Science.gov

Sample records for a1 proteases evidence

  1. Evidence of bovine immunoglobulin G1 (IgG1) protease activity in partially purified culture supernate of Pasteurella haemolytica A1.

    PubMed Central

    Lee, C W; Shewen, P E

    1996-01-01

    In the bovine respiratory tract, IgG1 is a major secretory immunoglobulin (Ig), and both IgG1 and IgG2 are believed to be important in defense against pneumonic pasteurellosis (shipping fever) in calves. Here we provide evidence for hydrolysis of IgG1 in the presence of partially purified culture supernate (ppCS) from the respiratory pathogen Pasteurella haemolytica A1. Bovine IgG1 was hydrolysed sequentially into three distinct bands (approximately 39, 12, and 7 kDa respectively). Furthermore, partial hydrolysis of bovine IgG2 was observed, but neither bovine IgA nor IgM were affected by incubation with ppCS. These findings suggest that the production of an IgG1-specific protease by P. haemolytica A1 may be a virulence mechanism contributing to the pathogenesis of bovine pneumonic pasteurellosis. Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. PMID:8785718

  2. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  3. Purification and characterization of an immunoglobulin A1 protease from Bacteroides melaninogenicus.

    PubMed Central

    Mortensen, S B; Kilian, M

    1984-01-01

    Attention has recently been focused on bacterial proteases with the capacity to cleave immunoglobulin A (IgA proteases) as possible pathogenic factors in bacterial meningitis, gonorrhoea, and destructive periodontal disease. Here, we describe a method for the rapid purification of a specific IgA1 protease from Bacteroides melaninogenicus. The IgA1 protease was purified 6,172-fold with a yield of 9% by ammonium sulfate precipitation, DEAE-ion exchange chromatography, and separation on a preparative TSK-G 3000SWG high-pressure gel permeation chromatography column. The enzyme was specific for human IgA1 and cleaved a prolyl-seryl peptide bond in the hinge region of the alpha 1 chain between residues 223 and 224. The molecular weight of the enzyme was 62,000, the isoelectric point was 5.0, and the Km was 3.4 X 10(-6). The enzyme was active over a broad pH range and had maximal activity at pH 5.0. B. melaninogenicus IgA1 protease was classified as a thiol protease on the basis of its inhibition by traditional protease inhibitors and the fact that it was active only under reducing conditions. Images PMID:6147309

  4. Proteolysis of bacterial membrane proteins by Neisseria gonorrhoeae type 2 immunoglobulin A1 protease.

    PubMed Central

    Shoberg, R J; Mulks, M H

    1991-01-01

    The immunoglobulin A1 (IgA1) proteases of Neisseria gonorrhoeae have been defined as having human IgA1 as their single permissive substrate. However, in recent years there have been reports of other proteins which are susceptible to the proteolytic activity of these enzymes. To examine the possibility that gonococcal membrane proteins are potential substrates for these enzymes, isolated outer and cytoplasmic membranes of N. gonorrhoeae were treated in vitro with exogenous pure IgA1 protease. Analysis of silver-stained sodium dodecyl sulfate-polyacrylamide gels of outer membranes indicated that there were two outer membrane proteins of 78 and 68 kDa which were cleaved by IgA1 protease in vitro in GCM 740 (a wild-type strain) and in two isogenic IgA1 protease-negative variants. Similar results were observed with a second gonococcal strain, F62, and its isogenic IgA1 protease-negative derivative. When GCM 740 cytoplasmic membranes were treated with protease, three minor proteins of 24.5, 23.5, and 21.5 kDa were cleaved. In addition, when outer membranes of Escherichia coli DH1 were treated with IgA1 protease, several proteins were hydrolyzed. While the identities of all of these proteolyzed proteins are unknown, the data presented indicate that there are several proteins found in the isolated membranes of gram-negative bacteria which are permissive in vitro substrates for gonococcal IgA1 protease. Images PMID:1713195

  5. IgA1 proteases of Haemophilus influenzae: cloning and characterization in Escherichia coli K-12.

    PubMed Central

    Bricker, J; Mulks, M H; Plaut, A G; Moxon, E R; Wright, A

    1983-01-01

    Haemophilus influenzae is one of several bacterial pathogens known to release IgA1 proteases into the extracellular environment. Each H. influenzae isolate produces one of at least three distinct types of these enzymes that differ in the specific peptide bond they cleave in the hinge region of human IgA1. We have isolated the gene specifying type 1 IgA1 protease from a total genomic library of H. influenzae, subcloned it into plasmid vectors, and introduced these vectors into Escherichia coli K-12. The enzyme synthesized by E. coli was active and had the same specificity as that of the H. influenzae donor. Unlike that of the donor, E. coli protease activity accumulated in the periplasm rather than being transported extracellularly. The position of the protease gene in H. influenzae DNA and its direction of transcription was approximated by deletion mapping. Tn5 insertions, and examination of the polypeptides synthesized by minicells. A 1-kilobase probe excised from the IgA1 protease gene hybridized with DNA restriction fragments of all H. influenzae serogroups but not with DNA of a nonpathogenic H. parainfluenzae species known to be IgA1 protease negative. Images PMID:6341996

  6. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  7. Protoporphyrins Enhance Oligomerization and Enzymatic Activity of HtrA1 Serine Protease

    PubMed Central

    Jo, Hakryul; Patterson, Victoria; Stoessel, Sean; Kuan, Chia-Yi; Hoh, Josephine

    2014-01-01

    High temperature requirement protein A1 (HtrA1), a secreted serine protease of the HtrA family, is associated with a multitude of human diseases. However, the exact functions of HtrA1 in these diseases remain poorly understood. We seek to unravel the mechanisms of HtrA1 by elucidating its interactions with chemical or biological modulators. To this end, we screened a small molecule library of 500 bioactive compounds to identify those that alter the formation of extracellular HtrA1 complexes in the cell culture medium. An initial characterization of two novel hits from this screen showed that protoporphyrin IX (PPP-IX), a precursor in the heme biosynthetic pathway, and its metalloporphyrin (MPP) derivatives fostered the oligomerization of HtrA1 by binding to the protease domain. As a result of the interaction with MPPs, the proteolytic activity of HtrA1 against Fibulin-5, a specific HtrA1 substrate in age-related macular degeneration (AMD), was increased. This physical interaction could be abolished by the missense mutations of HtrA1 found in patients with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Furthermore, knockdown of HtrA1 attenuated apoptosis induced by PPP-IX. These results suggest that PPP-IX, or its derivatives, and HtrA1 may function as co-factors whereby porphyrins enhance oligomerization and the protease activity of HtrA1, while active HtrA1 elevates the pro-apoptotic actions of porphyrin derivatives. Further analysis of this interplay may shed insights into the pathogenesis of diseases such as AMD, CARASIL and protoporphyria, as well as effective therapeutic development. PMID:25506911

  8. Proresolving Actions of Synthetic and Natural Protease Inhibitors Are Mediated by Annexin A1.

    PubMed

    Vago, Juliana P; Tavares, Luciana P; Sugimoto, Michelle A; Lima, Graziele Letícia N; Galvão, Izabela; de Caux, Thais R; Lima, Kátia M; Ribeiro, Ana Luíza C; Carneiro, Fernanda S; Nunes, Fernanda Freire C; Pinho, Vanessa; Perretti, Mauro; Teixeira, Mauro M; Sousa, Lirlândia P

    2016-02-15

    Annexin A1 (AnxA1) is a glucocorticoid-regulated protein endowed with anti-inflammatory and proresolving properties. Intact AnxA1 is a 37-kDa protein that may be cleaved in vivo at the N-terminal region by neutrophil proteases including elastase and proteinase-3, generating the 33-kDa isoform that is largely inactive. In this study, we investigated the dynamics of AnxA1 expression and the effects of synthetic (sivelestat [SIV]; Eglin) and natural (secretory leukocyte protease inhibitor [SLPI]; Elafin) protease inhibitors on the resolution of LPS-induced inflammation. During the settings of LPS inflammation AnxA1 cleavage associated closely with the peak of neutrophil and elastase expression and activity. SLPI expression increased during resolving phase of the pleurisy. Therapeutic treatment of LPS-challenge mice with recombinant human SLPI or Elafin accelerated resolution, an effect associated with increased numbers of apoptotic neutrophils in the pleural exudates, inhibition of elastase, and modulation of the survival-controlling proteins NF-κB and Mcl-1. Similar effects were observed with SIV, which dose-dependently inhibited neutrophil elastase and shortened resolution intervals. Mechanistically, SIV-induced resolution was caspase-dependent, associated to increased levels of intact AnxA1 and decreased expression of NF-κB and Mcl-1. The proresolving effect of antiproteases was also observed in a model of monosodium urate crystals-induced inflammation. SIV skewed macrophages toward resolving phenotypes and enhanced efferocytosis of apoptotic neutrophils. A neutralizing antiserum against AnxA1 and a nonselective antagonist of AnxA1 receptor abolished the accelerated resolution promoted by SIV. Collectively, these results show that elastase inhibition not only inhibits inflammation but actually promotes resolution, and this response is mediated by protection of endogenous intact AnxA1 with ensuing augmentation of neutrophil apoptosis.

  9. Immunoglobulins in Nasal Secretions of Healthy Humans: Structural Integrity of Secretory Immunoglobulin A1 (IgA1) and Occurrence of Neutralizing Antibodies to IgA1 Proteases of Nasal Bacteria

    PubMed Central

    Kirkeby, Line; Rasmussen, Trine Tang; Reinholdt, Jesper; Kilian, Mogens

    2000-01-01

    isolates were detected in secretions from five of the seven subjects but not in those from two subjects harboring IgA1 protease-producing S. mitis biovar 1. α-chain fragments different from Fcα and Fdα were detected in some samples, possibly reflecting nonspecific proteolytic activity of microbial or host origin. These results add to previous evidence for a role of secretory immunity in the defense of the nasal mucosa but do not help identify conditions under which bacterial IgA1 proteases may interfere with this defense. PMID:10618273

  10. Structural Evidence for Regulation and Specificity of Flaviviral Proteases and Evolution of the Flaviviridae Fold

    SciTech Connect

    Aleshin,A.; Shiryaev, S.; Strongin, A.; Liddington, R.

    2007-01-01

    Pathogenic members of the flavivirus family, including West Nile Virus (WNV) and Dengue Virus (DV), are growing global threats for which there are no specific treatments. The two-component flaviviral enzyme NS2B-NS3 cleaves the viral polyprotein precursor within the host cell, a process that is required for viral replication. Here, we report the crystal structure of WNV NS2B-NS3pro both in a substrate-free form and in complex with the trypsin inhibitor aprotinin/BPTI. We show that aprotinin binds in a substrate-mimetic fashion in which the productive conformation of the protease is fully formed, providing evidence for an 'induced fit' mechanism of catalysis and allowing us to rationalize the distinct substrate specificities of WNV and DV proteases. We also show that the NS2B cofactor of WNV can adopt two very distinct conformations and that this is likely to be a general feature of flaviviral proteases, providing further opportunities for regulation. Finally, by comparing the flaviviral proteases with the more distantly related Hepatitis C virus, we provide insights into the evolution of the Flaviviridae fold. Our work should expedite the design of protease inhibitors to treat a range of flaviviral infections.

  11. Similar proportions of immunoglobulin A1 (IgA1) protease-producing streptococci in initial dental plaque of selectively IgA-deficient and normal individuals.

    PubMed Central

    Reinholdt, J; Friman, V; Kilian, M

    1993-01-01

    By comparing the initial colonization of cleaned teeth in immunoglobulin A (IgA)-deficient, IgM-compensating individuals with that in normal individuals, no significant difference in the proportion of IgA1 protease-producing streptococci was found. Thus, as one of several bacterial means of immune evasion, the ability to cleave secretory IgA1 does not appear essential to the successful adherence of oral streptococci. PMID:8359924

  12. Characterization of Bactrocera dorsalis Serine Proteases and Evidence for Their Indirect Role in Insecticide Tolerance

    PubMed Central

    Hou, Ming-Zhe; Shen, Guang-Mao; Wei, Dong; Li, Ya-Li; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) causes devastating losses to agricultural crops world-wide and is considered to be an economically important pest. Little is known about the digestive enzymes such as serine proteases (SPs) in B. dorsalis, which are important both for energy supply and mitigation of fitness cost associated with insecticide tolerance. In this study, we identified five SP genes in the midgut of B. dorsalis, and the alignments of their deduced amino acid sequences revealed the presence of motifs conserved in the SP superfamily. Phylogenetic analyses with known SPs from other insect species suggested that three of them were trypsin-like proteases. Analyses of the expression profiles among the different developmental stages showed that all five genes were most abundant in larvae than in other stages. When larvae were continuously fed on diet containing 0.33 μg/g β-Cypermethrin, expression of all five genes were upregulated in the midgut but the larval development was delayed. Biochemical assays were consistent with the increased protease activity exhibited by SPs in the midgut after treatment with β-Cypermethrin. Taken together, these findings provide evidence for the hypothesis that enhanced SP activity may play an indirect role in relieving the toxicity stress of insecticide in B. dorsalis. PMID:24566149

  13. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.

    PubMed

    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard

    2004-05-04

    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  14. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    PubMed Central

    De Paolis, Francesca; Beghetto, Elisa; Spadoni, Andrea; Montagnani, Francesca; Felici, Franco; Oggioni, Marco R; Gargano, Nicola

    2007-01-01

    Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA) of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery. PMID:18088426

  15. Genetic and biochemical analysis of gonococcal IgA1 protease: cloning in Escherichia coli and construction of mutants of gonococci that fail to produce the activity.

    PubMed Central

    Koomey, J M; Gill, R E; Falkow, S

    1982-01-01

    The biological significance of bacterial extracellular proteases that specifically cleave human IgA1 is unknown. We have prepared a gene bank of gonococcal chromosomal DNA in Escherichia coli K-12 using a cosmid cloning system. Among these clones, we have identified and characterized an E. coli strain that elaborates an extracellular endopeptidase that is indistinguishable from gonococcal IgA1 protease in its substrate specificity and action on human IgA1. Analysis of recombinant plasmids and examination of plasmid-specific peptides in minicells have shown that the IgA1 protease activity in E. coli is associated with expression of a Mr 140,000 peptide. We have isolated IgA1 protease-deficient mutants of Neisseria gonorrhoeae by reintroduction of physically defined deletions of the cloned gene into the gonococcal chromosome by transformation. Images PMID:6818556

  16. The trimeric serine protease HtrA1 forms a cage-like inhibition complex with an anti-HtrA1 antibody.

    PubMed

    Ciferri, Claudio; Lipari, Michael T; Liang, Wei-Ching; Estevez, Alberto; Hang, Julie; Stawicki, Scott; Wu, Yan; Moran, Paul; Elliott, Mike; Eigenbrot, Charles; Katschke, Kenneth J; van Lookeren Campagne, Menno; Kirchhofer, Daniel

    2015-12-01

    High temperature requirement A1 (HtrA1) is a trypsin-fold serine protease implicated in the progression of age-related macular degeneration (AMD). Our interest in an antibody therapy to neutralize HtrA1 faces the complication that the target adopts a trimeric arrangement, with three active sites in close proximity. In the present study, we describe antibody 94, obtained from a human antibody phage display library, which forms a distinct macromolecular complex with HtrA1 and inhibits the enzymatic activity of recombinant and native HtrA1 forms. Using biochemical methods and negative-staining EM we were able to elucidate the molecular composition of the IgG94 and Fab94 complexes and the associated inhibition mechanism. The 246-kDa complex between the HtrA1 catalytic domain trimer (HtrA1_Cat) and Fab94 had a propeller-like organization with one Fab bound peripherally to each protomer. Low-resolution EM structures and epitope mapping indicated that the antibody binds to the surface-exposed loops B and C of the catalytic domain, suggesting an allosteric inhibition mechanism. The HtrA1_Cat-IgG94 complex (636 kDa) is a cage-like structure with three centrally located IgG94 molecules co-ordinating two HtrA1_Cat trimers and the six active sites pointing into the cavity of the cage. In both complexes, all antigen-recognition regions (paratopes) are found to bind one HtrA1 protomer and all protomers are bound by a paratope, consistent with the complete inhibition of enzyme activity. Therefore, in addition to its potential therapeutic usefulness, antibody 94 establishes a new paradigm of multimeric serine protease inhibition.

  17. Alpha-1-Antitrypsin: A Novel Human High Temperature Requirement Protease A1 (HTRA1) Substrate in Human Placental Tissue

    PubMed Central

    Frochaux, Violette; Hildebrand, Diana; Talke, Anja; Linscheid, Michael W.; Schlüter, Hartmut

    2014-01-01

    The human serine protease high temperature requirement A1 (HTRA1) is highly expressed in the placental tissue, especially in the last trimester of gestation. This suggests that HTRA1 is involved in placental formation and function. With the aim of a better understanding of the role of HTRA1 in the placenta, candidate substrates were screened in a placenta protein extract using a gel-based mass spectrometric approach. Protease inhibitor alpha-1-antitrypsin, actin cytoplasmic 1, tropomyosin beta chain and ten further proteins were identified as candidate substrates of HTRA1. Among the identified candidate substrates, alpha-1-antitrypsin (A1AT) was considered to be of particular interest because of its important role as protease inhibitor. For investigation of alpha-1-antitrypsin as substrate of HTRA1 synthetic peptides covering parts of the sequence of alpha-1-antitrypsin were incubated with HTRA1. By mass spectrometry a specific cleavage site was identified after met-382 (AIPM382↓383SIPP) within the reactive centre loop of alpha-1-antitrypsin, resulting in a C-terminal peptide comprising 36 amino acids. Proteolytic removal of this peptide from alpha-1-antitrypsin results in a loss of its inhibitor function. Beside placental alpha-1-antitrypsin the circulating form in human plasma was also significantly degraded by HTRA1. Taken together, our data suggest a link between the candidate substrates alpha-1-antitrypsin and the function of HTRA1 in the placenta in the syncytiotrophoblast, the cell layer attending to maternal blood in the villous tree of the human placenta. Data deposition: Mass spectrometry (MS) data have been deposited to the ProteomeXchange with identifier PXD000473. PMID:25329061

  18. Protease inhibition by Heterodera glycines cyst content: evidence for effects on the Meloidogyne incognita proteasome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases from Heterodera glycines and Meloidogyne incognita juveniles were inhibited by heat-stable content of H. glycines female cysts (HglCE), and by the plant polyphenol epigallocatechin gallate (EGCG). General protease activities detected using the nematode peptide KSAYMRFa were inhibited by EG...

  19. Thermodynamic analysis of unusually thermostable CutA1 protein from human brain and its protease susceptibility.

    PubMed

    Bagautdinov, Bagautdin; Matsuura, Yoshinori; Yamamoto, Hitoshi; Sawano, Masahide; Ogasahara, Kyoko; Takehira, Michiyo; Kunishima, Naoki; Katoh, Etsuko; Yutani, Katsuhide

    2015-03-01

    Unusually stable proteins are a disadvantage for the metabolic turnover of proteins in cells. The CutA1 proteins from Pyrococcus horikoshii and from Oryza sativa (OsCutA1) have unusually high denaturation temperatures (Td) of nearly 150 and 100 °C, respectively, at pH 7.0. It seemed that the CutA1 protein from the human brain (HsCutA1) also has a remarkably high stability. Therefore, the thermodynamic stabilities of HsCutA1 and its protease susceptibility were examined. The Td was remarkably high, being over 95 °C at pH 7.0. The unfolding Gibbs energy (ΔG(0)H2O) was 174 kJ/mol at 37 °C from the denaturant denaturation. The thermodynamic analysis showed that the unfolding enthalpy and entropy values of HsCutA1 were considerably lower than those of OsCutA1 with a similar stability to HsCutA1, which should be related to flexibility of the unstructured properties in both N- and C-terminals of HsCutA1. HsCutA1 was almost completely digested after 1-day incubation at 37 °C by subtilisin, although OsCutA1 was hardly digested at the same conditions. These results indicate that easily available fragmentation of HsCutA1 with remarkably high thermodynamic stability at the body temperature should be important for its protein catabolism in the human cells.

  20. Crystallographic and kinetic evidence of allostery in a trypsin-like protease.

    PubMed

    Niu, Weiling; Chen, Zhiwei; Gandhi, Prafull S; Vogt, Austin D; Pozzi, Nicola; Pelc, Leslie A; Zapata, Fatima; Di Cera, Enrico

    2011-07-26

    Protein allostery is based on the existence of multiple conformations in equilibrium linked to distinct functional properties. Although evidence of allosteric transitions is relatively easy to identify by functional studies, structural detection of a pre-existing equilibrium between alternative conformations remains challenging even for textbook examples of allosteric proteins. Kinetic studies show that the trypsin-like protease thrombin exists in equilibrium between two conformations where the active site is either collapsed (E*) or accessible to substrate (E). However, structural demonstration that the two conformations exist in the same enzyme construct free of ligands has remained elusive. Here we report the crystal structure of the thrombin mutant N143P in the E form, which complements the recently reported structure in the E* form, and both the E and E* forms of the thrombin mutant Y225P. The side chain of W215 moves 10.9 Å between the two forms, causing a displacement of 6.6 Å of the entire 215-217 segment into the active site that in turn opens or closes access to the primary specificity pocket. Rapid kinetic measurements of p-aminobenzamidine binding to the active site confirm the existence of the E*-E equilibrium in solution for wild-type and the mutants N143P and Y225P. These findings provide unequivocal proof of the allosteric nature of thrombin and lend strong support to the recent proposal that the E*-E equilibrium is a key property of the trypsin fold.

  1. Internalization and Trafficking of Nontypeable Haemophilus influenzae in Human Respiratory Epithelial Cells and Roles of IgA1 Proteases for Optimal Invasion and Persistence

    PubMed Central

    Clementi, Cara F.; Håkansson, Anders P.

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells. PMID:24218477

  2. Internalization and trafficking of nontypeable Haemophilus influenzae in human respiratory epithelial cells and roles of IgA1 proteases for optimal invasion and persistence.

    PubMed

    Clementi, Cara F; Håkansson, Anders P; Murphy, Timothy F

    2014-01-01

    Nontypeable Haemophilus influenzae (NTHI) is a leading cause of opportunistic infections of the respiratory tract in children and adults. Although considered an extracellular pathogen, NTHI has been observed repeatedly within and between cells of the human respiratory tract, and these observations have been correlated to symptomatic infection. These findings are intriguing in light of the knowledge that NTHI persists in the respiratory tract despite antibiotic therapy and the development of bactericidal antibodies. We hypothesized that intracellular NTHI avoids, escapes, or neutralizes the endolysosomal pathway and persists within human respiratory epithelial cells and that human IgA1 proteases are required for optimal internalization and persistence of NTHI. Virtually all strains encode a human IgA1 protease gene, igaA, and we previously characterized a novel human IgA1 protease gene, igaB, that is associated with disease-causing strains and is homologous to the IgA1 protease that is unique to pathogenic Neisseria spp. Here, we show that NTHI invades human bronchial epithelial cells in vitro in a lipid raft-independent manner, is subsequently trafficked via the endolysosomal pathway, and is killed in lysosomes after variable durations of persistence. IgaA is required for optimal invasion. IgaB appears to play little or no role in adherence or invasion but is required for optimal intracellular persistence of NTHI. IgaB cleaves lysosome-associated membrane protein 1 (LAMP1) at pHs characteristic of the plasma membrane, early endosome, late endosome, and lysosome. However, neither IgA1 protease inhibits acidification of intracellular vesicles containing NTHI. NTHI IgA1 proteases play important but different roles in NTHI invasion and trafficking in respiratory epithelial cells.

  3. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy.

    PubMed

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming

    2016-08-03

    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN.

  4. Bacterial IgA protease-mediated degradation of agIgA1 and agIgA1 immune complexes as a potential therapy for IgA Nephropathy

    PubMed Central

    Wang, Li; Li, Xueying; Shen, Hongchun; Mao, Nan; Wang, Honglian; Cui, Luke; Cheng, Yuan; Fan, Junming

    2016-01-01

    Mesangial deposition of aberrantly glycosylated IgA1 (agIgA1) and its immune complexes is a key pathogenic mechanism of IgA nephropathy (IgAN). However, treatment of IgAN remains ineffective. We report here that bacteria-derived IgA proteases are capable of degrading these pathogenic agIgA1 and derived immune complexes in vitro and in vivo. By screening 14 different bacterial strains (6 species), we found that 4 bacterial IgA proteases from H. influenzae, N. gonorrhoeae and N. meningitidis exhibited high cleaving activities on serum agIgA1 and artificial galactose-depleted IgA1 in vitro and the deposited agIgA1-containing immune complexes in the mesangium of renal biopsy from IgAN patients and in a passive mouse model of IgAN in vitro. In the modified mouse model of passive IgAN with abundant in situ mesangial deposition of the agIgA-IgG immune complexes, a single intravenous delivery of IgA protease from H. influenzae was able to effectively degrade the deposited agIgA-IgG immune complexes within the glomerulus, demonstrating a therapeutic potential for IgAN. In conclusion, the bacteria-derived IgA proteases are biologically active enzymes capable of cleaving the circulating agIgA and the deposited agIgA-IgG immune complexes within the kidney of IgAN. Thus, the use of such IgA proteases may represent a novel therapy for IgAN. PMID:27485391

  5. Comparison of HCV NS3 protease and NS5B polymerase inhibitor activity in 1a, 1b and 2a replicons and 2a infectious virus.

    PubMed

    Paulson, Matthew S; Yang, Huiling; Shih, I-hung; Feng, Joy Y; Mabery, Eric M; Robinson, Margaret F; Zhong, Weidong; Delaney, William E

    2009-08-01

    The hepatitis C virus infection system represents an important new tool for drug discovery. In this study, we compared the in vitro antiviral efficacy of several NS3 and NS5B inhibitors in genotype 1a, 1b, and 2a replicons and in the 2a infectious virus system. The nucleoside inhibitor 2'-C-methyl adenosine showed similar efficacy in each system tested. Three non-nucleoside inhibitors had small differences in potency between genotype 1a and 1b. In contrast, there was a dramatic loss of potency for these non-nucleoside inhibitors in the genotype 2a replicon, 2a infectious virus, and 2a NS5B biochemical assays. The protease inhibitor BILN-2061 had similar efficacy against 1a and 1b replicons but was 61-109-fold less potent against the 2a replicon and virus, respectively. VX-950, a covalent protease inhibitor, had similar efficacy (<3-fold changes in EC(50)) regardless of genotype or subtype. Importantly, we observed a significant correlation (p<0.0001) in antiviral potency between the 2a replicon and 2a infectious virus for all classes of compounds tested.

  6. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  7. Characterization of an extracellular subtilisin protease of Rhizopus microsporus and evidence for its expression during invasive rhinoorbital mycosis.

    PubMed

    Spreer, Annette; Rüchel, Reinhard; Reichard, Utz

    2006-12-01

    An endoprotease Arp (alkaline Rhizopus protease) was identified and purified to virtual homogeneity from the culture supernatant of an isolate of Rhizopus microsporus var. rhizopodiformis recovered from a non-fatal case of rhinoorbital mucormycosis. N-terminal sequencing of the mature native enzyme was obtained for the first 20 amino acids and revealed high homology to serine proteases of the subtilisin subfamily. Arp migrated in SDS-PAGE with an estimated molecular mass of 33 kDa and had a pI determined to be at pH 8.8. Arp is proteolytically active against various substrates, including elastin, over a broad pH range between 6 and 12 with an optimum at pH 10.5. After invasive mucormycosis, specific antibodies against Arp were detected in stored serum samples taken from the patient from whom the R. microsporus strain of this study had been isolated. Furthermore, in search of factors involved in thrombosis as a typical complication of mucormycosis, a procoagulatory effect of the enzyme has recently been shown. Altogether, these data substantiate the expression of Arp during human rhinoorbital mucormycosis and suggest a role of the enzyme in pathogenesis.

  8. Clinical Evidence for the Role of Trichomonas vaginalis in Regulation of Secretory Leukocyte Protease Inhibitor in the Female Genital Tract

    PubMed Central

    Huppert, Jill S.; Huang, Bin; Chen, Chen; Dawood, Hassan Y.; Fichorova, Raina N.

    2013-01-01

    Background. Secretory leukocyte protease inhibitor (SLPI) is responsible for regulating inflammatory damage to and innate and adaptive immune responses in the vaginal mucosa. Depressed cervicovaginal SLPI levels have been correlated with both Trichomonas vaginalis infection and poor reproductive health outcomes. Methods. We measured levels of SLPI in 215 vaginal specimens collected from adolescent and young adult females aged 14–22 years. Log-transformed SLPI values were compared by analysis of variance or by an unpaired t test before and after adjustment for confounding effects through the propensity score method. Results. Females receiving hormonal contraceptives and those with an abnormal vaginal pH had lower SLPI levels as compared to their peers. After propensity score adjustment for race, behavioral factors, hormonal use, and other sexually transmitted infections (STIs), SLPI levels were lower in females with a positive T. vaginalis antigen test result, a vaginal pH >4.5, vaginal leukocytosis, and recurrent (vs initial) T. vaginalis infection, with the lowest levels observed in those with the highest T. vaginalis loads. Conclusions. The SLPI level was reduced by >50% in a T. vaginalis load–dependent manner. Future research should consider whether identifying and treating females with low levels of T. vaginalis infection (before they become wet mount positive) would prevent the loss of SLPI and impaired vaginal immunity. The SLPI level could be used as a vaginal-health marker to evaluate interventions and vaginal products. PMID:23355743

  9. Evidence Supporting the 19 β-Strand Model for Tom40 from Cysteine Scanning and Protease Site Accessibility Studies*

    PubMed Central

    Lackey, Sebastian W. K.; Taylor, Rebecca D.; Go, Nancy E.; Wong, Annie; Sherman, E. Laura; Nargang, Frank E.

    2014-01-01

    Most proteins found in mitochondria are translated in the cytosol and enter the organelle via the TOM complex (translocase of the outer mitochondrial membrane). Tom40 is the pore forming component of the complex. Although the three-dimensional structure of Tom40 has not been determined, the structure of porin, a related protein, has been shown to be a β-barrel containing 19 membrane spanning β-strands and an N-terminal α-helical region. The evolutionary relationship between the two proteins has allowed modeling of Tom40 into a similar structure by several laboratories. However, it has been suggested that the 19-strand porin structure does not represent the native form of the protein. If true, modeling of Tom40 based on the porin structure would also be invalid. We have used substituted cysteine accessibility mapping to identify several potential β-strands in the Tom40 protein in isolated mitochondria. These data, together with protease accessibility studies, support the 19 β-strand model for Tom40 with the C-terminal end of the protein localized to the intermembrane space. PMID:24947507

  10. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  11. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  12. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  13. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  14. HbA1c as a Diagnostic Test for Diabetes Mellitus – Reviewing the Evidence

    PubMed Central

    Florkowski, Chris

    2013-01-01

    The evidence base in support of HbA1c as a diagnostic test for diabetes mellitus is focused on predicting a clinical outcome, considered to be the pinnacle of the Stockholm Hierarchy applied to reference intervals and clinical decision limits. In the case of diabetes, the major outcome of interest is the long term microvascular complications for which a large body of data has been accumulated, leading to the endorsement of HbA1c for diagnosis in many countries worldwide, with some variations in cut-offs and testing strategies. PMID:24151343

  15. In vivo inhibition of cysteine proteases provides evidence for the involvement of 'senescence-associated vacuoles' in chloroplast protein degradation during dark-induced senescence of tobacco leaves.

    PubMed

    Carrión, Cristian A; Costa, María Lorenza; Martínez, Dana E; Mohr, Christina; Humbeck, Klaus; Guiamet, Juan J

    2013-11-01

    Breakdown of leaf proteins, particularly chloroplast proteins, is a massive process in senescing leaves. In spite of its importance in internal N recycling, the mechanism(s) and the enzymes involved are largely unknown. Senescence-associated vacuoles (SAVs) are small, acidic vacuoles with high cysteine peptidase activity. Chloroplast-targeted proteins re-localize to SAVs during senescence, suggesting that SAVs might be involved in chloroplast protein degradation. SAVs were undetectable in mature, non-senescent tobacco leaves. Their abundance, visualized either with the acidotropic marker Lysotracker Red or by green fluorescent protein (GFP) fluorescence in a line expressing the senescence-associated cysteine protease SAG12 fused to GFP, increased during senescence induction in darkness, and peaked after 2-4 d, when chloroplast dismantling was most intense. Increased abundance of SAVs correlated with higher levels of SAG12 mRNA. Activity labelling with a biotinylated derivative of the cysteine protease inhibitor E-64 was used to detect active cysteine proteases. The two apparently most abundant cysteine proteases of senescing leaves, of 40kDa and 33kDa were detected in isolated SAVs. Rubisco degradation in isolated SAVs was completely blocked by E-64. Treatment of leaf disks with E-64 in vivo substantially reduced degradation of Rubisco and leaf proteins. Overall, these results indicate that SAVs contain most of the cysteine protease activity of senescing cells, and that SAV cysteine proteases are at least partly responsible for the degradation of stromal proteins of the chloroplast.

  16. Laboratory Detection of IZnCH_{3} (X^{1}A_{1}) : Further Evidence for Zinc Insertion

    NASA Astrophysics Data System (ADS)

    Bucchino, Matthew P.; Young, Justin P.; Sheridan, Phil M.; Ziurys, Lucy M.

    2013-06-01

    Millimeter-wave direct absorption techniques were used to record the pure rotational spectrum of IZnCH_{3} (X^{1}A_{1}). This species was produced by the reaction of zinc vapor with ICH_{3} in the presence of a DC discharge. Rotational transitions ranging from J = 109 {→} 108 to J = 122 {→} 121 were recorded for I^{64}ZnCH_{3} and I^{66}ZnCH_{3} in the frequency range of 250{-290} GHz. The Ka = 0{-4} components were measured for each transition, with the K-ladder structure and nuclear spin statistics indicative of a symmetric top. As with HZnCH_{3} (X^{1}A_{1}), the detection of IZnCH_{3} provides further evidence for a zinc insertion process.

  17. No evidence for disturbed COL1A1 and A2 expression in otosclerosis.

    PubMed

    Csomor, Péter; Liktor, Balázs; Liktor, Bálint; Sziklai, István; Karosi, Tamás

    2012-09-01

    Otosclerosis is a complex bone remodeling disorder of the human otic capsule that might be associated with various mutations of A1 and A2 alleles of type-I collagen. The study herein presented, investigates the possibilty of the genetic involvement of type-I collagen in the pathogenesis of histologically confirmed otosclerosis. A total of 55 ankylotic stapes footplates were analyzed. Cortical bone fragments (n = 30), incus (n = 3) and malleus (n = 2) specimens were employed as negative controls. Specimens were divided into two groups. The first group was processed using conventional H.E. hematoxylin-eosin (H.E.) staining and type-I collagen-specific immunofluorescent assay (IFA), while the second group was examined by COL1A1 and A2-specific RT-PCR. Otosclerotic- (n = 31) and non-otosclerotic stapes footplates (n = 9) as well as cortical bones (n = 20), incus (n = 2) and malleus specimens (n = 1) showed normal and quite similar A1 and A2 allele expression confirmed by IFA. RT-PCR analysis revealed normal and consistent mRNA expression of both alleles in each specimen. Expression levels and patterns of COL1A1/A2 alleles did not show significant correlation with the histological diagnosis of otosclerosis. Type-I collagen is a highly conserved structure protein, which plays a fundamental role in the integritiy of various connective tissues. Mutations of A1 and A2 alleles result in serious systemic disorders of the skeleton, tendons and skin. Since otosclerosis is an organ-specific disease, it is difficult to explain its genetic association with type-I collagen. In conclusion, we found no evidence supporting the putative link of COL1A1 and COL1A2 alleles with otosclerosis.

  18. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  19. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage.

    PubMed

    Tchetina, Elena V; Markova, Galina A; Poole, A Robin; Zukor, David J; Antoniou, John; Makarov, Sergey A; Kuzin, Aleksandr N

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1-50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10-50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  20. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    PubMed Central

    Markova, Galina A.; Poole, A. Robin; Zukor, David J.; Antoniou, John; Makarov, Sergey A.; Kuzin, Aleksandr N.

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients. PMID:28042296

  1. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  2. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  3. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  4. No evidence for association between SLC11A1 and visceral leishmaniasis in India

    PubMed Central

    2011-01-01

    Background SLC11A1 has pleiotropic effects on macrophage function and remains a strong candidate for infectious disease susceptibility. 5' and/or 3' polymorphisms have been associated with tuberculosis, leprosy, and visceral leishmaniasis (VL). Most studies undertaken to date were under-powered, and none has been replicated within a population. Association with tuberculosis has replicated variably across populations. Here we investigate SLC11A1 and VL in India. Methods Nine polymorphisms (rs34448891, rs7573065, rs2276631, rs3731865, rs17221959, rs2279015, rs17235409, rs17235416, rs17229009) that tag linkage disequilibrium blocks across SLC11A1 were genotyped in primary family-based (313 cases; 176 families) and replication (941 cases; 992 controls) samples. Family- and population-based analyses were performed to look for association between SLC11A1 variants and VL. Quantitative RT/PCR was used to compare SLC11A1 expression in mRNA from paired splenic aspirates taken before and after treatment from 24 VL patients carrying different genotypes at the functional promoter GTn polymorphism (rs34448891). Results No associations were observed between VL and polymorphisms at SLC11A1 that were either robust to correction for multiple testing or replicated across primary and replication samples. No differences in expression of SLC11A1 were observed when comparing pre- and post-treatment samples, or between individuals carrying different genotypes at the GTn repeat. Conclusions This is the first well-powered study of SLC11A1 as a candidate for VL, which we conclude does not have a major role in regulating VL susceptibility in India. PMID:21599885

  5. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  6. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  7. Evidence for an A1-adenosine receptor in the guinea-pig atrium.

    PubMed Central

    Collis, M. G.

    1983-01-01

    1 The purpose of this study was to determine whether the adenosine receptor that mediates a decrease in the force of contraction of the guinea-pig atrium is of the A1- or A2-sub-type. 2 Concentration-response curves to adenosine and a number of 5'- and N6-substituted analogues were constructed and the order of potency of the purines was: 5'-N-cyclopropylcarboxamide adenosine (NCPCA) = 5'-N-ethylcarboxamide adenosine (NECA) greater than N6cyclohexyladenosine (CHA) greater than L-N6-phenylisopropyl adenosine (L-PIA) = 2-chloroadenosine- greater than adenosine greater than D-N6-phenylisopropyl adenosine (D-PIA). 3 The difference in potency between the stereoisomers D- and L-PIA was over 100 fold. 4 The adenosine transport inhibitor, dipyridamole, potentiated submaximal responses to adenosine but had no significant effect on those evoked by the other purines. 5 Theophylline antagonized responses evoked by all purines, and with D-PIA revealed a positive inotropic effect that was abolished by atenolol. 6 The results indicate the existence of an adenosine A1-receptor in the guinea-pig atrium. PMID:6297647

  8. Combining Cationic Liposomal Delivery with MPL-TDM for Cysteine Protease Cocktail Vaccination against Leishmania donovani : Evidence for Antigen Synergy and Protection

    PubMed Central

    Das, Amrita; Ali, Nahid

    2014-01-01

    Background With the paucity of new drugs and HIV co-infection, vaccination remains an unmet research priority to combat visceral leishmaniasis (VL) requiring strong cellular immunity. Protein vaccination often suffers from low immunogenicity and poor generation of memory T cells for long-lasting protection. Cysteine proteases (CPs) are immunogenic proteins and key mediators of cellular functions in Leishmania. Here, we evaluated the vaccine efficacies of CPs against VL, using cationic liposomes with Toll like receptor agonists for stimulating host immunity against L. donovani in a hamster model. Methodology/Principal Findings Recombinant CPs type I (cpb), II (cpa) and III (cpc) of L. donovani were tested singly and in combination as a triple antigen cocktail for antileishmanial vaccination in hamsters. We found the antigens to be highly immunoreactive and persistent anti-CPA, anti-CPB and anti-CPC antibodies were detected in VL patients even after cure. The liposome-entrapped CPs with monophosphoryl lipid A-Trehalose dicorynomycolate (MPL-TDM) induced significantly high nitric oxide (up to 4 fold higher than controls) mediated antileishmanial activity in vitro, and resulted in strong in vivo protection. Among the three CPs, CPC emerged as the most potent vaccine candidate in combating the disease. Interestingly, a synergistic increase in protection was observed with liposomal CPA, CPB and CPC antigenic cocktail which reduced the organ parasite burden by 1013–1016 folds, and increased the disease-free survival of >80% animals at least up to 6 months post infection. Robust secretion of IFN-γ and IL-12, along with concomitant downregulation of Th2 cytokines, was observed in cocktail vaccinates, even after 3 months post infection. Conclusion/Significance The present study is the first report of a comparative efficacy of leishmanial CPs and their cocktail using liposomal formulation with MPL-TDM against L. donovani. The level of protection attained has not been

  9. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed Central

    Suleman, Louise

    2016-01-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes. PMID:27785379

  10. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  11. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  12. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  13. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  14. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  15. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  16. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  17. An in silico approach to understand the structure-function properties of a serine protease (Bacifrinase) from Bacillus cereus and experimental evidence to support the interaction of Bacifrinase with fibrinogen and thrombin.

