMID

  12. Seminal and colostral protease inhibitors on leukocytes.


    Veselský, L; Cechová, D; Hruban, V; Klaudy, J


    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  13. Saquinavir, the pioneer antiretroviral protease inhibitor.


    la Porte, Charles J L


    The treatment of HIV infection underwent a major change in 1995 when saquinavir was the first protease inhibitor introduced into the market. This drug made the use of combination therapy in the treatment of HIV possible and increased the success rate of treatment. This article will review recent literature on saquinavir to define its current role in HIV treatment, among the newer antiretroviral drugs. Scientific literature and conference presentations were evaluated for relevant information pertaining to saquinavir. Although underused, saquinavir has good efficacy and tolerability when compared to other protease inhibitors. The film-coated tablet formulation improved pill burden. Saquinavir still has potential in the treatment of adults, children and pregnant women.

  14. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan


    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  15. Detection of protease and protease activity using a single nanocrescent SERS probe


    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank


    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  16. Detection of protease and protease activity using a single nanoscrescent SERS probe


    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank


    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  17. Deep sequencing of protease inhibitor resistant HIV patient isolates reveals patterns of correlated mutations in Gag and protease.


    Flynn, William F; Chang, Max W; Tan, Zhiqiang; Oliveira, Glenn; Yuan, Jinyun; Okulicz, Jason F; Torbett, Bruce E; Levy, Ronald M


    While the role of drug resistance mutations in HIV protease has been studied comprehensively, mutations in its substrate, Gag, have not been extensively cataloged. Using deep sequencing, we analyzed a unique collection of longitudinal viral samples from 93 patients who have been treated with therapies containing protease inhibitors (PIs). Due to the high sequence coverage within each sample, the frequencies of mutations at individual positions were calculated with high precision. We used this information to characterize the variability in the Gag polyprotein and its effects on PI-therapy outcomes. To examine covariation of mutations between two different sites using deep sequencing data, we developed an approach to estimate the tight bounds on the two-site bivariate probabilities in each viral sample, and the mutual information between pairs of positions based on all the bounds. Utilizing the new methodology we found that mutations in the matrix and p6 proteins contribute to continued therapy failure and have a major role in the network of strongly correlated mutations in the Gag polyprotein, as well as between Gag and protease. Although covariation is not direct evidence of structural propensities, we found the strongest correlations between residues on capsid and matrix of the same Gag protein were often due to structural proximity. This suggests that some of the strongest inter-protein Gag correlations are the result of structural proximity. Moreover, the strong covariation between residues in matrix and capsid at the N-terminus with p1 and p6 at the C-terminus is consistent with residue-residue contacts between these proteins at some point in the viral life cycle.

  18. Tissue Factor, Protease Activated Receptors and Pathologic Heart Remodeling

    PubMed Central

    Antoniak, Silvio; Sparkenbaugh, Erica; Pawlinski, Rafal


    Tissue factor is the primary initiator of coagulation cascade and plays an essential role in hemostasis and thrombosis. In addition, tissue factor and coagulation proteases contribute to the many cellular responses via activation of protease activated receptors. Heart is the organ demonstrating high levels of constitutive tissue factor expression. This review focuses on the role of tissue factor, coagulation proteases and protease activated receptors in heart hemostasis and the pathological heart remodeling associated with myocardial infarction, viral myocarditis and hypertension. PMID:25104210

  19. Discovery and characterization of a novel plant pathogen protease

    USDA-ARS?s Scientific Manuscript database

    Chitinase modifying proteins are fungal proteases that attack specific plant defense chitinases. At least three unrelated types of proteases have evolved to have this function. They all truncate the targeted chitinases by cleaving near their amino termini, but each protease type targets a different ...

  20. CYP1A1 Induction in the Colon by Serum: Involvement of the PPARα Pathway and Evidence for a New Specific Human PPREα Site

    PubMed Central

    Villard, Pierre-Henri; Barlesi, Fabrice; Armand, Martine; Dao, Thi-Mai-Anh; Pascussi, Jean-Marc; Fouchier, Francis; Champion, Serge; Dufour, Claire; Giniès, Christian; Khalil, Ayman; Amiot, Marie-Josephe; Barra, Yves; Seree, Eric


    Background We previously showed that blood serum induced cytochrome P450 1A1 (CYP1A1) monooxygenase expression in vitro. Objective Our purpose was (i) to identify the molecular mechanism involved and (ii) to characterize the inducer compound(s) in serum involved at least in part. Methods Serum was fractionated on hydrophobic columns. PPARα involvement was demonstrated by gene reporter assays, DNA mutagenesis and EMSA. Gene expression was evaluated by qRT-PCR. Serum samples were analyzed using HS-SPME-GC-MS. Results The inductive effect of serum did not depend on the AhR pathway and was enhanced by cotransfection of PPARα cDNA. Mutations in the PPAR response elements of the CYP1A1 gene promoter suppressed this effect. One of the PPRE sites appeared highly specific for human PPARα, an unreported PPRE property. A link was found between CYP1A1 inducibility and serum hydrophobic compounds. Characterization of sera showed that hexanal, a metabolite produced by peroxidation of linoleic acid, was involved in CYP1A1 induction by serum, possibly along with other serum entities. Conclusion We demonstrate that serum induces CYP1A1 via the PPARα pathway and that hexanal is one of the serum inducers. The two PPRE sites within the CYP1A1 promoter are functional and one of them is specific for PPARα. PMID:21304969

  1. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico


    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  2. Zika Virus Protease: An Antiviral Drug Target.


    Kang, CongBao; Keller, Thomas H; Luo, Dahai


    The recent outbreak of Zika virus (ZIKV) infection has caused global concern due to its link to severe damage to the brain development of foetuses and neuronal complications in adult patients. A worldwide research effort has been undertaken to identify effective and safe treatment and vaccination options. Among the proposed viral and host components, the viral NS2B-NS3 protease represents an attractive drug target due to its essential role in the virus life cycle. Here, we outline recent progress in studies on the Zika protease. Biochemical, biophysical, and structural studies on different protease constructs provide new insight into the structure and activity of the protease. The unlinked construct displays higher enzymatic activity and better mimics the native state of the enzyme and therefore is better suited for drug discovery. Furthermore, the structure of the free enzyme adopts a closed conformation and a preformed active site. The availability of a lead fragment hit and peptide inhibitors, as well as the attainability of soakable crystals, suggest that the unlinked construct is a promising tool for drug discovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub


    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  4. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh


    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  5. trans-Protease Activity and Structural Insights into the Active Form of the Alphavirus Capsid Protease

    PubMed Central

    Aggarwal, Megha; Dhindwal, Sonali; Kumar, Pravindra; Kuhn, Richard J.


    ABSTRACT The alphavirus capsid protein (CP) is a serine protease that possesses cis-proteolytic activity essential for its release from the nascent structural polyprotein. The released CP further participates in viral genome encapsidation and nucleocapsid core formation, followed by its attachment to glycoproteins and virus budding. Thus, protease activity of the alphavirus capsid is a potential antialphaviral target to arrest capsid release, maturation, and structural polyprotein processing. However, the discovery of capsid protease inhibitors has been hampered due to the lack of a suitable screening assay and of the crystal structure in its active form. Here, we report the development of a trans-proteolytic activity assay for Aura virus capsid protease (AVCP) based on fluorescence resonance energy transfer (FRET) for screening protease inhibitors. Kinetic parameters using fluorogenic peptide substrates were estimated, and the Km value was found to be 2.63 ± 0.62 μM while the kcat/Km value was 4.97 × 104 M−1 min−1. Also, the crystal structure of the trans-active form of AVCP has been determined to 1.81-Å resolution. Structural comparisons of the active form with the crystal structures of available substrate-bound mutant and inactive blocked forms of the capsid protease identify conformational changes in the active site, the oxyanion hole, and the substrate specificity pocket residues, which could be critical for rational drug design. IMPORTANCE The alphavirus capsid protease is an attractive antiviral therapeutic target. In this study, we have described the formerly unappreciated trans-proteolytic activity of the enzyme and for the first time have developed a FRET-based protease assay for screening capsid protease inhibitors. Our structural studies unveil the structural features of the trans-active protease, which has been previously proposed to exist in the natively unfolded form (M. Morillas, H. Eberl, F. H. Allain, R. Glockshuber, and E. Kuennemann, J

  6. Draft Genome Sequence of Cylindrospermopsis raciborskii (Cyanobacteria) Strain ITEP-A1 Isolated from a Brazilian Semiarid Freshwater Body: Evidence of Saxitoxin and Cylindrospermopsin Synthetase Genes

    PubMed Central

    Lorenzi, Adriana Sturion; Silva, Genivaldo Gueiros Z.; Lopes, Fabyano Alvares Cardoso; Chia, Mathias Ahii; Edwards, Robert A.


    Cylindrospermopsis raciborskii ITEP-A1 is a saxitoxin-producing cyanobacterium. We report the draft genome sequence of ITEP-A1, which comprised 195 contigs that were assembled with SPAdes and annotated with Rapid Annotation using Subsystem Technology. The identified genome sequence had 3,605,836 bp, 40.1% G+C, and predicted 3,553 coding sequences (including the synthetase genes). PMID:27151783

  7. Spatial working memory deficits in GluA1 AMPA receptor subunit knockout mice reflect impaired short-term habituation: Evidence for Wagner's dual-process memory model

    PubMed Central

    Sanderson, David J.; McHugh, Stephen B.; Good, Mark A.; Sprengel, Rolf; Seeburg, Peter H.; Rawlins, J. Nicholas P.; Bannerman, David M.


    Genetically modified mice, lacking the GluA1 AMPA receptor subunit, are impaired on spatial working memory tasks, but display normal acquisition of spatial reference memory tasks. One explanation for this dissociation is that working memory, win-shift performance engages a GluA1-dependent, non-associative, short-term memory process through which animals choose relatively novel arms in preference to relatively familiar options. In contrast, spatial reference memory, as exemplified by the Morris water maze task, reflects a GluA1-independent, associative, long-term memory mechanism. These results can be accommodated by Wagner's dual-process model of memory in which short and long-term memory mechanisms exist in parallel and, under certain circumstances, compete with each other. According to our analysis, GluA1−/− mice lack short-term memory for recently experienced spatial stimuli. One consequence of this impairment is that these stimuli should remain surprising and thus be better able to form long-term associative representations. Consistent with this hypothesis, we have recently shown that long-term spatial memory for recently visited locations is enhanced in GluA1−/− mice, despite impairments in hippocampal synaptic plasticity. Taken together, these results support a role for GluA1-containing AMPA receptors in short-term habituation, and in modulating the intensity or perceived salience of stimuli. PMID:20350557

  8. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry


    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  9. A novel protease activity assay using a protease-responsive chaperone protein

    SciTech Connect

    Sao, Kentaro; Murata, Masaharu; Fujisaki, Yuri; Umezaki, Kaori; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki; Hashizume, Makoto


    Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

  10. Structure of alpha 2-macroglobulin-protease complexes. Methylamine competition shows that proteases bridge two disulfide-bonded half-molecules.


    Chen, B J; Wang, D; Yuan, A I; Feinman, R D


    alpha 2-Macroglobulin (alpha 2M) forms several different covalent complexes with proteases. These include unusual forms in which more than one of the four identical subunits of alpha 2M are cross-linked by amide bonds to more than one lysyl amino group of the bound protease. The structure of these complexes and the question of how the identical subunits are arranged to form two protease binding sites are matters of current controversy. The 185-kDa subunits are arranged into two disulfide-bonded half-molecules which are, in turn, noncovalently associated. We have provided evidence that, in the major multivalent cross-linked form, proteases can span the two half-molecules, forming a covalently bonded tetramer [Wang, D., Yuan, A. I., & Feinman, R. D. (1984) Biochemistry 23, 2807-2811]. An alternative theory has recently been proposed in which the major high molecular weight form has two bonds to protease that are within half-molecules--a multivalent cross-linked dimer [Sottrup-Jensen, L., Hansen, H. F., Pedersen, H. S., & Kristensen, L. (1990) J. Biol. Chem. 265, 17727-17737]. To resolve this conflict, experiments were carried out to determine the structure of one of the high molecular weight bands (band 3) seen on SDS-PAGE. Band 3 has anomalous migration, corresponding to markers of apparent molecular mass of 550 kDa (between the tetramer and dimer). In the experiments described here, reactions of thrombin with alpha 2M were run in the presence of methylamine, which competes for one of the two thrombin-alpha 2M covalent bonds.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. An aspartic protease of the scabies mite Sarcoptes scabiei is involved in the digestion of host skin and blood macromolecules.


    Mahmood, Wajahat; Viberg, Linda T; Fischer, Katja; Walton, Shelley F; Holt, Deborah C


    Scabies is a disease of worldwide significance, causing considerable morbidity in both humans and other animals. The scabies mite Sarcoptes scabiei burrows into the skin of its host, obtaining nutrition from host skin and blood. Aspartic proteases mediate a range of diverse and essential physiological functions such as tissue invasion and migration, digestion, moulting and reproduction in a number of parasitic organisms. We investigated whether aspartic proteases may play role in scabies mite digestive processes. We demonstrated the presence of aspartic protease activity in whole scabies mite extract. We then identified a scabies mite aspartic protease gene sequence and produced recombinant active enzyme. The recombinant scabies mite aspartic protease was capable of digesting human haemoglobin, serum albumin, fibrinogen and fibronectin, but not collagen III or laminin. This is consistent with the location of the scabies mites in the upper epidermis of human skin. The development of novel therapeutics for scabies is of increasing importance given the evidence of emerging resistance to current treatments. We have shown that a scabies mite aspartic protease plays a role in the digestion of host skin and serum molecules, raising the possibility that interference with the function of the enzyme may impact on mite survival.

  12. An Aspartic Protease of the Scabies Mite Sarcoptes scabiei Is Involved in the Digestion of Host Skin and Blood Macromolecules

    PubMed Central

    Mahmood, Wajahat; Viberg, Linda T.; Fischer, Katja; Walton, Shelley F.; Holt, Deborah C.


    Background Scabies is a disease of worldwide significance, causing considerable morbidity in both humans and other animals. The scabies mite Sarcoptes scabiei burrows into the skin of its host, obtaining nutrition from host skin and blood. Aspartic proteases mediate a range of diverse and essential physiological functions such as tissue invasion and migration, digestion, moulting and reproduction in a number of parasitic organisms. We investigated whether aspartic proteases may play role in scabies mite digestive processes. Methodology/Principle Findings We demonstrated the presence of aspartic protease activity in whole scabies mite extract. We then identified a scabies mite aspartic protease gene sequence and produced recombinant active enzyme. The recombinant scabies mite aspartic protease was capable of digesting human haemoglobin, serum albumin, fibrinogen and fibronectin, but not collagen III or laminin. This is consistent with the location of the scabies mites in the upper epidermis of human skin. Conclusions/Significance The development of novel therapeutics for scabies is of increasing importance given the evidence of emerging resistance to current treatments. We have shown that a scabies mite aspartic protease plays a role in the digestion of host skin and serum molecules, raising the possibility that interference with the function of the enzyme may impact on mite survival. PMID:24244770

  13. Protease Inhibitors Block Multiple Functions of the NS3/4A Protease-Helicase during the Hepatitis C Virus Life Cycle.


    McGivern, David R; Masaki, Takahiro; Lovell, William; Hamlett, Chris; Saalau-Bethell, Susanne; Graham, Brent


    Hepatitis C virus (HCV) NS3 is a multifunctional protein composed of a protease domain and a helicase domain linked by a flexible linker. Protease activity is required to generate viral nonstructural (NS) proteins involved in RNA replication. Helicase activity is required for RNA replication, and genetic evidence implicates the helicase domain in virus assembly. Binding of protease inhibitors (PIs) to the protease active site blocks NS3-dependent polyprotein processing but might impact other steps of the virus life cycle. Kinetic analyses of antiviral suppression of cell culture-infectious genotype 1a strain H77S.3 were performed using assays that measure different readouts of the viral life cycle. In addition to the active-site PI telaprevir, we examined an allosteric protease-helicase inhibitor (APHI) that binds a site in the interdomain interface. By measuring nucleotide incorporation into HCV genomes, we found that telaprevir inhibits RNA synthesis as early as 12 h at high but clinically relevant concentrations. Immunoblot analyses showed that NS5B abundance was not reduced until after 12 h, suggesting that telaprevir exerts a direct effect on RNA synthesis. In contrast, the APHI could partially inhibit RNA synthesis, suggesting that the allosteric site is not always available during RNA synthesis. The APHI and active-site PI were both able to block virus assembly soon (<12 h) after drug treatment, suggesting that they rapidly engage with and block a pool of NS3 involved in assembly. In conclusion, PIs and APHIs can block NS3 functions in RNA synthesis and virus assembly, in addition to inhibiting polyprotein processing. The NS3/4A protease of hepatitis C virus (HCV) is an important antiviral target. Currently, three PIs have been approved for therapy of chronic hepatitis C, and several others are in development. NS3-dependent cleavage of the HCV polyprotein is required to generate the mature nonstructural proteins that form the viral replicase. Inhibition of

  14. The role of habituation in hippocampus-dependent spatial working memory tasks: evidence from GluA1 AMPA receptor subunit knockout mice.


    Sanderson, David J; Bannerman, David M


    Spatial alternation, win-shift behavior has been claimed to be a test of working memory in rodents that requires active maintenance of relevant, trial-specific information. In this review, we describe work with GluA1 AMPA receptor subunit knockout mice that show impaired spatial alternation, but normal spatial reference memory. Due to their selective impairment on spatial alternation, GluA1 knockout mice provide a means by which the psychological processes underlying alternation can be examined. We now argue that the spatial alternation deficit in GluA1 knockout mice is due to an inability to show stimulus-specific, short-term habituation to recently experienced stimuli. Short-term habituation involves a temporary reduction in attention paid to recently presented stimuli, and is thus a distinct process from those that are involved in working memory in humans. We have recently demonstrated that GluA1 knockout mice show impaired short-term habituation, but, surprisingly, show enhanced long-term spatial habituation. Thus, GluA1 deletion reveals that there is competition between short-term and long-term processes in memory.

  15. Antagonist Selective Modulation of Adenosine A1 and A3 Receptor Pharmacology by the Food Dye Brilliant Black BN: Evidence for Allosteric Interactions

    PubMed Central

    May, L. T.; Briddon, S. J.


    Allosteric binding sites on the adenosine receptor family represent potential therapeutic targets for a number of conditions involving metabolic stress. This study has identified Brilliant Black BN as a novel allosteric modulator of the adenosine A1 and A3 receptors. In addition to being a food dye and pharmaceutical excipient, Brilliant Black BN is commonly used within calcium mobilization assays to quench extracellular fluorescence. Brilliant Black BN (5–500 μM) had no significant effect on the calcium mobilization stimulated by the nonselective adenosine receptor agonist 5′-(N-ethylcarboxamido)adenosine in Chinese hamster ovary cells stably transfected with the human adenosine A1 or A3 receptor. Likewise, calcium mobilization and radioligand binding assays found that Brilliant Black BN (5–500 μM) did not significantly influence the antagonism mediated by 8-cyclopentyl-1,3-dipropylxanthine (100 nM) at the A1 receptor. In contrast, the affinity of N-[9-chloro-2-(2-furanyl)[1,2,4]-triazolo[1,5-c]quinazolin-5-yl]benzene acetamide (MRS1220) at the A3 receptor and xanthine amine congener (XAC) and XAC-X-BY630 at the A1 and A3 receptors was significantly decreased in the presence of 500 μM Brilliant Black BN. A reduction in XAC potency at the A1 and A3 receptor was achieved within 1 min of Brilliant Black BN addition, despite receptors having been pre-equilibrated with antagonist. Dissociation kinetics of the fluorescent XAC derivative, XAC-X-BY630, revealed that the decrease in affinity is probably due to a significant increase in dissociation rate of the antagonist in the presence of Brilliant Black BN. Taken together, these results suggest that Brilliant Black BN can act allosterically to modify ligand affinity at A1 and A3 receptors. PMID:20086038

  16. Protease activity, localization and inhibition in the human hair follicle

    PubMed Central

    Bhogal, R K; Mouser, P E; Higgins, C A; Turner, G A


    Synopsis Objective In humans, the process of hair shedding, referred to as exogen, is believed to occur independently of the other hair cycle phases. Although the actual mechanisms involved in hair shedding are not fully known, it has been hypothesized that the processes leading to the final step of hair shedding may be driven by proteases and/or protease inhibitor activity. In this study, we investigated the presence of proteases and protease activity in naturally shed human hairs and assessed enzyme inhibition activity of test materials. Methods We measured enzyme activity using a fluorescence-based assay and protein localization by indirect immunohistochemistry (IHC). We also developed an ex vivo skin model for measuring the force required to pull hair fibres from skin. Results Our data demonstrate the presence of protease activity in the tissue material surrounding club roots. We also demonstrated the localization of specific serine protease protein expression in human hair follicle by IHC. These data provide evidence demonstrating the presence of proteases around the hair club roots, which may play a role during exogen. We further tested the hypothesis that a novel protease inhibitor system (combination of Trichogen® and climbazole) could inhibit protease activity in hair fibre club root extracts collected from a range of ethnic groups (UK, Brazil, China, first-generation Mexicans in the USA, Thailand and Turkey) in both males and females. Furthermore, we demonstrated that this combination is capable of increasing the force required to remove hair in an ex vivo skin model system. Conclusion These studies indicate the presence of proteolytic activity in the tissue surrounding the human hair club root and show that it is possible to inhibit this activity with a combination of Trichogen® and climbazole. This technology may have potential to reduce excessive hair shedding. Résumé Objectif Chez l'homme, le processus de perte de cheveux, désigné comme exog

  17. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.


    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  18. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central


    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  19. A multifunctional protease inhibitor to regulate endolysosomal function.


    van Kasteren, Sander I; Berlin, Ilana; Colbert, Jeff D; Keane, Doreen; Ovaa, Huib; Watts, Colin


    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin-pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses.

  20. Irreversible aggregation of the Fc fragment derived from polymeric but not monomeric serum IgA1--implications in IgA-mediated disease.


    Almogren, Adel; Kerr, Michael A


    IgA is by far the most abundant immunoglobulin in humans. It is found in serum and in secretions (SIgA). Unlike any other class of immunoglobulin, each form of IgA occurs naturally in different polymerisation states. In serum, the predominant form of IgA is IgA1 of which around 90% is monomeric and 10% is dimeric or polymeric. The proportion of dimeric/polymeric IgA increases in a number of important diseases, such as IgA nephropathy and in chronic liver disease. In both, there is evidence that further aggregation of dimeric/polymeric IgA is the cause of the characteristic tissue deposition. To investigate the effect of role of IgA polymerisation on the structure and function of IgA, we purified different molecular forms of IgA1 from myeloma serum (monomer, dimer and trimer) and SIgA1 from colostrum. Structural features of these different IgA1 forms were examined following proteolysis using Neisseria gonorrhoeae IgA1 type 2 protease and Streptococcus pneumoniae IgA1 protease. These IgA1 proteases cleave IgA1 at the hinge region and produce Fcalpha and Fab fragments. Western blot analysis demonstrated that the Fcalpha fragments of serum dimeric and trimeric but not monomeric IgA1 aggregated to form multimers resistant to disruption in SDS-PAGE under non-reducing conditions. Size exclusion chromatography under native conditions of cleaved serum dimeric IgA1 demonstrated that aggregation occurs because of structural changes in the IgA per se and was not an effect of the SDS-PAGE system. In the same assay, SIgA1 (dimeric) did not aggregate after digestion. The results suggest an important, previously unrecognised, property of dimeric/polymeric serum IgA1, which might explain its propensity to aggregate and deposit in tissues.

