Sample records for a1298c mtr a2756g

  1. Influence of Combined Methionine Synthase (MTR 2756A > G) and Methylenetetrahydrofolate Reductase (MTHFR 677C > T) Polymorphisms to Plasma Homocysteine Levels in Korean Patients with Ischemic Stroke

    PubMed Central

    Kim, Ok Joon; Hong, Sun Pyo; Ahn, Jung Yong; Hong, Seung Ho; Hwang, Tae Sun; Kim, Soo Ok; Yoo, Wangdon; Oh, Doyeun

    2007-01-01

    Purpose Methionine synthase (MTR) and 5,10-methylenetetrahydrofolate reductase (MTHFR) are the main regulatory enzymes for homocysteine metabolism. The present case-control study was conducted to determine whether there is an association between the MTR 2756A > G or MTHFR 677C > T polymorphism and plasma homocysteine concentration in Korean subjects with ischemic stroke. Materials and Methods DNA samples of 237 patients who had an ischemic stroke and 223 age and sex-matched controls were studied. MTR 2756A > G and MTHFR 677C > T genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results Frequencies of mutant alleles for MTR and MTHFR polymorphisms were not significantly different between the controls and cases. The patient group, however, had significantly higher homocysteine concentrations of the MTR 2756AA and MTHFR 677TT genotypes than the control group (p = 0.04 for MTR, p = 0.01 for MTHFR). The combined MTR 2756AA and MTHFR 677TT genotype (p = 0.04) and the homocysteine concentrations of the patient group were also higher than those of the controls. In addition, the genotype distribution was significant in the MTHFR 677TT genotype (p = 0.008) and combined MTR 2756AA and MTHFR 677TT genotype (p = 0.03), which divided the groups into the top 20% and bottom 20% based on their homocysteine levels. Conclusion The results of the present study demonstrate that the MTR 2756A > G and MTHFR 677C > T polymorphisms interact with elevated total homocysteine (tHcy) levels, leading to an increased risk of ischemic stroke. PMID:17461517

  2. Association between MTHFR 1298A>C polymorphism and spontaneous abortion with fetal chromosomal aneuploidy.

    PubMed

    Kim, Shin Young; Park, So Yeon; Choi, Ji Won; Kim, Do Jin; Lee, Shin Yeong; Lim, Ji Hyae; Han, Jung Yeol; Ryu, Hyun Mee; Kim, Min Hyoung

    2011-10-01

    PROBLEM  Polymorphisms in genes involved in folate metabolism are commonly associated with defects in folate-dependent homocysteine metabolism, which can result in DNA hypomethylation and chromosome nondisjunction. This prospective study aimed to investigate the associations between MTHFR 677C>T, MTHFR 1298A>C, MTR 2756A>G, MTRR 66A>G, and CBS 844ins68 polymorphisms and spontaneous abortion (SA) with fetal chromosomal aneuploidy. METHOD OF STUDY  Subjects included 33 SA with normal fetal karyotype, 24 SA with fetal chromosomal aneuploidy and 155 normal controls. Polymorphisms were genotyped by PCR-RFLP and QF-PCR analysis. RESULTS  The frequencies of MTHFR 1298AC and combined 1298AC/CC genotypes were higher in SA with fetal chromosomal aneuploidy than in controls. The 1298C allele frequency was also significantly higher in SA with fetal chromosomal aneuploidy than in controls. Moreover, the 1298C allele frequency was higher in SA with fetal chromosomal aneuploidy than in SA with normal fetal karyotype. The combined 1298AC/CC genotype was significantly associated with the risk of SA with fetal chromosomal aneuploidy compared with that of the 1298AA genotype (adjusted OR = 2.93, 95% CI: 1.11-7.69). There was no association between SA with fetal chromosomal aneuploidy and other polymorphisms. CONCLUSIONS  Our findings indicate that MTHFR 1298A>C polymorphism may be an independent risk factor for SA with fetal chromosomal aneuploidy. © 2011 John Wiley & Sons A/S.

  3. Association between decreased vitamin levels and MTHFR, MTR and MTRR gene polymorphisms as determinants for elevated total homocysteine concentrations in pregnant women.

    PubMed

    Barbosa, P R; Stabler, S P; Machado, A L K; Braga, R C; Hirata, R D C; Hirata, M H; Sampaio-Neto, L F; Allen, R H; Guerra-Shinohara, E M

    2008-08-01

    To examine the association between methylenetetrahydrofolate reductase (MTHFR) (C677T and A1298C), methionine synthase (MTR) A2756G and methionine synthase reductase (MTRR) A66G gene polymorphisms and total homocysteine (tHcy), methylmalonic acid (MMA) and S-adenosylmethionine/S-adenosylhomocysteine (SAM/SAH) levels; and to evaluate the potential interactions with folate or cobalamin (Cbl) status. Two hundred seventy-five healthy women at labor who delivered full-term normal babies. Cbl, folate, tHcy, MMA, SAM and SAH were measured in serum specimens. The genotypes for polymorphisms were determined by PCR-restriction fragment length polymorphism (RFLP). Serum folate, MTHFR 677T allele and MTR 2756AA genotypes were the predictors of tHcy levels in pregnant women. Serum Cbl and creatinine were the predictors of SAM/SAH ratio and MMA levels, respectively. The gene polymorphisms were not determinants for MMA levels and SAM/SAH ratios. Low levels of serum folate were associated with elevated tHcy in pregnant women, independently of the gene polymorphisms. In pregnant women carrying MTHFR 677T allele, or MTHFR 1298AA or MTRR 66AA genotypes, lower Cbl levels were associated with higher levels of tHcy. Lower SAM/SAH ratio was found in MTHFR 677CC or MTRR A2756AA genotypes carriers when Cbl levels were lower than 142 pmol/l. Serum folate and MTHFR C677T and MTR A2576G gene polymorphisms were the determinants for tHcy levels. The interaction between low levels of serum Cbl and MTHFR (C677T or A1298C) or MTRR A66G gene polymorphisms was associated with increased tHcy.

  4. Synergistic effect of methyltetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphism as risk modifiers of pediatric acute lymphoblastic leukemia.

    PubMed

    Kamel, Azza M; Moussa, Heba S; Ebid, Gamal T; Bu, Rong R; Bhatia, Kishor G

    2007-06-01

    ALL is the most common pediatric cancer. The causes of the majority of pediatric acute leukemia are unknown and are likely to involve an interaction between genetic and environmental factors. Therefore, unfavourable gene-environmental interactions might be involved in the genesis of ALL. The aim of this work was to evaluate, in a case-control study, whether the common polymorphisms in 5, 10-methylenetetrahydrofolate reductase (MTHFR) namely (C677T and A1298C) and methionine synthase (MS) (A2756G) genes may play a role in altering susceptibility to pediatric ALL as individual genes and in combination. DNA of 88 ALL patients (age < or = 18 years) and 311 healthy control subjects was analyzed for the polymorphisms of MTHFR and MS genes using PCR-RFLP method. The frequencies of the wild types of MTHFR 677CC, MTHFR 1298AA and MS 2756AA, the homozygous genotypes of MTHFR 677TT, MTHFR 1298CC and MS 2756GG and heterozygous genotypes of MTHFR 677CT and MS 2756AG showed no statistically significant differences between patients and controls. The frequency of the MTHFR 1298AC heterozygous genotype was 25% among patients compared to 45.0% among controls; the difference was found to be statistically significant (p value =0.001, O.R=0.382 & 95% C.I=0.222-0.658). The frequency of the MTHFR1298AC heterozygous genotype plus 1298CC homozygous genotype was 34% among patients compared to 54.3% among controls and the difference was statistically significant (p value =0.001). A synergistic effect of 677CT and1298AC (CTAC) was observed, (p value=0.002) with 3.65 fold protection (OR 0.273 & 95% C.I=0.155-0.9) compared to 2.6 folds for MTHFR 1298AC alone. This protective effect of CTAC polymorphism was abolished when combined with MS 2756AA or AG. The present study provided further evidence for the protective role of MTHFR 1298AC mutant alleles in acute lymphoblastic leukemia in children (2.6 fold protection). This suggests that folate and methionine metabolism play an important role in the

  5. Lack of association between methionine synthase A2756G polymorphism and digestive system cancer risk: evidence from 3,9327 subjects.

    PubMed

    Zhao, Yuan; Chen, Zixian; Ma, Yushui; Xia, Qing; Zhang, Feng; Fu, Da; Wang, Xiao-Feng

    2013-01-01

    Polymorphisms in genes involved in the metabolism of folate and methyl groups have been implicated with risk of digestive system cancer. Methionine synthase (MTR) plays a central role in folate metabolism, thereby affecting DNA methylation. The association between A2756G polymorphism (rs1805087) in MTR and digestive system cancer susceptibility was inconsistent in previous studies. To investigate this inconsistency, we performed this meta-analysis. Databases including Pubmed, EMBASE, ISI Web of Science and China National Knowledge Infrastructure (CNKI) were searched to find relevant studies. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to assess the strength of association. Potential sources of heterogeneity were also assessed by subgroup analysis and meta-regression. A total of 29 articles with 15,368 patients and 23,959 controls were included. We found no association between MTR A2756G polymorphism and digestive system cancer in overall population (G allele: OR = 1.03, 95% CI = 0.98-1.09, P = 0.25; dominant model: OR = 1.03, 95% CI = 0.97-1.10, P = 0.33; recessive model: OR = 1.02, 95% CI = 0.89-1.17, P = 0.79). In the stratified analyses according to cancer type, sample size and genotyping method, no evidence of any gene-disease association was obtained in almost all genetic models. However, marginal significant associations were found for East Asians and hospital-based studies. This meta-analysis suggests that there is no significant association between the MTR A2756G polymorphism and digestive system cancer risk.

  6. Methionine Synthase A2756G Polymorphism and Risk of Colorectal Adenoma and Cancer: Evidence Based on 27 Studies

    PubMed Central

    Jiang, Xun; Lu, Lie-sheng

    2013-01-01

    Methionine synthase (MTR), which plays a central role in maintaining adequate intracellular folate, methionine and normal homocysteine concentrations, was thought to be involved in the development of colorectal cancer (CRC) and colorectal adenoma (CRA) by affecting DNA methylation. However, studies on the association between MTR A2756G polymorphism and CRC/CRA remain conflicting. We conducted a meta-analysis of 27 studies, including 13465 cases and 20430 controls for CRC, and 4844 cases and 11743 controls for CRA. Potential sources of heterogeneity and publication bias were also systematically explored. Overall, the summary odds ratio of G variant for CRC was 1.03 (95% CI: 0.96–1.09) and 1.05 (95% CI: 0.99–1.12) for CRA. No significant results were observed in heterozygous and homozygous when compared with wild genotype for these polymorphisms. In the stratified analyses according to ethnicity, source of controls, sample size, sex, and tumor site, no evidence of any gene-disease association was obtained. Results from the meta-analysis of four studies on MTR stratified according to smoking and alcohol drinking status showed an increased CRC risk in heavy smokers (OR = 2.06, 95% CI: 1.32–3.20) and heavy drinkers (OR = 2.00, 95% CI: 1.28–3.09) for G allele carriers. This meta-analysis suggests that the MTR A2756G polymorphism is not associated with CRC/CRA susceptibility and that gene-environment interaction may exist. PMID:23593229

  7. Role of genetic mutations in folate-related enzyme genes on Male Infertility

    PubMed Central

    Liu, Kang; Zhao, Ruizhe; Shen, Min; Ye, Jiaxin; Li, Xiao; Huang, Yuan; Hua, Lixin; Wang, Zengjun; Li, Jie

    2015-01-01

    Several studies showed that the genetic mutations in the folate-related enzyme genes might be associated with male infertility; however, the results were still inconsistent. We performed a meta-analysis with trial sequential analysis to investigate the associations between the MTHFR C677T, MTHFR A1298C, MTR A2756G, MTRR A66G mutations and the MTHFR haplotype with the risk of male infertility. Overall, a total of 37 studies were selected. Our meta-analysis showed that the MTHFR C677T mutation was a risk factor for male infertility in both azoospermia and oligoasthenoteratozoospermia patients, especially in Asian population. Men carrying the MTHFR TC haplotype were most liable to suffer infertility while those with CC haplotype had lowest risk. On the other hand, the MTHFR A1298C mutation was not related to male infertility. MTR A2756G and MTRR A66G were potential candidates in the pathogenesis of male infertility, but more case-control studies were required to avoid false-positive outcomes. All of these results were confirmed by the trial sequential analysis. Finally, our meta-analysis with trial sequential analysis proved that the genetic mutations in the folate-related enzyme genes played a significant role in male infertility. PMID:26549413

  8. Evaluation of Factor V Leiden, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C gene polymorphisms in retinopathy of prematurity in a Turkish cohort.

    PubMed

    Aydin, Hatip; Gunay, Murat; Celik, Gokhan; Gunay, Betul Onal; Aydin, Umeyye Taka; Karaman, Ali

    2016-12-01

    To assess Factor V Leiden (FVL) (rs6025), Prothrombin G20210A (rs1799963), MTHFR C677T (rs1801133), and MTHFR A1298C (rs1801131) gene mutations as risk factors in the development of retinopathy of prematurity (ROP). A total of 105 children were included in this cross-sectional study. Patients were divided into two groups. The study group consisted of 55 infants with a history of ROP and the control group comprised 50 healthy infants with term birth. All subjects were screened for the presence of certain mutations (FVL, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C) by Real-Time PCR at 1 year of age. The mean gestational age (GA) and birth weight (BW) of the study group were, 28.65 ± 2.85 weeks and 1171 ± 385.74 g, respectively. There were no significant differences of genotype and allele frequency of Prothrombin G20210A, MTHFR A1298C and MTHFR C677T between the study and control groups (p > 0.05). Eight children (14.5 %) had heterozygous and one child (1.8%) had homozygous FVL mutation in the study group. One child (2%) in the control group had heterozygous FVL mutation. There was statistically significant differences of FVL allele and genotype frequencies between the groups (p < 0.05). The prevalence of FVL polymorphism (16.3 %) was higher in ROP patients than control subjects in this Turkish cohort. We suggest a possible association of FVL mutation with ROP at the end of the study.

  9. Correlation between the NPPB gene promoter c.-1298 G/T polymorphism site and pulse pressure in the Chinese Han population.

    PubMed

    Zeng, K; Wu, X D; Cai, H D; Gao, Y G; Li, G; Liu, Q C; Gao, F; Chen, J H; Lin, C Z

    2014-04-29

    The aim of this study was to investigate the correlation between the natriuretic peptide precursor B (NPPB) gene single nucleotide polymorphism (SNP) c.-1298 G/T and pulse pressure (PP) of the Chinese Han population and the association between genotype and clinical indicators of hypertension. Peripheral blood was collected from 180 unrelated patients with hypertension and 540 healthy volunteers (control group), and DNA was extracted to amplify the 5'-flanking region and 2 exons of the NPPB gene by polymerase chain reaction; the fragment was sequenced after purification. The clinical data of all subjects were recorded, the distribution of the NPPB gene c.-1298 G/T polymorphism was determined, and differences in clinical indicators between the two groups were evaluated. The mean arterial pressure PP, and creatinine levels were significantly higher in the hypertension group than in the control group (P<0.05), but no other clinical indicators differed between the groups. There were no significant differences in genotype frequency and distribution of the NPPB gene c.-1298 G/T polymorphism between the hypertension group and the control group (P>0.05); in the control group, the mean PP of individuals with the SNP c.-1298 GG genotype was greater than that of individuals with the GT+TT genotype (P<0.05). In conclusion, there was no significant correlation between the NPPB gene c.-1298 G/T polymorphism and the incidence of essential hypertension in the Han population; however, the PP of the SNP c.-1298 GG genotype was greater than that of the GT+TT genotype in the control group.

  10. Prevalence of MTHFR C677T and MS A2756G polymorphisms in major depressive disorder, and their impact on response to fluoxetine treatment

    USDA-ARS?s Scientific Manuscript database

    To examine the prevalence of the C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene and the A2756G polymorphism of methionine synthase (MS), and their impact on antidepressant response. We screened 224 subjects (52% female, mean age 39 +/- 11 years) with SCID-diagnosed major...

  11. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    PubMed Central

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  12. The association of polymorphisms in folate-metabolizing genes with response to adjuvant chemotherapy of colorectal cancer.

    PubMed

    Yousef, Al-Motassem; Zawiah, Mohammed; Al-Yacoub, Shorouq; Kadi, Taha; Tantawi, Dua' A; Al-Ramadhani, Hanguin

    2018-05-29

    Colorectal cancer (CRC) is one of the major health issues worldwide. 5-Fluorouracil (5-FU) is a cornerstone of chemotherapy for CRC and the major targets of 5-FU are folate-metabolizing enzymes. A total of 103 CRC patients with complete clinical data were included in this prospective cohort study. Genotyping was performed using polymerase chain reaction (PCR) followed by sequencing. Using Kaplan-Meier curves, log-rank tests, and Cox proportional hazard models, we evaluated associations between functional polymorphisms in four genes MTHFR (1298A>C and 677C>T), DPYD (496A>G and 85T>C), DHFR 19 bp del, and MTR (2756 A>G) with disease-free survival (DFS). The minor allele frequencies of MTHFR 1298A>C, MTHFR 677C>T, DPYD 496A>G, DPYD 85T>C, DHFR 19 bp del, and MTR 2756 A>G were 0.364, 0.214, 0.116, 0.209, 0.383, and 0.097, respectively. CRC patients carrying the homozygous GG genotype in DPYD 496A>G had 4.36 times shorter DFS than wild-type AA carriers, (DFS GG vs AA : 8.0 ± 4 vs 69.0 ± 10 months; HR 4.36, 95% CI 1.04-18; p = 0.04). Moreover, female carriers of homozygous CC genotype of DPYD 85T>C had shorter DFS compared to either heterozygous or wild-type genotypes, and were 12.7 times shorter than wild-type TT carriers (DFS CC vs TT : 5.0 ± 1.5 vs 42.0 ± 7.6 months; HR 12.7, 95% CI 2.2-71.4; p = 0.004). However, there were no significant associations with the other studied polymorphisms. Genetic polymorphism in DPYD seems to be associated with DFS in CRC patients receiving an adjuvant regimen of 5-FU/capecitabine-based chemotherapy. Further studies are needed to verify these findings.

  13. Methylenetetrahydrofolate reductase A1298C genetic variant& risk of schizophrenia: A meta-analysis.

    PubMed

    Rai, Vandana; Yadav, Upendra; Kumar, Pradeep; Yadav, Sushil K; Gupta, Sanjay

    2017-04-01

    Methylenetetrahydrofolate reductase (MTHFR) is an important enzyme of folate metabolism, whose role in schizophrenia is debatable. Numerous case-control studies have investigated the association of MTHFR A1298C polymorphism with schizophrenia, but results are controversial. The aim of the present study was to find the association between MTHFR A1298C gene polymorphism and schizophrenia. PubMed, Google Scholar, Science Direct and Springer link databases were searched for case-control association studies in which MTHFR A1298C polymorphism was investigated as a risk factor for schizophrenia. In all, 19 studies with 4049 cases and 5488 controls were included in this meta-analysis. Odds ratios (ORs) with 95 per cent confidence intervals (CIs) were used as an association measure. The results of meta-analysis reported a significant association between A1298C polymorphism and schizophrenia risk in overall comparisons in all genetic models (C vs. A: OR=1.13, 95% CI=1.01-1.27, P=0.02; CC vs. AA: OR=1.20, 95% CI=1.03-1.39, P=0.02; AC vs. AA: OR=1.13, 95% CI=1.03-1.23, P=0.009; AC+CC vs. AA: OR=1.14, 95% CI=1.02-1.24, P=0.002; CC vs. AA+AC: OR=1.17, 95% CI=1.01-1.35, P=0.04). MTHFR A1298C polymorphism was found to be a risk factor for schizophrenia and might have played a significant role in the pathogenesis of schizophrenia.

  14. Methylenetetrahydrofolate reductase A1298C genetic variant & risk of schizophrenia: A meta-analysis

    PubMed Central

    Rai, Vandana; Yadav, Upendra; Kumar, Pradeep; Yadav, Sushil K.; Gupta, Sanjay

    2017-01-01

    Background & objectives: Methylenetetrahydrofolate reductase (MTHFR) is an important enzyme of folate metabolism, whose role in schizophrenia is debatable. Numerous case-control studies have investigated the association of MTHFR A1298C polymorphism with schizophrenia, but results are controversial. The aim of the present study was to find the association between MTHFR A1298C gene polymorphism and schizophrenia. Methods: PubMed, Google Scholar, Science Direct and Springer link databases were searched for case-control association studies in which MTHFR A1298C polymorphism was investigated as a risk factor for schizophrenia. In all, 19 studies with 4049 cases and 5488 controls were included in this meta-analysis. Odds ratios (ORs) with 95 per cent confidence intervals (CIs) were used as an association measure. Results: The results of meta-analysis reported a significant association between A1298C polymorphism and schizophrenia risk in overall comparisons in all genetic models (C vs. A: OR=1.13, 95% CI=1.01-1.27, P=0.02; CC vs. AA: OR=1.20, 95% CI=1.03-1.39, P=0.02; AC vs. AA: OR=1.13, 95% CI=1.03-1.23, P=0.009; AC+CC vs. AA: OR=1.14, 95% CI=1.02-1.24, P=0.002; CC vs. AA+AC: OR=1.17, 95% CI=1.01-1.35, P=0.04). Interpretation & conclusions: MTHFR A1298C polymorphism was found to be a risk factor for schizophrenia and might have played a significant role in the pathogenesis of schizophrenia. PMID:28862175

  15. Association between MTHFR A1298C polymorphism and male infertility: A meta-analysis.

    PubMed

    Zhang, Qiang; Yin, Guo-Ying; Liu, Juan; Liang, Yue; Li, Yao-Yan; Zhao, Jing-Yu; Zhang, Li-Wen; Wang, Bai-Qi; Tang, Nai-Jun

    2017-04-01

    There have been several epidemiological studies evaluating the potential association between the methylenetetrahydrofolate reductase (MTHFR) A1298C polymorphism and the risk of male infertility. However, the results obtained were inconsistent. Therefore, we performed a meta-analysis to further examine the association between the MTHFR A1298C polymorphism and male infertility. A comprehensive search was conducted to identify all eligible studies from the online literature databases published prior to January 15th, 2016. A total of 20 studies with 4293 cases and 4507 controls were included. An odds ratio (OR) and a 95% confidence interval (95% CI) were calculated to assess the strength of the association. A cumulative meta-analysis, sensitivity analysis and assessment of the publication bias were also performed in this study. The results showed that in the overall analysis, the association between the MTHFR A1298C polymorphism and male infertility was not significant. A stratified analysis by ethnicity revealed a significant increase in the risk of male infertility in the Asian population with the MTHFR A1298C polymorphism (especially in the heterozygote model: OR=1.20, 95% CI=1.01-1.44, P=0.994; the dominant model: OR=1.23, 95% CI=1.04-1.45, P=0.996; and the allele model: OR=1.20, 95% CI=1.04-1.39, P=0.985) but not in the Caucasian population. In the stratified analyses, no significant association was observed between the different types of male infertility. This meta-analysis suggests the MTHFR A1298C polymorphism may be a potential risk factor for male infertility, especially in the Asian population.

  16. MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt.

    PubMed

    Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR=2.513, 95% CI: 0.722-4.086, P=0.025). No such association was shown for heterozygous 677CT (OR=1.010, 95% CI: 0.460-2.218, P=0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR=1.1816, 95% CI: 0.952-3.573, P=0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR=1.046, 95% CI: 0.740-1.759, P=0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR=1.849, 95% CI: 0.935-2.540, P=0.024; OR=1.915, 95% CI: 1.202-3.845, P=0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P=0.001, P=0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy.

  17. MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt

    PubMed Central

    Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR = 2.513, 95% CI: 0.722-4.086, P = 0.025). No such association was shown for heterozygous 677CT (OR = 1.010, 95% CI: 0.460-2.218, P = 0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR = 1.1816, 95% CI: 0.952-3.573, P = 0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR = 1.046, 95% CI: 0.740-1.759, P = 0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR = 1.849, 95% CI: 0.935-2.540, P = 0.024; OR = 1.915, 95% CI: 1.202-3.845, P = 0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P = 0.001, P = 0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy. PMID:24966971

  18. Analysis of Structural MtrC Models Based on Homology with the Crystal Structure of MtrF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Edwards, Marcus; Fredrickson, Jim K.; Zachara, John M.

    2012-12-01

    The outer-membrane decahaem cytochrome MtrC is part of the transmembrane MtrCAB complex required for mineral respiration by Shewanella oneidensis. MtrC has significant sequence similarity to the paralogous decahaem cytochrome MtrF, which has been structurally solved through X-ray crystallography. This now allows for homology-based models of MtrC to be generated. The structure of these MtrC homology models contain ten bis-histidine-co-ordinated c-type haems arranged in a staggered cross through a four-domain structure. This model is consistent with current spectroscopic data and shows that the areas around haem 5 and haem 10, at the termini of an octahaem chain, are likely to havemore » functions similar to those of the corresponding haems in MtrF. The electrostatic surfaces around haem 7, close to the β-barrels, are different in MtrF and MtrC, indicating that these haems may have different potentials and interact with substrates differently.« less

  19. Coexistence of the 677C>T and 1298A>C MTHFR polymorphisms and its significance in the population of Polish women.

    PubMed

    Wolski, Hubert; Kocięcka, Maria; Mrozikiewicz, Aleksandra E; Barlik, Magdalena; Kurzawińska, Grażyna

    2015-10-01

    The aim of the study was to evaluate the frequency of the 677C>T and 1298A>C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene, as well as the coexistence of both these genetic variants in women from the Polish population. A total of 662 women from the Polish population were enrolled in the study group. The frequency of the investigated genotypes of the 677C>T and 1298A>C polymorphisms of the MTHFR gene was analyzed with the use of PCR/RFLP methods. The frequency of the 677CC, 677CT and 677TT genotypes in the studied population of women was 50.60%, 39.88% and 9.52%, respectively As to the 1298AA, 1298AC and 1298CC genotypes, the obtained results were as follows: 42.75%, 47.88% and 9.37%, respectively (Tables II and III). Simultaneous analysis revealed the most frequent coexistence of 677CC/1298AC (28.85%), 677CT/1298AA (20.85%) and 677CT/1298AC (19.03%) genotypes. The coexistence of 677CC/1298AA (12.39%), 677CC/1298CC (9.37%) and 677TT/1298AA (9.51%) genotypes was observed less frequently In the studied population of Polish women, the coexistence of 677CT/1298CC, 677TT/1298AC and 677TT/1298CC genotypes has been not observed. The frequency and coexistence of genotypes of the 677C>T and 1298A>C MTHFR gene polymorphisms in the studied population of Polish women is similar to other North-European populations. Women carriers of the mutated variants of both, 677C>T and 1298A>C polymorphisms of the MTHFR gene should receive special perinatal care in order to prevent fetal defects and thrombosis-related complications during pregnancy It is vital to emphasize the significance of proper education of folate supplementation, especially in pregnant patients and women of reproductive age.

  20. Effects of Maternal 5,10-Methylenetetrahydrofolate Reductase C677T and A1298C Polymorphisms and Tobacco Smoking on Infant Birth Weight in a Japanese Population

    PubMed Central

    Yila, Thamar Ayo; Sasaki, Seiko; Miyashita, Chihiro; Braimoh, Titilola Serifat; Kashino, Ikuko; Kobayashi, Sumitaka; Okada, Emiko; Baba, Toshiaki; Yoshioka, Eiji; Minakami, Hisanori; Endo, Toshiaki; Sengoku, Kazuo; Kishi, Reiko

    2012-01-01

    Background Intracellular folate hemostasis depends on the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. Because 5,10-MTHFR 677TT homozygosity and tobacco smoking are associated with low folate status, we tested the hypothesis that smoking in mothers with 5,10-MTHFR C677T or A1298C polymorphisms would be independently associated with lower birth weight among their offspring. Methods We assessed 1784 native Japanese mother-child pairs drawn from the ongoing birth cohort of The Hokkaido Study on Environment and Children’s Health. Data (demographic information, hospital birth records, and biological specimens) were extracted from recruitments that took place during the period from February 2003 to March 2006. Maternal serum folate were assayed by chemiluminescent immunoassay, and genotyping of 5,10-MTHFR C677T/A1298C polymorphisms was done using a TaqMan allelic discrimination assay. Results The prevalence of folate deficiency (<6.8 nmol/L) was 0.3%. The 5,10-MTHFR 677CT genotype was independently associated with an increase of 36.40 g (95% CI: 2.60 to 70.30, P = 0.035) in mean infant birth weight and an increase of 90.70 g (95% CI: 6.00 to 175.50, P = 0.036) among male infants of nonsmokers. Female infants of 677TT homozygous passive smokers were 99.00 g (95% CI: −190.26 to −7.56, P = 0.034) lighter. The birth weight of the offspring of smokers with 5,10-MTHFR 1298AA homozygosity was lower by 107.00 g (95% CI: −180.00 to −33.90, P = 0.004). Conclusions The results suggest that, in this population, maternal 5,10-MTHFR C677T polymorphism, but not the 5,10-MTHFR A1298C variant, is independently associated with improvement in infant birth weight, especially among nonsmokers. However, 5,10-MTHFR 1298AA might be associated with folate impairment and could interact with tobacco smoke to further decrease birth weight. PMID:22277790

  1. Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and susceptibility to acute lymphoblastic leukemia in a cohort of Egyptian children.

    PubMed

    Mosaad, Youssef M; Abousamra, Nashwa K; Elashery, Rasha; Fawzy, Iman M; Eldein, Omar A Sharaf; Sherief, Doaa M; El Azab, Hend M M

    2015-01-01

    This case-control study was planned to investigate the possible role of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms as a risk factor for the development of acute lymphoblastic leukemia (ALL) in a cohort of Egyptian children. Typing of MTHFR C677T and A1298C polymorphisms was done using restriction fragment length polymorphism (RFLP) for 100 children with ALL and 100 age- and sex-matched healthy controls. No significant differences were found between patients with ALL and controls for the frequency of MTHFR C677T and A1298C alleles, genotypes, combined genotypes or haplotypes. The C677T and A1298C genotype frequency was different from that in Korean and Chinese populations (p < 0.5) and was similar to that in British, French-Canadian and German-Caucasian populations (p > 0.5). Our findings suggest that MTHFR C677T and A1298C polymorphisms are unlikely to affect the development of childhood ALL in an Egyptian population from Delta.

  2. Spectrum of MTHFR gene SNPs C677T and A1298C: a study among 23 population groups of India.

    PubMed

    Saraswathy, Kallur Nava; Asghar, Mohammad; Samtani, Ratika; Murry, Benrithung; Mondal, Prakash Ranjan; Ghosh, Pradeep Kumar; Sachdeva, Mohinder Pal

    2012-04-01

    Elevated homocysteine is a risk factor for many complex disorders. The role of methylenetetrahydrofolate reductase (MTHFR) gene in methylation of homocysteine makes it one of the most important candidate genes for these disorders. Considering the heterogeneity in its distribution in world populations, we screened MTHFR C677T and A1298C single nucleotide polymorphisms in a total of 23 Indian caste, tribal and religious population groups from five geographical regions of India and belonging to four major linguistic groups. The frequencies of MTHFR 677T and 1298C alleles were found to be 10.08 and 20.66%, respectively. MTHFR homozygous genotype 677TT was absent in eight population groups and homozygous 1298CC was absent in two population groups. 677T allele was found to be highest among north Indian populations with Indo-European tongue and 1298C was high among Dravidian-speaking tribes of east India and south India. The less common mutant haplotype 677T-1298C was observed among seven population groups and overall the frequency of this haplotype was 0.008, which is similar to that of African populations. cis configuration of 677T and 1298C was 0.94%. However, we could not find any individual with four mutant alleles which supports the earlier observation that presence of more than two mutant alleles may decrease the viability of foetus and possibly be a selective disadvantage in the population.

  3. Genetic variation in the folate metabolic pathway and risk of childhood leukemia

    PubMed Central

    Johnston, W. Thomas; Painter, Dan; Simpson, Jill; Roman, Eve; Skibola, Chris F.; Smith, Martyn T.; Allan, James M.; Taylor, G. Malcolm

    2010-01-01

    Studies of childhood leukemia and the potential etiologic role of genetic variation in folate metabolism have produced conflicting findings and have often been based on small numbers. We investigated the association between polymorphisms in key folate metabolism enzymes (MTHFR 677 C>T, MTHFR 1298 A>C, SHMT1 1420 C>T, MTR 2756 A>G, TS 1494del6, and TS 28bp repeat) in 939 cases of childhood acute lymphoblastic leukemia (ALL) and 89 cases of acute myeloid leukemia (AML) recruited into the United Kingdom Childhood Cancer Study. We also examined the maternal genotypes of 752 of these cases. Data from 824 noncancer controls recruited were used for comparison. No evidence of an association with MTHFR 677 was observed for ALL or AML, either in children or their mothers. However, in children an increased risk of ALL (odds ratio [OR] = 1.88; 95% confidence interval [CI], 1.16-3.07; P = .010) and AML (OR = 2.74; 95% CI, 1.07-7.01; P = .036) was observed with the MTR 2756 GG genotype; the association was most pronounced for cases with the MLL translocation (OR = 4.90; 95% CI, 1.30-18.45; P = .019). These data suggest that genetic variation in methionine synthase could mediate risk of childhood leukemia, either via effects on DNA methylation or via effects on fetal growth and development. PMID:20101025

  4. The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population.

    PubMed

    Nowak, Izabela; Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

    2017-01-01

    Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms' association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms.

  5. The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population

    PubMed Central

    Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R.; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

    2017-01-01

    Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms’ association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms. PMID:29073227

  6. Association of Methylenetetrahydrofolate Reductase (MTHFR 677C>T and 1298A>C) Polymorphisms and Haplotypes with Silent Brain Infarction and Homocysteine Levels in a Korean Population

    PubMed Central

    Han, In Bo; Kim, Ok Joon; Ahn, Jung Yong; Oh, Doyeun; Hong, Sun Pyo; Huh, Ryoong; Chung, Sang Sup

    2010-01-01

    Purpose Methylenetetrahydrofolate reductase (MTHFR) is the main regulatory enzyme for homocysteine metabolism. In the present study, we evaluated whether the MTHFR 677C>T and 1298A>C gene polymorphisms are associated with SBI and plasma homocysteine concentration in a Korean population. Materials and Methods We enrolled 264 patients with SBI and 234 healthy controls in South Korea. Fasting plasma total homocysteine (tHcy) concentrations were measured, and genotype analysis of the MTHFR gene was carried out. Results The plasma tHcy levels were significantly higher in patients with SBI than in healthy controls. Despite a significant association between the MTHFR 677TT genotype and hyperhomocysteinemia, the MTHFR 677C>T genotypes did not appear to influence susceptibility to SBI. However, odds ratios of the 1298AC and 1298AC + CC genotypes for the 1298AA genotype were significantly different between SBI patients and normal controls. The frequencies of 677C-1298A and 677C-1298C haplotypes were significantly higher in the SBI group than in the control group. Conclusion This study demonstrates that the MTHFR 1298A>C polymorphism is a risk factor for SBI in a Korean population. The genotypes of 677C>T and 1298A>C polymorphisms interact additively, and increase the risk of SBI in Korean subjects. PMID:20191019

  7. Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

    PubMed

    Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

    2018-02-01

    The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

  8. MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C Polymorphisms and Disease Activity in Mexicans with Rheumatoid Arthritis Treated with Methotrexate.

    PubMed

    González-Mercado, Mirna Gisel; Rivas, Fernando; Gallegos-Arreola, M Patricia; Morán-Moguel, M Cristina; Salazar-Páramo, Mario; González-López, Laura; Gámez-Nava, J Iván; Muñoz-Valle, J Francisco; Medina-Coss Y León, Ricardo; González-Mercado, Anahí; Aceves, Mario A; Dávalos, Nory O; Macías-Chumacera, Agustín; Dávalos, Ingrid P

    2017-11-01

    To investigate the relationships of polymorphisms in genes whose protein products are related in the metabolic pathway of folic acid, particularly MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C, and disease activity in Mexican patients with rheumatoid arthritis (RA) treated with methotrexate (MTX). Sixty-eight patients with RA were included in the study who were being treated with MTX, either with or without other drugs. In addition to general data, disease activity was measured by the disease activity score 28 (DAS28). Single nucleotide polymorphisms (SNPs) genotyping was performed by allelic discrimination using real-time polymerase chain reaction. Differences in genotype (homozygotic or heterozygotic for each allele), allele distributions, and phenotype were not statistically different between the RA group and control populations. We did not find any association between the studied polymorphisms and disease activity nor with the intragroup variables (e.g., clinical activity, body mass index, and single- or combined-drug treatment) or between genetic markers; we also did not find any association within the RA group or between the RA group and control populations. Additional studies of more polymorphisms related to this or other metabolic pathways are required to determine the influence of genetics on disease activity in RA.

  9. Genetic variation throughout the folate metabolic pathway influences negative symptom severity in schizophrenia.

    PubMed

    Roffman, Joshua L; Brohawn, David G; Nitenson, Adam Z; Macklin, Eric A; Smoller, Jordan W; Goff, Donald C

    2013-03-01

    Low serum folate levels previously have been associated with negative symptom risk in schizophrenia, as has the hypofunctional 677C>T variant of the MTHFR gene. This study examined whether other missense polymorphisms in folate-regulating enzymes, in concert with MTHFR, influence negative symptoms in schizophrenia, and whether total risk allele load interacts with serum folate status to further stratify negative symptom risk. Medicated outpatients with schizophrenia (n = 219), all of European origin and some included in a previous report, were rated with the Positive and Negative Syndrome Scale. A subset of 82 patients also underwent nonfasting serum folate testing. Patients were genotyped for the MTHFR 677C>T (rs1801133), MTHFR 1298A>C (rs1801131), MTR 2756A>G (rs1805087), MTRR 203A>G (rs1801394), FOLH1 484T>C (rs202676), RFC 80A>G (rs1051266), and COMT 675G>A (rs4680) polymorphisms. All genotypes were entered into a linear regression model to determine significant predictors of negative symptoms, and risk scores were calculated based on total risk allele dose. Four variants, MTHFR 677T, MTR 2756A, FOLH1 484C, and COMT 675A, emerged as significant independent predictors of negative symptom severity, accounting for significantly greater variance in negative symptoms than MTHFR 677C>T alone. Total allele dose across the 4 variants predicted negative symptom severity only among patients with low folate levels. These findings indicate that multiple genetic variants within the folate metabolic pathway contribute to negative symptoms of schizophrenia. A relationship between folate level and negative symptom severity among patients with greater genetic vulnerability is biologically plausible and suggests the utility of folate supplementation in these patients.

  10. Association between C677T and A1298C polymorphisms of the MTHFR gene and risk of male infertility: a meta-analysis.

    PubMed

    Yang, Y; Luo, Y Y; Wu, S; Tang, Y D; Rao, X D; Xiong, L; Tan, M; Deng, M Z; Liu, H

    2016-04-26

    Published studies on the association between the C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene and male infertility risk are controversial. To obtain a more precise evaluation, we performed a meta-analysis based on published case-control studies. We conducted an electronic search of PubMed, EMBASE, the Cochrane Library, the Web of Science, and the China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and male infertility risk. Pooled odds ratios (ORs) with 95% confidence intervals (95%CIs) were used to assess the strength of association in homozygote, heterozygote, dominant, recessive, and additive models. Statistical heterogeneity, test of publication bias, and sensitivity analysis were carried out using the STATA software (Version 13.0). Overall, 21 studies of C677T (4505 cases and 4024 controls) and 13 studies of A1298C (2785 cases and 3094 controls) were included in this meta-analysis. For C677T, the homozygote comparison results were OR = 1.629, 95%CI (1.215- 2.184), and the recessive model results were OR = 1.462 (1.155- 1.850). For A1298C, the homozygote comparison results were OR = 1.289 (1.029-1.616), and the recessive model results were OR = 1.288 (1.034-1.604). In conclusion, the current meta-analysis showed that the MTHFR C677T polymorphism was associated with a significantly increased male infertility risk in the Asian and overall populations, but not in the Caucasian population, and there was a significant association between the A1298C polymorphism and male infertility risk in the Asian, Caucasian, and overall groups.

  11. Methylenetetrahydrofolate reductase gene, homocysteine and coronary artery disease: the A1298C polymorphism does matter. Inferences from a case study (Madeira, Portugal).

    PubMed

    Freitas, Ana I; Mendonça, Isabel; Guerra, Graça; Brión, Maria; Reis, Roberto P; Carracedo, Angel; Brehm, António

    2008-01-01

    Elevated levels of plasma homocysteine, an independent risk factor and a strong predictor of mortality in patients with coronary artery disease (CAD), can result from nutritional deficiencies or genetic errors, including methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms. The contribution of these polymorphisms in the development of CAD remains controversial. We analysed the impact of MTHFR C677T and A1298C on fasting homocysteine and CAD in 298 CAD patients proved by angiography and 510 control subjects from the Island of Madeira (Portugal). After adjustment for other risk factors, plasma homocysteine remained independently correlated with CAD. Serum homocysteine was significantly higher in individuals with 677TT and 1298AA genotypes. There was no difference in the distribution of MTHFR677 genotypes between cases and controls but a significant increase in 1298AA prevalence was found in CAD patients. In spite of the clear effect of C677T mutation on elevated homocysteine levels we only found an association between 1298AA genotype and CAD in this population. The simultaneous presence of 677CT and 1298AA genotypes provides a significant risk of developing the disease, while the 1298AC genotype, combined with 677CC, shows a significant trend towards a decrease in CAD occurrence. The data shows an independent association between elevated levels of homocysteine and CAD. Both MTHFR polymorphisms are associated with increased fasting homocysteine (677TT and 1298AA genotypes), but only the 1298AA variant shows an increased prevalence in CAD group. Odds ratio seem to indicate that individuals with the MTHFR 1298AA genotype and the 677CT/1298AA compound genotype had a 1.6-fold increased risk for developing CAD suggesting a possible association of MTHFR polymorphisms with the risk of CAD in Madeira population.

  12. MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C Polymorphisms and Disease Activity in Mexicans with Rheumatoid Arthritis Treated with Methotrexate

    PubMed Central

    González-Mercado, Mirna Gisel; Rivas, Fernando; Gallegos-Arreola, M. Patricia; Morán-Moguel, M. Cristina; Salazar-Páramo, Mario; González-López, Laura; Gámez-Nava, J. Iván; Muñoz-Valle, J. Francisco; Medina-Coss y León, Ricardo; González-Mercado, Anahí; Aceves, Mario A.; Dávalos, Nory O.; Macías-Chumacera, Agustín

    2017-01-01

    Aim: To investigate the relationships of polymorphisms in genes whose protein products are related in the metabolic pathway of folic acid, particularly MTRR A66G, RFC1 G80A, and MTHFR C677T and A1298C, and disease activity in Mexican patients with rheumatoid arthritis (RA) treated with methotrexate (MTX). Materials and Methods: Sixty-eight patients with RA were included in the study who were being treated with MTX, either with or without other drugs. In addition to general data, disease activity was measured by the disease activity score 28 (DAS28). Single nucleotide polymorphisms (SNPs) genotyping was performed by allelic discrimination using real-time polymerase chain reaction. Results: Differences in genotype (homozygotic or heterozygotic for each allele), allele distributions, and phenotype were not statistically different between the RA group and control populations. We did not find any association between the studied polymorphisms and disease activity nor with the intragroup variables (e.g., clinical activity, body mass index, and single- or combined-drug treatment) or between genetic markers; we also did not find any association within the RA group or between the RA group and control populations. Conclusion: Additional studies of more polymorphisms related to this or other metabolic pathways are required to determine the influence of genetics on disease activity in RA. PMID:28994615

  13. The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children

    PubMed Central

    Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S.; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

    2017-01-01

    Abstract The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry. The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes. The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes. The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. PMID:29390492

  14. The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children.

    PubMed

    Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

    2017-12-01

    The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry.The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes.The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes.The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  15. Plasma homocysteine levels, methylene tetrahydrofolate reductase A1298C gene polymorphism and risk of retinal vein thrombosis.

    PubMed

    Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

    2016-09-01

    There are limited data regarding the role of methylene tetrahydrofolate reductase (MTHFR) A1298C polymorphism and hyperhomocysteinemia as risk factors for retinal vein thrombosis (RVT) in Iranians. This study aimed to examine a possible association between fasting plasma total homocysteine (tHcy) levels, MTHFR A1298C polymorphism and RVT development in Iranian patients. Our study population consisted of 73 patients with a diagnosis of RVT (52.7 ± 16.2 years) and 73 age and sex-matched healthy controls (49.1 ± 14.6 years). Genotyping for the MTHFR A1298Cpolymorphism was conducted by PCR-RFLP technique and plasma tHcy levels were measured by an enzyme immunoassay method. Fasting plasma tHcy levels were 20.29 ± 8.5 μmol/l in RVT patients and 10.9 ± 3.1 μmol/l in control subjects. The number of cases with abnormal tHcy values (hyperhomocysteinemia) was significantly higher in the RVT patients than control subjects (P = 0.0001). The prevalence of MTHFR 1298CC homozygote genotype was similar in RVT patients and controls (17.8 vs.15.1%, P = 0.45). There were no significant differences in genotype distribution of MTHFR A1298C polymorphism between males and females in both RVT patients and controls (P > 0.05). The frequency of the 1298C allele was 39.1 and 35.6% in patients and controls, respectively, and did not differ significantly between them (P = 0.23). Moreover, heterozygote and homozygote genotypes in the RVT patients had significantly higher abnormal tHcy values than corresponding genotypes in control subjects (P < 0.001). Our study demonstrated that hyperhomocysteinemia but not homozygosity for MTHFR A1298C polymorphism is a significant risk factor for RVT in the Iranian population.

  16. Association between maternal, fetal and paternal MTHFR gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss: a comprehensive evaluation.

    PubMed

    Yang, Yi; Luo, Yunyao; Yuan, Jing; Tang, Yidan; Xiong, Lang; Xu, MangMang; Rao, XuDong; Liu, Hao

    2016-06-01

    Numerous studies have investigated the associations between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss (RPL); however, the results remain controversial. The aim of this study is to drive a more precise estimation of association between MTHFR gene polymorphisms and risk of RPL. We searched PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and RPL risk. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the strength of association in the homozygous model, heterozygous model, dominant model, recessive model and an additive model. The software STATA (Version 13.0) was used for statistical analysis. Overall, 57 articles were included in the final meta-analysis. In maternal group the MTHFR C677T polymorphism showed pooled odds ratios for the homozygous comparison [OR = 2.285, 95 % CI (1.702, 3.067)] and the MTHFR A1298C polymorphism showed pooled odds ratios for recessive model [OR = 1.594, 95 % CI (1.136, 2.238)]. In fetal group the MTHFR C677T polymorphism showed pooled odds ratios for dominant model [OR = 1.037, 95 % CI (0.567, 1.894)] and the MTHFR A1298C polymorphism showed pooled odds ratios for dominant model [OR = 1.495, 95 % CI (1.102, 2.026)]. In summary, the results of our meta-analysis indicate that maternal and paternal MTHFR gene C677T and A1298C polymorphisms are associated with RPL. We also observed a significant association between fetal MTHFR A1298C polymorphism and RPL but not C677T.

  17. A literature review of MTHFR (C677T and A1298C polymorphisms) and cancer risk.

    PubMed

    Izmirli, Muzeyyen

    2013-01-01

    5,10-Methlenetetrahydrofolate reductase (MTHFR) is one of the most important enzymes for folate metabolism. This enzyme is mapped on chromosome 1, which is located at the end of the short arm (1p36.3). The C677T and A1298C are MTHFR polymorphisms that decrease in vitro MTHFR enzyme activity. Folate metabolism plays a key role in cell metabolism. These reactions are associated with purine-pyrimidine synthesis: DNA, RNA, and protein methylation. Polymorphism is also a factor in biodiversity, and be affected by ethnic heritage and geographic locale. In the case of unknown outcomes, not only should all geographical regions be investigated to ascertain biodiversity, but all populations as well to fully understand the variations in the effect. PUBMED was searched from January 2006 to December 2011 to develop an investigatory pursuit strategy. MTHFR, cancer, C677T, A1298C, and polymorphisms were key words used to focus the search. The literature review included all published relevant cancer types and MTHFR polymorphisms for that 5 years period. All selected polymorphisms data for cancer types was listed in tables for easy access and retrieval.

  18. MTHFR polymorphisms C677T and A1298C and associations with IVF outcomes in Brazilian women.

    PubMed

    D'Elia, Priscila Queiroz; dos Santos, Aline Amaro; Bianco, Bianca; Barbosa, Caio Parente; Christofolini, Denise Maria; Aoki, Tsutomu

    2014-06-01

    The aim of this study was to investigate the association between MTHFR gene polymorphisms and IVF outcomes in Brazilian women undergoing assisted reproduction treatment. A prospective study was conducted in the Human Reproduction Department at the ABC University School of Medicine and the Ideia Fertility Institute between December 2010 and April 2012. The patient population was 82 women undergoing assisted reproduction cycles. The MTHFR polymorphisms C677T and A1298C were evaluated and compared with laboratory results and pregnancy rates. The C677T variant was associated with proportions of mature (P=0.006) and immature (P=0.003) oocytes whereas the A1298C variant was associated with number of oocytes retrieved (P=0.044). The polymorphisms, whether alone or in combination, were not associated with normal fertilization, good-quality embryo or clinical pregnancy rates. This study suggests that the number and maturity of oocytes retrieved may be related to the MTHFR polymorphisms C677T and A1298C. It is believed that folate has a crucial function in human reproduction and that folate deficiency can compromise the function of the metabolic pathways it is involved in, leading to an accumulation of homocysteine. The gene MTHFR encodes the 5-MTHFR enzyme, which is involved in folate metabolism, and C677T/A1298C polymorphisms of this gene are related to decreased enzyme activity and consequent changes in homocysteine concentration. Folate deficiency and hyperhomocysteinaemia can also compromise fertility and lead to pregnancy complications by affecting the development of oocytes, preparation of endometrial receptivity, implantation of the embryo and pregnancy. In folliculogenesis, hyperhomocysteinaemia can activate apoptosis, leading to follicular atresia and affecting the maturity of oocytes and the quality of embryos cultured in vitro. This study was performed to investigate the association between MTHFR polymorphisms and IVF outcomes in women undergoing assisted

  19. A meta-analysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children.

    PubMed

    Yan, Jingrong; Yin, Ming; Dreyer, ZoAnn E; Scheurer, Michael E; Kamdar, Kala; Wei, Qingyi; Okcu, M Fatih

    2012-04-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have been implicated in childhood acute lymphoblastic leukemia (ALL) risk, but previously published studies were inconsistent and recent meta-analyses were not adequate. In a meta-analysis of 21 publications with 4,706 cases and 7,414 controls, we used more stringent inclusion method and summarized data on associations between MTHFR C677T and A1298C polymorphisms and childhood ALL risk. We found an overall association between 677T variant genotypes and reduced childhood ALL risk. Specifically, in the dominant genetic model, an association was found in a fixed-effect (TT + CT vs. CC: OR = 0.92; 95% CI = 0.85-0.99) but not random-effect model, whereas such an association was observed in both homozygote genetic model (TT vs. CC: OR = 0.80; 95% CI = 0.70-0.93 by fixed effects and OR = 0.78; 95% CI = 0.65-0.93 by random effects) and recessive genetic model (TT vs. CC + CT: OR = 0.83; 95% CI = 0.72-0.95 by fixed effects and OR = 0.84; 95% CI = 0.73-0.97 by random effects). These associations were also observed in subgroups by ethnicity: for Asians in all models except for the dominant genetic model by random effect and for Caucasians in all models except for the recessive genetic model. However, the A1298C polymorphism did not appear to have an effect on childhood ALL risk. These results suggest that the MTHFR C677T, but not A1298C, polymorphism is a potential biomarker for childhood ALL risk. Copyright © 2011 Wiley Periodicals, Inc.