    PubMed

    Bora, Bandana; Biswas, Akash Deep; Gurung, Arun Bahadur; Bhattacharjee, Atanu; Mattaparthi, Venkata Satish Kumar; Mukherjee, Ashis K

    2017-02-01

    Microbial fibrinogenolytic serine proteases find therapeutic applications in the treatment of thrombosis- and hyperfibrinogenemia-associated disorders. However, analysis of structure-function properties of an enzyme is utmost important before its commercial application. In this study, an attempt has been made to understand the structure of a fibrinogenolytic protease enzyme, "Bacifrinase" from Bacillus cereus strain AB01. From the molecular dynamics trajectory analysis, the modelled three-dimensional structure of the protease was found to be stable and the presence of a catalytic triad made up of Asp102, His83 and Ser195 suggests that it is a serine protease. To understand the mechanism of enzyme-substrate and enzyme-inhibitor interactions, the equilibrated protein was docked with human fibrinogen (the physiological substrate of this enzyme), human thrombin and with ten selective protease inhibitors. The Bacifrinase-chymostatin interaction was the strongest among the selected protease inhibitors. The serine protease inhibitor phenyl methane sulphonyl fluoride was found to interact with the Ser134 residue of Bacifrinase. Furthermore, protein-protein docking study revealed the fibrinogenolytic property of Bacifrinase and its interaction with Aα-, Bβ- and Cγ-chains human fibrinogen to a different extent. However, biochemical analysis showed that Bacifrinase did not hydrolyse the γ-chain of fibrinogen. The in silico and spectrofluorometric studies also showed interaction of Bacifrinase with thrombin as well as fibrinogen with a Kd value of 16.5 and .81 nM, respectively. Our findings have shed light on the salient structural features of Bacifrinase and confirm that it is a fibrinogenolytic serine protease.

  18. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  19. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  20. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  1. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  2. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  3. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  4. Feces Derived Allergens of Tyrophagus putrescentiae Reared on Dried Dog Food and Evidence of the Strong Nutritional Interaction between the Mite and Bacillus cereus Producing Protease Bacillolysins and Exo-chitinases

    PubMed Central

    Erban, Tomas; Rybanska, Dagmar; Harant, Karel; Hortova, Bronislava; Hubert, Jan

    2016-01-01

    Tyrophagus putrescentiae (Schrank, 1781) is an emerging source of allergens in stored products and homes. Feces proteases are the major allergens of astigmatid mites (Acari: Acaridida). In addition, the mites are carriers of microorganisms and microbial adjuvant compounds that stimulate innate signaling pathways. We sought to analyze the mite feces proteome, proteolytic activities, and mite-bacterial interaction in dry dog food (DDF). Proteomic methods comprising enzymatic and zymographic analysis of proteases and 2D-E-MS/MS were performed. The highest protease activity was assigned to trypsin-like proteases; lower activity was assigned to chymotrypsin-like proteases, and the cysteine protease cathepsin B-like had very low activity. The 2D-E-MS/MS proteomic analysis identified mite trypsin allergen Tyr p3, fatty acid-binding protein Tyr p13 and putative mite allergens ferritin (Grp 30) and (poly)ubiquitins. Tyr p3 was detected at different positions of the 2D-E. It indicates presence of zymogen at basic pI, and mature-enzyme form and enzyme fragment at acidic pI. Bacillolysins (neutral and alkaline proteases) of Bacillus cereus symbiont can contribute to the protease activity of the mite extract. The bacterial exo-chitinases likely contribute to degradation of mite exuviae, mite bodies or food boluses consisting of chitin, including the peritrophic membrane. Thus, the chitinases disrupt the feces and facilitate release of the allergens. B. cereus was isolated and identified based on amplification and sequencing of 16S rRNA and motB genes. B. cereus was added into high-fat, high-protein (DDF) and low-fat, low-protein (flour) diets to 1 and 5% (w/w), and the diets palatability was evaluated in 21-day population growth test. The supplementation of diet with B. cereus significantly suppressed population growth and the suppressive effect was higher in the high-fat, high-protein diet than in the low-fat, low-protein food. Thus, B. cereus has to coexist with the mite in

  5. Feces Derived Allergens of Tyrophagus putrescentiae Reared on Dried Dog Food and Evidence of the Strong Nutritional Interaction between the Mite and Bacillus cereus Producing Protease Bacillolysins and Exo-chitinases.

    PubMed

    Erban, Tomas; Rybanska, Dagmar; Harant, Karel; Hortova, Bronislava; Hubert, Jan

    2016-01-01

    Tyrophagus putrescentiae (Schrank, 1781) is an emerging source of allergens in stored products and homes. Feces proteases are the major allergens of astigmatid mites (Acari: Acaridida). In addition, the mites are carriers of microorganisms and microbial adjuvant compounds that stimulate innate signaling pathways. We sought to analyze the mite feces proteome, proteolytic activities, and mite-bacterial interaction in dry dog food (DDF). Proteomic methods comprising enzymatic and zymographic analysis of proteases and 2D-E-MS/MS were performed. The highest protease activity was assigned to trypsin-like proteases; lower activity was assigned to chymotrypsin-like proteases, and the cysteine protease cathepsin B-like had very low activity. The 2D-E-MS/MS proteomic analysis identified mite trypsin allergen Tyr p3, fatty acid-binding protein Tyr p13 and putative mite allergens ferritin (Grp 30) and (poly)ubiquitins. Tyr p3 was detected at different positions of the 2D-E. It indicates presence of zymogen at basic pI, and mature-enzyme form and enzyme fragment at acidic pI. Bacillolysins (neutral and alkaline proteases) of Bacillus cereus symbiont can contribute to the protease activity of the mite extract. The bacterial exo-chitinases likely contribute to degradation of mite exuviae, mite bodies or food boluses consisting of chitin, including the peritrophic membrane. Thus, the chitinases disrupt the feces and facilitate release of the allergens. B. cereus was isolated and identified based on amplification and sequencing of 16S rRNA and motB genes. B. cereus was added into high-fat, high-protein (DDF) and low-fat, low-protein (flour) diets to 1 and 5% (w/w), and the diets palatability was evaluated in 21-day population growth test. The supplementation of diet with B. cereus significantly suppressed population growth and the suppressive effect was higher in the high-fat, high-protein diet than in the low-fat, low-protein food. Thus, B. cereus has to coexist with the mite in

  6. Evidence of mutualism between two periodontal pathogens: co-operative haem acquisition by the HmuY haemophore of Porphyromonas gingivalis and the cysteine protease interpain A (InpA) of Prevotella intermedia.

    PubMed

    Byrne, D P; Potempa, J; Olczak, T; Smalley, J W

    2013-06-01

    Haem (iron protoporphyrin IX) is both an essential growth factor and a virulence regulator of the periodontal pathogens Porphyromonas gingivalis and Prevotella intermedia, which acquire it through the proteolytic degradation of haemoglobin and other haem-carrying plasma proteins. The haem-binding lipoprotein HmuY haemophore and the gingipain proteases of P. gingivalis form a unique synthrophic system responsible for capture of haem from haemoglobin and methaemalbumin. In this system, methaemoglobin is formed from oxyhaemoglobin by the activities of gingipain proteases and serves as a facile substrate from which HmuY can capture haem. This study examined the possibility of cooperation between HmuY and the cysteine protease interpain A (InpA) of Pr. intermedia in the haem acquisition process. Using UV-visible spectroscopy and polyacrylamide gel electrophoresis, HmuY was demonstrated to be resistant to proteolysis and so able to cooperate with InpA to extract haem from haemoglobin, which was proteolytically converted to methaemoglobin by the protease. Spectroscopic pH titrations showed that both the iron(II) and iron(III) protoporphyrin IX-HmuY complexes were stable over the pH range 4-10, demonstrating that the haemophore could function over a range of pH that may be encountered in the dental plaque biofilm. This is the first demonstration of a bacterial haemophore working in conjunction with a protease from another bacterial species to acquire haem from haemoglobin and may represent mutualism between P. gingivalis and Pr. intermedia co-inhabiting the periodontal pocket.

  7. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases.

  8. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  9. Enteric bacterial proteases in inflammatory bowel disease- pathophysiology and clinical implications.

    PubMed

    Carroll, Ian M; Maharshak, Nitsan

    2013-01-01

    Numerous reports have identified a dysbiosis in the intestinal microbiota in patients suffering from inflammatory bowel diseases (IBD), yet the mechanism(s) in which this complex microbial community initiates or perpetuates inflammation remains unclear. The purpose of this review is to present evidence for one such mechanism that implicates enteric microbial derived proteases in the pathogenesis of IBD. We highlight and discuss studies demonstrating that proteases and protease receptors are abundant in the digestive system. Additionally, we investigate studies demonstrating an association between increased luminal protease activity and activation of protease receptors, ultimately resulting in increased intestinal permeability and exacerbation of colitis in animal models as well as in human IBD. Proteases are essential for the normal functioning of bacteria and in some cases can serve as virulence factors for pathogenic bacteria. Although not classified as traditional virulence factors, proteases originating from commensal enteric bacteria also have a potential association with intestinal inflammation via increased enteric permeability. Reports of increased protease activity in stools from IBD patients support a possible mechanism for a dysbiotic enteric microbiota in IBD. A better understanding of these pathways and characterization of the enteric bacteria involved, their proteases, and protease receptors may pave the way for new therapeutic approaches for these diseases.

  10. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  11. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  12. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  13. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  14. Evidence for the 2B1-2A1 electronic transition in chlorine dioxide from resonance Raman depolarization ratios

    NASA Astrophysics Data System (ADS)

    Reid, Philip J.; Esposito, Anthony P.; Foster, Catherine E.; Beckman, Robert A.

    1997-11-01

    The resonance Raman depolarization ratios of chlorine dioxide (OClO) dissolved in cyclohexane are measured and analyzed to establish the existence of a 2A1 excited state that is nearly degenerate with the optically stronger, 2A2 excited state. The depolarization ratio of the symmetric stretch fundamental transition is measured at several excitation wavelengths spanning the lowest-energy electronic transition centered at ˜360 nm. The depolarization ratio of this transition reaches a maximum value of 0.25±0.04 directly on resonance suggesting that scattered intensity is not derived from a single excited state. The depolarization ratios are modeled utilizing the time-dependent formalism for Raman scattering. This analysis demonstrates that the observed Raman depolarization ratios are derived from contributions of two excited states of 2A1 and 2A2 symmetry to the observed scattering. The results presented here support the emerging picture of OClO excited-state reaction dynamics in which photoexcitation to the 2A2 excited state is followed by internal conversion from this state to the 2A1 surface. Both the role of the 2A1 state in the photochemistry of OClO and the importance of this state in modeling resonance Raman intensities are discussed.

  15. CYP1A1 polymorphism interactions with smoking status in oral cancer risk: evidence from epidemiological studies.

    PubMed

    Yu, Kai-Tao; Ge, Cheng; Xu, Xiao-Fang; Zou, Jing-Cai; Zou, Xuan; Zhen, Shuai

    2014-11-01

    The cytochrome CYP1A1 gene has been implicated in the etiology of oral cancer. However, the results have been inconsistent. In this study, a meta-analysis was performed to clarify the associations of polymorphisms in CYP1A1 gene with oral cancer risk. Published literatures from PubMed, MEDLINE, EMBASE, and China National Knowledge infrastructure (CNKI) databases were retrieved. A total of 12 studies were included in this meta-analysis. We found that significant positive associations between CYP1A1*2A polymorphism and oral cancer risk in recessive model (CC vs. TC + TT, OR = 1.93), dominant model (CC + TC vs. TT, OR = 1.33), and additive model (CC vs. TT, OR = 1.97). In subgroup analysis based on the ethnicity of study population, significant associations were found in all three genetic models for Asians (recessive OR = 2.29, 95% CI =  .42-3.71; dominant OR = 1.54, 95% CI = 1.03-2.31; additive OR  2.39, 95% CI = 1.47-3.88) but not non-Asians. For the smoking stratification, the result indicated a significant association between CYP1A1*2A polymorphism and oral cancer among the smoking subjects (OR = 1.83, 95% CI = 1.47-2.26). This meta-analysis indicated a marked association of CYP1A1*2A polymorphisms with oral cancer risk, particularly among Asians, whereas there were significant interactions between the polymorphisms and cigarette smoking on oral cancer risk.

  16. Plant proteases for bioactive peptides release: A review.

    PubMed

    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y

    2017-04-10

    Proteins are a potential source of health promoting biomolecules with medical, nutraceutical and food applications. Nowadays, bioactive peptides production, its isolation, characterization and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food-proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  17. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  18. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.

    PubMed

    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M

    2014-01-01

    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  19. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  20. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  1. Hubble Space Telescope Spectroscopic Evidence for a 1 X 10 9 Msun Black Hole in NGC 4594

    NASA Astrophysics Data System (ADS)

    Kormendy, John; Bender, Ralf; Ajhar, Edward A.; Dressler, Alan; Faber, S. M.; Gebhardt, Karl; Grillmair, Carl; Lauer, Tod R.; Richstone, Douglas; Tremaine, Scott

    1996-12-01

    The discovery by Kormendy of a M• ~= 109 Msolar massive dark object (MDO) in NGC 4594 is confirmed with higher resolution spectroscopy from the Canada-France-Hawaii Telescope (CFHT) and the Hubble Space Telescope (HST). CFHT measurements with the Subarcsecond Imaging Spectrograph improve the resolution from sigma * = 0."40 to 0."27 Gaussian dispersion radius of the point-spread function (PSF). The apparent central velocity dispersion rises from sigma = 250 +/- 7 km s-1 to sigma = 286 +/- 7 km s-1. As observed with the COSTAR-corrected HST, the Faint Object Spectrograph, and a 0."21 aperture, sigma = 321 +/- 7 km s-1 is still higher, and the central rotation curve is very steep. The highest-M• published dynamical model fits the new observations reasonably well when "observed" at HST resolution. The spatial resolution has now improved by a factor of ~5 since the discovery measurements, and the case for a black hole (BH) has strengthened correspondingly. We confirm that NGC 4594 has a Seyfert spectrum; H alpha is ~5200 km s-1 wide at zero intensity. However, gas velocities are lower than the circular velocities implied by the stars, so they cannot be used to test the BH case in NGC 4594. The gas may be in a ring, or it may be associated with patchy dust. HST images with the Wide Field and Planetary Camera 2 show dust at some aperture positions. NGC 4594 appears to have a bright point nucleus. However, the central absorption-line strengths are low, consistent with dilution by enough nonthermal light to explain the "nucleus." There is no evidence for a distinct nuclear star cluster. NGC 4594 is similar to M87, which also has a nonthermal nuclear source, and not to M31 and NGC 3115, which have quiescent BHs and nuclear star clusters.

  2. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  3. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  4. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  5. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  6. Protease inhibitor in scorpion (Mesobuthus eupeus) venom prolongs the biological activities of the crude venom.

    PubMed

    Ma, Hakim; Xiao-Peng, Tang; Yang, Shi-Long; Lu, Qiu-Min; Lai, Ren

    2016-08-01

    It is hypothesized that protease inhibitors play an essential role in survival of venomous animals through protecting peptide/protein toxins from degradation by proteases in their prey or predators. However, the biological function of protease inhibitors in scorpion venoms remains unknown. In the present study, a trypsin inhibitor was purified and characterized from the venom of scorpion Mesobuthus eupeus, which enhanced the biological activities of crude venom components in mice when injected in combination with crude venom. This protease inhibitor, named MeKTT-1, belonged to Kunitz-type toxins subfamily. Native MeKTT-1 selectively inhibited trypsin with a Kivalue of 130 nmol·L(-1). Furthermore, MeKTT-1 was shown to be a thermo-stable peptide. In animal behavioral tests, MeKTT-1 prolonged the pain behavior induced by scorpion crude venom, suggesting that protease inhibitors in scorpion venom inhibited proteases and protect the functionally important peptide/protein toxins from degradation, consequently keeping them active longer. In conclusion, this was the first experimental evidence about the natural existence of serine protease inhibitor in the venom of scorpion Mesobuthus eupeus, which preserved the activity of venom components, suggests that scorpions may use protease inhibitors for survival.

  7. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.

    PubMed

    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz

    2012-11-01

    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  8. Taspase1: a 'misunderstood' protease with translational cancer relevance.

    PubMed

    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H

    2016-06-30

    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  9. Determination of the protease cleavage site repertoire—The RNase H but not the RT domain is essential for foamy viral protease activity

    SciTech Connect

    Spannaus, Ralf; Bodem, Jochen

    2014-04-15

    In contrast to orthoretroviruses, the foamy virus protease is only active as a protease-reverse transcriptase fusion protein and requires viral RNA for activation. Maturation of foamy viral proteins seems to be restricted to a single cleavage site in Gag and Pol. We provide evidence that unprocessed Gag is required for optimal infectivity, which is unique among retroviruses. Analyses of the cleavage site sequences of the Gag and Pol cleavage sites revealed a high similarity compared to those of Lentiviruses. We show that positions P2' and P2 are invariant and that Gag and Pol cleavage sites are processed with similar efficiencies. The RNase H domain is essential for protease activity, but can functionally be substituted by RNase H domains of other retroviruses. Thus, the RNase H domain might be involved in the stabilization of the protease dimer, while the RT domain is essential for RNA dependent protease activation. - Highlights: • Unprocessed Gag is required for optimal infectivity of foamy viruses. • Positions P2 and P2' are invariant in the foamy viral cleavage sites. • The RNaseH domain is essential for protease activity. • The RNaseH domains of other retroviruses support foamy viral protease activity.

  10. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  11. Characterization of 18 new mutations in COL7A1 in recessive dystrophic epidermolysis bullosa provides evidence for distinct molecular mechanisms underlying defective anchoring fibril formation.

    PubMed Central

    Hovnanian, A; Rochat, A; Bodemer, C; Petit, E; Rivers, C A; Prost, C; Fraitag, S; Christiano, A M; Uitto, J; Lathrop, M; Barrandon, Y; de Prost, Y

    1997-01-01

    We have characterized 21 mutations in the type VII collagen gene (COL7A1) encoding the anchoring fibrils, 18 of which were not previously reported, in patients from 15 unrelated families with recessive dystrophic epidermolysis bullosa (RDEB). COL7A1 mutations in both alleles were identified by screening the 118 exons of COL7A1 and flanking intron regions. Fourteen mutations created premature termination codons (PTCs) and consisted of nonsense mutations, small insertions, deletions, and splice-site mutations. A further seven mutations predicted glycine or arginine substitutions in the collagenous domain of the molecule. Two mutations were found in more than one family reported in this study, and six of the seven missense mutations showed clustering within exons 72-74 next to the hinge region of the protein. Patients who were homozygous or compound heterozygotes for mutations leading to PTCs displayed both absence or drastic reduction of COL7A1 transcripts and undetectable type VII collagen protein in skin. In contrast, missense mutations were associated with clearly detectable COL7A1 transcripts and with normal or reduced expression of type VII collagen protein at the dermo/epidermal junction. Our results provide evidence for at least two distinct molecular mechanisms underlying defective anchoring fibril formation in RDEB: one involving PTCs leading to mRNA instability and absence of protein synthesis, the other implicating missense mutations resulting in the synthesis of type VII collagen polypeptide with decreased stability and/or altered function. Genotype-phenotype correlations suggested that the nature and location of these mutations are important determinants of the disease phenotype and showed evidence for interfamilial phenotypic variability. Images Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 PMID:9326325

  12. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  13. Characterization of a New S8 serine Protease from Marine Sedimentary Photobacterium sp. A5–7 and the Function of Its Protease-Associated Domain

    PubMed Central

    Li, Hui-Juan; Tang, Bai-Lu; Shao, Xuan; Liu, Bai-Xue; Zheng, Xiao-Yu; Han, Xiao-Xu; Li, Ping-Yi; Zhang, Xi-Ying; Song, Xiao-Yan; Chen, Xiu-Lan

    2016-01-01

    Bacterial extracellular proteases are important for bacterial nutrition and marine sedimentary organic nitrogen degradation. However, only a few proteases from marine sedimentary bacteria have been characterized. Some subtilases have a protease-associated (PA) domain inserted in the catalytic domain. Although structural analysis and deletion mutation suggests that the PA domain in subtilases is involved in substrate binding, direct evidence to support this function is still absent. Here, a protease, P57, secreted by Photobacterium sp. A5-7 isolated from marine sediment was characterized. P57 could hydrolyze casein, gelatin and collagen. It showed the highest activity at 40°C and pH 8.0. P57 is a new subtilase, with 63% sequence identity to the closest characterized protease. Mature P57 contains a catalytic domain and an inserted PA domain. The recombinant PA domain from P57 was shown to have collagen-binding ability, and Phe349 and Tyr432 were revealed to be key residues for collagen binding in the PA domain. This study first shows direct evidence that the PA domain of a subtilase can bind substrate, which provides a better understanding of the function of the PA domain of subtilases and bacterial extracellular proteases from marine sediment. PMID:28066343

  14. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  15. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  16. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  17. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  18. Protease activation of the entomocidal protoxin of Bacillus thuringiensis subsp. kurstaki.

    PubMed

    Andrews, R E; Bibilos, M M; Bulla, L A

    1985-10-01

    Two isolates of Bacillus thuringiensis subsp. kurstaki were examined which produced different levels of intracellular proteases. Although the crystals from both strains had comparable toxicity, one of the strains, LB1, had a strong polypeptide band at 68,000 molecular weight in the protein from the crystal; in the other, HD251, no such band was evident. When the intracellular proteases in both strains were measured, strain HD251 produced less than 10% of the proteolytic activity found in LB1. These proteases were primarily neutral metalloproteases, although low levels of other proteases were detected. In LB1, the synthesis of protease increased as the cells began to sporulate; however, in HD251, protease activity appeared much later in the sporulation cycle. The protease activity in strain LB1 was very high when the cells were making crystal toxin, whereas in HD251 reduced proteolytic activity was present during crystal toxin synthesis. The insecticidal toxin (molecular weight, 68,000) from both strains could be prepared by cleaving the protoxin (molecular weight, 135,000) with trypsin, followed by ion-exchange chromatography. The procedure described gave quantitative recovery of toxic activity, and approximately half of the total protein was recovered. Calculations show that these results correspond to stoichiometric conversion of protoxin to insecticidal toxin. The toxicities of whole crystals, soluble crystal protein, and purified toxin from both strains were comparable.

  19. Antimicrobial proteins and peptides in human lung diseases: A friend and foe partnership with host proteases.

    PubMed

    Lecaille, Fabien; Lalmanach, Gilles; Andrault, Pierre-Marie

    2016-03-01

    Lung antimicrobial proteins and peptides (AMPs) are major sentinels of innate immunity by preventing microbial colonization and infection. Nevertheless bactericidal activity of AMPs against Gram-positive and Gram-negative bacteria is compromised in patients with chronic obstructive pulmonary disease (COPD), cystic fibrosis (CF) and asthma. Evidence is accumulating that expression of harmful human serine proteases, matrix metalloproteases and cysteine cathepsins is markedely increased in these chronic lung diseases. The local imbalance between proteases and protease inhibitors compromises lung tissue integrity and function, by not only degrading extracellular matrix components, but also non-matrix proteins. Despite the fact that AMPs are somewhat resistant to proteolytic degradation, some human proteases cleave them efficiently and impair their antimicrobial potency. By contrast, certain AMPs may be effective as antiproteases. Host proteases participate in concert with bacterial proteases in the degradation of key innate immunity peptides/proteins and thus may play immunomodulatory activities during chronic lung diseases. In this context, the present review highlights the current knowledge and recent discoveries on the ability of host enzymes to interact with AMPs, providing a better understanding of the role of human proteases in innate host defense.

  20. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  1. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  2. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  3. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  4. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  5. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  6. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  7. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  8. Developmentally linked changes in proteases and protease inhibitors suggest a role for potato multicystatin in regulating protein content of potato tubers.

    PubMed

    Weeda, Sarah M; Mohan Kumar, G N; Richard Knowles, N

    2009-06-01

    The soluble protein fraction of fully developed potato (Solanum tuberosum L.) tubers is dominated by patatin, a 40 kD storage glycoprotein, and protease inhibitors. Potato multicystatin (PMC) is a multidomain Cys-type protease inhibitor. PMC effectively inhibits degradation of patatin by tuber proteases in vitro. Herein we show that changes in PMC, patatin concentration, activities of various proteases, and their gene expression are temporally linked during tuber development, providing evidence that PMC has a role in regulating tuber protein content in vivo. PMC was barely detectable in non-tuberized stolons. PMC transcript levels increased progressively during tuberization, concomitant with a 40-fold increase in PMC concentration (protein basis) as tubers developed to 10 g fresh wt. Further increases in PMC were comparatively modest (3.7-fold) as tubers developed to full maturity (250 g). Protease activity declined precipitously as PMC levels increased during tuberization. Proteolytic activity was highest in non-tuberized stolons and fell substantially through the 10-g fresh wt stage. Cys-type proteases dominated the pre-tuberization and earliest stages of tuber development. Increases in patatin transcript levels during tuberization were accompanied by a notable lag in patatin accumulation. Patatin did not begin to accumulate substantially on a protein basis until tubers had reached the 10-g stage, wherein protease activity had been inhibited by approximately 60%. These results indicate that a threshold level of PMC (ca. 3 microg tuber(-1), 144 ng mg(-1) protein) is needed to favor patatin accumulation. Collectively, these results are consistent with a role for PMC in facilitating the accumulation of proteins in developing tubers by inhibiting Cys-type proteases.

  9. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  10. Approaches for Analyzing the Roles of Mast Cells and Their Proteases In Vivo

    PubMed Central

    Galli, Stephen J.; Tsai, Mindy; Marichal, Thomas; Tchougounova, Elena; Reber, Laurent L.; Pejler, Gunnar

    2016-01-01

    The roles of mast cells in health and disease remain incompletely understood. While the evidence that mast cells are critical effector cells in IgE-dependent anaphylaxis and other acute IgE-mediated allergic reactions seems unassailable, studies employing various mice deficient in mast cells or mast cell-associated proteases have yielded divergent conclusions about the roles of mast cells or their proteases in certain other immunological responses. Such “controversial” results call into question the relative utility of various older versus newer approaches to ascertain the roles of mast cells and mast cell proteases in vivo. This review discusses how both older and more recent mouse models have been used to investigate the functions of mast cells and their proteases in health and disease. We particularly focus on settings in which divergent conclusions about the importance of mast cells and their proteases have been supported by studies that employed different models of mast cell or mast cell protease deficiency. We think that two major conclusions can be drawn from such findings: (1) no matter which models of mast cell or mast cell protease deficiency one employs, the conclusions drawn from the experiments always should take into account the potential limitations of the models (particularly abnormalities affecting cell types other than mast cells) and (2) even when analyzing a biological response using a single model of mast cell or mast cell protease deficiency, details of experimental design are critical in efforts to define those conditions under which important contributions of mast cells or their proteases can be identified. PMID:25727288

  11. Expression of IgA Proteases by Haemophilus influenzae in the Respiratory Tract of Adults With Chronic Obstructive Pulmonary Disease

    PubMed Central

    Murphy, Timothy F.; Kirkham, Charmaine; Jones, Megan M.; Sethi, Sanjay; Kong, Yong; Pettigrew, Melinda M.

    2015-01-01

    Background. Immunoglobulin (Ig)A proteases of Haemophilus influenzae are highly specific endopeptidases that cleave the hinge region of human IgA1 and also mediate invasion and trafficking in human respiratory epithelial cells, facilitating persistence of H. influenzae. Little is known about the expression of IgA proteases in clinical settings of H. influenzae infection. Methods. We identified and characterized IgA protease genes in H. influenzae and studied their expression and proteolytic specificity, in vitro and in vivo in 169 independent strains of H. influenzae collected longitudinally over 10 years from adults with chronic obstructive pulmonary disease. Results. The H. influenzae pangenome has 2 alleles of IgA protease genes; all strains have igaA, and 40% of strains have igaB. Each allele has 2 variants with differing proteolytic specificities for human IgA1. A total of 88% of 169 strains express IgA protease activity. Expression of the 4 forms of IgA protease varies among strains. Based on the presence of IgA1 fragments in sputum samples, each of the different forms of IgA protease is selectively expressed in the human airways during infection. Conclusions. Four variants of IgA proteases are variably expressed by H. influenzae during infection of the human airways. PMID:25995193

  12. Caffeine prevents kidney stone formation by translocation of apical surface annexin A1 crystal-binding protein into cytoplasm: In vitro evidence

    PubMed Central

    Peerapen, Paleerath; Thongboonkerd, Visith

    2016-01-01

    Recent large 3 cohorts have shown that caffeinated beverage consumption was associated with lower risk of kidney stone disease. However, its protective mechanisms remained unknown and had not been previously investigated. We thus evaluated protective effects of caffeine (1 μM–10 mM) on calcium oxalate monohydrate (COM) kidney stone formation, using crystallization, crystal growth, cell-crystal adhesion, Western blotting, and immunofluorescence assays. The results showed that caffeine reduced crystal number but, on the other hand, increased crystal size, resulting in unchanged crystal mass, consistent with crystal growth that was not affected by caffeine. However, caffeine significantly decreased crystal-binding capacity of MDCK renal tubular cells in a dose-dependent manner. Western blotting and immunofluorescence study of COM crystal-binding proteins revealed significantly decreased level of annexin A1 on apical surface and its translocation into cytoplasm of the caffeine-treated cells, but no significant changes in other COM crystal-binding proteins (annexin A2, α-enolase, HSP70, and HSP90) were observed. Moreover, caffeine decreased intracellular [Ca2+] but increased [Ca2+] secretory index. Taken together, our findings showed an in vitro evidence of the protective mechanism of caffeine against kidney stone formation via translocation of annexin A1 from apical surface into cytoplasm to reduce the crystal-binding capacity of renal tubular epithelial cells. PMID:27924845

  13. Millimeter-Wave Studies of the Isotopologues of IZnCH3(X1A1): Geometric Parameters and Evidence for Zinc Insertion

    NASA Astrophysics Data System (ADS)

    Bucchino, Matthew; Young, Justin; Sheridan, Phillip; Ziurys, Lucy

    2014-06-01

    The laboratory detection of gas-phase IZnCH3 (X1A1), using millimeter-wave direct absorption methods, was reported previously. This work has been extended by the measurement of the pure rotational spectrum of several isotopolgues: I64ZnCH3, I66ZnCH3, I64ZnCD3, and I64Zn13CH3. These species were all created by the reaction of zinc vapor with CH3I, CD3I, or 13CH3I in the presence of a DC discharge. The zinc isotopolgues were observed in natural abundance. Rotational transitions in the range 256{-293} GHz (J = 109 {←} 108 to J = 132 {←} 131, for K = 0 to 6) have been recorded for each species. From these measurements, an r0 structure has been determined. This structure was found to be in good agreement with previous DFT calculations. Interestingly, the 110.2° Zn - C - H bond angle of IZnCH3 is identical to that of the hydrogen substituted zinc insertion complex HZnCH3 (X1A1). These data are further evidence that IZnCH3 is not created by the generation of free radical fragments, but by the direct insertion of atomic zinc into the C - I bond of iodomethane.

  14. Evidence for defect-induced superconductivity up to 49 K in (C a1 -xRx) F e2A s2

    NASA Astrophysics Data System (ADS)

    Deng, L. Z.; Lv, B.; Zhao, K.; Wei, F. Y.; Xue, Y. Y.; Wu, Z.; Chu, C. W.

    2016-02-01

    To explore the origin of the unusual nonbulk superconductivity with a Tc up to 49 K reported in the rare-earth-doped CaF e2A s2 , the chemical composition, magnetization, specific heat, resistivity, and annealing effect are systematically investigated on nominal (C a1 -xRx) F e2A s2 single crystals with different x and R =La , Ce, Pr, and Nd. All display a doping-independent Tc once superconductivity is induced, a doping-dependent low field superconducting volume fraction f , and a large magnetic anisotropy η in the superconducting state, suggesting a rather inhomogeneous superconducting state in an otherwise microscale homogenous superconductor. The wavelength dispersive spectroscopy and specific heat show the presence of defects that are closely related to f , regardless of the R involved. The magnetism further reveals that the defects are mainly superparamagnetic clusters for R =Ce , Pr, and Nd with strong intercluster interactions, implying that defects are locally self-organized. Annealing at 500 °C, without varying the doping level x , suppresses f profoundly but not the Tc. The above observations provide evidence for the crucial role of defects in the occurrence of the unusually high Tc˜49 K in (C a1 -xRx) F e2A s2 and are consistent with the interface-enhanced superconductivity recently proposed.

  15. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-01-31

    CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT...could be fully inhibited at a 1:1 molar ratio by the naturally-occuring proteinaceous trypsin inhibitors BBI from soybeans and CI from chickpeas ...substrates. These activities were fully inhibited by the proteinaceous trypsin-chymotrypsin inhibitors BBI from soybeans and CI from chickpeas when assayed

  16. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  17. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  18. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  19. The prototype foamy virus protease is active independently of the integrase domain

    PubMed Central

    2012-01-01

    Background Recently, contradictory results on foamy virus protease activity were published. While our own results indicated that protease activity is regulated by the viral RNA, others suggested that the integrase is involved in the regulation of the protease. Results To solve this discrepancy we performed additional experiments showing that the protease-reverse transcriptase (PR-RT) exhibits protease activity in vitro and in vivo, which is independent of the integrase domain. In contrast, Pol incorporation, and therefore PR activity in the viral context, is dependent on the integrase domain. To further analyse the regulation of the protease, we incorporated Pol in viruses by expressing a GagPol fusion protein, which supported near wild-type like infectivity. A GagPR-RT fusion, lacking the integrase domain, also resulted in wild-type like Gag processing, indicating that the integrase is dispensable for viral Gag maturation. Furthermore, we demonstrate with a trans-complementation assays that the PR in the context of the PR-RT protein supports in trans both, viral maturation and infectivity. Conclusion We provide evidence that the FV integrase is required for Pol encapsidation and that the FV PR activity is integrase independent. We show that an active PR can be encapsidated in trans as a GagPR-RT fusion protein. PMID:22574974

  20. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  1. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  2. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  3. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  4. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  5. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  6. Inactivation of Streptococcus pyogenes extracellular cysteine protease significantly decreases mouse lethality of serotype M3 and M49 strains.

    PubMed Central

    Lukomski, S; Sreevatsan, S; Amberg, C; Reichardt, W; Woischnik, M; Podbielski, A; Musser, J M

    1997-01-01

    Cysteine proteases have been implicated as important virulence factors in a wide range of prokaryotic and eukaryotic pathogens, but little direct evidence has been presented to support this notion. Virtually all strains of the human bacterial pathogen Streptococcus pyogenes express a highly conserved extracellular cysteine protease known as streptococcal pyrogenic exotoxin B (SpeB). Two sets of isogenic strains deficient in SpeB cysteine protease activity were constructed by integrational mutagenesis using nonreplicating recombinant plasmids containing a truncated segment of the speB gene. Immunoblot analyses and enzyme assays confirmed that the mutant derivatives were deficient in expression of enzymatically active SpeB cysteine protease. To test the hypothesis that the cysteine protease participates in host mortality, we assessed the ability of serotype M3 and M49 wild-type strains and isogenic protease-negative mutants to cause death in outbred mice after intraperitoneal inoculation. Compared to wild-type parental organisms, the serotype M3 speB mutant lost virtually all ability to cause mouse death (P < 0.00001), and similarly, the virulence of the M49 mutant was detrimentally altered (P < 0.005). The data unambiguously demonstrate that the streptococcal enzyme is a virulence factor, and thereby provide additional evidence that microbial cysteine proteases are critical in host-pathogen interactions. PMID:9169486

  7. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  8. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  9. Further Evidence for the JuSt Program as Treatment for Insomnia in Adolescents: Results from a 1-Year Follow-Up Study

    PubMed Central

    Roeser, Karolin; Schwerdtle, Barbara; Kübler, Andrea; Schlarb, Angelika A.

    2016-01-01

    Study Objectives: Insomnia in adolescence adversely affects young people's current and future functioning, as well as their mental and physical health. Thus, effective and economic treatment is invaluable. The present study evaluated a 6-session multimodal group therapy, JuSt, for adolescents suffering from insomnia including cognitive-behavioral elements and clinical hypnosis. Methods: Participants (n = 19, 68.4% female) were aged 11–16 years and suffered from insomnia. Sleep onset latency (SOL), time spent awake time after sleep onset (WASO), and sleep efficiency (SE) were measured with sleep logs before and after treatment, and at 3-, 6-, and 12-month follow-up. Results: Compared to baseline, SOL and WASO significantly decreased, while there was a significant increase in SE and the feeling of being rested after the JuSt treatment. At 12-month follow-up, all parameters were still significantly different from their baseline level. The long-term effect sizes were at least as large as the short-term effects, indicating a stable improvement. Conclusions: These results suggest that the JuSt program represents a potent intervention to sustainably reduce insomniac complaints in adolescents. Given the unselected nature of our sample, a broad indication can be assumed. To further evaluate the program's efficacy, randomized controlled trials should be conducted. Citation: Roeser K, Schwerdtle B, Kübler A, Schlarb AA. Further evidence for the just program as treatment for insomnia in adolescents: results from a 1-year follow-up study. J Clin Sleep Med 2016;12(2):257–262. PMID:26446249

  10. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  11. Mice Deficient in the Gene for Cytochrome P450 (CYP)1A1 Are More Susceptible Than Wild-Type to Hyperoxic Lung Injury: Evidence for Protective Role of CYP1A1 Against Oxidative Stress

    PubMed Central

    Wang, Lihua; Wang, Gangduo; Couroucli, Xanthi I.; Shivanna, Binoy; Welty, Stephen E.; Barrios, Roberto; Khan,  M. Firoze; Nebert, Daniel W.; Roberts, L. Jackson; Moorthy, Bhagavatula

    2014-01-01

    Hyperoxia contributes to acute lung injury in diseases such as acute respiratory distress syndrome in adults and bronchopulmonary dysplasia in premature infants. Cytochrome P450 (CYP)1A1 has been shown to modulate hyperoxic lung injury. The mechanistic role(s) of CYP1A1 in hyperoxic lung injury in vivo is not known. In this investigation, we hypothesized that Cyp1a1(–/–) mice would be more susceptible to hyperoxic lung injury than wild-type (WT) mice, and that the protective role of CYP1A1 is in part due to CYP1A1-mediated decrease in the levels of reactive oxygen species-mediated lipid hydroperoxides, e.g., F2-isoprostanes/isofurans, leading to attenuation of oxidative damage. Eight- to ten-week-old male WT (C57BL/6J) or Cyp1a1(–/–) mice were exposed to hyperoxia (>95% O2) or room air for 24–72 h. The Cyp1a1(–/–) mice were more susceptible to oxygen-mediated lung damage and inflammation than WT mice, as evidenced by increased lung weight/body weight ratio, lung injury, neutrophil infiltration, and augmented expression of IL-6. Hyperoxia for 24–48 h induced CYP1A expression at the mRNA, protein, and enzyme levels in liver and lung of WT mice. Pulmonary F2-isoprostane and isofuran levels were elevated in WT mice after hyperoxia for 24 h. On the other hand, Cyp1a1(–/–) mice showed higher levels after 48–72 h of hyperoxia exposure compared to WT mice. Our results support the hypothesis that CYP1A1 protects against hyperoxic lung injury by decreasing oxidative stress. Future research could lead to the development of novel strategies for prevention and/or treatment of acute lung injury. PMID:24893714

  12. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  13. Genetic evidence that mutations in the COL1A1, COL1A2, COL3A1, or COL5A2 collagen genes are not responsible for mitral valve prolapse.

    PubMed Central

    Henney, A M; Tsipouras, P; Schwartz, R C; Child, A H; Devereux, R B; Leech, G J

    1989-01-01

    DNA markers were used to assess the segregation of genes encoding the collagen types that predominate in the mitral valve (types I, III, and V) in two family pedigrees that are phenotypically different but showed dominantly inherited mitral valve prolapse. The inheritance of these markers was compared with the segregation of the phenotype for mitral valve prolapse in both families. In one family it was shown that the COL1A1, COL1A2, COL3A1, and COL5A2 genes segregated independently of the phenotype; in the other family the results for COL1A1, COL1A2, and COL5A2 were similar but analysis at the COL3A1 locus was not possible. These data indicate that in these families mitral valve prolapse does not arise from a defect in one of these collagen genes. PMID:2930668

  14. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  15. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  16. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  17. Interaction of hnRNP A1 with snRNPs and pre-mRNAs: evidence for a possible role of A1 RNA annealing activity in the first steps of spliceosome assembly.