  1. Ancient DNA evidence reveals that the Y chromosome haplogroup Q1a1 admixed into the Han Chinese 3,000 years ago.


    Zhao, Yong-Bin; Zhang, Ye; Li, Hong-Jie; Cui, Ying-Qiu; Zhu, Hong; Zhou, Hui


    Y chromosome haplogroup Q1a1 is found almost only in Han Chinese populations. However, it has not been found in ancient Han Chinese samples until now. Thus, the origin of haplogroup Q1a1 in Han Chinese is still obscure. This study attempts to provide answer to this question, and to uncover the origin and paternal genetic structure of the ancestors of the Han Chinese. Eighty-nine ancient human remains that were excavated from the presumed geographic source of the Han Chinese and dated to approximately 3,000 years ago were treated by the amelogenin gene polymerase chain reaction test, to determine their sex. Then, Y chromosome single nucleotide polymorphisms were subsequently analyzed from the samples detected as male. Samples from 27 individuals were successfully amplified. Their haplotypes could be attributed to haplogroups N, O*, O2a, O3a, and Q1a1. Analyses showed that the assigned haplogroup of each sample is correlated to the suspected social status and observed burial custom associated with the sample. The origins of the observed haplotypes and their distribution in present day Han Chinese and in the samples suggest that haplogroup Q1a1 was probably introduced into the Han Chinese population approximately 3,000 years ago. © 2014 Wiley Periodicals, Inc.

  2. Factors associated with virological rebound in HIV-infected patients receiving protease inhibitor monotherapy.


    Stöhr, Wolfgang; Dunn, David T; Arenas-Pinto, Alejandro; Orkin, Chloe; Clarke, Amanda; Williams, Ian; Johnson, Margaret; Beeching, Nicholas J; Wilkins, Edmund; Sanders, Karen; Paton, Nicholas I


    The Protease Inhibitor Monotherapy Versus Ongoing Triple Therapy (PIVOT) trial found that protease inhibitor monotherapy as a simplification strategy is well tolerated in terms of drug resistance but less effective than combination therapy in suppressing HIV viral load. We sought to identify factors associated with the risk of viral load rebound in this trial. PIVOT was a randomized controlled trial in HIV-positive adults with suppressed viral load for at least 24 weeks on combination therapy comparing a strategy of physician-selected ritonavir-boosted protease inhibitor monotherapy versus ongoing triple therapy. In participants receiving monotherapy, we analysed time to confirmed viral load rebound and its predictors using flexible parametric survival models. Of 290 participants initiating protease inhibitor monotherapy (80% darunavir, 14% lopinavir, and 6% other), 93 developed viral load rebound on monotherapy. The risk of viral load rebound peaked at 9 months after starting monotherapy and then declined to approximately 5 per 100 person-years from 18 months onwards. Independent predictors of viral load rebound were duration of viral load suppression before starting monotherapy (hazard ratio 0.81 per additional year <50 copies/ml; P < 0.001), CD4 cell count (hazard ratio 0.73 per additional 100 cells/μl for CD4 nadir; P = 0.008); ethnicity (hazard ratio 1.87 for nonwhite versus white, P = 0.025) but not the protease inhibitor agent used (P = 0.27). Patients whose viral load was analysed with the Roche TaqMan-2 assay had a 1.87-fold risk for viral load rebound compared with Abbott RealTime assay (P = 0.012). A number of factors can identify patients at low risk of rebound with protease inhibitor monotherapy, and this may help to better target those who may benefit from this management strategy.

  3. Management of protease inhibitor-associated hyperlipidemia.


    Penzak, Scott R; Chuck, Susan K


    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  4. cDNA cloning and chromosomal mapping of the mouse type VII collagen gene (Col7a1): Evidence for rapid evolutionary divergence of the gene

    SciTech Connect

    Li, Kehua; Christiano, A.M.; Chu, Mon Li; Uitto, J. Thomas Jefferson Univ., Philadelphia, PA ); Copeland, N.G.; Gilbert, D.J. )


    Type VII collagen is the major component of anchoring fibrils, critical attachment structures at the dermal-epidermal basement membrane zone. Genetic linkage analyses with recently cloned human type VII collagen cDNAs have indicated that the corresponding gene, COL7A1, is the candidate gene in the dystrophic forms of epidermolysis bullosa. To gain insight into the evolutionary conservation of COL7A1, in this study the authors have isolated mouse type VII collagen cDNAs by screening a mouse epidermal keratinocyte cDNA library with a human COL7A1 cDNA. Two overlapping mouse cDNAs were isolated, and Northern hybridization of mouse epidermal keratinocyte RNA with one of them revealed the presence of a mRNA transcript of [approximately]9.5 kb, the approximate size of the human COL7A1 mRNA. Nucleotide sequencing of the mouse cDNAs revealed a 2760-bp open reading frame that encodes the 5[prime] half of the collagenous domain and a segment of the NC-1, the noncollagenous amino-terminal domain of type VII collagen. Comparison of the mouse amino acid sequences with the corresponding human sequences deduced from cDNAs revealed 82.5% identity. The evolutionary divergence of the gene was relatively rapid in comparison to other collagen genes. Despite the high degree of sequence variation, several sequences, including the size and the position of noncollagenous imperfections and interruptions within the Gly-X-Y repeat sequence, were precisely conserved. Finally, the mouse Col7a1 gene was located by interspecific backcross mapping to mouse Chromosome 9, a region that corresponds to human chromosome 3p21, the position of human COL7Al. This assignment confirms and extends the relationship between the mouse and the human chromosomes in this region of the genome. 33 refs., 5 figs., 1 tab.

  5. Earliest Evidence of Toxocara sp. in a 1.2-Million-Yr-Old Extinct Hyena (Pachycrocuta brevirostris) Coprolite from Northwest Pakistan.


    Perri, Angela R; Heinrich, Susann; Gur-Arieh, Shira; Saunders, Jeffrey J


    The study of fossil parasites can provide insight into the antiquity of host-parasite relationships and the origins and evolution of these paleoparasites. Here, a coprolite (fossilized feces) from the 1.2-million-yr-old paleontological site of Haro River Quarry in northwestern Pakistan was analyzed for paleoparasites. Micromorphological thin sectioning and Fourier-transform infrared spectrometry (FTIR) analysis confirms the coprolite belonged to a bone-eating carnivore, likely the extinct giant short-faced hyena (Pachycrocuta brevirostris). Parasitological analysis shows the coprolite to be positive for Toxocara sp. To our knowledge, this is the earliest evidence for Toxocara sp. found.

  6. Detection of protease-resistant cervid prion protein in water from a CWD-endemic area

    PubMed Central

    Nichols, TA; Pulford, Bruce; Wyckoff, A Christy; Meyerett, Crystal; Michel, Brady; Gertig, Kevin; Hoover, Edward A; Jewell, Jean E; Telling, Glenn C


    Chronic wasting disease (CWD) is the only known transmissible spongiform encephalopathy affecting free-ranging wildlife. Although the exact mode of natural transmission remains unknown, substantial evidence suggests that prions can persist in the environment, implicating components thereof as potential prion reservoirs and transmission vehicles.1–4 CWD-positive animals may contribute to environmental prion load via decomposing carcasses and biological materials including saliva, blood, urine and feces.5–7 Sensitivity limitations of conventional assays hamper evaluation of environmental prion loads in soil and water. Here we show the ability of serial protein misfolding cyclic amplification (sPMCA) to amplify a 1.3 × 10−7 dilution of CWD-infected brain homogenate spiked into water samples, equivalent to approximately 5 × 107 protease resistant cervid prion protein (PrPCWD) monomers. We also detected PrPCWD in one of two environmental water samples from a CWD endemic area collected at a time of increased water runoff from melting winter snow pack, as well as in water samples obtained concurrently from the flocculation stage of water processing by the municipal water treatment facility. Bioassays indicated that the PrPCWD detected was below infectious levels. These data demonstrate detection of very low levels of PrPCWD in the environment by sPMCA and suggest persistence and accumulation of prions in the environment that may promote CWD transmission. PMID:19823039

  7. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel


    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  8. CYP1A1 MspI polymorphism and the risk of oral squamous cell carcinoma: Evidence from a meta-analysis

    PubMed Central



    Numerous case-control studies have investigated whether the CYP1A1 gene polymorphism is involved in the occurrence of oral squamous cell carcinoma (OSCC); however, the conclusions are inconsistent. In order to further explore the correlation and obtain a strong conclusion, a meta-analysis was performed to systematically assess the association between the CYP1A1 MspI polymorphism and risk of OSCC. In the present meta-analysis, the odds ratios (ORs) and the corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical analyses were performed with STATA 11.0 software. The heterogeneity was assessed by Q test and I2test. The final analysis included 10 studies of 1,505 cases and 1,967 controls. The overall results suggested that the CYP1A1 MspI polymorphism was significantly associated with an increased risk of OSCC (CC+TC vs. TT: OR, 1.31; 95% CI, 1.01–1.70; P=0.043; CC vs. TC+TT: OR, 2.38; 95% CI, 1.58–3.58; P<0.001; CC vs. TT: OR, 2.52; 95% CI, 1.60–3.96; P<0.001; and C vs. T: OR, 1.45; 95% CI, 1.15–1.83; P<0.001). In a stratified analysis by ethnicity, a statistically significant correlation existed in the Asian population, but not mixed-race and Caucasian populations. In conclusion, despite several limitations, the present meta-analysis established that the CYP1A1 MspI polymorphism may be a risk factor for OSCC, particularly among the Asian population. PMID:27073686

  9. Caffeine prevents antihyperalgesic effect of gabapentin in an animal model of CRPS-I: evidence for the involvement of spinal adenosine A1 receptor.


    Martins, Daniel F; Prado, Marcos R B; Daruge-Neto, Eduardo; Batisti, Ana P; Emer, Aline A; Mazzardo-Martins, Leidiane; Santos, Adair R S; Piovezan, Anna P


    This study was designed to determine whether 3 weeks of gabapentin treatment is effective in alleviating neuropathic pain-like behavior in animal models of complex regional pain syndrome type-I and partial sciatic nerve ligation (PSNL). We investigated the contribution of adenosine subtypes to the antihyperalgesic effect of gabapentin by examining the effect of caffeine, a non-selective adenosine A1 and A2 receptor antagonist or 1,3-dipropyl-8-cyclopentylxanthine (DPCPX), a selective adenosine A1 subtype receptor antagonist on this effect. Neuropathic pain was produced by unilateral prolonged hind paw ischemia and reperfusion (I/R) or PSNL procedures which resulted in stimulus-evoked mechanical hyperalgesia. After procedures, animals received gabapentin (10, 30, or 100 mg/kg intraperitoneal, respectively), caffeine (10 mg/kg intraperitoneal or 150 nmol intrathecally) or DPCPX (3 µg intrathecally) alone or in combination. Mice were tested for tactile mechanical hyperalgesia at 1, 2, and 3 weeks following procedures. Gabapentin produced dose-related inhibition of mechanical hyperalgesia over a 3-week period, and this effect was blocked by concomitant caffeine or DPCPX administration 1 week after injuries. The results of this study demonstrated that the mechanism through which gabapentin produces its effect may involve the activation of adenosine A1 subtype receptor. © 2015 Peripheral Nerve Society.

  10. Coulometric and spectroscopic analysis of the purified cytochrome d complex of Escherichia coli: evidence for the identification of "cytochrome a1" as cytochrome b595.


    Lorence, R M; Koland, J G; Gennis, R B


    Coulometric and spectroscopic analyses were performed on the three cytochrome components (cytochrome d, cytochrome b558, and the cytochrome previously described as cytochrome a1) of the purified cytochrome d complex, a terminal oxidase of the Escherichia coli aerobic respiratory chain. On the basis of heme extraction, spectroscopic, and coulometric data, the "cytochrome a1" component was identified as a b-type cytochrome: cytochrome b595. The pyridine hemochromogen technique revealed the presence of two molecules of protoheme IX per cytochrome d complex. This quantity of protoheme IX fully accounted for the sum of the cytochrome b558 and cytochrome b595 components as determined coulometrically. The renaming of cytochrome a1 as cytochrome b595 was further indicated by the lack of any heme a in the complex and by its resolved reduced-minus-oxidized spectrum. The latter was found to be similar to that of cytochrome c peroxidase, which contains protoheme IX. Coulometric titrations and carbon monoxide binding titrations revealed that there are two molecules of cytochrome d per complex. A convenient measurement of the amount of cytochrome b558 was found to be the beta-band at 531 nm since cytochrome b558 was observed to be the only component of the cytochrome d complex with a peak at this wavelength. By use of this method and the extinction coefficient for the purified cytochrome b558, it was estimated that there is one molecule of cytochrome b595 and one of cytochrome b558 per cytochrome complex.

  11. Orally administered proteases in aesthetic surgery.


    Dusková, M; Wald, M


    Increasing demand for shortening the sequel period after aesthetic surgery has led to comparative testing of optional approaches. Systemic enzyme therapy with its pharmacological effects represents a preventive and curative option for inflammatory process including healing. Excellent results were presented, namely, in the treatment of secondary lymphoedema. The incidence of hematoma, edema, and pain was followed, and the results were compared in a randomized group of 20 patients with upper eyelid blepharoplasty treated with proteases (Wobenzym drg) and in a similar group treated with systemic antiedema and hemostyptic therapy (Dicynone drg and Reparil drg). No undesirable side effects were observed. In addition, proteases apparently have no limitation for patients with the risk of concurrent cardiovascular, hepatic, or renal diseases.

  12. Enteropeptidase, a type II transmembrane serine protease.


    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan


    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  13. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki


    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  14. Tyrosine Phosphorylation of Botulinum Neurotoxin Protease Domains

    DTIC Science & Technology


    terminus in the enzyme’s substrate or product binding. Keywords: botulinum neurotoxin, tyrosine phosphorylation, zinc endoporotease, protease, clostridium ...associated membrane protein. These 150 kDa exotoxins are produced by strains of Clostridium botulinum as sevendistinct serotypes,designatedBoNT/A-G.After...A) anti-phosphotyrosine antibody Western blot (B). (A) Relative abundance of the m/z species representing phosphorylated LcB was plotted as a% of

  15. Development of a rapid phenotypic test for HCV protease inhibitors with potential use in clinical decisions

    PubMed Central

    Pessoa, Luciana Santos; Vidal, Luãnna Liebscher; da Costa, Emmerson C.B.; Abreu, Celina Monteiro; da Cunha, Rodrigo Delvecchio; Valadão, Ana Luiza Chaves; dos Santos, André Felipe; Tanuri, Amilcar


    Abstract Approximately 185 million people worldwide are chronically infected with hepatitis C virus (HCV). The first-wave of approved NS3 protease inhibitors (PIs) were Telaprevir and Boceprevir, which are currently discontinued. Simeprevir is a second-wave PI incorporated into the Brazilian hepatitis C treatment protocol. Drug resistance plays a key role in patients' treatment regimen. Here, we developed a simple phenotypic assay to evaluate the impact of resistance mutations in HCV NS3 protease to PIs, using a protein expression vector containing wild type NS3 protease domain and NS4A co-factor. We analyzed the impact of five resistance mutations (T54A, V36M, V158I, V170I and T54S+V170I) against Telaprevir, Boceprevir and Simeprevir. Protein purifications were performed with low cost methodology, and enzymatic inhibition assays were measured by FRET. We obtained recombinant proteases with detectable activity, and IC50 and fold change values for the evaluated PIs were determined. The variant T54A showed the highest reduction of susceptibility for the PIs, while the other four variants exhibited lower levels of reduced susceptibility. Interestingly, V170I showed 3.2-fold change for Simeprevir, a new evidence about this variant. These results emphasize the importance of enzymatic assays in phenotypic tests to determine which therapeutic regimen should be implemented. PMID:27575432

  16. Suppression of Helicobacter pylori protease activity towards growth factors by sulglycotide.


    Piotrowski, J; Slomiany, A; Slomiany, B L


    Infection with H. pylori is now recognized as a major factor in the pathogenesis of gastric disease. Here, we examined the susceptibility of epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), transforming growth factor-beta (TGF beta) and platelet derived growth factor (PDGF) to degradation by H. pylori protease, and assessed the effect of a cytoprotective agent, sulglycotide, on this process. The 125I-labeled EGF, bFGF, TGF beta and PDGF were incubatet with H. pylori protease, obtained from the filtrates of saline washes of the bacterium culture, in the presence of 0-100 micrograms sulglycotide. The results showed that, under the assay conditions, H. pylori protease caused only 5% degradation of EGF and 7% degradation of bFGF. However, the protease evoked a 61.7% degradation of PDGF and a 62.3% degradation of TGF beta. Introduction of sulglycotide to the reaction assay system caused a dose-dependent inhibition in PDGF and TGF beta proteolysis by the H. pylori enzyme. The maximal inhibitory effect was obtained with sulglycotide at 100 micrograms/ml, at which dose an 84.4% decrease in PDGF and 88.3% decrease in TGF beta degradation was achieved. The results provide a strong evidence for the effectiveness of sulglycotide in the protection of gastric mucosal growth factors against degradation by H. pylori.

  17. Drosophila insulin degrading enzyme and rat skeletal muscle insulin protease cleave insulin at similar sites

    SciTech Connect

    Duckworth, W.C.; Garcia, J.V.; Liepnieks, J.J.; Hamel, F.G.; Hermodson, M.A.; Frank, B.H.; Rosner, M.R. )


    Insulin degradation is an integral part of the cellular action of insulin. Recent evidence suggests that the enzyme insulin protease is involved in the degradation of insulin in mammalian tissues. Drosophila, which has insulin-like hormones and insulin receptor homologues, also expresses an insulin degrading enzyme with properties that are very similar to those of mammalian insulin protease. In the present study, the insulin cleavage products generated by the Drosophila insulin degrading enzyme were identified and compared with the products generated by the mammalian insulin protease. Both purified enzymes were incubated with porcine insulin specifically labeled with {sup 125}I on either the A19 or B26 position, and the degradation products were analyzed by HPLC before and after sulfitolysis. Isolation and sequencing of the cleavage products indicated that both enzymes cleave the A chain of intact insulin at identical sites between residues A13 and A14 and A14 and A15. These results demonstrate that all the insulin cleavage sites generated by the Drosopohila insulin degrading enzyme are shared in common with the mammalian insulin protease. These data support the hypothesis that there is evolutionary conservation of the insulin degrading enzyme and further suggest that this enzyme plays an important role in cellular function.

  18. Roles of proteases during invasion and egress by Plasmodium and Toxoplasma.


    Dowse, Timothy J; Koussis, Konstantinos; Blackman, Michael J; Soldati-Favre, Dominique


    Apicomplexan pathogens replicate exclusively within the confines of a host cell. Entry into (invasion) and exit from (egress) these cells requires an array of specialized parasite molecules, many of which have long been considered to have potential as targets of drug or vaccine-based therapies. In this chapter the authors discuss the current state of knowledge regarding the role of parasite proteolytic enzymes in these critical steps in the life cycle of two clinically important apicomplexan genera, Plasmodium and Toxoplasma. At least three distinct proteases of the cysteine mechanistic class have been implicated in egress of the malaria parasite from cells of its vertebrate and insect host. In contrast, the bulk of the evidence indicates a prime role for serine proteases of the subtilisin and rhomboid families in invasion by both parasites. Whereas proteases involved in egress may function predominantly to degrade host cell structures, proteases involved in invasion probably act primarily as maturases and 'sheddases', required to activate and ultimately remove ligands involved in interactions with the host cell.

  19. Development of a rapid phenotypic test for HCV protease inhibitors with potential use in clinical decisions.


    Pessoa, Luciana Santos; Vidal, Luãnna Liebscher; Costa, Emmerson C B da; Abreu, Celina Monteiro; Cunha, Rodrigo Delvecchio da; Valadão, Ana Luiza Chaves; Santos, André Felipe Dos; Tanuri, Amilcar


    Approximately 185 million people worldwide are chronically infected with hepatitis C virus (HCV). The first-wave of approved NS3 protease inhibitors (PIs) were Telaprevir and Boceprevir, which are currently discontinued. Simeprevir is a second-wave PI incorporated into the Brazilian hepatitis C treatment protocol. Drug resistance plays a key role in patients' treatment regimen. Here, we developed a simple phenotypic assay to evaluate the impact of resistance mutations in HCV NS3 protease to PIs, using a protein expression vector containing wild type NS3 protease domain and NS4A co-factor. We analyzed the impact of five resistance mutations (T54A, V36M, V158I, V170I and T54S+V170I) against Telaprevir, Boceprevir and Simeprevir. Protein purifications were performed with low cost methodology, and enzymatic inhibition assays were measured by FRET. We obtained recombinant proteases with detectable activity, and IC50 and fold change values for the evaluated PIs were determined. The variant T54A showed the highest reduction of susceptibility for the PIs, while the other four variants exhibited lower levels of reduced susceptibility. Interestingly, V170I showed 3.2-fold change for Simeprevir, a new evidence about this variant. These results emphasize the importance of enzymatic assays in phenotypic tests to determine which therapeutic regimen should be implemented.

  20. Dysregulation of Protease and Protease Inhibitors in a Mouse Model of Human Pelvic Organ Prolapse

    PubMed Central

    Budatha, Madhusudhan; Silva, Simone; Montoya, Teodoro Ignacio; Suzuki, Ayako; Shah-Simpson, Sheena; Wieslander, Cecilia Karin; Yanagisawa, Masashi; Word, Ruth Ann; Yanagisawa, Hiromi


    Mice deficient for the fibulin-5 gene (Fbln5−/−) develop pelvic organ prolapse (POP) due to compromised elastic fibers and upregulation of matrix metalloprotease (MMP)-9. Here, we used casein zymography, inhibitor profiling, affinity pull-down, and mass spectrometry to discover additional protease upregulated in the vaginal wall of Fbln5−/− mice, herein named V1 (25 kDa). V1 was a serine protease with trypsin-like activity similar to protease, serine (PRSS) 3, a major extrapancreatic trypsinogen, was optimum at pH 8.0, and predominantly detected in estrogenized vaginal epithelium of Fbln5−/− mice. PRSS3 was (a) localized in epithelial secretions, (b) detected in media of vaginal organ culture from both Fbln5−/− and wild type mice, and (c) cleaved fibulin-5 in vitro. Expression of two serine protease inhibitors [Serpina1a (α1-antitrypsin) and Elafin] was dysregulated in Fbln5−/− epithelium. Finally, we confirmed that PRSS3 was expressed in human vaginal epithelium and that SERPINA1 and Elafin were downregulated in vaginal tissues from women with POP. These data collectively suggest that the balance between proteases and their inhibitors contributes to support of the pelvic organs in humans and mice. PMID:23437119

  1. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.


    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun


    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  2. Antibacterial cysteine protease from Cissus quadrangularis L.


    Muthu, Sakthivel; Gopal, Venkatesh Babu; Karthik S, Narayan; Sivaji, Prabu; Malairaj, Sathuvan; Lakshmikanthan, Mythileeswari; Subramani, Nagaraj; Perumal, Palani


    An antibacterial Cp was extracted from the stem of Cissus quadrangularis and purified with a 5.39 fold increase in specific activity and 8.67% recovery. The molecular weight of the purified enzyme was estimated to be 39kDa by SDS-PAGE. The purified enzyme appeared as a single band on Native-PAGE. The optimum pH and temperature for protease activity were around 6.0 and 50°C respectively. The Cp showed pH stability from 3 to 10 and retained more than 90% of its relative protease activity. The addition of metal ions such as Mg(2+) and Ca(2+) also exhibited relative protease activity. Cp showed a potent antibacterial activity against pathogenic bacteria. About 4.74Uml(-1) of Cp from C. quadrangularis was tested for antibacterial activity against Bacillus cereus and Bacillus megaterium which subsequently showed zone of inhibition of 21 and 20mm respectively. Cp from C. quadrangularis degraded the peptidoglycan layer of bacteria by Cp was confirmed by transmission electron microscopic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Effect of lanthanides on Porphyromonas gingivalis proteases.