  20. Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population

    PubMed Central

    2014-01-01

    Background The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). Methods A case–control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. Results No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. Conclusions The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population. PMID:24476575

  1. Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population.

    PubMed

    Li, Xiaolei; Liao, Qingchuan; Zhang, Shunguo; Chen, Minling

    2014-01-29

    The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). A case-control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population.

  2. Does the MTHFR A1298C Polymorphism Modulate the Cardiorespiratory Response to Training?

    PubMed

    Cięszczyk, Paweł; Zarębska, Aleksandra; Jastrzębski, Zbigniew; Sawczyn, Michał; Kozakiewicz-Drobnik, Izabela; Leońska-Duniec, Agata; Kaczmarczyk, Mariusz; Maciejewska-Skrendo, Agnieszka; Żmijewski, Piotr; Trybek, Grzegorz; Smółka, Wojciech; Pilch, Jan; Leźnicka, Katarzyna; Lulińska-Kuklik, Ewelina; Sawczuk, Marek; Massidda, Myosotis

    2016-12-01

    The 5,10-methylenetetrahydrofolate reductase gene (MTHFR) A1298C polymorphic variant is a candidate to explain the individual differences in trainability and response to exercise training. Therefore, the aim of the study was to verify whether the A1298C polymorphism influenced the aerobic and anaerobic performance as well as body and mass composition in young Polish women following low-high impact aerobic exercise training. Two hundred and one women aged 21 ± 1 years (range 19-24) were included in the study. All of them completed a 12-week exercise training program and were measured for selected somatic features, aerobic capacity and cardiorespiratory fitness indices as well as peak anaerobic power and anaerobic capacity, before and after the intervention. A mixed 2 x 2 ANOVA for 20 dependent variables grouped in three categories was conducted. No significant interaction of the genotype with training for body mass and body composition variables was observed. Although, there were three significant genotype x training interactions for maximal oxygen uptake variables, regardless of body mass i.e.: for VO2max (p < 0.05), HRmax (p < 0.0001) and HRAT/HRmax (p < 0.0001). Significantly greater improvement in VO2max was gained by the CC+AC group compared to the AA genotype group. The present results support the hypothesis that individual differences in trainability are at least in part determined by the genetic component and MTHFR A1298C seems to be one of the many polymorphisms involved.

  3. Association of Methylenetetrahydrofolate Reductase C677T and A1298C Gene Polymorphisms With Recurrent Pregnancy Loss in Syrian Women.

    PubMed

    Al-Achkar, Walid; Wafa, Abdulsamad; Ammar, Samer; Moassass, Faten; Jarjour, Rami A

    2017-09-01

    C677T polymorphism of the methylenetetrahydrofolate reductase ( MTHFR) gene was a risk factor for recurrent pregnancy loss (RPL), but few studies have confirmed a possible role of MTHFR A1298C polymorphism in RPL risk. This study was carried out to determine the influence of the MTHFR gene polymorphisms in RPL Syrian women. A case-control study was performed on 2 groups (106 healthy and 100 RPL women). The frequency of the MTHFR gene polymorphisms was determined by polymerase chain reaction based on restriction fragment length gene polymorphism. In the RPL group, the genotype frequencies of MTHFR C677T were CC (41%), CT (41%), and TT (18%), and in the control group, the frequencies were CC (62.2%), CT (36.7%), and TT (1%). Statistical analysis showed a homozygous TT genotype and T allele were significantly different in the RPL group ( P = .000003 and P = .000019, respectively). The genotype frequencies of MTHFR A1298C were AA (53%), AC (44%), and CC (8%) in the RPL group, whereas in the control group, these were AA (61.3%), AC (37.8%), and CC (1%). A significant difference in the CC genotype and C allelic frequencies in the RPL women was observed ( P = .014 and P = .064, respectively). The patients having compound heterozygous (677 CT/1298AC) were associated with an estimated 4.86-fold increase in risk of pregnancy loss compared to individuals with a wild type ( P = .012). Our findings indicate that RPL women with homozygous genotype for (C677T and A1298C) either alone or compound heterozygous genotypes have a high risk of pregnancy loss in Syrian women.

  4. Methylenetetrahydrofolate reductase A1298C genotypes are associated with the risks of acute lymphoblastic leukaemia and chronic myelogenous leukaemia in the Korean population.

    PubMed

    Hur, M; Park, J Y; Cho, H C; Lee, K M; Shin, H Y; Cho, H I

    2006-06-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism, DNA methylation and synthesis. We investigated the association between MTHFR polymorphisms and the risks of acute and chronic leukaemias. MTHFR C677T and A1298C were genotyped in 396 Korean individuals using multiplex polymerase chain reaction/restriction fragment-length polymorphism. They were acute lymphoblastic leukaemia (ALL, n = 89), acute myeloid leukaemia (AML, n = 55), biphenotypic acute leukaemia (n = 12), chronic myelogenous leukaemia (CML, n = 40), and normal controls (n = 200). C677T genotypes were not associated with the risk of each disease. A1298C variants, however, significantly decreased the risks of ALL and CML compared with 1298AA. Odds ratios and 95% confidence intervals of 1298AC and 1298AC + CC were 0.53 (0.31-0.93) and 0.54 (0.31-0.93) in ALL, and 0.34 (0.14-0.80) and 0.40 (0.18-0.89) in CML, respectively, compared with 1298AA. These findings demonstrate that the development of ALL and CML is more dependent on folate status, and more susceptible to DNA instability than that of AML. In addition, A1298C rather than C677T may be a more important genetic risk modifier in leukaemogenesis at least in the Korean population.

  5. The Role of the Transcription Factors MtrR and MtrA in the Fitness of the Pathogen Neisseria gonorrhoeae

    DTIC Science & Technology

    2007-10-19

    MacA -MacB efflux pump is expressed at very low levels in N. gonorrhoeae; however, experimental alteration of the promoter sequence showed that the...specificity (132). The gonococcus expresses four efflux pump systems, namely MtrC-Mtr-D-MtrE (64), FarA-FarB-MtrE (97), NorM (158), and MacA -MacB (161...2005. Characterization of the MacA -MacB efflux system in Neisseria gonorrhoeae. The Journal of antimicrobial chemotherapy 56:856-860. 162. Rouquette, C

  6. Association between the MTHFR A1298C polymorphism and risk of cancer: evidence from 265 case-control studies.

    PubMed

    Zhu, Xin-Li; Liu, Zhi-Zhong; Yan, Sen-Xiang; Wang, Wei; Chang, Rui-Xia; Zhang, Chun-Yan; Guo, Yan

    2016-02-01

    Many molecular, epidemiological studies have been performed to explore the association between MTHFR A1298C polymorphism and cancer risk. However, the results were inconsistent or even contradictory. Hence, we performed a meta-analysis to investigate the association between cancer risk and MTHFR A1298C (81,040 cases and 114,975 controls from 265 studies) polymorphism. Overall, significant association was observed between MTHFR A1298C polymorphism and cancer risk when all eligible studies were pooled into the meta-analysis. In further stratified and sensitivity analyses, significantly increased cervical cancer (dominant model: OR 1.46, 95 % CI 1.13-1.90; AC vs. AA: OR 1.48, 95 % CI 1.13-1.92) and lymphoma (dominant model: OR 1.22, 95 % CI 1.04-1.44; recessive model: OR 1.66, 95 % CI 1.15-2.39; CC vs. AA: OR 1.75, 95 % CI 1.21-2.53) risk were observed in Asians, and significantly decreased colorectal cancer risk was found in Asians (recessive model: OR 0.75, 95 % CI 0.59-0.96; CC vs. AA: OR 0.77, 95 % CI 0.60-1.00). In summary, this meta-analysis suggests that MTHFR A1298C polymorphism is associated with increased cervical cancer and lymphoma risk in Asians, and MTHFR A1298C polymorphism is associated with decreased colorectal cancer risk in Asians. Moreover, this meta-analysis also points out the importance of new studies, such as oral cancer and chronic myeloid leukemia, because they had high heterogeneity in this meta-analysis (I (2) > 75 %).

  7. Association of the 5,10-methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) polymorphisms in Korean patients with adult acute lymphoblastic leukemia.

    PubMed

    Oh, Doyeun; Kim, Nam Keun; Jang, Moon Ju; Kim, Hugh Chul; Lee, Jae Hoon; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Kim, Heung Sik; Park, Seonyang; Chio, Hyun Sook; Min, Yoo Hong

    2007-01-01

    Methylenetetrahydrofolate reductase (MTHFR) plays a central role in converting folate to methyl donor for DNA methylation. Because MTHFR is a key enzyme in folate metabolism, changes in its activity resulting from polymorphisms in the MTHFR gene could modify the susceptibility to cancer. Recently, the C677T and A1298C mutations of MTHFR were discovered to be associated with susceptibility in acute lymphoblastic leukemia (ALL). The association between MTHFR polymorphisms and susceptibility and clinical outcome in ALL was studied in 118 adult ALL patients and matched healthy controls (n =427). DNA samples taken from patients with ALL and controls were analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays to detect the MTHFR C677T and A1298C mutations. No significant difference was found in the development of adult ALL among those with different MTHFR genotypes of the C677T or A1298C polymorphisms. However, the MTHFR 677CT+TT genotype showed a tendency to be associated with adult ALL [crude odds ratio (OR), 0.67; 95% confidence interval (CI), 0.44-1.02; adjusted OR, 0.74 95% CI, 0.47-1.14]. The MTHFR C677T and A1298C polymorphisms are not significant risk factors in adult acute leukemia in the Korean population.

  8. Lack of association between MTHFR C677T and A1298C polymorphisms and risk of childhood acute lymphoblastic leukemia in the Kurdish population from Western Iran.

    PubMed

    Azhar, Mohammad-Reza; Rahimi, Zohreh; Vaisi-Raygani, Asad; Akramipour, Reza; Madani, Hamid; Rahimi, Ziba; Parsian, Abbas

    2012-03-01

    Polymorphism in genes involved in folate metabolism may influence the susceptibility to acute lymphoblastic leukemia (ALL). The aim of the present study was to determine the role of the two most common polymorphisms of the 5, 10-methylenetetrahydrofolate reductase (MTHFR) gene, MTHFR C677T and A1298C, and their interaction on the susceptibility to ALL. Seventy-two children with ALL and 109 age- and sex-matched healthy children from Western Iran were screened for MTHFR C677T and A1298C variants by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The frequencies of MTHFR 677T and 1298C alleles in patients were 29.9% and 43.1%, respectively, that were higher than those in controls (24.8% and 38.1%, respectively). Logistic regression analysis was performed and its result in the odds ratios (ORs) for possession of either MTHFR 677T or 1298C allele was found to be 1.98 [95% confidence interval (CI) 0.72-5.4, p = 0.18] and 1.48 (95% CI 0.59-3.69, p = 0.4), respectively. Also the concomitant presence of both MTHFR 677T and 1298C alleles was not associated with the risk of ALL [OR = 2.12 (95% CI 0.8-5.7, p = 0.13)]. Our results in a homogenous population with Kurdish ethnic background indicated that neither the MTHFR 677T allele nor the MTHFR 1298C allele is associated with increased risk of ALL.

  9. 7 CFR 275.6 - Management units.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 4 2013-01-01 2013-01-01 false Management units. 275.6 Section 275.6 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM PERFORMANCE REPORTING SYSTEM Management Evaluation (ME) Reviews § 275.6 Management units. (a) Establishment of management units. For the purpose of ME reviews...

  10. 7 CFR 275.6 - Management units.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 4 2014-01-01 2014-01-01 false Management units. 275.6 Section 275.6 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM PERFORMANCE REPORTING SYSTEM Management Evaluation (ME) Reviews § 275.6 Management units. (a) Establishment of management units. For the purpose of ME reviews...

  11. 7 CFR 275.6 - Management units.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Management units. 275.6 Section 275.6 Agriculture... FOOD STAMP AND FOOD DISTRIBUTION PROGRAM PERFORMANCE REPORTING SYSTEM Management Evaluation (ME) Reviews § 275.6 Management units. (a) Establishment of management units. For the purpose of ME reviews...

  12. Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

    PubMed

    Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

    2009-06-01

    This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

  13. Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

    PubMed

    Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

    2012-01-01

    Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

  14. Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

    PubMed

    Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

    2012-03-01

    Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

  15. Methylenetetrahydrofolate reductase gene C677T and A1298C polymorphisms in patients with small cell and non-small cell lung cancer.

    PubMed

    Siemianowicz, Krzysztof; Gminski, Jan; Garczorz, Wojciech; Slabiak, Natalia; Goss, Malgorzata; Machalski, Marek; Magiera-Molendowska, Helena

    2003-01-01

    Two mutations of methylenetetrahydrofolate reductase (MTHFR) gene (C677T and A1298C) may lead to a decreased activity of the enzyme. These mutations may change a risk of some cancers. We evaluated these two polymorphisms of MTHFR in patients with small cell lung cancer (SCLC) and non-small cell lung cancer (NCSCL). All lung cancer patients had statistically significantly higher percentage of MTHFR 677TT genotype in comparison with non-cancer controls. There were no statistically significant differences in the distribution of MTHFR 1298 genotypes. Neither of the polymorphisms presented any statistically significant differences between SCLC and NSCLC.

  16. The effect of RFC G80A polymorphism in Cretan children with acute lymphoblastic leukemia and its interaction with MTHFR C677T and A1298C polymorphisms.

    PubMed

    Karathanasis, N V; Stiakaki, E; Goulielmos, G Ν; Kalmanti, M

    2014-08-01

    The association between the risk of acute lymphoblastic leukemia (ALL) in children and enzymes involved in the folate metabolism has been under investigation lately. The reduced folate carrier gene (RFC) encodes reduced folate carrier, a protein that transports into the cell both folate and methotrexate, a commonly used chemotherapeutic drug, has been proved polymorphic at position 80 (G→A). The role of this polymorphism in childhood ALL and its interaction with other enzymes of the folate metabolic pathway, including MTHFR, has been examined in different populations with diverse results. In the present case-control study, 35 children with ALL and 48 healthy adult blood donors, all originating from the island of Crete (Greece), were screened for the presence of the RFC G80A polymorphism, using PCR/RFLP techniques. The effect on ALL risk and methotrexate-induced toxicities, along with the role of gene-gene interactions in our population, were examined. No significant association was observed between the RFC G80A genotypes and either the development of ALL or the presence of adverse events. However, a significant association was detected between the MTHFR A1298C/ RFC G80A genotype and a nonpredisposition for ALL (P = 0.035). This study suggests that gene-gene interactions in childhood ALL may be of prognostic value in our population. © 2013 John Wiley & Sons Ltd.

  17. Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey.

    PubMed

    Oztuzcu, Serdar; Ergun, Sercan; Ulaşlı, Mustafa; Nacarkahya, Gülper; Iğci, Yusuf Ziya; Iğci, Mehri; Bayraktar, Recep; Tamer, Ali; Çakmak, Ecir Ali; Arslan, Ahmet

    2014-06-01

    Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 -675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66%, respectively. No mutation was detected in 92 (1.95%) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population.

  18. C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: effect on methotrexate-related toxicity in adult acute lymphoblastic leukaemia.

    PubMed

    Eissa, Deena Samir; Ahmed, Tamer Mohamed

    2013-03-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism. Two polymorphisms, C677T and A1298C, were described leading to reduced enzyme activity. Methotrexate (MTX) is an antifolate agent of consolidation and maintenance therapy of acute lymphoblastic leukaemia (ALL). Despite its clinical success, MTX can be associated with serious toxicities resulting in treatment interruption or discontinuation, impacting disease outcome. There is evidence that MTX toxicity can be affected by polymorphisms in genes encoding for drug-metabolizing enzymes such as MTHFR. Therefore, we aimed to investigate the influence of MTHFR C677T and A1298C polymorphisms on the frequency of MTX-related toxicity, disease outcome and patients' survival. MTHFR polymorphisms were assessed in 50 adult patients with de novo ALL using real-time PCR. Patients were followed-up for the development of haematologic and/or nonhaematologic toxicity and assessment of clinical outcome. Frequency of C677T polymorphisms was 42% for TT, 24% for CT and 34% for CC; A1298C polymorphisms were 28, 6 and 66% for CC, AC and AA, respectively. MTX therapy was significantly associated with neutropaenia, hepatic and gastrointestinal toxicities, unfavourable response at day 14 of induction therapy, increased relapse and mortality rates and shorter survival in patients with 677 TT genotype than in those with CC and CT, whereas 1298 CC genotype patients had lower frequency of neutropaenia, hepatic toxicity and relapse than in those with AA and AC. Our study suggests MTHFR polymorphism as an attractive predictor of MTX-related toxicity in adult ALL, considering it a potential prognostic factor influencing disease outcome.

  19. Association of the MTHFR 1298A>C (rs1801131) polymorphism with speed and strength sports in Russian and Polish athletes.

    PubMed

    Zarebska, Aleksandra; Ahmetov, Ildus I; Sawczyn, Stanislaw; Weiner, Alexandra S; Kaczmarczyk, Mariusz; Ficek, Krzysztof; Maciejewska-Karlowska, Agnieszka; Sawczuk, Marek; Leonska-Duniec, Agata; Klocek, Tomasz; Voronina, Elena N; Boyarskikh, Uljana A; Filipenko, Maksim L; Cieszczyk, Pawel

    2014-01-01

    It has been suggested that DNA hypomethylation because of poorer effectiveness of the 5,10-methylenetetrahydrofolate reductase (MTHFR) enzyme induces muscular growth. We hypothesised that the common, functional 1298A>C polymorphism in the MTHFR gene is associated with athletic status. To test this hypothesis, we investigated the distribution of the 1298A>C variant in Polish (n = 302) and Russian (n = 842) athletes divided into four groups: endurance, strength-endurance, sprint-strength and strength-endurance, as well as in 1540 control participants. We found different genotypes (the AC heterozygote advantage) and allele distributions among sprint-strength athletes and strength athletes than the groups of sedentary controls for each nationality. In the combined study, the allelic frequencies for the 1298C variant were 35.6% in sprint-strength athletes (OR 1.18 [1.02-1.36], P = 0.024 vs. controls) and 38.6% in strength athletes (OR 1.34 [1.10-1.64], P = 0.003 vs. controls). The results of the initial and repetition studies as well as the combined analysis suggest that the functional 1298A>C polymorphism in the MTHFR gene is associated with athletic status. The presence of the C allele seems to be beneficial in sprint-strength and strength athletes. It needs to be established whether and to what extent this effect is mediated by alteration in DNA methylation status.

  20. Targeted Protein Degradation of Outer Membrane Decaheme Cytochrome MtrC Metal Reductase in Shewanella oneidensis MR-1 Measured Using Biarsenical Probe CrAsH-EDT2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiong, Yijia; Chen, Baowei; Shi, Liang

    2011-10-14

    Development of efficient microbial biofuel cells requires an ability to exploit interfacial electron transfer reactions to external electron acceptors, such as metal oxides; such reactions occur in the facultative anaerobic gram-negative bacterium Shewanella oneidensis MR-1 through the catalytic activity of the outer membrane decaheme c-type cytochrome MtrC. Central to the utility of this pathway to synthetic biology is an understanding of cellular mechanisms that maintain optimal MtrC function, cellular localization, and renewal by degradation and resynthesis. In order to monitor trafficking to the outer membrane, and the environmental sensitivity of MtrC, we have engineered a tetracysteine tag (i.e., CCPGCC) atmore » its C-terminus that permits labeling by the cell impermeable biarsenical fluorophore, carboxy-FlAsH (CrAsH) of MtrC at the surface of living Shewanella oneidensis MR-1 cells. In comparison, the cell permeable reagent FlAsH permits labeling of the entire population of MtrC, including proteolytic fragments resulting from incorrect maturation. We demonstrate specific labeling by CrAsH of engineered MtrC which is dependent on the presence of a functional type-2 secretion system (T2S), as evidenced by T2S system gspD or gspG deletion mutants which are incapable of CrAsH labeling. Under these latter conditions, MtrC undergoes proteolytic degradation to form a large 35-38 kDa fragment; this degradation product is also resolved during normal turnover of the CrAsH-labeled MtrC protein. No MtrC protein is released into the medium during turnover, suggesting the presence of cellular turnover systems involving MtrC reuptake and degradation. The mature MtrC localized on the outer membrane is a long-lived protein, with a turnover rate of 0.043 hr-1 that is insensitive to O2 concentration. Maturation of MtrC is relatively inefficient, with substantial rates of turnover of the immature protein prior to export to the outer membrane (i.e., 0.028 hr-1) that are

  1. 22 CFR 129.8 - Prior notification.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Prior notification. 129.8 Section 129.8 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS REGISTRATION AND LICENSING OF...,000, except for sharing of basic marketing information (e.g., information that does not include...

  2. Prevalence of factor V leiden, MTHFR C677T and MTHFR A1298C polymorphisms in patients with deep vein thrombosis in Central Iran.

    PubMed

    Ehsani, Majid; Imani, Aida; Moravveji, Alireza

    2018-05-31

    Deep vein thrombosis (DVT) is a common disease, especially among elderly patients, which is associated with high costs of treatment and high rates of recurrence. The risk factors for venous thrombosis are primarily related to hypercoagulability, which can be genetic or acquired, or because of immobilization and venous stasis. Among relevant genetic markers are a number of common polymorphisms and mutations in the genes coding for Factor V leiden and methylenetetrahydrofolate reductase. Differential associations of these polymorphisms have been reported in different populations with DVT due to ethnic variations. However, no study has been reported with respect to these polymorphisms in DVT in Iran. Thus, the aim of the present study is to determine the prevalence of FVL, MTHFR C677T and MTHFR A1298C gene polymorphisms in patients with DVT in central Iran. In the present cross-sectional study, a total of 100 patients with first and recurrent episodes of DVT and age less than 70 years were recruited during 2016-2017. Blood sample was collected from the recruited patients and FVL mutation was screened using ARMS-PCR method, MTHFR C677T and MTHFR A1298C mutations were screened using PCR-RFLP method. The results revealed that MTHFR A1298C gene polymorphism in both homozygote and heterozygote form was found to be most frequent i.e. 77% among cases, followed by MTHFR C677T (67%) and FVL (17%). The study highlights the importance of screening of these genetic markers among patients with DVT in this region.

  3. Methylenetetrahydrofolate Reductase Gene Polymorphisms (C677T and A1298C) and Hemorrhagic Stroke in Moroccan Patients.

    PubMed

    Abidi, Omar; Haissam, Mohammed; Nahili, Halima; El Azhari, Abdessamad; Hilmani, Said; Barakat, Abdelhamid

    2018-07-01

    The number of deaths from hemorrhagic strokes is about twice as high than the number of deaths from ischemic strokes. Genetic risk assessment could play important roles in preventive and therapeutic strategies. The present study was aimed to evaluate whether the MTHFR gene polymorphisms could increase the risk of cerebral hemorrhage in Moroccan patients. A total of 113 patients with hemorrhagic stroke and 323 healthy controls were included in this case-control study. The C677T (rs1801133) and A1298C (rs1801131) MTHFR gene polymorphisms were genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method in all patients and controls. The genotype and allele frequencies were compared between groups using appropriate statistical analyses. Both groups, patients and controls, were in accordance with the Hardy-Weinberg Equilibrium. For the C677T polymorphism, the frequencies of the CC, CT, and TT genotypes were 50.44% versus 46.13%, 39.82% versus 43.03, and 9.73% versus 10.84% in controls versus patients, respectively, whereas for the A1298C polymorphism, the frequencies of the AA, AC, and CC genotypes were 56.64% versus 57.59%, 40.71% versus 37.15, and 2.65% versus 5.26% in controls versus patients, respectively. No statistically significant difference has been proved between patients and controls frequencies (P >.05) for all additive, recessive, and dominant models. Additional analyses including genotypes combination, allelic frequencies, and hemorrhagic stroke patient subtypes did not show any statistically significant difference between controls and patients/subgroup patients. Our findings suggested no association between MTHFR gene polymorphisms and susceptibility to hemorrhagic strokes in Moroccan patients. Further investigations should be conducted to elucidate the roles of other gene variants in the pathogenesis of this condition. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  4. Methylenetetrahydrofolate reductase (MTHFR) gene 677C>T and 1298A>C polymorphisms are associated with differential apoptosis of leukemic B cells in vitro and disease progression in chronic lymphocytic leukemia.

    PubMed

    Nückel, H; Frey, U H; Dürig, J; Dührsen, U; Siffert, W

    2004-11-01

    Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. We investigated whether the two genetic MTHFR polymorphisms (677C>T and 1298A>C) are associated with an increased risk for chronic lymphocytic leukemia (CLL) or may predict disease progression. Moreover, we measured potential genotype effects on apoptosis of B-CLL cells.Allele frequencies and genotype distributions for both polymorphisms were not significantly different in 111 patients vs 92 healthy controls. While progression-free survival (PFS) was not significantly different in individuals with CLL including all stages, in patients with Binet stage A PFS was significantly longer in patients displaying the MTHFR 677CC (P=0.043) and the MTHFR 1298A/C or CC genotypes (P=0.019). In a multivariate analysis, MTHFR haplotype (677CC plus 1298CC or A/C) was the best independent prognostic factor for PFS compared with other known prognostic factors. Spontaneous apoptosis of B-CLL cells in vitro was significantly increased in the favorable risk group with MTHFR 677CC and MTHFR 1298AC, which may constitute the cellular basis of the observed associations. While MTHFR polymorphisms do not affect the risk for B-CLL, they may be independent prognostic markers that influence the PFS in patients with early-stage B-CLL.

  5. MTHFR gene C677T and A1298C polymorphisms and homocysteine levels in primary open angle and primary closed angle glaucoma

    PubMed Central

    Micheal, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Muhammad Imran; Khan, Wajid Ali

    2009-01-01

    Purpose To investigate the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C genotypes and plasma concentrations of total homocysteine (tHcy) in Pakistani patients with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). Methods This was a prospective case-control study. A total of 295 patients (173 POAG, 122 PCAG) and 143 age- and sex-matched controls were subdivided into two ethnic groups, Punjabis (Punjab province, central Pakistan) and Pathans (North-West Frontier Province, northern Pakistan). Genotypes of the MTHFR C677T and A1298C polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP). An enzyme-linked immunosorbent assay was used to determine the total serum homocysteine (tHcy) levels. Associations were determined by logistic regression analysis. Results Frequency distributions of genotypes and combined genotypes as well as homocysteine levels were obtained. The overall distribution of the C677T genotype was found to be significantly associated with PCAG (CC 69%, CT 21%, TT 10%; p=0.001, χ2=12.6), but not with POAG (CC 71%, CT 28%, TT 1%; p=0.98, χ2=0.02) as compared to the controls (CC 71%, CT 29%, TT 1%). The Pathan cohorts revealed no association with the disease; however, the Punjabis demonstrated a significant association with PCAG (CC 75%, CT 11%, TT 13%; p<0.001, χ2=17.2). PCAG in the Punjabi subjects was also significantly associated with the A1298C polymorphism (AA 43%, AC 54%, CC 3%; p<0.001, χ2=33.9) as compared to the controls. Combined genotype data showed no association with POAG; however, a significant association with all combined genotypes was observed in the overall PCAG subjects (p<0.05, χ2=20.1). This difference was particularly apparent in the TTAA and TTAC combinations that were completely absent in the control groups (p<0.05. χ2=49.6). Mean serum tHcy levels were found to be significantly increased in the POAG (15.2±1.28 µmol/l, p<0

  6. Flavin binding to the deca-heme cytochrome MtrC: Insights from computational molecular simulation

    DOE PAGES

    Breuer, Marian; Rosso, Kevin  M.; Blumberger, Jochen

    2015-12-15

    Here, certain dissimilatory bacteria have the remarkable ability to use extracellular metal oxide minerals instead of oxygen as terminal electron sinks, using a process known as “extracellular respiration”. Specialized multiheme cytochromes located on the outer membrane of the microbe were shown to be crucial for electron transfer from the cell surface to the mineral. This process is facilitated by soluble, biogenic flavins secreted by the organism for the purpose of acting as an electron shuttle. However, their interactions with the outer-membrane cytochromes are not established on a molecular scale. Here, we study the interaction between the outer-membrane deca-heme cytochrome MtrCmore » from Shewanella oneidensis and flavin mononucleotide (FMN in fully oxidized quinone form) using computational docking. We find that interaction of FMN with MtrC is significantly weaker than with known FMN-binding proteins, but identify a mildly preferred interaction site close to heme 2 with a dissociation constant (K d) = 490 μM, in good agreement with recent experimental estimates, K d = 255 μM. The weak interaction with MtrC can be qualitatively explained by the smaller number of hydrogen bonds that the planar headgroup of FMN can form with this protein compared to FMN-binding proteins. Molecular dynamics simulation gives indications for a possible conformational switch upon cleavage of the disulphide bond of MtrC, but without concomitant increase in binding affinities according to this docking study. Overall, our results suggest that binding of FMN to MtrC is reversible and not highly specific, which may be consistent with a role as redox shuttle that facilitates extracellular respiration.« less

  7. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    PubMed

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p < 0.05), on MTHFR C677T , MTR A2756G , MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05) except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike's information criterion and leave-one-out cross validation methods. Body mass index (BMI) and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene-environment interactions in the prevention of CRC.

  8. MTHFR 677CC/1298CC genotypes are highly associated with chronic myelogenous leukemia: a case-control study in Korea.

    PubMed

    Moon, Hee Won; Kim, Tae Young; Oh, Bo Ra; Min, Hyun Chung; Cho, Han Ik; Bang, Soo Mee; Lee, Jae Hoon; Yoon, Sung Soo; Lee, Dong Soon

    2007-09-01

    Methylenetetrahydrofolate reductase (MTHFR) is an enzyme involved in folate metabolism and DNA methylation. Studies on MTHFR polymorphism in leukemia have largely focused on the protective role of MTHFR polymorphism in acute lymphoblastic leukemia (ALL). We evaluated the C677T and A1298C polymorphisms using the TaqMan allelic discrimination assay in various malignancies. The study population included 115 subjects with chronic myelogenous leukemia (CML), 200 with acute myelogenous leukemia (AML), 196 with multiple myeloma (MM) and 434 healthy control subjects. The frequency of 1298CC was statistically significantly higher in subjects with CML than that of the controls (OR=5.12, 95% CI: 1.75-14.9, P-value=.003). Of note, the frequencies of 677CC/1298CC genotype were statistically significantly higher in subjects with CML, AML and MM than that of the controls (OR=8.8, 3.5, 3.83, P-value=.002, 0.036, 0.023, respectively). Our results demonstrate that the MTHFR 1298CC homozygote variant is strongly associated with an increased risk of CML, while MTHFR C677T does not significantly affect the risk of CML. Moreover, we demonstrated that MTHFR 677CC and 1298CC genotype might have combined effect on risk of CML, AML and MM and it is inferred that the A1298C may play a different role in carcinogenesis, depending on the types of organs involved, the types of disease entities and the genotype of C677T.

  9. Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and the risk of primary Hepatocellular Carcinoma (HCC) in a Chinese population

    PubMed Central

    Cao, Wei; Zhang, Zuo-Feng; Cai, Lin; Jiang, Qing-Wu; You, Nai-Chieh; Goldstein, Binh Yang; Wei, Guo-Rong; Chen, Chuan-Wei; Lu, Qing-Yi; Zhou, Xue-Fu; Ding, Bao-Guo; Chang, Jun; Yu, Shun-Zhang

    2014-01-01

    Objectives Methylenetetrahydrofolate reductase (MTHFR), which is expressed in the liver, may be involved in both DNA methylation and DNA synthesis. It is also indicated as a potential risk factor of liver cancer in patients with chronic liver disease. To date, no study has been conducted on MTHFR and hepatocellular carcinoma (HCC) using a population-based design. The objective of this study was to evaluate the effects of polymorphisms of the MTHFR gene on the risk of primary liver cancer and their possible effect modifications on various environmental risk factors. Methods A population-based case–control study was conducted in Taixing, China. MTHFR C677T and A1298C were assayed by PCR-RFLP techniques. Results The frequency of MTHFR 677 C/C wild homo-zygotes genotype was 25.8% in cases, which was lower than that in controls (34.5%). The adjusted odds ratios (ORs) for the MTHFR 677 C/T and T/T genotype were 1.66(95% CI: 1.06–2.61), 1.21(95% CI: 0.65–2.28) respectively when compared with the MTHFR 677 C/C genotype. Subjects carrying any T genotype have the increased risk of 1.55(95% CI: 1.01–2.40) for development of primary hepatocellular carcinoma. A high degree of linkage disequilibrium was observed between the C677T and A1298C polymorphisms, with the D′ of 0.887 and p < 0.01. The MTHFR 677 any T genotype was suggested to have potentially more than multiplicative interactions with raw water drinking with p-value for adjusted interaction of 0.03. Conclusion We observed that the MTHFR 677 C/T genotype was associated with an increased risk of primary liver cancer in a Chinese population. The polymorphism of MTHFR 677 might modify the effects of raw water drinking on the risk of primary hepatocellular carcinoma. PMID:17503006

  10. MTR MAIN FLOOR. MEN DEMONSTRATE INSERTION OF DUMMY PLUG INTO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR MAIN FLOOR. MEN DEMONSTRATE INSERTION OF DUMMY PLUG INTO AN MTR BEAM HOLE. ONE MAN CHECKS RADIATION LEVEL AT THE END OF THE UNIVERSAL COFFIN, WHILE ANOTHER USES TOOL TO INSERT PLUG INTO HOLE THROUGH COFFIN. MEN WEAR "ANTI-C" (ANTI-CONTAMINATION) CLOTHING. INL NEGATIVE NO. 6198. R.G. Larsen, Photographer, 6/27/1952 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  11. [Features of allele polymorphism of genes involved in homocysteine and folate metabolism in patients with atherosclerosis of the lower extremity arteries].

    PubMed

    Klenkova, N A; Kapustin, S I; Saltykova, N B; Shmeleva, V M; Blinov, M N

    2009-01-01

    Under study were features of allele polymorphism of genes of methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MS A 2756G), methionine synthase reductase (MTRR A66G) and methylenetetrahydrofolate dehydrogenase (MTHFD G1958A) in patients with atherosclerosis of the lower extremity arteries (ALEA). Patients with hyperhomocysteinemia (HHcy) had statistically significant increase of allele MTHFR 677T and MTRR 66GG as compared both with the control group and with the group of patients without HHcy. It suggests that polymorphism of genes involved in homocystein and folate metabolism might affect the risk of HHcy in patients with ALEA.

  12. Helicase-Dependent RNA Decay Illuminated by a Cryo-EM Structure of a Human Nuclear RNA Exosome-MTR4 Complex.

    PubMed

    Weick, Eva-Maria; Puno, M Rhyan; Januszyk, Kurt; Zinder, John C; DiMattia, Michael A; Lima, Christopher D

    2018-06-14

    The ribonucleolytic RNA exosome interacts with RNA helicases to degrade RNA. To understand how the 3' to 5' Mtr4 helicase engages RNA and the nuclear exosome, we reconstituted 14-subunit Mtr4-containing RNA exosomes from Saccharomyces cerevisiae, Schizosaccharomyces pombe, and human and show that they unwind structured substrates to promote degradation. We loaded a human exosome with an optimized DNA-RNA chimera that stalls MTR4 during unwinding and determined its structure to an overall resolution of 3.45 Å by cryoelectron microscopy (cryo-EM). The structure reveals an RNA-engaged helicase atop the non-catalytic core, with RNA captured within the central channel and DIS3 exoribonuclease active site. MPP6 tethers MTR4 to the exosome through contacts to the RecA domains of MTR4. EXOSC10 remains bound to the core, but its catalytic module and cofactor C1D are displaced by RNA-engaged MTR4. Competition for the exosome core may ensure that RNA is committed to degradation by DIS3 when engaged by MTR4. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. Performance of the MTR core with MOX fuel using the MCNP4C2 code.

    PubMed

    Shaaban, Ismail; Albarhoum, Mohamad

    2016-08-01

    The MCNP4C2 code was used to simulate the MTR-22 MW research reactor and perform the neutronic analysis for a new fuel namely: a MOX (U3O8&PuO2) fuel dispersed in an Al matrix for One Neutronic Trap (ONT) and Three Neutronic Traps (TNTs) in its core. Its new characteristics were compared to its original characteristics based on the U3O8-Al fuel. Experimental data for the neutronic parameters including criticality relative to the MTR-22 MW reactor for the original U3O8-Al fuel at nominal power were used to validate the calculated values and were found acceptable. The achieved results seem to confirm that the use of MOX fuel in the MTR-22 MW will not degrade the safe operational conditions of the reactor. In addition, the use of MOX fuel in the MTR-22 MW core leads to reduce the uranium fuel enrichment with (235)U and the amount of loaded (235)U in the core by about 34.84% and 15.21% for the ONT and TNTs cases, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. MTHFR 677C-->T and 1298A-->C polymorphisms in children with Down syndrome and acute myeloid leukemia in Brazil.

    PubMed

    Amorim, Marcia R; Zanrosso, Crisiane Wais; Magalhães, Isis Q; Pereira, Simone C; Figueiredo, Alexandre; Emerenciano, Mariana; Pinheiro, Vitoria Regia; d'Andréa, Maria Lydia; Orioli, Ieda M; Koifman, Sergio; Pombo-de-Oliveira, Maria S

    2008-12-01

    Down syndrome (DS) is an important risk factor associated with acute leukemia (AL). The presence of polymorphisms that reduce 5,10-methylenetetrahydrofolate reductase (MTHFR) activity has been linked to the multifactorial leukemogenic process. The authors have conducted a study to test whether 677C-->T and/or 1298A-->C polymorphisms of MTHFR would play an additional role in susceptibility of acute myeloid leukemia (AML) in DS children. They also verified whether any polymorphism in the MTHFR gene was associated with the risk of DS. Genetic polymorphisms determination was carried out in 248 samples from healthy individuals as controls and a total of 115 DS children (65 without leukemia and 50 with AML). The present study failed to reveal any association between these polymorphisms and risk of AML in DS children. The data also indicate that MTHFR polymorphisms are not associated with risk of being a DS child.

  15. 21 CFR 73.1298 - Ferric ammonium ferrocyanide.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 1 2014-04-01 2014-04-01 false Ferric ammonium ferrocyanide. 73.1298 Section 73.1298 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1298 Ferric ammonium ferrocyanide. (a...

  16. 21 CFR 73.1298 - Ferric ammonium ferrocyanide.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 1 2013-04-01 2013-04-01 false Ferric ammonium ferrocyanide. 73.1298 Section 73.1298 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1298 Ferric ammonium ferrocyanide. (a...

  17. 21 CFR 73.1298 - Ferric ammonium ferrocyanide.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Ferric ammonium ferrocyanide. 73.1298 Section 73.1298 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1298 Ferric ammonium ferrocyanide. (a...

  18. 21 CFR 73.1298 - Ferric ammonium ferrocyanide.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 1 2012-04-01 2012-04-01 false Ferric ammonium ferrocyanide. 73.1298 Section 73.1298 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1298 Ferric ammonium ferrocyanide. (a...

  19. Structural basis for MTR4-ZCCHC8 interactions that stimulate the MTR4 helicase in the nuclear exosome-targeting complex.

    PubMed

    Puno, M Rhyan; Lima, Christopher D

    2018-06-12

    The nuclear exosome-targeting (NEXT) complex functions as an RNA exosome cofactor and is involved in surveillance and turnover of aberrant transcripts and noncoding RNAs. NEXT is a ternary complex composed of the RNA-binding protein RBM7, the scaffold zinc-knuckle protein ZCCHC8, and the helicase MTR4. While RNA interactions with RBM7 are known, it remains unclear how NEXT subunits collaborate to recognize and prepare substrates for degradation. Here, we show that MTR4 helicase activity is enhanced when associated with RBM7 and ZCCHC8. While uridine-rich substrates interact with RBM7 and are preferred, optimal activity is observed when substrates include a polyadenylated 3' end. We identify a bipartite interaction of ZCCHC8 with MTR4 and uncover a role for the conserved C-terminal domain of ZCCHC8 in stimulating MTR4 helicase and ATPase activities. A crystal structure reveals that the ZCCHC8 C-terminal domain binds the helicase core in a manner that is distinct from that observed for Saccharomyces cerevisiae exosome cofactors Trf4p and Air2p. Our results are consistent with a model whereby effective targeting of substrates by NEXT entails recognition of elements within the substrate and activation of MTR4 helicase activity. Copyright © 2018 the Author(s). Published by PNAS.

  20. Combined 677CC/1298AC genotypes of methylenetetrahydrofolate reductase (MTHFR ) reduce susceptibility to precursor B lymphoblastic leukemia in a Chinese population.

    PubMed

    Lv, Ling; Wu, Cuie; Sun, Henjuan; Zhu, Saijuan; Yang, Yongchen; Chen, Xi; Fu, Hua; Bao, Liming

    2010-06-01

    The methylenetetrahydrofolate reductase (MTHFR) encodes a major enzyme in folate metabolism. It has been suggested that two MTHFR polymorphisms, 677C>T and 1298A>C, influence risk of acute lymphoblastic leukemia (ALL). Most studies on relation of MTHFR polymorphisms to ALL susceptibility have been in pediatric populations because ALL is relatively rare in adults. Here, we report a case-control study of 127 Chinese patients with adult precursor B lymphoblastic leukemia (B-ALL) to examine correlation between the MTHFR polymorphisms and B-ALL susceptibility in adults. Our data show that although the prevalence of genotype 1298CC was significantly higher in the female patients than in the controls (P = 0.04), the differences in distributions of combined genotypes of 1298CC with either 677CC or 677CT between the cases and the controls were statistically insignificant. Haplotype analysis revealed no significant difference between the cases and the controls. The prevalence for joint MTHFR genotypes 677CC/1298AC was significantly lower in the female B-ALL cases than in the controls [odds ratio (OR) = 0.06, 95% CI = 0.00-0.53, P = 0.0033] and no differences among the men [OR = 0.71, 95% CI = 0.20-2.53, P = 0.55], suggesting that protective effects of combined MTHFR 677CC/1298AC genotypes on susceptibility of adult B-ALL are gender bias toward women with 677CC/1298AC women being at a 17-fold reduced odds to develop B-ALL.

  1. The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

    PubMed

    Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

    2011-01-01

    Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

  2. The MATROSHKA experiment: results and comparison from extravehicular activity (MTR-1) and intravehicular activity (MTR-2A/2B) exposure.

    PubMed

    Berger, Thomas; Bilski, Paweł; Hajek, Michael; Puchalska, Monika; Reitz, Günther

    2013-12-01

    Astronauts working and living in space are exposed to considerably higher doses and different qualities of ionizing radiation than people on Earth. The multilateral MATROSHKA (MTR) experiment, coordinated by the German Aerospace Center, represents the most comprehensive effort to date in radiation protection dosimetry in space using an anthropomorphic upper-torso phantom used for radiotherapy treatment planning. The anthropomorphic upper-torso phantom maps the radiation distribution as a simulated human body installed outside (MTR-1) and inside different compartments (MTR-2A: Pirs; MTR-2B: Zvezda) of the Russian Segment of the International Space Station. Thermoluminescence dosimeters arranged in a 2.54 cm orthogonal grid, at the site of vital organs and on the surface of the phantom allow for visualization of the absorbed dose distribution with superior spatial resolution. These results should help improve the estimation of radiation risks for long-term human space exploration and support benchmarking of radiation transport codes.

  3. MtrA of the sodium ion pumping methyltransferase binds cobalamin in a unique mode

    PubMed Central

    Wagner, Tristan; Ermler, Ulrich; Shima, Seigo

    2016-01-01

    In the three domains of life, vitamin B12 (cobalamin) is primarily used in methyltransferase and isomerase reactions. The methyltransferase complex MtrA–H of methanogenic archaea has a key function in energy conservation by catalysing the methyl transfer from methyl-tetrahydromethanopterin to coenzyme M and its coupling with sodium-ion translocation. The cobalamin-binding subunit MtrA is not homologous to any known B12-binding proteins and is proposed as the motor of the sodium-ion pump. Here, we present crystal structures of the soluble domain of the membrane-associated MtrA from Methanocaldococcus jannaschii and the cytoplasmic MtrA homologue/cobalamin complex from Methanothermus fervidus. The MtrA fold corresponds to the Rossmann-type α/β fold, which is also found in many cobalamin-containing proteins. Surprisingly, the cobalamin-binding site of MtrA differed greatly from all the other cobalamin-binding sites. Nevertheless, the hydrogen-bond linkage at the lower axial-ligand site of cobalt was equivalently constructed to that found in other methyltransferases and mutases. A distinct polypeptide segment fixed through the hydrogen-bond linkage in the relaxed Co(III) state might be involved in propagating the energy released upon corrinoid demethylation to the sodium-translocation site by a conformational change. PMID:27324530

  4. Role of outer membrane c-type cytochromes MtrC and OmcA in Shewanella oneidensis MR-1 cell production, accumulation and detachment during respiration on hematite

    USDA-ARS?s Scientific Manuscript database

    The iron-reducing bacterium Shewanella oneidensis MR-1 has the capacity to contribute to iron cycling over the long term by respiring on crystalline iron oxides such as hematite when poorly crystalline phases are depleted. The ability of outer membrane cytochromes OmcA and MtrC of MR-1 to bind to an...

  5. MTR WING, TRA604. PRECAST CONCRETE PANELS AND DIMENSIONS. TYPES A, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604. PRECAST CONCRETE PANELS AND DIMENSIONS. TYPES A, B, C, D, E, AND F; AND HOW THEY ARE CONNECTED. TYPES C AND D ARE ON WEST SIDE WHERE GLASS BLOCKS SURROUND ENTRY DOOR. BLAW-KNOX 3150-804-20, SHEET #1, 11/1950. INL INDEX NO. 531-0604-62-098-100644, REV. 0. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  6. Plasma folate, related genetic variants, and colorectal cancer risk in EPIC.

    PubMed

    Eussen, Simone J P M; Vollset, Stein Emil; Igland, Jannicke; Meyer, Klaus; Fredriksen, Ase; Ueland, Per Magne; Jenab, Mazda; Slimani, Nadia; Boffetta, Paolo; Overvad, Kim; Tjønneland, Anne; Olsen, Anja; Clavel-Chapelon, Françoise; Boutron-Ruault, Marie-Christine; Morois, Sophie; Weikert, Cornelia; Pischon, Tobias; Linseisen, Jakob; Kaaks, Rudolf; Trichopoulou, Antonia; Zilis, Demosthenes; Katsoulis, Michael; Palli, Domenico; Berrino, Franco; Vineis, Paolo; Tumino, Rosario; Panico, Salvatore; Peeters, Petra H M; Bueno-de-Mesquita, H Bas; van Duijnhoven, Fränzel J B; Gram, Inger Torhild; Skeie, Guri; Lund, Eiliv; González, Carlos A; Martínez, Carmen; Dorronsoro, Miren; Ardanaz, Eva; Navarro, Carmen; Rodríguez, Laudina; Van Guelpen, Bethany; Palmqvist, Richard; Manjer, Jonas; Ericson, Ulrika; Bingham, Sheila; Khaw, Kay-Tee; Norat, Teresa; Riboli, Elio

    2010-05-01

    A potential dual role of folate in colorectal cancer (CRC) is currently subject to debate. We investigate the associations between plasma folate, several relevant folate-related polymorphisms, and CRC risk within the large European Prospective Investigation into Cancer and Nutrition cohort. In this nested case-control study, 1,367 incident CRC cases were matched to 2,325 controls for study center, age, and sex. Risk ratios (RR) were estimated with conditional logistic regression and adjusted for smoking, education, physical activity, and intake of alcohol and fiber. Overall analyses did not reveal associations of plasma folate with CRC. The RR (95% confidence interval; Ptrend) for the fifth versus the first quintile of folate status was 0.94 (0.74-1.20; 0.44). The polymorphisms MTHFR677C-->T, MTHFR1298A-->C, MTR2756A-->G, MTRR66A-->G, and MTHFD11958G-->A were not associated with CRC risk. However, in individuals with the lowest plasma folate concentrations, the MTHFR 677TT genotype showed a statistically nonsignificant increased CRC risk [RR (95% CI; Ptrend) TT versus CC=1.39 (0.87-2.21); 0.12], whereas those with the highest folate concentrations showed a nonsignificant decreased CRC risk [RR TT versus CC=0.74 (0.39-1.37); 0.34]. The SLC19A180G-->A showed a positive association with CRC risk [RR AA versus GG 1.30 (1.06-1.59); <0.01]. This large European prospective multicenter study did not show an association of CRC risk with plasma folate status nor with MTHFR polymorphisms. Findings of the present study tend to weaken the evidence that folate plays an important role in CRC carcinogenesis. However, larger sample sizes are needed to adequately address potential gene-environment interactions. Copyright (c) 2010 AACR

  7. 7 CFR 51.2756 - Similar varietal characteristics.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ....2756 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 FRESH FRUITS, VEGETABLES AND OTHER PRODUCTS 1,2 (INSPECTION, CERTIFICATION, AND...

  8. 7 CFR 51.2756 - Similar varietal characteristics.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ....2756 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 FRESH FRUITS, VEGETABLES AND OTHER PRODUCTS 1,2 (INSPECTION, CERTIFICATION, AND...

  9. Role of treatment-modifying MTHFR677C>T and 1298A>C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy.

    PubMed

    Jiménez-Ramírez, Francisco J; Castro, Liza M; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y; Morales-Borges, Raúl H; Miranda-Massari, Jorge R; Duconge, Jorge

    2017-03-01

    The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C>T and 1298A>C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer's exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p<0.0001 and p=0.03, respectively). Results suggest that 1298A>C but not 677C>T is associated with DPN susceptibility in this cohort (p=0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN.

  10. MTR BUILDING, TRA603. DETAILED VIEW OF NORTHWEST CORNERS OF MTR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BUILDING, TRA-603. DETAILED VIEW OF NORTHWEST CORNERS OF MTR HIGH-BAY AND SECOND/THIRD STORY SECTIONS. NOTE SHAPE OF PANEL ABOVE WINDOW OVER "TRA-603" BUILDING NUMBERS. THIS IS A "STANDARD PANEL." INL NEGATIVE NUMBER HD46-42-2. Mike Crane, Photographer, 4/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  11. Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3.

    PubMed

    Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

    2017-03-20

    To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

  12. Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

    NASA Astrophysics Data System (ADS)

    Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

    2017-03-01

    To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels.

  13. Role of treatment-modifying MTHFR677C>T and 1298A > C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy

    PubMed Central

    Jiménez-Ramírez, Francisco J.; Castro, Liza M.; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y.; Morales-Borges, Raúl H.; Miranda-Massari, Jorge R.; Duconge, Jorge

    2017-01-01

    Background The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. Methods DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C > T and 1298A > C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer’s exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Results Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p < 0.0001 and p = 0.03, respectively). Results suggest that 1298A > C but not 677C > T is associated with DPN susceptibility in this cohort (p = 0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Conclusions Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN. PMID:28231061

  14. 21 CFR 73.1298 - Ferric ammonium ferrocyanide.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 1 2011-04-01 2011-04-01 false Ferric ammonium ferrocyanide. 73.1298 Section 73... LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1298 Ferric ammonium ferrocyanide. (a) Identity. (1) The color additive ferric ammonium ferrocyanide is the blue pigment obtained by oxidizing...

  15. 26 CFR 1.1298-0 - Table of contents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Table of contents. 1.1298-0 Section 1.1298-0...) INCOME TAXES Special Rules for Determining Capital Gains and Losses § 1.1298-0 Table of contents. This... deemed sale election. (3) Time for making the deemed sale election. (4) Manner of making the deemed sale...