    PubMed Central

    Buvoli, M; Cobianchi, F; Riva, S

    1992-01-01

    The in vitro interaction of recombinant hnRNP A1 with purified snRNPs and with pre-mRNAs was investigated. We show that protein A1 can stably bind U2 and U4 snRNP but not U1. Oligo-RNAse H cleavage of U2 nucleotides involved in base pairing with the branch site, totally eliminates the A1-U2 interaction. RNase T1 protection and immunoprecipitation experiments demonstrate that recombinant protein A1 specifically binds the 3'-end regions of both beta-globin and Ad-2 introns. However, while on the beta-globin intron only binding to the polypyrimidine tract was observed, on the Ad-2 intron a 32 nt fragment encompassing the branch point and the AG splice-site dinucleotide was bound and protected. Such protection was drastically reduced in the presence of U2 snRNP. Altogether these results indicate that protein A1 can establish a different pattern of association with different pre-mRNAs and support the hypothesis that this protein could play a role in the annealing of U2 to the branch site and hence in the early events of pre-splicing complex assembly. Images PMID:1329035

  18. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  19. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  20. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  1. The Hypervariable Amino-Terminus of P1 Protease Modulates Potyviral Replication and Host Defense Responses

    PubMed Central

    Pasin, Fabio; Simón-Mateo, Carmen; García, Juan Antonio

    2014-01-01

    The replication of many RNA viruses involves the translation of polyproteins, whose processing by endopeptidases is a critical step for the release of functional subunits. P1 is the first protease encoded in plant potyvirus genomes; once activated by an as-yet-unknown host factor, it acts in cis on its own C-terminal end, hydrolyzing the P1-HCPro junction. Earlier research suggests that P1 cooperates with HCPro to inhibit host RNA silencing defenses. Using Plum pox virus as a model, we show that although P1 does not have a major direct role in RNA silencing suppression, it can indeed modulate HCPro function by its self-cleavage activity. To study P1 protease regulation, we used bioinformatic analysis and in vitro activity experiments to map the core C-terminal catalytic domain. We present evidence that the hypervariable region that precedes the protease domain is predicted as intrinsically disordered, and that it behaves as a negative regulator of P1 proteolytic activity in in vitro cleavage assays. In viral infections, removal of the P1 protease antagonistic regulator is associated with greater symptom severity, induction of salicylate-dependent pathogenesis-related proteins, and reduced viral loads. We suggest that fine modulation of a viral protease activity has evolved to keep viral amplification below host-detrimental levels, and thus to maintain higher long-term replicative capacity. PMID:24603811

  2. Serine Protease Catalysis: A Computational Study of Tetrahedral Intermediates and Inhibitory Adducts.

    PubMed

    Ngo, Phong D; Mansoorabadi, Steven O; Frey, Perry A

    2016-08-04

    Peptide boronic acids and peptidyl trifluoromethyl ketones (TFKs) inhibit serine proteases by forming monoanionic, tetrahedral adducts to serine in the active sites. Investigators regard these adducts as analogs of monoanionic, tetrahedral intermediates. Density functional theory (DFT) calculations and fractional charge analysis show that tetrahedral adducts of model peptidyl TFKs are structurally and electrostatically very similar to corresponding tetrahedral intermediates. In contrast, the DFT calculations show the structures and electrostatic properties of analogous peptide boronate adducts to be significantly different. The peptide boronates display highly electrostatically positive boron, with correspondingly negative ligands in the tetrahedra. In addition, the computed boron-oxygen and boron-carbon bond lengths in peptide boronates (which are identical or very similar to the corresponding bonds in a peptide boronate adduct of α-lytic protease determined by X-ray crystallography at subangstrom resolution) are significantly longer than the corresponding bond lengths in model tetrahedral intermediates. Since protease-peptidyl TFKs incorporate low-barrier hydrogen bonds (LBHBs) between an active site histidine and aspartate, while the protease-peptide boronates do not, these data complement the spectroscopic and chemical evidence for the participation of LBHBs in catalysis by serine proteases. Moreover, while the potency of these classes of inhibitors can be correlated to the structures of the peptide moieties, the present results indicate that the strength of their bonds to serine contribute significantly to their inhibitory properties.

  3. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  4. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  5. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  6. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  7. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  8. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  9. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  10. Draft Genome Sequence of Cylindrospermopsis raciborskii (Cyanobacteria) Strain ITEP-A1 Isolated from a Brazilian Semiarid Freshwater Body: Evidence of Saxitoxin and Cylindrospermopsin Synthetase Genes

    PubMed Central

    Lorenzi, Adriana Sturion; Silva, Genivaldo Gueiros Z.; Lopes, Fabyano Alvares Cardoso; Chia, Mathias Ahii; Edwards, Robert A.

    2016-01-01

    Cylindrospermopsis raciborskii ITEP-A1 is a saxitoxin-producing cyanobacterium. We report the draft genome sequence of ITEP-A1, which comprised 195 contigs that were assembled with SPAdes and annotated with Rapid Annotation using Subsystem Technology. The identified genome sequence had 3,605,836 bp, 40.1% G+C, and predicted 3,553 coding sequences (including the synthetase genes). PMID:27151783

  11. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  12. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  13. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  14. The role of habituation in hippocampus-dependent spatial working memory tasks: evidence from GluA1 AMPA receptor subunit knockout mice.

    PubMed

    Sanderson, David J; Bannerman, David M

    2012-05-01

    Spatial alternation, win-shift behavior has been claimed to be a test of working memory in rodents that requires active maintenance of relevant, trial-specific information. In this review, we describe work with GluA1 AMPA receptor subunit knockout mice that show impaired spatial alternation, but normal spatial reference memory. Due to their selective impairment on spatial alternation, GluA1 knockout mice provide a means by which the psychological processes underlying alternation can be examined. We now argue that the spatial alternation deficit in GluA1 knockout mice is due to an inability to show stimulus-specific, short-term habituation to recently experienced stimuli. Short-term habituation involves a temporary reduction in attention paid to recently presented stimuli, and is thus a distinct process from those that are involved in working memory in humans. We have recently demonstrated that GluA1 knockout mice show impaired short-term habituation, but, surprisingly, show enhanced long-term spatial habituation. Thus, GluA1 deletion reveals that there is competition between short-term and long-term processes in memory.

  15. Earliest Evidence of Toxocara sp. in a 1.2-Million-Yr-Old Extinct Hyena (Pachycrocuta brevirostris) Coprolite from Northwest Pakistan.

    PubMed

    Perri, Angela R; Heinrich, Susann; Gur-Arieh, Shira; Saunders, Jeffrey J

    2017-02-01

    The study of fossil parasites can provide insight into the antiquity of host-parasite relationships and the origins and evolution of these paleoparasites. Here, a coprolite (fossilized feces) from the 1.2-million-yr-old paleontological site of Haro River Quarry in northwestern Pakistan was analyzed for paleoparasites. Micromorphological thin sectioning and Fourier-transform infrared spectrometry (FTIR) analysis confirms the coprolite belonged to a bone-eating carnivore, likely the extinct giant short-faced hyena (Pachycrocuta brevirostris). Parasitological analysis shows the coprolite to be positive for Toxocara sp. To our knowledge, this is the earliest evidence for Toxocara sp. found.

  16. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  17. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  18. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  19. CYP1A1 MspI polymorphism and the risk of oral squamous cell carcinoma: Evidence from a meta-analysis

    PubMed Central

    XIE, SHANG; LUO, CHONGDAI; SHAN, XIAOFENG; ZHAO, SHUSHAN; HE, JING; CAI, ZHIGANG

    2016-01-01

    Numerous case-control studies have investigated whether the CYP1A1 gene polymorphism is involved in the occurrence of oral squamous cell carcinoma (OSCC); however, the conclusions are inconsistent. In order to further explore the correlation and obtain a strong conclusion, a meta-analysis was performed to systematically assess the association between the CYP1A1 MspI polymorphism and risk of OSCC. In the present meta-analysis, the odds ratios (ORs) and the corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical analyses were performed with STATA 11.0 software. The heterogeneity was assessed by Q test and I2test. The final analysis included 10 studies of 1,505 cases and 1,967 controls. The overall results suggested that the CYP1A1 MspI polymorphism was significantly associated with an increased risk of OSCC (CC+TC vs. TT: OR, 1.31; 95% CI, 1.01–1.70; P=0.043; CC vs. TC+TT: OR, 2.38; 95% CI, 1.58–3.58; P<0.001; CC vs. TT: OR, 2.52; 95% CI, 1.60–3.96; P<0.001; and C vs. T: OR, 1.45; 95% CI, 1.15–1.83; P<0.001). In a stratified analysis by ethnicity, a statistically significant correlation existed in the Asian population, but not mixed-race and Caucasian populations. In conclusion, despite several limitations, the present meta-analysis established that the CYP1A1 MspI polymorphism may be a risk factor for OSCC, particularly among the Asian population. PMID:27073686

  20. Coulometric and spectroscopic analysis of the purified cytochrome d complex of Escherichia coli: evidence for the identification of "cytochrome a1" as cytochrome b595.

    PubMed

    Lorence, R M; Koland, J G; Gennis, R B

    1986-05-06

    Coulometric and spectroscopic analyses were performed on the three cytochrome components (cytochrome d, cytochrome b558, and the cytochrome previously described as cytochrome a1) of the purified cytochrome d complex, a terminal oxidase of the Escherichia coli aerobic respiratory chain. On the basis of heme extraction, spectroscopic, and coulometric data, the "cytochrome a1" component was identified as a b-type cytochrome: cytochrome b595. The pyridine hemochromogen technique revealed the presence of two molecules of protoheme IX per cytochrome d complex. This quantity of protoheme IX fully accounted for the sum of the cytochrome b558 and cytochrome b595 components as determined coulometrically. The renaming of cytochrome a1 as cytochrome b595 was further indicated by the lack of any heme a in the complex and by its resolved reduced-minus-oxidized spectrum. The latter was found to be similar to that of cytochrome c peroxidase, which contains protoheme IX. Coulometric titrations and carbon monoxide binding titrations revealed that there are two molecules of cytochrome d per complex. A convenient measurement of the amount of cytochrome b558 was found to be the beta-band at 531 nm since cytochrome b558 was observed to be the only component of the cytochrome d complex with a peak at this wavelength. By use of this method and the extinction coefficient for the purified cytochrome b558, it was estimated that there is one molecule of cytochrome b595 and one of cytochrome b558 per cytochrome complex.

  1. An Aspartic Protease of the Scabies Mite Sarcoptes scabiei Is Involved in the Digestion of Host Skin and Blood Macromolecules

    PubMed Central

    Mahmood, Wajahat; Viberg, Linda T.; Fischer, Katja; Walton, Shelley F.; Holt, Deborah C.

    2013-01-01

    Background Scabies is a disease of worldwide significance, causing considerable morbidity in both humans and other animals. The scabies mite Sarcoptes scabiei burrows into the skin of its host, obtaining nutrition from host skin and blood. Aspartic proteases mediate a range of diverse and essential physiological functions such as tissue invasion and migration, digestion, moulting and reproduction in a number of parasitic organisms. We investigated whether aspartic proteases may play role in scabies mite digestive processes. Methodology/Principle Findings We demonstrated the presence of aspartic protease activity in whole scabies mite extract. We then identified a scabies mite aspartic protease gene sequence and produced recombinant active enzyme. The recombinant scabies mite aspartic protease was capable of digesting human haemoglobin, serum albumin, fibrinogen and fibronectin, but not collagen III or laminin. This is consistent with the location of the scabies mites in the upper epidermis of human skin. Conclusions/Significance The development of novel therapeutics for scabies is of increasing importance given the evidence of emerging resistance to current treatments. We have shown that a scabies mite aspartic protease plays a role in the digestion of host skin and serum molecules, raising the possibility that interference with the function of the enzyme may impact on mite survival. PMID:24244770

  2. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  3. The association of the CYP1A1 Ile462Val polymorphism with head and neck cancer risk: evidence based on a cumulative meta-analysis

    PubMed Central

    Wang, Yadong; Yang, Haiyan; Duan, Guangcai; Wang, Haiyu

    2016-01-01

    Objective The aim of this study was to address the association between the Ile462Val polymorphism in the gene encoding cytochrome P450 1A1 (CYP1A1) and the risk of head and neck cancer (HNC). Materials and methods The Medline/PubMed, EMBASE, and Web of Science databases were searched. The strength of the association was evaluated by calculating the odds ratio (OR) with a 95% confidence interval (CI). Results Overall, we observed an increased risk of HNC in patients with the Ile/Val+Val/Val genotype compared to those with the Ile/Ile genotype among the 6,367 cases and 6,395 controls evaluated in the 34 eligible studies, with a pooled OR of 1.284 (95% CI: 1.119–1.473). In addition, we observed an increased risk of HNC in patients with the Ile/Val+Val/Val genotype compared to those with the Ile/Ile genotype in the subgroup analyses (OR =1.362, 95% CI: 1.102–1.685 for laryngeal cancer; OR =1.519, 95% CI: 1.253–1.843 for pharyngeal cancer; OR =1.371, 95% CI: 1.111–1.693 for Asians; and OR =1.329, 95% CI: 1.138–1.551 for patients in studies using hospital-based controls). Conclusion This cumulative meta-analysis suggests that the CYP1A1 Ile462Val polymorphism might contribute to the risk of HNC, particularly for pharyngeal cancer and laryngeal cancer. PMID:27274286

  4. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  5. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  6. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  7. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  8. Transcriptomic Analysis Shows Decreased Cortical Expression of NR4A1, NR4A2 and RXRB in Schizophrenia and Provides Evidence for Nuclear Receptor Dysregulation

    PubMed Central

    Corley, Susan M.; Wilkins, Marc R.; Shannon Weickert, Cynthia

    2016-01-01

    Many genes are differentially expressed in the cortex of people with schizophrenia, implicating factors that control transcription more generally. Hormone nuclear receptors dimerize to coordinate context-dependent changes in gene expression. We hypothesized that members of two families of nuclear receptors (NR4As), and retinoid receptors (RARs and RXRs), are altered in the dorsal lateral prefrontal cortex (DLPFC) of people with schizophrenia. We used next generation sequencing and then qPCR analysis to test for changes in mRNA levels for transcripts encoding nuclear receptors: orphan nuclear receptors (3 in the NR4A, 3 in the RAR, 3 in the RXR families and KLF4) in total RNA extracted from the DLPFC from people with schizophrenia compared to controls (n = 74). We also correlated mRNA levels with demographic factors and with estimates of antipsychotic drug exposure (schizophrenia group only). We tested for correlations between levels of transcription factor family members and levels of genes putatively regulated by these transcription factors. We found significantly down regulated expression of NR4A1 (Nurr 77) and KLF4 mRNAs in people with schizophrenia compared to controls, by both NGS and qPCR (p = or <0.01). We also detected decreases in NR4A2 (Nurr1) and RXRB mRNAs by using qPCR in the larger cohort (p<0.05 and p<0.01, respectively). We detected decreased expression of RARG and NR4A2 mRNAs in females with schizophrenia (p<0.05). The mRNA levels of NR4A1, NR4A2 and NR4A3 were all negative correlated with lifetime estimates of antipsychotic exposure. These novel findings, which may be influenced by antipsychotic drug exposure, implicate the orphan and retinoid nuclear receptors in the cortical pathology found in schizophrenia. Genes down stream of these receptors can be dysregulated as well, but the direction of change is not immediately predictable based on the putative transcription factor changes. PMID:27992436

  9. Suppression of Helicobacter pylori protease activity towards growth factors by sulglycotide.

    PubMed

    Piotrowski, J; Slomiany, A; Slomiany, B L

    1997-09-01

    Infection with H. pylori is now recognized as a major factor in the pathogenesis of gastric disease. Here, we examined the susceptibility of epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), transforming growth factor-beta (TGF beta) and platelet derived growth factor (PDGF) to degradation by H. pylori protease, and assessed the effect of a cytoprotective agent, sulglycotide, on this process. The 125I-labeled EGF, bFGF, TGF beta and PDGF were incubatet with H. pylori protease, obtained from the filtrates of saline washes of the bacterium culture, in the presence of 0-100 micrograms sulglycotide. The results showed that, under the assay conditions, H. pylori protease caused only 5% degradation of EGF and 7% degradation of bFGF. However, the protease evoked a 61.7% degradation of PDGF and a 62.3% degradation of TGF beta. Introduction of sulglycotide to the reaction assay system caused a dose-dependent inhibition in PDGF and TGF beta proteolysis by the H. pylori enzyme. The maximal inhibitory effect was obtained with sulglycotide at 100 micrograms/ml, at which dose an 84.4% decrease in PDGF and 88.3% decrease in TGF beta degradation was achieved. The results provide a strong evidence for the effectiveness of sulglycotide in the protection of gastric mucosal growth factors against degradation by H. pylori.

  10. Roles of proteases during invasion and egress by Plasmodium and Toxoplasma.

    PubMed

    Dowse, Timothy J; Koussis, Konstantinos; Blackman, Michael J; Soldati-Favre, Dominique

    2008-01-01

    Apicomplexan pathogens replicate exclusively within the confines of a host cell. Entry into (invasion) and exit from (egress) these cells requires an array of specialized parasite molecules, many of which have long been considered to have potential as targets of drug or vaccine-based therapies. In this chapter the authors discuss the current state of knowledge regarding the role of parasite proteolytic enzymes in these critical steps in the life cycle of two clinically important apicomplexan genera, Plasmodium and Toxoplasma. At least three distinct proteases of the cysteine mechanistic class have been implicated in egress of the malaria parasite from cells of its vertebrate and insect host. In contrast, the bulk of the evidence indicates a prime role for serine proteases of the subtilisin and rhomboid families in invasion by both parasites. Whereas proteases involved in egress may function predominantly to degrade host cell structures, proteases involved in invasion probably act primarily as maturases and 'sheddases', required to activate and ultimately remove ligands involved in interactions with the host cell.

  11. Development of a rapid phenotypic test for HCV protease inhibitors with potential use in clinical decisions

    PubMed Central

    Pessoa, Luciana Santos; Vidal, Luãnna Liebscher; da Costa, Emmerson C.B.; Abreu, Celina Monteiro; da Cunha, Rodrigo Delvecchio; Valadão, Ana Luiza Chaves; dos Santos, André Felipe; Tanuri, Amilcar

    2016-01-01

    Abstract Approximately 185 million people worldwide are chronically infected with hepatitis C virus (HCV). The first-wave of approved NS3 protease inhibitors (PIs) were Telaprevir and Boceprevir, which are currently discontinued. Simeprevir is a second-wave PI incorporated into the Brazilian hepatitis C treatment protocol. Drug resistance plays a key role in patients' treatment regimen. Here, we developed a simple phenotypic assay to evaluate the impact of resistance mutations in HCV NS3 protease to PIs, using a protein expression vector containing wild type NS3 protease domain and NS4A co-factor. We analyzed the impact of five resistance mutations (T54A, V36M, V158I, V170I and T54S+V170I) against Telaprevir, Boceprevir and Simeprevir. Protein purifications were performed with low cost methodology, and enzymatic inhibition assays were measured by FRET. We obtained recombinant proteases with detectable activity, and IC50 and fold change values for the evaluated PIs were determined. The variant T54A showed the highest reduction of susceptibility for the PIs, while the other four variants exhibited lower levels of reduced susceptibility. Interestingly, V170I showed 3.2-fold change for Simeprevir, a new evidence about this variant. These results emphasize the importance of enzymatic assays in phenotypic tests to determine which therapeutic regimen should be implemented. PMID:27575432

  12. Development of a rapid phenotypic test for HCV protease inhibitors with potential use in clinical decisions.

    PubMed

    Pessoa, Luciana Santos; Vidal, Luãnna Liebscher; Costa, Emmerson C B da; Abreu, Celina Monteiro; Cunha, Rodrigo Delvecchio da; Valadão, Ana Luiza Chaves; Santos, André Felipe Dos; Tanuri, Amilcar

    2016-01-01

    Approximately 185 million people worldwide are chronically infected with hepatitis C virus (HCV). The first-wave of approved NS3 protease inhibitors (PIs) were Telaprevir and Boceprevir, which are currently discontinued. Simeprevir is a second-wave PI incorporated into the Brazilian hepatitis C treatment protocol. Drug resistance plays a key role in patients' treatment regimen. Here, we developed a simple phenotypic assay to evaluate the impact of resistance mutations in HCV NS3 protease to PIs, using a protein expression vector containing wild type NS3 protease domain and NS4A co-factor. We analyzed the impact of five resistance mutations (T54A, V36M, V158I, V170I and T54S+V170I) against Telaprevir, Boceprevir and Simeprevir. Protein purifications were performed with low cost methodology, and enzymatic inhibition assays were measured by FRET. We obtained recombinant proteases with detectable activity, and IC50 and fold change values for the evaluated PIs were determined. The variant T54A showed the highest reduction of susceptibility for the PIs, while the other four variants exhibited lower levels of reduced susceptibility. Interestingly, V170I showed 3.2-fold change for Simeprevir, a new evidence about this variant. These results emphasize the importance of enzymatic assays in phenotypic tests to determine which therapeutic regimen should be implemented.

  13. Dipeptide-derived nitriles containing additional electrophilic sites: potentially irreversible inhibitors of cysteine proteases.

    PubMed

    Löser, Reik; Gütschow, Michael

    2009-12-01

    Heterocyclic and open-chain dipeptide-derived nitriles have been synthesized, containing an additional electrophilic center enabling the subsequent covalent modification of the thioimidate nitrogen formed in situ at the active site of the enzyme. The inhibitory potential of these nitriles against the cysteine proteases papain and cathepsins L, S, and K was determined. The open-chain dipeptide nitriles 8 and 10 acted as moderate reversible inhibitors, but no evidence for an irreversible inhibition of these enzymes was discernable.

  14. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  15. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  16. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  17. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  18. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  19. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  20. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  1. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  2. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  3. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  4. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  5. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  6. Purification and characterization of serine proteases that exhibit caspase-like activity and are associated with programmed cell death in Avena sativa.

    PubMed

    Coffeen, Warren C; Wolpert, Thomas J

    2004-04-01

    Victoria blight of Avena sativa (oat) is caused by the fungus Cochliobolus victoriae, which is pathogenic because of the production of the toxin victorin. The victorin-induced response in sensitive A. sativa has been characterized as a form of programmed cell death (PCD) and displays morphological and biochemical features similar to apoptosis, including chromatin condensation, DNA laddering, cell shrinkage, altered mitochondrial function, and ordered, substrate-specific proteolytic events. Victorin-induced proteolysis of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is shown to be prevented by caspase-specific and general protease inhibitors. Evidence is presented for a signaling cascade leading to Rubisco proteolysis that involves multiple proteases. Furthermore, two proteases that are apparently involved in the Rubisco proteolytic cascade were purified and characterized. These proteases exhibit caspase specificity and display amino acid sequences homologous to plant subtilisin-like Ser proteases. The proteases are constitutively present in an active form and are relocalized to the extracellular fluid after induction of PCD by either victorin or heat shock. The role of the enzymes as processive proteases involved in a signal cascade during the PCD response is discussed.

  7. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  8. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  9. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.

    PubMed

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2014-02-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  10. Initiating protease with modular domains interacts with β-glucan recognition protein to trigger innate immune response in insects

    PubMed Central

    Takahashi, Daisuke; Garcia, Brandon L.; Kanost, Michael R.

    2015-01-01

    The autoactivation of an initiating serine protease upon binding of pattern recognition proteins to pathogen surfaces is a crucial step in eliciting insect immune responses such as the activation of Toll and prophenoloxidase pathways. However, the molecular mechanisms responsible for autoactivation of the initiating protease remains poorly understood. Here, we investigated the molecular basis for the autoactivation of hemolymph protease 14 (HP14), an initiating protease in hemolymph of Manduca sexta, upon the binding of β-1,3-glucan by its recognition protein, βGRP2. Biochemical analysis using HP14 zymogen (proHP14), βGRP2, and the recombinant proteins as truncated forms showed that the amino-terminal modular low-density lipoprotein receptor class A (LA) domains within HP14 are required for proHP14 autoactivation that is stimulated by its interaction with βGRP2. Consistent with this result, recombinant LA domains inhibit the activation of proHP14 and prophenoloxidase, likely by competing with the interaction between βGRP2 and LA domains within proHP14. Using surface plasmon resonance, we demonstrated that immobilized LA domains directly interact with βGRP2 in a calcium-dependent manner and that high-affinity interaction requires the C-terminal glucanase-like domain of βGRP2. Importantly, the affinity of LA domains for βGRP2 increases nearly 100-fold in the presence of β-1,3-glucan. Taken together, these results present the first experimental evidence to our knowledge that LA domains of an insect modular protease and glucanase-like domains of a βGRP mediate their interaction, and that this binding is essential for the protease autoactivation. Thus, our study provides important insight into the molecular basis underlying the initiation of protease cascade in insect immune responses. PMID:26504233

  11. Initiating protease with modular domains interacts with β-glucan recognition protein to trigger innate immune response in insects.

    PubMed

    Takahashi, Daisuke; Garcia, Brandon L; Kanost, Michael R

    2015-11-10

    The autoactivation of an initiating serine protease upon binding of pattern recognition proteins to pathogen surfaces is a crucial step in eliciting insect immune responses such as the activation of Toll and prophenoloxidase pathways. However, the molecular mechanisms responsible for autoactivation of the initiating protease remains poorly understood. Here, we investigated the molecular basis for the autoactivation of hemolymph protease 14 (HP14), an initiating protease in hemolymph of Manduca sexta, upon the binding of β-1,3-glucan by its recognition protein, βGRP2. Biochemical analysis using HP14 zymogen (proHP14), βGRP2, and the recombinant proteins as truncated forms showed that the amino-terminal modular low-density lipoprotein receptor class A (LA) domains within HP14 are required for proHP14 autoactivation that is stimulated by its interaction with βGRP2. Consistent with this result, recombinant LA domains inhibit the activation of proHP14 and prophenoloxidase, likely by competing with the interaction between βGRP2 and LA domains within proHP14. Using surface plasmon resonance, we demonstrated that immobilized LA domains directly interact with βGRP2 in a calcium-dependent manner and that high-affinity interaction requires the C-terminal glucanase-like domain of βGRP2. Importantly, the affinity of LA domains for βGRP2 increases nearly 100-fold in the presence of β-1,3-glucan. Taken together, these results present the first experimental evidence to our knowledge that LA domains of an insect modular protease and glucanase-like domains of a βGRP mediate their interaction, and that this binding is essential for the protease autoactivation. Thus, our study provides important insight into the molecular basis underlying the initiation of protease cascade in insect immune responses.

  12. Protease-activated receptors and prostaglandins in inflammatory lung disease

    PubMed Central

    Peters, Terence; Henry, Peter J

    2009-01-01

    Protease-activated receptors (PARs) are a novel family of G protein-coupled receptors. Signalling through PARs typically involves the cleavage of an extracellular region of the receptor by endogenous or exogenous proteases, which reveals a tethered ligand sequence capable of auto-activating the receptor. A considerable body of evidence has emerged over the past 20 years supporting a prominent role for PARs in a variety of human physiological and pathophysiological processes, and thus substantial attention has been directed towards developing drug-like molecules that activate or block PARs via non-proteolytic pathways. PARs are widely expressed within the respiratory tract, and their activation appears to exert significant modulatory influences on the level of bronchomotor tone, as well as on the inflammatory processes associated with a range of respiratory tract disorders. Nevertheless, there is debate as to whether the principal response to PAR activation is an augmentation or attenuation of airways inflammation. In this context, an important action of PAR activators may be to promote the generation and release of prostanoids, such as prostglandin E2, which have well-established anti-inflammatory effects in the lung. In this review, we primarily focus on the relationship between PARs, prostaglandins and inflammatory processes in the lung, and highlight their potential role in selected respiratory tract disorders, including pulmonary fibrosis, asthma and chronic obstructive pulmonary disease. This article is part of a themed issue on Mediators and Receptors in the Resolution of Inflammation. To view this issue visit http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2009 PMID:19845685

  13. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  14. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    agents , such as Soman and Sarin . 2. Linkage to binding molecules Conjugating an antibody (or any other binding module) with an initiating protease...to develop the tools and principles necessary to engineer subtilisin proteases which specifically target and deactivate biological warfare agent (BWA...warfare agent (BWA) toxins. We have engineered and evolved subtilisin proteases to specifically target and deactivate BoNT, SEB, ricin, and B

  15. A study on trypsin, Aspergillus flavus and Bacillus sp. protease inhibitory activity in Cassia tora (L.) syn Senna tora (L.) Roxb. seed extract

    PubMed Central

    2011-01-01

    extract for 60 min. The inhibitory activity was evident in gelatin SDS-PAGE where a major band (~17-19 kD) of protease inhibitor (PI) was detected in dialyzed and SEC elute. The conidial germination of Aspergillus flavus was moderately inhibited (30%) by the dialyzed seed extract. Conclusions Cassia tora seed extract has strong protease inhibitory activity against trypsin, Aspergillus flavus and Bacillus sp. proteases. The inhibitor in Cassia tora may attenuate microbial proteases and also might be used as phytoprotecting agent. PMID:21749682

  16. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  17. Interference with nuclear factor kappaB signaling pathway by pathogen-encoded proteases: global and selective inhibition.

    PubMed

    Hodgson, Andrea; Wan, Fengyi

    2016-02-01

    Pathogens have evolved a myriad of ways to abrogate and manipulate the host response to infections. Of the various mechanisms involved, pathogen-encoded and sometimes host-encoded proteases are an important category of virulence factors that cause robust changes on the host response by targeting key proteins along signaling cascades. The nuclear factor kappaB (NF-κB) signaling pathway is a crucial regulatory mechanism for the cell, controlling the expression of survival, immune and proliferation genes. Proteases from pathogens of almost all types have been demonstrated to target and cleave members of the NF-κB signaling pathway at nearly every level. This review provides discussion of proteases targeting the most abundant NF-κB subunit, p65, and the impact of protease-mediated p65 cleavage on the immune responses and survival of the infected host cell. After examining various examples of protease interference, it becomes evident that the cleavage fragments produced by pathogen-driven proteolytic processing should be further characterized to determine whether they have novel and unique functions within the cell. The selective targeting of p65 and its effect on gene transcription reveals unique mechanisms by which pathogens acutely alter their microenvironment, and further research may open new opportunities for novel therapeutics to combat pathogens.

  18. The m-AAA protease processes cytochrome c peroxidase preferentially at the inner boundary membrane of mitochondria.

    PubMed

    Suppanz, Ida E; Wurm, Christian A; Wenzel, Dirk; Jakobs, Stefan

    2009-01-01

    The m-AAA protease is a conserved hetero-oligomeric complex in the inner membrane of mitochondria. Recent evidence suggests a compartmentalization of the contiguous mitochondrial inner membrane into an inner boundary membrane (IBM) and a cristae membrane (CM). However, little is known about the functional differences of these subdomains. We have analyzed the localizations of the m-AAA protease and its substrate cytochrome c peroxidase (Ccp1) within yeast mitochondria using live cell fluorescence microscopy and quantitative immunoelectron microscopy. We find that the m-AAA protease is preferentially localized in the IBM. Likewise, the membrane-anchored precursor form of Ccp1 accumulates in the IBM of mitochondria lacking a functional m-AAA protease. Only upon proteolytic cleavage the mature form mCcp1 moves into the cristae space. These findings suggest that protein quality control and proteolytic activation exerted by the m-AAA protease take place preferentially in the IBM pointing to significant functional differences between the IBM and the CM.

  19. Uptake and Degradation of Protease-Sensitive and -Resistant Forms of Abnormal Human Prion Protein Aggregates by Human Astrocytes

    PubMed Central

    Choi, Young Pyo; Head, Mark W.; Ironside, James W.; Priola, Suzette A.

    2015-01-01

    Sporadic Creutzfeldt-Jakob disease is the most common of the human prion diseases, a group of rare, transmissible, and fatal neurologic diseases associated with the accumulation of an abnormal form (PrPSc) of the host prion protein. In sporadic Creutzfeldt-Jakob disease, disease-associated PrPSc is present not only as an aggregated, protease-resistant form but also as an aggregated protease-sensitive form (sPrPSc). Although evidence suggests that sPrPSc may play a role in prion pathogenesis, little is known about how it interacts with cells during prion infection. Here, we show that protease-sensitive abnormal PrP aggregates derived from patients with sporadic Creutzfeldt-Jakob disease are taken up and degraded by immortalized human astrocytes similarly to abnormal PrP aggregates that are resistant to proteases. Our data suggest that relative proteinase K resistance does not significantly influence the astrocyte's ability to degrade PrPSc. Furthermore, the cell does not appear to distinguish between sPrPSc and protease-resistant PrPSc, suggesting that sPrPSc could contribute to prion infection. PMID:25280631

  20. Production and characterization of thermostable alkaline protease of Bacillus subtilis (ATCC 6633) from optimized solid-state fermentation.

    PubMed

    Chatterjee, Joyee; Giri, Sudipta; Maity, Sujan; Sinha, Ankan; Ranjan, Ashish; Rajshekhar; Gupta, Suvroma

    2015-01-01

    Proteases are the most important group of enzymes utilized commercially in various arenas of industries, such as food, detergent, leather, dairy, pharmaceutical, diagnostics, and waste management, accounting for nearly 20% of the world enzyme market. Microorganisms of specially Bacillus genera serve as a vast repository of diverse set of industrially important enzymes and utilized for the large-scale enzyme production using a fermentation technology. Approximately 30%-40% of the cost of industrial enzymes originates from the cost of the growth medium. This study is attempted to produce protease from Bacillus subtilis (ATCC 6633) after optimization of various process parameters with the aid of solid-state fermentation using a cheap nutrient source such as wheat bran. B. subtilis (ATCC 6633) produces proteases of molecular weight 36 and 20 kDa, respectively, in the fermented medium as evident from SDS zymogram. Alkaline protease activity has been detected with optimum temperature at 50 °C and is insensitive to ethylenediaminetetraacetic acid. This thermostable alkaline protease exhibits dual pH optimum at 7 and 10 with moderate pH stability at alkaline pH range. It preserves its activity in the presence of detergent such as SDS, Tween 20, and Triton X-100 and may be considered as an effective additive to detergent formulation with some industrial importance.

  1. Interference with NF-κB signaling pathway by pathogen-encoded proteases: global and selective inhibition

    PubMed Central

    Hodgson, Andrea; Wan, Fengyi

    2016-01-01

    Pathogens have evolved a myriad of ways to abrogate and manipulate the host response to infections. Of the various mechanisms involved, pathogen-encoded and sometimes host-encoded proteases are an important category of virulence factors that cause robust changes on the host response by targeting key proteins along signaling cascades. The nuclear factor kappaB (NF-κB) signaling pathway is a crucial regulatory mechanism for the cell, controlling the expression of survival, immune, and proliferation genes. Proteases from pathogens of almost all types have been demonstrated to target and cleave members of the NF-κB signaling pathway at nearly every level. This review provides discussion of proteases targeting the most abundant NF-κB subunit, p65, and the impact of protease-mediated p65 cleavage on the immune responses and survival of the infected host cell. After examining various examples of protease interference, it becomes evident that the cleavage fragments produced by pathogen-driven proteolytic processing should be further characterized to determine whether they have novel and unique functions within the cell. The selective targeting of p65 and its effect on gene transcription reveals unique mechanisms by which pathogens acutely alter their microenvironment and further research may open new opportunities for novel therapeutics to combat pathogens. PMID:26449378

  2. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  3. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  4. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  5. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  6. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  7. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  8. Distinct and stage specific nuclear factors regulate the expression of falcipains, Plasmodium falciparum cysteine proteases

    PubMed Central

    Sunil, Sujatha; Chauhan, Virander S; Malhotra, Pawan

    2008-01-01

    Background Plasmodium falciparum cysteine proteases (falcipains) play indispensable roles in parasite infection and development, especially in the process of host erythrocyte rupture/invasion and hemoglobin degradation. No detailed molecular analysis of transcriptional regulation of parasite proteases especially cysteine proteases has yet been reported. In this study, using a combination of transient transfection assays and electrophoretic mobility shift assays (EMSA), we demonstrate the presence of stage specific nuclear factors that bind to unique sequence elements in the 5'upstream regions of the falcipains and probably modulate the expression of cysteine proteases. Results Falcipains differ in their timing of expression and exhibit ability to compensate each other's functions at asexual blood stages of the parasite. Present study was undertaken to study the transcriptional regulation of falcipains. Transient transfection assay employing firefly luciferase as a reporter revealed that a ~1 kb sequence upstream of translational start site is sufficient for the functional transcriptional activity of falcipain-1 gene, while falcipain-2, -2' and -3 genes that exist within 12 kb stretch on chromosome 11 require ~2 kb upstream sequences for the expression of reporter luciferase activity. EMSA analysis elucidated binding of distinct nuclear factors to specific sequences within the 5'upstream regions of falcipain genes. Analysis of falcipains' 5'upstream regulatory regions did not reveal the presence of sequences known to bind general eukaryotic factors. However, we did find parasite specific sequence elements such as poly(dA) poly(dT) tracts, CCAAT boxes and a single 7 bp-G rich sequence, (A/G)NGGGG(C/A) in the 5' upstream regulatory regions of these genes, thereby suggesting the role(s) of Plasmodium specific transcriptional factors in the regulation of falcipain genes. Conclusion Taken together, these results suggest that expression of Plasmodium cysteine proteases is

  9. Comparative genomic analysis of aspartic proteases in eight parasitic platyhelminths: insights into functions and evolution.

    PubMed

    Wang, Shuai; Wei, Wei; Luo, Xuenong; Wang, Sen; Hu, Songnian; Cai, Xuepeng

    2015-03-15

    We performed genome-wide identifications and comparative genomic analyses of the predicted aspartic proteases (APs) from eight parasitic flatworms, focusing on their evolution, potentials as drug targets and expression patterns. The results revealed that: i) More members of family A01 were identified from the schistosomes than from the cestodes; some evidence implied gene loss events along the class Cestoda, which may be related to the different ways to ingest host nutrition; ii) members in family A22 were evolutionarily highly conserved among all the parasites; iii) one retroviral-like AP in family A28 shared a highly similar predicted 3D structure with the HIV protease, implying its potential to be inhibited by HIV inhibitor-like molecules; and iiii) retrotransposon-associated APs were extensively expanded among these parasites. These results implied that the evolutionary histories of some APs in these parasites might relate to adaptations to their parasitism and some APs might have potential serving as intervention targets.

  10. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  11. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  12. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  13. Burden of Diabetes and First Evidence for the Utility of HbA1c for Diagnosis and Detection of Diabetes in Urban Black South Africans: The Durban Diabetes Study

    PubMed Central

    Hird, Thomas R.; Pirie, Fraser J.; Esterhuizen, Tonya M.; O’Leary, Brian; McCarthy, Mark I.; Young, Elizabeth H.; Sandhu, Manjinder S.; Motala, Ayesha A.

    2016-01-01

    Objective Glycated haemoglobin (HbA1c) is recommended as an additional tool to glucose-based measures (fasting plasma glucose [FPG] and 2-hour plasma glucose [2PG] during oral glucose tolerance test [OGTT]) for the diagnosis of diabetes; however, its use in sub-Saharan African populations is not established. We assessed prevalence estimates and the diagnosis and detection of diabetes based on OGTT, FPG, and HbA1c in an urban black South African population. Research Design and Methods We conducted a population-based cross-sectional survey using multistage cluster sampling of adults aged ≥18 years in Durban (eThekwini municipality), KwaZulu-Natal. All participants had a 75-g OGTT and HbA1c measurements. Receiver operating characteristic (ROC) analysis was used to assess the overall diagnostic accuracy of HbA1c, using OGTT as the reference, and to determine optimal HbA1c cut-offs. Results Among 1190 participants (851 women, 92.6% response rate), the age-standardised prevalence of diabetes was 12.9% based on OGTT, 11.9% based on FPG, and 13.1% based on HbA1c. In participants without a previous history of diabetes (n = 1077), using OGTT as the reference, an HbA1c ≥48 mmol/mol (6.5%) detected diabetes with 70.3% sensitivity (95%CI 52.7–87.8) and 98.7% specificity (95%CI 97.9–99.4) (AUC 0.94 [95%CI 0.89–1.00]). Additional analyses suggested the optimal HbA1c cut-off for detection of diabetes in this population was 42 mmol/mol (6.0%) (sensitivity 89.2% [95%CI 78.6–99.8], specificity 92.0% [95%CI: 90.3–93.7]). Conclusions In an urban black South African population, we found a high prevalence of diabetes and provide the first evidence for the utility of HbA1c for the diagnosis and detection of diabetes in black Africans in sub-Saharan Africa. PMID:27560687

  14. Structural and functional analysis of human HtrA3 protease and its subdomains

    SciTech Connect

    Glaza, Przemyslaw; Osipiuk, Jerzy; Wenta, Tomasz; Zurawa-Janicka, Dorota; Jarzab, Miroslaw; Lesner, Adam; Banecki, Bogdan; Skorko-Glonek, Joanna; Joachimiak, Andrzej; Lipinska, Barbara; van Raaij, Mark J.

    2015-06-25

    Human HtrA3 protease, which induces mitochondria-mediated apoptosis, can be a tumor suppressor and a potential therapeutic target in the treatment of cancer. However, there is little information about its structure and biochemical properties. HtrA3 is composed of an N-terminal domain not required for proteolytic activity, a central serine protease domain and a C-terminal PDZ domain. HtrA3S, its short natural isoform, lacks the PDZ domain which is substituted by a stretch of 7 C-terminal amino acid residues, unique for this isoform. This paper presents the crystal structure of the HtrA3 protease domain together with the PDZ domain (ΔN-HtrA3), showing that the protein forms a trimer whose protease domains are similar to those of human HtrA1 and HtrA2. The ΔN-HtrA3 PDZ domains are placed in a position intermediate between that in the flat saucer-like HtrA1 SAXS structure and the compact pyramidal HtrA2 X-ray structure. The PDZ domain interacts closely with the LB loop of the protease domain in a way not found in other human HtrAs. ΔN-HtrA3 with the PDZ removed (ΔN-HtrA3-ΔPDZ) and an N-terminally truncated HtrA3S (ΔN-HtrA3S) were fully active at a wide range of temperatures and their substrate affinity was not impaired. This indicates that the PDZ domain is dispensable for HtrA3 activity. As determined by size exclusion chromatography, ΔN-HtrA3 formed stable trimers while both ΔN-HtrA3-ΔPDZ and ΔN-HtrA3S were monomeric. This suggests that the presence of the PDZ domain, unlike in HtrA1 and HtrA2, influences HtrA3 trimer formation. The unique C-terminal sequence of ΔN-HtrA3S appeared to have little effect on activity and oligomerization. Additionally, we examined the cleavage specificity of ΔN-HtrA3. Results reported in this paper provide new insights into the structure and function of ΔN-HtrA3, which seems to have a unique combination of features among human HtrA proteases.