    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T


    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  4. Corruption of innate immunity by bacterial proteases.


    Potempa, Jan; Pike, Robert N


    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  5. Extracellular proteases from eight psychrotolerant Antarctic strains.


    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P


    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  6. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.


    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  7. Role of rhomboid proteases in bacteria.


    Rather, Philip


    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  8. The association of the CYP1A1 Ile462Val polymorphism with head and neck cancer risk: evidence based on a cumulative meta-analysis

    PubMed Central

    Wang, Yadong; Yang, Haiyan; Duan, Guangcai; Wang, Haiyu


    Objective The aim of this study was to address the association between the Ile462Val polymorphism in the gene encoding cytochrome P450 1A1 (CYP1A1) and the risk of head and neck cancer (HNC). Materials and methods The Medline/PubMed, EMBASE, and Web of Science databases were searched. The strength of the association was evaluated by calculating the odds ratio (OR) with a 95% confidence interval (CI). Results Overall, we observed an increased risk of HNC in patients with the Ile/Val+Val/Val genotype compared to those with the Ile/Ile genotype among the 6,367 cases and 6,395 controls evaluated in the 34 eligible studies, with a pooled OR of 1.284 (95% CI: 1.119–1.473). In addition, we observed an increased risk of HNC in patients with the Ile/Val+Val/Val genotype compared to those with the Ile/Ile genotype in the subgroup analyses (OR =1.362, 95% CI: 1.102–1.685 for laryngeal cancer; OR =1.519, 95% CI: 1.253–1.843 for pharyngeal cancer; OR =1.371, 95% CI: 1.111–1.693 for Asians; and OR =1.329, 95% CI: 1.138–1.551 for patients in studies using hospital-based controls). Conclusion This cumulative meta-analysis suggests that the CYP1A1 Ile462Val polymorphism might contribute to the risk of HNC, particularly for pharyngeal cancer and laryngeal cancer. PMID:27274286

  9. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.


    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  10. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David


    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  11. Structural determinants of tobacco vein mottling virus protease substrate specificity.


    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S


    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  12. Structural determinants of tobacco vein mottling virus protease substrate specificity

    PubMed Central

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S


    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1′ position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters kcat and Km for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease. PMID:20862670

  13. Serine protease activity in developmental stages of Eimeria tenella.


    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C


    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  14. Dipeptide-derived nitriles containing additional electrophilic sites: potentially irreversible inhibitors of cysteine proteases.


    Löser, Reik; Gütschow, Michael


    Heterocyclic and open-chain dipeptide-derived nitriles have been synthesized, containing an additional electrophilic center enabling the subsequent covalent modification of the thioimidate nitrogen formed in situ at the active site of the enzyme. The inhibitory potential of these nitriles against the cysteine proteases papain and cathepsins L, S, and K was determined. The open-chain dipeptide nitriles 8 and 10 acted as moderate reversible inhibitors, but no evidence for an irreversible inhibition of these enzymes was discernable.

  15. HIV-1 Protease in the Fission Yeast Schizosaccharomyces pombe

    PubMed Central

    Benko, Zsigmond; Elder, Robert T.; Li, Ge; Liang, Dong; Zhao, Richard Y.


    Background HIV-1 protease (PR) is an essential viral enzyme. Its primary function is to proteolyze the viral Gag-Pol polyprotein for production of viral enzymes and structural proteins and for maturation of infectious viral particles. Increasing evidence suggests that PR cleaves host cellular proteins. However, the nature of PR-host cellular protein interactions is elusive. This study aimed to develop a fission yeast (Schizosaccharomyces pombe) model system and to examine the possible interaction of HIV-1 PR with cellular proteins and its potential impact on cell proliferation and viability. Results A fission yeast strain RE294 was created that carried a single integrated copy of the PR gene in its chromosome. The PR gene was expressed using an inducible nmt1 promoter so that PR-specific effects could be measured. HIV-1 PR from this system cleaved the same indigenous viral p6/MA protein substrate as it does in natural HIV-1 infections. HIV-1 PR expression in fission yeast cells prevented cell proliferation and induced cellular oxidative stress and changes in mitochondrial morphology that led to cell death. Both these PR activities can be prevented by a PR-specific enzymatic inhibitor, indinavir, suggesting that PR-mediated proteolytic activities and cytotoxic effects resulted from enzymatic activities of HIV-1 PR. Through genome-wide screening, a serine/threonine kinase, Hhp2, was identified that suppresses HIV-1 PR-induced protease cleavage and cell death in fission yeast and in mammalian cells, where it prevented PR-induced apoptosis and cleavage of caspase-3 and caspase-8. Conclusions This is the first report to show that HIV-1 protease is functional as an enzyme in fission yeast, and that it behaves in a similar manner as it does in HIV-1 infection. HIV-1 PR-induced cell death in fission yeast could potentially be used as an endpoint for mechanistic studies, and this system could be used for developing a high-throughput system for drug screenings. PMID:26982200

  16. Cystatins, serpins and other families of protease inhibitors in plants.


    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R


    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  17. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.


    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong


    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  18. Transcriptomic Analysis Shows Decreased Cortical Expression of NR4A1, NR4A2 and RXRB in Schizophrenia and Provides Evidence for Nuclear Receptor Dysregulation

    PubMed Central

    Corley, Susan M.; Wilkins, Marc R.; Shannon Weickert, Cynthia


    Many genes are differentially expressed in the cortex of people with schizophrenia, implicating factors that control transcription more generally. Hormone nuclear receptors dimerize to coordinate context-dependent changes in gene expression. We hypothesized that members of two families of nuclear receptors (NR4As), and retinoid receptors (RARs and RXRs), are altered in the dorsal lateral prefrontal cortex (DLPFC) of people with schizophrenia. We used next generation sequencing and then qPCR analysis to test for changes in mRNA levels for transcripts encoding nuclear receptors: orphan nuclear receptors (3 in the NR4A, 3 in the RAR, 3 in the RXR families and KLF4) in total RNA extracted from the DLPFC from people with schizophrenia compared to controls (n = 74). We also correlated mRNA levels with demographic factors and with estimates of antipsychotic drug exposure (schizophrenia group only). We tested for correlations between levels of transcription factor family members and levels of genes putatively regulated by these transcription factors. We found significantly down regulated expression of NR4A1 (Nurr 77) and KLF4 mRNAs in people with schizophrenia compared to controls, by both NGS and qPCR (p = or <0.01). We also detected decreases in NR4A2 (Nurr1) and RXRB mRNAs by using qPCR in the larger cohort (p<0.05 and p<0.01, respectively). We detected decreased expression of RARG and NR4A2 mRNAs in females with schizophrenia (p<0.05). The mRNA levels of NR4A1, NR4A2 and NR4A3 were all negative correlated with lifetime estimates of antipsychotic exposure. These novel findings, which may be influenced by antipsychotic drug exposure, implicate the orphan and retinoid nuclear receptors in the cortical pathology found in schizophrenia. Genes down stream of these receptors can be dysregulated as well, but the direction of change is not immediately predictable based on the putative transcription factor changes. PMID:27992436

  19. Transcriptomic Analysis Shows Decreased Cortical Expression of NR4A1, NR4A2 and RXRB in Schizophrenia and Provides Evidence for Nuclear Receptor Dysregulation.


    Corley, Susan M; Tsai, Shan-Yuan; Wilkins, Marc R; Shannon Weickert, Cynthia


    Many genes are differentially expressed in the cortex of people with schizophrenia, implicating factors that control transcription more generally. Hormone nuclear receptors dimerize to coordinate context-dependent changes in gene expression. We hypothesized that members of two families of nuclear receptors (NR4As), and retinoid receptors (RARs and RXRs), are altered in the dorsal lateral prefrontal cortex (DLPFC) of people with schizophrenia. We used next generation sequencing and then qPCR analysis to test for changes in mRNA levels for transcripts encoding nuclear receptors: orphan nuclear receptors (3 in the NR4A, 3 in the RAR, 3 in the RXR families and KLF4) in total RNA extracted from the DLPFC from people with schizophrenia compared to controls (n = 74). We also correlated mRNA levels with demographic factors and with estimates of antipsychotic drug exposure (schizophrenia group only). We tested for correlations between levels of transcription factor family members and levels of genes putatively regulated by these transcription factors. We found significantly down regulated expression of NR4A1 (Nurr 77) and KLF4 mRNAs in people with schizophrenia compared to controls, by both NGS and qPCR (p = or <0.01). We also detected decreases in NR4A2 (Nurr1) and RXRB mRNAs by using qPCR in the larger cohort (p<0.05 and p<0.01, respectively). We detected decreased expression of RARG and NR4A2 mRNAs in females with schizophrenia (p<0.05). The mRNA levels of NR4A1, NR4A2 and NR4A3 were all negative correlated with lifetime estimates of antipsychotic exposure. These novel findings, which may be influenced by antipsychotic drug exposure, implicate the orphan and retinoid nuclear receptors in the cortical pathology found in schizophrenia. Genes down stream of these receptors can be dysregulated as well, but the direction of change is not immediately predictable based on the putative transcription factor changes.

  20. Purification and characterization of serine proteases that exhibit caspase-like activity and are associated with programmed cell death in Avena sativa.


    Coffeen, Warren C; Wolpert, Thomas J


    Victoria blight of Avena sativa (oat) is caused by the fungus Cochliobolus victoriae, which is pathogenic because of the production of the toxin victorin. The victorin-induced response in sensitive A. sativa has been characterized as a form of programmed cell death (PCD) and displays morphological and biochemical features similar to apoptosis, including chromatin condensation, DNA laddering, cell shrinkage, altered mitochondrial function, and ordered, substrate-specific proteolytic events. Victorin-induced proteolysis of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is shown to be prevented by caspase-specific and general protease inhibitors. Evidence is presented for a signaling cascade leading to Rubisco proteolysis that involves multiple proteases. Furthermore, two proteases that are apparently involved in the Rubisco proteolytic cascade were purified and characterized. These proteases exhibit caspase specificity and display amino acid sequences homologous to plant subtilisin-like Ser proteases. The proteases are constitutively present in an active form and are relocalized to the extracellular fluid after induction of PCD by either victorin or heat shock. The role of the enzymes as processive proteases involved in a signal cascade during the PCD response is discussed.

  1. Purification and Characterization of Serine Proteases That Exhibit Caspase-Like Activity and Are Associated with Programmed Cell Death in Avena sativa

    PubMed Central

    Coffeen, Warren C.; Wolpert, Thomas J.


    Victoria blight of Avena sativa (oat) is caused by the fungus Cochliobolus victoriae, which is pathogenic because of the production of the toxin victorin. The victorin-induced response in sensitive A. sativa has been characterized as a form of programmed cell death (PCD) and displays morphological and biochemical features similar to apoptosis, including chromatin condensation, DNA laddering, cell shrinkage, altered mitochondrial function, and ordered, substrate-specific proteolytic events. Victorin-induced proteolysis of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is shown to be prevented by caspase-specific and general protease inhibitors. Evidence is presented for a signaling cascade leading to Rubisco proteolysis that involves multiple proteases. Furthermore, two proteases that are apparently involved in the Rubisco proteolytic cascade were purified and characterized. These proteases exhibit caspase specificity and display amino acid sequences homologous to plant subtilisin-like Ser proteases. The proteases are constitutively present in an active form and are relocalized to the extracellular fluid after induction of PCD by either victorin or heat shock. The role of the enzymes as processive proteases involved in a signal cascade during the PCD response is discussed. PMID:15020745

  2. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  3. A preliminary neutron diffraction analysis of Achromobacter protease I

    NASA Astrophysics Data System (ADS)

    Ohnishi, Yuki; Masaki, Takeharu; Yamada, Taro; Kurihara, Kazuo; Tanaka, Ichiro; Niimura, Nobuo


    Achromobacter protease I (API, E.C. is one of the serine proteases produced by Achromobacter lyticus M497-1. API is distinct from the other tripsin type protease in its lysine specificity. The neutron structure analysis of catalytic triad with Trp169 and His210 was presented. His57 was double protonated and formed hydrogen bonds to Ser194Oγ and Asp113Oδ1, Oδ2.

  4. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    PubMed Central

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  5. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.


    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  6. Protease-activated receptors and prostaglandins in inflammatory lung disease

    PubMed Central

    Peters, Terence; Henry, Peter J


    Protease-activated receptors (PARs) are a novel family of G protein-coupled receptors. Signalling through PARs typically involves the cleavage of an extracellular region of the receptor by endogenous or exogenous proteases, which reveals a tethered ligand sequence capable of auto-activating the receptor. A considerable body of evidence has emerged over the past 20 years supporting a prominent role for PARs in a variety of human physiological and pathophysiological processes, and thus substantial attention has been directed towards developing drug-like molecules that activate or block PARs via non-proteolytic pathways. PARs are widely expressed within the respiratory tract, and their activation appears to exert significant modulatory influences on the level of bronchomotor tone, as well as on the inflammatory processes associated with a range of respiratory tract disorders. Nevertheless, there is debate as to whether the principal response to PAR activation is an augmentation or attenuation of airways inflammation. In this context, an important action of PAR activators may be to promote the generation and release of prostanoids, such as prostglandin E2, which have well-established anti-inflammatory effects in the lung. In this review, we primarily focus on the relationship between PARs, prostaglandins and inflammatory processes in the lung, and highlight their potential role in selected respiratory tract disorders, including pulmonary fibrosis, asthma and chronic obstructive pulmonary disease. This article is part of a themed issue on Mediators and Receptors in the Resolution of Inflammation. To view this issue visit PMID:19845685

  7. Global substrate profiling of proteases in human neutrophil extracellular traps reveals consensus motif predominantly contributed by elastase.


    O'Donoghue, Anthony J; Jin, Ye; Knudsen, Giselle M; Perera, Natascha C; Jenne, Dieter E; Murphy, John E; Craik, Charles S; Hermiston, Terry W


    Neutrophil extracellular traps (NETs) consist of antimicrobial molecules embedded in a web of extracellular DNA. Formation of NETs is considered to be a defense mechanism utilized by neutrophils to ensnare and kill invading pathogens, and has been recently termed NETosis. Neutrophils can be stimulated to undergo NETosis ex vivo, and are predicted to contain high levels of serine proteases, such as neutrophil elastase (NE), cathepsin G (CG) and proteinase 3 (PR3). Serine proteases are important effectors of neutrophil-mediated immunity, which function directly by degrading pathogenic virulent factors and indirectly via proteolytic activation or deactivation of cytokines, chemokines and receptors. In this study, we utilized a diverse and unbiased peptide library to detect and profile protease activity associated with NETs induced by phorbol-12-myristate-13-acetate (PMA). We obtained a "proteolytic signature" from NETs derived from healthy donor neutrophils and used proteomics to assist in the identification of the source of this proteolytic activity. In addition, we profiled each neutrophil serine protease and included the newly identified enzyme, neutrophil serine protease 4 (NSP4). Each enzyme had overlapping yet distinct endopeptidase activities and often cleaved at unique sites within the same peptide substrate. The dominant proteolytic activity in NETs was attributed to NE; however, cleavage sites corresponding to CG and PR3 activity were evident. When NE was immunodepleted, the remaining activity was attributed to CG and to a lesser extent PR3 and NSP4. Our results suggest that blocking NE activity would abrogate the major protease activity associated with NETs. In addition, the newly identified substrate specificity signatures will guide the design of more specific probes and inhibitors that target NET-associated proteases.

  8. Initiating protease with modular domains interacts with β-glucan recognition protein to trigger innate immune response in insects.


    Takahashi, Daisuke; Garcia, Brandon L; Kanost, Michael R


    The autoactivation of an initiating serine protease upon binding of pattern recognition proteins to pathogen surfaces is a crucial step in eliciting insect immune responses such as the activation of Toll and prophenoloxidase pathways. However, the molecular mechanisms responsible for autoactivation of the initiating protease remains poorly understood. Here, we investigated the molecular basis for the autoactivation of hemolymph protease 14 (HP14), an initiating protease in hemolymph of Manduca sexta, upon the binding of β-1,3-glucan by its recognition protein, βGRP2. Biochemical analysis using HP14 zymogen (proHP14), βGRP2, and the recombinant proteins as truncated forms showed that the amino-terminal modular low-density lipoprotein receptor class A (LA) domains within HP14 are required for proHP14 autoactivation that is stimulated by its interaction with βGRP2. Consistent with this result, recombinant LA domains inhibit the activation of proHP14 and prophenoloxidase, likely by competing with the interaction between βGRP2 and LA domains within proHP14. Using surface plasmon resonance, we demonstrated that immobilized LA domains directly interact with βGRP2 in a calcium-dependent manner and that high-affinity interaction requires the C-terminal glucanase-like domain of βGRP2. Importantly, the affinity of LA domains for βGRP2 increases nearly 100-fold in the presence of β-1,3-glucan. Taken together, these results present the first experimental evidence to our knowledge that LA domains of an insect modular protease and glucanase-like domains of a βGRP mediate their interaction, and that this binding is essential for the protease autoactivation. Thus, our study provides important insight into the molecular basis underlying the initiation of protease cascade in insect immune responses.

  9. Cysteine Protease Profiles of the Medicinal Plant Calotropis procera R. Br. Revealed by De Novo Transcriptome Analysis

    PubMed Central

    Kwon, Chang Woo; Park, Kyung-Min; Kang, Byoung-Cheorl; Kweon, Dae-Hyuk; Kim, Myoung-Dong; Shin, Sang Woon; Je, Yeon Ho; Chang, Pahn-Shick


    Calotropis procera R. Br., a traditional medicinal plant in India, is a promising source of commercial proteases, because the cysteine proteases from the plant exhibit high thermo-stability, broad pH optima, and plasma-clotting activity. Though several proteases such as Procerain, Procerain B, CpCp-1, CpCp-2, and CpCp-3 have been isolated and characterized, the information of their transcripts is limited to cDNAs encoding their mature peptides. Due to this limitation, in this study, to determine the cDNA sequences encoding full open reading frame of these cysteine proteases, transcripts were sequenced with an Illumina Hiseq2000 sequencer. A total of 171,253,393 clean reads were assembled into 106,093 contigs with an average length of 1,614 bp and an N50 of 2,703 bp, and 70,797 contigs with an average length of 1,565 bp and N50 of 2,082 bp using Trinity and Velvet-Oases software, respectively. Among these contigs, we found 20 unigenes related to papain-like cysteine proteases by BLASTX analysis against a non-redundant NCBI protein database. Our expression analysis revealed that the cysteine protease contains an N-terminal pro-peptide domain (inhibitor region), which is necessary for correct folding and proteolytic activity. It was evident that expression yields using an inducible T7 expression system in Escherichia coli were considerably higher with the pro-peptide domain than without the domain, which could contribute to molecular cloning of the Calotropis procera protease as an active form with correct folding. PMID:25786229

  10. Initiating protease with modular domains interacts with β-glucan recognition protein to trigger innate immune response in insects

    PubMed Central

    Takahashi, Daisuke; Garcia, Brandon L.; Kanost, Michael R.


    The autoactivation of an initiating serine protease upon binding of pattern recognition proteins to pathogen surfaces is a crucial step in eliciting insect immune responses such as the activation of Toll and prophenoloxidase pathways. However, the molecular mechanisms responsible for autoactivation of the initiating protease remains poorly understood. Here, we investigated the molecular basis for the autoactivation of hemolymph protease 14 (HP14), an initiating protease in hemolymph of Manduca sexta, upon the binding of β-1,3-glucan by its recognition protein, βGRP2. Biochemical analysis using HP14 zymogen (proHP14), βGRP2, and the recombinant proteins as truncated forms showed that the amino-terminal modular low-density lipoprotein receptor class A (LA) domains within HP14 are required for proHP14 autoactivation that is stimulated by its interaction with βGRP2. Consistent with this result, recombinant LA domains inhibit the activation of proHP14 and prophenoloxidase, likely by competing with the interaction between βGRP2 and LA domains within proHP14. Using surface plasmon resonance, we demonstrated that immobilized LA domains directly interact with βGRP2 in a calcium-dependent manner and that high-affinity interaction requires the C-terminal glucanase-like domain of βGRP2. Importantly, the affinity of LA domains for βGRP2 increases nearly 100-fold in the presence of β-1,3-glucan. Taken together, these results present the first experimental evidence to our knowledge that LA domains of an insect modular protease and glucanase-like domains of a βGRP mediate their interaction, and that this binding is essential for the protease autoactivation. Thus, our study provides important insight into the molecular basis underlying the initiation of protease cascade in insect immune responses. PMID:26504233

  11. Evidence that WapB Is a 1,2-Glucosyltransferase of Pseudomonas aeruginosa Involved in Lipopolysaccharide Outer Core Biosynthesis▿†

    PubMed Central

    Kocíncová, Dana; Hao, Youai; Vinogradov, Evgeny; Lam, Joseph S.


    Pseudomonas aeruginosa is an important opportunistic pathogen infecting debilitated individuals. One of the major virulence factors expressed by P. aeruginosa is lipopolysaccharide (LPS), which is composed of lipid A, core oligosaccharide (OS), and O-antigen polysaccharide. The core OS is divided into inner and outer regions. Although the structure of the outer core OS has been elucidated, the functions and mechanisms of the glycosyltransferases involved in core OS biogenesis are currently unknown. Here, we show that a previously uncharacterized gene, pa1014, is involved in outer core biosynthesis, and we propose to rename this gene wapB. We constructed a chromosomal mutant, wapB::Gm, in a PAO1 (O5 serotype) strain background. Characterization of the LPS from the mutant by Western immunoblotting showed a lack of reactivity to PAO1 outer core-specific monoclonal antibody (MAb) 5c-101. The chemical structure of the core OS of the wapB mutant was elucidated using nuclear magnetic resonance spectroscopy and mass spectrometry techniques and revealed that the core OS of the wapB mutant lacked the terminal β-1,2-linked-d-glucose residue. Complementation of the mutant with wapB in trans restored the core structure to one that is identical to that of the wild type. Eleven of the 20 P. aeruginosa International Antigenic Typing Scheme (IATS) serotypes produce LPSs that lack the terminal d-glucose residue (GlcIV). Interestingly, expressing wapB in each of these 11 serotypes modifies each of their outer core OS structures, which became reactive to MAb 5c-101 in Western immunoblotting, suggesting the presence of a terminal d-glucose in these core OS structures. Our results strongly suggested that wapB encodes a 1,2-glucosyltransferase. PMID:21441506

  12. A study on trypsin, Aspergillus flavus and Bacillus sp. protease inhibitory activity in Cassia tora (L.) syn Senna tora (L.) Roxb. seed extract

    PubMed Central


    extract for 60 min. The inhibitory activity was evident in gelatin SDS-PAGE where a major band (~17-19 kD) of protease inhibitor (PI) was detected in dialyzed and SEC elute. The conidial germination of Aspergillus flavus was moderately inhibited (30%) by the dialyzed seed extract. Conclusions Cassia tora seed extract has strong protease inhibitory activity against trypsin, Aspergillus flavus and Bacillus sp. proteases. The inhibitor in Cassia tora may attenuate microbial proteases and also might be used as phytoprotecting agent. PMID:21749682

  13. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.


    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu


    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  14. Expression, purification and identification of a thermolysin-like protease, neutral protease I, from Aspergillus oryzae with the Pichia pastoris expression system.