  16. Mechanical tissue resuscitation (MTR): a nonpharmacological approach to treatment of acute myocardial infarction.

    PubMed

    Jordan, James E; Pereira, Beatriz D; Lane, Magan R; Morykwas, Michael J; McGee, Maria; Argenta, Louis C

    2015-08-01

    Myocardial ischemia-reperfusion injury is known to trigger an inflammatory response involving edema, apoptosis, and neutrophil activation/accumulation. Recently, mechanical tissue resuscitation (MTR) was described as a potent cardioprotective strategy for reduction of myocardial ischemia-reperfusion injury. Here, we further describe the protective actions of MTR and begin to define its therapeutic window. A left ventricular, free-wall ischemic area was created in anesthetized swine for 85 minutes and then reperfused for three hours. Animals were randomized to two groups: (1) untreated controls (Control) and (2) application of MTR that was delayed 90 minutes after the initiation of reperfusion (D90). Hemodynamics and regional myocardial blood flow were assessed at multiple time points. Infarct size and neutrophil accumulation were assessed following the reperfusion period. In separate cohorts, the effect of MTR on myocardial interstitial water (MRI imaging) and blood flow was examined. Both groups had similar areas at risk (AAR), hemodynamics, and arterial blood gas values. MTR, even when delayed 90 minutes into reperfusion (D90, 29.2 ± 5.0% of AAR), reduced infarct size significantly compared to Controls (51.9 ± 2.7%, p = 0.006). This protection was associated with a 33% decrease in neutrophil accumulation (p = 0.047). Improvements in blood flow and interstitial water were also observed. Moreover, we demonstrated that the therapeutic window for MTR lasts for at least 90 minutes following reperfusion. This study confirms our previous observations that MTR is an effective therapeutic approach to reducing reperfusion injury with a clinically useful treatment window. © 2015 Wiley Periodicals, Inc.

  17. Physiological and transcriptional approaches reveal connection between nitrogen and manganese cycles in Shewanella algae C6G3

    PubMed Central

    Aigle, Axel; Bonin, Patricia; Iobbi-Nivol, Chantal; Méjean, Vincent; Michotey, Valérie

    2017-01-01

    To explain anaerobic nitrite/nitrate production at the expense of ammonium mediated by manganese oxide (Mn(IV)) in sediment, nitrate and manganese respirations were investigated in a strain (Shewanella algae C6G3) presenting these features. In contrast to S. oneidensis MR-1, a biotic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during anaerobic growth with Mn(IV) under condition of limiting electron acceptor, concomitantly, with a higher electron donor stoichiometry than expected. This low and reproducible transitory accumulation is the result of production and consumption since the strain is able to dissimilative reduce nitrate into ammonium. Nitrite production in Mn(IV) condition is strengthened by comparative expression of the nitrate/nitrite reductase genes (napA, nrfA, nrfA-2), and rates of the nitrate/nitrite reductase activities under Mn(IV), nitrate or fumarate conditions. Compared with S. oneidensis MR-1, S. algae contains additional genes that encode nitrate and nitrite reductases (napA-α and nrfA-2) and an Outer Membrane Cytochrome (OMC)(mtrH). Different patterns of expression of the OMC genes (omcA, mtrF, mtrH and mtrC) were observed depending on the electron acceptor and growth phase. Only gene mtrF-2 (SO1659 homolog) was specifically expressed under the Mn(IV) condition. Nitrate and Mn(IV) respirations seem connected at the physiological and transcriptional levels. PMID:28317859

  18. 47 CFR 27.56 - Antenna structures; air navigation safety.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 2 2012-10-01 2012-10-01 false Antenna structures; air navigation safety. 27... SERVICES MISCELLANEOUS WIRELESS COMMUNICATIONS SERVICES Technical Standards § 27.56 Antenna structures; air navigation safety. A licensee that owns its antenna structure(s) must not allow such antenna structure(s) to...

  19. 47 CFR 27.56 - Antenna structures; air navigation safety.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 2 2013-10-01 2013-10-01 false Antenna structures; air navigation safety. 27... SERVICES MISCELLANEOUS WIRELESS COMMUNICATIONS SERVICES Technical Standards § 27.56 Antenna structures; air navigation safety. A licensee that owns its antenna structure(s) must not allow such antenna structure(s) to...

  20. 47 CFR 27.56 - Antenna structures; air navigation safety.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 2 2011-10-01 2011-10-01 false Antenna structures; air navigation safety. 27... SERVICES MISCELLANEOUS WIRELESS COMMUNICATIONS SERVICES Technical Standards § 27.56 Antenna structures; air navigation safety. A licensee that owns its antenna structure(s) must not allow such antenna structure(s) to...

  1. 47 CFR 27.56 - Antenna structures; air navigation safety.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 2 2014-10-01 2014-10-01 false Antenna structures; air navigation safety. 27... SERVICES MISCELLANEOUS WIRELESS COMMUNICATIONS SERVICES Technical Standards § 27.56 Antenna structures; air navigation safety. A licensee that owns its antenna structure(s) must not allow such antenna structure(s) to...

  2. Role of Outer Membrane C-Type Cytochromes MtrC and OmcA in Shewanella Oneidensis MR-1 Cell Production, Accumulation, and Detachment During Respiration on Hematite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitchell, Andrew C.; Peterson, L.; Reardon, Catherine L.

    2012-07-01

    Solid phase iron oxides are considered to be important terminal electron acceptors for microbial respiration in many anoxic environments. Besides the knowledge that cells attach to and reduce these substrates, other aspects of surface-associated cell behavior and the related cell surface components that influence cell-mineral interactions are not well understood. In the present study, wild-type cells of the dissimilatory iron-reducing bacterium Shewanella oneidensis MR-1 formed thin biofilms one-to-two cell layers in thickness when respiring on natural specular hematite under flow conditions similar to those which exist in aquatic sediments and subsurface environments. The distribution of cells within the biofilm indicatedmore » that direct contact was not required for electron transfer from cells to the mineral surface. Detached biomass in the form of single cells represented >99% of the surface-associated wild-type cell production from respiration on hematite over the biofilm life cycle. A mutant deficient in the outer membrane c35 type cytochrome OmcA, while still able to respire and replicate on hematite, established a lower steady-state cell density on the mineral surface than that of the wild-type strain. A mutant deficient in MtrC, another outer membrane c-type cytochrome, and a mutant deficient in both cytochromes were unable to reduce sufficient amounts of hematite to support detectable growth on the mineral surface. When considered in the context of previous work, the results support a growing body of evidence that the relative importance of OmcA and MtrC to cell respiration and replication depends on the form of iron oxide available as terminal electron acceptor.« less

  3. MATERIALS TESTING REACTOR (MTR) BUILDING, TRA603. CONTEXTUAL VIEW OF MTR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MATERIALS TESTING REACTOR (MTR) BUILDING, TRA-603. CONTEXTUAL VIEW OF MTR BUILDING SHOWING NORTH SIDES OF THE HIGH-BAY REACTOR BUILDING, ITS SECOND/THIRD FLOOR BALCONY LEVEL, AND THE ATTACHED ONE-STORY OFFICE/LABORATORY BUILDING, TRA-604. CAMERA FACING SOUTHEAST. VERTICAL CONCRETE-SHROUDED BEAMS SUPPORT PRECAST CONCRETE PANELS. CONCRETE PROJECTION FORMED AS A BUNKER AT LEFT OF VIEW IS TRA-657, PLUG STORAGE BUILDING. INL NEGATIVE NO. HD46-42-1. Mike Crane, Photographer, 4/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  4. Are the methylenetetrahydrofolate reductase 1298 and 677 gene polymorphisms related to optic glioma and hamartoma risk in neurofibromatosis type 1 patients?

    PubMed

    Tanyıldız, Hikmet Gülşah; Yeşil, Şule; Bozkurt, Ceyhun; Çandır, Mehmet Onur; Akpınar-Tekgündüz, Sibel; Toprak, Şule; Yüksel, Deniz; Şahin, Gürses

    2016-01-01

    The methylenetetrahydrofolate reductase (MTHFR) gene plays a key role in carcinogenesis through its effects on DNA synthesis and methylation and also has a significant role in the etiology of many disorders, such as diabetes, migraine, and cardiovascular disease. Neurofibromatoses (NF) are autosomal dominant inherited diseases that can affect tissues such as bone and skin and predispose individuals to tumor development in various parts of the nervous system or body. Optic nerve glioma and brain tumors are common in children with NF, and leukemia and lymphoma incidence is also higher than normal. We therefore aimed to investigate the possible relationship between the MTHFR gene polymorphism and accompanying tumors such as neurofibroma, hamartoma, and optic glioma in children with NF1 found to have the MTHFR 677 and MTHFR 1298 gene polymorphism in this study. We included 55 pediatric patients diagnosed with NF1 between 2005 and 2014 in the study group. The control group included 44 healthy subjects without acute or chronic disease findings. A significant relationship was found between the MTHFR A1298C polymorphism and the incidence of optic glioma (p=0.014) (AA vs. AC: OR 11, 95% CI 1.27-95.17; AA vs. CC: OR 7.33, 95% CI 0.35-150.70). We also found a significant relationship between the MTHFR C1298C polymorphism and the incidence of hamartoma (p=0.019) (AA vs. AC: OR 2.12, 95% CI 0.662-6.809; p=0.203). Epilepsy incidence was high in subjects with MTHFR C677C. The MTHFR A1298C, C1298C, and C677C gene polymorphisms can be associated with a higher optic glioma, hamartoma, and epilepsy incidence, respectively, in patients diagnosed with neurofibromatosis type 1.

  5. Respiration of metal (hydr)oxides by Shewanella and Geobacter: a key role for multihaem c-type cytochromes

    PubMed Central

    Shi, Liang; Squier, Thomas C; Zachara, John M; Fredrickson, James K

    2007-01-01

    Dissimilatory reduction of metal (e.g. Fe, Mn) (hydr)oxides represents a challenge for microorganisms, as their cell envelopes are impermeable to metal (hydr)oxides that are poorly soluble in water. To overcome this physical barrier, the Gram-negative bacteria Shewanella oneidensis MR-1 and Geobacter sulfurreducens have developed electron transfer (ET) strategies that require multihaem c-type cytochromes (c-Cyts). In S. oneidensis MR-1, multihaem c-Cyts CymA and MtrA are believed to transfer electrons from the inner membrane quinone/quinol pool through the periplasm to the outer membrane. The type II secretion system of S. oneidensis MR-1 has been implicated in the reduction of metal (hydr)oxides, most likely by translocating decahaem c-Cyts MtrC and OmcA across outer membrane to the surface of bacterial cells where they form a protein complex. The extracellular MtrC and OmcA can directly reduce solid metal (hydr)oxides. Likewise, outer membrane multihaem c-Cyts OmcE and OmcS of G. sulfurreducens are suggested to transfer electrons from outer membrane to type IV pili that are hypothesized to relay the electrons to solid metal (hydr)oxides. Thus, multihaem c-Cyts play critical roles in S. oneidensis MR-1- and G. sulfurreducens-mediated dissimilatory reduction of solid metal (hydr)oxides by facilitating ET across the bacterial cell envelope. PMID:17581116

  6. Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

    PubMed

    Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

    2015-02-01

    To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

  7. Characterization of hMTr1, a Human Cap1 2′-O-Ribose Methyltransferase*

    PubMed Central

    Bélanger, François; Stepinski, Janusz; Darzynkiewicz, Edward; Pelletier, Jerry

    2010-01-01

    Cellular eukaryotic mRNAs are capped at their 5′ ends with a 7-methylguanosine nucleotide, a structural feature that has been shown to be important for conferring mRNA stability, stimulating mRNA biogenesis (splicing, poly(A) addition, nucleocytoplasmic transport), and increasing translational efficiency. Whereas yeast mRNAs have no additional modifications to the cap, called cap0, higher eukaryotes are methylated at the 2′-O-ribose of the first or the first and second transcribed nucleotides, called cap1 and cap2, respectively. In the present study, we identify the methyltransferase responsible for cap1 formation in human cells, which we call hMTr1 (also known as FTSJD2 and ISG95). We show in vitro that hMTr1 catalyzes specific methylation of the 2′-O-ribose of the first nucleotide of a capped RNA transcript. Using siRNA-mediated knockdown of hMTr1 in HeLa cells, we demonstrate that hMTr1 is responsible for cap1 formation in vivo. PMID:20713356

  8. ETR AND MTR COMPLEXES IN CONTEXT. CAMERA FACING NORTHERLY. FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    ETR AND MTR COMPLEXES IN CONTEXT. CAMERA FACING NORTHERLY. FROM BOTTOM TO TOP: ETR COOLING TOWER, ELECTRICAL BUILDING AND LOW-BAY SECTION OF ETR BUILDING, HEAT EXCHANGER BUILDING (WITH U SHAPED YARD), COMPRESSOR BUILDING. MTR REACTOR SERVICES BUILDING IS ATTACHED TO SOUTH WALL OF MTR. WING A IS ATTACHED TO BALCONY FLOOR OF MTR. NEAR UPPER RIGHT CORNER OF VIEW IS MTR PROCESS WATER BUILDING. WING B IS AT FAR WEST END OF COMPLEX. NEAR MAIN GATE IS GAMMA FACILITY, WITH "COLD" BUILDINGS BEYOND: RAW WATER STORAGE TANKS, STEAM PLANT, MTR COOLING TOWER PUMP HOUSE AND COOLING TOWER. INL NEGATIVE NO. 56-4101. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  9. Structure and function of Neisseria gonorrhoeae MtrF illuminates a class of antimetabolite efflux pumps

    DOE PAGES

    Su, Chih -Chia; Bolla, Jani  Reddy; Kumar, Nitin; ...

    2015-04-01

    Neisseria gonorrhoeae is an obligate human pathogen and the causative agent of the sexually transmitted disease gonorrhea. The control of this disease has been compromised by the increasing proportion of infections due to antibiotic-resistant strains, which are growing at an alarming rate. N. gonorrhoeae MtrF is an integral membrane protein that belongs to the AbgT family of transporters for which no structural information is available. Here, we describe the crystal structure of MtrF, revealing a dimeric molecule with architecture distinct from all other families of transporters. MtrF is a bowl-shaped dimer with a solvent-filled basin extending from the cytoplasm tomore » halfway across the membrane bilayer. Each subunit of the transporter contains nine transmembrane helices and two hairpins, posing a plausible pathway for substrate transport. A combination of the crystal structure and biochemical functional assays suggests that MtrF is an antibiotic efflux pump mediating bacterial resistance to sulfonamide antimetabolite drugs.« less

  10. Structure and function of Neisseria gonorrhoeae MtrF illuminates a class of antimetabolite efflux pumps

    PubMed Central

    Su, Chih-Chia; Bolla, Jani Reddy; Kumar, Nitin; Radhakrishnan, Abhijith; Long, Feng; Delmar, Jared A.; Chou, Tsung-Han; Rajashankar, Kanagalaghatta R.; Shafer, William M.; Yu, Edward W.

    2015-01-01

    SUMMARY Neisseria gonorrhoeae is an obligate human pathogen and the causative agent of the sexually-transmitted disease gonorrhea. The control of this disease has been compromised by the increasing proportion of infections due to antibiotic-resistant strains, which are growing at an alarming rate. N. gonorrhoeae MtrF is an integral membrane protein, which belongs to the AbgT family of transporters for which no structural information is available. Here we describe the crystal structure of MtrF, revealing a dimeric molecule with architecture distinct from all other families of transporters. MtrF is a bowl-shaped dimer with a solvent-filled basin extending from the cytoplasm to halfway across the membrane bilayer. Each subunit of the transporter contains nine transmembrane helices and two hairpins, posing a plausible pathway for substrate transport. A combination of the crystal structure and biochemical functional assays suggests that MtrF is an antibiotic efflux pump, mediating bacterial resistance to sulfonamide antimetabolite drugs. PMID:25818299

  11. 26 CFR 1.1298-0T - Passive foreign investment company-table of contents (temporary).

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 11 2014-04-01 2014-04-01 false Passive foreign investment company-table of... Capital Gains and Losses § 1.1298-0T Passive foreign investment company—table of contents (temporary). This section lists the table of contents for § 1.1298-1T. § 1.1298-1TSection 1298(f) annual reporting...

  12. Mutation in a locus linked to penB-nmp causes suppression of the Mtr phenotype of Neisseria gonorrhoeae.

    PubMed Central

    Shinners, E N; Catlin, B W

    1988-01-01

    The chromosomal locus mtr, which encodes low-level resistance to multiple antibacterial agents in Neisseria gonorrhoeae, is subject to phenotypic suppression by env mutations that increase the permeability of the envelope. We have identified a new locus, mom (for modifier of Mtr), which is located on the chromosome very close to penB and nmp, loci known to be linked to each other and to spc. Phenotypic suppression of Mtr was recognized by reductions of resistance to benzylpenicillin and also to oxacillin and the hydrophobic agents novobiocin and erythromycin. The resistance to each of these antibiotics returned to the Mtr levels in mom+ transformants isolated by selection for increased resistance to either novobiocin or erythromycin; the accompanying change of the outer membrane protein I seroreactions confirmed the proximity of nmp and mom. Thus, some mutant gonococci display wild-type antibiotic susceptibilities but can express multiple resistance following a mom+ mutation that releases the suppressed Mtr phenotype. PMID:3142343

  13. MTR WING, TRA604, INTERIOR. BASEMENT. INTERIOR VIEW FROM SAME LOCATION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604, INTERIOR. BASEMENT. INTERIOR VIEW FROM SAME LOCATION IN WEST CORRIDOR AS PHOTO ID-33-G-42 BUT CAMERA FACES SOUTH. SIGN ON DOOR FOR "PIPE TUNNEL" WARNS OF RADIOLOGICAL AND ASBESTOS HAZARDS. DOOR HAS METAL HASPS. SIGN ON OVERHEAD WASTE HEAT RECOVERY PIPES SAYS THEY CONTAIN "ASBESTOS FREE INSULATION." FIRE DOOR AT LEFT LEADS TO STAIRWAY TO FIRST FLOOR. DOOR AT RIGHT LEADS TO ROOM WHICH ONCE CONTAINED MTR LIBRARY. INL NEGATIVE NO. HD46-13-4. Mike Crane, Photographer, 2/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  14. 40 CFR 63.1298 - Standards for slabstock flexible polyurethane foam production-HAP emissions from equipment cleaning.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... polyurethane foam production-HAP emissions from equipment cleaning. 63.1298 Section 63.1298 Protection of... Hazardous Air Pollutants for Flexible Polyurethane Foam Production § 63.1298 Standards for slabstock flexible polyurethane foam production—HAP emissions from equipment cleaning. Each owner or operator of a...

  15. 40 CFR 63.1298 - Standards for slabstock flexible polyurethane foam production-HAP emissions from equipment cleaning.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... polyurethane foam production-HAP emissions from equipment cleaning. 63.1298 Section 63.1298 Protection of... Pollutants for Flexible Polyurethane Foam Production § 63.1298 Standards for slabstock flexible polyurethane foam production—HAP emissions from equipment cleaning. Each owner or operator of a new or existing...

  16. 40 CFR 63.1298 - Standards for slabstock flexible polyurethane foam production-HAP emissions from equipment cleaning.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... polyurethane foam production-HAP emissions from equipment cleaning. 63.1298 Section 63.1298 Protection of... Hazardous Air Pollutants for Flexible Polyurethane Foam Production § 63.1298 Standards for slabstock flexible polyurethane foam production—HAP emissions from equipment cleaning. Each owner or operator of a...

  17. 40 CFR 63.1298 - Standards for slabstock flexible polyurethane foam production-HAP emissions from equipment cleaning.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... polyurethane foam production-HAP emissions from equipment cleaning. 63.1298 Section 63.1298 Protection of... Pollutants for Flexible Polyurethane Foam Production § 63.1298 Standards for slabstock flexible polyurethane foam production—HAP emissions from equipment cleaning. Each owner or operator of a new or existing...

  18. 40 CFR 63.1298 - Standards for slabstock flexible polyurethane foam production-HAP emissions from equipment cleaning.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... polyurethane foam production-HAP emissions from equipment cleaning. 63.1298 Section 63.1298 Protection of... Pollutants for Flexible Polyurethane Foam Production § 63.1298 Standards for slabstock flexible polyurethane foam production—HAP emissions from equipment cleaning. Each owner or operator of a new or existing...

  19. 33 CFR 154.1041 - Specific response information to be maintained on mobile MTR facilities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... be maintained on mobile MTR facilities. 154.1041 Section 154.1041 Navigation and Navigable Waters... maintained on mobile MTR facilities. (a) Each mobile MTR facility must carry the following information as... respond to a discharge from the mobile MTR facility. (3) List of the appropriate persons and agencies...

  20. Preliminary developments of MTR plates with uranium nitride

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Durand, J.P.; Laudamy, P.; Richter, K.

    1997-08-01

    In the opinion of CERCA, the total weight of Uranium per MTR plate (without changing the external dimensions) cannot be further increased using U{sub 3}Si{sub 2}. Limits have been reached on plates with a thicker meat or loaded to 6g Ut/cm{sup 3}. The use of a denser fuel like Uranium mononitride could permit an increase in these limits. A collaboration between the Institute for Transuranium Elements (ITU), Joint Research Centre of the European Commission, and CERCA has been set ut. The preliminary studies at the ITU to check compatibility between aluminium and UN proved that there are no metallurgical interactionsmore » below 500{degrees}C. Feasibility of the manufacturing, on a laboratory scale at CERCA, of depleted Uranium mononitride plates loaded to 7 g Ut/cm{sup 3} has been demonstrated. The manufacturing process, however, is only one aspect of the development of a new fuel. The experience gained in the case of U{sub 3}Si{sub 2} has shown that the development of a new fuel requires considerable time and financial investment. Such a development certainly represents an effort of about 10 years.« less

  1. MTR, SOUTH FACE OF REACTOR. SPECIAL SUPPLEMENTAL SHIELDING WAS REQUIRED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR, SOUTH FACE OF REACTOR. SPECIAL SUPPLEMENTAL SHIELDING WAS REQUIRED OUTSIDE OF MTR FOR EXPERIMENTS. THE AIRCRAFT NUCLEAR PROPULSION PROJECT DOMINATED THE USE OF THIS PART OF THE MTR. INL NEGATIVE NO. 7225. Unknown Photographer, 11/28/1952 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  2. MTR WING A, TRA604, INTERIOR. MAIN FLOOR. DETAIL VIEW INSIDE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING A, TRA-604, INTERIOR. MAIN FLOOR. DETAIL VIEW INSIDE LABORATORY 114. CAMERA FACING NORTH. DISPOSAL OF RADIOACTIVE MATERIALS IS UNDERWAY. INL NEGATIVE NO. HD46-12-4. Mike Crane, Photographer, 2/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  3. Role of Mex67-Mtr2 in the Nuclear Export of 40S Pre-Ribosomes

    PubMed Central

    Occhipinti, Laura; Kemmler, Stefan; Panse, Vikram G.

    2012-01-01

    Nuclear export of mRNAs and pre-ribosomal subunits (pre40S and pre60S) is fundamental to all eukaryotes. While genetic approaches in budding yeast have identified bona fide export factors for mRNAs and pre60S subunits, little is known regarding nuclear export of pre40S subunits. The yeast heterodimeric transport receptor Mex67-Mtr2 (TAP-p15 in humans) binds mRNAs and pre60S subunits in the nucleus and facilitates their passage through the nuclear pore complex (NPC) into the cytoplasm by interacting with Phe-Gly (FG)-rich nucleoporins that line its transport channel. By exploiting a combination of genetic, cell-biological, and biochemical approaches, we uncovered an unanticipated role of Mex67-Mtr2 in the nuclear export of 40S pre-ribosomes. We show that recruitment of Mex67-Mtr2 to pre40S subunits requires loops emanating from its NTF2-like domains and that the C-terminal FG-rich nucleoporin interacting UBA-like domain within Mex67 contributes to the transport of pre40S subunits to the cytoplasm. Remarkably, the same loops also recruit Mex67-Mtr2 to pre60S subunits and to the Nup84 complex, the respective interactions crucial for nuclear export of pre60S subunits and mRNAs. Thus Mex67-Mtr2 is a unique transport receptor that employs a common interaction surface to participate in the nuclear export of both pre-ribosomal subunits and mRNAs. Mex67-Mtr2 could engage a regulatory crosstalk among the three major export pathways for optimal cellular growth and proliferation. PMID:22956913

  4. MTR BASEMENT. WORKERS (DON ALVORD AND CYRIL VAN ORDEN OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BASEMENT. WORKERS (DON ALVORD AND CYRIL VAN ORDEN OF PHILLIPS PETROLEUM CO.) POSE FOR GAMMA IRRADIATION EXPERIMENT IN MTR CANAL. CANS OF FOOD WILL BE LOWERED TO CANAL BOTTOM, WHERE SPENT MTR FUEL ELEMENTS EMIT GAMMA RADIATION. INL NEGATIVE NO. 11746. Unknown Photographer, 8/20/1954 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  5. MTR WING A, TRA604. SOUTH SIDE. CAMERA FACING NORTH. THIS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING A, TRA-604. SOUTH SIDE. CAMERA FACING NORTH. THIS VIEW TYPIFIES TENDENCY FOR EXPANSIONS TO TAKE THE FORM OF PROJECTIONS AND INFILL USING AVAILABLE YARD SPACES. INL NEGATIVE NO. HD47-44-3. Mike Crane, Photographer, 4/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  6. MTR WING A, TRA604, INTERIOR. BASEMENT. DETAIL OF A19 LAB ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING A, TRA-604, INTERIOR. BASEMENT. DETAIL OF A-19 LAB AREA ALONG SOUTH WALL. SIGN ON FLOOR DIRECTS WORKERS TO OBTAIN WHOLE BODY FRISK UPON LEAVING AREA. SIGN ON EQUIPMENT IN CENTER OF VIEW REQUESTS WORKERS TO "NOTIFY HEALTH PHYSICS BEFORE WORKING ON THIS SYSTEM." CAMERA FACING SOUTHWEST. INL NEGATIVE NO. HD46-13-2. Mike Crane, Photographer, 2/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  7. The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

    PubMed

    Frøystein, N A; Sletten, E

    1991-03-01

    The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

  8. 40 CFR 180.1298 - Trichoderma hamatum isolate 382; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Trichoderma hamatum isolate 382... RESIDUES IN FOOD Exemptions From Tolerances § 180.1298 Trichoderma hamatum isolate 382; exemption from the... Trichoderma hamatum isolate 382 in or on all food commodities when applied as a fungicide and used in...

  9. 40 CFR 180.1298 - Trichoderma hamatum isolate 382; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 24 2014-07-01 2014-07-01 false Trichoderma hamatum isolate 382... RESIDUES IN FOOD Exemptions From Tolerances § 180.1298 Trichoderma hamatum isolate 382; exemption from the... Trichoderma hamatum isolate 382 in or on all food commodities when applied as a fungicide and used in...

  10. 40 CFR 180.1298 - Trichoderma hamatum isolate 382; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 25 2012-07-01 2012-07-01 false Trichoderma hamatum isolate 382... RESIDUES IN FOOD Exemptions From Tolerances § 180.1298 Trichoderma hamatum isolate 382; exemption from the... Trichoderma hamatum isolate 382 in or on all food commodities when applied as a fungicide and used in...

  11. 40 CFR 180.1298 - Trichoderma hamatum isolate 382; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 25 2013-07-01 2013-07-01 false Trichoderma hamatum isolate 382... RESIDUES IN FOOD Exemptions From Tolerances § 180.1298 Trichoderma hamatum isolate 382; exemption from the... Trichoderma hamatum isolate 382 in or on all food commodities when applied as a fungicide and used in...

  12. Clinical outcomes and hospital length of stay in 2,756 elderly patients with hip fractures: a comparison of surgical and non-surgical management.

    PubMed

    Tan, Stephen Thong Soon; Tan, Wei Ping Marcus; Jaipaul, Josephine; Chan, Siew Pang; Sathappan, Sathappan S

    2017-05-01

    The purpose of this study was to compare the clinical outcomes of elderly hip fracture patients who received surgical treatment with those who received non-surgical treatment. This retrospective study involved 2,756 elderly patients with hip fractures who were admitted over a six-year period. The patients' biodata, complications, ambulatory status at discharge and length of hospital stay were obtained from the institution's hip fracture registry. Among the 2,756 hip fracture patients, 2,029 (73.6%) underwent surgical intervention, while 727 (26.4%) opted for non-surgical intervention. The complication rate among the patients who underwent surgical intervention was 6.6%, while that among the patients who underwent non-surgical intervention was 12.5% (p < 0.01). The mean length of hospital stay for the surgical and non-surgical hip fracture patients was 15.7 days and 22.4 days, respectively (p < 0.01). Surgical management of hip fractures among the elderly is associated with a lower complication rate, as well as a reduced length of hospital stay. Copyright: © Singapore Medical Association

  13. MTR WING, TRA604. A LABORATORY ROOM WITH ITS CABINETS AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604. A LABORATORY ROOM WITH ITS CABINETS AND SERVICE STRIP DOWN CENTER OF ROOM. CARD IN LEFT CORNER OF VIEW WAS INSERTED BY INL PHOTOGRAPHER TO COVER AN OBSOLETE SECURITY RESTRICTION PRINTED ON THE ORIGINAL NEGATIVE. INL NEGATIVE NO. 3817. Unknown Photographer, 11/28/1951 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  14. MTR AND ETR COMPLEXES. CAMERA FACING EASTERLY TOWARD CHEMICAL PROCESSING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR AND ETR COMPLEXES. CAMERA FACING EASTERLY TOWARD CHEMICAL PROCESSING PLANT. MTR AND ITS ATTACHMENTS IN FOREGROUND. ETR BEYOND TO RIGHT. INL NEGATIVE NO. 56-4100. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  15. Toward optimal set of single nucleotide polymorphism investigation before IVF.

    PubMed

    Ivanov, A V; Dedul, A G; Fedotov, Y N; Komlichenko, E V

    2016-10-01

    At present, the patient preparation for IVF needs to undergo a series of planned tests, including the genotyping of single nucleotide polymorphism (SNP) alleles of some genes. In former USSR countries, such investigation was not included in overwhelming majority of health insurance programs and paid by patient. In common, there are prerequisites to the study of more than 50 polymorphisms. An important faced task is to determine the optimal panel for SNP genotyping in terms of price/number of SNP. During 2009-2015 in the University Hospital of St. Petersburg State University, blood samples were analyzed from 550 women with different reproductive system disorders preparing for IVF and 46 healthy women in control group. In total, 28 SNP were analyzed in the genes of thrombophilia factors, folic acid cycle, detoxification system, and the renin-angiotensin system. The method used was real-time PCR. A significant increase in the frequency of pathological alleles of some polymorphisms in patients with habitual failure of IVF was shown, compared with the control group. As a result, two options defined panels for optimal typing SNP before IVF were composed. Standard panel includes 8 SNP, 5 in thromborhilic factors, and 3 in folic acid cycle genes. They are 20210 G > A of FII gene, R506Q G > A of FV gene (mutation Leiden), -675 5G > 4G of PAI-I gene, L33P T > C of ITGB3 gene, -455 G > A of FGB gene, 667 C > T of MTHFR gene, 2756 A > G of MTR gene, and 66 A > G of MTRR gene. Extended panel of 15 SNP also includes 807 C > T of ITGA2 gene, T154M C > T of GP1BA gene, second polymorphism 1298 A > C in MTHFR gene, polymorphisms of the renin-angiotensin gene AGT M235T T > C and -1166 A > C of AGTR1 gene, polymorphisms I105V A > G and A114V C > T of detoxification system gene GSTP. The results of SNP genotyping can be adjusted for treatment tactics and IVF, and also medical support getting pregnant. The success rate of

  16. ENGINEERING TEST REACTOR, TRA642. CONTEXTUAL VIEW ORIENTATING ETR TO MTR. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    ENGINEERING TEST REACTOR, TRA-642. CONTEXTUAL VIEW ORIENTATING ETR TO MTR. CAMERA IS ON ROOF OF MTR BUILDING AND FACES DUE SOUTH. MTR SERVICE BUILDING, TRA-635, IN LOWER RIGHT CORNER. STEEL FRAMES SHOW BUILDINGS TO BE ATTACHED TO ETR BUILDING. HIGH-BAY SECTION IN CENTER IS REACTOR BUILDING. TWO-STORY CONTROL ROOM AND OFFICE BUILDING, TRA-647, IS BETWEEN IT AND MTR SERVICE BUILDING. STRUCTURE TO THE LEFT (WITH NO FRAMING YET) IS COMPRESSOR BUILDING, TRA-643, AND BEYOND IT WILL BE HEAT EXCHANGER BUILDING, TRA-644, GREAT SOUTHERN BUTTE ON HORIZON. INL NEGATIVE NO. 56-2382. Jack L. Anderson, Photographer, 6/10/1956 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  17. MTR BUILDING AND BALCONY FLOORS. CAMERA FACING EASTERLY. PHOTOGRAPHER DID ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BUILDING AND BALCONY FLOORS. CAMERA FACING EASTERLY. PHOTOGRAPHER DID NOT EXPLAIN DARK CLOUD. MTR WING WILL ATTACH TO GROUND FLOOR. INL NEGATIVE NO. 1567. Unknown Photographer, 2/28/1951 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  18. CONTEXTUAL AERIAL VIEW OF "EXCLUSION" MTR AREA WITH IDAHO CHEMICAL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    CONTEXTUAL AERIAL VIEW OF "EXCLUSION" MTR AREA WITH IDAHO CHEMICAL PROCESSING PLANT IN BACKGROUND AT CENTER TOP OF VIEW. CAMERA FACING EAST. EXCLUSION GATE HOUSE AT LEFT OF VIEW. BEYOND MTR BUILDING AND ITS WING, THE PROCESS WATER BUILDING AND WORKING RESERVOIR ARE LEFT-MOST. FAN HOUSE AND STACK ARE TO ITS RIGHT. PLUG STORAGE BUILDING IS RIGHT-MOST STRUCTURE. NOTE FAN LOFT ABOVE MTR BUILDING'S ONE-STORY WING. THIS WAS LATER CONVERTED FOR OFFICES. INL NEGATIVE NO. 3610. Unknown Photographer, 10/30/1951 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  19. miR-1298 inhibits mutant KRAS-driven tumor growth by repressing FAK and LAMB3

    PubMed Central

    Zhou, Ying; Dang, Jason; Chang, Kung-Yen; Yau, Edwin; Aza-Blanc, Pedro; Moscat, Jorge; Rana, Tariq M.

    2016-01-01

    Global microRNA functional screens can offer a strategy to identify synthetic lethal interactions in cancer cells that might be exploited therapeutically. In this study, we applied this strategy to identify novel gene interactions in KRAS mutant cancer cells. In this manner, we discovered miR-1298, a novel miRNA that inhibited the growth of KRAS-driven cells both in vitro and in vivo. Using miR-TRAP affinity purification technology, we identified the tyrosine kinase FAK and the laminin subunit LAMB3 as functional targets of miR-1298. Silencing of FAK or LAMB3 recapitulated the synthetic lethal effects of miR-1298 expression in KRAS-driven cancer cells, whereas co-expression of both proteins was critical to rescue miR-1298-induced cell death. Expression of LAMB3 but not FAK was upregulated by mutant KRAS. In clinical specimens, elevated LAMB3 expression correlated with poorer survival in lung cancer patients with an oncogenic KRAS gene signature, suggesting a novel candidate biomarker in this disease setting. Our results define a novel regulatory pathway in KRAS-driven cancers which offers a potential therapeutic target for their eradication PMID:27698189

  20. REACTIVITY MEASUREMENT FACILITY, UNDER CONSTRUCTION OVER MTR CANAL IN BASEMENT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    REACTIVITY MEASUREMENT FACILITY, UNDER CONSTRUCTION OVER MTR CANAL IN BASEMENT OF MTR BUILDING, TRA-603. WOOD PLANKS REST ON CANAL WALL OBSERVABLE IN FOREGROUND. INL NEGATIVE NO. 11745. Unknown Photographer, 8/20/1954 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  1. The methylenetetrahydrofolate reductase (MTHFR) 677 C>T polymorphism increases the risk of developing chronic myeloid leukemia-a case-control study.

    PubMed

    Bănescu, Claudia; Iancu, Mihaela; Trifa, Adrian P; Macarie, Ioan; Dima, Delia; Dobreanu, Minodora

    2015-04-01

    The methylenetetrahydrofolate reductase (MTHFR) 677 C>T and 1298 A>C polymorphisms are associated with variations in folate levels, a phenomenon linked to the development of various malignancies. The aim of this study was to investigate the influence of the 677 C>T and 1298 A>C polymorphisms in the MTHFR gene on the risk of developing chronic myeloid leukemia (CML). Our study included 151 patients with CML and 305 controls. The MTHFR 677 C>T and 1298 A>C polymorphisms were investigated by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and allele-specific PCR techniques. The CT and TT genotypes of the MTHFR 677 C>T polymorphism were associated with an increased risk of developing CML (odds ratio (OR) = 1.556, 95% confidence interval (CI) = 1.017-2.381, p value = 0.041, and OR = 1.897, 95% CI = 1.046-3.44, p value = 0.035, respectively). No association was observed between the prognostic factors (blasts, basophils, additional chromosomal abnormalities, EUTOS score, Sokal and Hasford risk groups) and the MTHFR 677 C>T and 1298 A>C variant genotypes in CML patients. Our study shows that the MTHFR 677 C>T polymorphism is significantly associated with the risk of CML in Romanian patients.

  2. PRECONSTRUCTION IMAGE OF THE MTR SITE. ABANDONED IRRIGATION CANAL (FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PRE-CONSTRUCTION IMAGE OF THE MTR SITE. ABANDONED IRRIGATION CANAL (FROM EARLY 1900s) ILLUSTRATES FLATNESS OF MTR/TRA TERRAIN. FEATURE ON HORIZON IN LEFT OF VIEW IS EXPLORATORY WATER DRILLING EQUIPMENT. CAMERA LOOKS SOUTHEAST. INL NEGATIVE NO. 136. Unknown Photographer, 12/5/1949 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  3. Artificial neural network-based exploration of gene-nutrient interactions in folate and xenobiotic metabolic pathways that modulate susceptibility to breast cancer.

    PubMed

    Naushad, Shaik Mohammad; Ramaiah, M Janaki; Pavithrakumari, Manickam; Jayapriya, Jaganathan; Hussain, Tajamul; Alrokayan, Salman A; Gottumukkala, Suryanarayana Raju; Digumarti, Raghunadharao; Kutala, Vijay Kumar

    2016-04-15

    In the current study, an artificial neural network (ANN)-based breast cancer prediction model was developed from the data of folate and xenobiotic pathway genetic polymorphisms along with the nutritional and demographic variables to investigate how micronutrients modulate susceptibility to breast cancer. The developed ANN model explained 94.2% variability in breast cancer prediction. Fixed effect models of folate (400 μg/day) and B12 (6 μg/day) showed 33.3% and 11.3% risk reduction, respectively. Multifactor dimensionality reduction analysis showed the following interactions in responders to folate: RFC1 G80A × MTHFR C677T (primary), COMT H108L × CYP1A1 m2 (secondary), MTR A2756G (tertiary). The interactions among responders to B12 were RFC1G80A × cSHMT C1420T and CYP1A1 m2 × CYP1A1 m4. ANN simulations revealed that increased folate might restore ER and PR expression and reduce the promoter CpG island methylation of extra cellular superoxide dismutase and BRCA1. Dietary intake of folate appears to confer protection against breast cancer through its modulating effects on ER and PR expression and methylation of EC-SOD and BRCA1. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. MTR and In-vivo 1H-MRS studies on mouse brain with parkinson's disease

    NASA Astrophysics Data System (ADS)

    Yoon, Moon-Hyun; Kim, Hyeon-Jin; Chung, Jin-Yeung; Doo, Ah-Reum; Park, Hi-Joon; Kim, Seung-Nam; Choe, Bo-Young

    2012-12-01

    The aim of this study was to investigate whether the changes in the magnetization transfer ratio (MTR) histogram are related to specific characteristics of Parkinson's disease (PD) and to investigate whether the MTR histogram parameters are associated with neurochemical dysfunction by performing in vivo proton magnetic resonance spectroscopy (1H-MRS). MTR and in vivo 1H-MRS studies were performed on control mice (n = 10) and 1-methyl-1,2,3,6-tetrahydropyridine intoxicated mice (n = 10). All the MTR and in vivo 1H-MRS experiments were performed on a 9.4 T MRI/MRS system (Bruker Biospin, Germany) using a standard head coil. The protondensity fast spin echo (FSE) images and the T2-weighted spin echo (SE) images were acquired with no gap. Outer volume suppression (OVS), combined with the ultra-short echo-time stimulated echo acquisition mode (STEAM), was used for the localized in-vivo 1H-MRS. The quantitative analysis of metabolites was performed from the 1H spectra obtained in vivo on the striatum (ST) by using jMRUI (Lyon, France). The peak height of the MTR histograms in the PD model group was significantly lower than that in the control group (p < 0.05). The midbrain MTR values for volume were lower in the PD group than the control group(p < 0.05). The complex peak (Glx: glutamine+glutamate+ GABA)/creatine (Cr) ratio of the right ST in the PD group was significantly increased as compared to that of the control group. The present study revealed that the peak height of the MTR histogram was significantly decreased in the ST and substantia nigra, and a significant increase in the Gl x /Cr ratio was found in the ST of the PD group, as compared with that of the control group. These findings could reflect the early phase of neuronal dysfunction of neurotransmitters.

  5. L-Area STS MTR/NRU/NRX Grapple Assembly Closure Mechanics Review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huizenga, D. J.

    2016-06-08

    A review of the closure mechanics associated with the Shielded Transfer System (STS) MTR/NRU/NRX grapple assembly utilized at the Savannah River Site (SRS) was performed. This review was prompted by an operational event which occurred at the Canadian Nuclear Laboratories (CNL) utilizing a DTS-XL grapple assembly which is essentially identical to the STS MTR/NRU/NRX grapple assembly used at the SRS. The CNL operational event occurred when a NRU/NRX fuel basket containing spent nuclear fuel assemblies was inadvertently released by the DTS-XL grapple assembly during a transfer. The SM review of the STS MTR/NRU/NRX grapple assembly will examine the operational aspectsmore » of the STS and the engineered features of the STS which prevent such an event at the SRS. The design requirements for the STS NRU/NRX modifications and the overall layout of the STS are provided in other documents.« less

  6. Methylenetetrahydrofolate reductase polymorphism C677T is a protective factor for pediatric acute lymphoblastic leukemia in the Chinese population: a meta-analysis.

    PubMed

    Wang, Haigang; Meng, Lujing; Zhao, Lixia; Wang, Jiali; Liu, Xinchun; Mi, Wenjie

    2012-12-01

    Two polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, were hypothesized to decrease the risk of acute lymphoblastic leukemia (ALL). Studies examining the associations between these two polymorphisms and ALL susceptibility drew inconsistent results. To obtain a reliable conclusion in a Chinese population, we carried out a meta-analysis. In total, 11 studies on C677T polymorphism (1597 cases and 2295 controls) and 10 studies on A1298C polymorphism (1553 cases and 2224 controls) were included in the meta-analysis. We found a significant association between the 677T variant and reduced ALL risk in Chinese children (Dominant model: odds ratio [OR(FE)]=0.73, 95% confidence interval [CI]: 0.63-0.86, p<0.01). Heterogeneity between the studies in the children subgroup was weak and vanished after excluding one study deviating from HWE in the control group (p>0.1). In the adult subgroup, there was no significant association between the C677T variant and ALL risk (Dominant model: OR(RE)=0.88, 95% CI: 0.45-1.72, p=0.72). Significant heterogeneity was found in the adult subgroup in all the genetic model tests (p<0.1). The A1298C polymorphism had an effect on ALL risk neither in adults (Dominant model: OR(FE)=0.95, 95% CI: 0.71-1.27, p=0.72) nor in children (Dominant model: OR(FE)=1.02, 95% CI: 0.87-1.21, p=0.77). No significant heterogeneity between studies on A1298C polymorphism was found in the meta-analysis (p>0.1). The results showed that there was a protective effect of the MTHFR C677T variant on ALL risk in Chinese children.

  7. 76 FR 24910 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-03

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of a Currently Approved Information Collection; Comment Request ACTION: 30-Day notice of information collection under review: Forms G- 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of...

  8. MTR BUILDING INTERIOR, TRA603. BASEMENT. CAMERA IN WEST CORRIDOR FACING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BUILDING INTERIOR, TRA-603. BASEMENT. CAMERA IN WEST CORRIDOR FACING SOUTH. FREIGHT ELEVATOR IS AT RIGHT OF VIEW. AT CENTER VIEW IS MTR VAULT NO. 1, USED TO STORE SPECIAL OR FISSIONABLE MATERIALS. INL NEGATIVE NO. HD46-6-3. Mike Crane, Photographer, 2/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  9. Transportation of spent MTR fuels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Raisonnier, D.

    1997-08-01

    This paper gives an overview of the various aspects of MTR spent fuel transportation and provides in particular information about the on-going shipment of 4 spent fuel casks to the United States. Transnucleaire is a transport and Engineering Company created in 1963 at the request of the French Atomic Energy Commission. The company followed the growth of the world nuclear industry and has now six subsidiaries and affiliated companies established in countries with major nuclear programs.

  10. Analysis of canine herpesvirus gB, gC and gD expressed by a recombinant vaccinia virus.

    PubMed

    Xuan, X; Kojima, A; Murata, T; Mikami, T; Otsuka, H

    1997-01-01

    The genes encoding the canine herpesvirus (CHV) glycoprotein B (gB), gC and gD homologues have been reported already. However, products of these genes have not been identified yet. Previously, we have identified three CHV glycoproteins, gp 145/112, gp80 and gp47 using a panel of monoclonal antibodies (MAbs). To determine which CHV glycoprotein corresponds to gB, gC or gD, the putative genes of gB, gC, and gD of CHV were inserted into the thymidine kinase gene of vaccinia virus LC16mO strain under the control of the early-late promoter for the vaccinia virus 7.5-kilodalton polypeptide. We demonstrated here that gp145/112, gp80 and gp47 were the translation products of the CHV gB, gC and gD genes, respectively. The antigenic authenticity of recombinant gB, gC and gD were confirmed by a panel of MAbs specific for each glycoprotein produced in CHV-infected cells. Immunization of mice with these recombinants produced high titers of neutralizing antibodies against CHV. These results suggest that recombinant vaccinia viruses expressing CHV gB, gC and gD may be useful to develop a vaccine to control CHV infection.

  11. Membrane topology analysis of Escherichia coli K-12 Mtr permease by alkaline phosphatase and beta-galactosidase fusions.

    PubMed

    Sarsero, J P; Pittard, A J

    1995-01-01

    The mtr gene of Escherichia coli K-12 encodes an inner membrane protein which is responsible for the active transport of trypotophan into the cell. It has been proposed that the Mtr permease has a novel structure consisting of 11 hydrophobic transmembrane spans, with a cytoplasmically disposed amino terminus and a carboxyl terminus located in the periplasmic space (J.P. Sarsero, P. J. Wookey, P. Gollnick, C. Yanofsky, and A.J. Pittard, J. Bacteriol. 173:3231-3234, 1991). The validity of this model was examined by the construction of fusion proteins between the Mtr permease and alkaline phosphatase or beta-galactosidase. In addition to the conventional methods, in which the reporter enzyme replaces a carboxyl-terminal portion of the membrane protein, the recently developed alkaline phosphatase sandwich fusion technique was utilized, in which alkaline phosphatase is inserted into an otherwise intact membrane protein. A cluster of alkaline phosphatase fusions to the carboxyl-terminal end of the Mtr permease exhibited high levels of alkaline phosphatase activity, giving support to the proposition of a periplasmically located carboxyl terminus. The majority of fusion proteins produced enzymatic activities which were in agreement with the positions of the fusion sites on the proposed topological model of the permease. The synthesis of a small cluster of hybrid proteins, whose enzymatic activity did not agree with the location of their fusion sites within putative transmembrane span VIII or the preceding periplasmic loop, was not detected by immunological techniques and did not necessitate modification of the proposed model in this region. Slight alterations may need to be made in the positioning of the carboxyl-terminal end of transmembrane span X.

  12. Connection between nitrogen and manganese cycles revealed by transcriptomic analysis in Shewanella algae C6G3

    NASA Astrophysics Data System (ADS)

    Michotey, V.; Aigle, A.; Armougom, F.; Mejean, V.; Guasco, S.; Bonin, P.

    2016-02-01

    In sedimentary systems, the repartition of terminal electron-accepting molecules is often stratified on a permanent or seasonal basis. Just below to oxic zone, the suboxic one is characterized by high concentrations of oxidized inorganic compounds such as nitrate, manganese oxides (MnIII/IV) and iron oxides that are in close vicinity. Several studies have reported unexpected anaerobic nitrite/nitrate production at the expense of ammonium mediated by MnIII/IV, however this transient processes is difficult to discern and poorly understood. In the frame of this study, genes organization of nitrate and MnIII/IV respiration was investigated in S.algae. Additional genes were identified in S. algae compare to S. oneidensis: genes coding for nitrate and nitrite reductase (napA-a and nrfA-2) and an OMC protein (mtrH). In contrast to S. oneidensis, an anaerobic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during growth with MnIII/IV, concomitantly with expression of nitrate/nitrite reductase genes (napA, nrfA, nrfA-2). Among the hypothesis explaining this data, the potential putative expression of unidentified gene able to perform ammonium oxidation was not observed on the global transcriptional level, however several signs of oxidative stress were detected and the existence of a secondary reaction generated by a putative oxidative s could not be excluded. Another option could be the action of reverse reaction by an enzyme such as NrfA or NrfA-2 due to the electron flow equilibrium. Whatever the electron acceptor (Nitrate/ MnIII/IV), the unexpected expression level of of omcA, mtrF, mtrH, mtrC was observed and peaked at the end of the exponential phase. Different expression patterns of the omc genes were observed depending on electron acceptor and growth phase. Only mtrF-2 gene was specifically expressed in Mn(III/IV) condition. Nitrate and Mn(III/IV) respirations seem connected at physiological as well as at transcriptional level

  13. A Decaheme Cytochrome as a Molecular Electron Conduit in Dye-Sensitized Photoanodes

    PubMed Central

    Hwang, Ee Taek; Sheikh, Khizar; Orchard, Katherine L; Hojo, Daisuke; Radu, Valentin; Lee, Chong-Yong; Ainsworth, Emma; Lockwood, Colin; Gross, Manuela A; Adschiri, Tadafumi; Reisner, Erwin; Butt, Julea N; Jeuken, Lars J C

    2015-01-01

    In nature, charge recombination in light-harvesting reaction centers is minimized by efficient charge separation. Here, it is aimed to mimic this by coupling dye-sensitized TiO2 nanocrystals to a decaheme protein, MtrC from Shewanella oneidensis MR-1, where the 10 hemes of MtrC form a ≈7-nm-long molecular wire between the TiO2 and the underlying electrode. The system is assembled by forming a densely packed MtrC film on an ultra-flat gold electrode, followed by the adsorption of approximately 7 nm TiO2 nanocrystals that are modified with a phosphonated bipyridine Ru(II) dye (RuP). The step-by-step construction of the MtrC/TiO2 system is monitored with (photo)electrochemistry, quartz-crystal microbalance with dissipation (QCM-D), and atomic force microscopy (AFM). Photocurrents are dependent on the redox state of the MtrC, confirming that electrons are transferred from the TiO2 nanocrystals to the surface via the MtrC conduit. In other words, in these TiO2/MtrC hybrid photodiodes, MtrC traps the conduction-band electrons from TiO2 before transferring them to the electrode, creating a photobioelectrochemical system in which a redox protein is used to mimic the efficient charge separation found in biological photosystems. PMID:26180522

  14. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

    PubMed Central

    Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

    2017-01-01

    Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

  15. PUMP HOUSE FOR MTR WELL NO. 1, TRA601. FLOOR PLAN, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PUMP HOUSE FOR MTR WELL NO. 1, TRA-601. FLOOR PLAN, ELEVATIONS, SECTION SHOWING WELL CASING, ROOF FRAMING PLAN. AS BUILT. WELL HOUSE FOR WELL NO. 2, TRA-602, WAS IDENTICAL IN ALL PARTICULARS EXCEPT FLOOR DIMENSIONS AND ARRANGEMENT OF PUMP AND ELECTRICAL EQUIPMENT INSIDE. IDAHO OPERATIONS OFFICE MTR-601-IDO-1, 12/1954. INL INDEX NO. 531-0601-00-396-110463, REV. 2. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  16. Thermodynamics of Electron Flow in the Bacterial Deca-heme Cytochrome MtrF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Breuer, Marian; Zarzycki, Piotr P.; Blumberger, Jochen

    2012-07-01

    Electron transporting multiheme cytochromes are essential to the metabolism of microbes that inhabit soils and carry out important biogeochemical processes. Recently the first crystal structure of a prototype bacterial deca-heme cytochrome (MtrF) has been resolved and its electrochemistry characterized. However, the molecular details of electron conductance along heme chains in the cytochrome are difficult to access via experiment due to the nearly identical chemical nature of the heme cofactors. Here we employ large-scale molecular dynamics simulations to compute the reduction potentials of the ten hemes of MtrF in aqueous solution. We find that as a whole they fall within amore » range of about 0.3 V in agreement with experiment. Individual reduction potentials give rise to a free energy profile for electron conduction that is approximately symmetric with respect to the center of the protein. Our calculations indicate that there is no significant potential bias along the orthogonal octa- and tetra-heme chains suggesting that under aqueous conditions MtrF is a nearly reversible two-dimensional conductor.« less

  17. The carriers of the A/G-G/G allelic combination of the c.2039 A>G and c.-29 G>A FSH receptor polymorphisms retrieve the highest number of oocytes in IVF/ICSI cycles.