  15. Structural and functional analysis of human HtrA3 protease and its subdomains

    DOE PAGES

    Glaza, Przemyslaw; Osipiuk, Jerzy; Wenta, Tomasz; ...

    2015-06-25

    Human HtrA3 protease, which induces mitochondria-mediated apoptosis, can be a tumor suppressor and a potential therapeutic target in the treatment of cancer. However, there is little information about its structure and biochemical properties. HtrA3 is composed of an N-terminal domain not required for proteolytic activity, a central serine protease domain and a C-terminal PDZ domain. HtrA3S, its short natural isoform, lacks the PDZ domain which is substituted by a stretch of 7 C-terminal amino acid residues, unique for this isoform. This paper presents the crystal structure of the HtrA3 protease domain together with the PDZ domain (ΔN-HtrA3), showing that themore » protein forms a trimer whose protease domains are similar to those of human HtrA1 and HtrA2. The ΔN-HtrA3 PDZ domains are placed in a position intermediate between that in the flat saucer-like HtrA1 SAXS structure and the compact pyramidal HtrA2 X-ray structure. The PDZ domain interacts closely with the LB loop of the protease domain in a way not found in other human HtrAs. ΔN-HtrA3 with the PDZ removed (ΔN-HtrA3-ΔPDZ) and an N-terminally truncated HtrA3S (ΔN-HtrA3S) were fully active at a wide range of temperatures and their substrate affinity was not impaired. This indicates that the PDZ domain is dispensable for HtrA3 activity. As determined by size exclusion chromatography, ΔN-HtrA3 formed stable trimers while both ΔN-HtrA3-ΔPDZ and ΔN-HtrA3S were monomeric. This suggests that the presence of the PDZ domain, unlike in HtrA1 and HtrA2, influences HtrA3 trimer formation. The unique C-terminal sequence of ΔN-HtrA3S appeared to have little effect on activity and oligomerization. Additionally, we examined the cleavage specificity of ΔN-HtrA3. Results reported in this paper provide new insights into the structure and function of ΔN-HtrA3, which seems to have a unique combination of features among human HtrA proteases.« less

  16. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  17. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  18. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  19. The Effectiveness of Negative Pressure Therapy in Diabetic Foot Ulcers with Elevated Protease Activity: A Case Series

    PubMed Central

    Izzo, Valentina; Meloni, Marco; Giurato, Laura; Ruotolo, Valeria; Uccioli, Luigi

    2017-01-01

    Objective: Despite several works have described the usefulness of negative pressure therapy (NPT) in the treatment of diabetic foot ulcers (DFUs), no studies have reported its ability in the proteases modulation in DFUs. The aim of this work was to evaluate the role of NPT as a protease-modulating treatment in DFUs. Approach: We conducted a prospective study of a series of diabetic patients affected by chronic DFUs. Each ulcer was assessed for matrix metalloproteinases (MMPs) activity with a protease status diagnostic test at the baseline and after 2 weeks of NPT. Results: Four patients were included. All patients had type 2 diabetes with a disease duration of ≈20 years. A1c was 79.5 ± 15.3 mmol/mol. Ulcer area was >5 cm2 in all cases. All wounds showed elevated protease activity (EPA) at the baseline. After 2 weeks, all patients showed a normalization of MMPs activity. Innovation: NPT showed its effectiveness in the reduction of EPA in chronic DFUs. Conclusion: This study confirms the role of NPT in the positive modulation of protease activity also in chronic DFUs. PMID:28116227

  20. Construction, expression, and characterization of a novel fully activated recombinant single-chain hepatitis C virus protease.

    PubMed Central

    Taremi, S. S.; Beyer, B.; Maher, M.; Yao, N.; Prosise, W.; Weber, P. C.; Malcolm, B. A.

    1998-01-01

    Efficient proteolytic processing of essential junctions of the hepatitis C virus (HCV) polyprotein requires a heterodimeric complex of the NS3 bifunctional protease/helicase and the NS4A accessory protein. A single-chain recombinant form of the protease has been constructed in which NS4A residues 21-32 (GSVVIVGRIILS) were fused in frame to the amino terminus of the NS3 protease domain (residues 3-181) through a tetrapeptide linker. The single-chain recombinant protease has been overexpressed as a soluble protein in E. coli and purified to homogeneity by a combination of metal chelate and size-exclusion chromatography. The single-chain recombinant protease domain shows full proteolytic activity cleaving the NS5A-5B synthetic peptide substrate, DTEDVVCCSMSYTWTGK with a Km and k(cat) of 20.0 +/- 2.0 microM and 9.6 +/- 2.0 min(-1), respectively; parameters identical to those of the authentic NS3(1-631)/NS4A(1-54) protein complex generated in eukaryotic cells (Sali DL et al., 1998, Biochemistry 37:3392-3401). PMID:9792101

  1. Effects of exogenous proteases without or with carbohydrases on nutrient digestibility and disappearance of non-starch polysaccharides in broiler chickens

    PubMed Central

    Olukosi, O. A.; Beeson, L. A.; Englyst, K.; Romero, L. F.

    2015-01-01

    The objective of the current study was to evaluate the effect of a subtilisin protease, without or with inclusion of carbohydrases, on digestibility and retention of energy and protein, as well as the solubilization and disappearance of non-starch polysaccharides (NSP) from corn-soybean meal based diets fed to broiler chickens. Two hundred eighty-eight Ross 308 male broiler chickens were used for the experiment. On d 14, the birds were weighed and allocated to 6 treatments and 8 replicates per treatment with 6 birds per replicate. Treatments were: 1) corn-soybean meal based control diet; 2) control diet plus supplemental protease at 5,000 (P5000) protease units (PU)/kg); 3) control plus 10,000 PU/kg protease (P10000); or control plus an enzyme combination containing xylanase, amylase, and protease (XAP) added to achieve protease activity of: 4) 2,500 PU/kg (XAP2500); 5) 5,000 PU/kg (XAP5000); or 6) 10,000 PU/kg (XAP10000). The enzymes in XAP were combined at fixed ratios of 10:1:25 of xylanase:amylase:protease. Data were analyzed by ANOVA and specific orthogonal contrasts between treatments were performed. Addition of xylanase and amylase increased (P < 0.05) the ileal digestibility of protein by 4.2% and 2.1% at XAP5000 and XAP10000, respectively (relative to P5000 and P10000, respectively), exhibiting a plateau after the XAP5000 dose. Increment (P < 0.05) in AME due to protease was evident, particularly in P10000. At the ileal level, XAP reduced (P < 0.05) the flow of insoluble xylose and arabinose, which indicates an increase in the solubilization of arabinoxylan polymers in the small intestine. Protease on its own reduced (P < 0.05) the flow of insoluble arabinose but did not affect the flow of insoluble xylose. XAP reduced (P < 0.05) the pre-cecal flow of insoluble and total glucose and galactose. It was concluded that whereas protease by itself improved nutrient utilization and increased solubilization of NSP components, at the lower dose, a

  2. The New High Resolution Crystal Structure of NS2B-NS3 Protease of Zika Virus

    PubMed Central

    Badshah, Syed Lal; Naeem, Abdul; Mabkhot, Yahia

    2017-01-01

    Zika virus (ZIKV) is the cause of a significant viral disease affecting humans, which has spread throughout many South American countries and has also become a threat to Southeastern Asia. This commentary discusses the article “Crystal structure of unlinked NS2B-NS3 protease from Zika virus” published recently in the journal Science by Zhang et al. of Nanyang Technological University, Singapore. They resolved a 1.58 Å resolution structure of the NS2B-NS3 protease of ZIKV and demonstrated how peptide and non-peptide inhibitors interact with this structure, along with the different conformational states that were observed. This protease crystal structure offers new opportunities for the design and development of novel antiviral drugs used for the treatment and control of ZIKV. PMID:28075376

  3. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  4. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  5. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation.

  6. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  7. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  8. Amoebic forms of Blastocystis spp. - evidence for a pathogenic role

    PubMed Central

    2013-01-01

    Background Blastocystis spp. are one of the most prevalent parasites isolated from patients suffering from diarrhea, flatulence, constipation and vomiting. It’s pathogenicity and pathophysiology remains controversial to date. Protease activity and amoebic forms have been reported previously in symptomatic isolates but there has been no conclusive evidence provided to correlate the protease activity and any specific life cycle stage of the parasite thus far. Methods Symptomatic isolates with amoebic form were tested for protease activity and compared with symptomatic and asymptomatic isolates without amoebic form for 10 days culture period. Results The present study demonstrates an elevated protease activity in cultures having a higher percentage of amoebic forms seen in symptomatic isolates. The growth curve demonstrated a significantly (p < 0.05) higher average number of parasite counts in asymptomatic compared to symptomatic isolates. Symptomatic isolates showed amoebic forms with percentages ranging from 5% to 17%. Elevated protease activity was demonstrated in isolates that had higher percentages of amoebic forms with intense bands at higher molecular weight proteases (60 – 100 kDa). As days of culture proceeded, the protease quantification also showed a steady increase. Conclusion This study elucidates a correlation between protease activity and percentage of amoebic forms. The finding implies that these forms could play a role in exacerbation of intestinal symptoms during Blastocystis spp. infection. PMID:24499467

  9. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  10. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  11. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  12. TMPRSS12 Is an Activating Protease for Subtype B Avian Metapneumovirus.

    PubMed

    Yun, Bingling; Zhang, Yao; Liu, Yongzhen; Guan, Xiaolu; Wang, Yongqiang; Qi, Xiaole; Cui, Hongyu; Liu, Changjun; Zhang, Yanping; Gao, Honglei; Gao, Li; Li, Kai; Gao, Yulong; Wang, Xiaomei

    2016-12-15

    The entry of avian metapneumovirus (aMPV) into host cells initially requires the fusion of viral and cell membranes, which is exclusively mediated by fusion (F) protein. Proteolysis of aMPV F protein by endogenous proteases of host cells allows F protein to induce membrane fusion; however, these proteases have not been identified. Here, we provide the first evidence that the transmembrane serine protease TMPRSS12 facilitates the cleavage of subtype B aMPV (aMPV/B) F protein. We found that overexpression of TMPRSS12 enhanced aMPV/B F protein cleavage, F protein fusogenicity, and viral replication. Subsequently, knockdown of TMPRSS12 with specific small interfering RNAs (siRNAs) reduced aMPV/B F protein cleavage, F protein fusogenicity, and viral replication. We also found a cleavage motif in the aMPV/B F protein (amino acids 100 and 101) that was recognized by TMPRSS12. The histidine, aspartic acid, and serine residue (HDS) triad of TMPRSS12 was shown to be essential for the proteolysis of aMPV/B F protein via mutation analysis. Notably, we observed TMPRSS12 mRNA expression in target organs of aMPV/B in chickens. Overall, our results indicate that TMPRSS12 is crucial for aMPV/B F protein proteolysis and aMPV/B infectivity and that TMPRSS12 may serve as a target for novel therapeutics and prophylactics for aMPV.

  13. Using the SUBcellular database for Arabidopsis proteins to localize the Deg protease family

    PubMed Central

    Tanz, Sandra K.; Castleden, Ian; Hooper, Cornelia M.; Small, Ian; Millar, A. Harvey

    2014-01-01

    Sub-functionalization during the expansion of gene families in eukaryotes has occurred in part through specific subcellular localization of different family members. To better understand this process in plants, compiled records of large-scale proteomic and fluorescent protein localization datasets can be explored and bioinformatic predictions for protein localization can be used to predict the gaps in experimental data. This process can be followed by targeted experiments to test predictions. The SUBA3 database is a free web-service at http://suba.plantenergy.uwa.edu.au that helps users to explore reported experimental data and predictions concerning proteins encoded by gene families and to define the experiments required to locate these homologous sets of proteins. Here we show how SUBA3 can be used to explore the subcellular location of the Deg protease family of ATP-independent serine endopeptidases (Deg1–Deg16). Combined data integration and new experiments refined location information for Deg1 and Deg9, confirmed Deg2, Deg5, and Deg8 in plastids and Deg 15 in peroxisomes and provide substantial experimental evidence for mitochondrial localized Deg proteases. Two of these, Deg3 and Deg10, additionally localized to the plastid, revealing novel dual-targeted Deg proteases in the plastid and the mitochondrion. SUBA3 is continually updated to ensure that researchers can use the latest published data when planning the experimental steps remaining to localize gene family functions. PMID:25161662

  14. Purification and some characteristics of the human epidermal SH-protease inhibitor.

    PubMed

    Järvinen, M

    1978-08-01

    An inhibitor of papain and other SH-proteases was purified 520-fold from human epidermis extracts by acetone fractionation, heat treatment, papain-Sepharose affinity chromatography, and Sephadex G-50 chromatography. The purified inhibitor had a molecular weight of 12,600 and contained no hexose, as tested by the anthrone reaction. The inhibitor survived in a boiling water bath, in 5% trichloroacetic acid, 20 mM Na3PO4 (pH 12.1) and 4 M NH4OH (pH 11.9). By isoelectric focusing 2 major activity peaks with pI's of 4.6 and 4.8, and a minor peak with a pI of 4.9 was fractioned, and 3 corresponding protein bands were seen after analytical isoelectric focusing. Immunization of rabbits with the purified inhibitor yielded a highly specific anti-inhibitor serum. The purified inhibitor inhibited papain, ficin, human cathepsins B and C, and slightly inhibited bromelain. No inhibition of serine proteases (bovine trypsin and chymotrypsin A, porcine elastase) or an acid protease (human cathepsin D) was observed. Evidence was obtained that the inhibitor formed a complex with both dithiothreitol-activated papain and enzymatically inactive mercuripapain.

  15. Mutational analysis of plum pox potyvirus polyprotein processing by the NIa protease in Escherichia coli.

    PubMed

    García, J A; Laín, S; Cervera, M T; Riechmann, J L; Martín, M T

    1990-12-01

    A binary Escherichia coli expression system has been used to study the pathway for proteolytic processing of the plum pox potyvirus (PPV) polyprotein. Trans cleavage at the carboxyl end of the cylindrical inclusion protein occurred, although with lower efficiency than that at the large nuclear inclusion protein-capsid protein junction. No trans cleavage at the carboxyl end of the small nuclear inclusion protein (NIa) was detected. The proteolytic activities at different cleavage sites of several deletion and point mutations of NIa protein have been analysed. The large delta SX deletion and two different point mutations at His 239 abolished proteolytic activity at all sites. The effect of other mutations, particularly a Glu substitution for Asp 274, depended on the particular cleavage site analysed. The results obtained with the PPV NIa protein mutants were similar to those reported for comparable mutations in the tobacco etch virus 49K protease, despite differences in the sequences recognized for processing. No evident competitive inhibition of the proteolytic activity of PPV NIa protease by the presence of an excess of the different protease mutants could be demonstrated.

  16. Cleavage and activation of human factor IX by serine proteases

    SciTech Connect

    Enfield, D.L.; Thompson, A.R.

    1984-10-01

    Human factor IX circulates as a single-chain glycoprotein. Upon activation in vitro, it is cleaved into disulfide-linked light and heavy chains and an activation peptide. After reduction of activated /sup 125/I-factor IX, the heavy and light chains are readily identified by gel electrophoresis. A direct, immunoradiometric assay for factor IXa was developed to assess activation of factor IX for proteases that cleaved it. The assay utilized radiolabeled antithrombin III with heparin to identify the active site and antibodies to distinguish factor IX. After cleavage of factor IX by factor XIa, factor VIIa-tissue thromboplastin complex, or the factor X-activating enzyme from Russell's viper venom, antithrombin III bound readily to factor IXa. Cleavage of /sup 125/I-factor IX by trypsin, chymotrypsin, and granulocyte elastase in the presence of calcium yielded major polypeptide fragments of the sizes of the factor XIa-generated light and heavy chains. When the immunoradiometric assay was used to assess trypsin-cleaved factor IX, the product bound antithrombin III, but not maximally. After digesting with insolubilized trypsin, clotting activity confirmed activation. In evaluating activation of factor IX, physical evidence of activation cleavages does not necessarily correlate with generation of an active site.

  17. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  18. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  19. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  20. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  1. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  2. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  3. Staphylococcus aureus protease: a probe of exposed, non-basic histone sequences in nucleosomes

    SciTech Connect

    Rill, R.L.; Oosterhof, D.K.

    1980-01-01

    The digestion of histones in chicken erythrocyte nucleosome cores and chromatin by Staphylococcus aureus protease was examined. This protease cleaves specifically at acidic residues and prefers glu-X bonds under the conditions used. Only 1 of 24 glutamic and 2 of 13 aspartic acids among all four core histones are located in basic, amino-terminal tails, hence staph. protease is a highly specific probe of exposed non-basic sequences. Staph. protease readily degraded H1, H5, and H3; moderately degraded H2b, and only slightly degraded H2a and H4 in nucleosomes and nucleosome cores. Electrophoresis of core histone fragments from limited digests showed that most glutamic acids were inaccessible, but at least five sites in non-basic sequences were readily cleaved. Tentative assignments of these fragments based on comparisons with products from limited digests of pure histones suggested that most accessible sites in nucleosome cores occur in H3. The most probable sites of H3 cutting are glutamic acids at positions 51, 60, 73, 94, and 97. At least one site in H2b, probably the equivalent of glu-105 in the calf H2b sequence, was accessible. No sites in H2a and H4 appeared highly accessible. H5 was readily cleaved at a site near the amino-terminus. These data substantiate the other evidence that non-basic core histone sequences are located primarily in the nucleosome interior, but that H3 binds to the ends of core DNA and thereby is partly exposed as the upper and lower surfaces of the disk-shaped core.

  4. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    Salameh, M.A.; Soares, A.; Navaneetham, D.; Sinha, D.; Walsh, P. N.; Radisky, E. S.

    2010-11-19

    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P1 and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin {center_dot} APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  5. Synergistic Defensive Function of Raphides and Protease through the Needle Effect

    PubMed Central

    Konno, Kotaro; Inoue, Takashi A.; Nakamura, Masatoshi

    2014-01-01

    Raphides, needle-shaped calcium oxalate crystals in tissues of many plants, have been thought to play defensive roles against herbivores without detailed bioassays for their defensive roles and modes of function using purified raphides. In order to examine the defensive roles and modes of function of raphides in a clear experimental system, we performed bioassays giving the larvae of the Eri silkmoth, Samia ricini (Saturniidae), leaves of their host plant, the castor oil plant, Ricinus communis (Euphorbiaceae), painted with the raphides purified from kiwifruits, Actinidia deliciosa (Actinidiaceae), in presence or absence of cysteine protease, which often coincide with raphides in plant tissues. Raphides alone or cysteine protease alone showed only weak defensive activities around experimental concentrations. However, when raphides and cysteine protease coexisted, they synergistically showed very strong growth-reducing activities, and the mortality of caterpillars was very high. In contrast, amorphous calcium oxalate did not show synergism with cysteine protease on defensive activities, indicating that the needle-shape of raphides is essential for the synergism. The present study provides the first clear experimental evidence for the synergism between raphides and other defensive factors. Further, the study suggests that “the needle effect”, which intensify the bioactivities of other bioactive factors by making holes to the barriers (cell membrane, cuticle, epithelium, the nuclear membrane, etc.) and facilitate the bioactive factors to go through them and reach the targets, is important in the defensive activities of raphides, and possibly in the allergy caused by raphides, and in the carcinogenic activities of other needle-shaped components including asbestos and plant derived silica needles. PMID:24621613

  6. Tracking HCV protease population diversity during transmission and susceptibility of founder populations to antiviral therapy

    PubMed Central

    Khera, Tanvi; Todt, Daniel; Vercauteren, Koen; McClure, C. Patrick; Verhoye, Lieven; Farhoudi, Ali; Bhuju, Sabin; Geffers, Robert; Baumert, Thomas F.; Steinmann, Eike; Meuleman, Philip; Pietschmann, Thomas; Brown, Richard J.P.

    2017-01-01

    Due to the highly restricted species-tropism of Hepatitis C virus (HCV) a limited number of animal models exist for pre-clinical evaluation of vaccines and antiviral compounds. The human-liver chimeric mouse model allows heterologous challenge with clinically relevant strains derived from patients. However, to date, the transmission and longitudinal evolution of founder viral populations in this model have not been characterized in-depth using state-of-the-art sequencing technologies. Focusing on NS3 protease encoding region of the viral genome, mutant spectra in a donor inoculum and individual recipient mice were determined via Illumina sequencing and compared, to determine the effects of transmission on founder viral population complexity. In all transmissions, a genetic bottleneck was observed, although diverse viral populations were transmitted in each case. A low frequency cloud of mutations (<1%) was detectable in the donor inoculum and recipient mice, with single nucleotide variants (SNVs) > 1% restricted to a subset of nucleotides. The population of SNVs >1% was reduced upon transmission while the low frequency SNV cloud remained stable. Fixation of multiple identical synonymous substitutions was apparent in independent transmissions, and no evidence for reversion of T-cell epitopes was observed. In addition, susceptibility of founder populations to antiviral therapy was assessed. Animals were treated with protease inhibitor (PI) monotherapy to track resistance associated substitution (RAS) emergence. Longitudinal analyses revealed a decline in population diversity under therapy, with no detectable RAS >1% prior to therapy commencement. Despite inoculation from a common source and identical therapeutic regimens, unique RAS emergence profiles were identified in different hosts prior to and during therapeutic failure, with complex mutational signatures at protease residues 155, 156 and 168 detected. Together these analyses track viral population complexity at

  7. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    M Salameh; A Soares; D Navaneetham; D Sinha; P Walsh; E Radisky

    2011-12-31

    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P{sub 1} and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin-APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  8. Cowpea bruchid Callosobruchus maculatus counteracts dietary protease inhibitors by modulating propeptides of major digestive enzymes.

    PubMed

    Ahn, J-E; Lovingshimer, M R; Salzman, R A; Presnail, J K; Lu, A L; Koiwa, H; Zhu-Salzman, K

    2007-06-01

    Cowpea bruchids, when challenged by consumption of the soybean cysteine protease inhibitor scN, reconfigure expression of their major CmCP digestive proteases and resume normal feeding and development. Previous evidence indicated that insects selectively induced CmCPs from subfamily B, that were more efficient in autoprocessing and possessed not only higher proteolytic, but also scN-degrading activities. In contrast, dietary scN only marginally up-regulated genes from the more predominant CmCP subfamily A that were inferior to subfamily B. To gain further molecular insight into this adaptive adjustment, we performed domain swapping between the two respective subfamily members B1 and A16, the latter unable to autoprocess or degrade scN even after intermolecular processing. Swapping the propeptides did not qualitatively alter autoprocessing in either protease isoform. Incorporation of either the N- (pAmBA) or C-terminal (pAmAB) mature B1 segment into A16, however, was sufficient to prime autoprocessing of A16 to its mature form. Further, the swap at the N-terminal mature A16 protein region (pAmBA) resulted in four amino acid changes. Replacement of these amino acid residues by the corresponding B1 residues, singly and pair-wise, revealed that autoprocessing activation in pAmBA resulted from cumulative and/or coordinated individual effects. Bacterially expressed isolated propeptides (pA16 and pB1) differed in their ability to inhibit mature B1 enzyme. Lower inhibitory activity in pB1 is likely attributable to its lack of protein stability. This instability in the cleaved propeptide is necessary, although insufficient by itself, for scN-degradation by the mature B1 enzyme. Taken together, cowpea bruchids modulate proteolysis of their digestive enzymes by controlling proCmCP cleavage and propeptide stability, which explains at least in part the plasticity cowpea bruchids demonstrate in response to protease inhibitors.

  9. Sweet potato cysteine proteases SPAE and SPCP2 participate in sporamin degradation during storage root sprouting.

    PubMed

    Chen, Hsien-Jung; Liang, Shu-Hao; Huang, Guan-Jhong; Lin, Yaw-Huei

    2015-08-15

    Sweet potato sporamins are trypsin inhibitors and exhibit strong resistance to digestion by pepsin, trypsin and chymotrypsin. In addition, they constitute the major storage proteins in the sweet potato and, after degradation, provide nitrogen as a nutrient for seedling regrowth in sprouting storage roots. In this report, four cysteine proteases-one asparaginyl endopeptidase (SPAE), two papain-like cysteine proteases (SPCP1 and SPCP2), and one granulin-containing cysteine protease (SPCP3)-were studied to determine their association with sporamin degradation in sprouting storage roots. Sporamin degradation became significant in the flesh of storage roots starting from week 4 after sprouting and this correlated with expression levels of SPAE and SPCP2, but not of SPCP1 and SPCP3. In the outer flesh near the skin, sporamin degradation was more evident and occurred earlier than in the inner flesh of storage roots. Degradation of sporamins in the outer flesh was inversely correlated with the distance of the storage root from the sprout. Exogenous application of SPAE and SPCP2, but not SPCP3, fusion proteins to crude extracts of the outer flesh (i.e., extracted from a depth of 0.3cm and within 2cm of one-week-old sprouts) promoted in vitro sporamin degradation in a dose-dependent manner. Pre-treatment of SPAE and SPCP2 fusion proteins at 95°C for 5min prior to their application to the crude extracts reduced sporamin degradation. These data show that sweet potato asparaginyl endopeptidase SPAE and papain-like cysteine protease SPCP2 participate in sporamin degradation during storage root sprouting.

  10. A Bacillus anthracis strain deleted for six proteases serves as an effective host for production of recombinant proteins.

    PubMed

    Pomerantsev, Andrei P; Pomerantseva, Olga M; Moayeri, Mahtab; Fattah, Rasem; Tallant, Cynthia; Leppla, Stephen H

    2011-11-01

    Bacillus anthracis produces a number of extracellular proteases that impact the integrity and yield of other proteins in the B. anthracis secretome. In this study we show that anthrolysin O (ALO) and the three anthrax toxin proteins, protective antigen (PA), lethal factor (LF), and edema factor (EF), produced from the B. anthracis Ames 35 strain (pXO1⁺, pXO2⁻), are completely degraded at the onset of stationary phase due to the action of proteases. An improved Cre-loxP gene knockout system was used to sequentially delete the genes encoding six proteases (InhA1, InhA2, camelysin, TasA, NprB, and MmpZ). The role of each protease in degradation of the B. anthracis toxin components and ALO was demonstrated. Levels of the anthrax toxin components and ALO in the supernatant of the sporulation defective, pXO1⁺ A35HMS mutant strain deleted for the six proteases were significantly increased and remained stable over 24 h. A pXO1-free variant of this six-protease mutant strain, designated BH460, provides an improved host strain for the preparation of recombinant proteins. As an example, BH460 was used to produce recombinant EF, which previously has been difficult to obtain from B. anthracis. The EF protein produced from BH460 had the highest in vivo potency of any EF previously purified from B. anthracis or Escherichia coli hosts. BH460 is recommended as an effective host strain for recombinant protein production, typically yielding greater than 10mg pure protein per liter of culture.

  11. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  12. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Mixed carbohydrase and protease enzyme product... Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes carbohydrase and protease...

  13. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  14. Evaluation of trypanocidal activity of combinations of anti-sleeping sickness drugs with cysteine protease inhibitors.

    PubMed

    Steverding, Dietmar

    2015-01-01

    Chemotherapy of human African trypanosomiasis (HAT) is unsatisfactory because only a few drugs, with serious side effects and poor efficacy, are available. As drug combination regimes often achieve greater therapeutic efficacy than monotherapies, here the trypanocidal activity of the cysteine protease inhibitor K11777 in combination with current anti-HAT drugs using bloodstream forms of Trypanosoma brucei was investigated. Isobolographic analysis was used to determine the interaction between cysteine protease inhibitors (K11777, CA-074Me and CAA0225) and anti-HAT drugs (suramin, pentamidine, melarsoprol and eflornithine). Bloodstream forms of T. brucei were incubated in culture medium containing cysteine protease inhibitors or anti-HAT drugs alone or in combination at a 1:1 fixed-dose ratio. After 48 h incubation, live cells were counted, the 50% growth inhibition values determined and combination indices calculated. The general cytotoxicity of drug combinations was evaluated with human leukaemia HL-60 cells. Combinations of K11777 with suramin, pentamidine and melarsoprol showed antagonistic effects while with eflornithine a synergistic effect was observed. Whereas eflornithine antagonises with CA-074Me, an inhibitor inactivating the targeted TbCATL only under reducing conditions, it synergises with CAA0255, an inhibitor structurally related to CA-074Me which inactivates TbCATL independently of thiols. These findings indicate an essential role of thiols for the synergistic interaction between K11777 and eflornithine. Encouragingly, the K11777/eflornithine combination displayed higher trypanocidal than cytotoxic activity. The results of this study suggest that the combination of the cysteine protease inhibitor K11777 and eflornithine display promising synergistic trypanocidal activity that warrants further investigation of the drug combination as possible alternative treatment of HAT.

  15. Activity of purified hepatitis C virus protease NS3 on peptide substrates.

    PubMed Central

    Steinkühler, C; Urbani, A; Tomei, L; Biasiol, G; Sardana, M; Bianchi, E; Pessi, A; De Francesco, R

    1996-01-01

    The protease domain of the hepatitis C virus (HCV) protein NS3 was expressed in Escherichia coli, purified to homogeneity, and shown to be active on peptides derived from the sequence of the NS4A-NS4B junction. Experiments were carried out to optimize protease activity. Buffer requirements included the presence of detergent, glycerol, and dithiothreitol, pH between 7.5 and 8.5, and low ionic strength. C- and N-terminal deletion experiments defined a peptide spanning from the P6 to the P4' residue as a suitable substrate. Cleavage kinetics were subsequently measured by using decamer P6-P4' peptides corresponding to all intermolecular cleavage sites of the HCV polyprotein. The following order of cleavage efficiency, in terms of kcat/Km, was determined: NS5A-NS5B > NS4A-NS4B >> NS4B-NS5A. A 14-mer peptide containing residues 21 to 34 of the protease cofactor NS4A (Pep4A 21-34), when added in stoichiometric amounts, was shown to increase cleavage rates of all peptides, the largest effect (100-fold) being observed on the hydrolysis of the NS4B-NS5A decamer. From the kinetic analysis of cleavage data, we conclude that (i) primary structure is an important determinant of the efficiency with which each site is cleaved during polyprotein processing, (ii) slow cleavage of the NS4B-NS5A site in the absence of NS4A is due to low binding affinity of the enzyme for this site, and (iii) formation of a 1:1 complex between the protease and Pep4A 21-34 is sufficient and required for maximum activation. PMID:8794305

  16. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  17. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  18. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  19. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  20. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  1. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  2. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases.

  3. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  4. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  5. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  6. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  7. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  8. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  9. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  10. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  11. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  12. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  13. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  14. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).

    PubMed

    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia

    2011-07-01

    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  15. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  16. Streptococcus agalactiae CspA is a serine protease that inactivates chemokines.

    PubMed

    Bryan, Joshua D; Shelver, Daniel W

    2009-03-01

    Streptococcus agalactiae (group B Streptococcus [GBS]) remains a leading cause of invasive infections in neonates and has emerged as a pathogen of the immunocompromised and elderly populations. The virulence mechanisms of GBS are relatively understudied and are still poorly understood. Previous evidence indicated that the GBS cspA gene is necessary for full virulence and the cleavage of fibrinogen. The predicted cspA product displays homology to members of the extracellular cell envelope protease family. CXC chemokines, many of which can recruit neutrophils to sites of infection, are important signaling peptides of the immune system. In this study, we purified CspA and demonstrated that it readily cleaved the CXC chemokines GRO-alpha, GRO-beta, GRO-gamma, neutrophil-activating peptide 2 (NAP-2), and granulocyte chemotactic protein 2 (GCP-2) but did not cleave interleukin-8. CspA did not cleave a panel of other test substrates, suggesting that it possesses a certain degree of specificity. CXC chemokines also underwent cleavage by whole GBS cells in a cspA-dependent manner. CspA abolished the abilities of three representative CXC chemokines, GRO-gamma, NAP-2, and GCP-2, to attract and activate neutrophils. Genetic and biochemical evidence indicated that CspA is a serine protease with S575 at its active site. D180 was also implicated as part of the signature serine protease catalytic triad, and both S575 and D180 were required for both N-terminal and C-terminal autocatalytic processing of CspA.

  17. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.

    PubMed

    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  18. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  19. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  20. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  1. Efficacy of protease inhibitor from marine Streptomyces sp. VITBVK2 against Leishmania donovani - An in vitro study.

    PubMed

    Sreedharan, Veena; Bhaskara Rao, K V

    2017-03-01

    In the present study the leishmanicidal effect of potential protease inhibitor producing marine actinobacterial isolate has been investigated against Leishmania donovani, the causative agent of visceral leishmaniasis. Among 89 marine actinobacteria isolated from a salt pan in Kanyakumari, only one isolate (BVK2) showed 97% of protease inhibition activity against trypsin. Moderate to high protease inhibitor activity was shown by isolate BVK2 on proteinase (30%) and chymotrypsin (85%). In optimization study for protease inhibitor production glucose as carbon source and casein as nitrogen source showed the best activity. In the in-vitro Fluorescence-activated cell sorting (FACS) assay, 100 μg/ml of BVK2 extract was active against amastigotes in infected J774A.1 macrophages and showed 87% of parasitic inhibition. The isolate BVK2 showed significant anti-parasitic activity with an IC50 of 27.1 μg/ml after double doses were administered. The potential isolate was identified by molecular 16S rRNA gene sequencing as Streptomyces sp. VITBVK2. The results obtained suggest that the marine actinobacterial extract which have novel metabolites can be considered as a potential source for the development of drugs.

  2. Stress Conditions Increase Vimentin Cleavage by Omi/HtrA2 Protease in Human Primary Neurons and Differentiated Neuroblastoma Cells.

    PubMed

    Lucotte, Bérangère; Tajhizi, Mehdi; Alkhatib, Dareen; Samuelsson, Eva-Britt; Wiehager, Birgitta; Schedin-Weiss, Sophia; Sundström, Erik; Winblad, Bengt; Tjernberg, Lars O; Behbahani, Homira

    2015-12-01

    Dysfunctional Omi/HtrA2, a mitochondrial serine protease, has been implicated in various neurodegenerative disorders. Despite the wealth of evidence on the roles of Omi/HtrA2 in apoptosis, little is known about its cytosolic targets, the cleavage of which could account for the observed morphological changes such as cytoskeletal reorganizations in axons. By proteomic analysis, vimentin was identified as a substrate for Omi/HtrA2 and we have reported increased Omi/HtrA2 protease activity in Alzheimer disease (AD) brain. Here, we investigated a possible link between Omi/HtrA2 and vimentin cleavage, and consequence of this cleavage on mitochondrial distribution in neurons. In vitro protease assays showed vimentin to be cleaved by Omi/HtrA2 protease, and proximity ligation assay demonstrated an increased interaction between Omi/HtrA2 and vimentin in human primary neurons upon stress stimuli. Using differentiated neuroblastoma SH-SY5Y cells, we showed that Omi/HtrA2 under several different stress conditions induces cleavage of vimentin in wild-type as well as SH-SY5Y cells transfected with amyloid precursor protein with the Alzheimer disease-associated Swedish mutation. After stress treatment, inhibition of Omi/HtrA2 protease activity by the Omi/HtrA2 specific inhibitor, Ucf-101, reduced the cleavage of vimentin in wild-type cells. Following altered vimentin filaments integrity by stress stimuli, mitochondria was redistributed in differentiated SH-SY5Y cells and human primary neurons. In summary, the findings outlined in this paper suggest a role of Omi/HtrA2 in modulation of vimentin filamentous structure in neurons. Our results provide important findings for understanding the biological role of Omi/HtrA2 activity during stress conditions, and give knowledge of interplay between Omi/HtrA2 and vimentin which might affect mitochondrial distribution in neurons.

  3. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  4. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  5. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  6. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  7. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  8. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  9. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  10. Protease-activated receptor-1 modulates hippocampal memory formation and synaptic plasticity.

    PubMed

    Almonte, Antoine G; Qadri, Laura H; Sultan, Faraz A; Watson, Jennifer A; Mount, Daniel J; Rumbaugh, Gavin; Sweatt, J David

    2013-01-01

    Protease-activated receptor-1 (PAR1) is an unusual G-protein coupled receptor (GPCR) that is activated through proteolytic cleavage by extracellular serine proteases. Although previous work has shown that inhibiting PAR1 activation is neuroprotective in models of ischemia, traumatic injury, and neurotoxicity, surprisingly little is known about PAR1's contribution to normal brain function. Here, we used PAR1-/- mice to investigate the contribution of PAR1 function to memory formation and synaptic function. We demonstrate that PAR1-/- mice have deficits in hippocampus-dependent memory. We also show that while PAR1-/- mice have normal baseline synaptic transmission at Schaffer collateral-CA1 synapses, they exhibit severe deficits in N-methyl-d-aspartate receptor (NMDAR)-dependent long-term potentiation (LTP). Mounting evidence indicates that activation of PAR1 leads to potentiation of NMDAR-mediated responses in CA1 pyramidal cells. Taken together, this evidence and our data suggest an important role for PAR1 function in NMDAR-dependent processes subserving memory formation and synaptic plasticity.

  11. HIV-1 protease-induced apoptosis

    PubMed Central

    2014-01-01

    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  12. Protease inhibitor from Moringa oleifera with potential for use as therapeutic drug and as seafood preservative

    PubMed Central

    Bijina, B.; Chellappan, Sreeja; Krishna, Jissa G.; Basheer, Soorej M.; Elyas, K.K.; Bahkali, Ali H.; Chandrasekaran, M.

    2011-01-01

    Protease inhibitors are well known to have several applications in medicine and biotechnology. Several plant sources are known to return potential protease inhibitors. In this study plants belonging to different families of Leguminosae, Malvaceae, Rutaceae, Graminae and Moringaceae were screened for the protease inhibitor. Among them Moringa oleifera, belonging to the family Moringaceae, recorded high level of protease inhibitor activity after ammonium sulfate fractionation. M. oleifera, which grows throughout most of the tropics and having several industrial and medicinal uses, was selected as a source of protease inhibitor since so far no reports were made on isolation of the protease inhibitor. Among the different parts of M. oleifera tested, the crude extract isolated from the mature leaves and seeds showed the highest level of inhibition against trypsin. Among the various extraction media evaluated, the crude extract prepared in phosphate buffer showed maximum recovery of the protease inhibitor. The protease inhibitor recorded high inhibitory activity toward the serine proteases thrombin, elastase, chymotrypsin and the cysteine proteases cathepsin B and papain which have more importance in pharmaceutical industry. The protease inhibitor also showed complete inhibition of activities of the commercially available proteases of Bacillus licheniformis and Aspergillus oryzae. However, inhibitory activities toward subtilisin, esperase, pronase E and proteinase K were negligible. Further, it was found that the protease inhibitor could prevent proteolysis in a commercially valuable shrimp Penaeus monodon during storage indicating the scope for its application as a seafood preservative. This is the first report on isolation of a protease inhibitor from M. oleifera. PMID:23961135

  13. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  14. Catalysis and stability of an alkaline protease from a haloalkaliphilic bacterium under non-aqueous conditions as a function of pH, salt and temperature.

    PubMed

    Pandey, Sandeep; Rakholiya, Kalpna D; Raval, Vikram H; Singh, Satya P

    2012-09-01

    A haloalkaliphilic bacterium, isolated from Coastal Gujarat (India) was identified as Oceanobacillus sp. (GQ162111) based on 16S rRNA gene sequence. The organism grew and secreted extra cellular protease in presence of various organic solvents. At 30% (v/v) concentration of hexane, heptane, isooctane, dodecane and decane, significant growth and protease production was evident. The alkaline protease was purified in a single step on phenyl sepharose 6 FF with 28% yield. The molecular mass as judged by SDS-PAGE was 30 kDa. The temperature optimum of protease was 50°C and the enzyme retained 70% activity in 10% (v/v) isooctane. Effect of salt and pH was investigated in combination to assess the effect of isooctane. In organic solvents, the enzyme was considerably active at pH 8-11, with optimum activity at pH 10. Salt at 2 M was optimum for activity and enzyme maintained significant stability up to 18 h even at 3 M salt concentration. Patters of growth, protease production, catalysis and stability of the enzyme are presented. The study resumes significance as limited information is available on the interaction of haloalkaliphilic bacteria and their enzymes with organic solvents.

  15. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    PubMed

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films.

  16. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  17. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  18. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  19. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.

    2012-09-11

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  20. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.

    2013-01-01

    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  1. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  2. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  3. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  4. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  5. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  6. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  7. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  8. New therapeutic strategies in HCV: second-generation protease inhibitors.

    PubMed

    Clark, Virginia C; Peter, Joy A; Nelson, David R

    2013-02-01

    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance.

  9. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  10. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  11. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  12. Tobacco Etch Virus protease: A shortcut across biotechnologies.

    PubMed

    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca

    2016-08-10

    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  13. Cleaning protocols for crystallization robots: preventing protease contamination.

    PubMed

    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard

    2015-01-01

    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  14. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  15. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  16. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  17. [Cytokines and proteases involved in pathogenesis of COPD].