    Ma, Xiaojian; Liu, Yunyun; Li, Qingqing; Liu, Lu; Yi, Li; Ma, Lixin; Zhai, Chao


    Neutral proteases are widely used in the textile, food and medical industries. This study was designed to obtain high expression levels of neutral protease I from Aspergillus oryzae 3.042 by using Pichia pastoris GS115 as the host strain for industrial purposes. The coding sequence of the target gene was modified, synthesized, and then cloned into the expression vector pHBM905BDM, which harbored the d1+2 × 201 AOX1 promoter and the MF4I leader sequence. The recombinant plasmid was transformed into Pichia pastoris GS115. The recombinant strain was used for high-density fermentation in a 4-L fermenter. The yield of the target protein reached 12.87 mg/mL, and the enzyme activity was approximately 49370 U/mL, which indicated that this enzyme was expressed in Pichia pastoris at a high level. The target protein was purified and characterized. Its optimum temperature and pH were 55 °C and 8.0, respectively. This enzyme was extremely sensitive to EDTA, which is consistent with the previous reports that it is a zinc-dependent metalloprotease. Our results indicated that low concentrations of zinc, calcium and magnesium ions stimulated the enzyme activity, whereas high concentrations inhibited its activity. In addition, calcium and magnesium ions increased the thermostability of the enzyme. All of the evidence indicated that this protease is a thermolysin-like peptidase. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.


    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong


    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  16. Frequency and patterns of protease gene resistance mutations in HIV-infected patients treated with lopinavir/ritonavir as their first protease inhibitor.


    Barber, Tristan J; Harrison, Linda; Asboe, David; Williams, Ian; Kirk, Stuart; Gilson, Richard; Bansi, Loveleen; Pillay, Deenan; Dunn, David


    Selection of protease mutations on antiretroviral therapy (ART) including a ritonavir-boosted protease inhibitor (PI) has been reported infrequently. Scarce data exist from long-term cohorts on resistance incidence or mutational patterns emerging to different PIs. We studied UK patients receiving lopinavir/ritonavir as their first PI, either while naive to ART or having previously received non-PI-based ART. Virological failure was defined as viral load ≥ 400 copies/mL after previous suppression <400 copies/mL, or failure to achieve <400 copies/mL during the first 6 months. pol sequences whilst failing lopinavir or within 30 days after stopping were analysed. Major and minor mutations (IAS-USA 2008-after exclusion of polymorphisms) were considered. Predicted susceptibility was determined using the Stanford HIVdb algorithm. Three thousand and fifty-six patients were followed for a median (IQR) of 14 (6-30) months, of whom 811 (27%) experienced virological failure. Of these, resistance test results were available on 291 (36%). One or more protease mutations were detected in 32 (11%) patients; the most frequent were I54V (n = 12), M46I (n = 11), V82A (n = 7) and L76V (n = 3). No association with viral subtype was evident. Many patients retained virus predicted to be susceptible to lopinavir (14, 44%), tipranavir (26, 81%) and darunavir (27, 84%). This study reflects the experience of patients in routine care. Selection of protease gene mutations by lopinavir/ritonavir occurred at a much higher rate than in clinical trials. The mutations observed showed only partial overlap with those previously identified by structural chemistry models, serial cell culture passage and genotype-phenotype analyses. There remained a low degree of predicted cross-resistance to other widely used PIs.

  17. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne


    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  18. Purification of Pseudomonas aeruginosa proteases and microscopic characterization of pseudomonal protease-induced rabbit corneal damage.

    PubMed Central

    Kreger, A S; Gray, L D


    Extracellular proteases of three cornea-virulent strains of Pseudomonas aeruginosa were isolated by sequential ammonium sulfate precipitation, Ultrogel AcA 54 gel filtration, and flat-bed isoelectric focusing. The purity of the preparations was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis , thin-layer isoelectric focusing in polyacrylamide gel, immunodiffusion and immunoelectrophoretic procedures, and tests for the presence of other known pseudomonal products. Light and electron microscopic examination of rabbit corneal lesions observed 4 to 6 h after the intracorneal injection of submicrogram amounts of the proteases revealed: (i) degeneration and necrosis of epithelium, endothelium, and keratocytes, (ii) infiltration, degeneration, and necrosis of polymorphonuclear leukocytes, (iii) loss of the characteristic weblike pattern, colloidal iron staining, and ruthenium red staining of the stromal proteoglycan ground substance, (iv) dispersal of strucutrally normal appearing collagen fibrils, ground substance, (iv) dispersal of structurally normal appearing collagen fibrils, and (v) accumulation of plasma proteins and fibrin in the necrotic corneas. These structural alterations are very similar to those observed previously during experimental P. aeruginosa keratitis, and this similarity supports the idea that pseudomonal proteases are responsible, at least in part, for the rapid and extensive liquefaction necrosis characteristic of pseudomonal-induced keratitis. In addition, the results support the idea that pseudomonal proteases elicit severe corneal damage by causing the loss of the corneal proteoglycan ground substance, thus resulting in dispersal of undamaged collagen fibrils, weakening of the corneal stroma, and subsequent descemetocele formation and corneal perforation by the anterior chamber pressure. Images PMID:415981

  19. Effect of organic solvents on the structure and activity of moderately halophilic Bacillus sp. EMB9 protease.


    Sinha, Rajeshwari; Khare, S K


    Halophilic enzymes have been manifested for their stability and catalytic abilities under harsh operational conditions. These have been documented to withstand denaturation in presence of high temperature, pH, presence of organic solvents and chaotropic agents. The present study aims at understanding the stability and activity of a halophilic Bacillus sp. EMB9 protease in organic solvents. The protease was uniquely stable in polar solvents. A clear correlation was evident between the protease function and conformational transitions, validated by CD and fluorescence spectral studies. The study affirms that preservation of protein structure, possibly due to charge screening of the protein surface by Ca(2+) and Na(+) ions provides stability against organic solvents and averts denaturation. Salt was also found to exert a protective effect on dialyzed protease against chaotropism of solvents. Presence of 1 % (w/v) NaCl restored the activity in the dialyzed protease and prevented denaturation in methanol, toluene and n-decane. The work will have further implication on discerning protein folding in saline as well as non-aqueous environments.

  20. Inhibition of protease in intact fish fillets by soaking in or injection of recombinant soy cystatin or bovine plasma.


    Kang, I; Lanier, T C


    Arrowtooth flounder (AF) fillets are known to contain a heat-activated cysteine protease similar to that found in Pacific whiting, which results in soft texture upon cooking. A crude recombinant soy cystatin (CRSC) produced by Escherichia coli, which has been shown to inhibit the protease(s) in Pacific whiting, was introduced into AF fillets by immersion or injection at one of three levels of inhibitory activity: 10 times less than, equal to, or 10 times greater than that of a 20% bovine plasma protein (BPP) solution, a known inhibitor of AF protease(s). Fillets treated with CRSC or BPP at equal inhibitory strength subsequently exhibited the same degree of protection against textural degradation during cooking. Fillets treated with CRSC at lesser or greater levels of inhibitory activity than those of BPP exhibited lesser or higher protection, accordingly. As revealed by SDS-PAGE, the outer portion of fillets soaked with inhibitory solutions was more effectively protected than the inner portion. Such differences between the outer and inner portions of the fillets were not evident when inhibitory solutions were injected into the fillets.

  1. Interference with nuclear factor kappaB signaling pathway by pathogen-encoded proteases: global and selective inhibition.


    Hodgson, Andrea; Wan, Fengyi


    Pathogens have evolved a myriad of ways to abrogate and manipulate the host response to infections. Of the various mechanisms involved, pathogen-encoded and sometimes host-encoded proteases are an important category of virulence factors that cause robust changes on the host response by targeting key proteins along signaling cascades. The nuclear factor kappaB (NF-κB) signaling pathway is a crucial regulatory mechanism for the cell, controlling the expression of survival, immune and proliferation genes. Proteases from pathogens of almost all types have been demonstrated to target and cleave members of the NF-κB signaling pathway at nearly every level. This review provides discussion of proteases targeting the most abundant NF-κB subunit, p65, and the impact of protease-mediated p65 cleavage on the immune responses and survival of the infected host cell. After examining various examples of protease interference, it becomes evident that the cleavage fragments produced by pathogen-driven proteolytic processing should be further characterized to determine whether they have novel and unique functions within the cell. The selective targeting of p65 and its effect on gene transcription reveals unique mechanisms by which pathogens acutely alter their microenvironment, and further research may open new opportunities for novel therapeutics to combat pathogens.

  2. Uptake and Degradation of Protease-Sensitive and -Resistant Forms of Abnormal Human Prion Protein Aggregates by Human Astrocytes

    PubMed Central

    Choi, Young Pyo; Head, Mark W.; Ironside, James W.; Priola, Suzette A.


    Sporadic Creutzfeldt-Jakob disease is the most common of the human prion diseases, a group of rare, transmissible, and fatal neurologic diseases associated with the accumulation of an abnormal form (PrPSc) of the host prion protein. In sporadic Creutzfeldt-Jakob disease, disease-associated PrPSc is present not only as an aggregated, protease-resistant form but also as an aggregated protease-sensitive form (sPrPSc). Although evidence suggests that sPrPSc may play a role in prion pathogenesis, little is known about how it interacts with cells during prion infection. Here, we show that protease-sensitive abnormal PrP aggregates derived from patients with sporadic Creutzfeldt-Jakob disease are taken up and degraded by immortalized human astrocytes similarly to abnormal PrP aggregates that are resistant to proteases. Our data suggest that relative proteinase K resistance does not significantly influence the astrocyte's ability to degrade PrPSc. Furthermore, the cell does not appear to distinguish between sPrPSc and protease-resistant PrPSc, suggesting that sPrPSc could contribute to prion infection. PMID:25280631

  3. Production and characterization of thermostable alkaline protease of Bacillus subtilis (ATCC 6633) from optimized solid-state fermentation.


    Chatterjee, Joyee; Giri, Sudipta; Maity, Sujan; Sinha, Ankan; Ranjan, Ashish; Rajshekhar; Gupta, Suvroma


    Proteases are the most important group of enzymes utilized commercially in various arenas of industries, such as food, detergent, leather, dairy, pharmaceutical, diagnostics, and waste management, accounting for nearly 20% of the world enzyme market. Microorganisms of specially Bacillus genera serve as a vast repository of diverse set of industrially important enzymes and utilized for the large-scale enzyme production using a fermentation technology. Approximately 30%-40% of the cost of industrial enzymes originates from the cost of the growth medium. This study is attempted to produce protease from Bacillus subtilis (ATCC 6633) after optimization of various process parameters with the aid of solid-state fermentation using a cheap nutrient source such as wheat bran. B. subtilis (ATCC 6633) produces proteases of molecular weight 36 and 20 kDa, respectively, in the fermented medium as evident from SDS zymogram. Alkaline protease activity has been detected with optimum temperature at 50 °C and is insensitive to ethylenediaminetetraacetic acid. This thermostable alkaline protease exhibits dual pH optimum at 7 and 10 with moderate pH stability at alkaline pH range. It preserves its activity in the presence of detergent such as SDS, Tween 20, and Triton X-100 and may be considered as an effective additive to detergent formulation with some industrial importance.

  4. The m-AAA protease processes cytochrome c peroxidase preferentially at the inner boundary membrane of mitochondria.


    Suppanz, Ida E; Wurm, Christian A; Wenzel, Dirk; Jakobs, Stefan


    The m-AAA protease is a conserved hetero-oligomeric complex in the inner membrane of mitochondria. Recent evidence suggests a compartmentalization of the contiguous mitochondrial inner membrane into an inner boundary membrane (IBM) and a cristae membrane (CM). However, little is known about the functional differences of these subdomains. We have analyzed the localizations of the m-AAA protease and its substrate cytochrome c peroxidase (Ccp1) within yeast mitochondria using live cell fluorescence microscopy and quantitative immunoelectron microscopy. We find that the m-AAA protease is preferentially localized in the IBM. Likewise, the membrane-anchored precursor form of Ccp1 accumulates in the IBM of mitochondria lacking a functional m-AAA protease. Only upon proteolytic cleavage the mature form mCcp1 moves into the cristae space. These findings suggest that protein quality control and proteolytic activation exerted by the m-AAA protease take place preferentially in the IBM pointing to significant functional differences between the IBM and the CM.

  5. Caspase-dependant activation of chymotrypsin-like proteases mediates nuclear events during Jurkat T cell apoptosis

    SciTech Connect

    O'Connell, A.R.; Lee, B.W.; Stenson-Cox, C. . E-mail:


    Apoptosis involves a cascade of biochemical and morphological changes resulting in the systematic disintegration of the cell. Caspases are central mediators of this process. Supporting and primary roles for serine proteases as pro-apoptotic mediators have also been highlighted. Evidence for such roles comes largely from the use of pharmacological inhibitors; as a consequence information regarding their apoptotic function and biochemical properties has been limited. Here, we circumvented limitations associated with traditional serine protease inhibitors through use of a fluorescently labelled inhibitor of serine proteases (FLISP) that allowed for analysis of the specificity, regulation and positioning of apoptotic serine proteases within a classical apoptotic cascade. We demonstrate that staurosporine triggers a caspase-dependant induction of chymotrypsin-like activity in the nucleus of apoptotic Jurkat T cells. We show that serine protease activity is required for the generation of late stage nuclear events including condensation, fragmentation and DNA degradation. Furthermore, we reveal caspase-dependant activation of two chymotrypsin-like protein species that we hypothesize mediate cell death-associated nuclear events.

  6. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.


    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  7. Protease sensing using nontoxic silicon quantum dots

    NASA Astrophysics Data System (ADS)

    Cheng, Xiaoyu; McVey, Benjamin F. P.; Robinson, Andrew B.; Longatte, Guillaume; O'Mara, Peter B.; Tan, Vincent T. G.; Thordarson, Pall; Tilley, Richard D.; Gaus, Katharina; Justin Gooding, John


    Herein is presented a proof-of-concept study of protease sensing that combines nontoxic silicon quantum dots (SiQDs) with Förster resonance energy transfer (FRET). The SiQDs serve as the donor and an organic dye as the acceptor. The dye is covalently attached to the SiQDs using a peptide linker. Enzymatic cleavage of the peptide leads to changes in FRET efficiency. The combination of interfacial design and optical imaging presented in this work opens opportunities for use of nontoxic SiQDs relevant to intracellular sensing and imaging.

  8. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis


    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  9. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.


    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C


    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  10. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel


    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  11. Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

    PubMed Central

    Sunil, Sujatha; Chauhan, Virander S; Malhotra, Pawan


    Background Plasmodium falciparum cysteine proteases (falcipains) play indispensable roles in parasite infection and development, especially in the process of host erythrocyte rupture/invasion and hemoglobin degradation. No detailed molecular analysis of transcriptional regulation of parasite proteases especially cysteine proteases has yet been reported. In this study, using a combination of transient transfection assays and electrophoretic mobility shift assays (EMSA), we demonstrate the presence of stage specific nuclear factors that bind to unique sequence elements in the 5'upstream regions of the falcipains and probably modulate the expression of cysteine proteases. Results Falcipains differ in their timing of expression and exhibit ability to compensate each other's functions at asexual blood stages of the parasite. Present study was undertaken to study the transcriptional regulation of falcipains. Transient transfection assay employing firefly luciferase as a reporter revealed that a ~1 kb sequence upstream of translational start site is sufficient for the functional transcriptional activity of falcipain-1 gene, while falcipain-2, -2' and -3 genes that exist within 12 kb stretch on chromosome 11 require ~2 kb upstream sequences for the expression of reporter luciferase activity. EMSA analysis elucidated binding of distinct nuclear factors to specific sequences within the 5'upstream regions of falcipain genes. Analysis of falcipains' 5'upstream regulatory regions did not reveal the presence of sequences known to bind general eukaryotic factors. However, we did find parasite specific sequence elements such as poly(dA) poly(dT) tracts, CCAAT boxes and a single 7 bp-G rich sequence, (A/G)NGGGG(C/A) in the 5' upstream regulatory regions of these genes, thereby suggesting the role(s) of Plasmodium specific transcriptional factors in the regulation of falcipain genes. Conclusion Taken together, these results suggest that expression of Plasmodium cysteine proteases is

  12. HIV-1 protease-substrate coevolution in nelfinavir resistance.


    Kolli, Madhavi; Ozen, Ayşegül; Kurt-Yilmaz, Nese; Schiffer, Celia A


    Resistance to various human immunodeficiency virus type 1 (HIV-1) protease inhibitors (PIs) challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. The virus accumulates mutations within the protease (PR) that render the PIs less potent. Occasionally, Gag sequences also coevolve with mutations at PR cleavage sites contributing to drug resistance. In this study, we investigated the structural basis of coevolution of the p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations by determining crystal structures of wild-type and NFV-resistant HIV-1 protease in complex with p1-p6 substrate peptide variants with L449F and/or S451N. Alterations of residue 30's interaction with the substrate are compensated by the coevolving L449F and S451N cleavage site mutations. This interdependency in the PR-p1-p6 interactions enhances intermolecular contacts and reinforces the overall fit of the substrate within the substrate envelope, likely enabling coevolution to sustain substrate recognition and cleavage in the presence of PR resistance mutations. Resistance to human immunodeficiency virus type 1 (HIV-1) protease inhibitors challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. Mutations in HIV-1 protease selected under the pressure of protease inhibitors render the inhibitors less potent. Occasionally, Gag sequences also mutate and coevolve with protease, contributing to maintenance of viral fitness and to drug resistance. In this study, we investigated the structural basis of coevolution at the Gag p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations. Our structural analysis reveals the interdependency of protease-substrate interactions and how coevolution may restore substrate recognition and cleavage in the presence of protease drug resistance mutations. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena


    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  14. Regulated proteolysis by cortical granule serine protease 1 at fertilization.


    Haley, Sheila A; Wessel, Gary M


    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  15. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.


    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena


    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  16. Structural and functional analysis of human HtrA3 protease and its subdomains


    Glaza, Przemyslaw; Osipiuk, Jerzy; Wenta, Tomasz; ...


    Human HtrA3 protease, which induces mitochondria-mediated apoptosis, can be a tumor suppressor and a potential therapeutic target in the treatment of cancer. However, there is little information about its structure and biochemical properties. HtrA3 is composed of an N-terminal domain not required for proteolytic activity, a central serine protease domain and a C-terminal PDZ domain. HtrA3S, its short natural isoform, lacks the PDZ domain which is substituted by a stretch of 7 C-terminal amino acid residues, unique for this isoform. This paper presents the crystal structure of the HtrA3 protease domain together with the PDZ domain (ΔN-HtrA3), showing that themore » protein forms a trimer whose protease domains are similar to those of human HtrA1 and HtrA2. The ΔN-HtrA3 PDZ domains are placed in a position intermediate between that in the flat saucer-like HtrA1 SAXS structure and the compact pyramidal HtrA2 X-ray structure. The PDZ domain interacts closely with the LB loop of the protease domain in a way not found in other human HtrAs. ΔN-HtrA3 with the PDZ removed (ΔN-HtrA3-ΔPDZ) and an N-terminally truncated HtrA3S (ΔN-HtrA3S) were fully active at a wide range of temperatures and their substrate affinity was not impaired. This indicates that the PDZ domain is dispensable for HtrA3 activity. As determined by size exclusion chromatography, ΔN-HtrA3 formed stable trimers while both ΔN-HtrA3-ΔPDZ and ΔN-HtrA3S were monomeric. This suggests that the presence of the PDZ domain, unlike in HtrA1 and HtrA2, influences HtrA3 trimer formation. The unique C-terminal sequence of ΔN-HtrA3S appeared to have little effect on activity and oligomerization. Additionally, we examined the cleavage specificity of ΔN-HtrA3. Results reported in this paper provide new insights into the structure and function of ΔN-HtrA3, which seems to have a unique combination of features among human HtrA proteases.« less

  17. Structural and functional analysis of human HtrA3 protease and its subdomains

    SciTech Connect

    Glaza, Przemyslaw; Osipiuk, Jerzy; Wenta, Tomasz; Zurawa-Janicka, Dorota; Jarzab, Miroslaw; Lesner, Adam; Banecki, Bogdan; Skorko-Glonek, Joanna; Joachimiak, Andrzej; Lipinska, Barbara; van Raaij, Mark J.


    Human HtrA3 protease, which induces mitochondria-mediated apoptosis, can be a tumor suppressor and a potential therapeutic target in the treatment of cancer. However, there is little information about its structure and biochemical properties. HtrA3 is composed of an N-terminal domain not required for proteolytic activity, a central serine protease domain and a C-terminal PDZ domain. HtrA3S, its short natural isoform, lacks the PDZ domain which is substituted by a stretch of 7 C-terminal amino acid residues, unique for this isoform. This paper presents the crystal structure of the HtrA3 protease domain together with the PDZ domain (ΔN-HtrA3), showing that the protein forms a trimer whose protease domains are similar to those of human HtrA1 and HtrA2. The ΔN-HtrA3 PDZ domains are placed in a position intermediate between that in the flat saucer-like HtrA1 SAXS structure and the compact pyramidal HtrA2 X-ray structure. The PDZ domain interacts closely with the LB loop of the protease domain in a way not found in other human HtrAs. ΔN-HtrA3 with the PDZ removed (ΔN-HtrA3-ΔPDZ) and an N-terminally truncated HtrA3S (ΔN-HtrA3S) were fully active at a wide range of temperatures and their substrate affinity was not impaired. This indicates that the PDZ domain is dispensable for HtrA3 activity. As determined by size exclusion chromatography, ΔN-HtrA3 formed stable trimers while both ΔN-HtrA3-ΔPDZ and ΔN-HtrA3S were monomeric. This suggests that the presence of the PDZ domain, unlike in HtrA1 and HtrA2, influences HtrA3 trimer formation. The unique C-terminal sequence of ΔN-HtrA3S appeared to have little effect on activity and oligomerization. Additionally, we examined the cleavage specificity of ΔN-HtrA3. Results reported in this paper provide new insights into the structure and function of ΔN-HtrA3, which seems to have a unique combination of features among human HtrA proteases.

  18. Sequence conservation, phylogenetic relationships, and expression profiles of nondigestive serine proteases and serine protease homologs in Manduca sexta

    PubMed Central

    Cao, Xiaolong; He, Yan; Hu, Yingxia; Zhang, Xiufeng; Wang, Yang; Zou, Zhen; Chen, Yunru; Blissard, Gary W.; Kanost, Michael R.; Jiang, Haobo


    Serine protease (SP) and serine protease homolog (SPH) genes in insects encode a large family of proteins involved in digestion, development, immunity, and other processes. While 68 digestive SPs and their close homologs are reported in a companion paper (Kuwar et al., 2015), we have identified 125 other SPs/SPHs in Manduca sexta and studied their structure, evolution, and expression. Fifty-two of them contain cystine-stabilized structures for molecular recognition, including clip, LDLa, Sushi, Wonton, TSP, CUB, Frizzle, and SR domains. There are nineteen groups of genes evolved from relatively recent gene duplication and sequence divergence. Thirty-five SPs and seven SPHs contain 1, 2 or 5 clip domains. Multiple sequence alignment and molecular modeling of the 54 clip domains have revealed structural diversity of these regulatory modules. Sequence comparison with their homologs in Drosophila melanogaster, Anopheles gambiae and Tribolium castaneum allows us to classify them into five subfamilies: A are SPHs with 1 or 5 group-3 clip domains, B are SPs with 1 or 2 group-2 clip domains, C, D1 and D2 are SPs with a single clip domain in group-1a, 1b and 1c, respectively. We have classified into six categories the 125 expression profiles of SP-related proteins in fat body, brain, midgut, Malpighian tubule, testis, and ovary at different stages, suggesting that they participate in various physiological processes. Through RNA-Seq-based gene annotation and expression profiling, as well as intragenomic sequence comparisons, we have established a framework of information for future biochemical research of nondigestive SPs and SPHs in this model species. PMID:25530503

  19. Mutation Patterns and Structural Correlates in Human Immunodeficiency Virus Type 1 Protease following Different Protease Inhibitor Treatments

    PubMed Central

    Wu, Thomas D.; Schiffer, Celia A.; Gonzales, Matthew J.; Taylor, Jonathan; Kantor, Rami; Chou, Sunwen; Israelski, Dennis; Zolopa, Andrew R.; Fessel, W. Jeffrey; Shafer, Robert W.