    PubMed

    Allegra, Adolfo; Marino, Angelo; Raimondo, Stefania; Maiorana, Antonio; Gullo, Salvatore; Scaglione, Piero; Volpes, Aldo; Alessandro, Riccardo

    2017-02-01

    The objective of this study was the elucidation of the possible role of the single-nucleotide polymorphisms (SNP) at position -29 and 2039 of the FSH receptor gene (FSHR) as independent predictive markers of ovarian response. Indeed, the tailoring of reproductive treatments is crucial for both maximizing the success of IVF patients and obtaining a reduction in hypo- or hyper-response rates. This prospective, observational study analyzed the association of -29 and 2039 FSHR polymorphisms with the number of retrieved oocytes in 140 patients attending an IVF/ICSI cycle for severe male factors (≤5,000,000 spermatozoa/mL) or tubal factors at the ANDROS Day Surgery Clinic, Palermo, Italy. The results of this study demonstrate that the genetic combination of A/G for polymorphism c.2039 A>G with G/G for polymorphism c.-29 G>A is significantly associated with the highest number of collected oocytes (p = 0.03). This association was significant even after controlling for the effect of other clinical variables. The A/G-G/G allelic variant, identified as an independent variable, if confirmed in a larger number of patients, could be considered as a new genetic biomarker, which could increase the efficacy of prediction models for ovarian stimulation.

  18. Cilioretinal artery: Vasculogenesis might be promoted by plasminogen activator inhibitor-1 5G allele.

    PubMed

    Yilmaz, Sarenur; Ardagil, Aylin; Akalin, Ibrahim; Altinel, Meltem Guzin; Dag, Yasar; Kurum, Esra; Koyun, Efe; Ari Yaylali, Sevil; Bayramlar, Huseyin

    2017-01-01

    Cilioretinal arteries (CAs) represent enlargements of microscopic and early established collaterals formed via vasculogenesis between choroidal and retinal circulations. We aimed to investigate whether genetic tendency to thrombosis due to well-known gene polymorphisms may induce CA vasculogenesis in embryonic life. We assessed plasminogen activator inhibitor-1 (PAI-1) 4G/5G, methylenetetrahydrofolatereductase (MTHFR), FACTOR V LEIDEN and PROTHROMBIN gene polymorphisms on 130 patients [82/48 females/males; Median age: 57 (18-84) with visible CAs and 100 (64/36: female/male; Median age: 55 (19-90)] without visible CAs. Using multiple logistic regression models, we found PAI-1 4G/5G; MTHFR (C677T and A1298C) polymorphisms to have significant effects on the probability of visible CAs, that having at least one 5G allele would increase the odds of having visible cilioretinal artery by 98.4% [Odds ratio: 1984 (95% CI: 1.320-3.000, p = 0.001)], and having at least one MTHFR C677T or A1298C allele would decrease the odds of having visible CAs by approximately 38% (OR = 0.618, 95% CI: 0.394-0.961, p = 0.035) or 44% (OR = 0.558, 95% CI: 0.354-0.871, p = 0.011), respectively. This is the first study to test the existence of significant association between presence of enlarged and visible CAs and genetic factors predisposing to thrombosis, according to the literature. Here we suggest that not only the lack of genetic predisposition to thrombosis by MTHFR gene polymorphisms, but also the PAI-1 5G allele might promote vasculogenesis of CAs.

  19. Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

    PubMed

    Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

    2017-07-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

  20. Kinetic Monte Carlo Simulations and Molecular Conductance Measurements of the Bacterial Decaheme Cytochrome MtrF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Byun, H. S.; Pirbadian, S.; Nakano, Aiichiro

    2014-09-05

    Microorganisms overcome the considerable hurdle of respiring extracellular solid substrates by deploying large multiheme cytochrome complexes that form 20 nanometer conduits to traffic electrons through the periplasm and across the cellular outer membrane. Here we report the first kinetic Monte Carlo simulations and single-molecule scanning tunneling microscopy (STM) measurements of the Shewanella oneidensis MR-1 outer membrane decaheme cytochrome MtrF, which can perform the final electron transfer step from cells to minerals and microbial fuel cell anodes. We find that the calculated electron transport rate through MtrF is consistent with previously reported in vitro measurements of the Shewanella Mtr complex, asmore » well as in vivo respiration rates on electrode surfaces assuming a reasonable (experimentally verified) coverage of cytochromes on the cell surface. The simulations also reveal a rich phase diagram in the overall electron occupation density of the hemes as a function of electron injection and ejection rates. Single molecule tunneling spectroscopy confirms MtrF's ability to mediate electron transport between an STM tip and an underlying Au(111) surface, but at rates higher than expected from previously calculated heme-heme electron transfer rates for solvated molecules.« less

  1. MTR FAST NEUTRON FLUX MEASUREMENTS FOR CYCLE 146

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weber, L D; Hogg, C H

    1962-03-20

    The fast neutron fluxes in selected positions of the MTR were measured for Cycle 146. The measurements were made at the beginning, throughout, and at the end of the cycle (564 Mwd). Vertical traverses for each position monitors are shown. (auth)

  2. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet

    PubMed Central

    Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.

    2008-01-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906

  3. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet.

    PubMed

    Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S

    2007-08-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.

  4. CONTEXTUAL AERIAL VIEW OF "COLD" NORTH HALF OF MTR COMPLEX. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    CONTEXTUAL AERIAL VIEW OF "COLD" NORTH HALF OF MTR COMPLEX. CAMERA FACING EASTERLY. FOREGROUND CORNER CONTAINS OIL STORAGE TANKS. WATER TANKS AND WELL HOUSES ARE BEYOND THEM TO THE LEFT. LARGE LIGHT-COLORED BUILDING IN CENTER OF VIEW IS STEAM PLANT. DEMINERALIZER AND WATER STORAGE TANK ARE BEYOND. SIX-CELL COOLING TOWER AND ITS PUMP HOUSE ARE ABOVE IT IN VIEW. SERVICE BUILDINGS INCLUDING CANTEEN ARE ON NORTH SIDE OF ROAD. "EXCLUSION" AREA IS BEYOND ROAD. COMPARE LOCATION OF EXCLUSION-AREA GATE WITH PHOTO ID-33-G-202. INL NEGATIVE NO. 3608. Unknown Photographer, 10/30/1951 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  5. 76 FR 6629 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-07

    ... Collection Activities: Forms G-325, G-325A, G- 325B, and G-325C; Extension of an Existing Information Collection; Comment Request ACTION: 60-Day Notice of Information Collection Under Review; Forms 325, G-325A, G-325B, and G-325C, Biographic Information; OMB Control No. 1615-0008. The Department of Homeland...

  6. MTR MAIN FLOOR. NEUTRON TUNNEL (SPANNED BY STILELIKE STEPS) PROJECTS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR MAIN FLOOR. NEUTRON TUNNEL (SPANNED BY STILE-LIKE STEPS) PROJECTS FROM THE SOUTHEAST CORNER OF THE MTR TOWARD SOUTHEAST CORNER OF BUILDING, WHERE SHIELDING BLOCKS BEGIN TO SURROUND THE TUNNEL AS IT NEARS DETECTING INSTRUMENTS NEAR THE BUILDING WALL. GEAR RELATED TO CRYSTAL NEUTRON SPECTROMETER IS IN FOREGROUND SURROUNDED BY SHIELDING. DATA CONSOLES ARE AT MID-LEVEL OF EAST FACE. OTHER WORK PROCEEDS ON TOP OF AND ELSEWHERE AROUND REACTOR. NOTE TOOLS HANGING AGAINST SOUTHEAST CORNER, USED TO CHANGE FUEL ELEMENTS AND OTHER REACTOR ITEMS DURING REFUELING CYCLES. INL NEGATIVE NO. 10439. Unknown Photographer, 4/20/1954 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  7. Association between Thrombophilic Genes Polymorphisms and Recurrent Pregnancy Loss Susceptibility in the Iranian Population: a Systematic Review and Meta-Analysis

    PubMed Central

    Kamali, Mahdieh; Hantoushzadeh, Sedigheh; Borna, Sedigheh; Neamatzadeh, Hossein; Mazaheri, Mahta; Noori-Shadkam, Mahmood; Haghighi, Fatemeh

    2018-01-01

    Studies have indicated that thrombophilic genes polymorphisms are associated with recurrent pregnancy loss (RPL) in the Iranian population. We aimed to evaluate the precise association between thrombophilic genes polymorphisms (MTHFR C677T, MTHFR A1298C, Prothrombin G20210A, FVL G1691A, and PAI-1 4G/5G) and RPL risk in the Iranian population. PubMed, Web of Science, Google Scholar, and ISC were searched for eligible articles published up to April 1, 2017. In total, 37 case-control studies in 18 relevant publications were selected: 1,199, 1,194, 630, 830, and 955 RPL cases and 1,079, 1079, 594, 794, and 499 controls for MTHFR C677T, MTHFR A1298C,Prothrombin G20210A, FVL G1691A, and PAI-1 4G/5G, respectively. The results indicated a significant increased risk of RPL in all genetic models in the population. Also, Prothrombin G20210A and FVL G1691A as well as PAI-1 4G/5G polymorphisms were associated with RPL risk in the Iranian population. Hence, thrombophilic genes polymorphisms are associated with an increased RPL risk in the Iranian population. PMID:28734273

  8. CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

    DOE PAGES

    Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...

    2016-03-22

    Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

  9. CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.

    Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

  10. 77 FR 50519 - Agency Information Collection Activities: Forms G-325, G-325A, G-325B, and G-325C; Extension of a...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-21

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services [OMB Control Number 1615... Department of Homeland Security (DHS), U.S. Citizenship and Immigration Services (USCIS) will be submitting... collection: Forms G-325, G-325A, G-325B, and G-325C; U.S. Citizenship and Immigration Services (USCIS). (4...

  11. Structure and reconstitution of yeast Mpp6-nuclear exosome complexes reveals that Mpp6 stimulates RNA decay and recruits the Mtr4 helicase.

    PubMed

    Wasmuth, Elizabeth V; Zinder, John C; Zattas, Dimitrios; Das, Mom; Lima, Christopher D

    2017-07-25

    Nuclear RNA exosomes catalyze a range of RNA processing and decay activities that are coordinated in part by cofactors, including Mpp6, Rrp47, and the Mtr4 RNA helicase. Mpp6 interacts with the nine-subunit exosome core, while Rrp47 stabilizes the exoribonuclease Rrp6 and recruits Mtr4, but it is less clear if these cofactors work together. Using biochemistry with Saccharomyces cerevisiae proteins, we show that Rrp47 and Mpp6 stimulate exosome-mediated RNA decay, albeit with unique dependencies on elements within the nuclear exosome. Mpp6-exosomes can recruit Mtr4, while Mpp6 and Rrp47 each contribute to Mtr4-dependent RNA decay, with maximal Mtr4-dependent decay observed with both cofactors. The 3.3 Å structure of a twelve-subunit nuclear Mpp6 exosome bound to RNA shows the central region of Mpp6 bound to the exosome core, positioning its Mtr4 recruitment domain next to Rrp6 and the exosome central channel. Genetic analysis reveals interactions that are largely consistent with our model.

  12. Structure and reconstitution of yeast Mpp6-nuclear exosome complexes reveals that Mpp6 stimulates RNA decay and recruits the Mtr4 helicase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wasmuth, Elizabeth V.; Zinder, John C.; Zattas, Dimitrios

    Nuclear RNA exosomes catalyze a range of RNA processing and decay activities that are coordinated in part by cofactors, including Mpp6, Rrp47, and the Mtr4 RNA helicase. Mpp6 interacts with the nine-subunit exosome core, while Rrp47 stabilizes the exoribonuclease Rrp6 and recruits Mtr4, but it is less clear if these cofactors work together. Using biochemistry with Saccharomyces cerevisiae proteins, we show that Rrp47 and Mpp6 stimulate exosome-mediated RNA decay, albeit with unique dependencies on elements within the nuclear exosome. Mpp6-exosomes can recruit Mtr4, while Mpp6 and Rrp47 each contribute to Mtr4-dependent RNA decay, with maximal Mtr4-dependent decay observed with bothmore » cofactors. The 3.3 Å structure of a twelve-subunit nuclear Mpp6 exosome bound to RNA shows the central region of Mpp6 bound to the exosome core, positioning its Mtr4 recruitment domain next to Rrp6 and the exosome central channel. Genetic analysis reveals interactions that are largely consistent with our model.« less

  13. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family.

    PubMed

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam

    2016-09-01

    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β 0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  14. MTR,TRA603. EXPERIMENTERS' SPACE ALLOCATIONS IN BASEMENT AS OF 1963. SHIELDED ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR,TRA-603. EXPERIMENTERS' SPACE ALLOCATIONS IN BASEMENT AS OF 1963. SHIELDED CUBICLES WERE IDENTIFIED BY SPONSORING LABORATORY AND ITS TEST HOLE NUMBER IN THE REACTOR, IE, "KAPL HB-1" SIGNIFIED KNOLLS ATOMIC POWER LABORATORY, HORIZONTAL BEAM NO. 1. "WAPD" WAS WESTINGHOUSE ATOMIC POWER DIVISION. CATCH TANKS AND SAMPLE STATIONS FOR TEST LOOPS WERE ASSOCIATED WITH THESE CUBICLES. NOTE DESKS, STORAGE CABINETS, SWITCH GEAR, INSTRUMENT PANELS. PHILLIPS PETROLEUM COMPANY MTR-E-5205, 4/1963. INL INDEX NO. 531-0603-00-706-009757, REV. 5. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  15. Correlations of EGF G1380A, bFGF C754G and VEGF T460C polymorphisms with malignant melanoma susceptibility and prognosis: A case-control study.

    PubMed

    Wang, Xin-Hua; Long, Zi-Wen

    2017-06-20

    This case-control study aims to investigate the correlations of EGF G1380A, bFGF C754G and VEGF T460C polymorphisms with the susceptibility and prognosis of malignant melanoma. A total of 153 patients with multiple primary melanomas were collected as the case group and another 170 healthy individuals were selected as the control group. ELISA and PCR-RFLP were performed to test the serum level of VEGF and to analyze the genotype as well as allele frequencies of VEGF T460C, EGF G1380A, and bFGF C754G, respectively. The patients were assigned into complete remission (CR), partial remission (PR) and non-remission groups after treatment. HE and CD34 staining were conducted in tissue samples of CR and PR patients. Event-free survival (EFS) and overall survival (OS) were measured. AA genotype of EGF G1380A and GG genotype of bFGF C754G had higher frequency distribution in the case group than the control group. Patients with AA genotype of EGF G1380 and GG genotype of bFGF C754G had an elevated VEGF level in comparison to other genotypes. Patients with GA+GG genotypes of EGF G1380A and CG+CC genotypes of bFGF C754G had higher EFS and OS than those with AA genotype and those with GG genotype, respectively. According to the haplotype analysis, the case group had a notably higher frequency of TAG and CAG along with while lower frequency of TGG and CGC compared with the control group. Logistic regression analysis revealed that the polymorphisms of EGF G1380A and bFGF C754G as well as the haploid TAG increased the susceptibility of malignant melanoma. The results indicated that EGF G1380A and bFGF C754G gene polymorphisms were associated with the susceptibility and prognosis of malignant melanoma, and that the polymorphisms of EGF G1380A and bFGF C754G as well as the haploid TAG increased the susceptibility of malignant melanoma. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Exosome cofactor hMTR4 competes with export adaptor ALYREF to ensure balanced nuclear RNA pools for degradation and export.

    PubMed

    Fan, Jing; Kuai, Bin; Wu, Guifen; Wu, Xudong; Chi, Binkai; Wang, Lantian; Wang, Ke; Shi, Zhubing; Zhang, Heng; Chen, She; He, Zhisong; Wang, Siyuan; Zhou, Zhaocai; Li, Guohui; Cheng, Hong

    2017-10-02

    The exosome is a key RNA machine that functions in the degradation of unwanted RNAs. Here, we found that significant fractions of precursors and mature forms of mRNAs and long noncoding RNAs are degraded by the nuclear exosome in normal human cells. Exosome-mediated degradation of these RNAs requires its cofactor hMTR4. Significantly, hMTR4 plays a key role in specifically recruiting the exosome to its targets. Furthermore, we provide several lines of evidence indicating that hMTR4 executes this role by directly competing with the mRNA export adaptor ALYREF for associating with ARS2, a component of the cap-binding complex (CBC), and this competition is critical for determining whether an RNA is degraded or exported to the cytoplasm. Together, our results indicate that the competition between hMTR4 and ALYREF determines exosome recruitment and functions in creating balanced nuclear RNA pools for degradation and export. © 2017 The Authors.

  17. PRECAST CONCRETE WALL PANELS ARE LIFTED INTO PLACE ON MTR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PRECAST CONCRETE WALL PANELS ARE LIFTED INTO PLACE ON MTR STEEL FRAME STRUCTURE. INL NEGATIVE NO. 1330. Unknown Photographer, 1/1951 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  18. MTR BASEMENT. GENERAL ELECTRIC CONTROL CONSOLE FOR AIRCRAFT NUCLEAR PROPULSION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BASEMENT. GENERAL ELECTRIC CONTROL CONSOLE FOR AIRCRAFT NUCLEAR PROPULSION EXPERIMENT NO. 1. INL NEGATIVE NO. 6510. Unknown Photographer, 9/29/1959 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  19. MTR CONTROL ROOM WITH CONTROL CONSOLE AND STATUS READOUTS ALONG ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR CONTROL ROOM WITH CONTROL CONSOLE AND STATUS READOUTS ALONG WALL. WORKERS MAKE ELECTRICAL AND OTHER CONNECTIONS. INL NEGATIVE NO. 4289. Unknown Photographer, 2/26/1952 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  20. Polymorphisms of endothelin 1 (G5665T and T-1370G) and endothelin receptor type A (C+70G and G-231A) in Graves' disease.

    PubMed

    Aydın, A Fatih; Develi-İş, Seval; Doğru-Abbasoğlu, Semra; Vural, Pervin; Ozderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

    2014-01-01

    Endothelin 1 (EDN1) is a strong angiogenic and mitogenic factor, playing a key role in hypervascularization, thyroid follicle cell hyperplasia, and lymphocyte infiltration in the thyroid gland of patients with Graves' disease (GD). EDN1 induces angiogenesis and mitogenesis via endothelin receptor type A (EDNRA). This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of GD, and evaluates the relationship between genotypes and clinical/laboratory manifestations of GD. We analyzed genotype and allele distributions of EDN1 and EDNRA polymorphisms in 165 patients with GD and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between GD and variant alleles of the studied polymorphisms were observed. However, the anti-thyroid peroxidase (anti-TPO) and anti-thyroglobulin (anti-TG) levels in EDN1 G5665T GG genotype were higher than those in T allele carriers (GT+TT) (p=0.001 and p=0.026, respectively). In addition, anti-TPO levels in EDN1 T-1370G wild-type homozygous patients were found to be higher than in mutant gene carrying patients (GT+GG) (p=0.006). The presence of EDNRA+70G allele was associated with 3.37-fold increased risk for development of ophthalmopathy in GD patients (p=0.009). Although there were no associations between EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) SNPs and susceptibility to GD, EDN1 G5665T and T-1370G polymorphisms were related to alterations of autoantibody production and EDNRA C+70G polymorphism is related with increased risk for ophthalmopathy in GD patients. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. High temperature ultrasonic sensor for fission gas characterization in MTR harsh environment

    NASA Astrophysics Data System (ADS)

    Gatsa, O.; Combette, P.; Rozenkrantz, E.; Fourmentel, D.; Destouches, C.; Ferrandis, J. Y. AD(; )

    2018-01-01

    In the contemporary world, the measurements in hostile environment is one of the predominant necessity for automotive, aerospace, metallurgy and nuclear plant. The measurement of different parameters in experimental reactors is an important point in nuclear power strategy. In the near past, IES (Institut d'Électronique et des Systèmes) on collaboration with CEA (Commissariat à l'Energie Atomique et aux Energies Alternatives) have developed the first ultrasonic sensor for the application of gas quantity determination that has been tested in a Materials Testing Reactor (MTR). Modern requirements state to labor with the materials that possess stability on its parameters around 350°C in operation temperature. Previous work on PZT components elaboration by screen printing method established the new basis in thick film fabrication and characterization in our laboratory. Our trials on Bismuth Titanate ceramics showed the difficulties related to high electrical conductivity of fabricated samples that postponed further research on this material. Among piezoceramics, the requirements on finding an alternative solution on ceramics that might be easily polarized and fabricated by screen printing approach were resolved by the fabrication of thick film from Sodium Bismuth Titanate (NBT) piezoelectric powder. This material exhibits high Curie temperature, relatively good piezoelectric and coupling coefficients, and it stands to be a good solution for the anticipated application. In this paper, we present NBT thick film fabrication by screen printing, characterization of piezoelectric, dielectric properties and material parameters studies in dependence of temperature. Relatively high resistivity in the range of 1.1013 Ohm.cm for fabricated thick film is explained by Aurivillius structure in which a-and b-layers form perovskite structure between oxides of c-layer. Main results of this study are presented and discussed in terms of feasibility for an application to a new sensor

  2. SOUTH WING, TRA661. SOUTH SIDE. CAMERA FACING NORTH. MTR HIGH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SOUTH WING, TRA-661. SOUTH SIDE. CAMERA FACING NORTH. MTR HIGH BAY BEYOND. INL NEGATIVE NO. HD46-45-3. Mike Crane, Photographer, 4/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  3. Identification of a novel PMS2 alteration c.505C>G (R169G) in trans with a PMS2 pathogenic mutation in a patient with constitutional mismatch repair deficiency.

    PubMed

    Mork, Maureen E; Borras, Ester; Taggart, Melissa W; Cuddy, Amanda; Bannon, Sarah A; You, Y Nancy; Lynch, Patrick M; Ramirez, Pedro T; Rodriguez-Bigas, Miguel A; Vilar, Eduardo

    2016-10-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis.

  4. Prospective study of MTHFR genetic polymorphisms as a possible etiology of male infertility.

    PubMed

    Li, S-S; Li, J; Xiao, Z; Ren, A-G; Jin, L

    2014-03-24

    The aim of this study was to explore the relationship between 2 genetic polymorphisms of the methylenetetrahydrofolate reductase gene (MTHFR), C677T and A1298C, and determine the long-term reproductive outcome in infertile men. This was a prospective study conducted in an andrology clinic. Men with a 1-year history of infertility were assessed for the MTHFR polymorphisms at a 5-year follow-up. We compared the MTHFR C677T and A1298C polymorphisms by polymerase chain reaction-restriction fragment length polymorphism between men who did and did not bear children during follow-up. Of the 215 men who were infertile at 1 year, 82 (38.1%) remained infertile and 133 (61.9%) achieved natural conception during the 5-year follow-up, with the highest rate in the first year (32.6%). The MTHFR 677TT genotype (homozygote) was associated with a substantially increased risk of infertility during follow-up [odds ratio (OR) = 10.242; 95% confidence interval (CI) = 1.257-83.464] relative to the MTHFR 677CC genotype (wild-type). Risk of infertility was not increased by the MTHFR A1298C polymorphism alone, but was increased by the combination of polymorphisms MTHFR C677T and MTHFR A1298C (OR = 11.818; 95%CI = 1.415-98.674). The homozygous MTHFR C677T genotype was a risk factor for male infertility during 5-year follow-up, whereas a correlation between MTHFR A1298C and infertility was not observed. The MTHFR C677T and MTHFR A1298C polymorphisms had additive effects on male infertility.

  5. MTR plates modeling with MAIA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marelle, V.; Dubois, S.; Ripert, M.

    2008-07-15

    MAIA is a thermo-mechanical code dedicated to the modeling of MTR fuel plates. The main physical phenomena modeled in the code are the cladding oxidation, the interaction between fuel and Al-matrix, the swelling due to fission products and the Al/fuel particles interaction. The creeping of the plate can be modeled in the mechanical calculation. MAIA has been validated on U-Mo dispersion fuel experiments such as IRIS 1 and 2 and FUTURE. The results are in rather good agreement with post-irradiation examinations. MAIA can also be used to calculate in-pile behavior of U{sub 3}Si{sub 2} plates as in the SHARE experimentmore » irradiated in the SCK/Mol BR2 reactor. The main outputs given by MAIA throughout the irradiation are temperatures, cladding oxidation thickness, interaction thickness, volume fraction of meat constituents, swelling, displacements, strains and stresses. MAIA is originally a two-dimensional code but a three-dimensional version is currently under development. (author)« less

  6. CUTS FOR MTR EXCAVATION ILLUSTRATE SEDIMENTARY MANTLE OF SOIL AND ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    CUTS FOR MTR EXCAVATION ILLUSTRATE SEDIMENTARY MANTLE OF SOIL AND GRAVEL OVERLAYING LAVA ROCK FIFTY FEET BELOW. SAGEBRUSH HAS BEEN SCOURED FROM REST OF SITE. CAMERA PROBABLY FACES SOUTHWEST. INL NEGATIVE NO. 67. Unknown Photographer, 6/4/1950 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  7. CANAL EMERGES FROM EAST SIDE OF MTR BUILDING. "EXTRA" LENGTH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    CANAL EMERGES FROM EAST SIDE OF MTR BUILDING. "EXTRA" LENGTH WAS TO STORE SPENT FUEL THAT WOULD ACCUMULATE BEFORE THE CHEMICAL PROCESSING PLANT WAS READY TO PROCESS IT. INL NEGATIVE NO. 1659. Unknown Photographer, 3/9/1951 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  8. Delay Discounting and Frontostriatal Fiber Tracts: A Combined DTI and MTR Study on Impulsive Choices in Healthy Young Adults

    PubMed Central

    Peper, Jiska S.; Mandl, René C.W.; Braams, Barbara R.; de Water, Erik; Heijboer, Annemieke C.; Koolschijn, P. Cédric M.P.; Crone, Eveline A.

    2013-01-01

    Delay discounting, a measure of impulsive choice, has been associated with decreased control of the prefrontal cortex over striatum responses. The anatomical connectivity between both brain regions in delaying gratification remains unknown. Here, we investigate whether the quality of frontostriatal (FS) white matter tracts can predict individual differences in delay-discounting behavior. We use tract-based diffusion tensor imaging and magnetization transfer imaging to measure the microstructural properties of FS fiber tracts in 40 healthy young adults (from 18 to 25 years). We additionally explored whether internal sex hormone levels affect the integrity of FS tracts, based on the hypothesis that sex hormones modulate axonal density within prefrontal dopaminergic circuits. We calculated fractional anisotropy (FA), mean diffusivity (MD), longitudinal diffusivity, radial diffusivity (RD), and magnetization transfer ratio (MTR), a putative measure of myelination, for the FS tract. Results showed that lower integrity within the FS tract (higher MD and RD and lower FA), predicts faster discounting in both sexes. MTR was unrelated to delay-discounting performance. In addition, testosterone levels in males were associated with a lower integrity (higher RD) within the FS tract. Our study provides support for the hypothesis that enhanced structural integrity of white matter fiber bundles between prefrontal and striatal brain areas is associated with better impulse control. PMID:22693341

  9. A novel mutation of the ACADM gene (c.145C>G) associated with the common c.985A>G mutation on the other ACADM allele causes mild MCAD deficiency: a case report

    PubMed Central

    2010-01-01

    A female patient, with normal familial history, developed at the age of 30 months an episode of diarrhoea, vomiting and lethargy which resolved spontaneously. At the age of 3 years, the patient re-iterated vomiting, was sub-febrile and hypoglycemic, fell into coma, developed seizures and sequels involving right hemi-body. Urinary excretion of hexanoylglycine and suberylglycine was low during this metabolic decompensation. A study of pre- and post-prandial blood glucose and ketones over a period of 24 hours showed a normal glycaemic cycle but a failure to form ketones after 12 hours fasting, suggesting a mitochondrial β-oxidation defect. Total blood carnitine was lowered with unesterified carnitine being half of the lowest control value. A diagnosis of mild MCAD deficiency (MCADD) was based on rates of 1-14C-octanoate and 9, 10-3H-myristate oxidation and of octanoyl-CoA dehydrogenase being reduced to 25% of control values. Other mitochondrial fatty acid oxidation proteins were functionally normal. De novo acylcarnitine synthesis in whole blood samples incubated with deuterated palmitate was also typical of MCADD. Genetic studies showed that the patient was compound heterozygous with a sequence variation in both of the two ACADM alleles; one had the common c.985A>G mutation and the other had a novel c.145C>G mutation. This is the first report for the ACADM gene c.145C>G mutation: it is located in exon 3 and causes a replacement of glutamine to glutamate at position 24 of the mature protein (Q24E). Associated with heterozygosity for c.985A>G mutation, this mutation is responsible for a mild MCADD phenotype along with a clinical story corroborating the emerging literature view that patients with genotypes representing mild MCADD (high residual enzyme activity and low urinary levels of glycine conjugates), similar to some of the mild MCADDs detected by MS/MS newborn screening, may be at risk for disease presentation. PMID:20923556

  10. Identification of a Novel PMS2 Alteration c.505C>G (R169G) In Trans with a PMS2 Pathogenic Mutation in a Patient with Constitutional Mismatch Repair Deficiency

    PubMed Central

    Mork, Maureen E.; Borras, Ester; Taggart, Melissa W.; Cuddy, Amanda; Bannon, Sarah A.; You, Y. Nancy; Lynch, Patrick M.; Ramirez, Pedro T.; Rodriguez-Bigas, Miguel A.; Vilar, Eduardo

    2016-01-01

    Constitutional mismatch repair deficiency syndrome (CMMRD) is a rare autosomal recessive predisposition to colorectal polyposis and other malignancies, often childhood-onset, that is caused by biallelic inheritance of mutations in the same mismatch repair gene. Here, we describe a patient with a clinical diagnosis of CMMRD based on colorectal polyposis and young-onset endometrial cancer who was identified to have two alterations in trans in PMS2: one known pathogenic mutation (c.1831insA; p.Ile611Asnfs*2) and one novel variant of uncertain significance (c.505C>G; p.Arg169Glu), a missense alteration. We describe the clinical and molecular features in the patient harboring this novel alteration c.505C>G, who meets clinical criteria for CMMRD and exhibits molecular evidence supporting a diagnosis of CMMRD. Although experimental validation is needed to confirm its pathogenicity, PMS2 c.505C>G likely has functional consequences that contributes to our patient's phenotype based on the patient's clinical presentation, tumor studies, and bioinformatics analysis. PMID:27017610

  11. A review on g-C3N4-based photocatalysts

    NASA Astrophysics Data System (ADS)

    Wen, Jiuqing; Xie, Jun; Chen, Xiaobo; Li, Xin

    2017-01-01

    As one of the most appealing and attractive technologies, heterogeneous photocatalysis has been utilized to directly harvest, convert and store renewable solar energy for producing sustainable and green solar fuels and a broad range of environmental applications. Due to their unique physicochemical, optical and electrical properties, a wide variety of g-C3N4-based photocatalysts have been designed to drive various reduction and oxidation reactions under light irradiation with suitable wavelengths. In this review, we have systematically summarized the photocatalytic fundamentals of g-C3N4-based photocatalysts, including fundamental mechanism of heterogeneous photocatalysis, advantages, challenges and the design considerations of g-C3N4-based photocatalysts. The versatile properties of g-C3N4-based photocatalysts are highlighted, including their crystal structural, surface phisicochemical, stability, optical, adsorption, electrochemical, photoelectrochemical and electronic properties. Various design strategies are also thoroughly reviewed, including band-gap engineering, defect control, dimensionality tuning, pore texture tailoring, surface sensitization, heterojunction construction, co-catalyst and nanocarbon loading. Many important applications are also addressed, such as photocatalytic water splitting (H2 evolution and overall water splitting), degradation of pollutants, carbon dioxide reduction, selective organic transformations and disinfection. Through reviewing the important state-of-the-art advances on this topic, it may provide new opportunities for designing and constructing highly effective g-C3N4-based photocatalysts for various applications in photocatalysis and other related fields, such as solar cell, photoelectrocatalysis, electrocatalysis, lithium battery, supercapacitor, fuel cell and separation and purification.

  12. MTR WING, TRA604, INTERIOR. BASEMENT. WEST CORRIDOR. CAMERA FACES NORTH. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604, INTERIOR. BASEMENT. WEST CORRIDOR. CAMERA FACES NORTH. HVAC AREA IS AT RIGHT OF CORRIDOR. INL NEGATIVE NO. HD46-13-3. Mike Crane, Photographer, 2/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  13. MTR STACK, TRA710, CONTEXTUAL VIEW, CAMERA FACING SOUTH. PERIMETER SECURITY ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR STACK, TRA-710, CONTEXTUAL VIEW, CAMERA FACING SOUTH. PERIMETER SECURITY FENCE AND SECURITY LIGHTING IN VIEW AT LEFT. INL NEGATIVE NO. HD52-1-1. Mike Crane, Photographer, 5/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  14. ELECTRICAL LINES ARRIVE FROM CENTRAL FACILITIES AREA, SOUTH OF MTR. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    ELECTRICAL LINES ARRIVE FROM CENTRAL FACILITIES AREA, SOUTH OF MTR. EXCAVATION RUBBLE IN FOREGROUND. CONTRACTOR CRAFT SHOPS, CRANES, AND OTHER MATERIALS ON SITE. CAMERA FACES EAST, WITH LITTLE BUTTE AND MIDDLE BUTTE IN DISTANCE. INL NEGATIVE NO. 335. Unknown Photographer, 7/1/1950 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  15. REACTIVITY MEASUREMENT FACILITY. CAMERA LOOKS DOWN INTO MTR CANAL. REACTOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    REACTIVITY MEASUREMENT FACILITY. CAMERA LOOKS DOWN INTO MTR CANAL. REACTOR IS FUELED AS AN ETR MOCK-UP. LIGHTS DANGLE BELOW WATER LEVEL. CONTROL RODS AND OTHER APPARATUS DESCEND FROM ABOVE WATER LEVEL. INL NEGATIVE NO. 56-900. Jack L. Anderson, Photographer, 3/26/1956 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  16. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  17. [Polymorphism of TNF-alpha (308 A/G), IL-10 (1082 A/G, 819 C/T 592 A/C), IL-6 (174 G/C), and IFN-gamma (874 A/T); genetically conditioned cytokine synthesis level in children with diabetes type 1].

    PubMed

    Siekiera, Urszula; Jarosz-Chobot, P; Janusz, J; Koehler, Brygida

    2002-01-01

    Type 1 diabetes is a genetically conditioned autoimmune disease. Genes that account for strong clustering of the disease susceptibility are located within the HLA region. There is also considerable individual variation in the immune response and role of cytokine genes in the disease predisposition. The aim of our research was identification of the genetically controlled TNF-alpha, IL-10, IL-6, IFN-gamma secretion profile in children with diabetes type 1. We have examined 36 children with diabetes type 1 and 36 healthy individuals. DNA was extracted from mononuclear peripheral blood cells. For identification of the cytokine polymorphism PCR-SSP method was used. Patients with diabetes type 1 differ from the group of healthy persons in the cytokine synthesis level and in the cytokine genotypes distribution. Genotype TNF-alpha (A/G) as well as IL-10 (ATA/ATA) was found only in group of children with diabetes but not in the control group. Genotypes IL-10 (GCC/GCC), IL-6 (C/C), IFN-gamma (T/T) were observed with decreased frequency in children with diabetes type 1. No differences between patients and control group in the frequency of IL-10 (GCC/ACC) (GCC/ATA), (ACC/ACC) (ACC/ATA) IL-6 (G/G), (G/C) and IFN-gamma (T/A), (A/A) genotypes were observed. Children with diabetes type 1 were more frequent "high producers" of TNF-alpha and IL-6. It is possible to us molecular method to estimate the genetically controlled immune reactivity. It is a very important immunogenetic factor of the disease predisposition.

  18. MTR WING, TRA604. PRECAST CONCRETE PANELS AND DIMENSIONS FOR PANELS ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604. PRECAST CONCRETE PANELS AND DIMENSIONS FOR PANELS K THROUGH Q. BLAW-KNOX 3150-804-21, SHEET #2, 11/1950. INL INDEX NO. 531-0604-62-098-100645, REV. 2. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  19. MTHFR C677T Polymorphism is Associated with Tumor Response to Preoperative Chemoradiotherapy: A Result Based on Previous Reports.

    PubMed

    Zhao, Yue; Li, Xingde; Kong, Xiangjun

    2015-10-12

    Preoperative chemoradiotherapy (pRCT) followed by surgery has been widely practiced in locally advanced rectal cancer, esophageal cancer, gastric cancer and other cancers. However, the therapy also exerts some severe adverse effects and some of the patients show poor or no response. It is very important to develop biomarkers (e.g., gene polymorphisms) to identify patients who have a higher likelihood of responding to pRCT. Recently, a series of reports have investigated the association of the genetic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) and epidermal growth factor receptor (EGFR) genes with the tumor response to pRCT; however, the results were inconsistent and inconclusive. A systematic review and meta-analysis was performed by searching relevant studies about the association of MTHFR and EGFR polymorphisms with the tumor regression grade (TRG) in response to pRCT in databases of PubMed, EMBAS, Web of science, Chinese National Knowledge Infrastructure, and Wanfang database up to March 30, 2015. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (95% CIs) were calculated to assess the strength of the association under 5 genetic models. A total of 11 eligible articles were included in the present meta-analysis, of which 8 studies were performed in rectal cancer and 3 studies were performed in esophageal cancer. We finally included 8 included studies containing 839 cases for MTHFR C677T, 5 studies involving 634 cases for MTHFR A1298C, 3 studies containing 340 cases for EGFR G497A, and 4 studies containing 396 cases for EGFR CA repeat. The pooled analysis results indicated that MTHFR C677T might be correlated with the tumor response to pRCT under the recessive model (CC vs. CTTT) in overall analysis (OR=1.426(1.074-1.894), P=0.014), rectal cancer (OR=1.483(1.102-1.996), P=0.009), and TRG 1-2 vs. 3-5 group (OR=1.423(1.046-1.936), P=0.025), while other polymorphism including MTHFR A1298C, EGFR G497A, and EGFR CA repeat

  20. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  1. Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

    PubMed Central

    Patel, Dinshaw J.; Canuel, Lita L.

    1977-01-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

  2. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    PubMed

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  3. A new-generation 5-nitroimidazole can induce highly metronidazole-resistant Giardia lamblia in vitro

    PubMed Central

    Dunn, Linda A.; Burgess, Anita G.; Krauer, Kenia G.; Eckmann, Lars; Vanelle, Patrice; Crozet, Maxime D.; Gillin, Frances D.; Upcroft, Peter; Upcroft, Jacqueline A.

    2010-01-01

    The 5-nitroimidazole (NI) compound C17, with a side chain carrying a remote phenyl group in the 2-position of the imidazole ring, is at least 14-fold more active against the gut protozoan parasite Giardia lamblia than the 5-NI drug metronidazole (MTR), with a side chain in the 1-position of the imidazole ring, which is the primary drug for the treatment of giardiasis. Over 10 months, lines resistant to C17 were induced in vitro and were at least 12-fold more resistant to C17 than the parent strains. However, these lines had ID90 values (concentration of drug at which 10% of control parasite ATP levels are detected) for MTR of >200 μM, whilst lines induced to be highly resistant to MTR in vitro have maximum ID90 values around 100 μM (MTR-susceptible isolates typically have an ID90 of 5–12.8 μM). The mechanism of MTR activation in Giardia apparently involves reduction to toxic radicals by the activity of pyruvate:ferredoxin oxidoreductase (PFOR) and the electron acceptor ferredoxin. MTR-resistant Giardia have decreased PFOR activity, which is consistent with decreased activation of MTR in these lines, but C17-resistant lines have normal levels of PFOR. Therefore, an alternative mechanism of resistance in Giardia must account for these super-MTR-resistant cells. PMID:20456926

  4. Sharing the load: Mex67-Mtr2 cofunctions with Los1 in primary tRNA nuclear export.

    PubMed

    Chatterjee, Kunal; Majumder, Shubhra; Wan, Yao; Shah, Vijay; Wu, Jingyan; Huang, Hsiao-Yun; Hopper, Anita K

    2017-11-01

    Eukaryotic transfer RNAs (tRNAs) are exported from the nucleus, their site of synthesis, to the cytoplasm, their site of function for protein synthesis. The evolutionarily conserved β-importin family member Los1 (Exportin-t) has been the only exporter known to execute nuclear export of newly transcribed intron-containing pre-tRNAs. Interestingly, LOS1 is unessential in all tested organisms. As tRNA nuclear export is essential, we previously interrogated the budding yeast proteome to identify candidates that function in tRNA nuclear export. Here, we provide molecular, genetic, cytological, and biochemical evidence that the Mex67-Mtr2 (TAP-p15) heterodimer, best characterized for its essential role in mRNA nuclear export, cofunctions with Los1 in tRNA nuclear export. Inactivation of Mex67 or Mtr2 leads to rapid accumulation of end-matured unspliced tRNAs in the nucleus. Remarkably, merely fivefold overexpression of Mex67-Mtr2 can substitute for Los1 in los1 Δ cells. Moreover, in vivo coimmunoprecipitation assays with tagged Mex67 document that the Mex67 binds tRNAs. Our data also show that tRNA exporters surprisingly exhibit differential tRNA substrate preferences. The existence of multiple tRNA exporters, each with different tRNA preferences, may indicate that the proteome can be regulated by tRNA nuclear export. Thus, our data show that Mex67-Mtr2 functions in primary nuclear export for a subset of yeast tRNAs. © 2017 Chatterjee et al.; Published by Cold Spring Harbor Laboratory Press.

  5. CONTROL CONSOLE FOR MTR FISSION PRODUCT MONITOR, USED TO DETECT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    CONTROL CONSOLE FOR MTR FISSION PRODUCT MONITOR, USED TO DETECT BREAKS IN CLADDING OF FUEL ELEMENTS. COUNT-RATE METER IN TOP PANEL INDICATES AMOUNT OF RADIOACTIVITY. LOWER PANELS SUPPLY POWER AND AMPLIFICATION OF SIGNALS GENERATED BY SCINTILLATION COUNTER/PHOTOMULTIPLIER TUBE COMBINATION IN RESPONSE TO RADIOACTIVITY IN A SAMPLE OF THE COOLING WATER. INL NEGATIVE NO. 56-771. Jack L. Anderson, Photographer, 3/15/1956. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  6. The use of experimental data in an MTR-type nuclear reactor safety analysis

    NASA Astrophysics Data System (ADS)

    Day, Simon E.

    Reactivity initiated accidents (RIAs) are a category of events required for research reactor safety analysis. A subset of this is unprotected RIAs in which mechanical systems or human intervention are not credited in the response of the system. Light-water cooled and moderated MTR-type ( i.e., aluminum-clad uranium plate fuel) reactors are self-limiting up to some reactivity insertion limit beyond which fuel damage occurs. This characteristic was studied in the Borax and Spert reactor tests of the 1950s and 1960s in the USA. This thesis considers the use of this experimental data in generic MTR-type reactor safety analysis. The approach presented herein is based on fundamental phenomenological understanding and uses correlations in the reactor test data with suitable account taken for differences in important system parameters. Specifically, a semi-empirical approach is used to quantify the relationship between the power, energy and temperature rise response of the system as well as parametric dependencies on void coefficient and the degree of subcooling. Secondary effects including the dependence on coolant flow are also examined. A rigorous curve fitting approach and error assessment is used to quantify the trends in the experimental data. In addition to the initial power burst stage of an unprotected transient, the longer term stability of the system is considered with a stylized treatment of characteristic power/temperature oscillations (chugging). A bridge from the HEU-based experimental data to the LEU fuel cycle is assessed and outlined based on existing simulation results presented in the literature. A cell-model based parametric study is included. The results are used to construct a practical safety analysis methodology for determining reactivity insertion safety limits for a light-water moderated and cooled MTR-type core.

  7. The −174G/C and −572G/C Interleukin 6 Promoter Gene Polymorphisms in Mexican Patients with Rheumatoid Arthritis: A Case-Control Study

    PubMed Central

    Zavaleta-Muñiz, S. A.; Martín-Márquez, B. T.; Gonzalez-Lopez, L.; Gonzalez-Montoya, N. G.; Díaz-Toscano, M. L.; Ponce-Guarneros, J. M.; Ruiz-Padilla, A. J.; Mercado, M. Vázquez-Del; Maldonado-González, M.; Fafutis-Morris, M.; Flores-Martínez, S. E.; Martínez-García, E. A.; Gamez-Nava, J. I.

    2013-01-01

    Objective. There is a lack of information about the genotype frequencies of IL-6 −174G/C and −572G/C polymorphisms in Mexicans with rheumatoid arthritis (RA). Therefore, the aim of this study was to evaluate the association of the IL-6 −174G/C and −572G/C polymorphisms in Mexican mestizo with RA. Methods. We included 137 patients with RA and 102 healthy controls. Patients were assessed for clinical characteristics. IL-6 −174G/C and −572G/C polymorphisms were genotyped using PCR-RFLP analysis. Allele and genotype frequencies and the Hardy-Weinberg equilibrium were computed. Odds ratios (ORs) were computed to identify the risk for RA associated with the presence of GG genotype in comparison with the GC or CC genotypes. Results. The genotype −174GG occurred at a higher frequency in cases and controls (77.4% versus 78.4%, P = 0.845). We found similar results for the genotype −572GG (54% in patients versus 60.8% in controls, P = 0.295). Conclusions. This is the first study to evaluate the association of −174G/C and −572G/C polymorphisms of the IL-6 gene with RA in Mexican mestizo patients. These two polymorphisms were not associated with RA in the studied sample. Additional studies are required to evaluate if these IL-6 polymorphisms have relevance to the development of more severe disease. PMID:24223608

  8. The use of MOX caramel fuel mixed with 241Am, 242mAm and 243Am as burnable absorber actinides for the MTR research reactors.

    PubMed

    Shaaban, Ismail; Albarhoum, Mohamad

    2017-07-01

    The MOX (UO 2 &PuO 2 ) caramel fuel mixed with 241 Am, 242m Am and 243 Am as burnable absorber actinides was proposed as a fuel of the MTR-22MW reactor. The MCNP4C code was used to simulate the MTR-22MW reactor and estimate the criticality and the neutronic parameters, and the power peaking factors before and after replacing its original fuel (U 3 O 8 -Al) by the MOX caramel fuel mixed with 241 Am, 242m Am and 243 Am actinides. The obtained results of the criticality, the neutronic parameters, and the power peaking factors for the MOX caramel fuel mixed with 241 Am, 242m Am and 243 Am actinides were compared with the same parameters of the U 3 O 8 -Al original fuel and a maximum difference is -6.18% was found. Additionally, by recycling 2.65% and 2.71% plutonium and 241 Am, 242m Am and 243 Am actinides in the MTR-22MW reactor, the level of 235 U enrichment is reduced from 4.48% to 3% and 2.8%, respectively. This also results in the reduction of the 235 U loading by 32.75% and 37.22% for the 2.65%, the 2.71% plutonium and 241 Am, 242m Am and 243 Am actinides, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. SOUTH WING, MTR661. INTERIOR DETAIL INSIDE LAB ROOM 131. CAMERA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    SOUTH WING, MTR-661. INTERIOR DETAIL INSIDE LAB ROOM 131. CAMERA FACING NORTHEAST. NOTE CONCRETE BLOCK WALLS. SAFETY SHOWER AND EYE WASHER AT REAR WALL. INL NEGATIVE NO. HD46-7-2. Mike Crane, Photographer, 2/2005. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  10. MTR, TRA603. CONTROL ROOM DETAILS. ACOUSTIC PLASTER CEILING, USHAPED CONSOLE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR, TRA-603. CONTROL ROOM DETAILS. ACOUSTIC PLASTER CEILING, U-SHAPED CONSOLE, INSTRUMENT PANELS, GLASS DOOR, ASPHALT TILE FLOOR AND COLORS. BLAW-KNOX 3150-803-11, 10/1950. INL INDEX NO. 531-0603-00-098-100570, REV. 3. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  11. The role of methylenetetrahydrofolate reductase in acute lymphoblastic leukemia in a Brazilian mixed population.

    PubMed

    Zanrosso, Crisiane Wais; Hatagima, Ana; Emerenciano, Mariana; Ramos, Flávio; Figueiredo, Alexandre; Félix, Têmis Maria; Segal, Sandra L; Giugliani, Roberto; Guigliani, Roberto; Muniz, Maria Tereza Cartaxo; Pombo-de-Oliveira, Maria S

    2006-04-01

    The polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene are associated with leukemogenesis. In order to investigate the influence of two polymorphisms in the MTHFR gene, 677C>T and 1298A>C, on the risk of acute lymphoblastic leukemia (ALL) we performed a case-control study in children from different Brazilians' regions. Genotyping of 176 ALL and 199 unselected healthy subjects was performed using PCR-RFLP assay. There was no association between the 677C>T or 1298A>C and risk of ALL in total case-control sample. However, 677T allele was linked to a decrease risk of ALL [odds ratio (OR), 0.43; 95% confidence interval (CI), 0.22-0.86], whereas the 1298A>C polymorphism presents an elevated risk factor [OR, 2.01; 95% CI, 1.01-3.99] in non-White children. Our investigation provides interesting data concerning the opposite effect of A1298C polymorphisms, particularly in the light of relatively scarce data regarding the MTHFR role in leukemia susceptibility in different populations.

  12. In Vitro Activity of Delafloxacin against Clinical Neisseria gonorrhoeae Isolates and Selection of Gonococcal Delafloxacin Resistance.

    PubMed

    Soge, Olusegun O; Salipante, Stephen J; No, David; Duffy, Erin; Roberts, Marilyn C

    2016-05-01

    We evaluated the in vitro activity of delafloxacin against a panel of 117 Neisseria gonorrhoeae strains, including 110 clinical isolates collected from 2012 to 2015 and seven reference strains, compared with the activities of seven antimicrobials currently or previously recommended for treatment of gonorrhea. We examined the potential for delafloxacin to select for resistant mutants in ciprofloxacin-susceptible and ciprofloxacin-resistant N. gonorrhoeae We characterized mutations in the gyrA, gyrB, parC, and parE genes and the multidrug-resistant efflux pumps (MtrC-MtrD-MtrE and NorM) by PCR and sequencing and by whole-genome sequencing. The MIC50, MIC90, and MIC ranges of delafloxacin were 0.06 μg/ml, 0.125 μg/ml, and ≤0.001 to 0.25 μg/ml, respectively. The frequency of spontaneous mutation ranged from 10(-7) to <10(-9) The multistep delafloxacin resistance selection of 30 daily passages resulted in stable resistant mutants. There was no obvious cross-resistance to nonfluoroquinolone comparator antimicrobials. A mutant with reduced susceptibility to ciprofloxacin (MIC, 0.25 μg/ml) obtained from the ciprofloxacin-susceptible parental strain had a novel Ser91Tyr alteration in the gyrA gene. We also identified new mutations in the gyrA and/or parC and parE genes and the multidrug-resistant efflux pumps (MtrC-MtrD-MtrE and NorM) of two mutant strains with elevated delafloxacin MICs of 1 μg/ml. Although delafloxacin exhibited potent in vitro activity against N. gonorrhoeae isolates and reference strains with diverse antimicrobial resistance profiles and demonstrated a low tendency to select for spontaneous mutants, it is important to establish the correlation between these excellent in vitro data and treatment outcomes through appropriate randomized controlled clinical trials. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. In Vitro Activity of Delafloxacin against Clinical Neisseria gonorrhoeae Isolates and Selection of Gonococcal Delafloxacin Resistance

    PubMed Central

    Salipante, Stephen J.; No, David; Duffy, Erin; Roberts, Marilyn C.