    PubMed

    Yamaya, Atsuyo; Osanai, Kazuhiro

    2011-10-01

    COPD is characterized by persistence of chronic inflammation in small airways and alveoli. Macrophages, neutrophils, and a specialized subset of T lymphocytes orchestrate the mild inflammation. This article focuses on humoral factors such as cytokines and chemokines that recruit these inflammatory and immune cells to the lungs, and proteases/antiproteases that ultimately cause structural derangement in the terminal respiratory zones. In addition to the classical protease and antiprotease imbalance hypothesis, alveolar homeostasis abnormality that comes from imbalance of lung constitutional cell apoptosis and regeneration may play a role in emphysema development. Also, autoimmunity to elastin degradation products may take part in the disease.

  18. The chlamydial protease CPAF: important or not, important for what?

    PubMed

    Häcker, Georg

    2014-05-01

    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF.

  19. Regulation by proteolysis: energy-dependent proteases and their targets.

    PubMed Central

    Gottesman, S; Maurizi, M R

    1992-01-01

    A number of critical regulatory proteins in both prokaryotic and eukaryotic cells are subject to rapid, energy-dependent proteolysis. Rapid degradation combined with control over biosynthesis provides a mechanism by which the availability of a protein can be limited both temporally and spatially. Highly unstable regulatory proteins are involved in numerous biological functions, particularly at the commitment steps in developmental pathways and in emergency responses. The proteases involved in energy-dependent proteolysis are large proteins with the ability to use ATP to scan for appropriate targets and degrade complete proteins in a processive manner. These cytoplasmic proteases are also able to degrade many abnormal proteins in the cell. PMID:1480111

  20. Identification of Genotypic Changes in Human Immunodeficiency Virus Protease That Correlate with Reduced Susceptibility to the Protease Inhibitor Lopinavir among Viral Isolates from Protease Inhibitor-Experienced Patients

    PubMed Central

    Kempf, Dale J.; Isaacson, Jeffrey D.; King, Martin S.; Brun, Scott C.; Xu, Yi; Real, Kathryn; Bernstein, Barry M.; Japour, Anthony J.; Sun, Eugene; Rode, Richard A.

    2001-01-01

    The association of genotypic changes in human immunodeficiency virus (HIV) protease with reduced in vitro susceptibility to the new protease inhibitor lopinavir (previously ABT-378) was explored using a panel of viral isolates from subjects failing therapy with other protease inhibitors. Two statistical tests showed that specific mutations at 11 amino acid positions in protease (L10F/I/R/V, K20M/R, L24I, M46I/L, F53L, I54L/T/V, L63P, A71I/L/T/V, V82A/F/T, I84V, and L90M) were associated with reduced susceptibility. Mutations at positions 82, 54, 10, 63, 71, and 84 were most closely associated with relatively modest (4- and 10-fold) changes in phenotype, while the K20M/R and F53L mutations, in conjunction with multiple other mutations, were associated with >20- and >40-fold-reduced susceptibility, respectively. The median 50% inhibitory concentrations (IC50) of lopinavir against isolates with 0 to 3, 4 or 5, 6 or 7, and 8 to 10 of the above 11 mutations were 0.8-, 2.7-, 13.5-, and 44.0-fold higher, respectively, than the IC50 against wild-type HIV. On average, the IC50 of lopinavir increased by 1.74-fold per mutation in isolates containing three or more mutations. Each of the 16 viruses that displayed a >20-fold change in susceptibility contained mutations at residues 10, 54, 63, and 82 and/or 84, along with a median of three mutations at residues 20, 24, 46, 53, 71, and 90. The number of protease mutations from the 11 identified in these analyses (the lopinavir mutation score) may be useful for the interpretation of HIV genotypic resistance testing with respect to lopinavir-ritonavir (Kaletra) regimens and may provide insight into the genetic barrier to resistance to lopinavir-ritonavir in both antiretroviral therapy-naive and protease inhibitor-experienced patients. PMID:11462018

  1. Characterisation of a detergent-stable alkaline protease from a novel thermophilic strain Paenibacillus tezpurensis sp. nov. AS-S24-II.

    PubMed

    Rai, Sudhir K; Roy, Jetendra K; Mukherjee, Ashis K

    2010-02-01

    An alkaline-protease-producing bacterial strain (AS-S24-II) isolated from a soil sample in Assam is a Gram-stain-positive, catalase-positive, endospore-forming rod and grows at temperatures ranging from 30 degrees C to 60 degrees C and salinity ranging from 0% to 7% (w/v) NaCl. Phenotypic characterisation, chemotaxonomic properties, presence of Paenibacillus-specific signature sequences, and ribotyping data suggested that the strain AS-S24-II represents a novel species of the genus Paenibacillus, for which the name Paenibacillus tezpurensis sp. nov. (MTCC 8959) is proposed. Phylogenetic analysis revealed that P. lentimorbus strain DNG-14 and P. lentimorbus strain DNG-16 represent the closest phylogenetic neighbour of this novel strain. Alkaline protease production (598 x 10(3) U l(-1)) by P. tezpurensis sp. nov. in SmF was optimised by response surface method. A laundry-detergent-stable, Ca(2+)-independent, 43-kDa molecular weight alkaline serine protease from this strain was purified with a 1.7-fold increase in specific activity. The purified protease displayed optimum activity at pH 9.5 and 45-50 degrees C temperature range and exhibited a significant stability and compatibility with surfactants and most of the tested commercial laundry detergents at room temperature. Further, the protease improved the wash performance of detergents, thus demonstrating its feasibility for inclusion in laundry detergent formulations.

  2. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  3. Tracking HCV protease population diversity during transmission and susceptibility of founder populations to antiviral therapy.

    PubMed

    Khera, Tanvi; Todt, Daniel; Vercauteren, Koen; McClure, C Patrick; Verhoye, Lieven; Farhoudi, Ali; Bhuju, Sabin; Geffers, Robert; Baumert, Thomas F; Steinmann, Eike; Meuleman, Philip; Pietschmann, Thomas; Brown, Richard J P

    2017-03-01

    Due to the highly restricted species-tropism of Hepatitis C virus (HCV) a limited number of animal models exist for pre-clinical evaluation of vaccines and antiviral compounds. The human-liver chimeric mouse model allows heterologous challenge with clinically relevant strains derived from patients. However, to date, the transmission and longitudinal evolution of founder viral populations in this model have not been characterized in-depth using state-of-the-art sequencing technologies. Focusing on NS3 protease encoding region of the viral genome, mutant spectra in a donor inoculum and individual recipient mice were determined via Illumina sequencing and compared, to determine the effects of transmission on founder viral population complexity. In all transmissions, a genetic bottleneck was observed, although diverse viral populations were transmitted in each case. A low frequency cloud of mutations (<1%) was detectable in the donor inoculum and recipient mice, with single nucleotide variants (SNVs) > 1% restricted to a subset of nucleotides. The population of SNVs >1% was reduced upon transmission while the low frequency SNV cloud remained stable. Fixation of multiple identical synonymous substitutions was apparent in independent transmissions, and no evidence for reversion of T-cell epitopes was observed. In addition, susceptibility of founder populations to antiviral therapy was assessed. Animals were treated with protease inhibitor (PI) monotherapy to track resistance associated substitution (RAS) emergence. Longitudinal analyses revealed a decline in population diversity under therapy, with no detectable RAS >1% prior to therapy commencement. Despite inoculation from a common source and identical therapeutic regimens, unique RAS emergence profiles were identified in different hosts prior to and during therapeutic failure, with complex mutational signatures at protease residues 155, 156 and 168 detected. Together these analyses track viral population complexity

  4. Role of protease-activated receptors 2 (PAR2) in ocular infections and inflammation

    PubMed Central

    Tripathi, Trivendra; Alizadeh, Hassan

    2015-01-01

    Protease-activated receptors (PARs) belong to a unique family of G protein-coupled receptors (GPCRs) that are cleaved at an activation site within the N-terminal exodomain by a variety of proteinases, essentially of the serine (Ser) proteinase family. After cleavage, the new N-terminal sequence functions as a tethered ligand, which binds intramolecularly to activate the receptor and initiate signaling. Cell signals induced through the activation of PARs appear to play a significant role in innate and adoptive immune responses of the cornea, which is constantly exposed to proteinases under physiological or pathophysiological conditions. Activation of PARs interferes with all aspects of the corneal physiology such as barrier function, transports, innate and adoptive immune responses, and functions of corneal nerves. It is not known whether the proteinase released from the microorganism can activate PARs and triggers the inflammatory responses. The role of PAR2 expressed by the corneal epithelial cells and activation by serine protease released from microorganism is discussed here. Recent evidences suggest that activation of PAR2, by the serine proteinases, play an important role in innate and inflammatory responses of the corneal infection. PMID:26078987

  5. Regulation of distinct pools of amyloid β-protein by multiple cellular proteases

    PubMed Central

    2013-01-01

    Alzheimer’s disease (AD) is a progressive, age-related neurodegenerative disorder characterized by extracellular and intracellular deposition of the amyloid β-protein (Aβ). The study of rare, familial forms of AD has shown that sustained elevations in the production of Aβ (either all forms or specific pathogenic variants thereof) are sufficient to trigger the full spectrum of cognitive and histopathological features of the disease. Although the exact cause or causes remain unknown, emerging evidence suggests that impairments in the clearance of Aβ, after it is produced, may underlie the vast majority of sporadic AD cases. This review focuses on Aβ-degrading proteases (AβDPs), which have emerged as particularly important mediators of Aβ clearance. A wide variety of proteases that – by virtue of their particular regional and subcellular localization profiles – define distinct pools of Aβ have been identified. Different pools of Aβ, in turn, may contribute differentially to the pathogenesis of the disease. The study of individual AβDPs, therefore, promises to offer new insights into the mechanistic basis of AD pathogenesis and, ultimately, may facilitate the development of effective methods for its prevention or treatment or both. PMID:23953275

  6. Untangling structure-function relationships in the rhomboid family of intramembrane proteases.

    PubMed

    Brooks, Cory L; Lemieux, M Joanne

    2013-12-01

    Rhomboid proteases are a family of integral membrane proteins that have been implicated in critical regulatory roles in a wide array of cellular processes and signaling events. The determination of crystal structures of the prokaryotic rhomboid GlpG from Escherichia coli and Haemophilus influenzae has ushered in an era of unprecedented understanding into molecular aspects of intramembrane proteolysis by this fascinating class of protein. A combination of structural studies by X-ray crystallography, and biophysical and spectroscopic analyses, combined with traditional enzymatic and functional analysis has revealed fundamental aspects of rhomboid structure, substrate recognition and the catalytic mechanism. This review summarizes these remarkable advances by examining evidence for the proposed catalytic mechanism derived from inhibitor co-crystal structures, conflicting models of rhomboid-substrate interaction, and recent work on the structure and function of rhomboid cytosolic domains. In addition to exploring progress on aspects of rhomboid structure, areas for future research and unaddressed questions are emphasized and highlighted. This article is part of a Special Issue entitled: Intramembrane Proteases.

  7. Disruption of SUMO-Specific Protease 2 Induces Mitochondria Mediated Neurodegeneration

    PubMed Central

    Fu, Jiang; Yu, H.-M. Ivy; Chiu, Shang-Yi; Mirando, Anthony J.; Maruyama, Eri O.; Cheng, Jr-Gang; Hsu, Wei

    2014-01-01

    Post-translational modification of proteins by small ubiquitin-related modifier (SUMO) is reversible and highly evolutionarily conserved from yeasts to humans. Unlike ubiquitination with a well-established role in protein degradation, sumoylation may alter protein function, activity, stability and subcellular localization. Members of SUMO-specific protease (SENP) family, capable of SUMO removal, are involved in the reversed conjugation process. Although SUMO-specific proteases are known to reverse sumoylation in many well-defined systems, their importance in mammalian development and pathogenesis remains largely elusive. In patients with neurodegenerative diseases, aberrant accumulation of SUMO-conjugated proteins has been widely described. Several aggregation-prone proteins modulated by SUMO have been implicated in neurodegeneration, but there is no evidence supporting a direct involvement of SUMO modification enzymes in human diseases. Here we show that mice with neural-specific disruption of SENP2 develop movement difficulties which ultimately results in paralysis. The disruption induces neurodegeneration where mitochondrial dynamics is dysregulated. SENP2 regulates Drp1 sumoylation and stability critical for mitochondrial morphogenesis in an isoform-specific manner. Although dispensable for development of neural cell types, this regulatory mechanism is necessary for their survival. Our findings provide a causal link of SUMO modification enzymes to apoptosis of neural cells, suggesting a new pathogenic mechanism for neurodegeneration. Exploring the protective effect of SENP2 on neuronal cell death may uncover important preventive and therapeutic strategies for neurodegenerative diseases. PMID:25299344

  8. Co-lethality studied as an asset against viral drug escape: the HIV protease case

    PubMed Central

    2010-01-01

    Background Co-lethality, or synthetic lethality is the documented genetic situation where two, separately non-lethal mutations, become lethal when combined in one genome. Each mutation is called a "synthetic lethal" (SL) or a co-lethal. Like invariant positions, SL sets (SL linked couples) are choice targets for drug design against fast-escaping RNA viruses: mutational viral escape by loss of affinity to the drug may induce (synthetic) lethality. Results From an amino acid sequence alignment of the HIV protease, we detected the potential SL couples, potential SL sets, and invariant positions. From the 3D structure of the same protein we focused on the ones that were close to each other and accessible on the protein surface, to possibly bind putative drugs. We aligned 24,155 HIV protease amino acid sequences and identified 290 potential SL couples and 25 invariant positions. After applying the distance and accessibility filter, three candidate drug design targets of respectively 7 (under the flap), 4 (in the cantilever) and 5 (in the fulcrum) amino acid positions were found. Conclusions These three replication-critical targets, located outside of the active site, are key to our anti-escape strategy. Indeed, biological evidence shows that 2/3 of those target positions perform essential biological functions. Their mutational variations to escape antiviral medication could be lethal, thus limiting the apparition of drug-resistant strains. Reviewers This article was reviewed by Arcady Mushegian, Shamil Sunyaev and Claus Wilke. PMID:20565756

  9. Activity of Protease-Activated Receptors in Primary Cultured Human Myenteric Neurons

    PubMed Central

    Kugler, Eva M.; Mazzuoli, Gemma; Demir, Ihsan E.; Ceyhan, Güralp O.; Zeller, Florian; Schemann, Michael

    2012-01-01

    Activity of the four known protease-activated receptors (PARs) has been well studied in rodent enteric nervous system and results in animal models established an important role for neuronal PAR2. We recently demonstrated that, unlike in rodents, PAR1 is the dominant neuronal protease receptor in the human submucous plexus. With this study we investigated whether this also applies to the human myenteric plexus. We used voltage sensitive dye recordings to detect action potential discharge in primary cultures of human myenteric neurons in response to PAR activating peptides (APs). Application of the PAR1-AP (TFLLR) or PAR4-AP (GYPGQV) evoked spike discharge in 79 or 23% of myenteric neurons, respectively. The PAR1-AP response was mimicked by the endogenous PAR1 activator thrombin and blocked by the PAR1 antagonists SCH79797. Human myenteric neurons did not respond to PAR2-AP. This was not due to culture conditions because all three PAR-APs evoked action potentials in cultured guinea pig myenteric neurons. Consecutive application of PAR-APs revealed coexpression (relative to the population responding to PAR-APs) of PAR1/PAR2 in 51%, PAR1/PAR4 in 43%, and of PAR2/PAR4 in 29% of guinea pig myenteric neurons. Our study provided further evidence for the prominent role of neuronal PAR1 in the human enteric nervous system. PMID:22988431

  10. Purification and partial characterization of thiol protease inhibitors from embryos of the brine shrimp Artemia.

    PubMed

    Warner, A H; Sonnenfeld-Karcz, M J

    1992-01-01

    Thiol protease inhibitor (TPI) proteins in embryos of the brine shrimp Artemia were purified to apparent homogeneity and several of their properties were studied. Four protein fractions containing thiol protease inhibitor activity were obtained by high performance liquid chromatography of Artemia embryo proteins on a C-18 reverse-phase column and these were designated as TPI-1a, -1b, -2, and -3. Acrylamide gel electrophoresis showed that TPI-1a and TPI-1b each consisted of two bands of 11.8 and 13.6 kilodaltons (kDa), while TPI-2 and TPI-3 consisted of only one band of 12.5 kDa. Isoelectric focusing experiments demonstrated that TPI-3 contained one band at pH 5.3, while both TPI-1b and TPI-2 yielded bands at pH 5.2 and 5.3. TPI-1a did not yield any major bands. Amino acid composition analyses of the Artemia TPI proteins showed them to be remarkably similar to one another. All were rich in valine and aspartic and glutamic acids, and devoid of cysteine. Partial trypsin digestion of TPI-1b, TPI-2, and TPI-3 yielded several peptides with identical mobilities on a reverse-phase column and several other peptides with different mobilities, suggesting that the multiple forms of Artemia TPIs may have originated from the same parental protein. N-terminal amino acid sequence analyses of TPI-3 suggest that Artemia TPI proteins are members of the type I cystatin family of protease inhibitors.

  11. A Mycobacterium avium subsp. paratuberculosis Predicted Serine Protease Is Associated with Acid Stress and Intraphagosomal Survival

    PubMed Central

    Kugadas, Abirami; Lamont, Elise A.; Bannantine, John P.; Shoyama, Fernanda M.; Brenner, Evan; Janagama, Harish K.; Sreevatsan, Srinand

    2016-01-01

    The ability to maintain intra-cellular pH is crucial for bacteria and other microbes to survive in diverse environments, particularly those that undergo fluctuations in pH. Mechanisms of acid resistance remain poorly understood in mycobacteria. Although, studies investigating acid stress in M. tuberculosis are gaining traction, few center on Mycobacterium avium subsp. paratuberculosis (MAP), the etiological agent of chronic enteritis in ruminants. We identified a MAP acid stress response network involved in macrophage infection. The central node of this network was MAP0403, a predicted serine protease that shared an 86% amino acid identity with MarP in M. tuberculosis. Previous studies confirmed MarP as a serine protease integral to maintaining intra-bacterial pH and survival in acid in vitro and in vivo. We show that MAP0403 is upregulated in infected macrophages and MAC-T cells that coincided with phagosome acidification. Treatment of mammalian cells with bafilomcyin A1, a potent inhibitor of phagosomal vATPases, diminished MAP0403 transcription. MAP0403 expression was also noted in acidic medium. A surrogate host, M. smegmatis mc2 155, was designed to express MAP0403 and when exposed to either macrophages or in vitro acid stress had increased bacterial cell viability, which corresponds to maintenance of intra-bacterial pH in acidic (pH = 5) conditions, compared to the parent strain. These data suggest that MAP0403 may be the equivalent of MarP in MAP. Future studies confirming MAP0403 as a serine protease and exploring its structure and possible substrates are warranted. PMID:27597934

  12. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  13. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  14. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  15. Emerging technologies for protease engineering: New tools to clear out disease.

    PubMed

    Guerrero, Jennifer L; Daugherty, Patrick S; O'Malley, Michelle A

    2017-01-01

    Proteases regulate many biological processes through their ability to activate or inactive their target substrates. Because proteases catalytically turnover proteins and peptides, they present unique opportunities for use in biotechnological and therapeutic applications. However, many proteases are capable of cleaving multiple physiological substrates. Therefore their activity, expression, and localization are tightly controlled to prevent unwanted proteolysis. Currently, the use of protease therapeutics has been limited to a handful of proteases with narrow substrate specificities, which naturally limits their toxicity. Wider application of proteases is contingent upon the development of methods for engineering protease selectivity, activity, and stability. Recent advances in the development of high-throughput, bacterial and yeast-based methods for protease redesign have yielded protease variants with novel specificities, reduced toxicity, and increased resistance to inhibitors. Here, we highlight new tools for protease engineering, including methods suitable for the redesign of human secreted proteases, and future opportunities to exploit the catalytic activity of proteases for therapeutic benefit. Biotechnol. Bioeng. 2017;114: 33-38. © 2016 Wiley Periodicals, Inc.

  16. The Spl Serine Proteases Modulate Staphylococcus aureus Protein Production and Virulence in a Rabbit Model of Pneumonia

    PubMed Central

    Salgado-Pabon, Wilmara; Meyerholz, David K.; White, Mark J.; Schlievert, Patrick M.

    2016-01-01

    ABSTRACT The Spl proteases are a group of six serine proteases that are encoded on the νSaβ pathogenicity island and are unique to Staphylococcus aureus. Despite their interesting biochemistry, their biological substrates and functions in virulence have been difficult to elucidate. We found that an spl operon mutant of the community-associated methicillin-resistant S. aureus USA300 strain LAC induced localized lung damage in a rabbit model of pneumonia, characterized by bronchopneumonia observed histologically. Disease in the mutant-infected rabbits was restricted in distribution compared to that in wild-type USA300-infected rabbits. We also found that SplA is able to cleave the mucin 16 glycoprotein from the surface of the CalU-3 lung cell line, suggesting a possible mechanism for wild-type USA300 spreading pneumonia to both lungs. Investigation of the secreted and surface proteomes of wild-type USA300 and the spl mutant revealed multiple alterations in metabolic proteins and virulence factors. This study demonstrates that the Spls modulate S. aureus physiology and virulence, identifies a human target of SplA, and suggests potential S. aureus targets of the Spl proteases. IMPORTANCE Staphylococcus aureus is a versatile human pathogen that produces an array of virulence factors, including several proteases. Of these, six proteases called the Spls are the least characterized. Previous evidence suggests that the Spls are expressed during human infection; however, their function is unknown. Our study shows that the Spls are required for S. aureus to cause disseminated lung damage during pneumonia. Further, we present the first example of a human protein cut by an Spl protease. Although the Spls were predicted not to cut staphylococcal proteins, we also show that an spl mutant has altered abundance of both secreted and surface-associated proteins. This work provides novel insight into the function of Spls during infection and their potential ability to degrade

  17. A novel serine protease inhibitor from Bungarus fasciatus venom.

    PubMed

    Lu, Jia; Yang, Hailong; Yu, Haining; Gao, Weikai; Lai, Ren; Liu, Jingze; Liang, Xingcai

    2008-03-01

    By Sephadex G-50 gel filtration, cation-exchange CM-Sephadex C-25 chromatography and reversed phase high-performance liquid chromatography (HPLC), a novel serine protease inhibitor named bungaruskunin was purified and characterized from venom of Bungarus fasciatus. Its cDNA was also cloned from the cDNA library of B. fasciatus venomous glands. The predicted precursor is composed of 83 amino acid (aa) residues including a 24-aa signal peptide and a 59-aa mature bungaruskunin. Bungaruskunin showed maximal similarity (64%) with the predicted serine protease inhibitor blackelin deduced from the cDNA sequence of the red-bellied black snake Pseudechis porphyriacus. Bungaruskunin is a Kunitz protease inhibitor with a conserved Kunitz domain and could exert inhibitory activity against trypsin, chymotrypsin, and elastase. By screening the cDNA library, two new B chains of beta-bungarotoxin are also identified. The overall structures of bungaruskunin and beta-bungarotoxin B chains are similar; especially they have highly conserved signal peptide sequences. These findings strongly suggest that snake Kunitz/BPTI protease inhibitors and neurotoxic homologs may have originated from a common ancestor.

  18. Design, synthesis, and activity of nanocellulosic protease sensors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we contrast the molecular assembly, and biochemical utility of nanocellulosic materials prepared from cotton and wood as protease sensors. The cotton-based nanocellulosic substrates were prepared in a variety of ways to produce nanocrystals, films and aerogels, which were derivatized with eithe...

  19. Protease inhibitors interfere with the necessary factors of carcinogenesis.

    PubMed

    Troll, W

    1989-05-01

    Many tumor promoters are inflammatory agents that stimulate the formation of oxygen radicals (.O2-) and hydrogen peroxide (H2O2) in phagocytic neutrophils. The neutrophils use the oxygen radicals to kill bacteria, which are recognized by the cell membrane of phagocytic cells causing a signal to mount the oxygen response. The tumor promoter isolated from croton oil, 12-O-tetradecanoylphorbol-13-acetate (TPA), mimics the signal, causing an oxygen radical release that is intended to kill bacteria; instead, it injures cells in the host. Oxygen radicals cause single strand breaks in DNA and modify DNA bases. These damaging reactions appear to be related to tumor promotion, as three types of chemopreventive agents, retinoids, onion oil, and protease inhibitors, suppress the induction of oxygen radicals in phagocytic neutrophils and suppress tumor promotion in skin cancer in mice. Protease inhibitors also suppress breast and colon cancers in mice. Protease inhibitors capable of inhibiting chymotrypsin show a greater suppression of the oxygen effect and are better suppressors of tumor promotion. In addition, oxygen radicals may be one of the many agents that cause activation of oncogenes. Since retinoids and protease inhibitors suppress the expression of the ras oncogene in NIH 3T3 cells, NIH 3T3 cells may serve as a relatively facile model for finding and measuring chemopreventive agents that interfere with the carcinogenic process.

  20. Botulinum neurotoxin: a deadly protease with applications to human medicine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Botulinum neurotoxins (BoNTs) are some of the most potent biological toxins to humans. They are synthesized by the gram-positive, spore-forming bacterium Clostridium botulinum. BoNT is secreted from the bacterium as a ~150 kDa polypeptide which is cleaved by bacterial or host proteases into a ~50 kD...

  1. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  2. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  3. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  4. Enhanced Long-Term and Impaired Short-Term Spatial Memory in GluA1 AMPA Receptor Subunit Knockout Mice: Evidence for a Dual-Process Memory Model

    ERIC Educational Resources Information Center

    Sanderson, David J.; Good, Mark A.; Skelton, Kathryn; Sprengel, Rolf; Seeburg, Peter H.; Rawlins, J. Nicholas P.; Bannerman, David M.

    2009-01-01

    The GluA1 AMPA receptor subunit is a key mediator of hippocampal synaptic plasticity and is especially important for a rapidly-induced, short-lasting form of potentiation. GluA1 gene deletion impairs hippocampus-dependent, spatial working memory, but spares hippocampus-dependent spatial reference memory. These findings may reflect the necessity of…

  5. Mast Cell Proteases as Protective and Inflammatory Mediators

    PubMed Central

    Caughey, George H.

    2014-01-01

    Proteases are the most abundant class of proteins produced by mast cells. Many of these are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which include cross-linking of high affinity IgE receptor FcεRI by IgE bound to multivalent allergen. Understanding and separating the functions of the proteases is important because expression differs among mast cells in different tissue locations. Differences between laboratory animals and humans in protease expression also influence the degree of confidence with which results obtained in animal models of mast cell function can be extrapolated to humans. The inflammatory potential of mast cell proteases was the first aspect of their biology to be explored and has received the most attention, in part because some of them—notably tryptases and chymases—are biomarkers of local and systemic mast cell degranulation and anaphylaxis. Although some of the proteases indeed augment allergic inflammation and are potential targets for inhibition to treat asthma and related allergic disorders, they are protective and even anti-inflammatory in some settings. For example, mast cell tryptases may protect from serious bacterial lung infections and may limit the “rubor” component of inflammation caused by vasodilating neuropeptides in the skin. Chymases help to maintain intestinal barrier function and to expel parasitic worms, and may support blood pressure during anaphylaxis by generating angiotensin II. In other life-or-death examples, carboxypeptidase A3 and other mast cell peptidases limit systemic toxicity of endogenous peptides like endothelin and neurotensin during septic peritonitis, and inactivate venom-associated peptides. On the other hand, mast cell peptidase-mediated destruction of protective cytokines, like IL-6, can enhance mortality from sepsis. Peptidases released from mast cells also influence non-mast cell proteases, such as by activating matrix metalloproteinase cascades

  6. The stromal cell-surface protease fibroblast activation protein-α localizes to lipid rafts and is recruited to invadopodia.

    PubMed

    Knopf, Julia D; Tholen, Stefan; Koczorowska, Maria M; De Wever, Olivier; Biniossek, Martin L; Schilling, Oliver

    2015-10-01

    Fibroblast activation protein alpha (FAPα) is a cell surface protease expressed by cancer-associated fibroblasts in the microenvironment of most solid tumors. As there is increasing evidence for proteases having non-catalytic functions, we determined the FAPα interactome in cancer-associated fibroblasts using the quantitative immunoprecipitation combined with knockdown (QUICK) method. Complex formation with adenosin deaminase, erlin-2, stomatin, prohibitin, Thy-1 membrane glycoprotein, and caveolin-1 was further validated by immunoblotting. Co-immunoprecipitation (co-IP) of the known stoichiometric FAPα binding partner dipeptidyl-peptidase IV (DPPIV) corroborated the proteomic strategy. Reverse co-IPs validated the FAPα interaction with caveolin-1, erlin-2, and stomatin while co-IP upon RNA-interference mediated knock-down of DPPIV excluded adenosin deaminase as a direct FAPα interaction partner. Many newly identified FAPα interaction partners localize to lipid rafts, including caveolin-1, a widely-used marker for lipid raft localization. We hypothesized that this indicates a recruitment of FAPα to lipid raft structures. In density gradient centrifugation, FAPα co-fractionates with caveolin-1. Immunofluorescence optical sectioning microscopy of FAPα and lipid raft markers further corroborates recruitment of FAPα to lipid rafts and invadopodia. FAPα is therefore an integral component of stromal lipid rafts in solid tumors. In essence, we provide one of the first interactome analyses of a cell surface protease and translate these results into novel biological aspects of a marker protein for cancer-associated fibroblasts.

  7. Intrinsic flexibility of West Nile virus protease in solution characterized using small-angle X-ray scattering.

    PubMed

    Garces, Andrea P; Watowich, Stanley J

    2013-10-01

    West Nile virus (WNV) is a mosquito-borne flavivirus with a rapidly expanding global distribution. Infection can cause severe neurological disease and fatality in humans. Efforts are ongoing to develop antiviral drugs that inhibit the WNV protease, a viral enzyme required for polyprotein processing. Unfortunately, little is known about the solution structure of recombinant WNV protease (NS2B-NS3pro) used for antiviral drug discovery and development, although X-ray crystal structures and nuclear magnetic resonance (NMR) studies have provided valuable insights into the interactions between NS2B-NS3pro and peptide-based inhibitors. We completed small-angle X-ray scattering and Fourier transform infrared spectroscopy experiments to determine the solution structure and dynamics of WNV NS2B-NS3pro in the absence of a bound substrate or inhibitor. Importantly, these solution studies suggested that all or most of the NS2B cofactor was highly flexible and formed an ensemble of structures, in contrast to the NS2B tertiary structures observed in crystallographic and NMR studies. The secondary structure of NS2B-NS3pro in solution had high β-content, similar to the secondary structure observed in crystallographic studies. This work provided evidence of the intrinsic flexibility and conformational heterogeneity of the NS2B chain of the WNV protease in the absence of substratelike ligands, which should be considered during antiviral drug discovery and development efforts.

  8. SUMO proteases ULP1c and ULP1d are required for development and osmotic stress responses in Arabidopsis thaliana.

    PubMed

    Castro, Pedro Humberto; Couto, Daniel; Freitas, Sara; Verde, Nuno; Macho, Alberto P; Huguet, Stéphanie; Botella, Miguel Angel; Ruiz-Albert, Javier; Tavares, Rui Manuel; Bejarano, Eduardo Rodríguez; Azevedo, Herlânder

    2016-09-01

    Sumoylation is an essential post-translational regulator of plant development and the response to environmental stimuli. SUMO conjugation occurs via an E1-E2-E3 cascade, and can be removed by SUMO proteases (ULPs). ULPs are numerous and likely to function as sources of specificity within the pathway, yet most ULPs remain functionally unresolved. In this report we used loss-of-function reverse genetics and transcriptomics to functionally characterize Arabidopsis thaliana ULP1c and ULP1d SUMO proteases. GUS reporter assays implicated ULP1c/d in various developmental stages, and subsequent defects in growth and germination were uncovered using loss-of-function mutants. Microarray analysis evidenced not only a deregulation of genes involved in development, but also in genes controlled by various drought-associated transcriptional regulators. We demonstrated that ulp1c ulp1d displayed diminished in vitro root growth under low water potential and higher stomatal aperture, yet leaf transpirational water loss and whole drought tolerance were not significantly altered. Generation of a triple siz1 ulp1c ulp1d mutant suggests that ULP1c/d and the SUMO E3 ligase SIZ1 may display separate functions in development yet operate epistatically in response to water deficit. We provide experimental evidence that Arabidopsis ULP1c and ULP1d proteases act redundantly as positive regulators of growth, and operate mainly as isopeptidases downstream of SIZ1 in the control of water deficit responses.

  9. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  10. Highly efficient and easy protease-mediated protein purification.

    PubMed

    Last, Daniel; Müller, Janett; Dawood, Ayad W H; Moldenhauer, Eva J; Pavlidis, Ioannis V; Bornscheuer, Uwe T

    2016-02-01

    As both research on and application of proteins are rarely focused on the resistance towards nonspecific proteases, this property remained widely unnoticed, in particular in terms of protein purification and related fields. In the present study, diverse aspects of protease-mediated protein purification (PMPP) were explored on the basis of the complementary proteases trypsin and proteinase K as well as the model proteins green fluorescent protein (GFP) from Aequorea victoria, lipase A from Candida antarctica (CAL-A), a transaminase from Aspergillus fumigatus (AspFum), quorum quenching lactonase AiiA from Bacillus sp., and an alanine dehydrogenase from Thermus thermophilus (AlaDH). While GFP and AiiA were already known to be protease resistant, the thermostable enzymes CAL-A, AspFum, and AlaDH were selected due to the documented correlation between thermostability and protease resistance. As proof of principle for PMPP, recombinant GFP remained unaffected whereas most Escherichia coli (E. coli) host proteins were degraded by trypsin. PMPP was highly advantageous compared to the widely used heat-mediated purification of commercial CAL-A. The resistance of AspFum towards trypsin was improved by rational protein design introducing point mutation R20Q. Trypsin also served as economical and efficient substitute for site-specific endopeptidases for the removal of a His-tag fused to AiiA. Moreover, proteolysis of host enzymes with interfering properties led to a strongly improved sensitivity and accuracy of the NADH assay in E. coli cell lysate for AlaDH activity measurements. Thus, PMPP is an attractive alternative to common protein purification methods and facilitates also enzyme characterization in cell lysate.

  11. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  12. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  13. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  14. A Spider-Derived Kunitz-Type Serine Protease Inhibitor That Acts as a Plasmin Inhibitor and an Elastase Inhibitor

    PubMed Central

    Wan, Hu; Lee, Kwang Sik; Kim, Bo Yeon; Zou, Feng Ming; Yoon, Hyung Joo; Je, Yeon Ho; Li, Jianhong; Jin, Byung Rae

    2013-01-01

    Kunitz-type serine protease inhibitors are involved in various physiological processes, such as ion channel blocking, blood coagulation, fibrinolysis, and inflammation. While spider-derived Kunitz-type proteins show activity in trypsin or chymotrypsin inhibition and K+ channel blocking, no additional role for these proteins has been elucidated. In this study, we identified the first spider (Araneus ventricosus) Kunitz-type serine protease inhibitor (AvKTI) that acts as a plasmin inhibitor and an elastase inhibitor. AvKTI possesses a Kunitz domain consisting of a 57-amino-acid mature peptide that displays features consistent with Kunitz-type inhibitors, including six conserved cysteine residues and a P1 lysine residue. Recombinant AvKTI, expressed in baculovirus-infected insect cells, showed a dual inhibitory activity against trypsin (Ki 7.34 nM) and chymotrypsin (Ki 37.75 nM), defining a role for AvKTI as a spider-derived Kunitz-type serine protease inhibitor. Additionally, AvKTI showed no detectable inhibitory effects on factor Xa, thrombin, or tissue plasminogen activator; however, AvKTI inhibited plasmin (Ki 4.89 nM) and neutrophil elastase (Ki 169.07 nM), indicating that it acts as an antifibrinolytic factor and an antielastolytic factor. These findings constitute molecular evidence that AvKTI acts as a plasmin inhibitor and an elastase inhibitor and also provide a novel view of the functions of a spider-derived Kunitz-type serine protease inhibitor. PMID:23308198

  15. A New Pepstatin-Insensitive Thermopsin-Like Protease Overproduced in Peptide-Rich Cultures of Sulfolobus solfataricus

    PubMed Central

    Gogliettino, Marta; Riccio, Alessia; Cocca, Ennio; Rossi, Mosè; Palmieri, Gianna; Balestrieri, Marco

    2014-01-01

    In this study, we gain insight into the extracellular proteolytic system of Sulfolobus solfataricus grown on proteinaceous substrates, providing further evidence that acidic proteases were specifically produced in response to peptide-rich media. The main proteolytic component was the previously isolated SsMTP (Sulfolobus solfataricus multi-domain thermopsin-like protease), while the less abundant (named SsMTP-1) one was purified, characterized and identified as the sso1175 gene-product. The protein revealed a multi-domain organization shared with the cognate SsMTP with a catalytic domain followed by several tandemly-repeated motifs. Moreover, both enzymes were found spread across the Crenarchaeota phylum and belonging to the thermopsin family, although segregated into diverse phylogenetic clusters. SsMTP-1 showed a 75-kDa molecular mass and was stable in the temperature range 50–90 °C, with optimal activity at 70 °C and pH 2.0. Serine, metallo and aspartic protease inhibitors did not affect the enzyme activity, designating SsMTP-1 as a new member of the pepstatin-insensitive aspartic protease family. The peptide-bond-specificity of SsMTP-1 in the cleavage of the oxidized insulin B chain was uncommon amongst thermopsins, suggesting that it could play a distinct, but cooperative role in the protein degradation machinery. Interestingly, predictions of the transmembrane protein topology of SsMTP and SsMTP-1 strongly suggest a possible contribution in signal-transduction pathways. PMID:24566144

  16. A1C test

    MedlinePlus

    HbA1C test; Glycated hemoglobin test; Glycohemoglobin test; Hemoglobin A1C; Diabetes - A1C; Diabetic - A1C ... gov/pubmed/26696680 . Chernecky CC, Berger BJ. Glycosylated hemoglobin (GHb, glycohemoglobin, glycated hemoglobin, HbA1a, HbA1b, HbA1c - blood. ...

  17. Studies of membrane topology of mitochondrial cholesterol hydroxylases CYPs 27A1 and 11A1

    PubMed Central

    Mast, Natalia; Liao, Wei-Li; Turko, Illarion V.

    2010-01-01

    Mitochondrial cytochrome P450 enzymes (CYP or P450, EC 1.14.13.15) play an important role in metabolism of cholesterol. CYP27A1 hydroxylates cholesterol at position 27 and, thus, initiates cholesterol removal from many extrahepatic tissues. CYP11A1 is a steroidogenic P450 that converts cholesterol to pregnenolone, the first step in the biosynthesis of all steroid hormones. We utilized a new approach to study membrane topology of CYPs 27A1 and 11A1. This approach involves heterologous expression of membrane-bound P450 in E. coli, isolation of the P450-containing E. coli membranes, treatment of the membranes with protease, removal of the digested soluble portion and extraction of the membrane-associated peptides, which are then identified by mass spectrometry. By using this approach, we found four membrane-interacting peptides in CYP27A1, and two peptides in CYP11A1. Peptides in CYP27A1 represent a contiguous portion of the polypeptide chain (residues 210-251) corresponding to the putative F-G loop and adjacent portions of the F and G helices. Peptides in CYP11A1 are from the putative F-G loop (residues 218-225) and the C-terminal portion of the G helix (residues 238-250). This data is consistent with those obtained previously by us and others and provide new information about membrane topology of CYPs 27A1 and 11A1. PMID:18791760

  18. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  19. Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

    PubMed Central

    Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Brugnari, Tatiane; Castoldi, Rafael; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2015-01-01

    Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

  20. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  1. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  2. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  3. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  4. Evidence that histidine forms a coordination bond to the A(0A) and A(0B) chlorophylls and a second H-bond to the A(1A) and A(1B) phylloquinones in M688H(PsaA) and M668H(PsaB) variants of Synechocystis sp. PCC 6803.

    PubMed

    Sun, Junlei; Hao, Sijie; Radle, Matthew; Xu, Wu; Shelaev, Ivan; Nadtochenko, Victor; Shuvalov, Vladimir; Semenov, Alexey; Gordon, Heather; van der Est, Art; Golbeck, John H

    2014-08-01

    The axial ligands of the acceptor chlorophylls, A(0A) and A(0B), in Photosystem I are the Met sulfur atoms of M688(PsaA) and M668(PsaB). To determine the role of the Met, His variants were generated in Synechocystis sp. PCC 6803. Molecular dynamics simulations on M688H(PsaA) show that there exist low energy conformations with the His coordinated to A(0A) and possibly H-bonded to A(1A). Transient EPR studies on M688H(PsaA) indicate a more symmetrical electron spin distribution in the A(1A) phyllosemiquinone ring consistent with the presence of an H-bond to the C1 carbonyl. Ultrafast optical studies on the variants show that the 150fs charge separation between P₇₀₀ and A(0) remains unaffected. Studies on the ns timescale show that 57% of the electrons are transferred from A(0A)(-) to A(1A) in M688H(PsaA) and 48% from A(0B)(-) to A(1B) in M668H(PsaB); the remainder recombine with P₇₀₀(+) with 1/e times of 25ns and 37ns, respectively. Those electrons that reach A(1A) and A(1B) in the branch carrying the mutation are not transferred to FX, but recombine with P₇₀₀(+) with 1/e times of ~15μs and ~5μs, respectively. Hence, the His is coordinated to A0 in all populations, but in a second population, the His may be additionally H-bonded to A(1). Electron transfer from A(0) to A(1) occurs only in the latter, but the higher redox potentials of A(0) and A(1) as a result of the stronger coordination bond to A(0) and the proposed second H-bond to A(1) preclude electron transfer to the Fe/S clusters.