    Although many human immunodeficiency virus type 1 (HIV-1)-infected persons are treated with multiple protease inhibitors in combination or in succession, mutation patterns of protease isolates from these persons have not been characterized. We collected and analyzed 2,244 subtype B HIV-1 isolates from 1,919 persons with different protease inhibitor experiences: 1,004 isolates from untreated persons, 637 isolates from persons who received one protease inhibitor, and 603 isolates from persons receiving two or more protease inhibitors. The median number of protease mutations per isolate increased from 4 in untreated persons to 12 in persons who had received four or more protease inhibitors. Mutations at 45 of the 99 amino acid positions in the protease—including 22 not previously associated with drug resistance—were significantly associated with protease inhibitor treatment. Mutations at 17 of the remaining 99 positions were polymorphic but not associated with drug treatment. Pairs and clusters of correlated (covarying) mutations were significantly more likely to occur in treated than in untreated persons: 115 versus 23 pairs and 30 versus 2 clusters, respectively. Of the 115 statistically significant pairs of covarying residues in the treated isolates, 59 were within 8 Å of each other—many more than would be expected by chance. In summary, nearly one-half of HIV-1 protease positions are under selective drug pressure, including many residues not previously associated with drug resistance. Structural factors appear to be responsible for the high frequency of covariation among many of the protease residues. The presence of mutational clusters provides insight into the complex mutational patterns required for HIV-1 protease inhibitor resistance. PMID:12663790

  20. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.


    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  1. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.


    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni


    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  2. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    USDA-ARS?s Scientific Manuscript database

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  3. Construction, expression, and characterization of a novel fully activated recombinant single-chain hepatitis C virus protease.

    PubMed Central

    Taremi, S. S.; Beyer, B.; Maher, M.; Yao, N.; Prosise, W.; Weber, P. C.; Malcolm, B. A.


    Efficient proteolytic processing of essential junctions of the hepatitis C virus (HCV) polyprotein requires a heterodimeric complex of the NS3 bifunctional protease/helicase and the NS4A accessory protein. A single-chain recombinant form of the protease has been constructed in which NS4A residues 21-32 (GSVVIVGRIILS) were fused in frame to the amino terminus of the NS3 protease domain (residues 3-181) through a tetrapeptide linker. The single-chain recombinant protease has been overexpressed as a soluble protein in E. coli and purified to homogeneity by a combination of metal chelate and size-exclusion chromatography. The single-chain recombinant protease domain shows full proteolytic activity cleaving the NS5A-5B synthetic peptide substrate, DTEDVVCCSMSYTWTGK with a Km and k(cat) of 20.0 +/- 2.0 microM and 9.6 +/- 2.0 min(-1), respectively; parameters identical to those of the authentic NS3(1-631)/NS4A(1-54) protein complex generated in eukaryotic cells (Sali DL et al., 1998, Biochemistry 37:3392-3401). PMID:9792101

  4. The Effectiveness of Negative Pressure Therapy in Diabetic Foot Ulcers with Elevated Protease Activity: A Case Series

    PubMed Central

    Izzo, Valentina; Meloni, Marco; Giurato, Laura; Ruotolo, Valeria; Uccioli, Luigi


    Objective: Despite several works have described the usefulness of negative pressure therapy (NPT) in the treatment of diabetic foot ulcers (DFUs), no studies have reported its ability in the proteases modulation in DFUs. The aim of this work was to evaluate the role of NPT as a protease-modulating treatment in DFUs. Approach: We conducted a prospective study of a series of diabetic patients affected by chronic DFUs. Each ulcer was assessed for matrix metalloproteinases (MMPs) activity with a protease status diagnostic test at the baseline and after 2 weeks of NPT. Results: Four patients were included. All patients had type 2 diabetes with a disease duration of ≈20 years. A1c was 79.5 ± 15.3 mmol/mol. Ulcer area was >5 cm2 in all cases. All wounds showed elevated protease activity (EPA) at the baseline. After 2 weeks, all patients showed a normalization of MMPs activity. Innovation: NPT showed its effectiveness in the reduction of EPA in chronic DFUs. Conclusion: This study confirms the role of NPT in the positive modulation of protease activity also in chronic DFUs. PMID:28116227

  5. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.


    Panigrahi, Rashmi; Lemieux, M Joanne


    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  6. The Degradome database: mammalian proteases and diseases of proteolysis.


    Quesada, Víctor; Ordóñez, Gonzalo R; Sánchez, Luis M; Puente, Xose S; López-Otín, Carlos


    The degradome is defined as the complete set of proteases present in an organism. The recent availability of whole genomic sequences from multiple organisms has led us to predict the contents of the degradomes of several mammalian species. To ensure the fidelity of these predictions, our methods have included manual curation of individual sequences and, when necessary, direct cloning and sequencing experiments. The results of these studies in human, chimpanzee, mouse and rat have been incorporated into the Degradome database, which can be accessed through a web interface at The annotations about each individual protease can be retrieved by browsing catalytic classes and families or by searching specific terms. This web site also provides detailed information about genetic diseases of proteolysis, a growing field of great importance for multiple users. Finally, the user can find additional information about protease structures, protease inhibitors, ancillary domains of proteases and differences between mammalian degradomes.

  7. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma


    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  8. Protease-activated nanomaterials for targeted cancer theranostics.


    Chan, Yung-Chieh; Hsiao, Michael


    Cancer metastasis accompanies irreversible proteolysis. Malignant cells that abnormally express extracellular proteases usually lead to a poor outcome during cancer progression. The development of protease-activated drugs is an important goal. Moreover, the specific proteolytic mechanism can be used as a diagnostic strategy. Currently, nanotechnology for use in medication has been extensively developed to exploit the physical and chemical properties of nanoparticles. For example, to improve the efficacy of cancer therapy drugs, targeted delivery has been attempted by combining a targeting ligand with a nanoparticle. Multifunctional nanoparticles have been prepared for cancer therapy and diagnosis because of their advantages such as stable physical properties, drug carrying ability and potential specific targeting ability. In this review, we present reports on protease-activated nanoparticle design for cancer theranostics. We further describe recent protease-activated metalloprotease-based and cathepsin-based nanomaterials used in cancer nanotheranostics. Innovative protease-activated nanomaterials have significant potential for designing personalized treatment.

  9. Poliovirus protease 3C(pro) kills cells by apoptosis.


    Barco, A; Feduchi, E; Carrasco, L


    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation. Copyright 2000 Academic Press.

  10. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin


    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  11. The New High Resolution Crystal Structure of NS2B-NS3 Protease of Zika Virus

    PubMed Central

    Badshah, Syed Lal; Naeem, Abdul; Mabkhot, Yahia


    Zika virus (ZIKV) is the cause of a significant viral disease affecting humans, which has spread throughout many South American countries and has also become a threat to Southeastern Asia. This commentary discusses the article “Crystal structure of unlinked NS2B-NS3 protease from Zika virus” published recently in the journal Science by Zhang et al. of Nanyang Technological University, Singapore. They resolved a 1.58 Å resolution structure of the NS2B-NS3 protease of ZIKV and demonstrated how peptide and non-peptide inhibitors interact with this structure, along with the different conformational states that were observed. This protease crystal structure offers new opportunities for the design and development of novel antiviral drugs used for the treatment and control of ZIKV. PMID:28075376

  12. Effects of exogenous proteases without or with carbohydrases on nutrient digestibility and disappearance of non-starch polysaccharides in broiler chickens

    PubMed Central

    Olukosi, O. A.; Beeson, L. A.; Englyst, K.; Romero, L. F.


    The objective of the current study was to evaluate the effect of a subtilisin protease, without or with inclusion of carbohydrases, on digestibility and retention of energy and protein, as well as the solubilization and disappearance of non-starch polysaccharides (NSP) from corn-soybean meal based diets fed to broiler chickens. Two hundred eighty-eight Ross 308 male broiler chickens were used for the experiment. On d 14, the birds were weighed and allocated to 6 treatments and 8 replicates per treatment with 6 birds per replicate. Treatments were: 1) corn-soybean meal based control diet; 2) control diet plus supplemental protease at 5,000 (P5000) protease units (PU)/kg); 3) control plus 10,000 PU/kg protease (P10000); or control plus an enzyme combination containing xylanase, amylase, and protease (XAP) added to achieve protease activity of: 4) 2,500 PU/kg (XAP2500); 5) 5,000 PU/kg (XAP5000); or 6) 10,000 PU/kg (XAP10000). The enzymes in XAP were combined at fixed ratios of 10:1:25 of xylanase:amylase:protease. Data were analyzed by ANOVA and specific orthogonal contrasts between treatments were performed. Addition of xylanase and amylase increased (P < 0.05) the ileal digestibility of protein by 4.2% and 2.1% at XAP5000 and XAP10000, respectively (relative to P5000 and P10000, respectively), exhibiting a plateau after the XAP5000 dose. Increment (P < 0.05) in AME due to protease was evident, particularly in P10000. At the ileal level, XAP reduced (P < 0.05) the flow of insoluble xylose and arabinose, which indicates an increase in the solubilization of arabinoxylan polymers in the small intestine. Protease on its own reduced (P < 0.05) the flow of insoluble arabinose but did not affect the flow of insoluble xylose. XAP reduced (P < 0.05) the pre-cecal flow of insoluble and total glucose and galactose. It was concluded that whereas protease by itself improved nutrient utilization and increased solubilization of NSP components, at the lower dose, a

  13. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology


    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  14. Synthetic, structural mimetics of the β-hairpin flap of HIV-1 protease inhibit enzyme function.


    Chauhan, Jay; Chen, Shen-En; Fenstermacher, Katherine J; Naser-Tavakolian, Aurash; Reingewertz, Tali; Salmo, Rosene; Lee, Christian; Williams, Emori; Raje, Mithun; Sundberg, Eric; DeStefano, Jeffrey J; Freire, Ernesto; Fletcher, Steven


    Small-molecule mimetics of the β-hairpin flap of HIV-1 protease (HIV-1 PR) were designed based on a 1,4-benzodiazepine scaffold as a strategy to interfere with the flap-flap protein-protein interaction, which functions as a gated mechanism to control access to the active site. Michaelis-Menten kinetics suggested our small-molecules are competitive inhibitors, which indicates the mode of inhibition is through binding the active site or sterically blocking access to the active site and preventing flap closure, as designed. More generally, a new bioactive scaffold for HIV-1PR inhibition has been discovered, with the most potent compound inhibiting the protease with a modest K(i) of 11 μM. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Active Site Characterization of Proteases Sequences from Different Species of Aspergillus.


    Morya, V K; Yadav, Virendra K; Yadav, Sangeeta; Yadav, Dinesh


    A total of 129 proteases sequences comprising 43 serine proteases, 36 aspartic proteases, 24 cysteine protease, 21 metalloproteases, and 05 neutral proteases from different Aspergillus species were analyzed for the catalytically active site residues using MEROPS database and various bioinformatics tools. Different proteases have predominance of variable active site residues. In case of 24 cysteine proteases of Aspergilli, the predominant active site residues observed were Gln193, Cys199, His364, Asn384 while for 43 serine proteases, the active site residues namely Asp164, His193, Asn284, Ser349 and Asp325, His357, Asn454, Ser519 were frequently observed. The analysis of 21 metalloproteases of Aspergilli revealed Glu298 and Glu388, Tyr476 as predominant active site residues. In general, Aspergilli species-specific active site residues were observed for different types of protease sequences analyzed. The phylogenetic analysis of these 129 proteases sequences revealed 14 different clans representing different types of proteases with diverse active site residues.

  16. Burden of Diabetes and First Evidence for the Utility of HbA1c for Diagnosis and Detection of Diabetes in Urban Black South Africans: The Durban Diabetes Study

    PubMed Central

    Hird, Thomas R.; Pirie, Fraser J.; Esterhuizen, Tonya M.; O’Leary, Brian; McCarthy, Mark I.; Young, Elizabeth H.; Sandhu, Manjinder S.; Motala, Ayesha A.


    Objective Glycated haemoglobin (HbA1c) is recommended as an additional tool to glucose-based measures (fasting plasma glucose [FPG] and 2-hour plasma glucose [2PG] during oral glucose tolerance test [OGTT]) for the diagnosis of diabetes; however, its use in sub-Saharan African populations is not established. We assessed prevalence estimates and the diagnosis and detection of diabetes based on OGTT, FPG, and HbA1c in an urban black South African population. Research Design and Methods We conducted a population-based cross-sectional survey using multistage cluster sampling of adults aged ≥18 years in Durban (eThekwini municipality), KwaZulu-Natal. All participants had a 75-g OGTT and HbA1c measurements. Receiver operating characteristic (ROC) analysis was used to assess the overall diagnostic accuracy of HbA1c, using OGTT as the reference, and to determine optimal HbA1c cut-offs. Results Among 1190 participants (851 women, 92.6% response rate), the age-standardised prevalence of diabetes was 12.9% based on OGTT, 11.9% based on FPG, and 13.1% based on HbA1c. In participants without a previous history of diabetes (n = 1077), using OGTT as the reference, an HbA1c ≥48 mmol/mol (6.5%) detected diabetes with 70.3% sensitivity (95%CI 52.7–87.8) and 98.7% specificity (95%CI 97.9–99.4) (AUC 0.94 [95%CI 0.89–1.00]). Additional analyses suggested the optimal HbA1c cut-off for detection of diabetes in this population was 42 mmol/mol (6.0%) (sensitivity 89.2% [95%CI 78.6–99.8], specificity 92.0% [95%CI: 90.3–93.7]). Conclusions In an urban black South African population, we found a high prevalence of diabetes and provide the first evidence for the utility of HbA1c for the diagnosis and detection of diabetes in black Africans in sub-Saharan Africa. PMID:27560687

  17. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam


    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  18. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.


    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  19. Highly potent fibrinolytic serine protease from Streptomyces.


    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi


    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  20. HIV-1 protease inhibitors in development.


    Rusconi, Stefano; La Seta Catamancio, Simona


    Several pharmaceutical companies have developed an increasing number of second generation protease inhibitors (PI) during the last few years. Many of these compounds have been in preclinical trials and some are now in clinical use. All drugs in this category have been designed to be well absorbed and overcome the crucial problem of cross-resistance within this class of compounds. Taking into account the rapid occurrence of PI cross-resistance, clinicians who are treating patients with the HIV-1 infection will need new active PIs in the near future. The clinical and antiviral efficacy of the new molecules versus the older PIs will be investigated through comparative trials that are likely to be completed over the next 12 months. These third-generation PIs currently in development will be the subject of our review.

  1. Mutational analysis of plum pox potyvirus polyprotein processing by the NIa protease in Escherichia coli.


    García, J A; Laín, S; Cervera, M T; Riechmann, J L; Martín, M T


    A binary Escherichia coli expression system has been used to study the pathway for proteolytic processing of the plum pox potyvirus (PPV) polyprotein. Trans cleavage at the carboxyl end of the cylindrical inclusion protein occurred, although with lower efficiency than that at the large nuclear inclusion protein-capsid protein junction. No trans cleavage at the carboxyl end of the small nuclear inclusion protein (NIa) was detected. The proteolytic activities at different cleavage sites of several deletion and point mutations of NIa protein have been analysed. The large delta SX deletion and two different point mutations at His 239 abolished proteolytic activity at all sites. The effect of other mutations, particularly a Glu substitution for Asp 274, depended on the particular cleavage site analysed. The results obtained with the PPV NIa protein mutants were similar to those reported for comparable mutations in the tobacco etch virus 49K protease, despite differences in the sequences recognized for processing. No evident competitive inhibition of the proteolytic activity of PPV NIa protease by the presence of an excess of the different protease mutants could be demonstrated.

  2. Purification and some characteristics of the human epidermal SH-protease inhibitor.


    Järvinen, M


    An inhibitor of papain and other SH-proteases was purified 520-fold from human epidermis extracts by acetone fractionation, heat treatment, papain-Sepharose affinity chromatography, and Sephadex G-50 chromatography. The purified inhibitor had a molecular weight of 12,600 and contained no hexose, as tested by the anthrone reaction. The inhibitor survived in a boiling water bath, in 5% trichloroacetic acid, 20 mM Na3PO4 (pH 12.1) and 4 M NH4OH (pH 11.9). By isoelectric focusing 2 major activity peaks with pI's of 4.6 and 4.8, and a minor peak with a pI of 4.9 was fractioned, and 3 corresponding protein bands were seen after analytical isoelectric focusing. Immunization of rabbits with the purified inhibitor yielded a highly specific anti-inhibitor serum. The purified inhibitor inhibited papain, ficin, human cathepsins B and C, and slightly inhibited bromelain. No inhibition of serine proteases (bovine trypsin and chymotrypsin A, porcine elastase) or an acid protease (human cathepsin D) was observed. Evidence was obtained that the inhibitor formed a complex with both dithiothreitol-activated papain and enzymatically inactive mercuripapain.

  3. Using the SUBcellular database for Arabidopsis proteins to localize the Deg protease family

    PubMed Central

    Tanz, Sandra K.; Castleden, Ian; Hooper, Cornelia M.; Small, Ian; Millar, A. Harvey


    Sub-functionalization during the expansion of gene families in eukaryotes has occurred in part through specific subcellular localization of different family members. To better understand this process in plants, compiled records of large-scale proteomic and fluorescent protein localization datasets can be explored and bioinformatic predictions for protein localization can be used to predict the gaps in experimental data. This process can be followed by targeted experiments to test predictions. The SUBA3 database is a free web-service at that helps users to explore reported experimental data and predictions concerning proteins encoded by gene families and to define the experiments required to locate these homologous sets of proteins. Here we show how SUBA3 can be used to explore the subcellular location of the Deg protease family of ATP-independent serine endopeptidases (Deg1–Deg16). Combined data integration and new experiments refined location information for Deg1 and Deg9, confirmed Deg2, Deg5, and Deg8 in plastids and Deg 15 in peroxisomes and provide substantial experimental evidence for mitochondrial localized Deg proteases. Two of these, Deg3 and Deg10, additionally localized to the plastid, revealing novel dual-targeted Deg proteases in the plastid and the mitochondrion. SUBA3 is continually updated to ensure that researchers can use the latest published data when planning the experimental steps remaining to localize gene family functions. PMID:25161662

  4. TMPRSS12 Is an Activating Protease for Subtype B Avian Metapneumovirus.


    Yun, Bingling; Zhang, Yao; Liu, Yongzhen; Guan, Xiaolu; Wang, Yongqiang; Qi, Xiaole; Cui, Hongyu; Liu, Changjun; Zhang, Yanping; Gao, Honglei; Gao, Li; Li, Kai; Gao, Yulong; Wang, Xiaomei


    The entry of avian metapneumovirus (aMPV) into host cells initially requires the fusion of viral and cell membranes, which is exclusively mediated by fusion (F) protein. Proteolysis of aMPV F protein by endogenous proteases of host cells allows F protein to induce membrane fusion; however, these proteases have not been identified. Here, we provide the first evidence that the transmembrane serine protease TMPRSS12 facilitates the cleavage of subtype B aMPV (aMPV/B) F protein. We found that overexpression of TMPRSS12 enhanced aMPV/B F protein cleavage, F protein fusogenicity, and viral replication. Subsequently, knockdown of TMPRSS12 with specific small interfering RNAs (siRNAs) reduced aMPV/B F protein cleavage, F protein fusogenicity, and viral replication. We also found a cleavage motif in the aMPV/B F protein (amino acids 100 and 101) that was recognized by TMPRSS12. The histidine, aspartic acid, and serine residue (HDS) triad of TMPRSS12 was shown to be essential for the proteolysis of aMPV/B F protein via mutation analysis. Notably, we observed TMPRSS12 mRNA expression in target organs of aMPV/B in chickens. Overall, our results indicate that TMPRSS12 is crucial for aMPV/B F protein proteolysis and aMPV/B infectivity and that TMPRSS12 may serve as a target for novel therapeutics and prophylactics for aMPV.

  5. Salt stress represses production of extracellular proteases in Bacillus pumilus.


    Liu, R F; Huang, C L; Feng, H


    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  6. Screening and characterization of protease producing actinomycetes from marine saltern.


    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva


    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Staphylococcal proteases aid in evasion of the human complement system

    PubMed Central

    Jusko, Monika; Potempa, Jan; Kantyka, Tomasz; Bielecka, Ewa; Miller, Halie K.; Kalinska, Magdalena; Dubin, Grzegorz; Garred, Peter; Shaw, Lindsey N.; Blom, Anna M.


    Staphylococcus aureus is an opportunistic pathogen that presents severe healthcare concerns due to the prevalence of multiple antibiotic resistant strains. New treatment strategies are urgently needed, which requires an understanding of disease causation mechanisms. Complement is one of the first lines of defense against bacterial pathogens, and S. aureus expresses several specific complement inhibitors. The effect of extracellular proteases from this bacterium on complement, however, has been the subject of limited investigation, except for a recent report regarding cleavage of the C3 component by aureolysin. We demonstrate here that four major extracellular proteases of S. aureus are potent complement inhibitors. Incubation of human serum with the cysteine proteases staphopain A and staphopain B, the serine protease V8, and the metalloproteinase aureolysin resulted in a drastic decrease in the haemolytic activity of serum; whereas two serine-protease like enzymes, SplD and SplE, had no effect. These four proteases were found to inhibit all pathways of complement due to the efficient degradation of several crucial components. Furthermore, S. aureus mutants lacking proteolytic enzymes were found to be more efficiently killed in human blood. Taken together, the major proteases of S. aureus appear to be important for pathogen-mediated evasion of the human complement system. PMID:23838186

  8. Exploring a new serine protease from Cucumis sativus L.


    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda


    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  9. Cysteine Protease Inhibitors as Chemotherapy: Lessons from a Parasite Target

    NASA Astrophysics Data System (ADS)

    Selzer, Paul M.; Pingel, Sabine; Hsieh, Ivy; Ugele, Bernhard; Chan, Victor J.; Engel, Juan C.; Bogyo, Matthew; Russell, David G.; Sakanari, Judy A.; McKerrow, James H.


    Papain family cysteine proteases are key factors in the pathogenesis of cancer invasion, arthritis, osteoporosis, and microbial infections. Targeting this enzyme family is therefore one strategy in the development of new chemotherapy for a number of diseases. Little is known, however, about the efficacy, selectivity, and safety of cysteine protease inhibitors in cell culture or in vivo. We now report that specific cysteine protease inhibitors kill Leishmania parasites in vitro, at concentrations that do not overtly affect mammalian host cells. Inhibition of Leishmania cysteine protease activity was accompanied by defects in the parasite's lysosome/endosome compartment resembling those seen in lysosomal storage diseases. Colocalization of anti-protease antibodies with biotinylated surface proteins and accumulation of undigested debris and protease in the flagellar pocket of treated parasites were consistent with a pathway of protease trafficking from flagellar pocket to the lysosome/endosome compartment. The inhibitors were sufficiently absorbed and stable in vivo to ameliorate the pathology associated with a mouse model of Leishmania infection.

  10. Effects of detergents on the West Nile virus protease activity.


    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R


    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  11. Cold-adapted proteases as an emerging class of therapeutics.