    2016-01-01

    We evaluated the in vitro activity of delafloxacin against a panel of 117 Neisseria gonorrhoeae strains, including 110 clinical isolates collected from 2012 to 2015 and seven reference strains, compared with the activities of seven antimicrobials currently or previously recommended for treatment of gonorrhea. We examined the potential for delafloxacin to select for resistant mutants in ciprofloxacin-susceptible and ciprofloxacin-resistant N. gonorrhoeae. We characterized mutations in the gyrA, gyrB, parC, and parE genes and the multidrug-resistant efflux pumps (MtrC-MtrD-MtrE and NorM) by PCR and sequencing and by whole-genome sequencing. The MIC50, MIC90, and MIC ranges of delafloxacin were 0.06 μg/ml, 0.125 μg/ml, and ≤0.001 to 0.25 μg/ml, respectively. The frequency of spontaneous mutation ranged from 10−7 to <10−9. The multistep delafloxacin resistance selection of 30 daily passages resulted in stable resistant mutants. There was no obvious cross-resistance to nonfluoroquinolone comparator antimicrobials. A mutant with reduced susceptibility to ciprofloxacin (MIC, 0.25 μg/ml) obtained from the ciprofloxacin-susceptible parental strain had a novel Ser91Tyr alteration in the gyrA gene. We also identified new mutations in the gyrA and/or parC and parE genes and the multidrug-resistant efflux pumps (MtrC-MtrD-MtrE and NorM) of two mutant strains with elevated delafloxacin MICs of 1 μg/ml. Although delafloxacin exhibited potent in vitro activity against N. gonorrhoeae isolates and reference strains with diverse antimicrobial resistance profiles and demonstrated a low tendency to select for spontaneous mutants, it is important to establish the correlation between these excellent in vitro data and treatment outcomes through appropriate randomized controlled clinical trials. PMID:26976873

  14. MTR WING, TRA604. FIRST FLOOR PLAN. ENTRY LOBBY, MACHINE SHOP, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604. FIRST FLOOR PLAN. ENTRY LOBBY, MACHINE SHOP, INSTRUMENT SHOP, COUNTING ROOM, HEALTH PHYSICS LAB, LABS AND OFFICES, STORAGE, SHIPPING AND RECEIVING. BLAW-KNOX 3150-4-2, 7/1950. INL INDEX NO. 053-604-00-099-100008, REV. 7. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  15. MTR WING, TRA604. BASEMENT FLOOR PLAN. FIREPROOF RECORD ROOM BELOW ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604. BASEMENT FLOOR PLAN. FIRE-PROOF RECORD ROOM BELOW COUNTING ROOM. HEATING AND COOLING EQUIPMENT. UNSPECIFIED EXPANSION AREA ALONG WEST WALL. BLAW-KNOX 3150-4-1, 7/1950. INL INDEX NO. 531-0604-00-098-100007, REV. 1. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  16. Sharing the load: Mex67–Mtr2 cofunctions with Los1 in primary tRNA nuclear export

    PubMed Central

    Chatterjee, Kunal; Majumder, Shubhra; Wan, Yao; Shah, Vijay; Wu, Jingyan; Huang, Hsiao-Yun

    2017-01-01

    Eukaryotic transfer RNAs (tRNAs) are exported from the nucleus, their site of synthesis, to the cytoplasm, their site of function for protein synthesis. The evolutionarily conserved β-importin family member Los1 (Exportin-t) has been the only exporter known to execute nuclear export of newly transcribed intron-containing pre-tRNAs. Interestingly, LOS1 is unessential in all tested organisms. As tRNA nuclear export is essential, we previously interrogated the budding yeast proteome to identify candidates that function in tRNA nuclear export. Here, we provide molecular, genetic, cytological, and biochemical evidence that the Mex67–Mtr2 (TAP–p15) heterodimer, best characterized for its essential role in mRNA nuclear export, cofunctions with Los1 in tRNA nuclear export. Inactivation of Mex67 or Mtr2 leads to rapid accumulation of end-matured unspliced tRNAs in the nucleus. Remarkably, merely fivefold overexpression of Mex67–Mtr2 can substitute for Los1 in los1Δ cells. Moreover, in vivo coimmunoprecipitation assays with tagged Mex67 document that the Mex67 binds tRNAs. Our data also show that tRNA exporters surprisingly exhibit differential tRNA substrate preferences. The existence of multiple tRNA exporters, each with different tRNA preferences, may indicate that the proteome can be regulated by tRNA nuclear export. Thus, our data show that Mex67–Mtr2 functions in primary nuclear export for a subset of yeast tRNAs. PMID:29212662

  17. Lidocaine Injection in the Intramuscular Innervation Zone Can Effectively Treat Chronic Neck Pain Caused by MTrPs in the Trapezius Muscle.

    PubMed

    Xie, Peng; Qin, Bangyong; Yang, Fangjiu; Yu, Tian; Yu, Jin; Wang, Jiang; Zheng, Hong

    2015-01-01

    An increasing number of people suffer from neck pain due to life style and prolonged use of computers. Research has revealed that myofascial trigger points (MTrPs) and the intramuscular innervation zone (IZ) are involved in neck pain. MTrPs are induced mainly by IZ dysfunction of the affected skeletal muscle and the 2 do not overlap in location. The question is whether injection treatment in MTrPs or in the IZ is more effective to relieve MTrPs-associated pains. The precise location and body-surface map of the intramuscular IZ in the trapezius muscle and a clinical injection study in the IZ may provide a useful answer to the question. This study aimed to investigate the efficacy of lidocaine injection in the intramuscular IZ for the treatment of chronic neck pain caused by MTrPs in the trapezius muscle. Prospective observational study, approved by the local research ethics. University hospital, departments of Anesthesiology and Anatomy. First, for the determination of IZ distribution and body-surface mapping, a modified intramuscular Sihler's neural staining technique was applied to elucidate nerve distribution patterns of the trapezius muscle. Then, 120 patients with myofascial pain syndrome (MPS) of the trapezius muscle were randomly divided into 5 groups for analysis. Group 1 (n = 24) received injections of saline (0.9% NaCl) at the MTrPs. Group 2 (n = 24) received injections of 0.5% lidocaine at the MTrPs. Group 3 (n = 24) received injections of saline (0.9% NaCl) at the mid-upper trapezius (Point E). Group 4 (n = 24) received injections of 0.5% lidocaine at Point E. Group 5 (n = 24) received a combined injection of 0.5% lidocaine treatment at both Point E and the lower trapezius (Point F). The injection dose was 4 mL at each injection site. All patients received injections once a week for 4 weeks. The visual analogue scale (VAS) and the frequency of painful days per month (FPD) were obtained before treatment and at 2, 4, and 6 months after treatment. The

  18. TEST REACTOR AREA PLOT PLAN CA. 1968. MTR AND ETR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    TEST REACTOR AREA PLOT PLAN CA. 1968. MTR AND ETR AREAS SOUTH OF PERCH AVENUE. "COLD" SERVICES NORTH OF PERCH. ADVANCED TEST REACTOR IN NEW SECTION WEST OF COLD SERVICES SECTION. NEW PERIMETER FENCE ENCLOSES BETA RAY SPECTROMETER, TRA-669, AN ATR SUPPORT FACILITY, AND ATR STACK. UTM LOCATORS HAVE BEEN DELETED. IDAHO NUCLEAR CORPORATION, FROM A BLAW-KNOX DRAWING, 3/1968. INL INDEX NO. 530-0100-00-400-011646, REV. 0. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  19. MTR BASEMENT. DOORWAY TO SOURCE STORAGE VAULT IS AT CENTER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BASEMENT. DOORWAY TO SOURCE STORAGE VAULT IS AT CENTER OF VIEW; TO DECONTAMINATION ROOM, AT RIGHT. PART OF MAZE ENTRY IS VISIBLE INSIDE VAULT DOORWAY. INL NEGATIVE NO. 7763. Unknown Photographer, photo was dated as 3/30/1953, but this was probably an error. The more likely date is 3/30/1952. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  20. Genetic polymorphisms of genes involved in DNA repair and metabolism influence micronucleus frequencies in human peripheral blood lymphocytes.

    PubMed

    Dhillon, Varinderpal S; Thomas, Philip; Iarmarcovai, G; Kirsch-Volders, Micheline; Bonassi, Stefano; Fenech, Michael

    2011-01-01

    The cytokinesis-block micronucleus cytome (CBMNCyt) assay is a widely used technique for measuring DNA damage in human populations. The formation of micronuclei (MN) in dividing cells can result from chromosome breakage due to unrepaired or mis-repaired DNA lesions or chromosome malsegregation due to mitotic malfunction. The sensitivity of the MN assay to polymorphisms in various genes involved in DNA repair, activation/deactivation of carcinogens/chemicals/drugs/alcohol, folate metabolism pathway and micronutrient transport has been extensively reported in the literature. MN frequency is also an important index for determining DNA repair efficiency phenotype (including mis-repair), response to environmental exposure and identifying various dietary factors required for optimal genome stability. The aim of the present study is to review the reported in vivo associations between genotype and MN frequency in humans taking into considerations the presence of interactions with nutrients levels and/or exposure to genotoxins. One hundred and eleven publications linking MN frequency in peripheral blood lymphocytes to gene polymorphism were retrieved from PubMed. After applying exclusion criteria, only 37 studies were evaluated in the present review. Polymorphisms in XRCC1 (Arg280His), ERCC2 (Lys751Gln), CYP2E1 (c1/c2) and MTR (A2756G) were consistently associated with the MN formation. These results contribute substantial evidence to the hypothesis that genotype may influence MN frequency in human cells.

  1. MTR, TRA603. SECOND FLOOR PLAN. OFFICES AND INSTRUMENT ROOM. STEEL ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR, TRA-603. SECOND FLOOR PLAN. OFFICES AND INSTRUMENT ROOM. STEEL PARTITIONS ON EAST SIDE OF INSTRUMENT ROOM. DETAIL OF COLUMN ENCASEMENTS. STAIRWAYS IN NORTH AND SOUTH CORNERS. PASSENGER ELEVATION. BLAW-KNOX 3150-803-3, 7/1950. INL INDEX NO. 531-0603-00-098-100562, REV. 6. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  2. Arsenic methylation capacity in relation to nutrient intake and genetic polymorphisms in one-carbon metabolism.

    PubMed

    Gamboa-Loira, Brenda; Hernández-Alcaraz, César; Gandolfi, A Jay; Cebrián, Mariano E; Burguete-García, Ana; García-Martínez, Angélica; López-Carrillo, Lizbeth

    2018-07-01

    Nutrients and genetic polymorphisms participating in one-carbon metabolism may explain interindividual differences in inorganic arsenic (iAs) methylation capacity, which in turn may account for variations in susceptibility to iAs-induced diseases. 1) To evaluate the association between polymorphisms in five one-carbon metabolism genes (FOLH1 c.223 T > C, MTHFD1 c.1958 G > A, MTHFR c.665 C > T, MTR c.2756A > G, and MTRR c.66 A > G) and iAs methylation capacity; 2) To assess if previously reported associations between nutrient intake and iAs methylation capacity are modified by those polymorphisms. Women (n = 1027) exposed to iAs in Northern Mexico were interviewed. Blood and urine samples were collected. Nutrient dietary intake was estimated using a validated food frequency questionnaire. iAs methylation capacity was calculated from urinary iAs species (iAs, monomethylarsonic acid [MMA] and dimethylarsinic acid [DMA]) measured by high performance liquid chromatography (HPLC-ICP-MS). One polymorphism in each of the five genes evaluated was genotyped by allelic discrimination. Multivariable linear regression models were used to evaluate if genetic polymorphisms modified the associations between iAs methylation capacity parameters and nutrient intake. The median (min-max) concentration of total arsenic (TAs) was 20.2 (1.3-2776.0) µg/g creatinine in the study population. Significant interactions for iAs metabolism were only found with FOLH1 c.223 T > C polymorphism and vitamin B12 intake, so that CT and CC genotype carriers had significantly lower %iAs, and higher DMA/iAs with an increased vitamin B12 intake, as compared to carriers of wild-type TT. Differences in dietary nutrient intake and genetic variants in one-carbon metabolism may jointly influence iAs methylation capacity. Confirmation of these interactions in other populations is warranted. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. WORKERS FABRICATE ROOF SLABS FOR MTR BUILDING AT THE CONSTRUCTION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    WORKERS FABRICATE ROOF SLABS FOR MTR BUILDING AT THE CONSTRUCTION SITE. FORMS WERE MADE OF STEEL. AFTER AN INCH OF CONCRETE HAD BEEN POURED IN THE FORM, A MAT OF REINFORCING STEEL WAS PLACED ON IT. THE REMAINDER OF THE FORM WAS FILLED, AND THE CONCRETE WAS VIBRATED, STRUCK, AND TROWELED. GROOVES AT CORNER WILL HAVE 1/4 INCH RODS WELDED INTO THE EYE OF THE STEEL MAT FOR GROUNDING. INL NEGATIVE NO. 578. Unknown Photographer, 9/1/1950 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  4. MTR CAISSONS WERE DRILLED INTO BEDROCK. IN CENTER OF VIEW, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR CAISSONS WERE DRILLED INTO BEDROCK. IN CENTER OF VIEW, CONCRETE FLOWS FROM TRUCK INTO DRUM, WHICH IS LOWERED INTO CAISSON AND RELEASED AT BOTTOM OF HOLE. BEYOND, TRUCK-MOUNTED DRILLING RIG DRILLS HOLE FOR ANOTHER CAISSON NEAR EDGE OF EXCAVATION. MATERIAL REMOVED FROM HOLE IS CARRIED BY CONVEYOR TO WAITING TRUCK. INL NEGATIVE NO. 307. Unknown Photographer, 6/1950. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  5. MTR BUILDING, TRA603. EAST SIDE. CAMERA FACING WEST. CORRUGATED IRON ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BUILDING, TRA-603. EAST SIDE. CAMERA FACING WEST. CORRUGATED IRON BUILDING MARKED WITH "X" IS TRA-651. TRA-626, TO ITS RIGHT, HOUSED COMPRESSOR EQUIPMENT FOR THE AIRCRAFT NUCLEAR PROPULSION PROGRAM. LATER, IT WAS USED FOR STORAGE. INL NEGATIVE NO. HD46-42-4. Mike Crane, Photographer, April 2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  6. Tumor necrosis factor-α -308 G>A and interleukin-6 -174 G>C promoter polymorphisms and pemphigus.

    PubMed

    Mosaad, Youssef M; Fathy, Hanan; Fawzy, Zakaria; El-Saied, Moustafa Ahmed

    2012-05-01

    The objective of this study was to analyze the possible involvement of the tumor necrosis factor (TNF)-α -308 G>A and interleukin-6 (IL-6) -174 G>C polymorphisms in the susceptibility and/or disease profile of pemphigus in Egyptian patients. Detection of TNF-α -308 G>A by amplification refractory mutation system and IL-6 -174 G>C by restriction fragment length polymorphism was performed for 70 patients and 203 controls. No significant differences were observed in the distribution of TNF-α -308 in pemphigus patients and controls. However, GA+AA genotypes were more frequent in pemphigus vulgaris (PV) patients only versus controls (p(c) = 0.046). The frequency of the C allele and CC/GC genotypes of IL-6 -174 was significantly higher in pemphigus patients and those with the 2 major clinical forms (PV and pemphigus foliaceus [PF]) compared with controls (p < 0.05). Comparison of the distribution of TNF-α -308 and IL-6 -174 variants in relation to clinical type of pemphigus (PV versus PF), activity score, recurrence, and demographic data of patients revealed no significant associations. The IL-6 -174 CC genotype represents a marker of increased susceptibility to pemphigus in Egyptian patients and GG genotype can be considered a low-risk genotype; TNF-α -308 A-containing genotypes contribute to the susceptibility to PV only. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  7. Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine.

    PubMed

    Mozaffari, Elahe; Doosti, Abbas; Arshi, Asghar; Faghani, Mostafa

    2016-12-01

    Migraine is a common debilitating primary headache disorder with current head pain attacks, which contributes to physical activity dysfunctions in chronic pain phase. PGE2 and PGI2 are two important prostaglandins synthesised by COX-2 enzymes, involved in migraine pain signals. COX-2 modulation is essential in treatment and pathogenesis of migraine. This study aimed to investigating the association between COX-2 gene polymorphisms with the risk of migraine susceptibility in migraine patients with related and unrelated parents. This case- control study was based on 100 migraine patients and 100 non-migraine subjects in Bushehr province, Iran in 2013. Genomic DNA of blood samples was extracted and genotyping of COX-2-765G>C (rs20417) and COX-2-1195A>G (rs689466) gene variants was investigated by PCR-RFLP method. Statistical analyses were accomplished using the SPSS software package. There was a significant differences in the frequencies of the COX-2-765G>C and COX-2-1195A>G genotypes between migraine patients and controls ( P ≤0.05). COX-2-765CC , COX-2-765CG , COX-2-1195GG and COX-2-1195AG genotypes can increase the risk of migraine significantly. As the first study in Iran, we are hopeful to achieve greater results about the relevancy of COX-2 gene, migraine and pain signals pathway by repeating these experiments on more samples.

  8. The somatic FAH C.1061C>A change counteracts the frequent FAH c.1062+5G>A mutation and permits U1snRNA-based splicing correction.

    PubMed

    Scalet, Daniela; Sacchetto, Claudia; Bernardi, Francesco; Pinotti, Mirko; van de Graaf, Stan F J; Balestra, Dario

    2018-05-01

    In tyrosinaemia type 1(HT1), a mosaic pattern of fumarylacetoacetase (FAH) immunopositive or immunonegative nodules in liver tissue has been reported in many patients. This aspect is generally explained by a spontaneous reversion of the mutation into a normal genotype. In one HT1 patient carrying the frequent FAH c.1062+5G>A mutation, a second somatic change (c.1061C>A) has been reported in the same allele, and found in immunopositive nodules. Here, we demonstrated that the c.1062+5G>A prevents usage of the exon 12 5' splice site (ss), even when forced by an engineered U1snRNA specifically designed on the FAH 5'ss to strengthen its recognition. Noticeably the new somatic c.1061C>A change, in linkage with the c.1062+5G>A mutation, partially rescues the defective 5'ss and is associated to trace level (~5%) of correct transcripts. Interestingly, this combined genetic condition strongly favored the rescue by the engineered U1snRNA, with correct transcripts reaching up to 60%. Altogether, these findings elucidate the molecular basis of HT1 caused by the frequent FAH c.1062+5G>A mutation, and demonstrate the compensatory effect of the c.1061C>A change in promoting exon definition, thus unraveling a rare mechanism leading to FAH immune-reactive mosaicism.

  9. The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

    PubMed

    Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

    2018-08-01

    Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

  10. Methylenetetrahydrofolate reductase polymorphisms and interaction with smoking and alcohol consumption in lung cancer risk: a case-control study in a Japanese population.

    PubMed

    Kiyohara, Chikako; Horiuchi, Takahiko; Takayama, Koichi; Nakanishi, Yoichi

    2011-10-25

    Cigarette smoking is an established risk factor of lung cancer development while the current epidemiological evidence is suggestive of an increased lung cancer risk associated with alcohol consumption. Dietary folate, which is present in a wide range of fresh fruits and vegetables, may be a micronutrient that has a beneficial impact on lung carcinogenesis. Methylenetetrahydrofolate reductase (MTHFR) plays a crucial role in regulating folate metabolism, which affects both DNA synthesis/repair and methylation. We examined if smoking or alcohol consumption modify associations between MTHFR polymorphisms and lung cancer risk. We evaluated the role of the MTHFR C677T (rs1801133) and A1298C (rs1801131) polymorphisms in a case-control study comprised of 462 lung cancer cases and 379 controls in a Japanese population. Logistic regression was used to assess the adjusted odds ratios (OR) and 95% confidence intervals (95% CI). The TT genotype of the C677T polymorphism was significantly associated with an increased risk of lung cancer (OR = 2.27, 95% CI = 1.42 - 3.62, P < 0.01) while the A1298C polymorphism was not associated with lung cancer risk. The minor alleles of both polymorphisms behaved in a recessive fashion. The highest risks were seen for 677TT-carriers with a history of smoking or excessive drinking (OR = 6.16, 95% CI = 3.48 - 10.9 for smoking; OR = 3.09, 95% CI = 1.64 - 5.81 for drinking) compared with C-carriers without a history of smoking or excessive drinking, but no interactions were seen. The 1298CC genotype was only associated with increased risk among non-smokers (P < 0.05), and smoking was only associated with increased risks among 1298A-carriers (P < 0.01), but no significant interaction was seen. There was a synergistic interaction between the A1298C polymorphism and drinking (P < 0.05). The highest risk was seen for the CC-carriers with excessive drinking (OR = 7.24, 95% CI = 1.89 - 27.7) compared with the A-carriers without excessive drinking). The C

  11. MTR BUILDING, TRA603. SOUTHEAST CORNER, EAST SIDE FACING TOWARD RIGHT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR BUILDING, TRA-603. SOUTHEAST CORNER, EAST SIDE FACING TOWARD RIGHT OF VIEW. CAMERA FACING NORTHWEST. LIGHT-COLORED PROJECTION AT LEFT IS ENGINEERING SERVICES BUILDING, TRA-635. SMALL CONCRETE BLOCK BUILDING AT CENTER OF VIEW IS FAST CHOPPER DETECTOR HOUSE, TRA-665. INL NEGATIVE NO. HD46-43-3. Mike Crane, Photographer, 4/2005 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  12. Variants of the MTHFR gene and susceptibility to acute lymphoblastic leukemia in children: a synthesis of genetic association studies.

    PubMed

    Zintzaras, Elias; Doxani, Chrysoula; Rodopoulou, Paraskevi; Bakalos, Georgios; Ziogas, Dimitris C; Ziakas, Panayiotis; Voulgarelis, Michael

    2012-04-01

    Acute lymphoblastic leukemia (ALL) is a complex disease with genetic background. The genetic association studies (GAS) that investigated the association between ALL and the MTHFR C677T and A1298C gene variants have produced contradictory or inconclusive results. In order to decrease the uncertainty of estimated genetic risk effects, a meticulous meta-analysis of published GAS related the variants in the MTFHR gene with susceptibility to ALL was conducted. The risk effects were estimated based on the odds ratio (OR) of the allele contrast and the generalized odds ratio (OR(G)). Cumulative and recursive cumulative meta-analyses were also performed. The analysis showed marginal significant association for the C677T variant, overall [OR=0.91 (0.82-1.00) and OR(G)=0.89 (0.79-1.01)], and in Whites [OR=0.88 (0.77-0.99) and OR(G)=0.85 (0.73-0.99)]. The A1298C variant produced non-significant results. For both variants, the cumulative meta-analysis did not show a trend of association as evidence accumulates and the recursive cumulative meta-analysis indicated lack of sufficient evidence for denying or claiming an association. The current evidence is not sufficient to draw definite conclusions regarding the association of MTHFR variants and development of ALL. Copyright © 2011 Elsevier Ltd. All rights reserved.

  13. A benzindole substituted carbazole cyanine dye: a novel targeting fluorescent probe for parallel c-myc G-quadruplexes.

    PubMed

    Lin, Dayong; Fei, Xuening; Gu, Yingchun; Wang, Cuihong; Tang, Yalin; Li, Ran; Zhou, Jianguo

    2015-08-21

    Many organic ligands were synthesized to recognize G-quadruplexes. However, different kinds of G-quadruplexes (G4s) possess different structures and functions. Therefore, selective recognition of certain types of G4s is important for the study of G4s. In this paper, a novel cyanine dye, 3-(2-(4-vinylpyridine))-6-(2-((1-(4-sulfobutyl))-3,3-dimethyl-2-vinylbenz[e]indole)-9-ethyl-carbazole (9E PBIC), composed of benzindole and carbazole was designed and synthesised. The studies on UV-vis and fluorescence properties of the dye with different DNA forms showed that the dye exhibits almost no fluorescence under aqueous buffer conditions, but it increased over 100 fold in the presence of c-myc G4 and 10-30 fold in the presence of other G4s, while little in the presence of single/double-stranded DNA, indicating that it has excellent selectivity to c-myc 2345 G4. For the binding studies the dye is interacted with the c-myc 2345 G-quadruplex by using the end-stack binding model. It can be said that the dye is an excellent targeting fluorescent probe for c-myc G-quadruplexes.

  14. Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

    PubMed

    An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

    2015-06-01

    Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  16. gC1q-R/p32, a C1q-binding protein, is a receptor for the InlB invasion protein of Listeria monocytogenes.

    PubMed

    Braun, L; Ghebrehiwet, B; Cossart, P

    2000-04-03

    InlB is a Listeria monocytogenes protein that promotes entry of the bacterium into mammalian cells by stimulating tyrosine phosphorylation of the adaptor proteins Gab1, Cbl and Shc, and activation of phosphatidyl- inositol (PI) 3-kinase. Using affinity chromatography and enzyme-linked immunosorbent assay, we demonstrate a direct interaction between InlB and the mammalian protein gC1q-R, the receptor of the globular part of the complement component C1q. Soluble C1q or anti-gC1q-R antibodies impair InlB-mediated entry. Transient transfection of GPC16 cells, which are non-permissive to InlB-mediated entry, with a plasmid-expressing human gC1q-R promotes entry of InlB-coated beads. Furthermore, several experiments indicate that membrane recruitment and activation of PI 3-kinase involve an InlB-gC1q-R interaction and that gC1q-R associates with Gab1 upon stimulation of Vero cells with InlB. Thus, gC1q-R constitutes a cellular receptor involved in InlB-mediated activation of PI 3-kinase and tyrosine phosphorylation of the adaptor protein Gab1. After E-cadherin, the receptor for internalin, gC1q-R is the second identified mammalian receptor promoting entry of L. monocytogenes into mammalian cells.

  17. Hepatitis A, B, C, D, E, G: an update.

    PubMed

    Hall, Gairy F

    2007-01-01

    Acute and chronic liver diseases are an assortment of disorders brought to the clinician's attention by abnormal liver function tests or specific signs and symptoms. The differential diagnosis includes disorders that have primary or secondary liver involvement. This paper will be limited to the epidemiology, clinical manifestations, diagnosis, treatment, and prevention of the different viral liver diseases: A, B, C, D, E and G.

  18. [Correlation between genetic polymorphisms of -855 G/C and -1140 G/A in GRIN1 gene and paranoid schizophrenia].

    PubMed

    Li, Zhong-Jie; Ding, Mei; Pang, Hao; Sun, Xue-Fei; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

    2013-04-01

    To investigate the single nucleotide polymorphisms (SNP) of -855 G/C and -1140 G/A in promoter regions of GRIN1 gene and find their genetic correlation to paranoid schizophrenia as well as their applicable values in forensic medicine. The genetic polymorphisms of -855 G/C and -1140 G/A at the 5' end of GRIN1 gene were detected by PCR restriction fragment length polymorphism and PAGE in 183 healthy unrelated individuals of northern Chinese Han population and 172 patients of paranoid schizophrenia, respectively. The chi2 test was used to identify Hardy-Weinberg equilibrium of the genotype distribution. The differences of genotypes and allelic frequency distributions were compared between the two groups. Distributions of the genotypic frequencies satisfied Hardy-Weinberg equilibrium in both groups. The difference of genotypes was statistically significant between female patient group and female control group in -855 G/C distribution (P < 0.05). The differences of genotypes and allelic frequencies were statistically significant not only between the patient group and the control group but also between female patient group and female control group in -1140 G/A distribution (P < 0.05). The SNP of -1140 G/A in promoter regions of GRIN1 gene might positively correlate to paranoid schizophrenia. The genetic factor of schizophrenia is involved in gender tendency. And it could be useful in forensic identification of schizophrenia.

  19. sup 60 Co. gamma. -rays induce predominantly C/G to G/C transversions in double-stranded M13 DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoebee, B.; Loman, H.; Brouwer, J.

    Upon irradiation with gamma rays of an oxygenated aqueous solution of double-stranded M13 DNA, a very specific mutation spectrum was found with respect to both the type and the positions in the DNA sequence. Of the 23 mutations, which were sequenced, 16 represent a C/G to G/C transversion. A C/G to T/A transition was found once and a G/C to T/A transversion twice. The remaining 4 mutations are frameshifts, 2 are identical and formed by the insertion of a G/C basepair; the other 2 mutations are due to a duplication of 10 basepairs situated at different positions but with amore » remarkable homology in base sequence. Fourteen mutations, including the 2 duplications are found in the neighborhood of a TGCT/ACGA sequence.« less

  20. Association between methylenetetrahydrofolate reductase polymorphisms and the relapse of acute lymphoblastic leukemia: a meta-analysis.

    PubMed

    He, H-R; Chen, S-Y; You, H-S; Hu, S-S; Sun, J-Y; Dong, Y-L; Lu, J

    2014-10-01

    Relapse is a threat in patients treated for acute lymphoblastic leukemia (ALL). Methylenetetrahydrofolate reductase (MTHFR) activity may affect the sensitivity of patients to folate-based chemotherapeutic drugs, thus influencing the relapse risk. Two polymorphisms of the gene encoding MTHFR, C677T and A1298C, alter MTHFR enzyme activity and may be associated with ALL relapse. The aim of this meta-analysis was to clarify the correlation between the C677T and A1298C polymorphisms and ALL relapse. To this end, data were collected from studies of the association between these two polymorphisms and ALL relapse. Analysis of the data revealed a serious contradiction among the results. A recessive model demonstrated that the ALL relapse risk was significantly increased in carriers of the 677 TT genotype, especially for pediatric ALL, but was unaffected by the A1298C polymorphism. These findings confirm that the MTHFR C677T polymorphism could be considered as a good marker of the pediatric ALL relapse risk.

  1. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest. ...

  2. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance:Treasury 2 2013-07-01 2013-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest. ...

  3. 31 CFR 315.32 - Series A, B, C, D, F, G, J, and K bonds.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Series A, B, C, D, F, G, J, and K.... SAVINGS BONDS, SERIES A, B, C, D, E, F, G, H, J, AND K, AND U.S. SAVINGS NOTES Interest § 315.32 Series A, B, C, D, F, G, J, and K bonds. All bonds of these series have matured and no longer earn interest. ...

  4. Gene polymorphisms as risk factors for predicting the cardiovascular manifestations in Marfan syndrome. Role of folic acid metabolism enzyme gene polymorphisms in Marfan syndrome.

    PubMed

    Benke, Kálmán; Ágg, Bence; Mátyás, Gábor; Szokolai, Viola; Harsányi, Gergely; Szilveszter, Bálint; Odler, Balázs; Pólos, Miklós; Maurovich-Horvat, Pál; Radovits, Tamás; Merkely, Béla; Nagy, Zsolt B; Szabolcs, Zoltán

    2015-10-01

    Folic acid metabolism enzyme polymorphisms are believed to be responsible for the elevation of homocysteine (HCY) concentration in the blood plasma, correlating with the pathogenesis of aortic aneurysms and aortic dissection. We studied 71 Marfan patients divided into groups based on the severity of cardiovascular involvement: no intervention required (n=27, Group A); mild involvement requiring intervention (n=17, Group B); severe involvement (n=27, Group C) subdivided into aortic dilatation (n=14, Group C1) and aortic dissection (n=13, Group C2), as well as 117 control subjects. We evaluated HCY, folate, vitamin B12 and the polymorphisms of methylenetetrahydrofolate reductase (MTHFR;c.665C>T and c.1286A>C), methionine synthase (MTR;c.2756A>G) and methionine synthase reductase (MTRR;c.66A>G). Multiple comparisons showed significantly higher levels of HCY in Group C2 compared to Groups A, B, C1 and control group (p<0.0001, p<0.0001, p=0.001 and p=0.003, respectively). Folate was lower in Group C2 than in Groups A, B, C1 and control subjects (p<0.0001, p=0.02, p<0.0001 and p<0.0001, respectively). Group C2 had the highest prevalence of homozygotes for all four gene polymorphisms. Multivariate logistic regression analysis revealed that HCY plasma level was an independent risk factor for severe cardiovascular involvement (Group C; odds ratio [OR] 1.85, 95% confidence interval [CI] 1.28-2.67, p=0.001) as well as for aortic dissection (Group C2; OR 2.49, 95%CI 1.30-4.78, p=0.006). In conclusion, severe cardiovascular involvement in Marfan patients, and especially aortic dissection, is associated with higher HCY plasma levels and prevalence of homozygous genotypes of folic acid metabolism enzymes than mild or no cardiovascular involvement. These results suggest that impaired folic acid metabolism has an important role in the development and remodelling of the extracellular matrix of the aorta.

  5. WATER PROCESS SYSTEM FLOW DIAGRAM FOR MTR, TRA603. SUMMARY OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    WATER PROCESS SYSTEM FLOW DIAGRAM FOR MTR, TRA-603. SUMMARY OF COOLANT FLOW FROM WORKING RESERVOIR TO INTERIOR OF REACTOR'S THERMAL SHIELD. NAMES TANK SECTIONS. PIPE AND DRAIN-LINE SIZES. SHOWS DIRECTION OF AIR FLOW THROUGH PEBBLE AND GRAPHITE BLOCK ZONE. NEUTRON CURTAIN AND THERMAL COLUMN DOOR. BLAW-KNOX 3150-92-7, 3/1950. INL INDEX NO. 531-0603-51-098-100036, REV. 6. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  6. High Performance Reduction of H2O2 with an Electron Transport Decaheme Cytochrome on a Porous ITO Electrode

    PubMed Central

    2017-01-01

    The decaheme cytochrome MtrC from Shewanella oneidensis MR-1 immobilized on an ITO electrode displays unprecedented H2O2 reduction activity. Although MtrC showed lower peroxidase activity in solution compared to horseradish peroxidase, the ten heme cofactors enable excellent electronic communication and a superior activity on the electrode surface. A hierarchical ITO electrode enabled optimal immobilization of MtrC and a high current density of 1 mA cm–2 at 0.4 V vs SHE could be obtained at pH 6.5 (Eonset = 0.72 V). UV–visible and Resonance Raman spectroelectrochemical studies suggest the formation of a high valent iron-oxo species as the catalytic intermediate. Our findings demonstrate the potential of multiheme cytochromes to catalyze technologically relevant reactions and establish MtrC as a new benchmark in biotechnological H2O2 reduction with scope for applications in fuel cells and biosensors. PMID:28221032

  7. High prevalence of three prothrombotic polymorphisms among Palestinians: factor V G1691A, factor II G20210A and methylenetetrahydrofolate reductase C677T.

    PubMed

    Hussein, Ayman S

    2012-10-01

    Factor V leiden G1691A/R506Q (FVL), prothrombin G20210A (FII) and methylenetetrahydrofolate reductase (MTHFR) C677T are related genetic risk factors for venous thromboembolism. Analysis for those mutations is increasingly being performed on patients exhibiting hypercoagulability. The objective of this study was to determine the prevalence of FVL, FII-G20210A and MTHFR-C677T polymorphisms and their coexistence among apparently healthy Palestinians. After institutional approval, 303 apparently healthy students from An-Najah University representative to North and South regions of West Bank with no previous history of cardiovascular diseases participated in this study. A uniform questionnaire was used to collect relevant information through personal interview with the subjects. The collected information included gender, age, smoking habits, weight and height, diseases such as diabetes, cardiovascular and family history of CVD. The frequencies of allelic distribution of the three prothrombotic polymorphisms factor V G1691A/R506Q), prothrombin G2010A, and MTHFR-C677T were 0.114, 0.050 and 0.071, respectively. The prevalence of the three thrombotic polymorphisms (FVL, FII G20210A and MTHFR-C677T) were 20.1, 9.1 and 13.8 %, respectively. Statistical analysis for factor V leiden showed no significant association between place of residence (P value = 0.953) and gender (P value >0.082). The data presented in this study showed the highest prevalence of FVL among healthy Palestinians compared to other populations and this important finding should be followed in terms of clinical significance.

  8. Thermodynamics of triple helix formation: spectrophotometric studies on the d(A)10.2d(T)10 and d(C+3T4C+3).d(G3A4G3).d(C3T4C3) triple helices.

    PubMed Central

    Pilch, D S; Brousseau, R; Shafer, R H

    1990-01-01

    We have stabilized the d(A)10.2d(T)10 and d(C+LT4C+3).d(G3A4G3).d(C3T4C3) triple helices with either NaCl or MgCl2 at pH 5.5. UV mixing curves demonstrate a 1:2 stoichiometry of purine to pyrimidine strands under the appropriate conditions of pH and ionic strength. Circular dichroic titrations suggest a possible sequence-independent spectral signature for triplex formation. Thermal denaturation profiles indicate the initial loss of the third strand followed by dissociation of the underlying duplex with increasing temperature. Depending on the base sequence and ionic conditions, the binding affinity of the third strand for the duplex at 25 degrees C is two to five orders of magnitude lower than that of the two strands forming the duplex. Thermodynamic parameters for triplex formation were determined for both sequences in the presence of 50 mM MgCl2 and/or 2.0 M NaCl. Hoogsteen base pairs are 0.22-0.64 kcal/mole less stable than Watson-Crick base pairs, depending on ionic conditions and base composition. C+.G and T.A Hoogsteen base pairs appear to have similar stability in the presence of Mg2+ ions at low pH. PMID:2216768

  9. Total Syntheses of (-)-Mersicarpine, (-)-Scholarisine G, (+)-Melodinine E, (-)-Leuconoxine, (-)-Leuconolam, (-)-Leuconodine A, (+)-Leuconodine F, and (-)-Leuconodine C: Self-Induced Diastereomeric Anisochronism (SIDA) Phenomenon for Scholarisine G and Leuconodines A and C.

    PubMed

    Xu, Zhengren; Wang, Qian; Zhu, Jieping

    2015-05-27

    Enantioselective total syntheses of title natural products from a common cyclohexenone derivative (S)-18 were reported. Ozonolysis of (S)-18 afforded a stable diketo ester (R)-17 that was subsequently converted to two skeletally different natural products, i.e., (-)-mersicarpine (8) with a [6.5.6.7] fused tetracyclic ring system and (-)-scholarisine G (9) with a [6.5.6.6.5] fused pentacyclic skeleton, respectively. The postcyclization diversification was realized by taking advantage of the facile conversion of (+)-melodinine E (6) to N-acyliminium ion 7, from which a hydroxy group was selectively introduced to the C6, C7, C10 and the central C21 position of diazafenestrane system, leading to (-)-leuconodine A (11), (+)-leuconodine F (12), (-)-scholarisine G (9), (-)-leuconodine C (13), and skeletally different (-)-leuconolam (5). Furthermore, an unprecedented non-natural oxabridged oxadiazafenestrane 68 was formed by oxidation of (+)-melodinine E (6). During the course of this study, a strong self-induced diastereomeric anisochronism (SIDA) phenomenon was observed for scholarisine G (9), leuconodines A (11) and C (13). X-ray structures of both the racemic and the enantiopure natural products 9, 11, and 13 were obtained. The different crystal packing of these two forms nicely explained the chemical shift differences observed in the (1)H NMR spectra of the racemic and the enantio-enriched compounds in an achiral environment.

  10. MTR, TRA603. FIRST FLOOR PLAN. REACTOR AT CENTER. TWENTYMETER CHOPPER ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR, TRA-603. FIRST FLOOR PLAN. REACTOR AT CENTER. TWENTY-METER CHOPPER HOUSE. COFFIN TURNING ROLLS. REMOVABLE PANEL OVER CANAL ON EAST SIDE. NEW PLUG STORAGE ACCESS. DOOR SCHEDULE INDICATES STEEL (FOR VAULT), WIRE MESH, AND HOLLOW METAL TYPES. STORAGE AND ISSUE ROOM. SAFETY SHOWERS. DOORWAY TO WING, TRA-604. BLAW-KNOX 3150-803-2, 7/1950. INL INDEX NO. 531-0603-00-098-100561, REV. 10. - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  11. Frequency distribution of interleukin-10 haplotypes (-1082 A>G, -819 C>T, and -592 C>A) in a Mexican population.

    PubMed

    Vázquez-Villamar, M; Palafox-Sánchez, C A; Hernández-Bello, J; Muñoz-Valle, J F; Valle, Y; Cruz, A; Alatorre-Meza, A I; Oregon-Romero, E

    2016-11-03

    Interleukin 10 (IL-10) is an immunoregulatory cytokine with multiple roles in the immune system. Three single nucleotide polymorphisms at positions -1082 (A>G), -819 (C>T), and -592 (C>A) in the promoter region of the IL10 gene are believed to be associated with different inflammatory, infectious, and autoimmune diseases. These polymorphisms exhibit a strong linkage disequilibrium (LD) and form three principal haplotypes (GCC, ACC, and ATA). The GCC and ATA haplotypes have been associated with high and low levels of IL-10 production, respectively. The aim of this study was to establish the allele and haplotype frequencies of the IL10 polymorphisms in Mestizos from western Mexico. SNPs were analyzed in 340 healthy unrelated Mestizos from western Mexico by polymerase chain reaction-restriction fragment length polymorphism. The studied population presented significant differences, in the distribution of IL10 polymorphisms, from the Asian, African, and European populations. We also observed a strong LD within -1082 A>G, -819 C>T, and -592 C>A (100% pc = 7.735 x 10 -18 ). The haplotypes ACC (45.4%), ATA (22.0%), GTA (14.9%), and GCC (13.9%) were most frequently observed in this population. The haplotype frequencies, however, differed from those reported previously in Mestizos from central Mexico, Asians, Africans, and European Caucasians, suggesting a differential gene flow in the Mexican Mestizo population. This could account for the genetic variability between Mexicans and populations of other ethnicities. The study of these polymorphisms and their haplotypes could help in expanding our knowledge to design future disease-risk studies on the western Mexican population.

  12. Modified pectic polysaccharide from turmeric (Curcuma longa): A potent dietary component against gastric ulcer.

    PubMed

    Harsha, Mysore R; Chandra Prakash, Serkad V; Dharmesh, Shylaja M

    2016-03-15

    Native, intact (TrPP) and modified, low-molecular-weight (MTrPP) forms of pectic polysaccharides isolated from turmeric were evaluated for ulcer-preventive potentials in in vitro and in vivo models. Data indicated that MTrPP possessed significantly better ulcer-preventive property than TrPP; inhibiting ulcer scores up to 85%. Results were substantiated by effective muco-protection, H(+),K(+)-ATPase down-regulation, inhibition of H. pylori growth/adherence, higher antioxidant/cytoprotective mechanisms. Structural data indicated TrPP and MTrPP differ in their molecular weights and structural characteristics with different sugar compositions and side chain ratios. MTrPP was rich in galacturonic acid (687mg/g; TrPP-544mg/g) and galactose (52.9%; TrPP-21.7%). Results were substantiated by NMR/FTIR data indicating the presence of homogalacturonan and rhamnogalacturonam-I containing galactans. By virtue of binding to inflammatory marker (galectin-3), galactans may reduce inflammation induced ulcerations. The low molecular weight of MTrPP (155kDa; TrPP-13kDa) may increase its bioavailability than TrPP, thus MTrPP may possess higher antiulcer potential. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Solute Carrier Family 19, member 1 (SLC19A1) polymorphisms (-43T>C, 80G>A, and 696C>T), and haplotypes in idiopathic recurrent spontaneous abortion in a Korean population.

    PubMed

    Rah, HyungChul; Choi, Yi Seul; Jeon, Young Joo; Choi, Youngsok; Cha, Sun Hee; Choi, Dong Hee; Ko, Jung Jae; Shim, Sung Han; Kim, Nam Keun

    2012-05-01

    The objective was to investigate the association between idiopathic recurrent spontaneous abortion (RSA) and 3 SLC19A1 polymorphisms (-43T>C, 80G>A, and 696C>T). DNA from 269 patients with RSA and 125 controls were genotyped for the 3 SLC19A1 single nucleotide polymorphisms (SNPs) by polymerase chain reaction-restriction fragment length polymorphism. Homocysteine and folate levels of 100 patients with RSA were available for analysis. The combination genotypes of SLC19A1 -43TC/80GG, -43TC/80AA, and -43CC/80GA; 80GA/696TT, 80AA/696CC; and -43TC/696CC were less frequent in patients with RSA compared to controls (P < .05 for each). The -43C/80A/696 T and -43T/80G/696C haplotypes were more frequent in patients than controls, whereas -43T/80A/696C, -43C/80A/696C, -43C/80G/696C, -43C/80G/696T, and -43T/80G/696T haplotypes were less frequent in patients (P < .05 for each). The -43T/80G and 80A/696T haplotypes were more frequent in patients, while -43T/80A, -43C/80G, 80A/696C, 80G/696T, and -43C/696C haplotypes occurred less frequently in patients (P < .05 for each). The associations between idiopathic RSA occurrence and SLC19A1 -43T>C/80G>A/696C>T polymorphisms were identified and can be developed as biomarkers for RSA risk.

  14. Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children.

    PubMed

    De la Cruz-Mosso, Ulises; Muñoz-Valle, José F; Salgado-Goytia, Lorenzo; García-Carreón, Adrián; Illades-Aguiar, Berenice; Castañeda-Saucedo, Eduardo; Parra-Rojas, Isela

    2012-03-29

    Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was associated with the increase of total

  15. A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

    PubMed

    Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

    2013-12-01

    Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

  16. Mitochondrial G8292A and C8794T mutations in patients with Niemann-Pick disease type C.

    PubMed

    Masserrat, Abbas; Sharifpanah, Fatemeh; Akbari, Leila; Tonekaboni, Seyed Hasan; Karimzadeh, Parvaneh; Asharafi, Mahmood Reza; Mazouei, Safoura; Sauer, Heinrich; Houshmand, Massoud

    2018-07-01

    Niemann-Pick disease type C (NP-C) is a neurovisceral lipid storage disorder. At the cellular level, the disorder is characterized by accumulation of unesterified cholesterol and glycolipids in the lysosomal/late endosomal system. NP-C is transmitted in an autosomal recessive manner and is caused by mutations in either the NPC1 (95% of families) or NPC2 gene. The estimated disease incidence is 1 in 120,000 live births, but this likely represents an underestimate, as the disease may be under-diagnosed due to its highly heterogeneous presentation. Variants of adenosine triphosphatase (ATPase) subunit 6 and ATPase subunit 8 ( ATPase6/8 ) in mitochondrial DNA (mtDNA) have been reported in different types of genetic diseases including NP-C. In the present study, the blood samples of 22 Iranian patients with NP-C and 150 healthy subjects as a control group were analyzed. The DNA of the blood samples was extracted by the salting out method and analyzed for ATPase6/8 mutations using polymerase chain reaction sequencing. Sequence variations in mitochondrial genome samples were determined via the Mitomap database. Analysis of sequencing data confirmed the existence of 11 different single nucleotide polymorphisms (SNPs) in patients with NP-C1. One of the most prevalent polymorphisms was the A8860G variant, which was observed in both affected and non-affected groups and determined to have no significant association with NP-C incidence. Amongst the 11 polymorphisms, only one was identified in the ATPase8 gene, while 9 including A8860G were observed in the ATPase6 gene. Furthermore, two SNPs, G8292A and C8792A, located in the non-coding region of mtDNA and the ATPase6 gene, respectively, exhibited significantly higher prevalence rates in NP-C1 patients compared with the control group (P<0.01). The present study suggests that there may be an association between mitochondrial ATPase6/8 mutations and the incidence of NP-C disease. In addition, the mitochondrial SNPs identified

  17. Neonatal Hyperbilirubinemia in infants with G6PD c.563C > TVariant

    PubMed Central

    2012-01-01

    Background There is a strong correlation between glucose-6-phosphate dehydrogenase (G6PD) deficiency and neonatal hyperbilirubinemia with a rare but potential threat of devastating acute bilirubin encephalopathy. G6PD deficiency was observed in 4–14% of hospitalized icteric neonates in Pakistan. G6PD c.563C > T is the most frequently reported variant in this population. The present study was aimed at evaluating the time to onset of hyperbilirubinemia and the postnatal bilirubin trajectory in infants having G6PD c.563C > T. Methods This was a case–control study conducted at The Aga Khan University, Pakistan during the year 2008. We studied 216 icteric male neonates who were re-admitted for phototherapy during the study period. No selection was exercised. Medical records showed that 32 were G6PD deficient while 184 were G6PD normal. Each infant was studied for birth weight, gestational age, age at the time of presentation, presence of cephalhematoma, sepsis and neurological signs, peak bilirubin level, age at peak bilirubin level, days of hospitalization, whether phototherapy or exchange blood transfusion was initiated, and the outcome. During hospital stay, each baby was tested for complete blood count, reticulocyte count, ABO and Rh blood type, direct antiglobulin test and quantitative G6PD estimation [by kinetic determination of G6PDH]. G6PDgenotype was analyzed in 32 deficient infants through PCR-RFLP analysis and gene sequencing. Results G6PD variants c.563C > T and c.131 C > G were observed in 21 (65%) and three (9%) of the 32 G6PD deficient infants, respectively. DNA of eight (25%) newborns remained uncharacterized. In contrast to G6PD normal neonates, infants with c.563C > T variant had significantly lower enzyme activity (mean ± 1SD; 0.3 ± 0.2 U/gHb vs. 14.0 ± 4.5 U/gHb, p < 0.001) experienced higher peak levels of total serum bilirubin (mean ± 1SD; 16.8 ± 5.4 mg/dl vs. 13.8 ± 4.6 mg/dl, p = 0.008) which peaked earlier after

  18. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population.

    PubMed

    Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

    2005-05-27

    Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population.

  19. Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population

    PubMed Central

    Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

    2005-01-01

    Background Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. Methods We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. Results No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Conclusion Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population. PMID:15921520

  20. C. G. Jung's Dream of Siegfried: A Psychobiographical Study.

    PubMed

    Kovary, Zoltan

    2015-08-01

    During the past decades, besides Sigmund Freud, C.G. Jung has been a subject of modern psychobiographical investigations. The revealed documents of Jung and Sabina Speielrein's relationship remarkably changed the narratives of this outstanding story, and it also bears important theoretical consequences. This article focuses on Jung's Siegfried-dream found in his autobiography, since it is closely related to the Freud-Jung-Spielrein triangle, and can be associated with some significant aspects of intellectual history. The text of the dream is treated as an Allportian "first-person document" that can be a starting point of a psychobiographical investigation.

  1. Transcobalamin II (TCN2 67A>G and TCN2 776C>G) and transcobalamin II receptor (TCblR 1104C>T) polymorphisms in Korean patients with idiopathic recurrent spontaneous abortion.