  5. Development of marine biotechnology as a resource for novel proteases and their role in modern biotechnology.

    PubMed

    Homaei, Ahmad; Lavajoo, Fatemeh; Sariri, Reyhaneh

    2016-07-01

    Marine environment consists of the largest sources diversified genetic pool of material with an enormous potential for a wide variety of enzymes including proteases. A protease hydrolyzes the peptide bond and most of proteases possess many industrial applications. Marine proteases differ considerably from those found in internal or external organs of invertebrates and vertebrates. In common with all enzymes, external factors such as temperature, pH and type of media are important for the activity, catalytic efficiency, stability and proper functioning of proteases. In this review valuable characteristics of proteases in marine organisms and their applications are gathered from a wide literature survey. Considering their biochemical significance and their increasing importance in biotechnology, a thorough understanding of marine proteases functioning could be of prime importance.

  6. Production of plant proteases in vivo and in vitro--a review.

    PubMed

    González-Rábade, Nuria; Badillo-Corona, Jesús Agustín; Aranda-Barradas, Juan Silvestre; Oliver-Salvador, María Del Carmen

    2011-01-01

    In the latest two decades, the interest received by plant proteases has increased significantly. Plant enzymes such as proteases are widely used in medicine and the food industry. Some proteases, like papain, bromelain and ficin are used in various processes such as brewing, meat softening, milk-clotting, cancer treatment, digestion and viral disorders. These enzymes can be obtained from their natural source or through in vitro cultures, in order to ensure a continuous source of plant enzymes. The focus of this review will be the production of plant proteases both in vivo and in vitro, with particular emphasis on the different types of commercially important plant proteases that have been isolated and characterized from naturally grown plants. In vitro approaches for the production of these proteases is also explored, focusing on the techniques that do not involve genetic transformation of the plants and the attempts that have been made in order to enhance the yield of the desired proteases.

  7. Robust substrate profiling method reveals striking differences in specificities of serum and lung fluid proteases.

    PubMed

    Watson, Douglas S; Jambunathan, Kalyani; Askew, David S; Kodukula, Krishna; Galande, Amit K

    2011-08-01

    Proteases are candidate biomarkers and therapeutic targets for many diseases. Sensitive and robust techniques are needed to quantify proteolytic activities within the complex biological milieu. We hypothesized that a combinatorial protease substrate library could be used effectively to identify similarities and differences between serum and bronchoalveolar lavage fluid (BALF), two body fluids that are clinically important for developing targeted therapies and diagnostics. We used a concise library of fluorogenic probes to map the protease substrate specificities of serum and BALF from guinea pigs. Differences in the proteolytic fingerprints of the two fluids were striking: serum proteases cleaved substrates containing cationic residues and proline, whereas BALF proteases cleaved substrates containing aliphatic and aromatic residues. Notably, cleavage of proline-containing substrates dominated all other protease activities in both human and guinea pig serum. This substrate profiling approach provides a foundation for quantitative comparisons of protease specificities between complex biological samples.

  8. Inhibitors of hepatitis C virus NS3.4A protease. Part 3: P2 proline variants.

    PubMed

    Perni, Robert B; Farmer, Luc J; Cottrell, Kevin M; Court, John J; Courtney, Lawrence F; Deininger, David D; Gates, Cynthia A; Harbeson, Scott L; Kim, Joseph L; Lin, Chao; Lin, Kai; Luong, Yu-Ping; Maxwell, John P; Murcko, Mark A; Pitlik, Janos; Rao, B Govinda; Schairer, Wayne C; Tung, Roger D; Van Drie, John H; Wilson, Keith; Thomson, John A

    2004-04-19

    We recently described the identification of an optimized alpha-ketoamide warhead for our series of HCV NS3.4A inhibitors. We report herein a series of HCV protease inhibitors incorporating 3-alkyl-substituted prolines in P(2). These compounds show exceptional enzymatic and cellular potency given their relatively small size. The marked enhancement of activity of these 3-substituted proline derivatives relative to previously reported 4-hydroxyproline derivatives constitutes additional evidence for the importance of the S(2) binding pocket as the defining pharmacophore for inhibition of the NS3.4A enzyme.

  9. The NS4A Cofactor Dependent Enhancement of HCV NS3 Protease Activity Correlates with a 4D Geometrical Measure of the Catalytic Triad Region

    PubMed Central

    Hamad, Hamzah A.; Thurston, Jeremy; Teague, Thomas; Ackad, Edward; Yousef, Mohammad S.

    2016-01-01

    We are developing a 4D computational methodology, based on 3D structure modeling and molecular dynamics simulation, to analyze the active site of HCV NS3 proteases, in relation to their catalytic activity. In our previous work, the 4D analyses of the interactions between the catalytic triad residues (His57, Asp81, and Ser139) yielded divergent, gradual and genotype-dependent, 4D conformational instability measures, which strongly correlate with the known disparate catalytic activities among genotypes. Here, the correlation of our 4D geometrical measure is extended to intra-genotypic alterations in NS3 protease activity, due to sequence variations in the NS4A activating cofactor. The correlation between the 4D measure and the enzymatic activity is qualitatively evident, which further validates our methodology, leading to the development of an accurate quantitative metric to predict protease activity in silico. The results suggest plausible “communication” pathways for conformational propagation from the activation subunit (the NS4A cofactor binding site) to the catalytic subunit (the catalytic triad). The results also strongly suggest that the well-sampled (via convergence quantification) structural dynamics are more connected to the divergent catalytic activity observed in HCV NS3 proteases than to rigid structures. The method could also be applicable to predict patients’ responses to interferon therapy and better understand the innate interferon activation pathway. PMID:27936126

  10. Mutation in type II procollagen (COL2A1) that substitutes aspartate for glycine alpha 1-67 and that causes cataracts and retinal detachment: evidence for molecular heterogeneity in the Wagner syndrome and the Stickler syndrome (arthro-ophthalmopathy)

    PubMed Central

    Körkkö, J; Ritvaniemi, P; Haataja, L; Kääriäinen, H; Kivirikko, K I; Prockop, D J; Ala-Kokko, L

    1993-01-01

    A search for mutations in the gene for type II procollagen (COL2A1) was carried out in affected members of a family with early-onset cataracts, lattice degeneration of the retina, and retinal detachment. They had no symptoms suggestive of involvement of nonocular tissues, as is typically found in the Stickler syndrome. The COL2A1 gene was amplified with PCR, and the products were analyzed by denaturing gradient gel electrophoresis. The results suggested a mutation in one allele for exon 10. Sequencing of the fragment demonstrated a single-base mutation that converted the codon for glycine at position alpha 1-67 to aspartate. The mutation was found in three affected members of the family available for study but not in unaffected members or 100 unrelated individuals. Comparison with previously reported mutations suggested that mutations introducing premature termination codons in the COL2A1 gene are a frequent cause of the Stickler syndrome, but mutations in the COL2A1 gene that replace glycine codons with codons for bulkier amino acid can produce a broad spectrum of disorders that range from lethal chondrodysplasias to a syndrome involving only ocular tissues, similar to the syndrome in the family originally described by Wagner in 1938. Images Figure 2 Figure 3 Figure 4 PMID:8317498

  11. Protease Substrate Profiling by N-Terminal COFRADIC.

    PubMed

    Staes, An; Van Damme, Petra; Timmerman, Evy; Ruttens, Bart; Stes, Elisabeth; Gevaert, Kris; Impens, Francis

    2017-01-01

    Detection of (neo-)N-terminal peptides is essential for identifying protease cleavage sites . We here present an update of a well-established and efficient selection method for enriching N-terminal peptides out of peptide mixtures: N-terminal COFRADIC (COmbined FRActional DIagonal Chromatography). This method is based on the old concept of diagonal chromatography, which involves a peptide modification step in between otherwise identical chromatographic separations, with this modification step finally allowing for the isolation of N-terminal peptides by longer retention of non-N-terminal peptides on the resin. N-terminal COFRADIC has been successfully applied in many protease-centric studies, as well as for studies on protein alpha-N-acetylation and on characterizing alternative translation initiation events.

  12. Acquisition of accurate data from intramolecular quenched fluorescence protease assays.

    PubMed

    Arachea, Buenafe T; Wiener, Michael C

    2017-04-01

    The Intramolecular Quenched Fluorescence (IQF) protease assay utilizes peptide substrates containing donor-quencher pairs that flank the scissile bond. Following protease cleavage, the dequenched donor emission of the product is subsequently measured. Inspection of the IQF literature indicates that rigorous treatment of systematic errors in observed fluorescence arising from inner-filter absorbance (IF) and non-specific intermolecular quenching (NSQ) is incompletely performed. As substrate and product concentrations vary during the time-course of enzyme activity, iterative solution of the kinetic rate equations is, generally, required to obtain the proper time-dependent correction to the initial velocity fluorescence data. Here, we demonstrate that, if the IQF assay is performed under conditions where IF and NSQ are approximately constant during the measurement of initial velocity for a given initial substrate concentration, then a simple correction as a function of initial substrate concentration can be derived and utilized to obtain accurate initial velocity data for analysis.

  13. A high molecular weight protease in liver cytosol.

    PubMed

    Rose, I A; Warms, J V; Hershko, A

    1979-09-10

    A high molecular weight (greater than 400,000) protease active with [3H]leucine-labeled globin has been found in the postmicrosomal fraction of mouse kidney, brain, heart, spleen, and tumor cells and is most active in liver. The presence in liver was unexpected because liver cytosol is very ineffective in the breakdown of endogenous, labeled proteins. The enzyme has a number of properties that distinguish it from known cathepsins in addition to its high molecular weight. It is most active at pH approximately 7.5. When purified, it is unstable above 20 degrees C and is stabilized by metal chelating agents such as citrate, creatine-P, and glycerate-3-P. It is an -SH protease, but its thermal instability is not affected by 1 mM dithiothreitol. The enzyme is not lysosomal.

  14. Cold Denaturation of the HIV-1 Protease Monomer.

    PubMed

    Rösner, Heike I; Caldarini, Martina; Prestel, Andreas; Vanoni, Maria A; Broglia, Ricardo A; Aliverti, Alessandro; Tiana, Guido; Kragelund, Birthe B

    2017-02-28

    The human immunodeficiency virus-1 (HIV-1) protease is a complex protein that in its active form adopts a homodimer dominated by β-sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1 protease that is populated above 0 °C and therefore directly accessible to various spectroscopic approaches. Using nuclear magnetic resonance secondary chemical shifts, temperature coefficients, and protein dynamics, we suggest that the cold-denatured state populates a compact wet globule containing transient non-native-like α-helical elements. From the linearity of the temperature coefficients and the hydrodynamic radii, we propose that the overall architecture of the cold-denatured state is maintained over the temperature range studied.

  15. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  16. Intestinal proteases of free-living and parasitic astigmatid mites.

    PubMed

    Holt, Deborah C; Burgess, Stewart T G; Reynolds, Simone L; Mahmood, Wajahat; Fischer, Katja

    2013-02-01

    Among arthropod pests, mites are responsible for considerable damage to crops, humans and other animals. However, detailed physiological data on these organisms remain sparse, mainly because of their small size but possibly also because of their extreme diversity. Focusing on intestinal proteases, we draw together information from three distinct mite species that all feed on skin but have separately adapted to a free-living, a strictly ecto-parasitic and a parasitic lifestyle. A wide range of studies involving immunohistology, molecular biology, X-ray crystallography and enzyme biochemistry of mite gut proteases suggests that these creatures have diverged considerably as house dust mites, sheep scab mites and scabies mites. Each species has evolved a particular variation of a presumably ancestral repertoire of digestive enzymes that have become specifically adapted to their individual environmental requirements.

  17. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  18. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  19. Botulinum neurotoxin A protease: discovery of natural product exosite inhibitors.

    PubMed

    Silhár, Peter; Capková, Katerina; Salzameda, Nicholas T; Barbieri, Joseph T; Hixon, Mark S; Janda, Kim D

    2010-03-10

    A new mechanistic class of BoNT/A zinc metalloprotease inhibitors, from Echinacea, exemplified by the natural product d-chicoric acid (I1) is disclosed. A detailed evaluation of chicoric acid's mechanism of inhibition reveals that the inhibitor binds to an exosite, displays noncompetitive partial inhibition, and is synergistic with a competitive active site inhibitor when used in combination. Other components found in Echinacea, I3 and I4, were also inhibitors of the protease.

  20. Epsilon substituted lysinol derivatives as HIV-1 protease inhibitors.

    PubMed

    Jones, Kristen L G; Holloway, M Katharine; Su, Hua-Poo; Carroll, Steven S; Burlein, Christine; Touch, Sinoeun; DiStefano, Daniel J; Sanchez, Rosa I; Williams, Theresa M; Vacca, Joseph P; Coburn, Craig A

    2010-07-15

    A series of HIV-1 protease inhibitors containing an epsilon substituted lysinol backbone was synthesized. Two novel synthetic routes using N-boc-L-glutamic acid alpha-benzyl ester and 2,6-diaminopimelic acid were developed. Incorporation of this epsilon substituent enabled access to the S2 pocket of the enzyme, affording high potency inhibitors. Modeling studies and synthetic efforts suggest the potency increase is due to both conformational bias and van der Waals interactions with the S2 pocket.

  1. Enhanced Thermostability of a Fungal Alkaline Protease by Different Additives

    PubMed Central

    Nirmal, Nilesh P.; Laxman, R. Seeta

    2014-01-01

    A fungal strain (Conidiobolus brefeldianus MTCC 5184) isolated from plant detritus secreted a high activity alkaline protease. Thermostability studies of the fungal alkaline protease (FAP) revealed that the protease is stable up to 50°C with 40% residual activity after one hour. Effect of various additives such as sugars, sugar alcohols, polyols, and salts, on the thermostability of FAP was evaluated. Among the additives tested, glycerol, mannitol, xylitol, sorbitol, and trehalose were found to be very effective in increasing the stability of FAP, which was found to be concentration dependent. Fivefold increase in residual activity of FAP was observed in the presence of trehalose (50%) and sorbitol (50%) at 50°C for 4 h, compared to FAP without additive. Other additives like calcium at 20 mM and 10–15% ammonium sulphate showed lower stability improvement than trehalose and sorbitol. NaCl, MgCl2, K2HPO4, and glycine were found to be poor stabilizers and showed only a marginal improvement. PEG 6000 did not show any increase in stability but was found to be slightly inhibitory. PMID:25105022

  2. New roles for perforins and proteases in apicomplexan egress.

    PubMed

    Roiko, Marijo S; Carruthers, Vern B

    2009-10-01

    Egress is a pivotal step in the life cycle of intracellular pathogens initiating the transition from an expiring host cell to a fresh target cell. While much attention has been focused on understanding cell invasion by intracellular pathogens, recent work is providing a new appreciation of mechanisms and therapeutic potential of microbial egress. This review highlights recent insight into cell egress by apicomplexan parasites and emerging contributions of membranolytic and proteolytic secretory products, along with host proteases. New findings suggest that Toxoplasma gondii secretes a pore-forming protein, TgPLP1, during egress that facilitates parasite escape from the cell by perforating the parasitophorous membrane. Also, in a cascade of proteolytic events, Plasmodium falciparum late-stage schizonts activate and secrete a subtilisin, PfSUB1, which processes enigmatic putative proteases called serine-repeat antigens that contribute to merozoite egress. A new report also suggests that calcium-activated host proteases called calpains aid parasite exit, possibly by acting upon the host cytoskeleton. Together these discoveries reveal important new molecular players involved in the principal steps of egress by apicomplexans.

  3. Luminal Cathepsin G and Protease-Activated Receptor 4

    PubMed Central

    Dabek, Marta; Ferrier, Laurent; Roka, Richard; Gecse, Krisztina; Annahazi, Anita; Moreau, Jacques; Escourrou, Jean; Cartier, Christel; Chaumaz, Gilles; Leveque, Mathilde; Ait-Belgnaoui, Afifa; Wittmann, Tibor; Theodorou, Vassilia; Bueno, Lionel

    2009-01-01

    Impairment of the colonic epithelial barrier and neutrophil infiltration are common features of inflammatory bowel disease. Luminal proteases affect colonic permeability through protease-activated receptors (PARs). We evaluated: (i) whether fecal supernatants from patients with ulcerative colitis (UC) trigger alterations of colonic paracellular permeability and inflammation, and (ii) the roles of cathepsin G (Cat-G), a neutrophil serine protease, and its selective receptor, PAR4, in these processes. Expression levels of both PAR4 and Cat-G were determined in colonic biopsies from UC and healthy subjects. The effects of UC fecal supernatants on colonic paracellular permeability were measured in murine colonic strips. Involvement of Cat-G and PAR4 was evaluated using pepducin P4pal-10 and specific Cat-G inhibitor (SCGI), respectively. In addition, the effect of PAR4-activating peptide was assessed. UC fecal supernatants, either untreated or pretreated with SCGI, were infused into mice, and myeloperoxidase activity was determined. PAR4 was found to be overexpressed in UC colonic biopsies. Increased colonic paracellular permeability that was triggered by UC fecal supernatants was blocked by both SCGI (77%) and P4pal-10 (85%). Intracolonic infusion of UC fecal supernatants into mice increased myeloperoxidase activity. This effect was abolished by SCGI. These observations support that both Cat-G and PAR4 play key roles in generating and/or amplifying relapses in UC and provide a rationale for the development of new therapeutic agents in the treatment of this disease. PMID:19528350

  4. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  5. Pathogen-secreted proteases activate a novel plant immune pathway.

    PubMed

    Cheng, Zhenyu; Li, Jian-Feng; Niu, Yajie; Zhang, Xue-Cheng; Woody, Owen Z; Xiong, Yan; Djonović, Slavica; Millet, Yves; Bush, Jenifer; McConkey, Brendan J; Sheen, Jen; Ausubel, Frederick M

    2015-05-14

    Mitogen-activated protein kinase (MAPK) cascades play central roles in innate immune signalling networks in plants and animals. In plants, however, the molecular mechanisms of how signal perception is transduced to MAPK activation remain elusive. Here we report that pathogen-secreted proteases activate a previously unknown signalling pathway in Arabidopsis thaliana involving the Gα, Gβ, and Gγ subunits of heterotrimeric G-protein complexes, which function upstream of an MAPK cascade. In this pathway, receptor for activated C kinase 1 (RACK1) functions as a novel scaffold that binds to the Gβ subunit as well as to all three tiers of the MAPK cascade, thereby linking upstream G-protein signalling to downstream activation of an MAPK cascade. The protease-G-protein-RACK1-MAPK cascade modules identified in these studies are distinct from previously described plant immune signalling pathways such as that elicited by bacterial flagellin, in which G proteins function downstream of or in parallel to an MAPK cascade without the involvement of the RACK1 scaffolding protein. The discovery of the new protease-mediated immune signalling pathway described here was facilitated by the use of the broad host range, opportunistic bacterial pathogen Pseudomonas aeruginosa. The ability of P. aeruginosa to infect both plants and animals makes it an excellent model to identify novel immunoregulatory strategies that account for its niche adaptation to diverse host tissues and immune systems.

  6. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  7. [Extracellular proteases of mycelial fungi as participants of pathogenic processes].

    PubMed

    Dunaevskiĭ, Ia E; Matveeva, A R; Fatkhullina, G N; Beliakova, G A; Kolomiets, T M; Kovalenko, E D; Belozerskiĭ, M A

    2008-01-01

    The interest in proteases secreted by mycelial fungi is due to several reasons of which one of the most important is their involvement in the initiation and development of the pathogenic process. A comparison of saprophytic and phytopathogenic mycelial fungi revealed one characteristic feature, namely, the appearance of a new trypsin-like activity in phytopathogens that is absent in saprophytes. To clear up the question of whether the degree of pathogenicity of a fungus is related to the activity of secreted trypsin-like protease, several species of Fusarium of various pathogenicity were compared. In two species, F. sporotrichioides (which causes ear fusa-riosis of rye) and F. heterosporum (the causative agent of root rot in wheat), a clear correlation between the activity and pathogenicity was revealed: the more pathogenetic F. sporotrichioides exhibited a higher extracellular trypsin-like activity than the less pathogenetic species F. heterosporum. Thus, the presence of trypsin-like activity in a saprotroph-pathogen pair may be an indicator of the pathogenicity of a fungus; in some cases, the value of this activity may indicate the degree of its pathogenicity. This suggests that trypsin-like proteases specific to phytopathogens are directly involved in the pathogenetic process, probably, through interaction with the "sentry" protein or the product of the resistance gene.

  8. Optimum production and characterization of an acid protease from marine yeast Metschnikowia reukaufii W6b

    NASA Astrophysics Data System (ADS)

    Li, Jing; Peng, Ying; Wang, Xianghong; Chi, Zhenming

    2010-12-01

    The marine yeast strain W6b isolated from sediment of the South China Sea was found to produce a cell-bound acid protease. The crude acid protease produced by this marine yeast showed the highest activity at pH 3.5 and 40 °C. The optimal pH and temperature for the crude acid protease were in agreement with those for acid protease produced by the terrestrial yeasts. The optimal medium of the acid protease production was seawater containing 1.0% glucose, 1.5% casein, and 0.5% yeast extract, and the optimal cultivation conditions of the acid protease production were pH 4.0, a temperature of 25 °C and a shaking speed of 140 rmin-1. Under the optimal conditions, 72.5 UmL-1 of acid protease activity could be obtained in cell suspension within 48 h of fermentation at shake flask level. The acid protease production was induced by high-molecular-weight nitrogen sources and repressed by low-molecular-weight nitrogen sources. Skimmed-milk-clotting test showed that the crude acid protease from the cell suspension of the yeast W6b had high skimmed milk coagulability. The acid protease produced by M. reukaufii W6b may have highly potential applications in cheese, food and fermentation industries.

  9. A Culture-Based Method for Determining the Production of Secreted Protease Inhibitors

    PubMed Central

    Quintero, David; Bermudes, David

    2014-01-01

    We have developed a culture-based method for determining the production of secreted protease inhibitors. The assay utilizes standard proteolysis detection plates to support microbial growth followed by infiltrating the plate with a protease and subsequently detecting the remaining protein by trichloroacetic acid (TCA) precipitation, or by bromocreosol green (BCG) or Ponseau S (PS) staining. The presence of a protease inhibitor can be observed in the form of a protected zone of protein around the protease inhibitor-producing strain. Using the protease inhibitors α-2-macroglobulin, aprotinin, leupeptin, and bestatin and the primary and secondary forms of Photorhabdus luminescens in combination with the protease trypsin, we were able to demonstrate that the assay is specific for the cognate inhibitor of the protease and for bacteria secreting protease inhibitors. In addition, when casein-containing plates were used, the size of the diffusion zone was inversely correlated with the molecular weight of the inhibitor allowing a relative estimation of the protease inhibitor molecular weight. This assay is useful for detecting the presence of microbial secreted protease inhibitors and may reveal their production by microorganisms that were not previously recognized to produce them. PMID:24632514

  10. Detergent-compatible proteases: microbial production, properties, and stain removal analysis.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2015-01-01

    Proteases are one of the most important commercial enzymes used in various industrial domains such as detergent and leather industries. The alkaline proteases as well as other detergent-compatible enzymes such as lipases and amylases serve now as the key components in detergent formulations. They break down various stains during fabric washing. The search for detergent-compatible proteases with better properties is a continuous exercise. The current trend is to use detergent-compatible proteases that are stable over a wide temperature range. Although the proteases showing stability at elevated pH have the capacity to be used in detergent formulations, their usage can be significant if they are also stable and compatible with detergent and detergent ingredients, and also able to remove protein stains. Despite the existence of some reviews on alkaline proteases, there is no specification for the use of alkaline proteases as detergent additives. The present review describes the detergent-compatible proteases tested as detergent additives. An overview was provided for screening, optimization, purification, and properties of detergent compatible proteases, with an emphasis on the stability and compatibility of the alkaline proteases with the detergent and detergent compounds, as well as stain removal examination methods.

  11. Cardiometabolic Risk Profiles in Patients With Impaired Fasting Glucose and/or Hemoglobin A1c 5.7% to 6.4%: Evidence for a Gradient According to Diagnostic Criteria: The PREDAPS Study.

    PubMed

    Giráldez-García, Carolina; Sangrós, F Javier; Díaz-Redondo, Alicia; Franch-Nadal, Josep; Serrano, Rosario; Díez, Javier; Buil-Cosiales, Pilar; García-Soidán, F Javier; Artola, Sara; Ezkurra, Patxi; Carrillo, Lourdes; Millaruelo, J Manuel; Seguí, Mateu; Martínez-Candela, Juan; Muñoz, Pedro; Goday, Albert; Regidor, Enrique

    2015-11-01

    It has been suggested that the early detection of individuals with prediabetes can help prevent cardiovascular diseases. The purpose of the current study was to examine the cardiometabolic risk profile in patients with prediabetes according to fasting plasma glucose (FPG) and/or hemoglobin A1c (HbA1c) criteria.Cross-sectional analysis from the 2022 patients in the Cohort study in Primary Health Care on the Evolution of Patients with Prediabetes (PREDAPS Study) was developed. Four glycemic status groups were defined based on American Diabetes Association criteria. Information about cardiovascular risk factors-body mass index, waist circumference, blood pressure, cholesterol, triglycerides, uric acid, gamma-glutamyltransferase, glomerular filtration-and metabolic syndrome components were analyzed. Mean values of clinical and biochemical characteristics and frequencies of metabolic syndrome were estimated adjusting by age, sex, educational level, and family history of diabetes.A linear trend (P < 0.001) was observed in most of the cardiovascular risk factors and in all components of metabolic syndrome. Normoglycemic individuals had the best values, individuals with both criteria of prediabetes had the worst, and individuals with only one-HbA1c or FPG-criterion had an intermediate position. Metabolic syndrome was present in 15.0% (95% confidence interval: 12.6-17.4), 59.5% (54.0-64.9), 62.0% (56.0-68.0), and 76.2% (72.8-79.6) of individuals classified in normoglycemia, isolated HbA1c, isolated FPG, and both criteria groups, respectively.In conclusion, individuals with prediabetes, especially those with both criteria, have worse cardiometabolic risk profile than normoglycemic individuals. These results suggest the need to use both criteria in the clinical practice to identify those individuals with the highest cardiovascular risk, in order to offer them special attention with intensive lifestyle intervention programs.

  12. Transport of A1 adenosine receptor agonist tecadenoson by human and mouse nucleoside transporters: evidence for blood-brain barrier transport by murine equilibrative nucleoside transporter 1 mENT1.

    PubMed

    Lepist, Eve-Irene; Damaraju, Vijaya L; Zhang, Jing; Gati, Wendy P; Yao, Sylvia Y M; Smith, Kyla M; Karpinski, Edward; Young, James D; Leung, Kwan H; Cass, Carol E

    2013-04-01

    The high density of A1 adenosine receptors in the brain results in significant potential for central nervous system (CNS)-related adverse effects with A1 agonists. Tecadenoson is a selective A1 adenosine receptor agonist with close similarity to adenosine. We studied the binding and transmembrane transport of tecadenoson by recombinant human equilibrative nucleoside transporters (hENTs) hENT1 and hENT2, and human concentrative nucleoside transporters (hCNTs) hCNT1, hCNT2, and hCNT3 in vitro and by mouse mENT1 in vivo. Binding affinities of the five recombinant human nucleoside transporters for tecadenoson differed (hENT1 > hCNT1 > hCNT3 > hENT2 > hCNT2), and tecadenoson was transported largely by hENT1. Pretreatment of mice with a phosphorylated prodrug of nitrobenzylmercaptopurine riboside, an inhibitor of mENT1, significantly decreased brain exposure to tecadenoson compared with that of the untreated (control) group, suggesting involvement of mENT1 in transport of tecadenoson across the blood-brain barrier (BBB). In summary, ENT1 was shown to mediate the transport of tecadenoson in vitro with recombinant and native human protein and in vivo with mice. The micromolar apparent Km value of tecadenoson for transport by native hENT1 in cultured cells suggests that hENT1 will not be saturated at clinically relevant (i.e., nanomolar) concentrations of tecadenoson, and that hENT1-mediated passage across the BBB may contribute to the adverse CNS effects observed in clinical trials. In contrast, in cases in which a CNS effect is desired, the present results illustrate that synthetic A1 agonists that are transported by hENT1 could be used to target CNS disorders because of enhanced delivery to the brain.

  13. Cardiometabolic Risk Profiles in Patients With Impaired Fasting Glucose and/or Hemoglobin A1c 5.7% to 6.4%: Evidence for a Gradient According to Diagnostic Criteria

    PubMed Central

    Giráldez-García, Carolina; Sangrós, F. Javier; Díaz-Redondo, Alicia; Franch-Nadal, Josep; Serrano, Rosario; Díez, Javier; Buil-Cosiales, Pilar; García-Soidán, F. Javier; Artola, Sara; Ezkurra, Patxi; Carrillo, Lourdes; Millaruelo, J. Manuel; Seguí, Mateu; Martínez-Candela, Juan; Muñoz, Pedro; Goday, Albert; Regidor, Enrique

    2015-01-01

    Abstract It has been suggested that the early detection of individuals with prediabetes can help prevent cardiovascular diseases. The purpose of the current study was to examine the cardiometabolic risk profile in patients with prediabetes according to fasting plasma glucose (FPG) and/or hemoglobin A1c (HbA1c) criteria. Cross-sectional analysis from the 2022 patients in the Cohort study in Primary Health Care on the Evolution of Patients with Prediabetes (PREDAPS Study) was developed. Four glycemic status groups were defined based on American Diabetes Association criteria. Information about cardiovascular risk factors–body mass index, waist circumference, blood pressure, cholesterol, triglycerides, uric acid, gamma-glutamyltransferase, glomerular filtration–and metabolic syndrome components were analyzed. Mean values of clinical and biochemical characteristics and frequencies of metabolic syndrome were estimated adjusting by age, sex, educational level, and family history of diabetes. A linear trend (P < 0.001) was observed in most of the cardiovascular risk factors and in all components of metabolic syndrome. Normoglycemic individuals had the best values, individuals with both criteria of prediabetes had the worst, and individuals with only one–HbA1c or FPG–criterion had an intermediate position. Metabolic syndrome was present in 15.0% (95% confidence interval: 12.6–17.4), 59.5% (54.0–64.9), 62.0% (56.0–68.0), and 76.2% (72.8–79.6) of individuals classified in normoglycemia, isolated HbA1c, isolated FPG, and both criteria groups, respectively. In conclusion, individuals with prediabetes, especially those with both criteria, have worse cardiometabolic risk profile than normoglycemic individuals. These results suggest the need to use both criteria in the clinical practice to identify those individuals with the highest cardiovascular risk, in order to offer them special attention with intensive lifestyle intervention programs. PMID:26554799

  14. In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects.

    PubMed Central

    Lech, W J; Wang, G; Yang, Y L; Chee, Y; Dorman, K; McCrae, D; Lazzeroni, L C; Erickson, J W; Sinsheimer, J S; Kaplan, A H

    1996-01-01

    We have evaluated the sequence diversity of the protease human immunodeficiency virus type 1 in vivo. Our analysis of 246 protease coding domain sequences obtained from 12 subjects indicates that amino acid substitutions predicted to give rise to protease inhibitor resistance may be present in patients who have not received protease inhibitors. In addition, we demonstrated that amino acid residues directly involved in enzyme-substrate interactions may be varied in infected individuals. Several of these substitutions occurred in combination either more or less frequently than would be expected if their appearance was independent, suggesting that one substitution may compensate for the effects of another. Taken together, our analysis indicates that the human immunodeficiency virus type 1 protease has flexibility sufficient to vary critical subsites in vivo, thereby retaining enzyme function and viral pathogenicity. PMID:8627733

  15. Evaluation of dipeptide nitriles as inhibitors of rhodesain, a major cysteine protease of Trypanosoma brucei.

    PubMed

    Schirmeister, Tanja; Schmitz, Janina; Jung, Sascha; Schmenger, Torsten; Krauth-Siegel, R Luise; Gütschow, Michael

    2017-01-01

    A series of dipeptide nitriles known as inhibitors of mammalian cathepsins were evaluated for inhibition of rhodesain, the cathepsin L-like protease of Trypanosoma brucei. Compound 35 consisting of a Leu residue fitting into the S2 pocket and a triarylic moiety consisting of thiophene, a 1,2,4-oxadiazole and a phenyl ring fitting into the S3 pocket, and compound 33 with a 3-bromo-Phe residue (S2) and a biphenyl fragment (S3) were found to inhibit rhodesain in the single-digit nanomolar range. The observed steep structure-activity relationship could be explained by covalent docking simulations. With their high selectivity indices (ca. 200) and the good antitrypanosomal activity (8μM) the compounds represent promising starting points for new rhodesain inhibitors.

  16. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1987-06-30

    CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT (Coninue, on reverse aide It necessary...CI from chickpeas . Attempts are now in progress to separate and isolate these trypsin-and chymotrypsin-like enzymes. (3) Locust proteinases...and from chickpeas (CI). In addition, a specific Tribolium proteinase inhibitor from soybeans was separated. SIGNIFICANT FINDINGS A. The detection of

  17. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1988-01-31

    PROTEASES; INSECT TRYPSINS and CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBLTOR; SOYBEAN...inhibitors from legume .seeds, such as the Bowman-Birk inhibitor (BBI) from soybeans and CI from chickpeas . The purified and partially-characterized insect DD...inhibited by the trypsin - chymotrypsin inhibitors BBI from soybeans and CI from chickpeas . Separation and purification of these enzymes by gel

  18. Identification of novel malarial cysteine protease inhibitors using structure-based virtual screening of a focused cysteine protease inhibitor library.

    PubMed

    Shah, Falgun; Mukherjee, Prasenjit; Gut, Jiri; Legac, Jennifer; Rosenthal, Philip J; Tekwani, Babu L; Avery, Mitchell A

    2011-04-25

    Malaria, in particular that caused by Plasmodium falciparum , is prevalent across the tropics, and its medicinal control is limited by widespread drug resistance. Cysteine proteases of P. falciparum , falcipain-2 (FP-2) and falcipain-3 (FP-3), are major hemoglobinases, validated as potential antimalarial drug targets. Structure-based virtual screening of a focused cysteine protease inhibitor library built with soft rather than hard electrophiles was performed against an X-ray crystal structure of FP-2 using the Glide docking program. An enrichment study was performed to select a suitable scoring function and to retrieve potential candidates against FP-2 from a large chemical database. Biological evaluation of 50 selected compounds identified 21 diverse nonpeptidic inhibitors of FP-2 with a hit rate of 42%. Atomic Fukui indices were used to predict the most electrophilic center and its electrophilicity in the identified hits. Comparison of predicted electrophilicity of electrophiles in identified hits with those in known irreversible inhibitors suggested the soft-nature of electrophiles in the selected target compounds. The present study highlights the importance of focused libraries and enrichment studies in structure-based virtual screening. In addition, few compounds were screened against homologous human cysteine proteases for selectivity analysis. Further evaluation of structure-activity relationships around these nonpeptidic scaffolds could help in the development of selective leads for antimalarial chemotherapy.

  19. Lipid and cationic polymer based transduction of botulinum holotoxin, or toxin protease alone, extends the target cell range and improves the efficiency of intoxication.

    PubMed

    Kuo, Chueh-Ling; Oyler, George; Shoemaker, Charles B

    2010-01-01

    Botulinum neurotoxin (BoNT) heavy chain (Hc) facilitates receptor-mediated endocytosis into neuronal cells and transport of the light chain (Lc) protease to the cytosol where neurotransmission is inhibited as a result of SNARE protein cleavage. Here we show that the role of BoNT Hc in cell intoxication can be replaced by commercial lipid-based and polycationic polymer DNA transfection reagents. BoNT "transduction" by these reagents permits efficient intoxication of neuronal cells as well as some non-neuronal cell lines normally refractory to BoNT. Surprisingly, the reagents facilitate delivery of recombinant BoNT Lc protease to the cytosol of both neuronal and non-neuronal cells in the absence of BoNT Hc, and with sensitivities approaching that of BoNT holotoxin. Transduction of BoNT, as with natural intoxication, is inhibited by bafilomycin A1, methylamine and ammonium chloride indicating that both pathways require endosome acidification. DNA transfection reagents facilitate intoxication by holotoxins, or isolated Lc proteases, of all three BoNT serotypes tested (A, B, E). These results suggest that lipid and cationic polymer transfection reagents facilitate cytosolic delivery of BoNT holotoxins and isolated Lc proteases by an endosomal uptake pathway.

  20. Using C. elegans to Identify the Protease Targets of Serpins In Vivo

    PubMed Central

    Bhatia, Sangeeta R.; Miedel, Mark T.; Chotoo, Cavita K.; Graf, Nathan J.; Hood, Brian L.; Conrads, Thomas P.; Silverman, Gary A.; Luke, Cliff J.

    2015-01-01

    Most serpins inhibit serine and/or cysteine proteases, and their inhibitory activities are usually defined in vitro. However, the physiological protease targets of most serpins are unknown despite many years of research. This may be due to the rapid degradation of the inactive serpin:protease complexes and/or the conditions under which the serpin inhibits the protease. The model organism Caenorhabditis elegans is an ideal system for identifying protease targets due to powerful forward and reverse genetics, as well as the ease of creating transgenic animals. Using combinatorial approaches of genetics and biochemistry in C. elegans, the true in vivo protease targets of the endogenous serpins can be elucidated. PMID:21683259

  1. Recent developments in production and biotechnological applications of cold-active microbial proteases.

    PubMed

    Kuddus, Mohammed; Ramteke, Pramod W

    2012-11-01

    Microbial proteases that occupy a pivotal position with respect to their commercial applications are most important hydrolytic enzymes and have been studied extensively since the advent of enzymology. Cold-adapted microorganisms are potential source of cold-active proteases and they have been isolated from the cold regions. Although there are many microbial sources available for producing proteases, only few are recognized as commercial producer. Cold-active proteases along with their producing microbes are of commercial value and find multiple applications in various industrial and biotechnological sectors such as additives in detergents, additives in food industries, environmental bioremediations, biotransformation and molecular biology applications. Therefore, cold-active proteases are the enzymes of choice for many biotechnologists, microbiologists, biochemists, environmentalists and biochemical engineers. In the present review, we discuss some novel sources along with recent developments in production and biotechnological applications of cold-active microbial proteases.

  2. A tobacco etch virus protease with increased substrate tolerance at the P1' position.

    PubMed

    Renicke, Christian; Spadaccini, Roberta; Taxis, Christof

    2013-01-01

    Site-specific proteases are important tools for in vitro and in vivo cleavage of proteins. They are widely used for diverse applications, like protein purification, assessment of protein-protein interactions or regulation of protein localization, abundance or activity. Here, we report the development of a procedure to select protease variants with altered specificity based on the well-established Saccharomyces cerevisiae adenine auxotrophy-dependent red/white colony assay. We applied this method on the tobacco etch virus (TEV) protease to obtain a protease variant with altered substrate specificity at the P1' Position. In vivo experiments with tester substrates showed that the mutated TEV protease still efficiently recognizes the sequence ENLYFQ, but has almost lost all bias for the amino acid at the P1' Position. Thus, we generated a site-specific protease for synthetic approaches requiring in vivo generation of proteins or peptides with a specific N-terminal amino acid.

  3. A survey of IgA protease production among clinical isolates of Proteeae.

    PubMed

    Senior, B W; Albrechtsen, M; Kerr, M A

    1988-01-01

    A collection of 100 strains of Proteeae, in which all species within the tribe were represented, was examined for IgA protease production. The strains were isolated from various clinical specimens from sick and healthy persons in several countries. IgA protease-producing strains were not found amongst species of Providencia and Morganella but were common in Proteus spp. All the strains of P. mirabilis and P. penneri and many of the strains of P. vulgaris examined produced an EDTA-sensitive protease that cleaved the IgA heavy chain outside the hinge region. The proteus enzyme was different in this respect from the EDTA-sensitive, hinge-cutting proteases of other bacteria. The ability to produce IgA protease was unrelated to the O antigenicity, biotype or bacteriocin type of the strain. IgA protease production may be an important virulence mechanism for Proteus strains.

  4. Targeting Proteases in Cardiovascular Diseases by Mass Spectrometry-Based Proteomics

    PubMed Central

    Klingler, Diana; Hardt, Markus

    2012-01-01

    Proteases hydrolyze peptide bonds, thereby controlling the function of proteins and peptides on the posttranslational level. In the cardiovascular system, proteases play pivotal roles in the regulation of blood pressure, coagulation and other essential physiological processes. Accordingly, proteases are prime targets for therapeutic interventions and diagnostics. Proteases are part of complex proteolytic networks comprised of enzymes, inhibitors, activators, substrates and cleavage products. Analyzing these networks on a system-wide level is essential to understanding cardiovascular function and how dysregulation can lead to pathological conditions. Mass spectrometry-based quantitative and dynamic proteomics approaches are leading the way to enhance our knowledge of proteolytic networks such as the renin-angiotensin-system. Here, we critically review proteomics tools utilized in protease biology and provide an overview on how these methods can be used to characterize and validate protease function. PMID:22511707

  5. Cloning, characterization, expression and antifungal activity of an alkaline serine protease of Aureobasidium pullulans PL5 involved in the biological control of postharvest pathogens.