    Fornbacke, Marcus; Clarsund, Mats


    Proteases have been used in medicine for several decades and are an established and well tolerated class of therapeutic agent. These proteases were sourced from mammals or bacteria that exist or have adapted to moderate temperatures (mesophilic organisms); however, proteases derived from organisms from cold environments-cold-adapted or psychrophilic proteases-generally have high specific activity, low substrate affinity, and high catalytic rates at low and moderate temperatures. Made possible by greater flexibility, psychrophilic enzymes interact with and transform the substrate at lower energy costs. Cold-adapted proteases have been used in a wide range of applications, including industrial functions, textiles, cleaning/hygiene products, molecular biology, environmental bioremediations, consumer food products, cosmetics, and pharmaceutical production. In addition to these applications, they have also shown promise as therapeutic modalities for cosmeceutical applications (by reducing glabellar [frown] lines) and a number of disease conditions, including bacterial infections (by disrupting biofilms to prevent bacterial infection), topical wound management (when used as a debridement agent to remove necrotic tissue and fibrin clots), oral/dental health management (by removing plaque and preventing periodontal disease), and in viral infections (by reducing the infectivity of viruses, such as human rhinovirus 16 and herpes simplex virus). Psychrophilic proteases with greater activity and stability (than the original organism-derived variant) have been developed; this coupled with available manufacturing recombinant production techniques suggests that cold-adapted proteases have a promising future as a distinct therapeutic class with diverse clinical applications.

  12. Expression and functions of proteases in vascular tissues.


    Petzold, H Earl; Zhao, Mingzhe; Beers, Eric P


    With the emergence of new models for wood formation and the increasing emphasis on improving the efficiency of cellulosic biofuel production, research on vascular tissue biology has intensified in recent years. Some of the most active areas of research focus on manipulating activity of enzymes in the cellulose, hemicellulose, pectin and lignin pathways. In addition, great strides have been made in the characterization of transcriptional networks controlling genes that affect differentiation, secondary cell wall synthesis and programmed cell death in xylem. Less attention has been devoted to the characterization of proteases that may be important regulators of post-translational events that affect vascular cell differentiation and function and cell wall composition. Several genes for proteases and components of the ubiquitin/26S proteasome pathway are upregulated in xylem and phloem and in cell culture systems for studying the differentiation of xylem tracheary elements (TEs). Although small molecule protease inhibitors have been used to explore the roles of proteases during the differentiation of cultured TEs, only a small number of vascular tissue-associated protease genes have been directly tested to determine whether they play roles in vascular tissue biology. In this report, we review roles for proteases in vascular cell differentiation and function as determined through the use of protease inhibitors and genetic analyses and conclude by identifying opportunities for future research in this area. Copyright © Physiologia Plantarum 2011.

  13. A proteomic approach for the discovery of protease substrates.


    Bredemeyer, Andrew J; Lewis, Renate M; Malone, James P; Davis, Alan E; Gross, Julia; Townsend, R Reid; Ley, Timothy J


    Standardized, comprehensive platforms for the discovery of protease substrates have been extremely difficult to create. Screens for protease specificity are now frequently based on the cleavage patterns of peptide substrates, which contain small recognition motifs that are required for the cleavage of the scissile bond within an active site. However, these studies do not identify in vivo substrates, nor can they lead to the definition of the macromolecular features that account for the biological specificity of proteases. To use properly folded proteins in a proteomic screen for protease substrates, we used 2D difference gel electrophoresis and tandem MS to identify substrates of an apoptosis-inducing protease, granzyme B. We confirmed the cleavage of procaspase-3, one of the key substrates of this enzyme, and identified several substrates that were previously unknown, as well as the cleavage site for one of these substrates. We were also able to observe the kinetics of substrate cleavage and cleavage product accumulation by using the 2D difference gel electrophoresis methodology. "Protease proteomics" may therefore represent an important tool for the discovery of the native substrates of a variety of proteases.

  14. Rabbit endogenous retrovirus-H encodes a functional protease.


    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J


    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  15. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.


    Banik, Rathindra Mohan; Prakash, Monika


    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  16. The emerging role of coagulation proteases in kidney disease

    PubMed Central

    Madhusudhan, Thati; Kerlin, Bryce A.; Isermann, Berend


    A role of coagulation proteases in kidney disease beyond their function in normal haemostasis and thrombosis has long been suspected, and studies performed in the past 15 years have provided novel insights into the mechanisms involved. The expression of protease-activated receptors (PARs) in renal cells provides a molecular link between coagulation proteases and renal cell function and revitalizes research evaluating the role of haemostasis regulators in renal disease. Renal cell-specific expression and activity of coagulation proteases, their regulators and their receptors are dynamically altered during disease processes. Furthermore, renal inflammation and tissue remodelling are not only associated, but are causally linked with altered coagulation activation and protease-dependent signalling. Intriguingly, coagulation proteases signal through more than one receptor or induce formation of receptor complexes in a cell-specific manner, emphasizing context specificity. Understanding these cell-specific signalosomes and their regulation in kidney disease is crucial to unravelling the pathophysiological relevance of coagulation regulators in renal disease. In addition, the clinical availability of small molecule targeted anticoagulants as well as the development of PAR antagonists increases the need for in-depth knowledge of the mechanisms through which coagulation proteases might regulate renal physiology. PMID:26592189

  17. Amoebic forms of Blastocystis spp. - evidence for a pathogenic role.


    Rajamanikam, Arutchelvan; Govind, Suresh Kumar


    Blastocystis spp. are one of the most prevalent parasites isolated from patients suffering from diarrhea, flatulence, constipation and vomiting. It's pathogenicity and pathophysiology remains controversial to date. Protease activity and amoebic forms have been reported previously in symptomatic isolates but there has been no conclusive evidence provided to correlate the protease activity and any specific life cycle stage of the parasite thus far. Symptomatic isolates with amoebic form were tested for protease activity and compared with symptomatic and asymptomatic isolates without amoebic form for 10 days culture period. The present study demonstrates an elevated protease activity in cultures having a higher percentage of amoebic forms seen in symptomatic isolates. The growth curve demonstrated a significantly (p < 0.05) higher average number of parasite counts in asymptomatic compared to symptomatic isolates. Symptomatic isolates showed amoebic forms with percentages ranging from 5% to 17%. Elevated protease activity was demonstrated in isolates that had higher percentages of amoebic forms with intense bands at higher molecular weight proteases (60 - 100 kDa). As days of culture proceeded, the protease quantification also showed a steady increase. This study elucidates a correlation between protease activity and percentage of amoebic forms. The finding implies that these forms could play a role in exacerbation of intestinal symptoms during Blastocystis spp. infection.

  18. Amoebic forms of Blastocystis spp. - evidence for a pathogenic role

    PubMed Central


    Background Blastocystis spp. are one of the most prevalent parasites isolated from patients suffering from diarrhea, flatulence, constipation and vomiting. It’s pathogenicity and pathophysiology remains controversial to date. Protease activity and amoebic forms have been reported previously in symptomatic isolates but there has been no conclusive evidence provided to correlate the protease activity and any specific life cycle stage of the parasite thus far. Methods Symptomatic isolates with amoebic form were tested for protease activity and compared with symptomatic and asymptomatic isolates without amoebic form for 10 days culture period. Results The present study demonstrates an elevated protease activity in cultures having a higher percentage of amoebic forms seen in symptomatic isolates. The growth curve demonstrated a significantly (p < 0.05) higher average number of parasite counts in asymptomatic compared to symptomatic isolates. Symptomatic isolates showed amoebic forms with percentages ranging from 5% to 17%. Elevated protease activity was demonstrated in isolates that had higher percentages of amoebic forms with intense bands at higher molecular weight proteases (60 – 100 kDa). As days of culture proceeded, the protease quantification also showed a steady increase. Conclusion This study elucidates a correlation between protease activity and percentage of amoebic forms. The finding implies that these forms could play a role in exacerbation of intestinal symptoms during Blastocystis spp. infection. PMID:24499467

  19. Cleavage and activation of human factor IX by serine proteases

    SciTech Connect

    Enfield, D.L.; Thompson, A.R.


    Human factor IX circulates as a single-chain glycoprotein. Upon activation in vitro, it is cleaved into disulfide-linked light and heavy chains and an activation peptide. After reduction of activated /sup 125/I-factor IX, the heavy and light chains are readily identified by gel electrophoresis. A direct, immunoradiometric assay for factor IXa was developed to assess activation of factor IX for proteases that cleaved it. The assay utilized radiolabeled antithrombin III with heparin to identify the active site and antibodies to distinguish factor IX. After cleavage of factor IX by factor XIa, factor VIIa-tissue thromboplastin complex, or the factor X-activating enzyme from Russell's viper venom, antithrombin III bound readily to factor IXa. Cleavage of /sup 125/I-factor IX by trypsin, chymotrypsin, and granulocyte elastase in the presence of calcium yielded major polypeptide fragments of the sizes of the factor XIa-generated light and heavy chains. When the immunoradiometric assay was used to assess trypsin-cleaved factor IX, the product bound antithrombin III, but not maximally. After digesting with insolubilized trypsin, clotting activity confirmed activation. In evaluating activation of factor IX, physical evidence of activation cleavages does not necessarily correlate with generation of an active site.

  20. Synergistic Defensive Function of Raphides and Protease through the Needle Effect

    PubMed Central

    Konno, Kotaro; Inoue, Takashi A.; Nakamura, Masatoshi


    Raphides, needle-shaped calcium oxalate crystals in tissues of many plants, have been thought to play defensive roles against herbivores without detailed bioassays for their defensive roles and modes of function using purified raphides. In order to examine the defensive roles and modes of function of raphides in a clear experimental system, we performed bioassays giving the larvae of the Eri silkmoth, Samia ricini (Saturniidae), leaves of their host plant, the castor oil plant, Ricinus communis (Euphorbiaceae), painted with the raphides purified from kiwifruits, Actinidia deliciosa (Actinidiaceae), in presence or absence of cysteine protease, which often coincide with raphides in plant tissues. Raphides alone or cysteine protease alone showed only weak defensive activities around experimental concentrations. However, when raphides and cysteine protease coexisted, they synergistically showed very strong growth-reducing activities, and the mortality of caterpillars was very high. In contrast, amorphous calcium oxalate did not show synergism with cysteine protease on defensive activities, indicating that the needle-shape of raphides is essential for the synergism. The present study provides the first clear experimental evidence for the synergism between raphides and other defensive factors. Further, the study suggests that “the needle effect”, which intensify the bioactivities of other bioactive factors by making holes to the barriers (cell membrane, cuticle, epithelium, the nuclear membrane, etc.) and facilitate the bioactive factors to go through them and reach the targets, is important in the defensive activities of raphides, and possibly in the allergy caused by raphides, and in the carcinogenic activities of other needle-shaped components including asbestos and plant derived silica needles. PMID:24621613

  1. Tracking HCV protease population diversity during transmission and susceptibility of founder populations to antiviral therapy

    PubMed Central

    Khera, Tanvi; Todt, Daniel; Vercauteren, Koen; McClure, C. Patrick; Verhoye, Lieven; Farhoudi, Ali; Bhuju, Sabin; Geffers, Robert; Baumert, Thomas F.; Steinmann, Eike; Meuleman, Philip; Pietschmann, Thomas; Brown, Richard J.P.


    Due to the highly restricted species-tropism of Hepatitis C virus (HCV) a limited number of animal models exist for pre-clinical evaluation of vaccines and antiviral compounds. The human-liver chimeric mouse model allows heterologous challenge with clinically relevant strains derived from patients. However, to date, the transmission and longitudinal evolution of founder viral populations in this model have not been characterized in-depth using state-of-the-art sequencing technologies. Focusing on NS3 protease encoding region of the viral genome, mutant spectra in a donor inoculum and individual recipient mice were determined via Illumina sequencing and compared, to determine the effects of transmission on founder viral population complexity. In all transmissions, a genetic bottleneck was observed, although diverse viral populations were transmitted in each case. A low frequency cloud of mutations (<1%) was detectable in the donor inoculum and recipient mice, with single nucleotide variants (SNVs) > 1% restricted to a subset of nucleotides. The population of SNVs >1% was reduced upon transmission while the low frequency SNV cloud remained stable. Fixation of multiple identical synonymous substitutions was apparent in independent transmissions, and no evidence for reversion of T-cell epitopes was observed. In addition, susceptibility of founder populations to antiviral therapy was assessed. Animals were treated with protease inhibitor (PI) monotherapy to track resistance associated substitution (RAS) emergence. Longitudinal analyses revealed a decline in population diversity under therapy, with no detectable RAS >1% prior to therapy commencement. Despite inoculation from a common source and identical therapeutic regimens, unique RAS emergence profiles were identified in different hosts prior to and during therapeutic failure, with complex mutational signatures at protease residues 155, 156 and 168 detected. Together these analyses track viral population complexity at

  2. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    M Salameh; A Soares; D Navaneetham; D Sinha; P Walsh; E Radisky


    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P{sub 1} and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin-APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  3. Conversion of proinsulin to insulin: involvement of a 31,500 molecular weight thiol protease.

    PubMed Central

    Docherty, K; Carroll, R J; Steiner, D F


    A lysed crude secretory granule fraction from rat islets of Langerhans was shown to process endogenous proinsulin to insulin with a pH optimum of 5.0--6.0. The converting activity in the lysed fraction was not inhibited by serine protease inhibitors (diisopropyl fluorophosphate, soybean trypsin inhibitor, and aprotinin) or metalloprotease inhibitors (EDTA and o-phenanthroline) but was inhibited by some thiol protease reagents (p-chloromercuribenzenesulfonic acid, antipain, and leupeptin) but not by others (N-ethylmaleimide and iodoacetamide). N alpha-p-Tosyl-L-lysyl chloromethyl ketone only mildly inhibited at higher concentrations, whereas L-alanyl-L-lysyl-L-arginyl chloromethyl ketone was a powerful inhibitor. L-Alanyl-L-lysyl-L-arginyl chloromethyl ketone was [125I]iodotyrosylated and used as an affinity labeling agent for the converting activity. Because the crude granule preparation contained contaminating lysosomes the affinity labeling of the granule preparation proteins was compared with that in liver lysosomes purified from rats injected with Triton WR1339. In the crude granule fraction the affinity label bound in a cysteine-enhanced manner to a single 31,500 molecular weight protein, but in purified liver lysosomes the major affinity-labeled protein had a molecular weight of 25,000 and minor 31,500 and 35,000 molecular weight proteins were also labeled. Evidence suggests that these proteins are thiol proteases and that in islets the 31,500 molecular weight thiol protease is involved in the conversion of proinsulin to insulin. Images PMID:6750605

  4. Staphylococcus aureus protease: a probe of exposed, non-basic histone sequences in nucleosomes

    SciTech Connect

    Rill, R.L.; Oosterhof, D.K.


    The digestion of histones in chicken erythrocyte nucleosome cores and chromatin by Staphylococcus aureus protease was examined. This protease cleaves specifically at acidic residues and prefers glu-X bonds under the conditions used. Only 1 of 24 glutamic and 2 of 13 aspartic acids among all four core histones are located in basic, amino-terminal tails, hence staph. protease is a highly specific probe of exposed non-basic sequences. Staph. protease readily degraded H1, H5, and H3; moderately degraded H2b, and only slightly degraded H2a and H4 in nucleosomes and nucleosome cores. Electrophoresis of core histone fragments from limited digests showed that most glutamic acids were inaccessible, but at least five sites in non-basic sequences were readily cleaved. Tentative assignments of these fragments based on comparisons with products from limited digests of pure histones suggested that most accessible sites in nucleosome cores occur in H3. The most probable sites of H3 cutting are glutamic acids at positions 51, 60, 73, 94, and 97. At least one site in H2b, probably the equivalent of glu-105 in the calf H2b sequence, was accessible. No sites in H2a and H4 appeared highly accessible. H5 was readily cleaved at a site near the amino-terminus. These data substantiate the other evidence that non-basic core histone sequences are located primarily in the nucleosome interior, but that H3 binds to the ends of core DNA and thereby is partly exposed as the upper and lower surfaces of the disk-shaped core.

  5. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    Salameh, M.A.; Soares, A.; Navaneetham, D.; Sinha, D.; Walsh, P. N.; Radisky, E. S.


    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P1 and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin {center_dot} APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  6. Sweet potato cysteine proteases SPAE and SPCP2 participate in sporamin degradation during storage root sprouting.


    Chen, Hsien-Jung; Liang, Shu-Hao; Huang, Guan-Jhong; Lin, Yaw-Huei


    Sweet potato sporamins are trypsin inhibitors and exhibit strong resistance to digestion by pepsin, trypsin and chymotrypsin. In addition, they constitute the major storage proteins in the sweet potato and, after degradation, provide nitrogen as a nutrient for seedling regrowth in sprouting storage roots. In this report, four cysteine proteases-one asparaginyl endopeptidase (SPAE), two papain-like cysteine proteases (SPCP1 and SPCP2), and one granulin-containing cysteine protease (SPCP3)-were studied to determine their association with sporamin degradation in sprouting storage roots. Sporamin degradation became significant in the flesh of storage roots starting from week 4 after sprouting and this correlated with expression levels of SPAE and SPCP2, but not of SPCP1 and SPCP3. In the outer flesh near the skin, sporamin degradation was more evident and occurred earlier than in the inner flesh of storage roots. Degradation of sporamins in the outer flesh was inversely correlated with the distance of the storage root from the sprout. Exogenous application of SPAE and SPCP2, but not SPCP3, fusion proteins to crude extracts of the outer flesh (i.e., extracted from a depth of 0.3cm and within 2cm of one-week-old sprouts) promoted in vitro sporamin degradation in a dose-dependent manner. Pre-treatment of SPAE and SPCP2 fusion proteins at 95°C for 5min prior to their application to the crude extracts reduced sporamin degradation. These data show that sweet potato asparaginyl endopeptidase SPAE and papain-like cysteine protease SPCP2 participate in sporamin degradation during storage root sprouting.

  7. Cowpea bruchid Callosobruchus maculatus counteracts dietary protease inhibitors by modulating propeptides of major digestive enzymes.


    Ahn, J-E; Lovingshimer, M R; Salzman, R A; Presnail, J K; Lu, A L; Koiwa, H; Zhu-Salzman, K


    Cowpea bruchids, when challenged by consumption of the soybean cysteine protease inhibitor scN, reconfigure expression of their major CmCP digestive proteases and resume normal feeding and development. Previous evidence indicated that insects selectively induced CmCPs from subfamily B, that were more efficient in autoprocessing and possessed not only higher proteolytic, but also scN-degrading activities. In contrast, dietary scN only marginally up-regulated genes from the more predominant CmCP subfamily A that were inferior to subfamily B. To gain further molecular insight into this adaptive adjustment, we performed domain swapping between the two respective subfamily members B1 and A16, the latter unable to autoprocess or degrade scN even after intermolecular processing. Swapping the propeptides did not qualitatively alter autoprocessing in either protease isoform. Incorporation of either the N- (pAmBA) or C-terminal (pAmAB) mature B1 segment into A16, however, was sufficient to prime autoprocessing of A16 to its mature form. Further, the swap at the N-terminal mature A16 protein region (pAmBA) resulted in four amino acid changes. Replacement of these amino acid residues by the corresponding B1 residues, singly and pair-wise, revealed that autoprocessing activation in pAmBA resulted from cumulative and/or coordinated individual effects. Bacterially expressed isolated propeptides (pA16 and pB1) differed in their ability to inhibit mature B1 enzyme. Lower inhibitory activity in pB1 is likely attributable to its lack of protein stability. This instability in the cleaved propeptide is necessary, although insufficient by itself, for scN-degradation by the mature B1 enzyme. Taken together, cowpea bruchids modulate proteolysis of their digestive enzymes by controlling proCmCP cleavage and propeptide stability, which explains at least in part the plasticity cowpea bruchids demonstrate in response to protease inhibitors.

  8. Spatially dependent activation of the patterning protease, Easter.


    LeMosy, Ellen K


    The dorsoventral axis of the Drosophila embryo is established by the activating cleavage of a signaling ligand by a serine protease, Easter, only on the ventral side of the embryo. Easter is the final protease in a serine protease cascade in which initial reaction steps appear not to be ventrally restricted, but where Easter activity is promoted ventrally through the action of a spatial cue at an unknown step in the pathway. Here, biochemical studies demonstrate that this spatial control occurs at or above the level of Easter zymogen activation, rather than through direct promotion of Easter's catalytic activity against the signaling ligand.

  9. [The extracellular proteases of the phytopathogenic bacterium Xanthomonas campestris].


    Kalashnikova, E E; Chernyshova, M P; Ignatov, V V


    The culture liquids of three Xanthomonas campestris pv. campestris strains were found to possess proteolytic activity. The culture liquid of strain B-611 with the highest proteolytic activity was fractionated by salting-out with ammonium sulfate, gel filtration, and ion-exchange chromatography. The electrophoretic analysis of active fractions showed the presence of two proteases in the culture liquid of strain B-611, the major of which being serine protease. The treatment of cabbage seedlings with the proteases augmented the activity of peroxidase in the cabbage roots by 28%.

  10. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.


    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel


    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  11. Identification of cysteine protease inhibitors that belong to cystatin family 1 in the cellular slime mold Dictyostelium discoideum.


    El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi


    Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.

  12. A Bacillus anthracis strain deleted for six proteases serves as an effective host for production of recombinant proteins.


    Pomerantsev, Andrei P; Pomerantseva, Olga M; Moayeri, Mahtab; Fattah, Rasem; Tallant, Cynthia; Leppla, Stephen H


    Bacillus anthracis produces a number of extracellular proteases that impact the integrity and yield of other proteins in the B. anthracis secretome. In this study we show that anthrolysin O (ALO) and the three anthrax toxin proteins, protective antigen (PA), lethal factor (LF), and edema factor (EF), produced from the B. anthracis Ames 35 strain (pXO1⁺, pXO2⁻), are completely degraded at the onset of stationary phase due to the action of proteases. An improved Cre-loxP gene knockout system was used to sequentially delete the genes encoding six proteases (InhA1, InhA2, camelysin, TasA, NprB, and MmpZ). The role of each protease in degradation of the B. anthracis toxin components and ALO was demonstrated. Levels of the anthrax toxin components and ALO in the supernatant of the sporulation defective, pXO1⁺ A35HMS mutant strain deleted for the six proteases were significantly increased and remained stable over 24 h. A pXO1-free variant of this six-protease mutant strain, designated BH460, provides an improved host strain for the preparation of recombinant proteins. As an example, BH460 was used to produce recombinant EF, which previously has been difficult to obtain from B. anthracis. The EF protein produced from BH460 had the highest in vivo potency of any EF previously purified from B. anthracis or Escherichia coli hosts. BH460 is recommended as an effective host strain for recombinant protein production, typically yielding greater than 10mg pure protein per liter of culture.

  13. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.


    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  14. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.


    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  15. Genome-wide identification and structure-function studies of proteases and protease inhibitors in Cicer arietinum (chickpea).


    Sharma, Ranu; Suresh, C G


    Proteases are a family of enzymes present in almost all living organisms. In plants they are involved in many biological processes requiring stress response in situations such as water deficiency, pathogen attack, maintaining protein content of the cell, programmed cell death, senescence, reproduction and many more. Similarly, protease inhibitors (PIs) are involved in various important functions like suppression of invasion by pathogenic nematodes, inhibition of spores-germination and mycelium growth of Alternaria alternata and response to wounding and fungal attack. As much as we know, no genome-wide study of proteases together with proteinaceous PIs is reported in any of the sequenced genomes till now. Phylogenetic studies and domain analysis of proteases were carried out to understand the molecular evolution as well as gene and protein features. Structural analysis was carried out to explore the binding mode and affinity of PIs for cognate proteases and prolyl oligopeptidase protease with inhibitor ligand. In the study reported here, a significant number of proteases and PIs were identified in chickpea genome. The gene expression profiles of proteases and PIs in five different plant tissues revealed a differential expression pattern in more than one plant tissue. Molecular dynamics studies revealed the formation of stable complex owing to increased number of protein-ligand and inter and intramolecular protein-protein hydrogen bonds. The genome-wide identification, characterization, evolutionary understanding, gene expression, and structural analysis of proteases and PIs provide a framework for future analysis when defining their roles in stress response and developing a more stress tolerant variety of chickpea. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Zebra chip disease decreases tuber (Solanum tuberosum L.) protein content by attenuating protease inhibitor levels and increasing protease activities.