    PubMed

    Kim, Hyun Seok; Lee, Bo Eun; Jeon, Young Joo; Rah, HyungChul; Lee, Woo Sik; Shin, Ji Eun; Choi, Dong Hee; Kim, Nam Keun

    2014-09-01

    The transcobalamin II (TCN2) 776C>G polymorphism has been reported to be a genetic risk factor for idiopathic recurrent spontaneous abortion (RSA). However, the sample size in previous studies was small, and other TCN2 polymorphisms have not been studied. Moreover, the TCN2 67A>G and 776C>G polymorphisms, and the transcobalamin II receptor (TCblR/CD320) 1104C>T polymorphism, have demonstrated associations with immune responses. Three hundred and seventy-eight RSA patients who had at least two consecutive spontaneous abortions were enrolled. Two hundred and seven control subjects were collected from a convenience sample. Polymerase chain reaction and restriction fragment length polymorphism analysis were performed to identify the TCN2 67A>G and 776C>G polymorphisms, and the TCblR 1104C>T polymorphism. RSA patients showed significantly different frequencies of the TCN2 67AG+GG genotypes compared with control subjects. The TCN2 67G allele is a possible risk factor for idiopathic RSA. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Final Environmental Assessment for Proposed Airspace Changes for Paradise East and Paradise West Military Operations Areas (MOAs) at Mountain Home Air Force Base (MHAFB) Idaho

    DTIC Science & Technology

    2010-03-29

    IR FO R C E\\ 32 99 91 AI R SP A C E EA \\G IS \\M X D \\F IG U R E- A LT ER N AT IV E A. M X D M KO U BE K...basis. BO I \\\\O W L\\ PR O J\\ M O U N TA IN H O M EA IR FO R C E\\ 32 99 91 AI R SP A C E EA \\G IS \\M X D \\F IG U R E- A LT ER N AT IV E B. M X D M KO...MTR. MTR segments are identified and charted as either IR routes (IFR) or VR routes

  3. Versatile mechanical properties of novel g-SiC x monolayers from graphene to silicene: a first-principles study.

    PubMed

    Lu, X K; Xin, T Y; Zhang, Q; Xu, Q; Wei, T H; Wang, Y X

    2018-08-03

    Recently, a series of graphene-like binary monolayers (g-SiC x ), where Si partly substitutes the C positions in graphene, have been obtained by tailoring the band gaps of graphene and silicene that have made them a promising material for application in opto-electronic devices. Subsequently, evaluating the mechanical properties of g-SiC x has assumed great importance for engineering applications. In this study, we quantified the in-plane mechanical properties of g-SiC x (x = 7, 5, 3, 2 and 1) monolayers (also including graphene and silicene) based on density function theory. It was found that the mechanical parameters of g-SiC x , such as the ideal strength, Young's modulus, shear modulus, Poisson's ratio, as well as fracture toughness, are overall related to the ratio of Si-C to C-C bonds, which varies with Si concentration. However, for g-SiC 7 and g-SiC 3 , the mechanical properties seem to depend on the structure because in g-SiC 7 , the C-C bond strength is severely weakened by abnormal stretching, and in g-SiC 3 , conjugation structure is formed. The microscopic failure of g-SiC x exhibits diverse styles depending on the more complex structural deformation modes introduced by Si substitution. We elaborated the structure-properties relationship of g-SiC x during the failure process, and in particular, found that the structural transformation of g-SiC 3 and g-SiC is due to the singular symmetry of their structure. Due to the homogeneous phase, all the g-SiC x investigated in this study preserve rigorous isotropic Young's moduli and Poisson's ratios. With versatile mechanical performances, the family of g-SiC x may facilitate the design of advanced two-dimensional materials to meet the needs for practical mechanical engineering applications. The results offer a fundamental understanding of the mechanical behaviors of g-SiC x monolayers.

  4. Draft genome sequence of Janthinobacterium lividum strain MTR reveals its mechanism of capnophilic behavior.

    PubMed

    Valdes, Natalia; Soto, Paola; Cottet, Luis; Alarcon, Paula; Gonzalez, Alex; Castillo, Antonio; Corsini, Gino; Tello, Mario

    2015-01-01

    Janthinobacterium lividum is a Gram-negative bacterium able to produce violacein, a pigment with antimicrobial and antitumor properties. Janthinobacterium lividum colonizes the skin of some amphibians and confers protection against fungal pathogens. The mechanisms underlying this association are not well understood. In order to identify the advantages for the bacterium to colonize amphibian skin we sequenced Janthinobacterium lividum strain MTR, a strain isolated from Cajón del Maipo, Chile. The strain has capnophilic behavior, with growth favored by high concentrations (5 %) of carbon dioxide. Its genome is 6,535,606 bp in size, with 5,362 coding sequences and a G + C content of 62.37 %. The presence of genes encoding for products that participate in the carbon fixation pathways (dark CAM pathways), and the entire set of genes encoding for the enzymes of the glyoxylate cycle may explain the capnophilic behavior and allow us to propose that the CO2 secreted by the skin of amphibians is the signal molecule that guides colonization by Janthinobacterium lividum.

  5. Relationship of metabolic syndrome and its components with -844 G/A and HindIII C/G PAI-1 gene polymorphisms in Mexican children

    PubMed Central

    2012-01-01

    Background Several association studies have shown that -844 G/A and HindIII C/G PAI-1 polymorphisms are related with increase of PAI-1 levels, obesity, insulin resistance, glucose intolerance, hypertension and dyslipidemia, which are components of metabolic syndrome. The aim of this study was to analyze the allele and genotype frequencies of these polymorphisms in PAI-1 gene and its association with metabolic syndrome and its components in a sample of Mexican mestizo children. Methods This study included 100 children with an age range between 6-11 years divided in two groups: a) 48 children diagnosed with metabolic syndrome and b) 52 children metabolically healthy without any clinical and biochemical alteration. Metabolic syndrome was defined as the presence of three or more of the following criteria: fasting glucose levels ≥ 100 mg/dL, triglycerides ≥ 150 mg/dL, HDL-cholesterol < 40 mg/dL, obesity BMI ≥ 95th percentile, systolic blood pressure (SBP) and diastolic blood pressure (DBP) ≥ 95th percentile and insulin resistance HOMA-IR ≥ 2.4. The -844 G/A and HindIII C/G PAI-1 polymorphisms were analyzed by PCR-RFLP. Results For the -844 G/A polymorphism, the G/A genotype (OR = 2.79; 95% CI, 1.11-7.08; p = 0.015) and the A allele (OR = 2.2; 95% CI, 1.10-4.43; p = 0.015) were associated with metabolic syndrome. The -844 G/A and A/A genotypes were associated with increase in plasma triglycerides levels (OR = 2.6; 95% CI, 1.16 to 6.04; p = 0.02), decrease in plasma HDL-cholesterol levels (OR = 2.4; 95% CI, 1.06 to 5.42; p = 0.03) and obesity (OR = 2.6; 95% CI, 1.17-5.92; p = 0.01). The C/G and G/G genotypes of the HindIII C/G polymorphism contributed to a significant increase in plasma total cholesterol levels (179 vs. 165 mg/dL; p = 0.02) in comparison with C/C genotype. Conclusions The -844 G/A PAI-1 polymorphism is related with the risk of developing metabolic syndrome, obesity and atherogenic dyslipidemia, and the HindIII C/G PAI-1 polymorphism was

  6. Purification of the active C5a receptor from human polymorphonuclear leukocytes as a receptor - G sub i complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rollins, T.E.; Siciliano, S.; Kobayashi, S.

    1991-02-01

    The authors have isolated, in an active state, the C5a receptor from human polymorphonuclear leukocytes. The purification was achieved in a single step using a C5a affinity column in which the C5a molecule was coupled to the resin through its N terminus. The purified receptor, like the crude solubilized molecule, exhibited a single class of high-affinity binding sites with a K{sub d} of 30 pM. Further, the binding of C5a retained its sensitivity to guanine nucleotides, implying that the purified receptor contained a guanine nucleotide-binding protein (G protein). SDS/PAGE revealed the presence of three polypeptides with molecular masses of 42,more » 40, and 36 kDa, which were determined to be the C5a-binding subunit and the {alpha} and {beta} subunits of G{sub i}, respectively. The 36- and 40-kDa polypeptides were identified by immunoblotting and by the ability of pertussis toxin to ADP-ribosylate the 40-kDa molecule. These results confirm their earlier hypothesis that the receptor exists as a complex with a G protein in the presence or absence of C5a. The tight coupling between the receptor and G protein should make possible the identification of the G protein(s) involved in the transduction pathways used by C5a to produce its many biological effects.« less

  7. Association between -174G/C and -572G/C interleukin 6 gene polymorphisms and severe radiographic damage to the hands of Mexican patients with rheumatoid arthritis: a preliminary report.

    PubMed

    Zavaleta-Muñiz, S A; Gonzalez-Lopez, L; Murillo-Vazquez, J D; Saldaña-Cruz, A M; Vazquez-Villegas, M L; Martín-Márquez, B T; Vasquez-Jimenez, J C; Sandoval-Garcia, F; Ruiz-Padilla, A J; Fajardo-Robledo, N S; Ponce-Guarneros, J M; Rocha-Muñoz, A D; Alcaraz-Lopez, M F; Cardona-Müller, D; Totsuka-Sutto, S E; Rubio-Arellano, E D; Gamez-Nava, J I

    2016-12-19

    Several interleukin 6 gene (IL6) polymorphisms are implicated in susceptibility to rheumatoid arthritis (RA). It has not yet been established with certainty if these polymorphisms are associated with the severe radiographic damage observed in some RA patients, particularly those with the development of joint bone ankylosis (JBA). The objective of the present study was to evaluate the association between severe radiographic damage in hands and the -174G/C and -572G/C IL6 polymorphisms in Mexican Mestizo people with RA. Mestizo adults with RA and long disease duration (>5 years) were classified into two groups according to the radiographic damage in their hands: a) severe radiographic damage (JBA and/or joint bone subluxations) and b) mild or moderate radiographic damage. We compared the differences in genotype and allele frequencies of -174G/C and -572G/C IL6 polymorphisms (genotyped using polymerase chain reaction-restriction fragment length polymorphism) between these two groups. Our findings indicated that the -174G/C polymorphism of IL6 is associated with severe joint radiographic damage [maximum likelihood odds ratios (MLE_OR): 8.03; 95%CI 1.22-187.06; P = 0.03], whereas the -572G/C polymorphism of IL6 exhibited no such association (MLE_OR: 1.5; 95%CI 0.52-4.5; P = 0.44). Higher anti-cyclic citrullinated peptide antibody levels were associated with more severe joint radiographic damage (P = 0.04). We conclude that there is a relevant association between the -174G/C IL6 polymorphism and severe radiographic damage. Future studies in other populations are required to confirm our findings.

  8. A discrete event simulation model for evaluating the performances of an m/g/c/c state dependent queuing system.

    PubMed

    Khalid, Ruzelan; Nawawi, Mohd Kamal M; Kawsar, Luthful A; Ghani, Noraida A; Kamil, Anton A; Mustafa, Adli

    2013-01-01

    M/G/C/C state dependent queuing networks consider service rates as a function of the number of residing entities (e.g., pedestrians, vehicles, and products). However, modeling such dynamic rates is not supported in modern Discrete Simulation System (DES) software. We designed an approach to cater this limitation and used it to construct the M/G/C/C state-dependent queuing model in Arena software. Using the model, we have evaluated and analyzed the impacts of various arrival rates to the throughput, the blocking probability, the expected service time and the expected number of entities in a complex network topology. Results indicated that there is a range of arrival rates for each network where the simulation results fluctuate drastically across replications and this causes the simulation results and analytical results exhibit discrepancies. Detail results that show how tally the simulation results and the analytical results in both abstract and graphical forms and some scientific justifications for these have been documented and discussed.

  9. A Discrete Event Simulation Model for Evaluating the Performances of an M/G/C/C State Dependent Queuing System

    PubMed Central

    Khalid, Ruzelan; M. Nawawi, Mohd Kamal; Kawsar, Luthful A.; Ghani, Noraida A.; Kamil, Anton A.; Mustafa, Adli

    2013-01-01

    M/G/C/C state dependent queuing networks consider service rates as a function of the number of residing entities (e.g., pedestrians, vehicles, and products). However, modeling such dynamic rates is not supported in modern Discrete Simulation System (DES) software. We designed an approach to cater this limitation and used it to construct the M/G/C/C state-dependent queuing model in Arena software. Using the model, we have evaluated and analyzed the impacts of various arrival rates to the throughput, the blocking probability, the expected service time and the expected number of entities in a complex network topology. Results indicated that there is a range of arrival rates for each network where the simulation results fluctuate drastically across replications and this causes the simulation results and analytical results exhibit discrepancies. Detail results that show how tally the simulation results and the analytical results in both abstract and graphical forms and some scientific justifications for these have been documented and discussed. PMID:23560037

  10. Survivin -31 G/C polymorphism might contribute to colorectal cancer (CRC) risk: a meta-analysis.

    PubMed

    Yao, Linhua; Hu, Yi; Deng, Zhongmin; Li, Jingjing

    2015-01-01

    Published data has shown inconsistent findings about the association of survivin -31 G/C polymorphism with the risk of colorectal cancer (CRC). This meta-analysis quantitatively assesses the results from published studies to provide a more precise estimate of the association between survivin -31 G/C polymorphism as a possible predictor of the risk of CRC. We conducted a literature search in the PubMed, Web of Science, and Cochrane Library databases. Stata 12 software was used to calculate the pooled odds ratios (ORs) with 95% confidence intervals (CIs) based on the available data from each article. Six studies including 1840 cases with CRC and 1804 controls were included in this study. Survivin -31 G/C polymorphism was associated with a significantly increased risk of CRC (OR = 1.78; 95% CI, 1.53-2.07; I(2) = 0%). In the race subgroup analysis, both Asians (OR = 1.72; 95% CI, 1.44-2.05; I(2) = 0%) and Caucasians (OR = 1.93; 95% CI, 1.46-2.55; I(2) = 0%) with survivin -31 G/C polymorphism had increased CRC risk. In the subgroup analysis according to site of CRC, survivin -31 G/C polymorphism was not associated with colon cancer risk (OR = 2.02; 95% CI, 0.79-5.22; I(2) = 82%). However, this polymorphism was significantly associated with rectum cancer risk (OR = 1.98; 95% CI, 1.42-2.74; I(2) = 0%). In the subgroup analysis by clinical stage, both early stage (I+II) and advanced stage (III+IV) were associated with survivin -31 G/C polymorphism (OR = 1.61; 95% CI, 1.20-2.16; I(2) = 0% and OR = 2.30; 95% CI, 1.70-3.13; I(2) = 0%, respectively). In the subgroup analysis by smoke status, both smokers and non-smokers with survivin -31 G/C polymorphism showed increased CRC risk (OR = 1.47; 95% CI, 1.01-2.13; I(2) = 60% and OR = 1.71; 95% CI, 1.28-2.30; I(2) = 0%, respectively). In the subgroup analysis by drink status, both drinkers and non-drinkers with survivin -31 G/C polymorphism showed increased CRC risk (OR = 1.58; 95% CI, 1.06-2.37; I(2) = 8% and OR = 1.61; 95% CI, 1

  11. Beta-haemolytic group A, C and G streptococcal infections in Western Norway: a 15-year retrospective survey.

    PubMed

    Oppegaard, O; Mylvaganam, H; Kittang, B R

    2015-02-01

    Pyogenic streptococci cause significant morbidity and mortality, and the incidence of invasive group C and G streptococcal disease appears to be increasing. In this retrospective study we describe the epidemiological characteristics of invasive group A, C and G, along with non-invasive group C and G streptococcal infections in Western Norway from 1999 to 2013. A total of 512 invasive streptococcal infections were identified, of these 297 (58%) were group A (GAS), 24 (5%) group C (GCS) and 188 (37%) group G streptococci (GGS). In the non-invasive group, 4935 GCS and GGS-infections were identified. GCS and GGS were treated as one group (GCGS) for statistical purposes. All microbial categories displayed increasing incidence with age, seasonal variation and a male predominance. The incidence of invasive GCGS infections increased significantly from 1.4/100,000 inhabitants in 1999 to 6.3/100,000 in 2013 (p <0.001). Conversely, the annual rates of invasive GAS infection exhibited marked fluctuations, ranging from 2.7/100,000 (2000) to 8.3/100,000 (1999), but no significant temporal trends were observed. The incidence of non-invasive GCGS infections decreased significantly during the study period (p <0.001). The most frequently encountered emm-types among the 209 iGAS-isolates analysed were emm1 (24%), emm3 (14%) and emm28 (14%); whereas stG643 (19%), stG485 (15%) and stG6 (13%) were most prevalent among the 122 iGCGS-isolates available for typing. The increasing burden of invasive β-haemolytic streptococcal disease in our community calls for sustained attentiveness to the clinical and molecular aspects of GAS, GCS and GGS infections. Copyright © 2014 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    PubMed

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  13. Association of IL-6-174 G/C and IL10-1082 G/A polymorphisms with recurrent aphthous stomatitis risk: A meta-analysis.

    PubMed

    Yang, Shuo; Zhang, Bin; Shi, Quan; Liu, Jinglong; Xu, Juan; Huo, Na

    2017-12-01

    Recurrent aphthous stomatitis (RAS) is a common oral disease with unknown etiology. The association between IL-6-174 G/C and IL10-1082 G/A polymorphisms and the risk of RAS remains controversial. Therefore, we conducted this meta-analysis to gain more evidence-based information. Four online databases, PubMed, Embase, Web of Science, and Cochrane Library, were searched, and the relevant publications were collected. An odds ratio (OR) with a 95% confidence interval (CI) was applied to assess the association of the IL-6-174 G/C and IL10-1082 G/A polymorphisms with RAS susceptibility. Nine published case-control studies with 779 patients and 1016 controls were collected. The overall analysis proved that the IL10-1082 G/A polymorphism was significantly associated with the risk of RAS in a dominant model (GG + AG vs AA: OR = 1.49, 95% CI = 1.10-2.01, P = .01). A subgroup analysis based on ethnicity revealed significant associations in Asian populations in allelic, heterozygote, and dominant models (G vs A: OR = 1.55, 95% CI = 1.04-2.31, P = .03; AG vs AA: OR = 1.76, 95% CI = 1.16-2.67, P = .01; GG + AG vs AA: OR = 2.04, 95% CI = 1.37-3.03, P = .00). The association in Caucasians and people of mixed ethnicity requires further study. No significant association was detected between the IL-6-174 G/C polymorphism and RAS in any of the genetic models. However, subgroup analysis by ethnicity revealed that the Caucasians were more likely to develop RAS in 4 genetic models (G vs C: OR = 2.36, 95% CI = 1.26-4.41, P = .01; GG vs CC: OR = 7.05, 95% CI = 3.50-14.18, P = .00; GG + CG vs CC: OR = 4.28, 95% CI = 2.17-8.45, P = .00; GG vs CG + CC: OR = 2.59, 95% CI = 1.05-6.41, P = .04). In addition, a significantly decreased risk of RAS susceptibility was found in Asians (CG vs CC: OR = 0.27, 95% CI = 0.07-0.99, P = .049; GG + CG vs CC: OR = 0

  14. A review on g-C3N4 for photocatalytic water splitting and CO2 reduction

    NASA Astrophysics Data System (ADS)

    Ye, Sheng; Wang, Rong; Wu, Ming-Zai; Yuan, Yu-Peng

    2015-12-01

    Solar fuel generation through water splitting and CO2 photoreduction is an ideal route to provide the renewable energy sources and mitigate global warming. The main challenge in photocatalysis is finding a low-cost photocatalyst that can work efficiently to split water into hydrogen and reduce CO2 to hydrocarbon fuels. Metal-free g-C3N4 photocatalyst shows great potentials for solar fuel production. In this mini review, we summarize the most current advances on novel design idea and new synthesis strategy for g-C3N4 preparation, insightful ideas on extending optical absorption of pristine g-C3N4, overall water splitting and CO2 photoreduction over g-C3N4 based systems. The research challenges and perspectives on g-C3N4 based photocatalysts were also suggested.

  15. Germline variation in the MTHFR and MTRR genes determines the nadir of bone density in pediatric acute lymphoblastic leukemia: a prospective study.

    PubMed

    te Winkel, M L; de Muinck Keizer-Schrama, S M P F; de Jonge, R; van Beek, R D; van der Sluis, I M; Hop, W C J; Pieters, R; van den Heuvel-Eibrink, M M

    2011-03-01

    This study aims to identify folate-metabolism-related genetic risk factors for low bone mineral density (BMD) during/after pediatric acute lymphoblastic leukemia (ALL) treatment. We investigated the influence of methylenetetrahydrofolate reductase (MTHFR 677C > T and 1298A > C) and methionine synthase reductase (MTRR 66A > G) single nucleotide polymorphisms (SNPs) on total body BMD (BMD(TB)) and lumbar spine BMD (BMD(LS)) in 83 patients. Homocysteine, folate and vitamin B12 were determined. BMD was measured repeatedly using dual-energy X-ray absorptiometry in patients ≥ 4 years (n = 68). Carriers of the MTHFR 677 T-allele showed a lower baseline BMD(TB) than non-carriers (-0.38 SDS vs. +0.55 SDS, p = 0.01) and BMD(TB) remained lower during/after treatment. MTHFR 677C>T did not influence treatment-related loss of BMD(TB) (p = 0.39). The MTRR 66 G-allele carriers showed a trend towards a lower BMD(TB) compared with non-carriers. Combining these two SNPs, patients carrying ≥ 2 risk alleles had a significantly lower BMD(TB) (-1.40 SDS) than patients with one (-0.80 SDS) or no risk alleles (-0.31 SDS). Although carriers of the MTHFR 1298A > C had higher homocysteine levels, this SNP was not related to BMD(TB). BMD(LS) of carriers was similar to non-carriers of the investigated SNPs. The MTHFR 677C>T SNP and the MTRR 66A >G SNP were identified as determinants of impaired BMD(TB) in childhood ALL patients. Crown Copyright © 2010. Published by Elsevier Inc. All rights reserved.

  16. Vascular endothelial growth factor (VEGF-634G/C) polymorphism and retinopathy of prematurity: a meta-analysis

    PubMed Central

    Malik, Manzoor Ahmad; Shukla, Swati; Azad, Shorya Vardhan; Kaur, Jasbir

    2014-01-01

    Purpose Vascular endothelial growth factor polymorphism (VEGF-634G/C, rs 2010963) has been considered a risk factor for the development of retinopathy of prematurity (ROP). However, the results remain controversial. Therefore, the aim of the present meta-analysis was to determine the association between VEGF-634G/C polymorphism and ROP risk. Methods Published literature from PubMed and other databases were retrieved. All studies evaluating the association between VEGF-634G/C polymorphism and ROP risk were included. Pooled odds ratio (OR) and 95% confidence interval (CI) were calculated using random or fixed effects model. A total of six case-control studies including 355 cases and 471 controls were included. Results By pooling all the studies, we found that VEGF-634G/C polymorphism was not associated with ROP risk at co-dominant and allele levels and no association was also found in dominant and recessive models. While stratifying on ethnicity level no association was observed in Caucasian and Asian population. Discussion This meta-analysis suggests that VEGF-634G/C polymorphism may not be associated with ROP risk, the association between single VEGF-634G/C polymorphism and ROP risk awaits further investigation. PMID:25473347

  17. The C.A.M.S. 54 G.R. transatlantic seaplane (French)

    NASA Technical Reports Server (NTRS)

    Ide, John Jay

    1928-01-01

    Tested at the end of March, 1928, the C.A.M.S. 54 G.R. was built for the purpose of crossing the Atlantic from Europe by way of the azores. It has a biplane construction with wings mounted above the hull. It is powered by two new series 500 HP. geared Hispano Suiza V type engines.

  18. Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

    PubMed Central

    Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

    1985-01-01

    The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

  19. [Study of mastocytes in 1298 bone biopsies. Relationship between mastocytes and osteoporosis].

    PubMed

    Grardel, B; Flautre, B; Sutter, B; Duriez, J; Hardouin, P

    1991-11-30

    The relationship between the bone damage in systemic mastocytosis and reactional mastocytosis is still poorly understood. The purpose of this study was to determine the incidence of excessive mastocytes in a series of bone biopsies and their significance in cases of osteoporosis. The mastocytes were routinely counted in 1,298 successive biopsies stained with May Grumwald Giemsa: 131 biopsies had more than 5 mastocytes/mm2, i.e., 10% of all samples for all diagnoses combined. In 11 patients (13 bone biopsies) with a large excess of mastocytes (more than 15/mm2) and osteoporosis, the biopsies were examined again to look for mastocytic nodules suggesting bone mastocytosis: mastocytic nodules of this type were found in only 4 cases. The mastocyte is an active cell which may play a role in bone metabolism through the intermediary of its mediators. In osteoporosis, the incidence and significance of excessive mastocytes is not yet understood; this excess of mastocytes appears to correspond to reactive mastocytosis rather than systemic mastocytosis.

  20. ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

    PubMed

    Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

    2018-02-20

    Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  1. G-231A and G+70C Polymorphisms of Endothelin Receptor Type-A Gene could Affect the Psoriasis Area and Severity Index Score and Endothelin 1 Levels.

    PubMed

    Okan, Gökhan; Yıldız, Zeynep; Gökdemir, Gonca; Yorulmaz, Eda; Vural, Pervin; Doğru-Abbasoğlu, Semra; Uysal, Müjdat

    2015-01-01

    The etiopathogenesis of psoriasis has not been clearly elucidated although the role of chronic inflammation, imbalance between pro- and anti-inflammatory cytokines, and many immunological events have been established. Endothelin 1 (EDN1) and endothelin receptor type-A (EDNRA) are implicated in the inflammatory process. The relationships between EDN1 and EDNRA polymorphisms with several diseases have been found. This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (G-231A and G + 70C) single nucleotide polymorphisms (SNPs) with the occurence of psoriasis, and evaluated the relationship between genotypes and clinical/laboratory manifestation of psoriasis. We analyzed genotype and allele distributions of the above-mentioned polymorphisms in 151 patients with psoriasis and 152 healthy controls by real-time PCR combined with melting curve analysis. We did not find significant differences in the genotype and allele distributions of EDN1 T-1370G, EDNRA G-231A, and EDNRA G+70C polymorphisms between patients with psoriasis and healthy controls. Psoriasis area and severity index (PASI) score of EDNRA -231 polymorphic A allele carrying subjects (AA and AA + AG) was higher than that of wild homozygotes (P = 0.044 and P = 0.027, respectively). In addition, EDN1 levels in EDNRA+70 polymorphic C allele carriers (CC + CG) were elevated when compared with GG genotype; however, the difference was at borderline significance (P = 0.05). Although there were no associations between studied polymorphisms and psoriasis susceptibility, the PASI score and EDN1 levels seem to be affected by EDNRA G-231A and G + 70C polymorphisms.

  2. Multicentre physiological reference intervals for serum concentrations of immunoglobulins A, G and M, complement C3c and C4 measured with Tina-Quant reagents systems.

    PubMed

    Fuentes-Arderiu, Xavier; Alonso-Gregorio, Eduardo; Alvarez-Funes, Virtudes; Ambrós-Marigómez, Carmen; Coca-Fábregas, Lluís; Cruz-Placer, Marta; Díaz-Fernández, Julián; Pinel-Julián, María Pilar; Gutiérrez-Cecchini, Beatriz; Herrero-Bernal, Pilar; Sempere-Alcocer, Marcos; García-Caballero, Francisca; Del Mar Larrea-Ortiz-Quintana, María; La-Torre-Marcellán, Pedro; Del Señor López-Vélez, María; Mar-Medina, Carmen; Martín-Oncina, Javier; Rodríguez-Hernández, María Victoria; Romero-Sotomayor, María Victoria; Serrano-López, Cándido; Sicilia-Enríquez-de-Salamanca, Adolfo; Velasco-Romero, Ana María; Juvé-Cuxart, Santiago

    2007-01-01

    Clinical laboratories seeking accreditation for compliance with ISO 15189:2003 need to demonstrate that the physiological reference intervals communicated to all users of the laboratory service are appropriate for the patient population served and for the measurement systems used. In the case of immunological quantities, few articles have been published in peer-reviewed journals. A total of 21 clinical laboratories in different regions of Spain collaborated in identifying reference individuals and determining adult reference intervals for some immunological quantities measured using RD/Hitachi Modular Analytics analysers and Tina-Quant reagent systems. These immunological quantities are the mass concentrations of immunoglobulin A, immunoglobulin G, immunoglobulin M, complement C3c and complement C4 in serum. All the logistic work was carried out in co-operation with the supplier of the reagents and analysers (Roche Diagnostics España, S.L., Sant Cugat del Vallès, Catalonia, Spain). From the set of reference values obtained by each laboratory, multicentre reference limits were estimated non-parametrically. The reference intervals estimated in this study for concentrations of serum components under consideration are: complement C3c, 0.62-1.64 g/L for women and men; complement C4, 0.14-0.72 g/L for women and men; immunoglobulin A, 0.89-4.80 g/L for women and men; immunoglobulin G, 6.5-14.3 g/L for women and men; and immunoglobulin M, 0.48-3.38 g/L for women and 0.41-2.46 g/L for men.

  3. A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

    PubMed Central

    Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

    2012-01-01

    Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

  4. Isolated cytochrome c oxidase deficiency in G93A SOD1 mice overexpressing CCS protein.

    PubMed

    Son, Marjatta; Leary, Scot C; Romain, Nadine; Pierrel, Fabien; Winge, Dennis R; Haller, Ronald G; Elliott, Jeffrey L

    2008-05-02

    G93A SOD1 transgenic mice overexpressing CCS protein develop an accelerated disease course that is associated with enhanced mitochondrial pathology and increased mitochondrial localization of mutant SOD1. Because these results suggest an effect of mutant SOD1 on mitochondrial function, we assessed the enzymatic activities of mitochondrial respiratory chain complexes in the spinal cords of CCS/G93A SOD1 and control mice. CCS/G93A SOD1 mouse spinal cord demonstrates a 55% loss of complex IV (cytochrome c oxidase) activity compared with spinal cord from age-matched non-transgenic or G93A SOD1 mice. In contrast, CCS/G93A SOD1 spinal cord shows no reduction in the activities of complex I, II, or III. Blue native gel analysis further demonstrates a marked reduction in the levels of complex IV but not of complex I, II, III, or V in spinal cords of CCS/G93A SOD1 mice compared with non-transgenic, G93A SOD1, or CCS/WT SOD1 controls. With SDS-PAGE analysis, spinal cords from CCS/G93A SOD1 mice showed significant decreases in the levels of two structural subunits of cytochrome c oxidase, COX1 and COX5b, relative to controls. In contrast, CCS/G93A SOD1 mouse spinal cord showed no reduction in levels of selected subunits from complexes I, II, III, or V. Heme A analyses of spinal cord further support the existence of cytochrome c oxidase deficiency in CCS/G93A SOD1 mice. Collectively, these results establish that CCS/G93A SOD1 mice manifest an isolated complex IV deficiency which may underlie a substantial part of mutant SOD1-induced mitochondrial cytopathy.

  5. MTR WING, TRA604. ONE OF THE LABORATORY UNITS ALONG THE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    MTR WING, TRA-604. ONE OF THE LABORATORY UNITS ALONG THE SOUTH SIDE WALL. NOTE SINK, CABINET, TABLE, AND HOOD UNITS. DUCT ABOVE RECEIVES CONTAMINATED AIR AND SENDS IT TO FAN HOUSE AND STACK. NOTE PARTITION WALL BEHIND WORK UNITS. THE HEALTH PHYSICS LAB WAS SIMILARLY EQUIPPED. WINDOW AT LEFT EDGE OF VIEW. CARD IN LOWER RIGHT WAS INSERTED BY INL PHOTOGRAPHER TO COVER AN OBSOLETE SECURITY RESTRICTION PRINTED ON ORIGINAL NEGATIVE. INL NEGATIVE NO. 4225. Unknown Photographer, 2/13/1952 - Idaho National Engineering Laboratory, Test Reactor Area, Materials & Engineering Test Reactors, Scoville, Butte County, ID

  6. Influence of the Cyclooxygenase-2 Gene -765G/C and -1195G/A Polymorphisms on Development of Ischemic Stroke.

    PubMed

    Wu, Guangliang; Cai, Haiyan; Cai, Haobin; Chen, Zhao; Tan, Lei; Qin, Xiurong; Cai, Yefeng

    2016-09-01

    Many studies have investigated the association between the cyclooxygenase-2 (COX-2) gene polymorphism and ischemic stroke. However, results of these studies still remain controversial. To better explain the association between COX-2 polymorphisms (-765G/C and -1195G/A) and ischemic stroke risk, a meta-analysis was performed. Relevant studies were identified from 4 Chinese databases (Chinese Biological Medical Literature database, Chinese National Knowledge Infrastructure database, Chongqing VIP database, and Chinese WANFANG database), PUBMED and EMBASE prior to December 2015. The strength of association between COX-2 polymorphism and ischemic stroke was evaluated by the odds ratio (OR) with 95% confidence interval (CI). Inconsistency index (I(2)) and the Cochran's Q statistic were used to check heterogeneity. Publication bias was evaluated by funnel plots and Egger's regression test. A total of 4086 ischemic stroke cases and 4747 controls were identified. Significant association between COX-2 -765G/C polymorphism and the risk of ischemic stroke was found in Brazilians and the African-Americans. The OR of (CC+GC versus GG) for the Brazilians and African-Americans were (6.328, 95% CI = 2.295-17.448) and (1.644, 95% CI = 1.060-2.551). In addition, the recessive model of the Brazilians gave an OR of 3.621 (95% CI: 1.519-8.630). Furthermore, the (GC versus GG) and the allele model of the African-Americans were (OR: 1.615, 95% CI = 1.015-2.572) and (OR: 1.422, 95% CI = 1.033-1.957). Significant association was also observed for COX-2 -1195G/A polymorphism in the subtypes of small vessel disease (SVD) of ischemic stroke. Our study suggests that COX-2 -765G/C and -1195G/A polymorphisms may contribute to susceptibility of ischemic stroke, specifically in Brazilians and the African-Americans, and those of SVD. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

  7. The presence of PAI-1 4G/5G and ACE DD genotypes increases the risk of early-stage AVF thrombosis in hemodialysis patients.

    PubMed

    Güngör, Yahya; Kayataş, Mansur; Yıldız, Gürsel; Özdemir, Öztürk; Candan, Ferhan

    2011-01-01

    In this study, we investigated the relationship between early arteriovenous fistula (AVF) thrombosis with angiotensin-converting enzyme (ACE) gene and thrombophilic factor gene polymorphisms. Thirty-five patients who suffered from three or more fistula thrombosis episodes in the early period after AVF operation and 33 control patients with no history of thrombosis for at least 3 years were enrolled in this study. Factor V G1691A Leiden, factor V H1299R (R2), prothrombin G20210A, factor XIIIV34L, β-fibrinogen-455 G-A, glycoprotein IIIa L33P human platelet antigens (HPA-1), methylenetetrahydrofolate reductase C677T, and methylenetetrahydrofolate reductase A1298C gene polymorphisms were similar in both groups (p > 0.05). Plasminogen activator inhibitor 1 (PAI-1) 4G/5G genotype in the study group and 4G/4G genotype in the control group were significantly higher (p = 0.014). No significant difference was detected in terms of the 5G/5G genotype. With regard to the ACE gene polymorphism, the control group showed more ID genotype (19/33, 57.6%), whereas the study group showed more DD genotype (17/35, 48.6%). II genotype was similar in both groups (x(2) = 7.40, p = 0.025). The rate of ACE inhibitor-angiotensin II receptor blockers use was 5/35 in the study group (14.3%) and 5/33 in the control group (15.2%). Individuals with PAI-1 4G/5G genotype showed 5.03 times more risk of thrombosis when compared with 4G/4G and 5G/5G genotypes [p = 0.008, OR = 5.03, 95% confidence interval (1.44:17.64)]. Individuals with ACE DD genotype showed 4.25 times more risk of thrombosis when compared with II and ID [p = 0.008, OR = 4.25, 95% confidence interval (1.404:12.83)]. PAI-1 4G/5G and ACE DD genotypes are associated with increased risk for early AVF thrombosis.

  8. Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population

    PubMed Central

    Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

    2016-01-01

    Background IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. Objectives The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. Patients and Methods 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Results Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. Conclusions These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection. PMID:27148384

  9. Association Between IL-10 Gene Promoter Polymorphisms (-592 A/C, -819 T/C, -1082 A/G) and Susceptibility to HBV Infection in an Iranian Population.

    PubMed

    Moudi, Bita; Heidari, Zahra; Mahmoudzadeh-Sagheb, Hamidreza; Hashemi, Mohammad; Metanat, Malihe; Khosravi, Soheila; Farrokh, Parisa

    2016-02-01

    IL-10 can play a vital role in immune response against HBV. Three biallelic SNPs from the transcription start site control the transcription of the IL-10 gene. An association between susceptibility to HBV and IL-10 polymorphisms has been suggested in patients with HBV infection. The present study was designed to study the association between polymorphisms in interleukin-10 (-1082 A/G, -819 T/C and -592 A/C) promoter gene and chronic hepatitis B virus (HBV) infection. 221 chronically infected patients and 200 healthy control subjects were enrolled in the study. Three biallelic (-1082 A/G, -819 T/C and -592 A/C) polymorphisms in the IL-10 promoter gene were determined by PCR-RFLP method. Persistent HBV infection was associated with IL-10-1082 AG (P = 0.001) and GG (P = 0.004) genotypes and G (P = 0.000) allele. IL-10-819 T/C and -592 A/C genotype and allele frequencies did not show any correlation with the risk of chronic hepatitis B infection. These results suggest that polymorphisms in interleukin-10 gene promoter influence clinical outcome of HBV infection and susceptibility to HBV infection.

  10. MTHFR gene polymorphism in acute lymphoblastic leukemia among North Indian children: a case-control study and meta-analysis updated from 2011.

    PubMed

    Roy Moulik, Nirmalya; Parveen, Farah; Kumar, Archana; Awasthi, Shally; Agrawal, Suraksha

    2014-07-01

    Studies on the association of methylenetetrahydrofolate reductase (MTHFR) genotype in childhood acute lymphoblastic leukemia (ALL) have yielded conflicting results. The present study examines this association in north Indian children with ALL and includes an updated meta-analysis. MTHFR (677 and 1298) genotype of children with ALL and healthy adult controls were done by the PCR-restriction fragment length polymorphism (PCR-RFLP) method and were compared using various models of inheritance. A total of 150 patients and 300 controls were included. The 677T allele was found protective (odds ratio (OR) 0.21, 95% confidence interval (CI) 0.04-0.94), whereas 1298C allele led to an increase in risk (OR 4.44, 95% CI 2.19-8.99) of childhood ALL. Meta-analysis included 31 and 27 studies examining the association of 677 and 1298 genotypes, respectively. The 677 C -> T polymorphism was protective (OR 0.90, 95% CI 0.82-0.99). Protection was more pronounced in folate-sufficient populations as compared with those not covered by folate fortification guidelines. The 1298A->C polymorphism was associated with a marginal increase in risk (OR 1.19, 95% CI 1.01-1.40).

  11. Methylenetetrahydrofolate reductase gene polymorphisms contribute to acute myeloid leukemia and chronic myeloid leukemia susceptibilities: evidence from meta-analyses.

    PubMed

    He, Hairong; He, Gonghao; Wang, Taotao; Cai, Jiangxia; Wang, Yan; Zheng, Xiaowei; Dong, Yalin; Lu, Jun

    2014-10-01

    The expression of methylenetetrahydrofolate reductase (MTHFR) is associated with acute myeloid leukemia (AML) and chronic myeloid leukemia (CML). Most studies have linked the common functional C677T and A1298C polymorphisms of the MTHFR gene and susceptibility to AML and CML, but the results were not consistent. The aim of the present study was to derive a more precise estimation of the relationship. Meta-analyses assessing the association of MTHFR C677T and A1298C variations with AML and CML were conducted. Eligible articles were identified from the PubMed and EMBASE databases. All statistical analyses were conducted using Review Manager Software. 10 and 10 studies were included in the meta-analysis about the role of C677T polymorphism on the AML and CML risks, respectively; 6 and 4 studies were included about the role of A1298C polymorphism on the AML and CML risks, respectively. Overall, both the C677T and A1298C polymorphisms were significantly associated with CML risk under the recessive model (P=0.04, OR=1.35, 95% CI=1.02-1.79 for C677T and P=0.003, OR=2.17, 95% CI=1.29-3.63 for A1298C). In addition, the risk of CML was higher in 1298CC genotype carriers than in 1298AA genotype carriers (P=0.004, OR=2.17, 95%=1.28-3.69). Conversely, the overall data failed to indicate a significant association of C677T or A1298C polymorphisms with AML risk under any model. The findings provide evidence that C677T and A1298C polymorphisms are risk factors for CML risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    PubMed

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  13. Association between -1082G/A, -819C/T, and -592C/A genetic polymorphisms in IL-10 and risk of type 2 diabetes mellitus in a Chinese population.

    PubMed

    Dong, Q Y; Liu, X M; Liang, C G; Du, W H; Wang, Y L; Li, W X; Gao, G Q

    2016-08-29

    Type 2 diabetes mellitus is the most common form of endocrine disease in humans; genetic factors are known to contribute to the development of this disease. In this case-control study, we investigated the relationship between the -1082G/A, -819C/T, and -592C/A polymorphisms in interleukin 10 (IL-10) and the pathogenesis of type 2 diabetes mellitus in a Chinese population. Patients with type 2 diabetes mellitus (N = 228) and control subjects (N = 240) were recruited from the Department of Endocrinology at the People's Hospital of Linyi City, between September 2013 and April 2015. The IL-10 -1082G/A, -819C/T, and -592C/A polymorphisms were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Multivariate logistic regression analyses revealed that patients carrying the AA genotype of IL-10 -592C/A were at a higher risk of developing type 2 diabetes mellitus compared to those carrying the CC genotype [adjusted odds ratio (OR) = 1.74; 95% confidence interval (CI) = 1.03-2.95]. In addition, individuals carrying the A allele of IL-10 -592C/A showed a 1.34-fold higher risk of developing type 2 diabetes mellitus compared to those carrying the C allele (adjusted OR = 1.34; 95%CI = 1.03- 1.75). There was no significant correlation between the IL-10 -1082G/ A and -819C/T polymorphisms and risk of type 2 diabetes mellitus. In conclusion, this study shows that the -1082G/A polymorphism of IL-10 contributes to the onset of type 2 diabetes mellitus, and may be considered a biomarker for early screening of type 2 diabetes mellitus in the Chinese population studied here.

  14. Myofascial Trigger Points Then and Now: A Historical and Scientific Perspective

    PubMed Central

    Shah, Jay P.; Thaker, Nikki; Heimur, Juliana; Aredo, Jacqueline V.; Sikdar, Siddhartha; Gerber, Lynn H.

    2015-01-01

    The intent of this paper is to discuss the evolving role of the myofascial trigger point (MTrP) in myofascial pain syndrome (MPS) from both a historical and scientific perspective. MTrPs are hard, discrete, palpable nodules in a taut band of skeletal muscle that may be spontaneously painful (i.e. active), or painful only on compression (i.e. latent). MPS is a term used to describe a pain condition which can be acute or, more commonly, chronic and involves the muscle and its surrounding connective tissue (e.g. fascia). According to Travell and Simons, MTrPs are central to the syndrome—but are they necessary? Although the clinical study of muscle pain and MTrPs has proliferated over the past two centuries, the scientific literature often seems disjointed and confusing. Unfortunately, much of the terminology, theories, concepts, and diagnostic criteria are inconsistent, incomplete, or controversial. In order to address these deficiencies, investigators have recently applied clinical, imaging (of skeletal muscle and brain), and biochemical analyses to systematically and objectively study the MTrP and its role in MPS. Data suggest that the soft tissue milieu around the MTrP, neurogenic inflammation, sensitization, and limbic system dysfunction may all play a role in the initiation, amplification, and perpetuation of MPS. The authors will chronicle the advances that have led to the current understanding of MTrP pathophysiology and its relationship to MPS, and review the contributions of clinicians and researchers who have influenced and expanded our contemporary level of clinical knowledge and practice. PMID:25724849

  15. Identification of a novel BRCA2 and CHEK2 A-C-G-C haplotype in Turkish patients affected with breast cancer.

    PubMed

    Haytural, Hazal; Yalcinkaya, Nazli; Akan, Gokce; Arikan, Soykan; Ozkok, Elif; Cakmakoglu, Bedia; Yaylim, Ilhan; Aydin, Makbule; Atalar, Fatmahan

    2013-01-01

    Many breast cancers are caused by certain rare and familial mutations in the high or moderate penetrance genes BRCA1, BRCA2 and CHEK2. The aim of this study was to examine the allele and genotype frequencies of seven mutations in BRCA1, BRCA2 and CHEK2 genes in breast cancer patients and to investigate their isolated and combined associations with breast cancer risk. We genotyped seven mutations in BRCA1, BRCA2 and CHEK2 genes and then analyzed single variations and haplotype associations in 106 breast cancer patients and 80 healthy controls. We found significant associations in the analyses of CHEK2- 1100delC (p=0.001) and BRCA1-5382insC (p=0.021) mutations in breast cancer patients compared to controls. The highest risk was observed among breast cancer patients carrying both CHEK2-1100delC and BRCA2- Met784Val mutations (OR=0.093; 95%CI 0.021-0.423; p=0.001). We identified one previously undescribed BRCA2 and a CHEK2 four-marker haplotype of A-C-G-C which was overrepresented (?2=7.655; p=0.0057) in the patient group compared to controls. In this study, we identified a previously undescribed BRCA2 and CHEK2 A-C-G-C haplotype in association with the breast cancer in our population. Our results further suggest that the CHEK2-1100delC mutation in combination with BRCA2-Met784Val may lead to an unexpected high risk which needs to be confirmed in larger cohorts in order to better understand their role in the development and prognosis of breast cancer.

  16. Association between MTHFR Polymorphisms and Acute Myeloid Leukemia Risk: A Meta-Analysis

    PubMed Central

    Su, Yan; Lu, Ge-Ning; Wang, Ren-Sheng

    2014-01-01

    Previous observational studies investigating the association between methylenetetrahydrofolate reductase (MTHFR) polymorphisms and acute myeloid leukemia risk (AML) have yielded inconsistent results. The aim of this study is to derive a more precise estimation of the association between MTHFR (C677T and A1298C) polymorphisms and acute myeloid leukemia risk. PubMed and Embase databases were systematically searched to identify relevant studies from their inception to August 2013. Odds ratios (ORs) with 95% confidence intervals (CIs) were the metric of choice. Thirteen studies were selected for C677T polymorphism (1838 cases and 5318 controls) and 9 studies (1335 patients and 4295 controls) for A1298C polymorphism. Overall, pooled results showed that C677T polymorphism was not significant associated with AML risk(OR, 0.98–1.04; 95% CI, 0.86–0.92 to 1.09–1.25). Similar results were observed for the A1298C polymorphism and in subgroup analysis. All comparisons revealed no substantial heterogeneity nor did we detect evidence of publication bias. In summary, this meta-analysis provides evidence that MTHFR polymorphisms were not associated with AML risk. Further investigations are needed to offer better insight into the role of these polymorphisms in AML carcinogenesis. PMID:24586405

  17. Association between MTHFR polymorphisms and acute myeloid leukemia risk: a meta-analysis.

    PubMed

    Qin, Yu-Tao; Zhang, Yong; Wu, Fang; Su, Yan; Lu, Ge-Ning; Wang, Ren-Sheng

    2014-01-01

    Previous observational studies investigating the association between methylenetetrahydrofolate reductase (MTHFR) polymorphisms and acute myeloid leukemia risk (AML) have yielded inconsistent results. The aim of this study is to derive a more precise estimation of the association between MTHFR (C677T and A1298C) polymorphisms and acute myeloid leukemia risk. PubMed and Embase databases were systematically searched to identify relevant studies from their inception to August 2013. Odds ratios (ORs) with 95% confidence intervals (CIs) were the metric of choice. Thirteen studies were selected for C677T polymorphism (1838 cases and 5318 controls) and 9 studies (1335 patients and 4295 controls) for A1298C polymorphism. Overall, pooled results showed that C677T polymorphism was not significant associated with AML risk(OR, 0.98-1.04; 95% CI, 0.86-0.92 to 1.09-1.25). Similar results were observed for the A1298C polymorphism and in subgroup analysis. All comparisons revealed no substantial heterogeneity nor did we detect evidence of publication bias. In summary, this meta-analysis provides evidence that MTHFR polymorphisms were not associated with AML risk. Further investigations are needed to offer better insight into the role of these polymorphisms in AML carcinogenesis.

  18. Transcription arrest by a G quadruplex forming-trinucleotide repeat sequence from the human c-myb gene.

    PubMed

    Broxson, Christopher; Beckett, Joshua; Tornaletti, Silvia

    2011-05-17

    Non canonical DNA structures correspond to genomic regions particularly susceptible to genetic instability. The transcription process facilitates formation of these structures and plays a major role in generating the instability associated with these genomic sites. However, little is known about how non canonical structures are processed when encountered by an elongating RNA polymerase. Here we have studied the behavior of T7 RNA polymerase (T7RNAP) when encountering a G quadruplex forming-(GGA)(4) repeat located in the human c-myb proto-oncogene. To make direct correlations between formation of the structure and effects on transcription, we have taken advantage of the ability of the T7 polymerase to transcribe single-stranded substrates and of G4 DNA to form in single-stranded G-rich sequences in the presence of potassium ions. Under physiological KCl concentrations, we found that T7 RNAP transcription was arrested at two sites that mapped to the c-myb (GGA)(4) repeat sequence. The extent of arrest did not change with time, indicating that the c-myb repeat represented an absolute block and not a transient pause to T7 RNAP. Consistent with G4 DNA formation, arrest was not observed in the absence of KCl or in the presence of LiCl. Furthermore, mutations in the c-myb (GGA)(4) repeat, expected to prevent transition to G4, also eliminated the transcription block. We show T7 RNAP arrest at the c-myb repeat in double-stranded DNA under conditions mimicking the cellular concentration of biomolecules and potassium ions, suggesting that the G4 structure formed in the c-myb repeat may represent a transcription roadblock in vivo. Our results support a mechanism of transcription-coupled DNA repair initiated by arrest of transcription at G4 structures.

  19. Methylenetetrahydrofolate reductase gene polymorphism and risk of chronic myelogenous leukemia: a meta-analysis.

    PubMed

    Li, Chen; Yichao, Jin; Jiaxin, Lin; Yueting, Zhang; Qin, Lu; Tonghua, Yang

    2015-01-01

    Reported evidence supports a role for methylenetetrahydrofolate reductase (MTHFR) in the risk of chronic myelogenous leykemia (CML). However, these reports arrived at non-conclusive and even conflicting results regarding the association between two common MTHFR polymorphisms (C677T and A1298C) and CML risk. Thus, a meta-analysis was carried out to clarify a more precise association between these two polymorphisms and the CML risk by updating the available publications. Pooled odds ratios (OR) with corresponding 95% confidence interval (95% CI) and stratification analysis were performed to estimate the relationship between MTHFR polymorphisms and the risk of CML under different genetic comparison models. Data from the meta-analysis showed no significant association between MTHFR C677T polymorphism and CML risk. However, significant associations were found between MTHFR A1298C variants and CML risk under homozygous comparison model (CC vs AA, OR=1.62, 95% CI=1.11-2.36, p=0.01) and dominant comparison model (CC+AC vs AA, OR=1.68, 95% CI=1.17-2.43, p=0.005) in overall population; especially more obvious impacts were noticed for Asian populations in subgroup analysis for homozygous model (CC vs AA, OR=2.00, 95% CI=1.25-3.21, p=0.004) and dominant model (CC+AC vs AA, OR=2.49, 95% CI=1.42-4.36, p=0.001), but this did not apply in Caucasian populations. The results of this meta-analysis suggested no significant association between MTHFR C677T polymorphism and CML risk, while an increased CML risk was noticed for 1298C variant carriers, especially in Asian populations but not in Caucasian populations, which suggested ethnicity differences between MTHFR A1298C polymorphisms and risk of CML.

  20. The eΠ3g state of C2: A pathway to dissociation

    NASA Astrophysics Data System (ADS)

    Welsh, B. A.; Krechkivska, O.; Nauta, K.; Bacskay, G. B.; Kable, S. H.; Schmidt, T. W.

    2017-07-01

    The lowest 13 vibrational levels, v = 0-12, of the eΠ3g state of the C2 molecule have been measured by laser-induced fluorescence of new bands of the Fox-Herzberg system. The newly observed levels, v = 5-12, which span the eΠ3g electronic state up to and beyond the first dissociation threshold of C2, were analyzed to afford highly accurate molecular constants, including band origins, and rotational and spin-orbit constants. The spin-orbit coupling constants of the previously published lowest five levels are revised in sign and magnitude, requiring an overhaul of previously published molecular constants. The analysis is supported by high level ab initio calculations. Lifetimes of all observed levels were recorded and found to be in excellent agreement with ab initio predicted values up to v = 11. v = 12 was found to exhibit a much reduced lifetime and fluorescence quantum yield, which is attributed to the onset of predissociation. This brackets the dissociation energy of ground state XΣ+1g C2 between 6.1803 and 6.2553 eV, in agreement with the Active Thermochemical Tables.