    PubMed

    Zhang, Dianpeng; Spadaro, Davide; Valente, Silvia; Garibaldi, Angelo; Gullino, Maria Lodovica

    2012-02-15

    An alkaline protease gene was amplified from genomic DNA and cDNA of the antagonistic yeast-like fungus Aureobasidium pullulans PL5, a biocontrol agent effective against Monilinia laxa on stone fruit and Botrytis cinerea and Penicillium expansum on pome fruits. An open reading frame of 1248 bp encoding a 415-amino acid (aa) protein with a calculated molecular weight (M(r)) of 42.9 kDa and an isoelectric point (pI) of 4.5 was characterized. The cDNAALP5 gene had an 18-amino acid signal peptide, one N-gylcosylation, one histidine active site, and one serine active site. The ALP5 gene with a M(r) of 1351 bp contained two introns. One intron was of 54 bp, while the other was of 50 bp. Protein BLAST and phylogenetic tree analysis of the deduced amino sequences from the cDNAALP5 gene showed that the encoded protein had 100% homology to a protease enzyme (ALP2) of a sea strain of A. pullulans, suggesting that the protein ALP5 was an alkaline serine protease. Expression of ALP5 in Escherichia coli BL21 (DE3), followed by identification with Western-blotting, purification with Ni-NTA and analysis of enzymatic activity, yielded an homogeneous recombinant ALP5 which hydrolysed the substrate casein and inhibited the mycelial growth of the pathogens. At its optimal pH of 10.0 and reaction temperature of 50°C, the recombinant protease exhibited the highest activity towards the substrate casein, though the highest stability was at lower temperatures and pH between 7.0 and 9.0. This study provided the direct evidence that extracellular proteases secreted by the antagonist A. pullulans PL5 played a role in the biocontrol activities against some postharvest pathogens of apple and peach.

  6. Cell-specific and developmental expression of lectican-cleaving proteases in mouse hippocampus and neocortex.

    PubMed

    Levy, C; Brooks, J M; Chen, J; Su, J; Fox, M A

    2015-03-01

    Mounting evidence has demonstrated that a specialized extracellular matrix exists in the mammalian brain and that this glycoprotein-rich matrix contributes to many aspects of brain development and function. The most prominent supramolecular assemblies of these extracellular matrix glycoproteins are perineuronal nets, specialized lattice-like structures that surround the cell bodies and proximal neurites of select classes of interneurons. Perineuronal nets are composed of lecticans, a family of chondroitin sulfate proteoglycans that includes aggrecan, brevican, neurocan, and versican. These lattice-like structures emerge late in postnatal brain development, coinciding with the ending of critical periods of brain development. Despite our knowledge of the presence of lecticans in perineuronal nets and their importance in regulating synaptic plasticity, we know little about the development or distribution of the extracellular proteases that are responsible for their cleavage and turnover. A subset of a large family of extracellular proteases (called a disintegrin and metalloproteinase with thrombospondin motifs [ADAMTS]) is responsible for endogenously cleaving lecticans. We therefore explored the expression pattern of two aggrecan-degrading ADAMTS family members, ADAMTS15 and ADAMTS4, in the hippocampus and neocortex. Here, we show that both lectican-degrading metalloproteases are present in these brain regions and that each exhibits a distinct temporal and spatial expression pattern. Adamts15 mRNA is expressed exclusively by parvalbumin-expressing interneurons during synaptogenesis, whereas Adamts4 mRNA is exclusively generated by telencephalic oligodendrocytes during myelination. Thus, ADAMTS15 and ADAMTS4 not only exhibit unique cellular expression patterns but their developmental upregulation by these cell types coincides with critical aspects of neural development.

  7. Purification, characterization and identification of a senescence related serine protease in dark-induced senescent wheat leaves.

    PubMed

    Wang, Renxian; Liu, Shaowei; Wang, Jin; Dong, Qiang; Xu, Langlai; Rui, Qi

    2013-11-01

    Senescence-related proteases play important roles in leaf senescence by regulating protein degradation and nutrient recycling. A 98.9kDa senescence-related protease EP3 in wheat leaves was purified by ammonium sulfate precipitation, Q-Sepharose fast flow anion exchange chromatography and gel slicing after gel electrophoresis. Due to its relatively high thermal stability, its protease activity did not decrease after incubation at 40°C for 1-h. EP3 protease was suggested to be a metal-dependent serine protease, because its activity was inhibited by serine protease inhibitors PMSF and AEBSF and metal related protease inhibitor EGTA. It was identified as a subtilisin-like serine protease of the S8A family based on data from both mass spectrometry and the cloned cDNA sequence. Therefore, these data suggest that a serine protease of the S8A subfamily with specific biochemical properties is involved in senescence-associated protein degradation.

  8. Purification and characterization of organic solvent stable serine alkaline protease from newly isolated Bacillus circulans M34.

    PubMed

    Sari, Esma; Loğoğlu, Elif; Öktemer, Atilla

    2015-09-01

    A protease from newly isolated Bacillus circulans M34 was purified by Q-Sepharose anion exchange chromatography and Sepharose-bacitracin affinity chromatography followed by (NH4)2SO4 precipitation. The molecular mass of the purified enzyme was determined using SDS-PAGE. The optimum pH and temperature for protease activity were 11 and 50°C, respectively. The effect of various metal ions on protease activity was investigated. Alkaline protease from Bacillus circulans M34 wase activated by Zn(2+), Cu(2+) and Co(2+) up to 31%. The purified protease was found to be stable in the organic solvents, surfactants and oxidizing agent. The substrate specificity of purified protease was investigated towards different substrates. The protease was almost completely inhibited by the serine protease inhibitor phenylmethanesulfonyl fluoride. The kinetic parameters of the purified protease, maximum rate (Vmax) and Michaelis constant (Km), were determined using a Lineweaver-Burk plot.

  9. A Serine Protease Homolog Negatively Regulates TEP1 Consumption in Systemic Infections of the Malaria Vector Anopheles gambiae

    PubMed Central

    Yassine, Hassan; Kamareddine, Layla; Chamat, Soulaima; Christophides, George K.; Osta, Mike A.

    2016-01-01

    Clip domain serine protease homologs are widely distributed in insect genomes and play important roles in regulating insect immune responses, yet their exact functions remain poorly understood. Here, we show that CLIPA2, a clip domain serine protease homolog of Anopheles gambiae, regulates the consumption of the mosquito complement-like protein TEP1 during systemic bacterial infections. We provide evidence that CLIPA2 localizes to microbial surfaces in a TEP1-dependent manner whereby it negatively regulates the activity of a putative TEP1 convertase, which converts the full-length TEP1-F form into active TEP1cut. CLIPA2 silencing triggers an exacerbated TEP1-mediated response that significantly enhances mosquito resistance to infections with a broad class of microorganisms including Plasmodium berghei, Escherichia coli and the entomopathogenic fungus Beauveria bassiana. We also provide further evidence for the existence of a functional link between TEP1 and activation of hemolymph prophenoloxidase during systemic infections. Interestingly, the enhanced TEP1-mediated immune response in CLIPA2 knockdown mosquitoes correlated with a significant reduction in fecundity, corroborating the existence of a trade-off between immunity and reproduction. In sum, CLIPA2 is an integral regulatory component of the mosquito complement-like pathway which functions to prevent an overwhelming response by the host in response to systemic infections. PMID:25012124

  10. A New Class of Serine and Cysteine Protease Inhibitor with Chemotherapeutic Potential

    DTIC Science & Technology

    1999-06-01

    also be used to produce a serine protease inhibitor. Similar to the cysteine inhibitors, a dipeptide side chain is attached to the ring which is...which relieves the 7 strain (Figure 3). Serine and cysteine proteases use a mechanism to cleave peptide bonds which involves addition of a catalytic...serine and cysteine proteases share a similar mechanism for hydrolyzing amide bonds , we expect that 4-heterocyclohexanones should be good inhibitors

  11. Development of activity-based probes for trypsin-family serine proteases.

    PubMed

    Pan, Zhengying; Jeffery, Douglas A; Chehade, Kareem; Beltman, Jerlyn; Clark, James M; Grothaus, Paul; Bogyo, Matthew; Baruch, Amos

    2006-06-01

    A series of diphenylphosphonate-based probes were developed for the trypsin-like serine proteases. These probes selectively target serine proteases rather than general serine hydrolases that are targets for fluorophosphonate-based probes. This increased selectivity allows detection of low abundance serine proteases in complex proteomes using simple SDS-PAGE methods. We present here the application of multiple probes in enzyme activity profiling of intact mast cells, a type of inflammatory cell implicated in allergy and autoimmune diseases.

  12. MALT1 Protease Activity Is Required for Innate and Adaptive Immune Responses.

    PubMed

    Yu, Jong W; Hoffman, Sandy; Beal, Allison M; Dykon, Angela; Ringenberg, Michael A; Hughes, Anna C; Dare, Lauren; Anderson, Amber D; Finger, Joshua; Kasparcova, Viera; Rickard, David; Berger, Scott B; Ramanjulu, Joshi; Emery, John G; Gough, Peter J; Bertin, John; Foley, Kevin P

    2015-01-01

    CARMA-BCL10-MALT1 signalosomes play important roles in antigen receptor signaling and other pathways. Previous studies have suggested that as part of this complex, MALT1 functions as both a scaffolding protein to activate NF-κB through recruitment of ubiquitin ligases, and as a protease to cleave and inactivate downstream inhibitory signaling proteins. However, our understanding of the relative importance of these two distinct MALT1 activities has been hampered by a lack of selective MALT1 protease inhibitors with suitable pharmacologic properties. To fully investigate the role of MALT1 protease activity, we generated mice homozygous for a protease-dead mutation in MALT1. We found that some, but not all, MALT1 functions in immune cells were dependent upon its protease activity. Protease-dead mice had defects in the generation of splenic marginal zone and peritoneal B1 B cells. CD4+ and CD8+ T cells displayed decreased T cell receptor-stimulated proliferation and IL-2 production while B cell receptor-stimulated proliferation was partially dependent on protease activity. In dendritic cells, stimulation of cytokine production through the Dectin-1, Dectin-2, and Mincle C-type lectin receptors was also found to be partially dependent upon protease activity. In vivo, protease-dead mice had reduced basal immunoglobulin levels, and showed defective responses to immunization with T-dependent and T-independent antigens. Surprisingly, despite these decreased responses, MALT1 protease-dead mice, but not MALT1 null mice, developed mixed inflammatory cell infiltrates in multiple organs, suggesting MALT1 protease activity plays a role in immune homeostasis. These findings highlight the importance of MALT1 protease activity in multiple immune cell types, and in integrating immune responses in vivo.

  13. A Novel Apoptotic Protease Activated in Human Breast Cancer Cells After Poisoning Topoisomerase I

    DTIC Science & Technology

    1999-10-01

    tocopherol, N- acetyl -L- cysteine ( NAC ) or pyrrolidinedithiocarbamate (PDTC)) did not significantly affect lethality caused by B-lap exposure (data not...will be required for the cloning of this novel noncaspase cysteine protease. The new hypothesis being tested is that B- lap activates calpain, which...caspase cysteine protease was activated within 4-8 hours, concomitant with the appearance of DNA fragmentation, measured by TUNEL assays; (e) protease

  14. Bacillus anthracis sin Locus and Regulation of Secreted Proteases ▿ †

    PubMed Central

    Pflughoeft, Kathryn J.; Sumby, Paul; Koehler, Theresa M.

    2011-01-01

    Bacillus anthracis shares many regulatory loci with the nonpathogenic Bacillus species Bacillus subtilis. One such locus is sinIR, which in B. subtilis controls sporulation, biofilm formation, motility, and competency. As B. anthracis is not known to be motile, to be naturally competent, or to readily form biofilms, we hypothesized that the B. anthracis sinIR regulon is distinct from that of B. subtilis. A genome-wide expression microarray analysis of B. anthracis parental and sinR mutant strains indicated limited convergence of the B. anthracis and B. subtilis SinR regulons. The B. anthracis regulon includes homologues of some B. subtilis SinR-regulated genes, including the signal peptidase gene sipW near the sinIR locus and the sporulation gene spoIIE. The B. anthracis SinR protein also negatively regulates transcription of genes adjacent to the sinIR locus that are unique to the Bacillus cereus group species. These include calY and inhA1, structural genes for the metalloproteases camelysin and immune inhibitor A1 (InhA1), which have been suggested to be associated with virulence in B. cereus and B. anthracis, respectively. Electrophoretic mobility shift assays revealed direct binding of B. anthracis SinR to promoter DNA from strongly regulated genes, such as calY and sipW, but not to the weakly regulated inhA1 gene. Assessment of camelysin and InhA1 levels in culture supernates from sinR-, inhA1-, and calY-null mutants showed that the concentration of InhA1 in the culture supernatant is inversely proportional to the concentration of camelysin. Our data are consistent with a model in which InhA1 protease levels are controlled at the transcriptional level by SinR and at the posttranslational level by camelysin. PMID:21131488

  15. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  16. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  17. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  18. Characterization of bacterial proteases with a panel of fluorescent peptide substrates.

    PubMed

    Wildeboer, Dirk; Jeganathan, Fiona; Price, Robert G; Abuknesha, Ramadan A

    2009-01-15

    Bacteria produce a range of proteolytic enzymes. In an attempt to detect and identify bacteria on the basis of their protease activity, a panel of protease substrates was investigated. Peptides conjugated to the fluorophore 7-amino-4-methylcoumarin (AMC) are well-established substrates for measuring protease activity. Although peptide-AMC substrates are generally not specific for a single protease, a unique pattern can be achieved for both highly specific enzymes and those with a broader substrate range by comparing different peptide substrates. The panel of 7 peptide-AMC substrates chosen exhibited a unique pattern for nine microbial proteases. The selected peptides were used to determine protease activity in cultured strains of Pseudomonas aeruginosa and Staphylococcus aureus. A signal pattern obtained with peptides with arginine, lysine, and tyrosine in the P1 position characterized the bacterial protease activities in these samples. The kinetic parameters for the three best substrates for the P. aeruginosa sample were calculated. Further information about substrate specificity was gained by the selective use of protease inhibitors. The results presented show that peptide-AMC substrates provide a simple and sensitive tool to characterize protease activity in microbiological samples and that they have the potential to identify and distinguish different bacterial species.

  19. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  20. Immobilized protease on the magnetic nanoparticles used for the hydrolysis of rapeseed meals

    NASA Astrophysics Data System (ADS)

    Jin, Xin; Li, Ju-Fang; Huang, Ping-Ying; Dong, Xu-Yan; Guo, Lu-Lu; Yang, Liang; Cao, Yuan-Cheng; Wei, Fang; Zhao, Yuan-Di; Chen, Hong

    2010-07-01

    (3-aminopropl) triethoxysilaneand modified magnetic nanoparticles with the average diameter of 25.4 nm were synthesized in water-phase co-precipitation method. And then these nanoparticles were covalently coupled with alkaline protease as enzyme carrier by using 1,4-phenylene diisothlocyanate as coupling agent. Experiments showed that the immobilized protease can keep the catalytic bioactivity, which can reach to 47.8% when casein was served as substrate. Results showed that the catalytic activity of immobilized protease on these magnetic nanoparticles could retain 98.63±2.37% after 60 days. And it is more stable than the free protease during the shelf-life test. The enzyme reaction conditions such as optimum reaction temperature and pH are the same as free protease. Furthermore, mix-and-separate experiments showed that the immobilized protease could be recycled through the magnetic nanoparticles after the biocatalysis process. When the rapeseed meals were used as substrate, the degree of hydrolysis of immobilized alkaline protease achieved 9.86%, while it was 10.41% for the free protease. The macromolecular proteins of rapeseed meals were hydrolyzed by immobilized protease into small molecules such as polypeptides or amino acids. Thus, a novel efficient and economic way for the recycling of enzymes in the application of continuous production of active peptides was provided based on these magnetic nanoparticles.

  1. Potent inhibition of feline coronaviruses with peptidyl compounds targeting coronavirus 3C-like protease.

    PubMed

    Kim, Yunjeong; Mandadapu, Sivakoteswara Rao; Groutas, William C; Chang, Kyeong-Ok

    2013-02-01

    Feline coronavirus infection is common among domestic and exotic felid species and usually associated with mild or asymptomatic enteritis; however, feline infectious peritonitis (FIP) is a fatal disease of cats that is caused by systemic infection with a feline infectious peritonitis virus (FIPV), a variant of feline enteric coronavirus (FECV). Currently, there is no specific treatment approved for FIP despite the importance of FIP as the leading infectious cause of death in young cats. During the replication process, coronavirus produces viral polyproteins that are processed into mature proteins by viral proteases, the main protease (3C-like [3CL] protease) and the papain-like protease. Since the cleavages of viral polyproteins are an essential step for virus replication, blockage of viral protease is an attractive target for therapeutic intervention. Previously, we reported the generation of broad-spectrum peptidyl inhibitors against viruses that possess a 3C or 3CL protease. In this study, we further evaluated the antiviral effects of the peptidyl inhibitors against feline coronaviruses, and investigated the interaction between our protease inhibitor and a cathepsin B inhibitor, an entry blocker, against a feline coronavirus in cell culture. Herein we report that our compounds behave as reversible, competitive inhibitors of 3CL protease, potently inhibited the replication of feline coronaviruses (EC(50) in a nanomolar range) and, furthermore, combination of cathepsin B and 3CL protease inhibitors led to a strong synergistic interaction against feline coronaviruses in a cell culture system.

  2. Scouring Potential of Mesophile Acidic Proteases of Pseudomonas aeruginosa for Grey Cotton Fabrics

    NASA Astrophysics Data System (ADS)

    Saravanan, D.

    2013-04-01

    Mesophile, acidic proteases were produced using the microbial source, Pseudomonas aeruginosa, with wider thermal tolerances. Process conditions of scouring treatment were optimized using Taguchi method for optimum temperature, time, pH and concentration of protease. Treatment with the protease lower weight loss values compared to the alkali scouring, however, significant improvement in the absorbency compared to the grey samples was observed. Large amounts of pectin left out in the samples resulted in higher extractable impurities, substantiated by the FTIR results. Relatively, lower reduction in the tear strengths was observed in both warp and weft directions after protease treatment of the cotton fabrics.

  3. A metagenomic alkaline protease from saline habitat: cloning, over-expression and functional attributes.

    PubMed

    Purohit, Megha K; Singh, Satya P

    2013-02-01

    Metagenomics has opened new horizon to unlock the biotechnological potential for novel enzymes. An alkaline protease gene was obtained from the total environmental DNA extracted from a saline habitat. After cloning and sequencing, it was identified that the protease gene related to uncultivable bacteria (HM219181). The protease was over expressed at 6h of induction with optimum induction at 1mM IPTG and 27°C. The purified enzyme was characterized with respect to various factors; temperature, pH, NaCl and chemical denaturant. The sequence analysis indicated a hydrophobic tendency of the protein, while the predicted 3D structure indicated the enzyme as a serine protease.

  4. Synthesis and herbicidal evaluation of novel benzothiazole derivatives as potential inhibitors of D1 protease.

    PubMed

    Huang, Tonghui; Sun, Jie; An, Lin; Zhang, Lixian; Han, Cuiping

    2016-04-01

    D1 protease is a C-terminal processing protease that has been predicted to be an ideal herbicidal target. Three novel series of benzothiazole derivatives were synthesized and evaluated for their herbicidal activities against Brassica napus (rape) and Echinochloa crusgalli (barnyard grass). The preliminary bioassay indicated that most of the synthesized compounds possess promising D1 protease inhibitory activities and considerable herbicidal activities. Molecular docking was performed to position representative compounds into the active site of D1 protease to determine a probable binding model.

  5. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  6. Nine Crystal Structures Determine the Substrate Envelope of the MDR HIV-1 Protease

    SciTech Connect

    Liu, Zhigang; Wang, Yong; Brunzelle, Joseph; Kovari, Iulia A.; Kovari, Ladislau C.

    2012-03-27

    Under drug selection pressure, emerging mutations render HIV-1 protease drug resistant, leading to the therapy failure in anti-HIV treatment. It is known that nine substrate cleavage site peptides bind to wild type (WT) HIV-1 protease in a conserved pattern. However, how the multidrug-resistant (MDR) HIV-1 protease binds to the substrate cleavage site peptides is yet to be determined. MDR769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, and 90) was selected for present study to understand the binding to its natural substrates. MDR769 HIV-1 protease was co-crystallized with nine substrate cleavage site hepta-peptides. Crystallographic studies show that MDR769 HIV-1 protease has an expanded substrate envelope with wide open flaps. Furthermore, ligand binding energy calculations indicate weaker binding in MDR769 HIV-1 protease-substrate complexes. These results help in designing the next generation of HIV-1 protease inhibitors by targeting the MDR HIV-1 protease.

  7. The encephalomyocarditis virus 3C protease is a substrate for the ubiquitin-mediated proteolytic system.

    PubMed

    Lawson, T G; Gronros, D L; Werner, J A; Wey, A C; DiGeorge, A M; Lockhart, J L; Wilson, J W; Wintrode, P L

    1994-11-11

    The encephalomyocarditis virus 3C protease has been shown to be rapidly degraded in infected cells and in vitro in rabbit reticulocyte lysate. The in vitro degradation, at least, is accomplished by a virus-independent, ATP-dependent proteolytic system. Here we identify this proteolytic system as the ubiquitin-mediated system. Incubation of the 3C protease in rabbit reticulocyte or cultured mouse cell lysate preparations, alone or in the presence of added ubiquitin or methylated ubiquitin, resulted in the generation of new higher molecular weight species. These new products were shown to be 3C protease-ubiquitin conjugates by their ability to bind antibodies against both the 3C protease and ubiquitin. Supplemental ubiquitin also stimulated the degradation of the 3C protease in these preparations. Large 3C protease-polyubiquitin conjugates were observed to accumulate in reticulocyte lysate in the presence of adenosine 5'-O-(3-thiotriphosphate), an inhibitor of the 26 S multicatalytic protease. This, combined with the fact that the proteolytic activity could be removed from the lysate by sedimentation, implicates the multicatalytic protease in the degradation of the 3C protease-ubiquitin conjugates. It was also found that the slow rate of degradation of a model polyprotein, which resembles the stable viral 3CD diprotein produced in vivo, is likely due to the fact that the polyprotein is a poor substrate for the ubiquitin-conjugating system.

  8. A biochemical comparison of proteases from pathogenic naegleria fowleri and non-pathogenic Naegleria gruberi.

    PubMed

    Serrano-Luna, Jesús; Cervantes-Sandoval, Isaac; Tsutsumi, Victor; Shibayama, Mineko

    2007-01-01

    Naegleria fowleri is the etiologic agent of primary amoebic meningoencephalitis (PAM). Proteases have been suggested to be involved in tissue invasion and destruction during infection. We analyzed and compared the complete protease profiles of total crude extract and conditioned medium of both pathogenic N. fowleri and non-pathogenic Naegleria gruberi trophozoites. Using SDS-PAGE, we found differences in the number and molecular weight of proteolytic bands between the two strains. The proteases showed optimal activity at pH 7.0 and 35 degrees C for both strains. Inhibition assays showed that the main proteolytic activity in both strains is due to cysteine proteases although serine proteases were also detected. Both N. fowleri and N. gruberi have a variety of different protease activities at different pH levels and temperatures. These proteases may allow the amoebae to acquire nutrients from different sources, including those from the host. Although, the role of the amoebic proteases in the pathogenesis of PAM is not clearly defined, it seems that proteases and other molecules of the parasite as well as those from the host, could be participating in the damage to the human central nervous system.

  9. Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein

    PubMed Central

    Azarnezhad, Asaad; Sharifi, Zohreh; Seyedabadi, Rahmatollah; Hosseini, Arshad; Johari, Behrooz; Sobhani Fard, Mahsa

    2016-01-01

    Background: As a drug target and an antigenic agent, HIV-1 protease (HIV-1 PR) is at the center of attention for designing anti-AIDS inhibitors and diagnostic tests. In previous studies, the production of the recombinant protease has been faced with several difficulties; therefore, the aims of this study were the easy production, purification of the soluble form of protease in E. coli and investigation of its immunoreactivity. Methods: Protease coding region was isolated from the serum of an infected individual, amplified by RT-PCR and cloned into PTZ57R using TA-cloning. Protease coding frame was isolated by PCR and cloned in pET102/D. TOPO expression vector and cloned protease was expressed in Escherichia coli (E. coli) BL21. Produced recombinant protein was purified by affinity Ni-NTA column and protein concentration was checked by BCA protein assay kit. Subsequently, immunoreactivity of recombinant protease (rPR) was assayed by Western blotting and ELISA. Results: Cloning of the HIV protease by TOPO cloning system in pET102/D.TOPO was confirmed with PCR and sequencing. The concentration range of purified recombinant protein was 85 to 100 μg/ml. Immunogenicity of rPR was confirmed by Western blotting and ELISA. Conclusion: Soluble production of recombinant HIV-1 protease (HIV-1 rPR) was performed successfully. This recombinant protein disclosed 86% specificity and 90% sensitivity in immunoassay tests. PMID:27920885

  10. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  11. Pseudomonas aeruginosa protease IV degrades surfactant proteins and inhibits surfactant host defense and biophysical functions.

    PubMed

    Malloy, Jaret L; Veldhuizen, Ruud A W; Thibodeaux, Brett A; O'Callaghan, Richard J; Wright, Jo Rae

    2005-02-01

    Pulmonary surfactant has two distinct functions within the lung: reduction of surface tension at the air-liquid interface and participation in innate host defense. Both functions are dependent on surfactant-associated proteins. Pseudomonas aeruginosa is primarily responsible for respiratory dysfunction and death in cystic fibrosis patients and is also a leading pathogen in nosocomial pneumonia. P. aeruginosa secretes a number of proteases that contribute to its virulence. We hypothesized that P. aeruginosa protease IV degrades surfactant proteins and results in a reduction in pulmonary surfactant host defense and biophysical functions. Protease IV was isolated from cultured supernatant of P. aeruginosa by gel chromatography. Incubation of cell-free bronchoalveolar lavage fluid with protease IV resulted in degradation of surfactant proteins (SP)-A, -D, and -B. SPs were degraded in a time- and dose-dependent fashion by protease IV, and degradation was inhibited by the trypsin-like serine protease inhibitor Nalpha-p-tosyl-L-lysine-chloromethyl ketone (TLCK). Degradation by protease IV inhibited SP-A- and SP-D-mediated bacterial aggregation and uptake by macrophages. Surfactant treated with protease IV was unable to reduce surface tension as effectively as untreated surfactant, and this effect was inhibited by TLCK. We speculate that protease IV may be an important contributing factor to the development and propagation of acute lung injury associated with P. aeruginosa via loss of surfactant function within the lung.

  12. Membrane-protease interactions. III: A consideration of the difference in binding potential of pancreatic proteases to erythrocytes and erythrocyte ghosts.

    PubMed

    Brecher, A S; Rosen, M; Burkholder, D E

    1999-09-01

    Trypsin and chymotrypsin readily bind to human erythrocyte ghosts and to resealed right-side-out ghosts, but not to intact erythrocytes, as followed with [3H]trypsin and [3H]chymotrypsin and with cold proteases in a caseinolytic assay. The proteases freely reacted with casein in the presence of intact cells. Trypsin activated trypsinogen over an 8-hr time course at a faster rate in the presence of erythrocytes than in the absence thereof, after a slight initial delay. Trypsinogen did not bind to intact erythrocytes, thereby behaving comparably to trypsin. These results suggest that different microenvironments exist about the erythrocyte ghosts and the intact erythrocytes, thereby permitting the proteases to bind to the former but not to the latter. Hence, in the absence of considerable ghosts in circulating blood, which may mask the binding site of the proteases, the proteases may be more readily accessible for interaction with circulating serpins, leading to inactivation of the proteases and protection from their degradative potential. The presence of the serpins in circulating blood may assist in the control of the degradative power of the pancreatic proteases in pancreatitis and may negatively modulate such processes as thrombosis, activation of the complement system, and vascular remodeling.

  13. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  14. A multifaceted analysis of HIV-1 protease multidrug resistance phenotypes

    PubMed Central

    2011-01-01

    Background Great strides have been made in the effective treatment of HIV-1 with the development of second-generation protease inhibitors (PIs) that are effective against historically multi-PI-resistant HIV-1 variants. Nevertheless, mutation patterns that confer decreasing susceptibility to available PIs continue to arise within the population. Understanding the phenotypic and genotypic patterns responsible for multi-PI resistance is necessary for developing PIs that are active against clinically-relevant PI-resistant HIV-1 variants. Results In this work, we use globally optimal integer programming-based clustering techniques to elucidate multi-PI phenotypic resistance patterns using a data set of 398 HIV-1 protease sequences that have each been phenotyped for susceptibility toward the nine clinically-approved HIV-1 PIs. We validate the information content of the clusters by evaluating their ability to predict the level of decreased susceptibility to each of the available PIs using a cross validation procedure. We demonstrate the finding that as a result of phenotypic cross resistance, the considered clinical HIV-1 protease isolates are confined to ~6% or less of the clinically-relevant phenotypic space. Clustering and feature selection methods are used to find representative sequences and mutations for major resistance phenotypes to elucidate their genotypic signatures. We show that phenotypic similarity does not imply genotypic similarity, that different PI-resistance mutation patterns can give rise to HIV-1 isolates with similar phenotypic profiles. Conclusion Rather than characterizing HIV-1 susceptibility toward each PI individually, our study offers a unique perspective on the phenomenon of PI class resistance by uncovering major multidrug-resistant phenotypic patterns and their often diverse genotypic determinants, providing a methodology that can be applied to understand clinically-relevant phenotypic patterns to aid in the design of novel inhibitors that

  15. Serine Proteases Enhance Immunogenic Antigen Presentation on Lung Cancer Cells.

    PubMed

    Peters, Haley L; Tripathi, Satyendra C; Kerros, Celine; Katayama, Hiroyuki; Garber, Haven R; St John, Lisa S; Federico, Lorenzo; Meraz, Ismail M; Roth, Jack A; Sepesi, Boris; Majidi, Mourad; Ruisaard, Kathryn; Clise-Dwyer, Karen; Roszik, Jason; Gibbons, Don L; Heymach, John V; Swisher, Stephen G; Bernatchez, Chantale; Alatrash, Gheath; Hanash, Samir; Molldrem, Jeffrey J

    2017-03-02

    Immunotherapies targeting immune checkpoints have proven efficacious in reducing the burden of lung cancer in patients; however, the antigenic targets of these reinvigorated T cells remain poorly defined. Lung cancer tumors contain tumor-associated macrophages (TAM) and neutrophils, which release the serine proteases neutrophil elastase (NE) and proteinase 3 (P3) into the tumor microenvironment. NE and P3 shape the antitumor adaptive immune response in breast cancer and melanoma. In this report, we demonstrate that lung cancer cells cross-presented the tumor-associated antigen PR1, derived from NE and P3. Additionally, NE and P3 enhanced the expression of human leukocyte antigen (HLA) class I molecules on lung cancer cells and induced unique, endogenous peptides in the immunopeptidome, as detected with mass spectrometry sequencing. Lung cancer patient tissues with high intratumoral TAMs were enriched for MHC class I genes and T-cell markers, and patients with high TAM and cytotoxic T lymphocyte (CTL) infiltration had improved overall survival. We confirmed the immunogenicity of unique, endogenous peptides with cytotoxicity assays against lung cancer cell lines, using CTLs from healthy donors that had been expanded against select peptides. Finally, CTLs specific for serine proteases-induced endogenous peptides were detected in lung cancer patients using peptide/HLA-A2 tetramers and were elevated in tumor-infiltrating lymphocytes. Thus, serine proteases in the tumor microenvironment of lung cancers promote the presentation of HLA class I immunogenic peptides that are expressed by lung cancer cells, thereby increasing the antigen repertoire that can be targeted in lung cancer. Cancer Immunol Res; 5(4); 1-11. ©2017 AACR.

  16. Biased signaling by peptide agonists of protease activated receptor 2.

    PubMed

    Jiang, Yuhong; Yau, Mei-Kwan; Kok, W Mei; Lim, Junxian; Wu, Kai-Chen; Liu, Ligong; Hill, Timothy A; Suen, Jacky Y; Fairlie, David P

    2017-02-07

    Protease activated receptor 2 (PAR2) is associated with metabolism, obesity, inflammatory, respiratory and gastrointestinal disorders, pain, cancer and other diseases. The extracellular N-terminus of PAR2 is a common target for multiple proteases, which cleave it at different sites to generate different N-termini that activate different PAR2-mediated intracellular signaling pathways. There are no synthetic PAR2 ligands that reproduce the same signaling profiles and potencies as proteases. Structure-activity relationships here for 26 compounds spanned a signaling bias over 3 log units, culminating in three small ligands as biased agonist tools for interrogating PAR2 functions. DF253 (2f-LAAAAI-NH2) triggered PAR2-mediated calcium release (EC50 2 μM) but not ERK1/2 phosphorylation (EC50 > 100 μM) in CHO cells transfected with hPAR2. AY77 (Isox-Cha-Chg-NH2) was a more potent calcium-biased agonist (EC50 40 nM, Ca2+; EC50 2 μM, ERK1/2), while its analogue AY254 (Isox-Cha-Chg-A-R-NH2) was an ERK-biased agonist (EC50 2 nM, ERK1/2; EC50 80 nM, Ca2+). Signaling bias led to different functional responses in human colorectal carcinoma cells (HT29). AY254, but not AY77 or DF253, attenuated cytokine-induced caspase 3/8 activation, promoted scratch-wound healing and induced IL-8 secretion, all via PAR2-ERK1/2 signaling. Different ligand components were responsible for different PAR2 signaling and functions, clues that can potentially lead to drugs that modulate different pathway-selective cellular and physiological responses.

  17. Functional protease profiling for laboratory based diagnosis of invasive aspergillosis.

    PubMed

    Sabbagh, Bassel; Costina, Victor; Buchheidt, Dieter; Reinwald, Mark; Neumaier, Michael; Findeisen, Peter

    2015-07-01

    Invasive aspergillosis (IA) remains difficult to diagnose in immunocompromised patients, because diagnostic criteria according to EORTC/MSG guidelines are often not met and have low sensitivity. Hence there is an urgent need to improve diagnostic procedures by developing novel approaches. In the present study, we present a proof of concept experiment for the monitoring of Aspergillus associated protease activity in serum specimens for diagnostic purpose. Synthetic peptides that are selectively cleaved by proteases secreted from Aspergillus species were selected from our own experiments and published data. These so called reporter peptides (RP, n=5) were added to serum specimens from healthy controls (HC, n=101) and patients with proven (IA, n=9) and possible (PIA, n=144) invasive aspergillosis. Spiked samples were incubated ex vivo under strictly standardized conditions. Proteolytic fragments were analyzed using MALDI-TOF mass spectrometry. Spiked specimens of IA patients had highest concentrations of RP-fragments followed by PIA and HC. The median signal intensity was 116.546 (SD, 53.063) for IA and 5.009 (SD, 8.432) for HC. A cut-off >36.910 was chosen that performed with 100% specificity and sensitivity. Patients with PIA had either values above [53% (76/144)] or below [47% (67/144)] this chosen cut-off. The detection of respective reporter peptide fragments can easily be performed by MALDI TOF mass spectrometry. In this proof of concept study we were able to demonstrate that serum specimens of patients with IA have increased proteolytic activity towards selected reporter peptides. However, the diagnostic value of functional protease profiling has to be validated in further prospective studies. It is likely that a combination of existing and new methods will be required to achieve optimal performance for diagnosis of IA in the future.

  18. Plant Protease Inhibitors in Therapeutics-Focus on Cancer Therapy

    PubMed Central

    Srikanth, Sandhya; Chen, Zhong

    2016-01-01

    Plants are known to have many secondary metabolites and phytochemical compounds which are highly explored at biochemical and molecular genetics level and exploited enormously in the human health care sector. However, there are other less explored small molecular weight proteins, which inhibit proteases/proteinases. Plants are good sources of protease inhibitors (PIs) which protect them against diseases, insects, pests, and herbivores. In the past, proteinaceous PIs were considered primarily as protein-degrading enzymes. Nevertheless, this view has significantly changed and PIs are now treated as very important signaling molecules in many biological activities such as inflammation, apoptosis, blood clotting and hormone processing. In recent years, PIs have been examined extensively as therapeutic agents, primarily to deal with various human cancers. Interestingly, many plant-based PIs are also found to be effective against cardiovascular diseases, osteoporosis, inflammatory diseases and neurological disorders. Several plant PIs are under further evaluation in in vitro clinical trials. Among all types of PIs, Bowman-Birk inhibitors (BBI) have been studied extensively in the treatment of many diseases, especially in the field of cancer prevention. So far, crops such as beans, potatoes, barley, squash, millet, wheat, buckwheat, groundnut, chickpea, pigeonpea, corn, and pineapple have been identified as good sources of PIs. The PI content of such foods has a significant influence on human health disorders, particularly in the regions where people mostly depend on these kind of foods. These natural PIs vary in concentration, protease specificity, heat stability, and sometimes several PIs may be present in the same species or tissue. However, it is important to carry out individual studies to identify the potential effects of each PI on human health. PIs in plants make them incredible sources to determine novel PIs with specific pharmacological and therapeutic effects due

  19. The protease cathepsin L regulates Th17 cell differentiation.

    PubMed

    Hou, Lifei; Cooley, Jessica; Swanson, Richard; Ong, Poh Chee; Pike, Robert N; Bogyo, Matthew; Olson, Steven T; Remold-O'Donnell, Eileen

    2015-12-01

    Previously we reported that IL-17(+) T cells, primarily IL-17(+) γδ cells, are increased in mice lacking the protease inhibitor serpinB1 (serpinb1(-/-) mice). Here we show that serpinB1-deficient CD4 cells exhibit a cell-autonomous and selective deficiency in suppressing T helper 17 (Th17) cell differentiation. This suggested an opposing role for one or more protease in promoting Th17 differentiation. We found that several SerpinB1-inhibitable cysteine cathepsins are induced in Th17 cells, most prominently cathepsin L (catL); this was verified by peptidase assays, active site labeling and Western blots. Moreover, Th17 differentiation was suppressed by both broad cathepsin inhibitors and catL selective inhibitors. CatL is present in Th17 cells as single chain (SC)- and two-chain (TC)-forms. Inhibiting asparagine endopeptidase (AEP) blocked conversion of SC-catL to TC-catL and increased generation of serpinb1(-/-) Th17 cells, but not wild-type Th17 cells. These findings suggest that SC-catL is biologically active in promoting Th17 generation and is counter-regulated by serpinB1 and secondarily by AEP. Thus, in addition to regulation by cytokines and transcription factors, differentiation of CD4 cells to Th17 cells is actively regulated by a catL-serpinB1-AEP module. Targeting this protease regulatory module could be an approach to treating Th17 cell-driven autoimmune disorders.

  20. Plant Protease Inhibitors in Therapeutics-Focus on Cancer Therapy.

    PubMed

    Srikanth, Sandhya; Chen, Zhong

    2016-01-01

    Plants are known to have many secondary metabolites and phytochemical compounds which are highly explored at biochemical and molecular genetics level and exploited enormously in the human health care sector. However, there are other less explored small molecular weight proteins, which inhibit proteases/proteinases. Plants are good sources of protease inhibitors (PIs) which protect them against diseases, insects, pests, and herbivores. In the past, proteinaceous PIs were considered primarily as protein-degrading enzymes. Nevertheless, this view has significantly changed and PIs are now treated as very important signaling molecules in many biological activities such as inflammation, apoptosis, blood clotting and hormone processing. In recent years, PIs have been examined extensively as therapeutic agents, primarily to deal with various human cancers. Interestingly, many plant-based PIs are also found to be effective against cardiovascular diseases, osteoporosis, inflammatory diseases and neurological disorders. Several plant PIs are under further evaluation in in vitro clinical trials. Among all types of PIs, Bowman-Birk inhibitors (BBI) have been studied extensively in the treatment of many diseases, especially in the field of cancer prevention. So far, crops such as beans, potatoes, barley, squash, millet, wheat, buckwheat, groundnut, chickpea, pigeonpea, corn, and pineapple have been identified as good sources of PIs. The PI content of such foods has a significant influence on human health disorders, particularly in the regions where people mostly depend on these kind of foods. These natural PIs vary in concentration, protease specificity, heat stability, and sometimes several PIs may be present in the same species or tissue. However, it is important to carry out individual studies to identify the potential effects of each PI on human health. PIs in plants make them incredible sources to determine novel PIs with specific pharmacological and therapeutic effects due

  1. Endothelial Progenitor Cells in Sprouting Angiogenesis: Proteases Pave the Way.

    PubMed

    Laurenzana, A; Fibbi, G; Margheri, F; Biagioni, A; Luciani, C; Del Rosso, M; Chillà, A

    2015-01-01

    Sprouting angiogenesis consists of the expansion and remodelling of existing vessels, where the vascular sprouts connect each other to form new vascular loops. Endothelial Progenitor Cells (EPCs) are a subtype of stem cells, with high proliferative potential, able to differentiate into mature Endothelial Cells (ECs) during the neovascularization process. In addition to this direct structural role EPCs improve neovascularization, also secreting numerous pro-angiogenic factors able to enhance the proliferation, survival and function of mature ECs, and other surrounding progenitor cells. While sprouting angiogenesis by mature ECs involves resident ECs, the vasculogenic contribution of EPCs is a high hurdle race. Bone marrowmobilized EPCs have to detach from the stem cell niche, intravasate into bone marrow vessels, reach the hypoxic area or tumour site, extravasate and incorporate into the new vessel lumen, thus complementing the resident mature ECs in sprouting angiogenesis. The goal of this review is to highlight the role of the main protease systems able to control each of these steps. The pivotal protease systems here described, involved in vascular patterning in sprouting angiogenesis, are the matrix-metalloproteinases (MMPs), the serineproteinases urokinase-type plasminogen activator (uPA) associated with its receptor (uPAR) and receptorassociated plasminogen/plasmin, the neutrophil elastase and the cathepsins. Since angiogenesis plays a critical role not only in physiological but also in pathological processes, such as in tumours, controlling the contribution of EPCs to the angiogenic process, through the regulation of the protease systems involved, could yield new opportunities for the therapeutic prospect of efficient control of pathological angiogenesis.