    Kumar, G N Mohan; Knowles, Lisa O; Knowles, N Richard


    Zebra chip disease of potato decreases protease inhibitor levels resulting in enhanced serine-type protease activity, decreased protein content and altered protein profiles of fully mature tubers. Zebra-chip (ZC), caused by Candidatus Liberibacter solanacearum (CLso), is a relatively new disease of potato that negatively affects growth, yield, propagation potential, and fresh and process qualities of tubers. Diseased plants produce tubers with characteristic brown discoloration of vascular tissue accompanied by elevated levels of free amino acids and reducing sugars. Here we demonstrate that ZC disease induces selective protein catabolism in tubers through modulating protease inhibitor levels. Soluble protein content of tubers from CLso-infected plants was 33% lower than from non-infected plants and electrophoretic analyses revealed substantial reductions in major tuber proteins. Patatin (~40 kDa) and ser-, asp- (22 kDa) and cys-type (85 kDa) protease inhibitors were either absent or greatly reduced in ZC-afflicted tubers. In contrast to healthy (non-infected) tubers, the proteolytic activity in CLso infected tubers was high and the ability of extracts from infected tubers to inhibit trypsin (ser-type) and papain (cys-type) proteases greatly attenuated. Moreover, extracts from CLso-infected tubers rapidly catabolized proteins purified from healthy tubers (40 kDa patatin, 22 kDa protease inhibitors, 85 kDa potato multicystatin) when subjected to proteolysis individually. In contrast, crude extracts from non-infected tubers effectively inhibited the proteolytic activity from ZC-afflicted tubers. These results suggest that the altered protein profile of ZC afflicted tubers is largely due to loss of ser- and cys-type protease inhibitors. Further analysis revealed a novel PMSF-sensitive (ser) protease (ca. 80-120 kDa) in CLso infected tubers. PMSF abolished the proteolytic activities responsible for degrading patatin, the 22 kDa protease inhibitor(s) and potato

  17. Improving Viral Protease Inhibitors to Counter Drug Resistance

    PubMed Central

    Yilmaz, Nese Kurt; Swanstrom, Ronald; Schiffer, Celia A.


    Drug resistance is a major problem in health care, undermining therapy outcomes and necessitating novel approaches to drug design. Extensive studies on resistance to viral protease inhibitors, particularly those of HIV-1 and hepatitis C virus (HCV) protease, revealed a plethora of information on the structural and molecular mechanisms underlying resistance. These insights led to several strategies to improve viral protease inhibitors to counter resistance, such as exploiting the essential biological function and leveraging evolutionary constraints. Incorporation of these strategies into structure-based drug design can minimize vulnerability to resistance, not only for viral proteases but for other quickly evolving drug targets as well, toward designing inhibitors one step ahead of evolution to counter resistance with more intelligent and rational design. PMID:27090931

  18. Synergism of Selective Tumor Vascular Thrombosis and Protease Activated Prodrug

    DTIC Science & Technology


    Such a cytotoxin can be aldesleukin, 5- aminolevulinic acid, bleomycin sulfate, camptothecin, carboplatin, carmustine, cisplatin, cladribine, lyophilized... aminolevulinic acid, protoporphyrin IX, taxol or paclitaxel. In one embodiment, the prodrug is activated by asparaginyl proteases (e.g., legumain) and

  19. Inhibition of activity of the protease from bovine leukemia virus.


    Ménard, A; Leonard, R; Llido, S; Geoffre, S; Picard, P; Berteau, F; Precigoux, G; Hospital, M; Guillemain, B


    In view of the close similarity between bovine leukemia virus (BLV) and human T-cell leukemia virus type I (HTLV-I) we investigated the possibility of developing specific inhibitors of the proteases of these retroviruses using the purified enzyme from BLV. We tested the ability of this protease to specifically cleave various short oligopeptide substrates containing cleavage sites of BLV and HTLV-I proteases, as well as a recombinant BLV Gag precursor. The best substrate, a synthetic decapeptide bearing the natural cleavage site between the matrix and the capsid proteins of BLV Gag precursor polyprotein, was used to develop an inhibition assay. We determined the relative inhibitory effect of synthetic Gag precursor-like peptides in which the cleavable site was replaced by a non-hydrolyzable moiety. The encouraging inhibitory effect of these compounds indicates that potent non-peptidic inhibitors for retroviral proteases are not unattainable.

  20. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W


    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  1. Evaluation of trypanocidal activity of combinations of anti-sleeping sickness drugs with cysteine protease inhibitors.


    Steverding, Dietmar


    Chemotherapy of human African trypanosomiasis (HAT) is unsatisfactory because only a few drugs, with serious side effects and poor efficacy, are available. As drug combination regimes often achieve greater therapeutic efficacy than monotherapies, here the trypanocidal activity of the cysteine protease inhibitor K11777 in combination with current anti-HAT drugs using bloodstream forms of Trypanosoma brucei was investigated. Isobolographic analysis was used to determine the interaction between cysteine protease inhibitors (K11777, CA-074Me and CAA0225) and anti-HAT drugs (suramin, pentamidine, melarsoprol and eflornithine). Bloodstream forms of T. brucei were incubated in culture medium containing cysteine protease inhibitors or anti-HAT drugs alone or in combination at a 1:1 fixed-dose ratio. After 48 h incubation, live cells were counted, the 50% growth inhibition values determined and combination indices calculated. The general cytotoxicity of drug combinations was evaluated with human leukaemia HL-60 cells. Combinations of K11777 with suramin, pentamidine and melarsoprol showed antagonistic effects while with eflornithine a synergistic effect was observed. Whereas eflornithine antagonises with CA-074Me, an inhibitor inactivating the targeted TbCATL only under reducing conditions, it synergises with CAA0255, an inhibitor structurally related to CA-074Me which inactivates TbCATL independently of thiols. These findings indicate an essential role of thiols for the synergistic interaction between K11777 and eflornithine. Encouragingly, the K11777/eflornithine combination displayed higher trypanocidal than cytotoxic activity. The results of this study suggest that the combination of the cysteine protease inhibitor K11777 and eflornithine display promising synergistic trypanocidal activity that warrants further investigation of the drug combination as possible alternative treatment of HAT.

  2. Activity of purified hepatitis C virus protease NS3 on peptide substrates.

    PubMed Central

    Steinkühler, C; Urbani, A; Tomei, L; Biasiol, G; Sardana, M; Bianchi, E; Pessi, A; De Francesco, R


    The protease domain of the hepatitis C virus (HCV) protein NS3 was expressed in Escherichia coli, purified to homogeneity, and shown to be active on peptides derived from the sequence of the NS4A-NS4B junction. Experiments were carried out to optimize protease activity. Buffer requirements included the presence of detergent, glycerol, and dithiothreitol, pH between 7.5 and 8.5, and low ionic strength. C- and N-terminal deletion experiments defined a peptide spanning from the P6 to the P4' residue as a suitable substrate. Cleavage kinetics were subsequently measured by using decamer P6-P4' peptides corresponding to all intermolecular cleavage sites of the HCV polyprotein. The following order of cleavage efficiency, in terms of kcat/Km, was determined: NS5A-NS5B > NS4A-NS4B >> NS4B-NS5A. A 14-mer peptide containing residues 21 to 34 of the protease cofactor NS4A (Pep4A 21-34), when added in stoichiometric amounts, was shown to increase cleavage rates of all peptides, the largest effect (100-fold) being observed on the hydrolysis of the NS4B-NS5A decamer. From the kinetic analysis of cleavage data, we conclude that (i) primary structure is an important determinant of the efficiency with which each site is cleaved during polyprotein processing, (ii) slow cleavage of the NS4B-NS5A site in the absence of NS4A is due to low binding affinity of the enzyme for this site, and (iii) formation of a 1:1 complex between the protease and Pep4A 21-34 is sufficient and required for maximum activation. PMID:8794305

  3. Purification and characterization of alpha 1-antichymotrypsin-like protease inhibitor that regulates prohormone thiol protease involved in enkephalin precursor processing.


    Hook, V Y; Purviance, R T; Azaryan, A V; Hubbard, G; Krieger, T J


    Evidence is presented showing that alpha 1-antichymotrypsin (ACT) inhibits a novel prohormone thiol protease (PTP) involved in processing the enkephalin precursor. Colocalization of ACT immunoreactivity with PTP within isolated secretory vesicles of bovine adrenal medulla and pituitary indicated that endogenous ACT could regulate PTP in vivo. The endogenous 60 kDa bovine ACT (bACT)-like protein was purified from pituitary by chromatography on DEAE-Sepharose, chromatofocusing, butyl-Sepharose, and Sephacryl S-200. Characterization showed that the bACT-like protein was a potent inhibitor of PTP (Ki,app value of 2.2 nM) as well as an effective inhibitor of chymotrypsin (Ki,app value of 2.3 nM). Furthermore, the bACT-like protein formed sodium dodecyl sulfate-stable complexes with chymotrypsin, which is typical of serpin protease inhibitors. Importantly, PTP formed sodium dodecyl sulfate-stable complexes with human ACT, suggesting that PTP's cleavage specificity may resemble the reactive center of ACT. PTP cleavage of enkephalin-containing peptides at the NH2-terminal side of paired basic residues (Lys-Arg, Arg-Arg, Lys-Lys), flanking the COOH terminus of (Met)enkephalin (Tyr-Gly-GLy-Phe-Met), indicates methionine at the P1 position. PTP cleavage of peptide-methylcoumarin amide and peptide-p-nitroanilide substrates demonstrated specificity for paired basic and monobasic residues, as well as a role for methionine in PTP's cleavage site. These results showing PTP's ability for processing at a methionine residue which resembles the P1 specificity of ACT are compatible with inhibition of PTP by ACT. These findings are the first demonstration of the involvement of a protease inhibitor in neuropeptide precursor processing. The known developmental regulation of ACT in brain and significant amounts of ACT in amyloid plaques of Alzheimer's disease suggest a possible role for PTP in the maturation of peptidergic neurons.

  4. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.


    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  5. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan


    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  6. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology



  7. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.


    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N


    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  8. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F


    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  9. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.


    Usha, R; Singh, M


    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  10. The roles of intramembrane proteases in protozoan parasites.


    Sibley, L David


    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Protease inhibitors and proteolytic signalling cascades in insects.


    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane


    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  12. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.


    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A


    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  13. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael


    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  14. Phenotypic Analysis of Mice Lacking the Tmprss2-Encoded Protease

    PubMed Central

    Kim, Tom S.; Heinlein, Cynthia; Hackman, Robert C.; Nelson, Peter S.


    Tmprss2 encodes an androgen-regulated type II transmembrane serine protease (TTSP) expressed highly in normal prostate epithelium and has been implicated in prostate carcinogenesis. Although in vitro studies suggest protease-activated receptor 2 may be a substrate for TMPRSS2, the in vivo biological activities of TMPRSS2 remain unknown. We generated Tmprss2−/− mice by disrupting the serine protease domain through homologous recombination. Compared to wild-type littermates, Tmprss2−/− mice developed normally, survived to adulthood with no differences in protein levels of prostatic secretions, and exhibited no discernible abnormalities in organ histology or function. Loss of TMPRSS2 serine protease activity did not influence fertility, reduce survival, result in prostate hyperplasia or carcinoma, or alter prostatic luminal epithelial cell regrowth following castration and androgen replacement. Lack of an observable phenotype in Tmprss2−/− mice was not due to transcriptional compensation by closely related Tmprss2 homologs. We conclude that the lack of a discernible phenotype in Tmprss2−/− mice suggests functional redundancy involving one or more of the type II transmembrane serine protease family members or other serine proteases. Alternatively, TMPRSS2 may contribute a specialized but nonvital function that is apparent only in the context of stress, disease, or other systemic perturbation. PMID:16428450

  15. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli


    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  16. Phage display as a powerful tool to engineer protease inhibitors.


    Zani, Marie-Louise; Moreau, Thierry


    Since its introduction by Georges Smith some 25 years ago, phage display has proved to be a powerful molecular technique for selecting proteins with desired biological properties from huge libraries. Early on, various protease inhibitor scaffolds were displayed at the surface of filamentous phages to select new inhibitors with shifted specificities and enhanced affinities towards one or more target protease(s). The past two decades have seen a number of natural protease inhibitors subjected to phage display, mostly to shift and increase their inhibitory specificity, but also to explore the molecular mechanisms by which they interact with their cognate enzymes with low or very high selectivity. This review focuses on the major uses of phage display in the field of protein protease inhibitors. The exquisite molecular mechanisms by which natural protease inhibitors prevent unwanted or excessive proteolysis in cells and tissues are also examined along with some of the general principles underlying the way phage display is applied to these molecules. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  17. Characterizing Protease Specificity: How Many Substrates Do We Need?


    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R


    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  18. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha


    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  19. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya


    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  20. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane


    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  1. Bioinformatics perspective on rhomboid intramembrane protease evolution and function.


    Kinch, Lisa N; Grishin, Nick V


    Endopeptidase classification based on catalytic mechanism and evolutionary history has proven to be invaluable to the study of proteolytic enzymes. Such general mechanistic- and evolutionary- based groupings have launched experimental investigations, because knowledge gained for one family member tends to apply to the other closely related enzymes. The serine endopeptidases represent one of the most abundant and diverse groups, with their apparently successful proteolytic mechanism having arisen independently many times throughout evolution, giving rise to the well-studied soluble chemotrypsins and subtilisins, among many others. A large and diverse family of polytopic transmembrane proteins known as rhomboids has also evolved the serine protease mechanism. While the spatial structure, mechanism, and biochemical function of this family as intramembrane proteases has been established, the cellular roles of these enzymes as well as their natural substrates remain largely undetermined. While the evolutionary history of rhomboid proteases has been debated, sorting out the relationships among current day representatives should provide a solid basis for narrowing the knowledge gap between their biochemical and cellular functions. Indeed, some functional characteristics of rhomboid proteases can be gleaned from their evolutionary relationships. Finally, a specific case where phylogenetic profile analysis has identified proteins that contain a C-terminal processing motif (GlyGly-Cterm) as co-occurring with a set of bacterial rhomboid proteases provides an example of potential target identification through bioinformatics. This article is part of a Special Issue entitled: Intramembrane Proteases. © 2013.

  2. Mixture-based peptide libraries for identifying protease cleavage motifs.


    Turk, Benjamin E


    All proteases and peptidases are to some extent sequence-specific, in that one or more residues are preferred at particular positions surrounding the cleavage site in substrates. I describe here a general protocol for determining protease cleavage site preferences using mixture-based peptide libraries. Initially a completely random, amino-terminally capped peptide mixture is digested with the protease of interest, and the cleavage products are analyzed by automated Edman sequencing. The distribution of amino acids found in each sequencing cycle indicates which residues are preferred by the protease at positions downstream of the cleavage site. On the basis of these results, a second peptide library is designed that is partially degenerate and partially fixed sequence. Edman sequencing analysis of the cleavage products of this peptide mixture provides preferences amino-terminal to the scissile bond. As necessary, the process is reiterated until the full cleavage motif of the protease is known. Cleavage specificity data obtained with this method have been used to generate specific and efficient peptide substrates, to design potent and specific inhibitors, and to identify novel protease substrates.

  3. Direct Visualization of Protease Action on Collagen Triple Helical Structure

    PubMed Central

    Rosenblum, Gabriel; Van den Steen, Philippe E.; Cohen, Sidney R.; Bitler, Arkady; Brand, David D.; Opdenakker, Ghislain; Sagi, Irit


    Enzymatic processing of extracellular matrix (ECM) macromolecules by matrix metalloproteases (MMPs) is crucial in mediating physiological and pathological cell processes. However, the molecular mechanisms leading to effective physiological enzyme-ECM interactions remain elusive. Only scant information is available on the mode by which matrix proteases degrade ECM substrates. An example is the enzymatic degradation of triple helical collagen II fragments, generated by the collagenase MMP-8 cleavage, during the course of acute inflammatory conditions by gelatinase B/MMP-9. As is the case for many other matrix proteases, it is not clear how MMP-9 recognizes, binds and digests collagen in this important physiological process. We used single molecule imaging to directly visualize this protease during its interaction with collagen fragments. We show that the initial binding is mediated by the diffusion of the protease along the ordered helix on the collagen ¾ fragment, with preferential binding of the collagen tail. As the reaction progressed and prior to collagen degradation, gelatin-like morphologies resulting from the denaturation of the triple helical collagen were observed. Remarkably, this activity was independent of enzyme proteolysis and was accompanied by significant conformational changes of the working protease. Here we provide the first direct visualization of highly complex mechanisms of macromolecular interactions governing the enzymatic processing of ECM substrates by physiological protease. PMID:20585385

  4. Rapid enzymatic test for phenotypic HIV protease drug resistance.


    Hoffmann, Dieter; Assfalg-Machleidt, Irmgard; Nitschko, Hans; von der Helm, Klaus; Koszinowski, Ulrich; Machleidt, Werner


    A phenotypic resistance test based on recombinant expression of the active HIV protease in E. coli from patient blood samples was developed. The protease is purified in a rapid one-step procedure as active enzyme and tested for inhibition by five selected synthetic inhibitors (amprenavir, indinavir, nelfinavir, ritonavir, and saquinavir) used presently for chemotherapy of HIV-infected patients. The HPLC system used in a previous approach was replaced by a continuous fluorogenic assay suitable for high-throughput screening on microtiter plates. This reduces significantly the total assay time and allows the determination of inhibition constants (Ki). The Michaelis constant (Km) and the inhibition constant (Ki) of recombinant wild-type protease agree well with published data for cloned HIV protease. The enzymatic test was evaluated with recombinant HIV protease derived from eight HIV-positive patients scored from 'sensitive' to 'highly resistant' according to mutations detected by genotypic analysis. The measured Ki values correlate well with the genotypic resistance scores, but allow a higher degree of differentiation. The non-infectious assay enables a more rapid yet sensitive detection of HIV protease resistance than other phenotypic assays.

  5. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.


    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  6. Purification and Properties of Mucor pusillus Acid Protease1

    PubMed Central

    Somkuti, G. A.; Babel, F. J.


    The protease produced by Mucor pusillus was recovered from a wheat bran medium by treatment with ammonium sulfate, ethyl alcohol, gel filtration and ion-exchange chromatography. The yield of the enzyme was 55%. The overall increase in the specific activity of the protease was 34-fold. The purified protease was most active at pH 3.8 and 5.6 against hemoglobin and casein, respectively. Optimal hydrolysis of casein was observed at 55 C. The enzyme was stable from pH 3.0 to 6.0. Enzyme inactivated by metal ions was reactivated by ethylenediaminetetraacetate and o-phenanthroline. Reducing agents and thiol poisons had no effect on the protease, suggesting that free sulfhydryl groups were not required for enzyme activity. Diisopropyl fluorophosphate did not inhibit the protease, indicating the probable absence of serine in the active center. The Michaelis-Menten constant for casein was 0.357%. Electrophoretic analysis of active protein recovered by ion-exchange chromatography showed that the protease preparation was homogeneous. Images PMID:5646628

  7. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.


    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan


    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  8. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.


    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo


    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  9. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  10. Protease production by different thermophilic fungi.


    Macchione, Mariana M; Merheb, Carolina W; Gomes, Eleni; da Silva, Roberto


    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi--Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37--using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  11. Fluoride Does Not Inhibit Enamel Protease Activity

    PubMed Central

    Tye, C.E.; Antone, J.V.; Bartlett, J.D.


    Fluorosed enamel can be porous, mottled, discolored, hypomineralized, and protein-rich if the enamel matrix is not completely removed. Proteolytic processing by matrix metalloproteinase-20 (MMP20) and kallikrein-4 (KLK4) is critical for enamel formation, and homozygous mutation of either protease results in hypomineralized, protein-rich enamel. Herein, we demonstrate that the lysosomal proteinase cathepsin K is expressed in the enamel organ in a developmentally defined manner that suggests a role for cathepsin K in degrading re-absorbed enamel matrix proteins. We therefore asked if fluoride directly inhibits the activity of MMP20, KLK4, dipeptidyl peptidase I (DPPI) (an in vitro activator of KLK4), or cathepsin K. Enzyme kinetics were studied with quenched fluorescent peptides with purified enzyme in the presence of 0–10 mM NaF, and data were fit to Michaelis-Menten curves. Increasing concentrations of known inhibitors showed decreases in enzyme activity. However, concentrations of up to 10 mM NaF had no effect on KLK4, MMP20, DPPI, or cathepsin K activity. Our results show that fluoride does not directly inhibit enamel proteolytic activity. PMID:21118795

  12. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).


    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia


    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  13. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.


    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen


    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  14. Streptococcus agalactiae CspA is a serine protease that inactivates chemokines.


    Bryan, Joshua D; Shelver, Daniel W


    Streptococcus agalactiae (group B Streptococcus [GBS]) remains a leading cause of invasive infections in neonates and has emerged as a pathogen of the immunocompromised and elderly populations. The virulence mechanisms of GBS are relatively understudied and are still poorly understood. Previous evidence indicated that the GBS cspA gene is necessary for full virulence and the cleavage of fibrinogen. The predicted cspA product displays homology to members of the extracellular cell envelope protease family. CXC chemokines, many of which can recruit neutrophils to sites of infection, are important signaling peptides of the immune system. In this study, we purified CspA and demonstrated that it readily cleaved the CXC chemokines GRO-alpha, GRO-beta, GRO-gamma, neutrophil-activating peptide 2 (NAP-2), and granulocyte chemotactic protein 2 (GCP-2) but did not cleave interleukin-8. CspA did not cleave a panel of other test substrates, suggesting that it possesses a certain degree of specificity. CXC chemokines also underwent cleavage by whole GBS cells in a cspA-dependent manner. CspA abolished the abilities of three representative CXC chemokines, GRO-gamma, NAP-2, and GCP-2, to attract and activate neutrophils. Genetic and biochemical evidence indicated that CspA is a serine protease with S575 at its active site. D180 was also implicated as part of the signature serine protease catalytic triad, and both S575 and D180 were required for both N-terminal and C-terminal autocatalytic processing of CspA.

  15. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine


    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  16. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.


    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal


    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  17. Efficacy of protease inhibitor from marine Streptomyces sp. VITBVK2 against Leishmania donovani - An in vitro study.


    Sreedharan, Veena; Bhaskara Rao, K V


    In the present study the leishmanicidal effect of potential protease inhibitor producing marine actinobacterial isolate has been investigated against Leishmania donovani, the causative agent of visceral leishmaniasis. Among 89 marine actinobacteria isolated from a salt pan in Kanyakumari, only one isolate (BVK2) showed 97% of protease inhibition activity against trypsin. Moderate to high protease inhibitor activity was shown by isolate BVK2 on proteinase (30%) and chymotrypsin (85%). In optimization study for protease inhibitor production glucose as carbon source and casein as nitrogen source showed the best activity. In the in-vitro Fluorescence-activated cell sorting (FACS) assay, 100 μg/ml of BVK2 extract was active against amastigotes in infected J774A.1 macrophages and showed 87% of parasitic inhibition. The isolate BVK2 showed significant anti-parasitic activity with an IC50 of 27.1 μg/ml after double doses were administered. The potential isolate was identified by molecular 16S rRNA gene sequencing as Streptomyces sp. VITBVK2. The results obtained suggest that the marine actinobacterial extract which have novel metabolites can be considered as a potential source for the development of drugs.

  18. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.


    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K


    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  19. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central


    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  20. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush


    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  1. HIV-1 protease-induced apoptosis

    PubMed Central


    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  2. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.


    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan


    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  3. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.


    Johnston, David B; McAloon, Andrew J


    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  4. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang


    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  5. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.