  1. THE GSTP1 c.313A>G POLYMORPHISM MODULATES THE CARDIORESPIRATORY RESPONSE TO AEROBIC TRAINING

    PubMed Central

    Zarebska, A; Jastrzebski, Z; Kaczmarczyk, M; Ficek, K; Maciejewska-Karlowska, A; Sawczuk, M; Leońska-Duniec, A; Krol, P; Cieszczyk, P; Zmijewski, P

    2014-01-01

    The GSTP1 c.313A>G polymorphism is a candidate to explain some of the individual differences in cardiorespiratory fitness phenotypes’ responses to aerobic exercise training. We aim to explore the association between the GSTP1 c.313A>G polymorphism and the response to low-high impact aerobic exercise training. Sixty-six Polish Caucasian women were genotyped for the GSTP1 c.313A>G polymorphism; 62 of them completed 12-week aerobic (50-75% HRmax) exercise training and were measured for selected somatic features (body mass and BMI) and cardiorespiratory fitness indices – maximal oxygen uptake (VO2max, maximum heart rate (HRmax), maximum ventilation (VEmax) and anaerobic threshold (AT) – before and after the training period. Two-factor analysis of variance revealed a main training effect for body mass reduction (p=0.007) and BMI reduction (p=0.013), improvements of absolute and relative VO2max (both p<0.001), and increased VEmax (p=0.005), but not for changes in fat-free mass (FFM) (p=0.162). However, a significant training x GSTP1 c.313A>G interaction was found only for FFM (p=0.042), absolute and relative VO2max (p=0.029 and p=0.026), and VEmax (p=0.005). As the result of training, significantly greater improvements in VO2max, VEmax and FFM were gained by the GG+GA group compared to the AA genotype group. The results support the hypothesis that heterogeneity in individual response to training stimuli is at least in part determined by genetics, and GSTP1 c.313A>G may be considered as one (of what appear to be many) target polymorphisms to influence these changes. PMID:25435667

  2. THE GSTP1 c.313A>G POLYMORPHISM MODULATES THE CARDIORESPIRATORY RESPONSE TO AEROBIC TRAINING.

    PubMed

    Zarebska, A; Jastrzebski, Z; Kaczmarczyk, M; Ficek, K; Maciejewska-Karlowska, A; Sawczuk, M; Leońska-Duniec, A; Krol, P; Cieszczyk, P; Zmijewski, P; Eynon, N

    2014-12-01

    The GSTP1 c.313A>G polymorphism is a candidate to explain some of the individual differences in cardiorespiratory fitness phenotypes' responses to aerobic exercise training. We aim to explore the association between the GSTP1 c.313A>G polymorphism and the response to low-high impact aerobic exercise training. Sixty-six Polish Caucasian women were genotyped for the GSTP1 c.313A>G polymorphism; 62 of them completed 12-week aerobic (50-75% HRmax) exercise training and were measured for selected somatic features (body mass and BMI) and cardiorespiratory fitness indices - maximal oxygen uptake (VO2max, maximum heart rate (HRmax), maximum ventilation (VEmax) and anaerobic threshold (AT) - before and after the training period. Two-factor analysis of variance revealed a main training effect for body mass reduction (p=0.007) and BMI reduction (p=0.013), improvements of absolute and relative VO2max (both p<0.001), and increased VEmax (p=0.005), but not for changes in fat-free mass (FFM) (p=0.162). However, a significant training x GSTP1 c.313A>G interaction was found only for FFM (p=0.042), absolute and relative VO2max (p=0.029 and p=0.026), and VEmax (p=0.005). As the result of training, significantly greater improvements in VO2max, VEmax and FFM were gained by the GG+GA group compared to the AA genotype group. The results support the hypothesis that heterogeneity in individual response to training stimuli is at least in part determined by genetics, and GSTP1 c.313A>G may be considered as one (of what appear to be many) target polymorphisms to influence these changes.

  3. Mitomycin C binding to poly[d(G-m5C)].

    PubMed Central

    Portugal, J; Sánchez-Baeza, F J

    1995-01-01

    Poly[d(G-m5C)] was modified by reductively activated mitomycin C, an anti-tumour drug, under buffer conditions which are known to favour either the B or the Z conformations of DNA. C.d. and 31P-n.m.r. were used to characterize the poly[d(G-m5C)]-mitomycin cross-linked complexes, as well as the effects on the equilibrium between the B and Z forms of the polynucleotide. Mitomycin C appears to inhibit the B-->Z transition, even in the presence of 3 mM MgCl2, while the Z-form of poly[d(G-m5C)] does not interact significantly with the drug under bifunctionally activating conditions; thus no reversion from the Z-form to the B-form of the polynucleotide can be observed under the salt conditions which are required for the Z-form to exist. PMID:7864808

  4. Novel Compound Heterozygous CLCNKB Gene Mutations (c.1755A>G/ c.848_850delTCT) Cause Classic Bartter Syndrome.

    PubMed

    Wang, Chunli; Chen, Ying; Zheng, Bixia; Zhu, Mengshu; Fan, Jia; Wang, Juejin; Jia, Zhanjun; Huang, Songming; Zhang, Aihua

    2018-02-14

    Inactivated variants in CLCNKB gene encoding the basolateral chloride channel ClC-Kb cause classic Bartter syndrome characterized by hypokalemic metabolic alkalosis and hyperreninemic hyperaldosteronism. Here we identified two cBS siblings presenting hypokalemia in a Chinese family due to novel compound heterozygous CLCNKB mutations (c.848_850delTCT/c.1755A>G). Compound heterozygosity was confirmed by amplifying and sequencing the patient's genomic DNA. The synonymous mutation c.1755A>G (Thr585Thr) was located at +2bp from the 5' splice donor site in exon 15, further transcript analysis demonstrated that this single nucleotide mutation causes exclusion of exon 15 in the cDNA from the proband and his mother. Furthermore, we investigated the expression and protein trafficking change of c.848_850delTCT (TCT) and exon 15 deletion(E15)mutation in vitro. The E15 mutation markedly decreased the expression of ClC-Kb and resulted in a low-molecular-weight band (~55kD) trapping in the endoplasmic reticulum, while the TCT mutant only decreased the total and plasma membrane ClC-Kb protein expression but did not affect the subcellular localization. Finally, we studied the physiological functions of mutations by using whole-cell patch clamp and found that E15 or TCT mutation decreased the current of ClC-Kb/barttin channel. These results suggested that the compound defective mutations of CLCNKB gene are the molecular mechanism of the two cBS siblings.

  5. KSC-385C-1298-02

    NASA Image and Video Library

    1985-04-13

    CAPE CANAVERAL, Fla. – At the Kennedy Space Center in Florida, the new space shuttle, Atlantis, arrives at the Shuttle Landing Facility. The shuttle is mounted atop the Shuttle Carrier Aircraft, a modified Boeing 747. Over the next seven months Atlantis will be prepared for its maiden voyage, STS-51J. Atlantis, NASA's fourth space-rated shuttle, was named after the two-masted boat that served as the primary research vessel for the Woods Hole Oceanographic Institute in Massachusetts from 1930 to 1966. The boat had a 17-member crew and accommodated up to five scientists who worked in two onboard laboratories, examining water samples and marine life. Like its predecessors, Atlantis was constructed by Rockwell International in Palmdale, Calif. The spacecraft was transported over land from Palmdale to Edwards Air Force Base on April 3, 1985 for the cross-country ferry flight to Kennedy. For more: http://www.nasa.gov/centers/kennedy/shuttleoperations/orbiters/atlantis-info.html Photo credit: NASA/Louie Rochefort

  6. KSC-385C-1298-05

    NASA Image and Video Library

    1985-04-13

    CAPE CANAVERAL, Fla. – At the Kennedy Space Center in Florida, the new space shuttle, Atlantis, arrives at the Shuttle Landing Facility. The shuttle is mounted atop the Shuttle Carrier Aircraft, a modified Boeing 747. Over the next seven months Atlantis will be prepared for its maiden voyage, STS-51J. Atlantis, NASA's fourth space-rated shuttle, was named after the two-masted boat that served as the primary research vessel for the Woods Hole Oceanographic Institute in Massachusetts from 1930 to 1966. The boat had a 17-member crew and accommodated up to five scientists who worked in two onboard laboratories, examining water samples and marine life. Like its predecessors, Atlantis was constructed by Rockwell International in Palmdale, Calif. The spacecraft was transported over land from Palmdale to Edwards Air Force Base on April 3, 1985 for the cross-country ferry flight to Kennedy. For more: http://www.nasa.gov/centers/kennedy/shuttleoperations/orbiters/atlantis-info.html Photo credit: NASA/Louie Rochefort

  7. KSC-385C-1298-06

    NASA Image and Video Library

    1985-04-13

    CAPE CANAVERAL, Fla. – At the Kennedy Space Center in Florida, the new space shuttle, Atlantis, arrives at the Shuttle Landing Facility. The shuttle is mounted atop the Shuttle Carrier Aircraft, a modified Boeing 747. Over the next seven months Atlantis will be prepared for its maiden voyage, STS-51J. Atlantis, NASA's fourth space-rated shuttle, was named after the two-masted boat that served as the primary research vessel for the Woods Hole Oceanographic Institute in Massachusetts from 1930 to 1966. The boat had a 17-member crew and accommodated up to five scientists who worked in two onboard laboratories, examining water samples and marine life. Like its predecessors, Atlantis was constructed by Rockwell International in Palmdale, Calif. The spacecraft was transported over land from Palmdale to Edwards Air Force Base on April 3, 1985 for the cross-country ferry flight to Kennedy. For more: http://www.nasa.gov/centers/kennedy/shuttleoperations/orbiters/atlantis-info.html Photo credit: NASA/Louie Rochefort

  8. [Relationship between the methylenetetrahydrofolate reductase gene polymorphism and adverse reactions of high-dose methotrexate in children with acute lymphocytic leukemia].

    PubMed

    Zheng, Miao-Miao; Yue, Li-Jie; Chen, Xiao-Wen; Wen, Fei-Qiu; Li, Chang-Gang; Yang, Chun-Lan; Xie, Cai; Ding, Hui

    2013-03-01

    To study the association between methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and toxicities after high-dose methotrexate (HD-MTX) infusion in children with acute lymphocytic leukemia (ALL). MTHFR variants in 52 children with ALL were determined by reverse transcriptase-polymerase chain reaction-denaturing gradient gel electrophoresis and sequencing. Toxicities of children who received HD-MTX chemotherapy were evaluated according to the National Cancer Institute-Common Toxicity Criteria (NCI-CTC). The children carrying MTHFR 1298AC had a higher risk of developing thrombocytopenia compared with the carriers of the 1298 AA genotype (OR=13.7, 95%CI=1.18-159.36, P=0.036). There was no significant difference in HD-MTX chemotherapy-related adverse effects between the patients with different MTHFR C677T or G1793A genotypes. MTHFR A1298C polymorohism may associate with the toxicity of HD-MTX chemotherapy in children with ALL.

  9. Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

    2014-03-01

    Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each

  10. 26 CFR 6a.6652(g)-1 - Failure to make return or furnish statement required under section 6039C.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... required under section 6039C. 6a.6652(g)-1 Section 6a.6652(g)-1 Internal Revenue INTERNAL REVENUE SERVICE... OMNIBUS RECONCILIATION ACT OF 1980 § 6a.6652(g)-1 Failure to make return or furnish statement required... limitation under § 6a.6652(g)-1(b)(3) with respect to failure to meet the requirements of section 6039C(c), U...

  11. 26 CFR 6a.6652(g)-1 - Failure to make return or furnish statement required under section 6039C.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... required under section 6039C. 6a.6652(g)-1 Section 6a.6652(g)-1 Internal Revenue INTERNAL REVENUE SERVICE... OMNIBUS RECONCILIATION ACT OF 1980 § 6a.6652(g)-1 Failure to make return or furnish statement required... limitation under § 6a.6652(g)-1(b)(3) with respect to failure to meet the requirements of section 6039C(c), U...

  12. 26 CFR 6a.6652(g)-1 - Failure to make return or furnish statement required under section 6039C.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... required under section 6039C. 6a.6652(g)-1 Section 6a.6652(g)-1 Internal Revenue INTERNAL REVENUE SERVICE... OMNIBUS RECONCILIATION ACT OF 1980 § 6a.6652(g)-1 Failure to make return or furnish statement required... limitation under § 6a.6652(g)-1(b)(3) with respect to failure to meet the requirements of section 6039C(c), U...

  13. 26 CFR 6a.6652(g)-1 - Failure to make return or furnish statement required under section 6039C.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... required under section 6039C. 6a.6652(g)-1 Section 6a.6652(g)-1 Internal Revenue INTERNAL REVENUE SERVICE... OMNIBUS RECONCILIATION ACT OF 1980 § 6a.6652(g)-1 Failure to make return or furnish statement required... limitation under § 6a.6652(g)-1(b)(3) with respect to failure to meet the requirements of section 6039C(c), U...

  14. 26 CFR 6a.6652(g)-1 - Failure to make return or furnish statement required under section 6039C.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... required under section 6039C. 6a.6652(g)-1 Section 6a.6652(g)-1 Internal Revenue INTERNAL REVENUE SERVICE... OMNIBUS RECONCILIATION ACT OF 1980 § 6a.6652(g)-1 Failure to make return or furnish statement required... limitation under § 6a.6652(g)-1(b)(3) with respect to failure to meet the requirements of section 6039C(c), U...

  15. [Association between methylene-tetrahydrofolate reductase gene polymorphisms and chronic myeloid leukemia].

    PubMed

    Dorgham, Samia; Aberkane, Meriem; Boughrara, Wefa; Antar Soltan, Badra; Mehalhal, Nemra; Touhami, Hadj; Sidimansour, Noureddine; Merad Boudia, Nadia; Louhibi, Lotfi; Boudjema, Abdallah

    2014-09-01

    Methylene-tetrahydrofolate reductase (MTHFR) is a key enzyme of folate metabolism. Few studies were reported about its relationship with chronic myeloid leukemia (CML). We conducted a case-control study analyzing the prevalence of the polymorphisms MTHFR C677T and MTHFR A1298C in Algerians CML patients. Using TaqMan(®) allelic discrimination assay, we investigate MTHFR C677T and A1298C polymorphism distribution in 90 cases of CML and 100 healthy subjects. The frequencies of 677T alleles and genotypes 677TT and 677CT were significantly higher in cases than in control (P = 1E-6; OR = 6.77 [4.22-10.86]) and (P = 1E-6; OR = 10.38 [4.56-23.6]) respectively. Also, the frequencies of 1298C alleles and genotypes 1298CC and 1298AC were higher in cases (P = 9 E-6; OR = 2.65 [1.71-4.10]) and (P = 0.008; OR = 2.22 [1.21-4.06]) respectively. We report also the higher significance of the haplotype 677T/1298A and 677T/1298C in cases (P = 0.007; OR = 2.57 [1.26-5.24]) and (P = 5 E-6, OR = 6.91 [2.7646-17.2899]) respectively. Our results demonstrate that 677T and 1298C alleles are both associated with an increased risk of CML in Algeria.

  16. The USH2A c.2299delG mutation: dating its common origin in a Southern European population

    PubMed Central

    Aller, Elena; Larrieu, Lise; Jaijo, Teresa; Baux, David; Espinós, Carmen; González-Candelas, Fernando; Nájera, Carmen; Palau, Francesc; Claustres, Mireille; Roux, Anne-Françoise; Millán, José M

    2010-01-01

    Usher syndrome type II is the most common form of Usher syndrome. USH2A is the main responsible gene of the three known to be disease causing. It encodes two isoforms of the protein usherin. This protein is part of an interactome that has an essential role in the development and function of inner ear hair cells and photoreceptors. The gene contains 72 exons spanning over a region of 800 kb. Although numerous mutations have been described, the c.2299delG mutation is the most prevalent in several populations. Its ancestral origin was previously suggested after the identification of a common core haplotype restricted to 250 kb in the 5′ region that encodes the short usherin isoform. By extending the haplotype analysis over the 800 kb region of the USH2A gene with a total of 14 intragenic single nucleotide polymorphisms, we have been able to define 10 different c.2299delG haplotypes, showing high variability but preserving the previously described core haplotype. An exhaustive c.2299delG/control haplotype study suggests that the major source of variability in the USH2A gene is recombination. Furthermore, we have evidenced twice the amount of recombination hotspots located in the 500 kb region that covers the 3′ end of the gene, explaining the higher variability observed in this region when compared with the 250 kb of the 5′ region. Our data confirm the common ancestral origin of the c.2299delG mutation. PMID:20145675

  17. A Nucleus-Imaging Probe That Selectively Stabilizes a Minor Conformation of c-MYC G-quadruplex and Down-regulates c-MYC Transcription in Human Cancer Cells

    PubMed Central

    Panda, Deepanjan; Debnath, Manish; Mandal, Samir; Bessi, Irene; Schwalbe, Harald; Dash, Jyotirmayee

    2015-01-01

    The c-MYC proto-oncogene is a regulator of fundamental cellular processes such as cell cycle progression and apoptosis. The development of novel c-MYC inhibitors that can act by targeting the c-MYC DNA G-quadruplex at the level of transcription would provide potential insight into structure-based design of small molecules and lead to a promising arena for cancer therapy. Herein we report our finding that two simple bis-triazolylcarbazole derivatives can inhibit c-MYC transcription, possibly by stabilizing the c-MYC G-quadruplex. These compounds are prepared using a facile and modular approach based on Cu(I) catalysed azide and alkyne cycloaddition. A carbazole ligand with carboxamide side chains is found to be microenvironment-sensitive and highly selective for “turn-on” detection of c-MYC quadruplex over duplex DNA. This fluorescent probe is applicable to visualize the cellular nucleus in living cells. Interestingly, the ligand binds to c-MYC in an asymmetric fashion and selects the minor-populated conformer via conformational selection. PMID:26286633

  18. Vitamin B6 and homocysteine levels in carbamazepine treated epilepsy of Khyber Pakhtunkhwa.

    PubMed

    Shakir, Shakirullah; Ali, Niaz; Udin, Zia; Nazish, Haleema; Nabi, Muhammad

    2017-06-01

    The study focused on the plasma levels of vitamin B 6 and homocysteine in different genotypes of MTHFR (C677T, A1298C) and GABRG2 (C588T, C315T) genes in carbamazepine resistant epilepsy in the population of Khyber Pakhtunkhwa. Patients who were possible candidates for carbamazepine therapy were followed for six months for their seizure control. Plasma levels of vitamin B 6 and homocysteine were determined using immunoassay based techniques at baseline and after six months. MTHFR (C677T, A1298C) and GABRG2 (C588T, C315T) genes were genotyped using restriction fragment length polymorphisms. Seizure control during therapy was recorded on a standardized proforma. Low vitamin B 6 levels and hyperhomocysteinemia were found in 61.7% of resistant patients (n=34). Resistant patients had the following frequencies of variant genotypes (677CT=38.1% and 677TT=24.4%; 1298AC=42.2% and 1298CC=26.1%; 588CT= 47.6% and 315TT= 33.3%) of MTHFR (C677T and A1298C) and GABRG2 (C588T and C315T) genes. A significant decline in vitamin B 6 (P<0.0001) and hyperhomocysteinemia were found in variant genotypes of MTHFR (C677T, A1298C) and GABRG2 (C588T, C315T) genes. Following six months of carbamazepine of therapy in heterozygous variant genotypes of MTHFR (677CT and 1298AC) and GABRG2 (588CT and 315CT) genes, we observed a significant fall in vitamin B 6 levels and hyperhomocysteinemia.

  19. Lack of association of -607 C/A and -137 G/C polymorphisms in interleukin 18 gene with susceptibility to gout disease in Chinese Han male population.

    PubMed

    Li, Changgui; Yuan, Ying; Wang, Xinfeng; Han, Lin; Chu, Nan; Wang, Hui; Liu, Shiguo

    2012-06-01

    To identify association of IL18-607 C/A and -137 G/C polymorphism with susceptibility to gout in Chinese Han male population, We evaluate the genetic contribution of the IL18-607 C/A and -137 G/C polymorphism in 202 gout male patients and 493 gout-free control of Chinese Han population by allele-specific polymerase chain reaction assay. Our results reveal no significant association between the polymorphisms -607C/A and -137G/C in IL18 with gout. Our study might suggest that -607 C/A and -137 G/C polymorphisms in the promoter of IL18 are not associated with susceptibility to gout and thus do not play a major role in the development of gout in the Chinese Han male population.

  20. Cross-communication between Gi and Gs in a G-protein-coupled receptor heterotetramer guided by a receptor C-terminal domain.

    PubMed

    Navarro, Gemma; Cordomí, Arnau; Brugarolas, Marc; Moreno, Estefanía; Aguinaga, David; Pérez-Benito, Laura; Ferre, Sergi; Cortés, Antoni; Casadó, Vicent; Mallol, Josefa; Canela, Enric I; Lluís, Carme; Pardo, Leonardo; McCormick, Peter J; Franco, Rafael

    2018-02-28

    G-protein-coupled receptor (GPCR) heteromeric complexes have distinct properties from homomeric GPCRs, giving rise to new receptor functionalities. Adenosine receptors (A 1 R or A 2A R) can form A 1 R-A 2A R heteromers (A 1 -A 2A Het), and their activation leads to canonical G-protein-dependent (adenylate cyclase mediated) and -independent (β-arrestin mediated) signaling. Adenosine has different affinities for A 1 R and A 2A R, allowing the heteromeric receptor to detect its concentration by integrating the downstream G i - and G s -dependent signals. cAMP accumulation and β-arrestin recruitment assays have shown that, within the complex, activation of A 2A R impedes signaling via A 1 R. We examined the mechanism by which A 1 -A 2A Het integrates G i - and G s -dependent signals. A 1 R blockade by A 2A R in the A 1 -A 2A Het is not observed in the absence of A 2A R activation by agonists, in the absence of the C-terminal domain of A 2A R, or in the presence of synthetic peptides that disrupt the heteromer interface of A 1 -A 2A Het, indicating that signaling mediated by A 1 R and A 2A R is controlled by both G i and G s proteins. We identified a new mechanism of signal transduction that implies a cross-communication between G i and G s proteins guided by the C-terminal tail of the A 2A R. This mechanism provides the molecular basis for the operation of the A 1 -A 2A Het as an adenosine concentration-sensing device that modulates the signals originating at both A 1 R and A 2A R.

  1. Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

    PubMed

    Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

    2012-04-15

    The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

  2. Graphene and g-C3N4 based photocatalysts for NOx removal: A review

    NASA Astrophysics Data System (ADS)

    Nikokavoura, Aspasia; Trapalis, Christos

    2018-02-01

    NOx liberated into atmosphere from automobile exhausts and fossil fuel combustion, comprise the major air pollutants. They are responsible for serious environmental problems such as acid rain, ozone accumulation, haze and photochemical smog. Besides they contribute to the deterioration of human health by causing decrease of the lung function and respiratory problems. The application of photocatalytic methods in order to mitigate the presence of NOx in the atmosphere is preferable as they are environmentally friendly, mild and low cost. Therefore, in this review, the photocatalytic activity of g-C3N4 and graphene based composites towards NOx removal was discussed. NOx oxidation to non volatile nitrates on the surface of graphene and g-C3N4 based photocatalysts has attracted much interest during the last years due to their structures with unique features such as large specific surface area, thermal and chemical stability and enhanced visible light utilization. The formation of 2D-2D intimate heterojunctions between graphene or g-C3N4 and other components ensures the enhanced charge transfer, lifetime of electron/hole pairs and thus photocatalytic activity. The increased visible light harvesting also contributes to their usefulness as effective photocatalytic materials. In the present work, the advantages of these novel photocatalysts and the differences/similarities between them were exhaustively highlighted. The role of graphene as catalyst promoter, electron reservoir, support and photosensitizer in its photocatalytic composites was emphasized. The effect of g-C3N4 doping and copolymerization with metals/semiconductors on its photocatalytic activity towards NOx oxidation was thoroughly discussed. Besides, the preparation methods, photocatalytic efficiencies, type of irradiation, utilization of appropriate cocatalysts, and reaction mechanisms during the photocatalytic NOx removal by graphene and g-C3N4 composies, were summarized. It was demonstrated that in the vast

  3. Immunization with a Vaccine Combining Herpes Simplex Virus 2 (HSV-2) Glycoprotein C (gC) and gD Subunits Improves the Protection of Dorsal Root Ganglia in Mice and Reduces the Frequency of Recurrent Vaginal Shedding of HSV-2 DNA in Guinea Pigs Compared to Immunization with gD Alone ▿

    PubMed Central

    Awasthi, Sita; Lubinski, John M.; Shaw, Carolyn E.; Barrett, Shana M.; Cai, Michael; Wang, Fushan; Betts, Michael; Kingsley, Susan; DiStefano, Daniel J.; Balliet, John W.; Flynn, Jessica A.; Casimiro, Danilo R.; Bryan, Janine T.; Friedman, Harvey M.

    2011-01-01

    Attempts to develop a vaccine to prevent genital herpes simplex virus 2 (HSV-2) disease have been only marginally successful, suggesting that novel strategies are needed. Immunization with HSV-2 glycoprotein C (gC-2) and gD-2 was evaluated in mice and guinea pigs to determine whether adding gC-2 to a gD-2 subunit vaccine would improve protection by producing antibodies that block gC-2 immune evasion from complement. Antibodies produced by gC-2 immunization blocked the interaction between gC-2 and complement C3b, and passive transfer of gC-2 antibody protected complement-intact mice but not C3 knockout mice against HSV-2 challenge, indicating that gC-2 antibody is effective, at least in part, because it prevents HSV-2 evasion from complement. Immunization with gC-2 also produced neutralizing antibodies that were active in the absence of complement; however, the neutralizing titers were higher when complement was present, with the highest titers in animals immunized with both antigens. Animals immunized with the gC-2-plus-gD-2 combination had robust CD4+ T-cell responses to each immunogen. Multiple disease parameters were evaluated in mice and guinea pigs immunized with gC-2 alone, gD-2 alone, or both antigens. In general, gD-2 outperformed gC-2; however, the gC-2-plus-gD-2 combination outperformed gD-2 alone, particularly in protecting dorsal root ganglia in mice and reducing recurrent vaginal shedding of HSV-2 DNA in guinea pigs. Therefore, the gC-2 subunit antigen enhances a gD-2 subunit vaccine by stimulating a CD4+ T-cell response, by producing neutralizing antibodies that are effective in the absence and presence of complement, and by blocking immune evasion domains that inhibit complement activation. PMID:21813597

  4. Human IgG is produced in a pro-form that requires clipping of C-terminal lysines for maximal complement activation

    PubMed Central

    van den Bremer, Ewald TJ; Beurskens, Frank J; Voorhorst, Marleen; Engelberts, Patrick J; de Jong, Rob N; van der Boom, Burt G; Cook, Erika M; Lindorfer, Margaret A; Taylor, Ronald P; van Berkel, Patrick HC; Parren, Paul WHI

    2015-01-01

    Human IgG is produced with C-terminal lysines that are cleaved off in circulation. The function of this modification was unknown and generally thought not to affect antibody function. We recently reported that efficient C1q binding and complement-dependent cytotoxicity (CDC) requires IgG hexamerization at the cell surface. Here we demonstrate that C-terminal lysines may interfere with this process, leading to suboptimal C1q binding and CDC of cells opsonized with C-terminal lysine-containing IgG. After we removed these lysines with a carboxypeptidase, maximal complement activation was observed. Interestingly, IgG1 mutants containing either a negative C-terminal charge or multiple positive charges lost CDC almost completely; however, CDC was fully restored by mixing C-terminal mutants of opposite charge. Our data indicate a novel post-translational control mechanism of human IgG: human IgG molecules are produced in a pro-form in which charged C-termini interfere with IgG hexamer formation, C1q binding and CDC. To allow maximal complement activation, C-terminal lysine processing is required to release the antibody's full cytotoxic potential. PMID:26037225

  5. Magnetic Fe@g??C3N4: A Photoactive Catalyst for the Hydrogenation of Alkenes and Alkynes

    EPA Pesticide Factsheets

    A photoactive catalyst, Fe@g-C3N4, has been developed for the hydrogenation of alkenes and alkynes using hydrazine hydrate as a source of hydrogen. The magnetically separable Fe@g-C3N4 eliminates the use of high pressure hydrogenation, and the reaction can be accomplished using visible light without the need for external sources of energy.This dataset is associated with the following publication:Baig, N., S. Verma, R. Varma , and M. Nadagouda. Magnetic Fe@g-C3N4: A Photoactive Catalyst for the Hydrogenation of Alkenes and Alkynes. ACS Sustainable Chemistry & Engineering. American Chemical Society, Washington, DC, USA, 4(3): 1661-1664, (2016).

  6. Methylenetetrahydrofolate reductase gene polymorphisms and acute lymphoblastic leukemia risk: a meta-analysis based on 28 case-control studies.

    PubMed

    Tong, Na; Sheng, Xiaojing; Wang, Meilin; Fang, Yongjun; Shi, Danni; Zhang, Zhizhong; Zhang, Zhengdong

    2011-10-01

    Methylenetetrahydrofolate reductase (MTHFR) is involved in DNA methylation and nucleotide synthesis. Accumulated evidence has demonstrated that C677T and A1298C polymorphisms of the MTHFR gene are associated with acute lymphoblastic leukemia (ALL) risk, but the results have been inconclusive. To determine a more precise estimation, we performed a meta-analysis of 28 studies with 4240 cases and 9289 controls. We found that the 677TT genotype showed a reduced risk of ALL compared with the 677CC genotype in the overall population (odds ratio [OR] 0.76, 95% confidence interval [CI] 0.61-0.92). The reduced risk was pronounced only among the Caucasian population (OR 0.68, 95% CI 0.51-0.90), not the Asian (OR 0.89, 95% CI 0.75-1.05). For the MTHFR A1298C polymorphism, no significant association with ALL susceptibility was observed in the pooled analyses. However, significantly increased ALL risk was found in childhood in the comparison of 1298CA versus AA genotype. This study provides evidence that MTHFR polymorphisms may play an important role in the development of ALL.

  7. Magnetic Fe@g-C3N4: A Photoactive Catalyst for the Hydrogenation of Alkenes and Alkynes

    EPA Science Inventory

    A photoactive catalyst, Fe@g-C3N4, has been developed for the hydrogenation of alkenes and alkynes using hydrazine hydrate as a source of hydrogen. The magnetically separable Fe@g-C3N4 eliminates the use of high pressure hydrogenation and the reaction can be accomplished using vi...

  8. The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

    PubMed Central

    Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

    1988-01-01

    We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

  9. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  10. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 054771 in § 510.600(c) of this...

  11. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  12. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  13. 21 CFR 522.1696c - Penicillin G procaine in oil.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Penicillin G procaine in oil. 522.1696c Section... § 522.1696c Penicillin G procaine in oil. (a) Specifications. Each milliliter contains penicillin G procaine equivalent to 300,000 units of penicillin G. (b) Sponsor. See No. 053501 in § 510.600(c) of this...

  14. Association of -604G/A and -501A/C Ghrelin and Obestatin Prepropeptide Gene Polymorphisms with Polycystic Ovary Syndrome.

    PubMed

    Ghaleh, Talaat Dabbaghi; Skandari, Somayeh Saadat; Najafipour, Reza; Rashvand, Zahra; Darabi, Masoud; Sahmani, Mehdi

    2018-04-01

    Ghrelin hormone has an important role in a wide range of metabolic and non-metabolic processes. Polymorphisms of ghrelin gene could be associated with a large number of diseases. The aim of this study was to evaluate the association of -604G/A and -501A/C polymorphisms in ghrelin and obestatin prepropeptide gene (GHRL) with polycystic ovary syndrome (PCOS) in a sample of Iranian women. One hundred and fifty-two women with PCOS and 162 age-matched apparently healthy women as control group were enrolled in this study. The study subjects were genotyped for polymorphisms in the ghrelin gene using polymerase chain reaction-restriction fragment length polymorphism-based methods. Biochemical parameters, serum prolactin, luteinizing hormone, follicle stimulating hormone, estradiol, and testosterone were estimated by chemiluminescence assay. Serum lipids and lipoproteins were determined by standard enzymatic methods. The association between the risk of PCOS and ghrelin gene polymorphisms was examined using Multivariate analysis. The frequency of the -604G/A and -501A/C polymorphisms was not statistically different between patients and the control group of women (p = 0.12 and p = 0.21, respectively). A significantly higher level of LDL-C was found in the wild-type AA genotype compared with CC genotype of -501A/C polymorphism (p = 0.02). Our findings indicate that neither -604G/A and nor -501A/C polymorphisms of ghrelin gene are associated with PCOS, but suggest a relation between the presence of polymorphic allele of -501A/C polymorphism and LDL-C level in a sample of Iranian women.

  15. Characterization of glucose-6-phosphate dehydrogenase deficiency and identification of a novel haplotype 487G>A/IVS5-612(G>C) in the Achang population of Southwestern China.

    PubMed

    Yang, YinFeng; Zhu, YueChun; Li, DanYi; Li, ZhiGang; Lü, HuiRu; Wu, Jing; Tang, Jing; Tong, ShuFen

    2007-08-01

    The prevalence of glucose-6-phosphate dehydrogenase (G6PD) deficiency and its gene mutations were studied in the Achang population from Lianghe County in Southwestern China. We found that 7.31% (19 of 260) males and 4.35% (10 of 230) females had G6PD deficiency. The molecular analysis of G6PD gene exons 2-13 was performed by a PCR-DHPLC-Sequencing or PCR-Sequencing. Sixteen independent subjects with G6PD Mahidol (487G>A) and the new polymorphism IVS5-612 (G>C), which combined into a novel haplotype, were identified accounting for 84.2% (16/19). And 100% Achang G6PD Mahidol were linked to the IVS5-612 C. The percentage of G6PD Mahidol in the Achang group is close to that in the Myanmar population (91.3% 73/80), which implies that there are some gene flows between Achang and Myanmar populations. Interestingly, G6PD Canton (1376G>T) and G6PD Kaiping (1388G>A), which were the most common G6PD variants from other ethnic groups in China, were not found in this Achang group, suggesting that there are different G6PD mutation profiles in the Achang group and other ethnic groups in China. Our findings appear to be the first documented report on the G6PD genetics of the AChang people, which will provide important clues to the Achang ethnic group origin and will help prevention and treatment of malaria in this area.

  16. The effect of the common c.2299delG mutation in USH2A on RNA splicing.

    PubMed

    Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

    2014-05-01

    Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad.

    PubMed

    Zhang, Diana; Huang, Terry; Lukeman, Philip S; Paukstelis, Paul J

    2014-12-01

    We have determined the 1.50 Å crystal structure of the DNA decamer, d(CCA(CNV)KGCGTGG) ((CNV)K, 3-cyanovinylcarbazole), which forms a G-quadruplex structure in the presence of Ba(2+). The structure contains several unique features including a bulged nucleotide and the first crystal structure observation of a C-tetrad. The structure reveals that water molecules mediate contacts between the divalent cations and the C-tetrad, allowing Ba(2+) ions to occupy adjacent steps in the central ion channel. One ordered Mg(2+) facilitates 3'-3' stacking of two quadruplexes in the asymmetric unit, while the bulged nucleotide mediates crystal contacts. Despite the high diffraction limit, the first four nucleotides including the (CNV)K nucleoside are disordered though they are still involved in crystal packing. This work suggests that the bulky hydrophobic groups may locally influence the formation of non-Watson-Crick structures from otherwise complementary sequences. These observations lead to the intriguing possibility that certain types of DNA damage may act as modulators of G-quadruplex formation. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with sever nephropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com; Mkaouar-Rebai, Emna; Mnif, Mouna

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating thatmore » this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is

  19. Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

    PubMed

    Lee, Young Ho; Song, Gwan Gyu

    2014-04-01

    The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Integrated G and C Implementation within IDOS: A Simulink Based Reusable Launch Vehicle Simulation

    NASA Technical Reports Server (NTRS)

    Fisher, Joseph E.; Bevacqua, Tim; Lawrence, Douglas A.; Zhu, J. Jim; Mahoney, Michael

    2003-01-01

    The implementation of multiple Integrated Guidance and Control (IG&C) algorithms per flight phase within a vehicle simulation poses a daunting task to coordinate algorithm interactions with the other G&C components and with vehicle subsystems. Currently being developed by Universal Space Lines LLC (USL) under contract from NASA, the Integrated Development and Operations System (IDOS) contains a high fidelity Simulink vehicle simulation, which provides a means to test cutting edge G&C technologies. Combining the modularity of this vehicle simulation and Simulink s built-in primitive blocks provide a quick way to implement algorithms. To add discrete-event functionality to the unfinished IDOS simulation, Vehicle Event Manager (VEM) and Integrated Vehicle Health Monitoring (IVHM) subsystems were created to provide discrete-event and pseudo-health monitoring processing capabilities. Matlab's Stateflow is used to create the IVHM and Event Manager subsystems and to implement a supervisory logic controller referred to as the Auto-commander as part of the IG&C to coordinate the control system adaptation and reconfiguration and to select the control and guidance algorithms for a given flight phase. Manual creation of the Stateflow charts for all of these subsystems is a tedious and time-consuming process. The Stateflow Auto-builder was developed as a Matlab based software tool for the automatic generation of a Stateflow chart from information contained in a database. This paper describes the IG&C, VEM and IVHM implementations in IDOS. In addition, this paper describes the Stateflow Auto-builder.

  1. The energy gap in a-Si 1 - xC g: H alloys

    NASA Astrophysics Data System (ADS)

    Valladares, Ariel A.; Valladares, Alexander; Enrique Sansores, L.; Nelis, Mary Ann Me

    1997-02-01

    The electronic structure of amorphous tetrahedral clusters of the type a-Si 1 - xC g: H are studied using the pseudopotential SCF Hartree-Fock approximation. The reduced energy gap isgiven by Egr( x) - 1 + 0.84 x for x ⩽ 0.5, whereas experimentally Egr( x) = 1 + 0.96 x. For x ⩾ 0.5 the dip in the gap value reported experimentally is verified.

  2. A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

    PubMed

    Sawada, Tomohisa; Fujita, Makoto

    2010-05-26

    Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

  3. Dipole moments and transition probabilities of the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u systems of molecular hydrogen

    NASA Technical Reports Server (NTRS)

    Guberman, Steven L.; Dalgarno, A.

    1992-01-01

    Bonn-Oppenheimer-based ab initio calculations of dipole moments from the i 3Pi sub g-b 3Sigma(+) sub u, c 3Pi sub u-a 3Sigma(+) sub g, and i 3Pi sub g-c 3Pi sub u transitions of H2 have been conducted, to yield a tabulation of the dipole transition probabilities and Franck-Condon factors. These factors are given for transitions originating in the lowest vibrational level of the ground X 1Sigma(+) sub g state.

  4. Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

    DOE PAGES

    Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui; ...

    2017-06-02

    In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

  5. Enhanced visible light photocatalytic water reduction from a g-C 3N 4/SrTa 2O 6 heterojunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adhikari, Shiba P.; Hood, Zachary D.; Wang, Hui

    In this paper, a new g-C 3N 4/SrTa 2O 6 heterojunction photocatalyst was designed and prepared by chimie douce (soft chemistry) method where carbon nitride (g-C 3N 4) was deposited over the metastable perovskite phase of SrTa 2O 6. The morphological study of the heterojunction using SEM and STEM revealed that g-C 3N 4 nanofibers are dispersed uniformly on the surface of SrTa 2O 6 plates leading to the intimate contact between them. The heterojunction could achieve a high and stable visible light photocatalytic H 2 generation of 137 mmol/h/mole of g-C 3N 4, which is much larger than themore » amount of hydrogen generated by one mole of pristine g-C 3N 4. Finally, a plausible mechanism for the observed enhanced photocatalytic activity for the heterojunction is proposed on the basis of effective charge separation of photogenerated electron-hole pairs, supported by band position calculations and photo-physical properties of g-C 3N 4 and SrTa 2O 6.« less

  6. Carbazole ligands as c-myc G-quadruplex binders.

    PubMed

    Głuszyńska, Agata; Juskowiak, Bernard; Kuta-Siejkowska, Martyna; Hoffmann, Marcin; Haider, Shozeb

    2018-07-15

    The interactions of c-myc G-quadruplex with three carbazole derivatives were investigated by UV-Vis spectrophotometry, fluorescence, CD spectroscopy, and molecular modeling. The results showed that a combination of carbazole scaffold functionalized with ethyl, triazole and imidazole groups resulted in stabilization of the intramolecular G-quadruplex formed by the DNA sequence derived from the NHE III 1 region of c-myc oncogene (Pu22). Binding to the G-quadruplex Pu22 resulted in the significant increase in fluorescence intensity of complexed ligands 1-3. All ligands were capable of interacting with G4 DNA with binding stoichiometry indicating that two ligand molecules bind to G-quadruplex with comparable affinity, which agrees with binding model of end-stacking on terminal G-tetrads. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Methylenetetrahydrofolate reductase gene polymorphisms and the risk of colorectal carcinoma in a sample of Egyptian individuals.

    PubMed

    El Awady, Mostafa K; Karim, Amr M; Hanna, Laila S; El Husseiny, Lamia A; El Sahar, Medhat; Menem, Hanan A Abdel; Meguid, Nagwa A

    2009-01-01

    The study was planned as a pilot study to investigate two common polymorphisms in the MTHFR gene c.677C > T and c.1298A > C and their association with enhanced risk of colorectal cancer (CRC) in a sample of Egyptian individuals. Venous blood samples were withdrawn from 35 cases of CRC and 68 healthy controls. Specimens from colonic and rectal carcinoma tissues in addition to cancer free tissues were obtained from all cases. Frequencies of MTHFR677T and 1298C alleles were significantly higher among cases of CRC tumor tissues (50% and 56%, respectively) than germ line alleles in CRC patients (33% and 41%, respectively) and healthy controls (21% and 35%, respectively). Frequencies of heterozygous and homoyzgous polymorphisms of MTHFR at positions 677 and 1298 in carcinoma tissues were always the highest. At position 677, TT and CT genotype frequencies were 17% and 66% with an odds ratio {OR} of 11 [95% confidence interval {CI} 2.39-50.59] and OR 8.34 [95%CI 2.97-23.92], respectively, in carcinoma tissues. While in the germ line of patients the genotype frequencies of 677TT and CT were 6% and 54% with OR 1.57 [95%CI 0.26-9.51] and 2.99 [95%CI 1.25-7.12], respectively, compared to controls (6% and 29%, respectively). The combined genotype MTHFR 1298CC + AC frequencies were 86% with OR 3.71 [95%CI 1.28-10.78] in carcinoma tissues, 69% with OR 1.35 [95%CI 0.57-3.21] in germ line of patients and 62% in controls. The combined genotype 677CT plus any of the following genotypes 1298AA, AC or CC enhanced risk of CRC, when comparing germ line DNA polymorphism of patients versus peripheral blood DNA of control subjects with OR 4.5 [95%CI 0.94-21.56], OR 3.12 [95%CI 0.79-12.36] and OR 18 [95%CI 1.56-207.5], respectively, suggesting strong genetic predisposition of certain Egyptian population to CRC. These results suggested that at least one C to T polymorphism at 677MTHFR gene is required to significantly increase the risk for CRC development. Further large scale studies are

  8. Association between methylene tetrahydrofolate reductase and glutathione S-transferase M1 gene polymorphisms and chronic myeloid leukemia in a Brazilian population.

    PubMed

    Lordelo, G S; Miranda-Vilela, A L; Akimoto, A K; Alves, P C Z; Hiragi, C O; Nonino, A; Daldegan, M B; Klautau-Guimarães, M N; Grisolia, C K

    2012-04-19

    Chronic myeloid leukemia is a hematopoietic stem cell disorder that causes uncontrolled proliferation of white blood cells. Although the clinical and biological aspects are well documented, little is known about individual susceptibility to this disease. We conducted a case-control study analyzing the prevalence of the polymorphisms MTHFR C677T, MTHFR A1298C, del{GSTM1}, del{GSTT1}, and haptoglobin in 105 patients with chronic myeloid leukemia (CML) and 273 healthy controls, using PCR-based methods. A significant association with risk of developing CML was found for MTHFR 1298AA (odds ratio (OR) = 1.794; 95% confidence interval (CI) = 1.14-2.83) and GSTM1 non-null (OR = 1.649; 95%CI = 1.05-2.6) genotypes, while MTHFR 1298AC (OR = 0.630; 95%CI = 0.40-0.99) and GSTM1 null (OR = 0.606; 95%CI = 0.21-0.77) genotypes significantly decreased this risk. There appeared to be selection for heterozygosity at the MTHFR 1298 locus. The considerable range of variation in this and other human populations may be a consequence of distinctive processes of natural selection and adaptation to variable environmental conditions. The Brazilian population is very mixed and heterogeneous; we found these two loci to be associated with CML in this population.

  9. A -819 C/T polymorphism in the interleukin-10 promoter is associated with persistent HBV infection, but -1082 A/G and -592A/C polymorphisms are not: a meta-analysis.

    PubMed

    Ren, Hong; Zhang, Ting-Ting; Hu, Wen-Long

    2015-03-01

    Single-nucleotide polymorphisms (SNPs) in the interleukin-10 (IL10) gene promoter have been associated with persistent hepatitis B virus (HBV) infection. In particular, the -1082A/G, -819 C/T and -592 A/C polymorphisms have most often been implicated. We performed a meta-analysis of available data to determine the relative importance of these SNPs in persistent HBV infection. We searched available articles in NCBI PubMed, EMBASE, the Chinese National Knowledge Infrastructure (CNKI), and the Chinese Biomedical Literature Database (CBM) and identified 24 studies for inclusion in our meta-analysis. Our results indicated that the presence of the IL10 -819 C allele significantly increased the risk for persistent HBV infection (CC+CT vs. TT: OR = 1.283, 95 % CI 1.023-1.610, P = 0.031; C vs. T: OR = 1.183, 95 % CI 1.001-1.399, P = 0.049). Meanwhile, the -1082A/-819T/-592A haplotype (OR = 0.751, 95 % CI 0.640-0.881, P = 0.000) and the -1082A/-819C/-592C haplotype (OR = 1.568, 95 % CI 1.304-1.884, P = 0.000) were observed to be significantly associated with HBV disease progression in Asians. In contrast, the IL10 -1082A/G and -592A/C polymorphisms were not associated with an increased susceptibility to or outcome of HBV infection. Our meta-analysis supports the growing body of evidence that the presence of the IL10 -819 C/T polymorphism is associated with persistent HBV infection and that the -1082A/-819T/-592A haplotype and the -1082A/-819C/-592C haplotype are associated with HBV disease progression in Asians.

  10. Facile synthesis of Fe3O4/g-C3N4/HKUST-1 composites as a novel biosensor platform for ochratoxin A.

    PubMed

    Hu, Shuisheng; Ouyang, Wenjun; Guo, Longhua; Lin, Zhenyu; Jiang, Xiaohua; Qiu, Bin; Chen, Guonan

    2017-06-15

    A fluorescent biosensor for ochratoxin A was fabricated on the basis of a new nanocomposite (Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites). Fe 3 O 4 /g-C 3 N 4 /HKUST-1 was synthesized in this work for the first time, which combined HKUST-1 with g-C 3 N 4 to improve its chemical stability. Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites have strong adsorption capacity for dye-labeled aptamer and are able to completely quench the fluorescence of the dye through the photoinduced electron transfer (PET) mechanism. In the presence of ochratoxin A (OTA), it can bind with the aptamer with high affinity, causing the releasing of the dye-labeled aptamer from the Fe 3 O 4 /g-C 3 N 4 /HKUST-1 and therefore results in the recovery of fluorescence. The fluorescence intensity of the biosensor has a linear relationship with the OTA concentration in the range of 5.0-160.0ng/mL. The LOD of sensor is 2.57ng/mL (S/N=3). This fluorescence sensor based on the Fe 3 O 4 /g-C 3 N 4 /HKUST-1 composites has been applied to detect OTA in corn with satisfying results. Copyright © 2016. Published by Elsevier B.V.

  11. The association between the miRNA-146a rs2910164 C>G polymorphism and Kawasaki disease in a southern Chinese population.

    PubMed

    Zhang, Li; Wang, Jinxin; Che, Di; Wang, Yanfei; Rong, Xing; Pi, Lei; Xu, Yufen; Li, Wei; Huang, Ping; Chu, Maoping; Gu, Xiaoqiong

    2018-06-14

    miRNA-146a plays a critical role in innate immune and inflammatory responses. Kawasaki disease involves immune-mediated inflammatory responses, which lead to vascular endothelial injury. However, there has been no study on the association between the miRNA-146a rs2910164 C>G polymorphism and Kawasaki disease risk. We enrolled 532 Kawasaki disease patients and 623 healthy controls from a southern Chinese population, and the miRNA-146a rs2910164 C>G polymorphism was genotyped by the TaqMan method. There was no evidence that this polymorphism was associated with Kawasaki disease. Stratified analysis also showed no significant association. This study indicates that the miRNA-146a rs2910164 C>G polymorphism may not be associated with Kawasaki disease in a southern Chinese population. Larger, multicenter studies are needed to confirm our conclusions. ©2018 The Author(s).

  12. Association of the methylenetetrahydrofolate reductase polymorphism in Korean patients with childhood acute lymphoblastic leukemia.

    PubMed

    Kim, Nam Keun; Chong, So Young; Jang, Moon Ju; Hong, Seung Ho; Kim, Heung Sik; Cho, Eun Kyung; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Oh, Doyeun

    2006-01-01

    Methylenetetrahydrofolate reductase plays a central role in converting folate to methyl donor for DNA methylation. Recently, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) mutations were discovered to be associated with childhood acute lymphoblastic leukemia (ALL), as well as colon cancer, lymphoma, esophageal and stomach cancer. Therefore, it was hypothesized that the MTHFR polymorphisms are associated with the risk of childhood ALL in the Korean population. DNA samples taken from 66 patients with ALL and 100 age-matched controls were analyzed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay for detection of MTHFR C677T and A1298C mutations. The frequency of the AC genotype for MTHFR A1298C polymorphism was significantly different between the controls and the cases (OR, 2.22; CI, 95% 1.09-4.51, p=0.03). The 1298AC+CC genotype was also significantly different (OR, 2.11; 95% CI, 1.06-4.22; p=0.049). There was, however, no significant difference for MTHFR C677T polymorphism and combined genotype frequencies between the two groups. Although no consistent results on associations between MTHFR A 1298C polymorphism and ALL in the populations studied were obtained, the A1298C polymorphism, at least in Koreans, may be a genetic determinant among childhood ALL patients.

  13. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 11 Federal Elections 1 2012-01-01 2012-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  14. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  15. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 11 Federal Elections 1 2011-01-01 2011-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  16. 11 CFR 111.4 - Complaints (2 U.S.C. 437g(a)(1)).

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 11 Federal Elections 1 2014-01-01 2014-01-01 false Complaints (2 U.S.C. 437g(a)(1)). 111.4 Section... knowledge and statements based upon information and belief. (d) The complaint should conform to the... accompanied by an identification of the source of information which gives rise to the complainants belief in...

  17. Methylenetetrahydrofolate reductase gene polymorphisms: association with risk for pediatric acute lymphoblastic leukemia in north Indians.

    PubMed

    Sood, Swati; Das, Reena; Trehan, Amita; Ahluwalia, Jasmina; Sachdeva, Man Updesh; Varma, Neelam; Bansal, Deepak; Marwaha, Ram Kumar

    2010-05-01

    Genetic polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene have been associated with the development of acute leukemias and various malignancies. We conducted a case-control study in 95 north Indian children with acute lymphoblastic leukemia (ALL) and 255 controls, to investigate the role of MTHFR C677T and A1298C polymorphisms as risk factors in the development of ALL. PCR-RFLP on genomic DNA was carried out to determine C677T and A1298C genotypes. The frequency of MTHFR C677T for the T allele was found to be 23.2% among patients and 18.2% among controls. The frequency of the C allele in MTHFR A1298C was 44.2% among cases and 48.2% in controls. Patients showed a higher frequency of heterozygosity for the MTHFR C677T polymorphism as compared to controls (40% vs 27.8%; OR = 1.73, 95% CI 1.02-2.91, p = 0.02), and the A1298C polymorphism did not show any difference in genotype frequency between cases and controls. MTHFR 677CC/1298AC genotype frequencies showed a statistically significant difference between cases and controls (OR = 0.58, 95% CI 0.34-1.01, p = 0.04). In conclusion, our study in north Indian controls and patients with pediatric ALL showed increased frequency for MTHFR C677T in the heterozygous state and no significant difference in the frequency of A1298C genotype between the two groups.