  2. Conformational transition of the lid helix covering the protease active site is essential for the ATP-dependent protease activity of FtsH.

    PubMed

    Suno, Ryoji; Shimoyama, Masakazu; Abe, Akiko; Shimamura, Tatsuro; Shimodate, Natsuka; Watanabe, Yo-hei; Akiyama, Yoshinori; Yoshida, Masasuke

    2012-09-21

    When bound to ADP, ATP-dependent protease FtsH subunits adopt either an "open" or "closed" conformation. In the open state, the protease catalytic site is located in a narrow space covered by a lidlike helix. This space disappears in the closed form because the lid helix bends at Gly448. Here, we replaced Gly448 with various residues that stabilize helices. Most mutants retained low ATPase activity and bound to the substrate protein, but lost protease activity. However, a mutant proline substitution lost both activities. Our study shows that the conformational transition of the lid helix is essential for the function of FtsH.

  3. Lung vascular injury with protease infusion. Relationship to plasma fibronectin.

    PubMed Central

    Cohler, L F; Saba, T M; Lewis, E P

    1985-01-01

    Fibronectin exists in a soluble form in plasma and in an insoluble form in tissues. Plasma fibronectin can modulate phagocytic function as well as incorporate into the tissue matrix where it is believed to influence microvascular integrity and tissue repair. The temporal alterations in plasma and lung lymph fibronectin were studied in relation to increased pulmonary vascular permeability induced by protease infusion. The acute sheep lung lymph fistula model was used. A 39% decrease in plasma fibronectin (control = 421 +/- 67 micrograms/ml) was observed 2.5 hours (255 +/- 43 micrograms/ml) after protease infusion. There was an elevation of lymph fibronectin early after protease infusion, followed by a progressive decline. Concomitant with the decrease in plasma fibronectin, an increase in lymph flow (QL) of greater than 200% (from a control of 6.7 +/- 1.0 ml/hr to 13.9 +/- 1.4 ml/hr) was observed within 2.5 hours. Also, there was a sustained elevation in the total protein lymph/plasma concentration (L/P) ratio, which was maximal at 2.5 hours. The transvascular protein clearance (TVPC = QL X L/P) was 4.5 +/- 0.7 ml/hr at the control period and 13.1 +/- 2.0 ml/hr by 2.5 hours. This was indicative of increased flux of protein-rich fluid across the pulmonary endothelial barrier. Lung vascular permeability stabilized after 2.5 hours as manifested by a slowly declining L/P ratio. Thus, plasma fibronectin deficiency may contribute to the etiology of increased lung vascular permeability with protease infusion. Since the progressive decline in plasma fibronectin was not reflected in a proportional increase in lymph fibronectin, plasma fibronectin may have sequestered in tissues such as the lung, or perhaps in reticuloendothelial cells during the injury phase. Whether the progressive decrease in plasma fibronectin reflects its incorporation into the endothelial barrier matrix where it may mediate stabilization of the pulmonary microvascular barrier remains to be determined

  4. Lysosomal cysteine proteases: structure, function and inhibition of cathepsins.

    PubMed

    Roberts, Rebecca

    2005-12-01

    Lysosomal cysteine proteases, a subgroup of the cathepsin family, are critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling. In the past decade, the number of identified human cathepsins has more than doubled and their known role in several pathologies has expanded rapidly. Increased understanding of the structure and mechanism of this class of enzymes has brought on a new fervor in the design of small molecule inhibitors with the hope of producing specific, therapeutic drugs for diseases such as arthritis, allergy, multiple sclerosis, atherosclerosis, Alzheimer's disease and cancer.

  5. Functional analysis of rhomboid proteases during Toxoplasma invasion.

    PubMed

    Shen, Bang; Buguliskis, Jeffrey S; Lee, Tobie D; Sibley, L David

    2014-10-21

    Host cell invasion by Toxoplasma gondii and other apicomplexan parasites requires transmembrane adhesins that mediate binding to receptors on the substrate and host cell to facilitate motility and invasion. Rhomboid proteases (ROMs) are thought to cleave adhesins within their transmembrane segments, thus allowing the parasite to disengage from receptors and completely enter the host cell. To examine the specific roles of individual ROMs during invasion, we generated single, double, and triple knockouts for the three ROMs expressed in T. gondii tachyzoites. Analysis of these mutants demonstrated that ROM4 is the primary protease involved in adhesin processing and host cell invasion, whereas ROM1 or ROM5 plays negligible roles in these processes. Deletion of ROM4 blocked the shedding of adhesins such as MIC2 (microneme protein 2), causing them to accumulate on the surface of extracellular parasites. Increased surface adhesins led to nonproductive attachment, altered gliding motility, impaired moving junction formation, and reduced invasion efficiency. Despite the importance of ROM4 for efficient invasion, mutants lacking all three ROMs were viable and MIC2 was still efficiently removed from the surface of invaded mutant parasites, implying the existence of ROM-independent mechanisms for adhesin removal during invasion. Collectively, these results suggest that although ROM processing of adhesins is not absolutely essential, it is important for efficient host cell invasion by T. gondii. Importance: Apicomplexan parasites such as Toxoplasma gondii express surface proteins that bind host cell receptors to aid invasion. Many of these adhesins are subject to cleavage by rhomboid proteases (ROMs) within their transmembrane segments during invasion. Previous studies have demonstrated the importance of adhesin cleavage for parasite invasion and proposed that the ROMs responsible for processing would be essential for parasite survival. In T. gondii, ROM5 was thought to be the

  6. Ergotism associated with HIV antiviral protease inhibitor therapy.

    PubMed

    Baldwin, Zachary K; Ceraldi, Chris C

    2003-03-01

    Ergotism is a rare condition of acute vasospasm found classically in young and middle-aged women taking ergot alkaloid agents to treat migraine headache. We report the case of a young man with human immunodeficiency virus (HIV) positivity and describe the drug interaction between protease inhibitors and ergot alkaloid agents, which most likely predisposed to development of ergot toxicity. The HIV-positive population receiving antiviral therapy may be an under-recognized group at risk for ergotism through decreased hepatic metabolism of ergot preparations.

  7. Expression and activation of proteases in co-cultures.

    PubMed

    Paduch, Roman; Kandefer-Szerszeń, Martyna

    2011-01-01

    The present study concerned the expression and activation of metalloproteinase-2 (MMP-2), metalloproteinase-9 (MMP-9) and the urokinase plasminogen activator/urokinase plasminogen activator receptor (uPA/uPAR) system in co-cultures of human colon carcinoma cell spheroids (HT29, LS180, SW948) with human normal colon epithelium (CCD 841 CoTr), myofibroblasts (CCD-18Co) and endothelial cells (HUVEC). Additionally, the influence of monensin on the production and function of the proteases was tested. Tumor cells expressed small amounts of MMP-2, MMP-9 and uPA. Normal cells generally produced proportionally higher concentrations of these proteases (especially MMP-2, compared with significantly smaller yields of MMP-9 and significantly lower amounts of uPAR than tumors. In co-cultures of tumor spheroids with normal cell monolayers, the concentration of the proteases was equal to the sum of the enzymes produced in monocultures of both types of cells. The highest activity of uPA, measured as the reduction of the chromogenic substrate (S-2444), was detected in supernatants and lysates of endothelial cells. Interestingly, in normal cells, the higher expression of proteases, mainly uPA, measured as the level of protein concentration, was closely linked with their lower activity and inversely, in tumor cells, the low level of the expression of the enzymes correlated with their high enzymatic activity. In zymography analysis, mainly pro-MMPs were detected both in culture supernatants and cell lysates. The highest amounts of active forms of the MMPs were detected in tumor spheroids co-cultured with endothelial cells. Monensin inhibited MMPs and uPA secretion but significantly increased uPAR release, mainly from normal cells. In conclusion, during direct interactions of tumor cells with normal cells, MMPs and the uPA/uPAR system play an important role in the degradation of ECM and tumor development, but as we found, there is a reverse relationship between the concentration and the

  8. Structures of a bi-functional Kunitz-type STI family inhibitor of serine and aspartic proteases: Could the aspartic protease inhibition have evolved from a canonical serine protease-binding loop?

    PubMed

    Guerra, Yasel; Valiente, Pedro A; Pons, Tirso; Berry, Colin; Rudiño-Piñera, Enrique

    2016-08-01

    Bi-functional inhibitors from the Kunitz-type soybean trypsin inhibitor (STI) family are glycosylated proteins able to inhibit serine and aspartic proteases. Here we report six crystal structures of the wild-type and a non-glycosylated mutant of the bifunctional inhibitor E3Ad obtained at different pH values and space groups. The crystal structures show that E3Ad adopts the typical β-trefoil fold of the STI family exhibiting some conformational changes due to pH variations and crystal packing. Despite the high sequence identity with a recently reported potato cathepsin D inhibitor (PDI), three-dimensional structures obtained in this work show a significant conformational change in the protease-binding loop proposed for aspartic protease inhibition. The E3Ad binding loop for serine protease inhibition is also proposed, based on structural similarity with a novel non-canonical conformation described for the double-headed inhibitor API-A from the Kunitz-type STI family. In addition, structural and sequence analyses suggest that bifunctional inhibitors of serine and aspartic proteases from the Kunitz-type STI family are more similar to double-headed inhibitor API-A than other inhibitors with a canonical protease-binding loop.

  9. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    SciTech Connect

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-02-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage lambdagt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16/sup +/ natural killer cells and CD3/sup +/, CD16/sup -/ T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.

  10. Increasing activity and thermal resistance of Bacillus gibsonii alkaline protease (BgAP) by directed evolution.

    PubMed

    Martinez, Ronny; Jakob, Felix; Tu, Ran; Siegert, Petra; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2013-03-01

    Bacillus gibsonii Alkaline Protease (BgAP) is a recently reported subtilisin protease exhibiting activity and stability properties suitable for applications in laundry and dish washing detergents. However, BgAP suffers from a significant decrease of activity at low temperatures. In order to increase BgAP activity at 15°C, a directed evolution campaign based on the SeSaM random mutagenesis method was performed. An optimized microtiter plate expression system in B. subtilis was established and classical proteolytic detection methods were adapted for high throughput screening. In parallel, the libraries were screened for increased residual proteolytic activity after incubation at 58°C. Three iterative rounds of directed BgAP evolution yielded a set of BgAP variants with increased specific activity (K(cat)) at 15°C and increased thermal resistance. Recombination of both sets of amino acid substitutions resulted finally in variant MF1 with a 1.5-fold increased specific activity (15°C) and over 100 times prolonged half-life at 60°C (224 min compared to 2 min of the WT BgAP). None of the introduced amino acid substitutions were close to the active site of BgAP. Activity-altering amino acid substitutions were from non-charged to non-charged or from sterically demanding to less demanding. Thermal stability improvements were achieved by substitutions to negatively charged amino acids in loop areas of the BgAP surface which probably fostered ionic and hydrogen bonds interactions.

  11. Triple combination treatment for chronic hepatitis C with protease inhibitors, pegylated interferon and ribavirin: 'lead-in or no lead-in'?

    PubMed

    Foster, Graham R; Serfaty, Lawrence D

    2012-02-01

    Direct acting antiviral agents for the management of chronic hepatitis C infection have recently been licensed. These new protease inhibitors are combined with pegylated interferon and ribavirin and markedly increase the proportion of patients who respond to antiviral therapy. The protease inhibitors may be used with a 'lead-in' phase of pegylated interferon and ribavirin and the value of this approach has been much debated with those supporting 'lead in' citing the advantages of assessing the early response to therapy before commencing the direct acting antiviral agent. Those opposed to the 'lead-in' phase cite the complexity of the regime and the lack of robust evidence showing an improvement in clinical outcome in those treated in this fashion.

  12. Optimisation of the detection of bacterial proteases using adsorbed immunoglobulins as universal substrates.

    PubMed

    Abuknesha, Ram A; Jeganathan, Fiona; Wildeboer, Dirk; Price, Robert G

    2010-06-15

    Bacterial proteases, Type XXIV from Bacillus licheniformens and Type XIV from Streptomyces griseus, were used to investigate the utility and optimisation of a solid phase assay for proteases, using immunoglobulin proteins as substrates. Immunoglobulins IgA and IgG were adsorbed on to surfaces of ELISA plates and exposed to various levels of the bacterial proteases which led to digestion and desorption of proportional amounts of the immunoglobulins. The assay signal was developed by measuring the remaining proteins on the polystyrene surface with appropriate enzyme-labelled anti-immunoglobulin reagents. The assay was fully optimised in terms of substrate levels employing ELISA techniques to titrate levels of adsorbed substrates and protease analytes. The critical factor which influences assay sensitivity was found to be the substrate concentration, the levels of adsorbed immunoglobulins. The estimated detection limits for protease XXIV and XIV were 10micro units/test and 9micro units/test using IgA as a substrate. EC(50) values were calculated as 213 and 48micro units/test for each protease respectively. Using IgG as a substrate, the estimated detection limits were 104micro units/test for protease XXIV and 9micro units/test for protease XIV. EC(50) values were calculated at 529micro units/test and 28micro units/test for protease XXIV and XIV respectively. The solid phase protease assay required no modification of the substrates and the adsorption step is merely simple addition of immunoglobulins to ELISA plates. Adsorption of the immunoglobulins to polystyrene enabled straightforward separation of reaction mixtures prior to development of assay signal. The assay exploits the advantages of the technical facilities of ELISA technology and commercially available reagents enabling the detection and measurement of a wide range of proteases. However, the key issue was found to be that in order to achieve the potential performance of the simple assay, optimisation of the

  13. Understanding the specificity of serpin-protease complexes through interface analysis.

    PubMed

    Rashid, Qudsia; Kapil, Charu; Singh, Poonam; Kumari, Vineeta; Jairajpuri, Mohamad Aman

    2015-01-01

    Serpins such as antithrombin, heparin cofactor II, plasminogen activator inhibitor, antitrypsin, antichymotrypsin, and neuroserpin are involved in important biological processes by inhibiting specific serine proteases. Initially, the protease recognizes the mobile reactive loop of the serpin eliciting conformational changes, where the cleaved loop together with the protease inserts into β-sheet A, translocating the protease to the opposite side of inhibitor leading to its inactivation. Serpin interaction with proteases is governed mainly by the reactive center loop residues (RCL). However, in some inhibitory serpins, exosite residues apart from RCL have been shown to confer protease specificity. Further, this forms the basis of multi-specificity of some serpins, but the residues and their dimension at interface in serpin-protease complexes remain elusive. Here, we present a comprehensive structural analysis of the serpin-protease interfaces using bio COmplexes COntact MAPS (COCOMAPS), PRotein Interface Conservation and Energetics (PRICE), and ProFace programs. We have carried out interface, burial, and evolutionary analysis of different serpin-protease complexes. Among the studied complexes, non-inhibitory serpins exhibit larger interface region with greater number of residue involvement as compared to the inhibitory serpins. On comparing the multi-specific serpins (antithrombin and antitrypsin), a difference in the interface area and residue number was observed, suggestive of a differential mechanism of action of these serpins in regulating their different target proteases. Further, detailed study of these multi-specific serpins listed few essential residues (common in all the complexes) and certain specificity (unique to each complex) determining residues at their interfaces. Structural mapping of interface residues suggested that individual patches with evolutionary conserved residues in specific serpins determine their specificity towards a particular protease.

  14. Antiparasitic effect of a fraction enriched in tight-binding protease inhibitors isolated from the Caribbean coral Plexaura homomalla.

    PubMed

    Salas-Sarduy, Emir; Cabrera-Muñoz, Aymara; Cauerhff, Ana; González-González, Yamile; Trejo, Sebastián A; Chidichimo, Agustina; Chávez-Planes, Maria de Los Angeles; Cazzulo, Juan José

    2013-11-01

    Malaria and American Trypanosomiasis constitute major global health problems. The continued emergence and spreading of resistant strains and the limited efficacy and/or safety of currently available therapeutic agents require a constant search for new sources of antiparasitic compounds. In the present study, a fraction enriched in tight-binding protease inhibitors was isolated from the Caribbean coral Plexaura homomalla (Esper, 1792), functionally characterized and tested for their antiparasitic activity against Trypanosoma cruzi and Plasmodium falciparum. The resultant fraction was chromatographically enriched in tight-binding inhibitors active against Papain-like cysteine peptidases (92%) and Pepsin-like aspartyl peptidases (8%). Globally, the inhibitors present in the enriched fraction showed no competition with substrates and apparent Ki values of 1.99 and 4.81nM for Falcipain 2 and Cruzipain, the major cysteine peptidases from P. falciparum and T. cruzi, respectively. The inhibitor-enriched fraction showed promising antiparasitic activity in cultures. It reduced the growth of the chloroquine-resistant P. falciparum strain Dd2 (IC50=0.46μM) and promoted the apparent accumulation of trophozoites, both consistent with a blockade in the hemoglobin degradation pathway. At sub-micromolar concentrations, the inhibitor-enriched fraction reduced the infection of VERO cells by T. cruzi (CL Brener clone) trypomastigotes and interfered with intracellular differentiation and/or replication of the parasites. This study provides new scientific evidence that confirms P. homomalla as an excellent source of tight-biding protease inhibitors for different proteases with biomedical relevance, and suggests that either the individual inhibitors or the enriched fraction itself could be valuable as antiparasitic compounds.

  15. Plasmodium falciparum metacaspase PfMCA-1 triggers a z-VAD-fmk inhibitable protease to promote cell death.

    PubMed

    Meslin, Benoît; Beavogui, Abdoul H; Fasel, Nicolas; Picot, Stéphane

    2011-01-01

    Activation of proteolytic cell death pathways may circumvent drug resistance in deadly protozoan parasites such as Plasmodium falciparum and Leishmania. To this end, it is important to define the cell death pathway(s) in parasites and thus characterize proteases such as metacaspases (MCA), which have been reported to induce cell death in plants and Leishmania parasites. We, therefore, investigated whether the cell death function of MCA is conserved in different protozoan parasite species such as Plasmodium falciparum and Leishmania major, focusing on the substrate specificity and functional role in cell survival as compared to Saccharomyces cerevisae. Our results show that, similarly to Leishmania, Plasmodium MCA exhibits a calcium-dependent, arginine-specific protease activity and its expression in yeast induced growth inhibition as well as an 82% increase in cell death under oxidative stress, a situation encountered by parasites during the host or when exposed to drugs such as artemisins. Furthermore, we show that MCA cell death pathways in both Plasmodium and Leishmania, involve a z-VAD-fmk inhibitable protease. Our data provide evidence that MCA from both Leishmania and Plasmodium falciparum is able to induce cell death in stress conditions, where it specifically activates a downstream enzyme as part of a cell death pathway. This enzymatic activity is also induced by the antimalarial drug chloroquine in erythrocytic stages of Plasmodium falciparum. Interestingly, we found that blocking parasite cell death influences their drug sensitivity, a result which could be used to create therapeutic strategies that by-pass drug resistance mechanisms by acting directly on the innate pathways of protozoan cell death.

  16. Kunitz-type protease inhibitors group B from Solanum palustre.

    PubMed

    Speransky, Anna S; Cimaglia, Fabio; Krinitsina, Anastasya A; Poltronieri, Palmiro; Fasano, Pasqua; Bogacheva, Anna M; Valueva, Tatiana A; Halterman, Dennis; Shevelev, Alexei B; Santino, Angelo

    2007-11-01

    Five Kunitz protease inhibitor group B genes were isolated from the genome of the diploid non-tuber-forming potato species Solanum palustre. Three of five new genes share 99% identity to the published KPI-B genes from various cultivated potato accessions, while others exhibit 96% identity. Spls-KPI-B2 and Spls-KPI-B4 proteins contain unique substitutions of the most conserved residues usually involved to trypsin and chymotrypsin-specific binding sites of Kunitz-type protease inhibitor (KPI)-B, respectively. To test the inhibition of trypsin and chymotrypsin by Spls-KPI proteins, five of them were produced in E. coli purified using a Ni-sepharose resin and ion-exchange chromatography. All recombinant Spls-KPI-B inhibited trypsin; K(i) values ranged from 84.8 (Spls-KPI-B4), 345.5 (Spls-KPI-B1), and 1310.6 nM (Spls-KPI-B2) to 3883.5 (Spls-KPI-B5) and 8370 nM (Spls-KPI-B3). In addition, Spls-KPI-B1 and Spls-KPI-B4 inhibited chymotrypsin. These data suggest that regardless of substitutions of key active-center residues both Spls-KPI-B4 and Spls-KPI-B1 are functional trypsin-chymotrypsin inhibitors.

  17. MOFzyme: Intrinsic protease-like activity of Cu-MOF

    NASA Astrophysics Data System (ADS)

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-01

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu2(C9H3O6)4/3 MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  18. Preliminary crystallographic analysis of avian infectious bronchitis virus main protease

    SciTech Connect

    Li, Jun; Shen, Wei; Liao, Ming; Bartlam, Mark

    2007-01-01

    The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed in Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.

  19. Sphingosine-induced apoptosis is dependent on lysosomal proteases.

    PubMed Central

    Kågedal, K; Zhao, M; Svensson, I; Brunk, U T

    2001-01-01

    We propose a new mechanism for sphingosine-induced apoptosis, involving relocation of lysosomal hydrolases to the cytosol. Owing to its lysosomotropic properties, sphingosine, which is also a detergent, especially when protonated, accumulates by proton trapping within the acidic vacuolar apparatus, where most of its action as a detergent would be exerted. When sphingosine was added in low-to-moderate concentrations to Jurkat and J774 cells, partial lysosomal rupture occurred dose-dependently, starting within a few minutes. This phenomenon preceded caspase activation, as well as changes of mitochondrial membrane potential. High sphingosine doses rapidly caused extensive lysosomal rupture and ensuing necrosis, without antecedent apoptosis or caspase activation. The sphingosine effect was prevented by pre-treatment with another, non-toxic, lysosomotropic base, ammonium chloride, at 10 mM. The lysosomal protease inhibitors, pepstatin A and epoxysuccinyl-L-leucylamido-3-methyl-butane ethyl ester ('E-64d'), inhibited markedly sphingosine-induced caspase activity to almost the same degree as the general caspase inhibitor benzyloxycarbonyl-Val-Ala-DL-Asp-fluoromethylketone ('Z-VAD-FMK'), although they did not by themselves inhibit caspases. We conclude that cathepsin D and one or more cysteine proteases, such as cathepsins B or L, are important mediators of sphingosine-induced apoptosis, working upstream of the caspase cascade and mitochondrial membrane-potential changes. PMID:11583579

  20. Recent patents on microbial proteases for the dairy industry.

    PubMed

    Feijoo-Siota, Lucía; Blasco, Lucía; Rodríguez-Rama, José Luis; Barros-Velázquez, Jorge; Miguel, Trinidad de; Sánchez-Pérez, Angeles; Villa, Tomás G

    2014-01-01

    This paper reviews the general characteristics of exo and endopeptidases of microbial origin currently used in the milk industry. It also includes recent patents developed either to potentiate the enzymatic activity or to improve the resulting milk derivatives. The main application of these proteases is in the cheese-making industry. Although this industry preferentially uses animal rennets, and in particular genetically engineered chymosins, it also utilizes milk coagulants of microbial origin. Enzymes derived from Rhizomucor miehei, Rhizomucor pusillus and Cryphonectria parasitica are currently used to replace the conventional milk-clotting enzymes. In addition, the dairy industry uses microbial endo and exoproteases for relatively new applications, such as debittering and flavor generation in cheese, accelerated cheese ripening, manufacture of protein hydrolysates with improved functional properties, and production of enzyme-modified cheeses. Lactic acid bacteria play an essential role in these processes, hence these bacteria and the proteases they produce are currently being investigated by the dairy industry and are the subject of many of their patent applications.

  1. The Early Years of Retroviral Protease Crystal Structures

    PubMed Central

    Miller, Maria

    2010-01-01

    Soon after its discovery, the attempts to develop anti-AIDS therapeutics focused on the retroviral protease (PR) — an enzyme used by lentiviruses to process the precursor polypeptide into mature viral proteins. An urgent need for the three-dimensional structure of PR to guide rational drug design prompted efforts to produce milligram quantities of this enzyme. However, only minute amounts of PR were present in the HIV-1 and HIV-2 viruses, and initial attempts to express this protein in bacteria were not successful. This review describes X-ray crystallographic studies of the retroviral proteases carried out at NCI-Frederick in the late 1980s and early 1990s and puts into perspective the crucial role that the total protein chemical synthesis played in unraveling the structure, mechanism of action, and inhibition of HIV-1 PR. Notably, the first fully correct structure of HIV-1 PR and the first cocrystal structure of its complex with an inhibitor (a substrate-derived, reduced isostere hexapeptide MVT-101) were determined using chemically synthesized protein. Most importantly, these sets of coordinates were made freely available to the research community and were used worldwide to solve X-ray structures of HIV-1 PR complexes with an array of inhibitors and set in motion a variety of theoretical studies. Publication of the structure of chemically synthesized HIV-1 PR complexed with MVT-101 preceded only by six years the approval of the first PR inhibitor as an anti-AIDS drug. PMID:20593466

  2. Design of HIV Protease Inhibitors Based on Inorganic Polyhedral Metallacarboranes

    SciTech Connect

    Rezacova, Pavlina; Pokorna, Jana; Brynda, Ji; Kozisek, Milan; Cigler, Petr; Lesik, Martin; Fanfrlik, Jindrich; Rezac, Jan; Saskova, Klara Grantz; Sieglova, Irena; Plesek, Jaromir; Sicha, Vaclav; Gruner, Bohumir; Oberwinkler, Heike; Sedlacek, Juraj; Krausslich, Hans-Georg; Hobza, Pavel; Kral, Vladimir; Konvalinka, Jan

    2010-04-19

    HIV protease (HIV PR) is a primary target for anti-HIV drug design. We have previously identified and characterized substituted metallacarboranes as a new class of HIV protease inhibitors. In a structure-guided drug design effort, we connected the two cobalt bis(dicarbollide) clusters with a linker to substituted ammonium group and obtained a set of compounds based on a lead formula [H{sub 2}N-(8-(C{sub 2}H{sub 4}O){sub 2}-1,2-C{sub 2}B{sub 9}H{sub 10})(1',2'-C{sub 2}B{sub 9}H{sub 11})-3,3'-Co){sub 2}]Na. We explored inhibition properties of these compounds with various substitutions, determined the HIV PR:inhibitor crystal structure, and computationally explored the conformational space of the linker. Our results prove the capacity of linker-substituted dual-cage cobalt bis(dicarbollides) as lead compounds for design of more potent inhibitors of HIV PR.

  3. MOFzyme: Intrinsic protease-like activity of Cu-MOF.

    PubMed

    Li, Bin; Chen, Daomei; Wang, Jiaqiang; Yan, Zhiying; Jiang, Liang; Deliang Duan; He, Jiao; Luo, Zhongrui; Zhang, Jinping; Yuan, Fagui

    2014-10-24

    The construction of efficient enzyme mimetics for the hydrolysis of peptide bonds in proteins is challenging due to the high stability of peptide bonds and the importance of proteases in biology and industry. Metal-organic frameworks (MOFs) consisting of infinite crystalline lattices with metal clusters and organic linkers may provide opportunities for protease mimic which has remained unknown. Herein, we report that Cu₂(C₉H₃O₆)₄/₃ MOF (which is well known as HKUST-1 and denoted as Cu-MOF here), possesses an intrinsic enzyme mimicking activity similar to that found in natural trypsin to bovine serum albumin (BSA) and casein. The Michaelis constant (Km) of Cu-MOF is about 26,000-fold smaller than that of free trypsin indicating a much higher affinity of BSA for Cu-MOF surface. Cu-MOF also exhibited significantly higher catalytic efficiency than homogeneous artificial metalloprotease Cu(II) complexes and could be reused for ten times without losing in its activity. Moreover, Cu-MOF was successfully used to simulate trypsinization in cell culture since it dissociated cells in culture even without EDTA.

  4. Extracellular trypsin-like proteases produced by Cordyceps militaris.

    PubMed

    Hattori, Maki; Isomura, Shigeki; Yokoyama, Eiji; Ujita, Minoru; Hara, Akira

    2005-12-01

    A trypsin-like protease, P-1-1, was purified from the culture supernatant of the fungus Cordyceps militaris by (NH(4))(2)SO(4) precipitation, chromatography on DEAE Bio-Gel Agarose, TSKgel CM-5PW, and gel-filtration with HiLoad 26/60 Superdex 75 pg, and its properties were examined. Purified P-1-1 showed a single band by SDS-PAGE and was estimated to have a molecular mass of 23,405 by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS). The optimum pH of the enzyme was between 8.5 and 12.0. It was inhibited strongly by leupeptin and diisopropyl fluorophosphate (DFP), and definitely did by N(alpha)-tosyl-L-lysine chloromethyl ketone hydrochloride (TLCK), phenylmethanesulfonyl fluoride (PMSF) and chymostatin. The carbonyl group sides of Arg and Lys were confirmed as the sites of cleavage by the enzyme toward cecropin B. These results indicate that P-1-1 is a trypsin-type serine protease. The N-terminal amino acid sequence of P-1-1 showed a high homology with those of trypsins or chymotrypsin derived from Diptera insects.

  5. Targeting the AKT pathway: Repositioning HIV protease inhibitors as radiosensitizers.

    PubMed

    Goda, Jayant S; Pachpor, Tejaswini; Basu, Trinanjan; Chopra, Supriya; Gota, Vikram

    2016-02-01

    Cellular resistance in tumour cells to different therapeutic approaches has been a limiting factor in the curative treatment of cancer. Resistance to therapeutic radiation is a common phenomenon which significantly reduces treatment options and impacts survival. One of the mechanisms of acquiring resistance to ionizing radiation is the overexpression or activation of various oncogenes like the EGFR (epidermal growth factor receptor), RAS (rat sarcoma) oncogene or loss of PTEN (phosphatase and tensin homologue) which in turn activates the phosphatidyl inositol 3-kinase/protein kinase B (PI3-K)/AKT pathway responsible for radiation resistance in various tumours. Blocking the pathway enhances the radiation response both in vitro and in vivo. Due to the differential activation of this pathway (constitutively activated in tumour cells and not in the normal host cells), it is an excellent candidate target for molecular targeted therapy to enhance radiation sensitivity. In this regard, HIV protease inhibitors (HPIs) known to interfere with PI3-K/AKT signaling in tumour cells, have been shown to sensitize various tumour cells to radiation both in vitro and in vivo. As a result, HPIs are now being investigated as possible radiosensitizers along with various chemotherapeutic drugs. This review describes the mechanisms by which PI3-K/AKT pathway causes radioresistance and the role of HIV protease inhibitors especially nelfinavir as a potential candidate drug to target the AKT pathway for overcoming radioresistance and its use in various clinical trials for different malignancies.

  6. Targeting the AKT pathway: Repositioning HIV protease inhibitors as radiosensitizers

    PubMed Central

    Goda, Jayant S.; Pachpor, Tejaswini; Basu, Trinanjan; Chopra, Supriya; Gota, Vikram

    2016-01-01

    Cellular resistance in tumour cells to different therapeutic approaches has been a limiting factor in the curative treatment of cancer. Resistance to therapeutic radiation is a common phenomenon which significantly reduces treatment options and impacts survival. One of the mechanisms of acquiring resistance to ionizing radiation is the overexpression or activation of various oncogenes like the EGFR (epidermal growth factor receptor), RAS (rat sarcoma) oncogene or loss of PTEN (phosphatase and tensin homologue) which in turn activates the phosphatidyl inositol 3-kinase/protein kinase B (PI3-K)/AKT pathway responsible for radiation resistance in various tumours. Blocking the pathway enhances the radiation response both in vitro and in vivo. Due to the differential activation of this pathway (constitutively activated in tumour cells and not in the normal host cells), it is an excellent candidate target for molecular targeted therapy to enhance radiation sensitivity. In this regard, HIV protease inhibitors (HPIs) known to interfere with PI3-K/AKT signaling in tumour cells, have been shown to sensitize various tumour cells to radiation both in vitro and in vivo. As a result, HPIs are now being investigated as possible radiosensitizers along with various chemotherapeutic drugs. This review describes the mechanisms by which PI3-K/AKT pathway causes radioresistance and the role of HIV protease inhibitors especially nelfinavir as a potential candidate drug to target the AKT pathway for overcoming radioresistance and its use in various clinical trials for different malignancies. PMID:27121513

  7. Botulinum neurotoxin devoid of receptor binding domain translocates active protease.

    PubMed

    Fischer, Audrey; Mushrush, Darren J; Lacy, D Borden; Montal, Mauricio

    2008-12-01

    Clostridium botulinum neurotoxin (BoNT) causes flaccid paralysis by disabling synaptic exocytosis. Intoxication requires the tri-modular protein to undergo conformational changes in response to pH and redox gradients across endosomes, leading to the formation of a protein-conducting channel. The approximately 50 kDa light chain (LC) protease is translocated into the cytosol by the approximately 100 kDa heavy chain (HC), which consists of two modules: the N-terminal translocation domain (TD) and the C-terminal Receptor Binding Domain (RBD). Here we exploited the BoNT modular design to identify the minimal requirements for channel activity and LC translocation in neurons. Using the combined detection of substrate proteolysis and single-channel currents, we showed that a di-modular protein consisting only of LC and TD was sufficient to translocate active protease into the cytosol of target cells. The RBD is dispensable for cell entry, channel activity, or LC translocation; however, it determined a pH threshold for channel formation. These findings indicate that, in addition to its individual functions, each module acts as a chaperone for the others, working in concert to achieve productive intoxication.

  8. Sparse Representation for Prediction of HIV-1 Protease Drug Resistance.

    PubMed

    Yu, Xiaxia; Weber, Irene T; Harrison, Robert W

    2013-01-01

    HIV rapidly evolves drug resistance in response to antiviral drugs used in AIDS therapy. Estimating the specific resistance of a given strain of HIV to individual drugs from sequence data has important benefits for both the therapy of individual patients and the development of novel drugs. We have developed an accurate classification method based on the sparse representation theory, and demonstrate that this method is highly effective with HIV-1 protease. The protease structure is represented using our newly proposed encoding method based on Delaunay triangulation, and combined with the mutated amino acid sequences of known drug-resistant strains to train a machine-learning algorithm both for classification and regression of drug-resistant mutations. An overall cross-validated classification accuracy of 97% is obtained when trained on a publically available data base of approximately 1.5×10(4) known sequences (Stanford HIV database http://hivdb.stanford.edu/cgi-bin/GenoPhenoDS.cgi). Resistance to four FDA approved drugs is computed and comparisons with other algorithms demonstrate that our method shows significant improvements in classification accuracy.

  9. Regulation of neurotoxin and protease formation in Clostridium botulinum Okra B and Hall A by arginine.

    PubMed Central

    Patterson-Curtis, S I; Johnson, E A

    1989-01-01

    Supplementation of a minimal medium with high levels of arginine (20 g/liter) markedly decreased neurotoxin titers and protease activities in cultures of Clostridium botulinum Okra B and Hall A. Nitrogenous nutrients that are known to be derived from arginine, including proline, glutamate, and ammonia, also decreased protease and toxin but less so than did arginine. Proteases synthesized during growth were rapidly inactivated after growth stopped in media containing high levels of arginine. Separation of extracellular proteins by electrophoresis and immunoblots with antibodies to toxin showed that the decrease in toxin titers in media containing high levels of arginine was caused by both reduced synthesis of protoxin and impaired proteolytic activation. In contrast, certain other nutritional conditions stimulated protease and toxin formation in C. botulinum and counteracted the repression by arginine. Supplementation of the minimal medium with casein or casein hydrolysates increased protease activities and toxin titers. Casein supplementation of a medium containing high levels of arginine prevented protease inactivation. High levels of glucose (50 g/liter) also delayed the inactivation of proteases in both the minimal medium and a medium containing high levels of arginine. These observations suggest that the availability of nitrogen and energy sources, particularly arginine, affects the production and proteolytic processing of toxins and proteases in C. botulinum. Images PMID:2669631

  10. Purification and characterization of Bacillus cereus protease suitable for detergent industry.

    PubMed

    Prakash, Monika; Banik, Rathindra Mohan; Koch-Brandt, Claudia

    2005-12-01

    An extracellular alkaline protease from an alkalophilic bacterium, Bacillus cereus, was produced in a large amount by the method of extractive fermentation. The protease is thermostable, pH tolerant, and compatible with commercial laundry detergents. The protease purified and characterized in this study was found to be superior to endogenous protease already present in commercial laundry detergents. The enzyme was purified to homogeneity by ammonium sulfate precipitation, concentration by ultrafiltration, anion-exchange chromatography, and gel filtration. The purified enzyme had a specific activity of 3256.05 U/mg and was found to be a monomeric protein with a molecular mass of 28 and 31 kDa, as estimated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and nondenaturing PAGE, respectively. Its maximum protease activity against casein was found to be at pH 10.5 and 50 degrees C. Proteolytic activity of the enzyme was detected by casein and gelatin zymography, which gave a very clear protease activity zone on gel that corresponded to the band obtained on SDS-PAGE and nondenaturing PAGE with a molecular mass of nearly 31 kDa. The purified enzyme was analyzed through matrix-assisted laser desorption ionization-time-of-flight-mass spectrometry (MALDI-TOF-MS) and identified as a subtilisin class of protease. Specific serine protease inhibitors, suggesting the presence of serine residues at the active site, inhibited the enzyme significantly.

  11. Biochemical analysis and investigation on the prospective applications of alkaline protease from a Bacillus cereus strain.

    PubMed

    Saleem, Mahjabeen; Rehman, Atiqa; Yasmin, Riffat; Munir, Bushra

    2012-06-01

    Proteases have prospective financial and environment-friendly applications; hence attention is focused currently on the finding of new protease producing microorganism so as to meet the requirements of industry. A thermophilic bacterial strain producing extracellular protease activity was isolated from soil and identified as Bacillus cereus by analysis of 16S rRNA. Protease production by the microorganism was improved by studying the impact of the type of nitrogen and carbon source, fermentation period, growth temperature and initial pH of the culture medium in cultivation optimization experiments. The enzyme was purified to homogeneity in two step procedure involving Sephadex G-75 and Q-Sepharose chromatography. The molecular weight of purified enzyme was found to be 58 kDa by SDS-PAGE. Protease exhibited a pH and temperature optima of 7.5 and 60°, respectively. The enzyme was active in the pH range of 6.0-9.0 and stable up to 70°C. Histological analysis of protease treated goat and cow skin pelts showed complete removal of non leather forming structures such as hair shaft, hair follicles and glandular structures. The protease showed the stain removing property from blood stained cotton cloth and found to be compatible with six commercially available detergents. The protease could release peptides from natural proteins after digestion of coagulated egg albumin and blood clot.

  12. Discovery of MK-8718, an HIV Protease Inhibitor Containing a Novel Morpholine Aspartate Binding Group.

    PubMed

    Bungard, Christopher J; Williams, Peter D; Ballard, Jeanine E; Bennett, David J; Beaulieu, Christian; Bahnck-Teets, Carolyn; Carroll, Steve S; Chang, Ronald K; Dubost, David C; Fay, John F; Diamond, Tracy L; Greshock, Thomas J; Hao, Li; Holloway, M Katharine; Felock, Peter J; Gesell, Jennifer J; Su, Hua-Poo; Manikowski, Jesse J; McKay, Daniel J; Miller, Mike; Min, Xu; Molinaro, Carmela; Moradei, Oscar M; Nantermet, Philippe G; Nadeau, Christian; Sanchez, Rosa I; Satyanarayana, Tummanapalli; Shipe, William D; Singh, Sanjay K; Truong, Vouy Linh; Vijayasaradhi, Sivalenka; Wiscount, Catherine M; Vacca, Joseph P; Crane, Sheldon N; McCauley, John A

    2016-07-14

    A novel HIV protease inhibitor was designed using a morpholine core as the aspartate binding group. Analysis of the crystal structure of the initial lead bound to HIV protease enabled optimization of enzyme potency and antiviral activity. This afforded a series of potent orally bioavailable inhibitors of which MK-8718 was identified as a compound with a favorable overall profile.

  13. Crystal Structure of a Novel Viral Protease with a Serine/Lysine Catalytic Dyad Mechanism

    SciTech Connect

    Feldman,A.; Lee, J.; Delmas, B.; Paetzel, M.

    2006-01-01

    The blotched snakehead virus (BSNV), an aquatic birnavirus, encodes a polyprotein (NH2-pVP2-X-VP4-VP3-COOH) that is processed through the proteolytic activity of its own protease (VP4) to liberate itself and the viral proteins pVP2, X and VP3.