    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  6. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.


    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R


    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  7. Stress Conditions Increase Vimentin Cleavage by Omi/HtrA2 Protease in Human Primary Neurons and Differentiated Neuroblastoma Cells.


    Lucotte, Bérangère; Tajhizi, Mehdi; Alkhatib, Dareen; Samuelsson, Eva-Britt; Wiehager, Birgitta; Schedin-Weiss, Sophia; Sundström, Erik; Winblad, Bengt; Tjernberg, Lars O; Behbahani, Homira


    Dysfunctional Omi/HtrA2, a mitochondrial serine protease, has been implicated in various neurodegenerative disorders. Despite the wealth of evidence on the roles of Omi/HtrA2 in apoptosis, little is known about its cytosolic targets, the cleavage of which could account for the observed morphological changes such as cytoskeletal reorganizations in axons. By proteomic analysis, vimentin was identified as a substrate for Omi/HtrA2 and we have reported increased Omi/HtrA2 protease activity in Alzheimer disease (AD) brain. Here, we investigated a possible link between Omi/HtrA2 and vimentin cleavage, and consequence of this cleavage on mitochondrial distribution in neurons. In vitro protease assays showed vimentin to be cleaved by Omi/HtrA2 protease, and proximity ligation assay demonstrated an increased interaction between Omi/HtrA2 and vimentin in human primary neurons upon stress stimuli. Using differentiated neuroblastoma SH-SY5Y cells, we showed that Omi/HtrA2 under several different stress conditions induces cleavage of vimentin in wild-type as well as SH-SY5Y cells transfected with amyloid precursor protein with the Alzheimer disease-associated Swedish mutation. After stress treatment, inhibition of Omi/HtrA2 protease activity by the Omi/HtrA2 specific inhibitor, Ucf-101, reduced the cleavage of vimentin in wild-type cells. Following altered vimentin filaments integrity by stress stimuli, mitochondria was redistributed in differentiated SH-SY5Y cells and human primary neurons. In summary, the findings outlined in this paper suggest a role of Omi/HtrA2 in modulation of vimentin filamentous structure in neurons. Our results provide important findings for understanding the biological role of Omi/HtrA2 activity during stress conditions, and give knowledge of interplay between Omi/HtrA2 and vimentin which might affect mitochondrial distribution in neurons.

  8. Proteases for Cell Suicide: Functions and Regulation of Caspases

    PubMed Central

    Chang, Howard Y.; Yang, Xiaolu


    Caspases are a large family of evolutionarily conserved proteases found from Caenorhabditis elegans to humans. Although the first caspase was identified as a processing enzyme for interleukin-1β, genetic and biochemical data have converged to reveal that many caspases are key mediators of apoptosis, the intrinsic cell suicide program essential for development and tissue homeostasis. Each caspase is a cysteine aspartase; it employs a nucleophilic cysteine in its active site to cleave aspartic acid peptide bonds within proteins. Caspases are synthesized as inactive precursors termed procaspases; proteolytic processing of procaspase generates the tetrameric active caspase enzyme, composed of two repeating heterotypic subunits. Based on kinetic data, substrate specificity, and procaspase structure, caspases have been conceptually divided into initiators and effectors. Initiator caspases activate effector caspases in response to specific cell death signals, and effector caspases cleave various cellular proteins to trigger apoptosis. Adapter protein-mediated oligomerization of procaspases is now recognized as a universal mechanism of initiator caspase activation and underlies the control of both cell surface death receptor and mitochondrial cytochrome c-Apaf-1 apoptosis pathways. Caspase substrates have bene identified that induce each of the classic features of apoptosis, including membrane blebbing, cell body shrinkage, and DNA fragmentation. Mice deficient for caspase genes have highlighted tissue- and signal-specific pathways for apoptosis and demonstrated an independent function for caspase-1 and -11 in cytokine processing. Dysregulation of caspases features prominently in many human diseases, including cancer, autoimmunity, and neurodegenerative disorders, and increasing evidence shows that altering caspase activity can confer therapeutic benefits. PMID:11104820

  9. Protease-activated receptor-1 modulates hippocampal memory formation and synaptic plasticity.


    Almonte, Antoine G; Qadri, Laura H; Sultan, Faraz A; Watson, Jennifer A; Mount, Daniel J; Rumbaugh, Gavin; Sweatt, J David


    Protease-activated receptor-1 (PAR1) is an unusual G-protein coupled receptor (GPCR) that is activated through proteolytic cleavage by extracellular serine proteases. Although previous work has shown that inhibiting PAR1 activation is neuroprotective in models of ischemia, traumatic injury, and neurotoxicity, surprisingly little is known about PAR1's contribution to normal brain function. Here, we used PAR1-/- mice to investigate the contribution of PAR1 function to memory formation and synaptic function. We demonstrate that PAR1-/- mice have deficits in hippocampus-dependent memory. We also show that while PAR1-/- mice have normal baseline synaptic transmission at Schaffer collateral-CA1 synapses, they exhibit severe deficits in N-methyl-d-aspartate receptor (NMDAR)-dependent long-term potentiation (LTP). Mounting evidence indicates that activation of PAR1 leads to potentiation of NMDAR-mediated responses in CA1 pyramidal cells. Taken together, this evidence and our data suggest an important role for PAR1 function in NMDAR-dependent processes subserving memory formation and synaptic plasticity.

  10. Protease-activated receptor-1 modulates hippocampal memory formation and synaptic plasticity

    PubMed Central

    Almonte, Antoine G.; Qadri, Laura H.; Sultan, Faraz A.; Watson, Jennifer A.; Mount, Daniel J.; Rumbaugh, Gavin; Sweatt, J. David


    Protease-activated receptor-1 (PAR1) is an unusual G-protein coupled receptor (GPCR) that is activated through proteolytic cleavage by extracellular serine proteases. While previous work has shown that inhibiting PAR1 activation is neuroprotective in models of ischemia, traumatic injury, and neurotoxicity, surprisingly little is known about PAR1’s contribution to normal brain function. Here we used PAR1 −/− mice to investigate the contribution of PAR1 function to memory formation and synaptic function. We demonstrate that PAR1 −/− mice have deficits in hippocampus-dependent memory. We also show that while PAR1 −/− mice have normal baseline synaptic transmission at Schaffer collateral-CA1 synapses, they exhibit severe deficits in N-methyl-D-aspartate receptor (NMDAR)-dependent long-term potentiation (LTP). Mounting evidence indicates that activation of PAR1 leads to potentiation of NMDAR-mediated responses in CA1 pyramidal cells. Taken together, this evidence and our data suggest an important role for PAR1 function in NMDAR-dependent processes subserving memory formation and synaptic plasticity. PMID:23113835

  11. Modeling and structural analysis of PA clan serine proteases

    PubMed Central


    Background Serine proteases account for over a third of all known proteolytic enzymes; they are involved in a variety of physiological processes and are classified into clans sharing structural homology. The PA clan of endopeptidases is the most abundant and over two thirds of this clan is comprised of the S1 family of serine proteases, which bear the archetypal trypsin fold and have a catalytic triad in the order Histidine, Aspartate, Serine. These proteases have been studied in depth and many three dimensional structures have been experimentally determined. However, these structures mostly consist of bacterial and animal proteases, with a small number of plant and fungal proteases and as yet no structures have been determined for protozoa or archaea. The core structure and active site geometry of these proteases is of interest for many applications. This study investigated the structural properties of different S1 family serine proteases from a diverse range of taxa using molecular modeling techniques. Results Our predicted models from protozoa, archaea, fungi and plants were combined with the experimentally determined structures of 16 S1 family members and used for analysis of the catalytic core. Amino acid sequences were submitted to SWISS-MODEL for homology-based structure prediction or the LOOPP server for threading-based structure prediction. Predicted models were refined using INSIGHT II and SCRWL and validated against experimental structures. Investigation of secondary structures and electrostatic surface potential was performed using MOLMOL. The structural geometry of the catalytic core shows clear deviations between taxa, but the relative positions of the catalytic triad residues were conserved. Some highly conserved residues potentially contributing to the stability of the structural core were identified. Evolutionary divergence was also exhibited by large variation in secondary structure features outside the core, differences in overall amino acid

  12. Hydrophobic core flexibility modulates enzyme activity in HIV-1 protease

    PubMed Central

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.; Bolon, Daniel N. A.; Schiffer, Celia A.


    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity. PMID:22295904

  13. Microbial aspartic proteases: current and potential applications in industry.


    Theron, Louwrens W; Divol, Benoit


    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  14. Non-proteolytic functions of microbial proteases increase pathological complexity.


    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P


    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  15. Protease production by Burkholderia pseudomallei and virulence in mice.


    Gauthier, Y P; Thibault, F M; Paucod, J C; Vidal, D R


    The aim of this study was to assess protease production and virulence of various Burkholderia pseudomallei strains. Protease activity was evaluated in filtrates from cultures grown for 50 h in TSB Dialysate by azocasein hydrolysis, and expressed as absorbancy at 405 nm. Virulence was assessed in 8 weeks old SWISS mice, by intraperitoneal injection of 6-6 x 10(5) CFU, and the LD50 was calculated after 30 days by the method of Reed and Muench. The lethal activity was studied for five strains of B. pseudomallei and the type strains of Burkholderia pseudomallei, Burkholderia mallei, and Burkholderia cepacia. The three type strains appeared to be low protease producers (A405 = 0.11, 0.09 and 0.00, respectively) and avirulent. The two more virulent B. pseudomallei strains exhibited significantly different LD50, 3.5 x 10(2) (IPP 6068 VIR) versus 2.1 x 10(5) CFU/mouse (40/97), and protease activities (A405 = 0.046 and 0.79, respectively). Moreover, the avirulent parent of IPP 6068 (AG), was a better protease producer than the 6068 VIR strain, A405 = 0.26 versus 0.046. These results suggest that there is no correlation between virulence and level of exoproteolytic activity, when B. pseudomallei is injected to mice via the intraperitoneal route.

  16. Mitochondrial cereblon functions as a Lon-type protease.


    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya


    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  17. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.


    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  18. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya


    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  19. Emerging roles for diverse intramembrane proteases in plant biology.


    Adam, Zach


    Progress in the field of regulated intramembrane proteolysis (RIP) in recent years has made its impact on plant biology as well. Although this field within plant research is still in its infancy, some interesting observations have started to emerge. Gene encoding orthologs of rhomboid proteases, site-2 proteases (S2P), presenilin/γ-secretases, and signal peptide peptidases are found in plant genomes and some of these gene products were identified in different plant cell membranes. The lack of chloroplast-located rhomboid proteases was associated with reduced fertility and aberrations in flower morphology. Mutations in homologues of S2P resulted in chlorophyll deficiency and impaired chloroplast development. An S2P was also implicated in the response to ER stress through cleavage of ER-membrane bZIP transcription factors, allowing their migration to the nucleus and activation of the transcription of BiP chaperones. Other membrane-bound transcription factors of the NAC and PHD families were also demonstrated to undergo RIP and relocalization to the nucleus. These and other new data are expected to shed more light on the roles of intramembrane proteases in plant biology in the future. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Current trends and challenges in proteomic identification of protease substrates.


    Vizovišek, Matej; Vidmar, Robert; Fonović, Marko; Turk, Boris


    Proteolytic cleavage is a ubiquitous, irreversible, posttranslational modification that changes protein structure and function and plays an important role in numerous physiological and pathological processes. Over the last decade, proteases have become increasingly important clinical targets because many of their inhibitors are already used in the clinic or in various stages of clinical testing. Therefore, a better understanding of protease action and their repertoires of physiological substrates can not only provide an important insight into their mechanisms of action but also open a path toward novel drug design. Historically, proteases and their substrates were mainly studied on a case-by-case basis, but recent advancements in mass spectrometry-based proteomics have enabled proteolysis studies on a global scale. Because there are many different types of proteases that can operate in various cellular contexts, multiple experimental approaches for their degradomic characterization had to be developed. The present paper reviews the mass spectrometry-based approaches for determining the proteolytic events in complex biological samples. The methodologies for substrate identification and the determination of protease specificity are discussed, with a special focus on terminomic strategies, which combine peptide labeling and enrichment. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  1. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.


    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  2. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.


    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  3. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.


    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong


    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  4. Catalysis and stability of an alkaline protease from a haloalkaliphilic bacterium under non-aqueous conditions as a function of pH, salt and temperature.


    Pandey, Sandeep; Rakholiya, Kalpna D; Raval, Vikram H; Singh, Satya P


    A haloalkaliphilic bacterium, isolated from Coastal Gujarat (India) was identified as Oceanobacillus sp. (GQ162111) based on 16S rRNA gene sequence. The organism grew and secreted extra cellular protease in presence of various organic solvents. At 30% (v/v) concentration of hexane, heptane, isooctane, dodecane and decane, significant growth and protease production was evident. The alkaline protease was purified in a single step on phenyl sepharose 6 FF with 28% yield. The molecular mass as judged by SDS-PAGE was 30 kDa. The temperature optimum of protease was 50°C and the enzyme retained 70% activity in 10% (v/v) isooctane. Effect of salt and pH was investigated in combination to assess the effect of isooctane. In organic solvents, the enzyme was considerably active at pH 8-11, with optimum activity at pH 10. Salt at 2 M was optimum for activity and enzyme maintained significant stability up to 18 h even at 3 M salt concentration. Patters of growth, protease production, catalysis and stability of the enzyme are presented. The study resumes significance as limited information is available on the interaction of haloalkaliphilic bacteria and their enzymes with organic solvents.

  5. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.


    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R


    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  6. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.


    Boudrant, J; Cuq, J L; Cheftel, C


    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  7. Evolution of Primary Protease Inhibitor Resistance Mutations during Protease Inhibitor Salvage Therapy

    PubMed Central

    Kantor, Rami; Fessel, W. Jeffrey; Zolopa, Andrew R.; Israelski, Dennis; Shulman, Nancy; Montoya, Jose G.; Harbour, Michael; Schapiro, Jonathan M.; Shafer, Robert W.


    In order to track the evolution of primary protease inhibitor (PI) resistance mutations in human immunodeficiency virus type 1 (HIV-1) isolates, baseline and follow-up protease sequences were obtained from patients undergoing salvage PI therapy who presented initially with isolates containing a single primary PI resistance mutation. Among 78 patients meeting study selection criteria, baseline primary PI resistance mutations included L90M (42% of patients), V82A/F/T (27%), D30N (21%), G48V (6%), and I84V (4%). Despite the switching of treatment to a new PI, primary PI resistance mutations present at the baseline persisted in 66 of 78 (85%) patients. D30N persisted less frequently than L90M (50% versus 100%, respectively; P < 0.001) and V82A/F/T (50% versus 81%, respectively; P = 0.05). HIV-1 isolates from 38 (49%) patients failing PI salvage therapy developed new primary PI resistance mutations including L90M, I84V, V82A, and G48V. Common combinations of primary and secondary PI resistance mutations after salvage therapy included mutations at amino acid positions 10, 82, and 46 and/or 54 in 16 patients; 10, 90, and 71 and/or 73 in 14 patients; 10, 73, 84, 90, and 46 and/or 54 in 5 patients; 10, 48, and 82 in 5 patients; and 30, 88 and 90 in 5 patients. In summary, during salvage PI therapy, most HIV-1 isolates with a single primary PI resistance mutation maintained their original mutations, and 49% developed additional primary PI resistance mutations. The persistence of L90M, V82A/F/T, G48V, and I84V during salvage therapy suggests that these mutations play a role in clinical resistance to multiple PIs. PMID:11897594

  8. From nonpeptide toward noncarbon protease inhibitors: Metallacarboranes as specific and potent inhibitors of HIV protease

    PubMed Central

    Cígler, Petr; Kožíšek, Milan; Řezáčová, Pavlína; Brynda, Jíří; Otwinowski, Zbyszek; Pokorná, Jana; Plešek, Jaromír; Grüner, Bohumír; Dolečková-Marešová, Lucie; Máša, Martin; Sedláček, Juraj; Bodem, Jochen; Kräusslich, Hans-Georg; Král, Vladimír; Konvalinka, Jan


    HIV protease (PR) represents a prime target for rational drug design, and protease inhibitors (PI) are powerful antiviral drugs. Most of the current PIs are pseudopeptide compounds with limited bioavailability and stability, and their use is compromised by high costs, side effects, and development of resistant strains. In our search for novel PI structures, we have identified a group of inorganic compounds, icosahedral metallacarboranes, as candidates for a novel class of nonpeptidic PIs. Here, we report the potent, specific, and selective competitive inhibition of HIV PR by substituted metallacarboranes. The most active compound, sodium hydrogen butylimino bis-8,8-[5-(3-oxa-pentoxy)-3-cobalt bis(1,2-dicarbollide)]di-ate, exhibited a Ki value of 2.2 nM and a submicromolar EC50 in antiviral tests, showed no toxicity in tissue culture, weakly inhibited human cathepsin D and pepsin, and was inactive against trypsin, papain, and amylase. The structure of the parent cobalt bis(1,2-dicarbollide) in complex with HIV PR was determined at 2.15 Å resolution by protein crystallography and represents the first carborane-protein complex structure determined. It shows the following mode of PR inhibition: two molecules of the parent compound bind to the hydrophobic pockets in the flap-proximal region of the S3 and S3′ subsites of PR. We suggest, therefore, that these compounds block flap closure in addition to filling the corresponding binding pockets as conventional PIs. This type of binding and inhibition, chemical and biological stability, low toxicity, and the possibility to introduce various modifications make boron clusters attractive pharmacophores for potent and specific enzyme inhibition. PMID:16227435

  9. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.


    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu


    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  10. (Processing and targeting of the thiol protease aleurain)

    SciTech Connect

    Rogers, J.C.


    Our goal for work during the past two years under this Grant was to characterize the barley thiol protease, aleurain, to determine if it is secreted or retained intracellularly in aleurone cells, and to begin to elucidate structural features that might control targeting of the protein to its final destination. We have shown that aleurain is synthesized as a proenzyme with two N-linked oligosaccharide chains, one high mannose-type and one complex-type. Aleurain undergoes processing to mature form by removal of an Nterminal prosegment, and is retained intracellularly; it cannot be detected among proteins secreted from aleurone cells. Treatment of aleurone cells with tunicamycin to prevent glycosylation of aleurain does not prevent processing of the unglycosylated form. The N-terminal portion of aleurain's prosegment is homologous to the comparable region in two yeast vacuolar proteases, where that region is known to contain the signal necessary for targeting the proteases to the vacuole. 18 refs., 7 figs.

  11. Cleaning protocols for crystallization robots: preventing protease contamination.


    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard


    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  12. Peptide synthesis in neat organic solvents with novel thermostable proteases.


    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B


    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  13. Protease-specific nanosensors for magnetic resonance imaging.


    Schellenberger, Eyk; Rudloff, Franziska; Warmuth, Carsten; Taupitz, Matthias; Hamm, Bernd; Schnorr, Jörg


    Imaging of enzyme activity is a central goal of molecular imaging. With the introduction of fluorescent smart probes, optical imaging has become the modality of choice for experimental in vivo detection of enzyme activity. Here, we present a novel high-relaxivity nanosensor that is suitable for in vivo imaging of protease activity by magnetic resonance imaging. Upon specific protease cleavage, the nanoparticles rapidly switch from a stable low-relaxivity stealth state to become adhesive, aggregating high-relaxivity particles. To demonstrate the principle, we chose a cleavage motif of matrix metalloproteinase 9 (MMP-9), an enzyme important in inflammation, atherosclerosis, tumor progression, and many other diseases with alterations of the extracellular matrix. On the basis of clinically tested very small iron oxide particles (VSOP), the MMP-9-activatable protease-specific iron oxide particles (PSOP) have a hydrodynamic diameter of only 25 nm. PSOP are rapidly activated, resulting in aggregation and increased T2*-relaxivity.

  14. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu


    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  15. New therapeutic strategies in HCV: second-generation protease inhibitors.


    Clark, Virginia C; Peter, Joy A; Nelson, David R


    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance. © 2012 John Wiley & Sons A/S.

  16. Tobacco Etch Virus protease: A shortcut across biotechnologies.


    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca


    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  17. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.


    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  18. Purification and properties of serine protease from Halobacterium halobium.

    PubMed Central

    Izotova, L S; Strongin, A Y; Chekulaeva, L N; Sterkin, V E; Ostoslavskaya, V I; Lyublinskaya, L A; Timokhina, E A; Stepanov, V M


    Pure extracellular serine protease was isolated from the culture filtrate of Halobacterium halobium by bacitracin-Sepharose affinity chromatography. The enzyme activity was completely and irreversibly lost if the NaCl concentration fell below 2 M. The protease consists of one polypeptide chain with a molecular weight of 41,000. It is characteristically enriched in Asx and Glx content, whereas the level of basic amino acids in the enzyme molecule is unusually low. The protease shows a preference for leucine in the carboxylic side of the scissile bond of the substrate, cleaving the B-chain of oxidized bovine insulin only at the Leu15-Tyr16 bond and liberating p-nitroaniline from L-pyroglutamyl-L-alanyl-L-alanyl-L-leucine-p-nitroanilide. PMID:6348027

  19. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.


    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  20. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.


    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin


    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  1. Protease inhibitor therapy in children with perinatally acquired HIV infection.


    Rutstein, R M; Feingold, A; Meislich, D; Word, B; Rudy, B


    To review the short-term response and safety of protease inhibitor therapy in HIV-infected children. Retrospective chart review of open-label protease inhibitor-containing combination therapy. Two urban pediatric HIV centers. Twenty-eight HIV-infected children were prescribed 30 protease inhibitor-containing antiretroviral therapy combinations. The median age at initiation of protease inhibitor antiretroviral therapy was 79 months. Patients had been on previous antiretroviral therapy for a mean of 45.5 months. Of the 28 children who completed at least 1 month of therapy, 26 experienced marked virologic and immunologic improvement (mean maximal decrease in viral load 1.90 log10 copies/ml; SD, 0.8; mean maximal rise in CD4+ lymphocytes of 279 x 10(6)/l; SD, 300 x 10(6)/l). Eleven patients achieved a viral nadir of < 400 copies/ml, and seven sustained this level of viral suppression for a mean of 6 months. Indinavir use was associated with a high incidence of renal side-effects, including two patients who developed interstitial nephritis. Two patients on ritonavir experienced a significant elevation of liver enzymes. Protease inhibitor therapy was associated with substantial short-term virologic and immunologic improvement in this primarily heavily pretreated cohort, with 25% maintaining a viral load of < 400 copies/ml after 6 months of therapy. There was a significant rate of adverse events. Pharmacokinetic and safety data are needed to guide aggressive antiretroviral therapy in HIV-infected children, and further treatment options are required for those failing or intolerant to the available protease inhibitors.

  2. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )


    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  3. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H


    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  4. The chlamydial protease CPAF: important or not, important for what?


    Häcker, Georg


    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  5. Glycosyl part identified within Balanites aegyptiaca fruit protease.


    Beka, R G; Guiama, V D; Delmont, A; Donn, P; Slomianny, M-C; Libouga, D G; Mbofung, C M; Guillochon, D; Vercaigne-Marko, D


    The many milk-clotting proteases from plant are glycosylated; attachment of monosaccharides to enzyme is an advantage for its activity and stability. In this study, gas chromatography coupled to mass spectrometry-electrospray ionization was used to identify glycans bond to proteases purified from Balanites aegyptiaca fruits pulp through cation exchange chromatography. Carbohydrates were identified according to the retention time and the ion at m/z after derivation by heptafluorobutyric acid. The chromatograms obtained from monosaccharides analysis revealed the presence of galactose, mannose, arabinose, xylose, rhamnose and glucuronic acid. The mass spectrometry-electrospray ionization spectra corroborated these findings. Copyright © 2011 Elsevier B.V. All rights reserved.