  18. C3G promotes a selective release of angiogenic factors from activated mouse platelets to regulate angiogenesis and tumor metastasis.

    PubMed

    Martín-Granado, Víctor; Ortiz-Rivero, Sara; Carmona, Rita; Gutiérrez-Herrero, Sara; Barrera, Mario; San-Segundo, Laura; Sequera, Celia; Perdiguero, Pedro; Lozano, Francisco; Martín-Herrero, Francisco; González-Porras, José Ramón; Muñoz-Chápuli, Ramón; Porras, Almudena; Guerrero, Carmen

    2017-12-19

    Previous observations indicated that C3G (RAPGEF1) promotes α-granule release, evidenced by the increase in P-selectin exposure on the platelet surface following its activation. The goal of the present study is to further characterize the potential function of C3G as a modulator of the platelet releasate and its implication in the regulation of angiogenesis. Proteomic analysis revealed a decreased secretion of anti-angiogenic factors from activated transgenic C3G and C3G∆Cat platelets. Accordingly, the secretome from both transgenic platelets had an overall pro-angiogenic effect as evidenced by an in vitro capillary-tube formation assay with HUVECs (human umbilical vein endothelial cells) and by two in vivo models of heterotopic tumor growth. In addition, transgenic C3G expression in platelets greatly increased mouse melanoma cells metastasis. Moreover, immunofluorescence microscopy showed that the pro-angiogenic factors VEGF and bFGF were partially retained into α-granules in thrombin- and ADP-activated mouse platelets from both, C3G and C3GΔCat transgenic mice. The observed interaction between C3G and Vesicle-associated membrane protein (Vamp)-7 could explain these results. Concomitantly, increased platelet spreading in both transgenic platelets upon thrombin activation supports this novel function of C3G in α-granule exocytosis. Collectively, our data point out to the co-existence of Rap1GEF-dependent and independent mechanisms mediating C3G effects on platelet secretion, which regulates pathological angiogenesis in tumors and other contexts. The results herein support an important role for platelet C3G in angiogenesis and metastasis.

  19. Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules.

    PubMed Central

    Tal-Singer, R; Peng, C; Ponce De Leon, M; Abrams, W R; Banfield, B W; Tufaro, F; Cohen, G H; Eisenberg, R J

    1995-01-01

    The entry of herpes simplex virus (HSV) into mammalian cells is a multistep process beginning with an attachment step involving glycoproteins gC and gB. A second step requires the interaction of glycoprotein gD with a cell surface molecule. We explored the interaction between gC and the cell surface by using purified proteins in the absence of detergent. Truncated forms of gC and gD, gC1(457t), gC2(426t), and gD1(306t), lacking the transmembrane and carboxyl regions were expressed in the baculovirus system. We studied the ability of these proteins to bind to mammalian cells, to bind to immobilized heparin, to block HSV type 1 (HSV-1) attachment to cells, and to inhibit plaque formation by HSV-1. Each of these gC proteins bound to conformation-dependent monoclonal antibodies and to human complement component C3b, indicating that they maintained the same conformation of gC proteins expressed in mammalian cells. Biotinylated gC1(457t) and gC2(426t) each bind to several cell lines. Binding was inhibited by an excess of unlabeled gC but not by gD, indicating specificity. The attachment of gC to cells involves primarily heparan sulfate proteoglycans, since heparitinase treatment of cells reduced gC binding by 50% but had no effect on gD binding. Moreover, binding of gC to two heparan sulfate-deficient L-cell lines, gro2C and sog9, both of which are mostly resistant to HSV infection, was markedly reduced. Purified gD1 (306t), however, bound equally well to the two mutant cell lines. In contrast, saturating amounts of gC1(457t) interfered with HSV-1 attachment to cells but failed to block plaque formation, suggesting a role for gC in attachment but not penetration. A mutant form of gC lacking residues 33 to 123, gC1(delta 33-123t), expressed in the baculovirus system, bound significantly less well to cells than did gC1(457t) and competed poorly with biotinylated gC1(457t) for binding. These results suggest that residues 33 to 123 are important for gC attachment to cells

  20. Damnacanthal, a noni anthraquinone, inhibits c-Met and is a potent antitumor compound against Hep G2 human hepatocellular carcinoma cells.

    PubMed

    García-Vilas, Javier A; Quesada, Ana R; Medina, Miguel A

    2015-01-26

    Damnacanthal, an anthraquinone present in noni plants, targets several tyrosine kinases and has antitumoral effects. This study aims at getting additional insight on the potential of damnacanthal as a natural antitumor compound. The direct effect of damnacanthal on c-Met was tested by in vitro activity assays. Additionally, Western blots of c-Met phosphorylation in human hepatocellular carcinoma Hep G2 cells were performed. The antitumor effects of damnacanthal were tested by using cell growth, soft agar clonogenic, migration and invasion assays. Their mechanisms were studied by Western blot, and cell cycle, apoptosis and zymographic assays. Results show that damnacanthal targets c-Met both in vitro and in cell culture. On the other hand, damnacanthal also decreases the phosphorylation levels of Akt and targets matrix metalloproteinase-2 secretion in Hep G2 cells. These molecular effects are accompanied by inhibition of the growth and clonogenic potential of Hep G2 hepatocellular carcinoma cells, as well as induction of Hep G2 apoptosis. Since c-Met has been identified as a new potential therapeutical target for personalized treatment of hepatocellular carcinoma, damnacanthal and noni extract supplements containing it could be potentially interesting for the treatment and/or chemoprevention of hepatocellular carcinoma through its inhibitory effects on the HGF/c-Met axis.

  1. Effect of interleukin-10 gene promoter polymorphisms -1082 G/A and -592 C/A on response to therapy in children and adolescents with chronic hepatitis C virus infection.

    PubMed

    El-Karaksy, Hanaa M; Sharaf, Sahar A; Mandour, Iman A; Mogahed, Engy A; Rady, Normeen H; El-Mougy, Fatma A

    2016-12-01

    Studying predictors of response to therapy for hepatitis C virus (HCV) infection in children may help avoid the inappropriate use of currently available costly therapy associated with numerous adverse effects. We tested the hypothesis that inheritance of single nucleotide polymorphisms (SNPs) of the interleukin-10 (IL-10) promoter gene might influence response to HCV treatment. The impact of SNPs, -1082 G/A and -592 C/A, in the promoter region of IL-10 gene, on response to HCV therapy was assessed in a cohort of 40 children treated with a combination of pegylated interferon (Peg-IFN) α2b and ribavirin. Sustained virological response was achieved in 48.7%. High viral load was associated with non-response to therapy. There was no association between histopathological degree of inflammation or fibrosis and response to therapy. There was no direct statistically significant association between polymorphisms in the IL-10 gene (-1082G/A and -592 C/A) as regards inflammation or response to therapy in children. As for the SNP -592 C/A; there was a statistically significant association with the score of fibrosis (P<0.004), concluding that the A allele was protective from moderate and severe fibrosis. Meanwhile the SNP -1082G/A did not show any association with the fibrosis score. We could not associate response to therapy for HCV with IL-10 polymorphisms -1082 G/A and -592 C/A. For the SNP -592 C/A, the A allele protected from moderate and severe fibrosis. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  2. Relationship between miR-146a rs2910164 (G>C) Polymorphism and Digestive System Cancer Susceptibility: A Meta-Analysis.

    PubMed

    Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong

    2017-08-01

    MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.

  3. Rapid electron exchange between surface-exposed bacterial cytochromes and Fe(III) minerals

    PubMed Central

    White, Gaye F.; Shi, Zhi; Shi, Liang; Wang, Zheming; Dohnalkova, Alice C.; Marshall, Matthew J.; Fredrickson, James K.; Zachara, John M.; Butt, Julea N.; Richardson, David J.; Clarke, Thomas A.

    2013-01-01

    The mineral-respiring bacterium Shewanella oneidensis uses a protein complex, MtrCAB, composed of two decaheme cytochromes, MtrC and MtrA, brought together inside a transmembrane porin, MtrB, to transport electrons across the outer membrane to a variety of mineral-based electron acceptors. A proteoliposome system containing a pool of internalized electron carriers was used to investigate how the topology of the MtrCAB complex relates to its ability to transport electrons across a lipid bilayer to externally located Fe(III) oxides. With MtrA facing the interior and MtrC exposed on the outer surface of the phospholipid bilayer, the established in vivo orientation, electron transfer from the interior electron carrier pool through MtrCAB to solid-phase Fe(III) oxides was demonstrated. The rates were 103 times higher than those reported for reduction of goethite, hematite, and lepidocrocite by S. oneidensis, and the order of the reaction rates was consistent with those observed in S. oneidensis cultures. In contrast, established rates for single turnover reactions between purified MtrC and Fe(III) oxides were 103 times lower. By providing a continuous flow of electrons, the proteoliposome experiments demonstrate that conduction through MtrCAB directly to Fe(III) oxides is sufficient to support in vivo, anaerobic, solid-phase iron respiration. PMID:23538304

  4. Functional variants of gene encoding folate metabolizing enzyme and methotrexate-related toxicity in children with acute lymphoblastic leukemia.

    PubMed

    Kałużna, Ewelina; Strauss, Ewa; Zając-Spychała, Olga; Gowin, Ewelina; Świątek-Kościelna, Bogna; Nowak, Jerzy; Fichna, Marta; Mańkowski, Przemysław; Januszkiewicz-Lewandowska, Danuta

    2015-12-15

    Methotrexate (MTX) is commonly used agent in therapy of malignancies, including acute lymphoblastic leukemia (ALL). Based on the literature data it is known that MTX elimination and toxicity can be affected by polymorphisms in genes encoding enzymes involved in MTX metabolism. The aim of our study was to investigate the influence of C677T and A1298C polymorphisms in methylenetetrahydrofolate reductase (MTHFR) gene on MTX-induced toxicity during treatment of children with ALL. We also tried to answer the question whether simultaneous occurrence of these two polymorphisms has a clinical significance. MTHFR polymorphisms were assessed in 47 pediatric ALL patients, treated according to intensive chemotherapy for childhood ALL, ALL IC BFM 2009. Prolonged MTX elimination and higher incidence of toxicity were observed for patients with 677T-1298A haplotype. On the other hand, occurrence of 677C-1298A haplotype had protective effect on MTX clearance and toxicity, that was not observed in carriers of 677C-1298C haplotype. In patients with coexistence of studied variants 677CT/1298AC heterozygotes as well as in 677TT/1298AA homozygotes more frequently toxicity incidents were noted. The obtained results suggest that occurrence of 677T allele and coexistence of 677T and 1298C alleles may be associated with lower MTX clearance and elevated risk of adverse effects during MTX-treatment of pediatric ALL patients. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. c-Type Cytochrome-Dependent Formation of U(IV) Nanoparticles by Shewanella oneidensis

    PubMed Central

    Marshall, Matthew J; Dohnalkova, Alice C; Kennedy, David W; Shi, Liang; Wang, Zheming; Boyanov, Maxim I; Lai, Barry; Kemner, Kenneth M; McLean, Jeffrey S; Reed, Samantha B; Culley, David E; Bailey, Vanessa L; Simonson, Cody J; Saffarini, Daad A; Romine, Margaret F; Zachara, John M

    2006-01-01

    Modern approaches for bioremediation of radionuclide contaminated environments are based on the ability of microorganisms to effectively catalyze changes in the oxidation states of metals that in turn influence their solubility. Although microbial metal reduction has been identified as an effective means for immobilizing highly-soluble uranium(VI) complexes in situ, the biomolecular mechanisms of U(VI) reduction are not well understood. Here, we show that c-type cytochromes of a dissimilatory metal-reducing bacterium, Shewanella oneidensis MR-1, are essential for the reduction of U(VI) and formation of extracelluar UO 2 nanoparticles. In particular, the outer membrane (OM) decaheme cytochrome MtrC (metal reduction), previously implicated in Mn(IV) and Fe(III) reduction, directly transferred electrons to U(VI). Additionally, deletions of mtrC and/or omcA significantly affected the in vivo U(VI) reduction rate relative to wild-type MR-1. Similar to the wild-type, the mutants accumulated UO 2 nanoparticles extracellularly to high densities in association with an extracellular polymeric substance (EPS). In wild-type cells, this UO 2-EPS matrix exhibited glycocalyx-like properties and contained multiple elements of the OM, polysaccharide, and heme-containing proteins. Using a novel combination of methods including synchrotron-based X-ray fluorescence microscopy and high-resolution immune-electron microscopy, we demonstrate a close association of the extracellular UO 2 nanoparticles with MtrC and OmcA (outer membrane cytochrome). This is the first study to our knowledge to directly localize the OM-associated cytochromes with EPS, which contains biogenic UO 2 nanoparticles. In the environment, such association of UO 2 nanoparticles with biopolymers may exert a strong influence on subsequent behavior including susceptibility to oxidation by O 2 or transport in soils and sediments. PMID:16875436

  6. Association of the polymorphisms 292 C>T and 1304 G>A in the SLC38A4 gene with hyperglycaemia.

    PubMed

    González-Renteria, Siblie Marbey; Loera-Castañeda, Verónica; Chairez-Hernández, Isaías; Sosa-Macias, Martha; Paniagua-Castro, Norma; Lares-Aseff, Ismael; Rodríguez-Moran, Martha; Guerrero-Romero, Fernando; Galaviz-Hernández, Carlos

    2013-01-01

    The SLC38A4 gene is related to system 'A' activity, which seems to be related to impaired gluconeogenesis. The objective of this study was to determine whether the 292 C>T and 1304 G>A polymorphisms of SLC38A4 gene are associated with hyperglycaemia in humans. A total of 227 individuals were enrolled in a case-control study, in which hyperglycaemia was defined by plasma glucose levels ≥95 mg/dL. Genotyping was carried out by using real-time polymerase chain reaction. The frequency of mutant alleles of SLC38A4 gene for single-nucleotide polymorphism (SNP) 1304 G>A was 23.6% and 30.2% for SNP 292 C>T. The frequency of allele T for the SNP 292 C>T in the case and control groups did not show significant differences, whereas the frequency of allele A for the SNP 1304 G>A was significantly higher in the case group than in the control group (p = 0.04). In the logistic regression analysis, the SNP 1304 G>A [odds ratio (OR) 1.78; 95%CI 1.04-3.05, p = 0.03] but not SNP 292 C>T (OR 1.41; 95%CI 0.80-2.47, p = 0.23) showed a significant association with hyperglycaemia. After adjusting by body mass index, waist circumference and triglycerides, the SNP 1304 G>A remained significantly associated with hyperglycaemia (OR 2.13; 95%CI 1.18-3.83, p = 0.03). Pair wise linkage disequilibrium showed correlation (D' > 0.82) between 292 C>T and 1304 G>A SNPs. Haplotype association with hyperglycaemia also showed significant association between both homozygous mutant alleles (A/T) and hyperglycaemia (OR 1.68; 95%CI 1.01-2.79, p = 0.048). Our results suggest that mutant allele A for SNP 1304 G>A of SLC38A4 gene is associated with hyperglycaemia. Copyright © 2012 John Wiley & Sons, Ltd.

  7. Combined genetic and splicing analysis of BRCA1 c.[594-2A>C; 641A>G] highlights the relevance of naturally occurring in-frame transcripts for developing disease gene variant classification algorithms

    PubMed Central

    de la Hoya, Miguel; Soukarieh, Omar; López-Perolio, Irene; Vega, Ana; Walker, Logan C.; van Ierland, Yvette; Baralle, Diana; Santamariña, Marta; Lattimore, Vanessa; Wijnen, Juul; Whiley, Philip; Blanco, Ana; Raponi, Michela; Hauke, Jan; Wappenschmidt, Barbara; Becker, Alexandra; Hansen, Thomas V. O.; Behar, Raquel; Investigators, KConFaB; Niederacher, Diether; Arnold, Norbert; Dworniczak, Bernd; Steinemann, Doris; Faust, Ulrike; Rubinstein, Wendy; Hulick, Peter J.; Houdayer, Claude; Caputo, Sandrine M.; Castera, Laurent; Pesaran, Tina; Chao, Elizabeth; Brewer, Carole; Southey, Melissa C.; van Asperen, Christi J.; Singer, Christian F.; Sullivan, Jan; Poplawski, Nicola; Mai, Phuong; Peto, Julian; Johnson, Nichola; Burwinkel, Barbara; Surowy, Harald; Bojesen, Stig E.; Flyger, Henrik; Lindblom, Annika; Margolin, Sara; Chang-Claude, Jenny; Rudolph, Anja; Radice, Paolo; Galastri, Laura; Olson, Janet E.; Hallberg, Emily; Giles, Graham G.; Milne, Roger L.; Andrulis, Irene L.; Glendon, Gord; Hall, Per; Czene, Kamila; Blows, Fiona; Shah, Mitul; Wang, Qin; Dennis, Joe; Michailidou, Kyriaki; McGuffog, Lesley; Bolla, Manjeet K.; Antoniou, Antonis C.; Easton, Douglas F.; Couch, Fergus J.; Tavtigian, Sean; Vreeswijk, Maaike P.; Parsons, Michael; Meeks, Huong D.; Martins, Alexandra; Goldgar, David E.; Spurdle, Amanda B.

    2016-01-01

    A recent analysis using family history weighting and co-observation classification modeling indicated that BRCA1 c.594-2A > C (IVS9-2A > C), previously described to cause exon 10 skipping (a truncating alteration), displays characteristics inconsistent with those of a high risk pathogenic BRCA1 variant. We used large-scale genetic and clinical resources from the ENIGMA, CIMBA and BCAC consortia to assess pathogenicity of c.594-2A > C. The combined odds for causality considering case-control, segregation and breast tumor pathology information was 3.23 × 10−8. Our data indicate that c.594-2A > C is always in cis with c.641A > G. The spliceogenic effect of c.[594-2A > C;641A > G] was characterized using RNA analysis of human samples and splicing minigenes. As expected, c.[594-2A > C; 641A > G] caused exon 10 skipping, albeit not due to c.594-2A > C impairing the acceptor site but rather by c.641A > G modifying exon 10 splicing regulatory element(s). Multiple blood-based RNA assays indicated that the variant allele did not produce detectable levels of full-length transcripts, with a per allele BRCA1 expression profile composed of ≈70–80% truncating transcripts, and ≈20–30% of in-frame Δ9,10 transcripts predicted to encode a BRCA1 protein with tumor suppression function. We confirm that BRCA1c.[594-2A > C;641A > G] should not be considered a high-risk pathogenic variant. Importantly, results from our detailed mRNA analysis suggest that BRCA-associated cancer risk is likely not markedly increased for individuals who carry a truncating variant in BRCA1 exons 9 or 10, or any other BRCA1 allele that permits 20–30% of tumor suppressor function. More generally, our findings highlight the importance of assessing naturally occurring alternative splicing for clinical evaluation of variants in disease-causing genes. PMID:27008870

  8. HTR2A A-1438G/T102C polymorphisms predict negative symptoms performance upon aripiprazole treatment in schizophrenic patients.

    PubMed

    Chen, Shih-Fen; Shen, Yu-Chih; Chen, Chia-Hsiang

    2009-08-01

    Aripiprazole acts as a partial agonist at dopamine D2 and D3 and serotonin 1A receptors and as an antagonist at serotonin 2A receptors (HTR2A). Since aripiprazole acts as an antagonist at HTR2A, genetic variants of HTR2A may be important in explaining variability in response to aripiprazole. This study investigated whether the efficacy of aripiprazole can be predicted by functional HTR2A A-1438G/T102C polymorphisms (rs63311/rs6313) as modified by clinical factors in Han Chinese hospitalized patients with acutely exacerbated schizophrenia. After hospitalization, the patients (n = 128) were given a 4-week course of aripiprazole. Patients were genotyped for HTR2A A-1438G/T102C polymorphisms via the restriction fragment length polymorphism method. Clinical factors such as gender, age, duration of illness, education level, diagnostic subtype, and medication dosage were noted as well. The researchers measured psychopathology biweekly, using the Positive and Negative Syndrome Scale (PANSS). A mixed model regression approach (SAS Proc MIXED) was used to analyze the effects of genetic and clinical factors on PANSS performance after aripiprazole treatment. We found that the GG/CC genotype group of HTR2A A-1438G/T102C polymorphisms predicts poor aripiprazole response specifically for negative symptoms. In addition, the clinical factors, including dosage of aripiprazole, age, duration of illness, and diagnostic subtype, were found to influence PANSS performance after aripiprazole treatment. The data suggest HTR2A A-1438G/T102C polymorphisms may predict negative symptoms performance upon aripiprazole treatment in schizophrenic patients as modified by clinical factors.

  9. Photoreduction of Shewanella oneidensis Extracellular Cytochromes by Organic Chromophores and Dye‐Sensitized TiO2

    PubMed Central

    Ainsworth, Emma V.; Lockwood, Colin W. J.; White, Gaye F.; Hwang, Ee Taek; Sakai, Tsubasa; Gross, Manuela A.; Richardson, David J.; Clarke, Thomas A.

    2016-01-01

    Abstract The transfer of photoenergized electrons from extracellular photosensitizers across a bacterial cell envelope to drive intracellular chemical transformations represents an attractive way to harness nature's catalytic machinery for solar‐assisted chemical synthesis. In Shewanella oneidensis MR‐1 (MR‐1), trans‐outer‐membrane electron transfer is performed by the extracellular cytochromes MtrC and OmcA acting together with the outer‐membrane‐spanning porin⋅cytochrome complex (MtrAB). Here we demonstrate photoreduction of solutions of MtrC, OmcA, and the MtrCAB complex by soluble photosensitizers: namely, eosin Y, fluorescein, proflavine, flavin, and adenine dinucleotide, as well as by riboflavin and flavin mononucleotide, two compounds secreted by MR‐1. We show photoreduction of MtrC and OmcA adsorbed on RuII‐dye‐sensitized TiO2 nanoparticles and that these protein‐coated particles perform photocatalytic reduction of solutions of MtrC, OmcA, and MtrCAB. These findings provide a framework for informed development of strategies for using the outer‐membrane‐associated cytochromes of MR‐1 for solar‐driven microbial synthesis in natural and engineered bacteria. PMID:27685371

  10. Bone Mineral Properties in Growing Col1a2+/G610C Mice, an animal model of Osteogenesis Imperfecta

    PubMed Central

    Masci, Marco; Wang, Min; Imbert, Laurianne; Barnes, Aileen M; Spevak, Lyudmila; Lukashova, Lyudmila; Yihe, Huang; Yan, Ma; Marini, Joan C; Jacobsen, Christina M; Warman, Matthew L; Boskey, Adele L

    2016-01-01

    The Col1a2+/G610C knock-in mouse, models osteogenesis imperfecta in a large old order Amish family (OOA) with type IV OI, caused by a G-to-T transversion at nucleotide 2098, which alters the gly-610 codon in the triple-helical domain of the α2(I) chain of type I collagen. Mineral and matrix properties of the long bones and vertebrae of male Col1a2+/G610C and their wild-type controls (Col1a2+/+), were characterized to gain insight into the role of α2-chain collagen mutations in mineralization. Additionally, we examined the rescuability of the composition by sclerostin inhibition initiated by crossing Col1a2+/G610C with an LRP+/A214V high bone mass allele. At age 10-days, vertebrae and tibia showed few alterations by micro-CT or Fourier transform infrared imaging (FTIRI). At 2-months-of-age, Col1a2+/G610C tibias had 13% fewer secondary trabeculae than Col1a2+/+, these were thinner (11%) and more widely spaced (20%) than those of Col1a2+/+ mice. Vertebrae of Col1a2+/G610C mice at 2-months also had lower bone volume fraction (38%), trabecular number (13%), thickness (13%) and connectivity density (32%) compared to Col1a2+/+. The cortical bone of Col1a2+/G610C tibias at 2-months had 3% higher tissue mineral density compared to Col1a2+/+; Col1a2+/G610C vertebrae had lower cortical thickness (29%), bone area (37%) and polar moment of inertia (38%) relative to Col1a2+/+. FTIRI analysis, which provides information on bone chemical composition at ~ 7 µm-spatial resolution, showed tibias at 10-days, did not differ between genotypes. Comparing identical bone types in Col1a2+/G610C to Col1a2+/+ at 2-months-of-age, tibias showed higher mineral-to-matrix ratio in trabeculae (17%) and cortices (31%). and in vertebral cortices (28%). Collagen maturity was 42% higher at 10-days-of-age in Col1a2+/G610C vertebral trabeculae and in 2-month tibial cortices (12%), vertebral trabeculae (42%) and vertebral cortices (12%). Higher acid-phosphate substitution was noted in 10-day

  11. Investigation on the IL-18 -607A/C and -137C/G on the susceptibility of ischemic stroke.

    PubMed

    Shi, Jin-He; Niu, Li-Dan; Chen, Xi-Yan; Hou, Jing-Yu; Yang, Ping; Li, Guang-Peng

    2015-01-01

    We conducted a case-control study with 322 cases and 322 controls to assess the role of the two common SNPs in the promoter of IL-18 gene. Polymerase chain reaction restriction fragment length of polymorphism (PCR-RFLP) was taken to genotype -607A/C and -137C/G in the promoter of the IL-18 gene. By comparing cases and control subjects, we found that IS cases were more likely to have higher BMI, higher proportion of hypertension, and have higher proportion of smokers and drinkers. We found that IL-18 -607CC genotype (OR=1.70, 95% CI=1.03-2.81) and C allele (OR=1.26, 95% CI=1.01-1.58) were significantly more frequent in IS patients when compared with AA genotype. We did not find significant association between IL-18 -607A/C gene polymorphism and BMI, hypertension, smoking and drinking on the risk of IS. Our study suggests that polymorphisms in IL-18 -607A/C can influence the development of IS, and this gene polymorphism is associated with risk of IS in a Chinese population.

  12. Novel compound heterozygous Thyroglobulin mutations c.745+1G>A/c.7036+2T>A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5' splice site in the exon 6.

    PubMed

    Citterio, Cintia E; Morales, Cecilia M; Bouhours-Nouet, Natacha; Machiavelli, Gloria A; Bueno, Elena; Gatelais, Frédérique; Coutant, Regis; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2015-03-15

    Several patients were identified with dyshormonogenesis caused by mutations in the thyroglobulin (TG) gene. These defects are inherited in an autosomal recessive manner and affected individuals are either homozygous or compound heterozygous for the mutations. The aim of the present study was to identify new TG mutations in a patient of Vietnamese origin affected by congenital hypothyroidism, goiter and low levels of serum TG. DNA sequencing identified the presence of compound heterozygous mutations in the TG gene: the maternal mutation consists of a novel c.745+1G>A (g.IVS6 + 1G>A), whereas the hypothetical paternal mutation consists of a novel c.7036+2T>A (g.IVS40 + 2T>A). The father was not available for segregation analysis. Ex-vivo splicing assays and subsequent RT-PCR analyses were performed on mRNA isolated from the eukaryotic-cells transfected with normal and mutant expression vectors. Minigene analysis of the c.745+1G>A mutant showed that the exon 6 is skipped during pre-mRNA splicing or partially included by use of a cryptic 5' splice site located to 55 nucleotides upstream of the authentic exon 6/intron 6 junction site. The functional analysis of c.7036+2T>A mutation showed a complete skipping of exon 40. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool NNSplice, Fsplice, SPL, SPLM and MaxEntScan programs were investigated and evaluated in relation with the experimental evidence. These analyses predicted that both mutant alleles would result in the abolition of the authentic splice donor sites. The c.745+1G>A mutation originates two putative truncated proteins of 200 and 1142 amino acids, whereas c.7036+2T>A mutation results in a putative truncated protein of 2277 amino acids. In conclusion, we show that the c.745+1G>A mutation promotes the activation of a new cryptic donor splice site in the exon 6 of the TG gene. The functional consequences of these mutations could be structural changes in the protein

  13. Reduction of Werner Syndrome Protein Enhances G:CA:T Transition by O6-Methylguanine in Human Cells.

    PubMed

    Suzuki, Tetsuya; Kuramoto, Yoshie; Kamiya, Hiroyuki

    2018-05-21

    O 6 -Methylguanine ( O 6 -MeG) is a damaged base produced by methylating reagents. The Werner syndrome protein (WRN) is a cancer-related human DNA helicase. The effects of WRN reduction on O 6 -MeG-caused mutagenesis were assessed by an siRNA-mediated knockdown in human U2OS cells, using a shuttle plasmid with a single O 6 -MeG base in the supF gene. The plasmid DNA was replicated in the cells, isolated, and electroporated into an Escherichia coli indicator strain. The lowered amount of WRN increased the frequency of mutations induced by O 6 -MeG, mainly G:CA:T substitution. The increased mutation rate suggested that the cancer-related WRN suppresses the G:CA:T substitution by O 6 -MeG in human cells.

  14. Potent and Selective Covalent Quinazoline Inhibitors of KRAS G12C

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zeng, Mei; Lu, Jia; Li, Lianbo

    Targeted covalent small molecules have shown promise for cancers driven by KRAS G12C. Allosteric compounds that access an inducible pocket formed by movement of a dynamic structural element in KRAS, switch II, have been reported, but these compounds require further optimization to enable their advancement into clinical development. We demonstrate that covalent quinazoline-based switch II pocket (SIIP) compounds effectively suppress GTP loading of KRAS G12C, MAPK phosphorylation, and the growth of cancer cells harboring G12C. Notably we find that adding an amide substituent to the quinazoline scaffold allows additional interactions with KRAS G12C, and remarkably increases the labeling efficiency, potency,more » and selectivity of KRAS G12C inhibitors. Structural studies using X-ray crystallography reveal a new conformation of SIIP and key interactions made by substituents located at the quinazoline 2-, 4-, and 7-positions. Optimized lead compounds in the quinazoline series selectively inhibit KRAS G12C-dependent signaling and cancer cell growth at sub-micromolar concentrations.« less

  15. Bone mineral properties in growing Col1a2(+/G610C) mice, an animal model of osteogenesis imperfecta.

    PubMed

    Masci, Marco; Wang, Min; Imbert, Laurianne; Barnes, Aileen M; Spevak, Lyudmila; Lukashova, Lyudmila; Huang, Yihe; Ma, Yan; Marini, Joan C; Jacobsen, Christina M; Warman, Matthew L; Boskey, Adele L

    2016-06-01

    The Col1a2(+/G610C) knock-in mouse, models osteogenesis imperfecta in a large old order Amish family (OOA) with type IV OI, caused by a G-to-T transversion at nucleotide 2098, which alters the gly-610 codon in the triple-helical domain of the α2(I) chain of type I collagen. Mineral and matrix properties of the long bones and vertebrae of male Col1a2(+/G610C) and their wild-type controls (Col1a2(+/+)), were characterized to gain insight into the role of α2-chain collagen mutations in mineralization. Additionally, we examined the rescuability of the composition by sclerostin inhibition initiated by crossing Col1a2(+/G610C) with an LRP(+/A214V) high bone mass allele. At age 10-days, vertebrae and tibia showed few alterations by micro-CT or Fourier transform infrared imaging (FTIRI). At 2-months-of-age, Col1a2(+/G610C) tibias had 13% fewer secondary trabeculae than Col1a2(+/+), these were thinner (11%) and more widely spaced (20%) than those of Col1a2(+/+) mice. Vertebrae of Col1a2(+/G610C) mice at 2-months also had lower bone volume fraction (38%), trabecular number (13%), thickness (13%) and connectivity density (32%) compared to Col1(a2+/+). The cortical bone of Col1a2(+/G610C) tibias at 2-months had 3% higher tissue mineral density compared to Col1a2(+/+); Col1a2(+/G610C) vertebrae had lower cortical thickness (29%), bone area (37%) and polar moment of inertia (38%) relative to Col1a2(+/+). FTIRI analysis, which provides information on bone chemical composition at ~7μm-spatial resolution, showed tibias at 10-days did not differ between genotypes. Comparing identical bone types in Col1a2(+/G610C) to Col1a2(+/+) at 2-months-of-age, tibias showed higher mineral-to-matrix ratio in trabeculae (17%) and cortices (31%). and in vertebral cortices (28%). Collagen maturity was 42% higher at 10-days-of-age in Col1a2(+/G610C) vertebral trabeculae and in 2-month tibial cortices (12%), vertebral trabeculae (42%) and vertebral cortices (12%). Higher acid-phosphate substitution

  16. Triple helical polynucleotidic structures: an FTIR study of the C+ .G. Ctriplet.

    PubMed

    Akhebat, A; Dagneaux, C; Liquier, J; Taillandier, E

    1992-12-01

    Triple helixes containing one homopurine poly dG or poly rG strand and two homopyrimidine poly dC or poly rC strands have been prepared and studied by FTIR spectroscopy in H2O and D2O solutions. The spectra are discussed by comparison with those of the corresponding third strands (auto associated or not) and of double stranded poly dG.poly dC and poly rG.poly rC in the same concentration range and salt conditions. The triplex formation is characterized by the study of the base-base interactions reflected by changes in the spectral domain involving the in-plane double bond vibrations of the bases. Modifications of the initial duplex conformation (A family form for poly rG.poly rC, B family form for poly dG.poly dC) when the triplex is formed have been investigated. Two spectral domains (950-800 and 1450-1350 cm-1) containing absorption bands markers of the N and S type sugar geometries have been extensively studied. The spectra of the triplexes prepared starting with a double helix containing only riboses (poly rC+.poly rG.poly rC and poly dC+.poly rG.poly rC) as well as that of poly rC+.poly dG.poly dC present exclusively markers of the North type geometry of the sugars. On the contrary in the case of the poly dC+.poly dG.poly dC triplex both N and S type sugars are shown to coexist. The FTIR spectra allow us to propose that in this case the sugars of the purine (poly dG) strand adopt the S type geometry.

  17. Bipyrimidine Signatures as a Photoprotective Genome Strategy in G + C-rich Halophilic Archaea.

    PubMed

    Jones, Daniel L; Baxter, Bonnie K

    2016-09-02

    Halophilic archaea experience high levels of ultraviolet (UV) light in their environments and demonstrate resistance to UV irradiation. DNA repair systems and carotenoids provide UV protection but do not account for the high resistance observed. Herein, we consider genomic signatures as an additional photoprotective strategy. The predominant forms of UV-induced DNA damage are cyclobutane pyrimidine dimers, most notoriously thymine dimers (T^Ts), which form at adjacent Ts. We tested whether the high G + C content seen in halophilic archaea serves a photoprotective function through limiting T nucleotides, and thus T^T lesions. However, this speculation overlooks the other bipyrimidine sequences, all of which capable of forming photolesions to varying degrees. Therefore, we designed a program to determine the frequencies of the four bipyrimidine pairs (5' to 3': TT, TC, CT, and CC) within genomes of halophilic archaea and four other randomized sample groups for comparison. The outputs for each sampled genome were weighted by the intrinsic photoreactivities of each dinucleotide pair. Statistical methods were employed to investigate intergroup differences. Our findings indicate that the UV-resistance seen in halophilic archaea can be attributed in part to a genomic strategy: high G + C content and the resulting bipyrimidine signature reduces the genomic photoreactivity.

  18. Bipyrimidine Signatures as a Photoprotective Genome Strategy in G + C-rich Halophilic Archaea

    PubMed Central

    Jones, Daniel L.; Baxter, Bonnie K.

    2016-01-01

    Halophilic archaea experience high levels of ultraviolet (UV) light in their environments and demonstrate resistance to UV irradiation. DNA repair systems and carotenoids provide UV protection but do not account for the high resistance observed. Herein, we consider genomic signatures as an additional photoprotective strategy. The predominant forms of UV-induced DNA damage are cyclobutane pyrimidine dimers, most notoriously thymine dimers (T^Ts), which form at adjacent Ts. We tested whether the high G + C content seen in halophilic archaea serves a photoprotective function through limiting T nucleotides, and thus T^T lesions. However, this speculation overlooks the other bipyrimidine sequences, all of which capable of forming photolesions to varying degrees. Therefore, we designed a program to determine the frequencies of the four bipyrimidine pairs (5’ to 3’: TT, TC, CT, and CC) within genomes of halophilic archaea and four other randomized sample groups for comparison. The outputs for each sampled genome were weighted by the intrinsic photoreactivities of each dinucleotide pair. Statistical methods were employed to investigate intergroup differences. Our findings indicate that the UV-resistance seen in halophilic archaea can be attributed in part to a genomic strategy: high G + C content and the resulting bipyrimidine signature reduces the genomic photoreactivity. PMID:27598206

  19. ANALYSIS OF POLYMORPHISMS IN THE INTERLEUKIN 18 GENE PROMOTOR (-137 G/C AND -607 C/A) IN PATIENTS INFECTED WITH HEPATITIS C VIRUS FROM THE BRAZILIAN AMAZON.

    PubMed

    Santos, Kemper Nunes dos; Almeida, Marcella Kelly Costa de; Fecury, Amanda Alves; Costa, Carlos Araújo da; Martins, Luísa Caricio

    2015-01-01

    The hepatitis C virus has been recognized as the leading cause of chronic liver disease in the world. Host genetic factors have been implicated in the persistence of hepatitis C virus infection. Single nucleotide polymorphisms at positions -607 C/A (rs1946518) and -137 G/C (rs187238) in the IL-18 gene promoter have been suggested to be associated with delayed hepatitis C virus clearance and persistence of the disease. Identify these polymorphisms in a population infected with hepatitis C virus from the Brazilian Amazon region. In a cross-sectional analytical study conducted in Belém, Pará, Brazil, 304 patients infected with hepatitis C virus were divided into two groups: group A, patients with persistent infection; group B, patients with spontaneous clearance. The control group consisted of 376 volunteers not infected with hepatitis C virus. Samples were analyzed by RT-PCR for the detection of viral RNA and by RFLP-PCR to evaluate the presence of the -137 G/C and -607 C/A IL-18 gene promoter polymorphisms. Comparison of polymorphism allele frequencies between the patient and control groups showed a higher frequency of allele C at position -607 among patients (P=0.02). When the association between the polymorphisms and viral infection was analyzed, patients carrying genotype C/A at position -607 were found to be at higher risk of persistent hepatitis C virus infection (P=0.03). The present results suggest a possible role of the -607 IL-18 gene promoter polymorphism in the pathogenesis of hepatitis C virus infection.

  20. 40 CFR Appendixes C-G to Part 80 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 16 2011-07-01 2011-07-01 false [Reserved] C Appendixes C-G to Part 80 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Appendixes C-G to Part 80 [Reserved] ...

  1. 40 CFR Appendixes C-G to Part 80 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false [Reserved] C Appendixes C-G to Part 80 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Appendixes C-G to Part 80 [Reserved] ...

  2. An assessment of the ICE6G_C(VM5a) glacial isostatic adjustment model

    NASA Astrophysics Data System (ADS)

    Purcell, A.; Tregoning, P.; Dehecq, A.

    2016-05-01

    The recent release of the next-generation global ice history model, ICE6G_C(VM5a), is likely to be of interest to a wide range of disciplines including oceanography (sea level studies), space gravity (mass balance studies), glaciology, and, of course, geodynamics (Earth rheology studies). In this paper we make an assessment of some aspects of the ICE6G_C(VM5a) model and show that the published present-day radial uplift rates are too high along the eastern side of the Antarctic Peninsula (by ˜8.6 mm/yr) and beneath the Ross Ice Shelf (by ˜5 mm/yr). Furthermore, the published spherical harmonic coefficients—which are meant to represent the dimensionless present-day changes due to glacial isostatic adjustment (GIA)—contain excessive power for degree ≥90, do not agree with physical expectations and do not represent accurately the ICE6G_C(VM5a) model. We show that the excessive power in the high-degree terms produces erroneous uplift rates when the empirical relationship of Purcell et al. (2011) is applied, but when correct Stokes coefficients are used, the empirical relationship produces excellent agreement with the fully rigorous computation of the radial velocity field, subject to the caveats first noted by Purcell et al. (2011). Using the Australian National University (ANU) groups CALSEA software package, we recompute the present-day GIA signal for the ice thickness history and Earth rheology used by Peltier et al. (2015) and provide dimensionless Stokes coefficients that can be used to correct satellite altimetry observations for GIA over oceans and by the space gravity community to separate GIA and present-day mass balance change signals. We denote the new data sets as ICE6G_ANU.

  3. Insights into the photocatalytic mechanism of mediator-free direct Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures: A hybrid density functional theory study

    NASA Astrophysics Data System (ADS)

    Opoku, Francis; Govender, Krishna Kuben; Sittert, Cornelia Gertina Catharina Elizabeth van; Govender, Penny Poomani

    2018-01-01

    Graphite-like carbon nitride (g-C3N4)-based heterostructures have received much attention due to their prominent photocatalytic activity. The g-C3N4/Bi2WO6 and g-C3N4/Bi2MoO6 heterostructures, which follow a typical hetero-junction charge transfer mechanisms show a weak potential for hydrogen evolution and reactive radical generation under visible light irradiation. A mediator-free Z-scheme g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures photocatalyst are designed for the first time using first-principles studies. Moreover, theoretical understanding of the underlying mechanism, the effects of interfacial composition and the role the interface play in the overall photoactivity is still unexplained. The calculated band gap of the heterostructures is reduced compared to the bulk Bi2WO6 and Bi2MoO6. In this study, we systematically calculated energy band structure, optical properties and charge transfer of the g-C3N4/Bi2MoO6(010) and g-C3N4/Bi2WO6(010) heterostructures using the hybrid density functional theory approach. The results show that the charge transfer at the interface of the heterostructures induces a built-in potential, which benefits the separation of photogenerated charge carriers. The g-C3N4/Bi2MoO6(010) heterostructure with more negative adhesion energy (-1.10 eVA-2) is predicted to have a better adsorptive ability and can form more easily compared to the g-C3N4/Bi2WO6(010) interface (-1.16 eVA-2). Therefore, our results show that the g-C3N4 interaction with Bi2MoO6 is stronger than Bi2WO6, which is also verified by the smaller vertical separation (3.25 Å) between Bi2MoO6 and g-C3N4 compared to the g-C3N4/Bi2WO6(010) interface (3.36 Å). The optical absorption verifies that these proposed Z-scheme heterostructures are excellent visible light harvesting semiconductor photocatalyst materials. This enhancement is ascribed to the role of g-C3N4 monolayer as an electron acceptor and the direct Z-scheme charge carrier transfer at the interface of

  4. Nuclear Proximity of Mtr4 with RNA exosome restricts DNA mutational asymmetry

    PubMed Central

    Lim, Junghyun; Giri, Pankaj Kumar; Kazadi, David; Laffleur, Brice; Zhang, Wanwei; Grinstein, Veronika; Pefanis, Evangelos; Brown, Lewis M.; Ladewig, Erik; Martin, Ophélie; Chen, Yuling; Rabadan, Raul; Boyer, François; Rothschild, Gerson; Cogné, Michel; Pinaud, Eric; Deng, Haiteng; Basu, Uttiya

    2017-01-01

    SUMMARY The distribution of sense and antisense strand DNA mutations on transcribed duplex DNA contributes to the development of immune and neural systems along with the progression of cancer. Because developmentally matured B cells undergo biologically programmed strand-specific DNA mutagenesis at focal DNA/RNA hybrid structures, they make a convenient system to investigate strand-specific mutagenesis mechanisms. We demonstrate that the sense and antisense strand DNA mutagenesis at the immunoglobulin heavy chain locus and some other regions of the B cell genome depends upon localized RNA processing protein complex formation in the nucleus. Both the physical proximity and coupled activities of RNA helicase Mtr4 (and Senataxin) with the noncoding RNA processing function of RNA exosome determine the strand specific distribution of DNA mutations. Our study suggests that strand-specific DNA mutagenesis-associated mechanisms will play major roles in other undiscovered aspects of organismic development. PMID:28431250

  5. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  6. C3G dynamically associates with nuclear speckles and regulates mRNA splicing.

    PubMed

    Shakyawar, Dhruv Kumar; Muralikrishna, Bhattiprolu; Radha, Vegesna

    2018-05-01

    C3G (Crk SH3 domain binding guanine nucleotide releasing factor) (Rap guanine nucleotide exchange factor 1), essential for mammalian embryonic development, is ubiquitously expressed and undergoes regulated nucleocytoplasmic exchange. Here we show that C3G localizes to SC35-positive nuclear speckles and regulates splicing activity. Reversible association of C3G with speckles was seen on inhibition of transcription and splicing. C3G shows partial colocalization with SC35 and is recruited to a chromatin and RNase-sensitive fraction of speckles. Its presence in speckles is dependent on intact cellular actin cytoskeleton and is lost on expression of the kinase Clk1. Rap1, a substrate of C3G, is also present in nuclear speckles, and inactivation of Rap signaling by expression of GFP-Rap1GAP alters speckle morphology and number. Enhanced association of C3G with speckles is seen on glycogen synthase kinase 3 beta inhibition or differentiation of C2C12 cells to myotubes. CRISPR/Cas9-mediated knockdown of C3G resulted in altered splicing activity of an artificial gene as well as endogenous CD44. C3G knockout clones of C2C12 as well as MDA-MB-231 cells showed reduced protein levels of several splicing factors compared with control cells. Our results identify C3G and Rap1 as novel components of nuclear speckles and a role for C3G in regulating cellular RNA splicing activity.

  7. [Gene IL6 G(-174)C and gene IL10 G(-1082)A polymorphisms are associated with unfavourable outcomes in patients with acute coronary syndrome].

    PubMed

    Blagodatskikh, K A; Evdokimova, M A; Agapkina, Iu V; Nikitin, A G; Brovkin, A N; Pushkov, A A; Blagodatskikh, E G; Kudriasheva, O Iu; Osmolovskaia, V S; Minushkina, L O; Kochkina, M S; Selezneva, N D; Dankovtseva, E N; Chumakova, O S; Baklanova, T N; Talyzin, P A; Reznichenko, N E; Donetskaia, O P; Tereshchenko, S N; Krasil'nikova, E S; Dzhaiani, N A; Akatova, E V; Glezer, M G; Galiavich, A S; Zakirova, V B; Kaziolova, N A; Timofeeva, I V; Iagoda, A V; Boeva, O I; Katel'nitskaia, L I; Khorolets, E V; Shlyk, S V; Volkova, É G; Margarian, M P; Guz', O I; Konstantinov, V O; Timofeeva, N V; Sidorenko, B A; Zateĭshchikov, D A; Nosikov, V V

    2010-01-01

    We investigated the association of gene IL6 G(-174)C polymorphism and gene IL10 G(-1082)A polymorphism with coronary artery disease (CAD) in the Russian population. A total of 1145 patients with CAD diagnose on the basis of clinical studies in cardiological hospitals of Moscow, St -Petersburg, Kazan, Chelyabinsk, Perm, Stavropol and Rostov-on-Don. Supervision term was 9.10 +/- 5.03 months (the maximum term 18 months). In case of gene IL10 G(-1082)A polymorphism we determined that patients with CAD diagnose and A alleles gene IL10 had unfavorable outcome more often than patients with homozygous G alleles. Survival time from end point from carrier genotype GA and AA is 11.68 +/- 0.67 months against 12.69 +/- 0.65 months from carrier phenotype GG gene IL10 (chi2 = 4.13, p = 0.042). The group studied do not differ significantly with respect to the distributions of gene IL6 G(-174)C alleles and genotypes. However in case combined group studies of gene IL10 G(-1082)A polymorphism and IL6 G(-174)C polymorphism we determined that patients with CAD diagnose and carrier genotype GG gene IL6 and genotype GA and AA gene IL10 had unfavorable outcome more often (survival time 11.01 +/- 1.24 months) than patients with genotype CC and CG gene IL6 and genotype GG gene IL10 (survival time 13.28 +/- 0.83 months) chi2 = 10.23, p = 0.017. The obtained data allows assuming the important role of the IL6 and IL10 genes which are responsible for functioning of inflammation system, in the accelerated formation of failures at the patients who had a coronary syndrome.

  8. Target guided synthesis using DNA nano-templates for selectively assembling a G-quadruplex binding c-MYC inhibitor

    NASA Astrophysics Data System (ADS)

    Panda, Deepanjan; Saha, Puja; Das, Tania; Dash, Jyotirmayee

    2017-07-01

    The development of small molecules is essential to modulate the cellular functions of biological targets in living system. Target Guided Synthesis (TGS) approaches have been used for the identification of potent small molecules for biological targets. We herein demonstrate an innovative example of TGS using DNA nano-templates that promote Huisgen cycloaddition from an array of azide and alkyne fragments. A G-quadruplex and a control duplex DNA nano-template have been prepared by assembling the DNA structures on gold-coated magnetic nanoparticles. The DNA nano-templates facilitate the regioselective formation of 1,4-substituted triazole products, which are easily isolated by magnetic decantation. The G-quadruplex nano-template can be easily recovered and reused for five reaction cycles. The major triazole product, generated by the G-quadruplex inhibits c-MYC expression by directly targeting the c-MYC promoter G-quadruplex. This work highlights that the nano-TGS approach may serve as a valuable strategy to generate target-selective ligands for drug discovery.

  9. Study of Infrared Emission Spectroscopy for the B1Δg-A1Πu and B'1Σg+-A1Πu Systems of C2

    NASA Astrophysics Data System (ADS)

    Tang, Jian; Chen, Wang; Kawaguchi, Kentarou; Bernath, Peter F.

    2016-06-01

    Recently, we carried out the perturbation analysis of C_2 spectra and identified forbidden singlet-triplet intersystem transitions, which aroused further interest in other C_2 spectra for the many low-lying electronic states of this fundamental molecule. In 1988, the B1Δg-A1Πu and B'1Σg+-A1Πu band systems were discovered by Douay et al., who observed eight bands of the B1Δg-A1Πu system with v up to 5 for the B1Δg state and six bands of the B'1Σg+-A1Πu system with v up to 3 for the B'1Σg+ state in the Fourier transform infrared emission spectra of hydrocarbon discharges. In the work presented here, we identified twenty-four bands of the two systems, among which the B'1Σg+ v = 4 and the B1Δg v = 6, 7 and 8 vibrational levels involved in nine bands were studied for the first time. A direct global analysis with Dunham parameters was carried out satisfactorily for the B1Δg-A1Πu system except for a small perturbation in the B1Δg v = 6 level. The calculated rovibrational term energies up to B1Δg v = 12 showed that the level crossing between the B1Δg and d3Πg states is responsible for many of the prominent perturbations in the Swan system observed previously. Nineteen lines of the B1Δg-a3Πu forbidden transitions were identified and the off-diagonal spin-orbit interaction constant AdB between d3Πg and B1Δg was derived as 8.3(1) wn. For the B'1Σg+-A1Πu system, only individual band analyses for each vibrational level in the B'1Σg+ state could be done satisfactorily and Dunham parameters obtained from these effective parameters showed that the anharmonic vibrational constant ω_e x_e is anomalously small (nearly zero). Inspection of the RKR potential curves for the B'1Σg+ and X1Σg+ states revealed that an avoided crossing may occur around 30000 wn, which is responsible for the anomalous molecular constants in these two states. W. Chen, K. Kawaguchi, P. F. Bernath, and J. Tang, J. Chem. Phys., 141, 064317 (2015) M. Douay, R. Nietmann and P. F. Bernath

  10. The MLH1 c.-27C>A and c.85G>T variants are linked to dominantly inherited MLH1 epimutation and are borne on a European ancestral haplotype.

    PubMed

    Kwok, Chau-To; Vogelaar, Ingrid P; van Zelst-Stams, Wendy A; Mensenkamp, Arjen R; Ligtenberg, Marjolijn J; Rapkins, Robert W; Ward, Robyn L; Chun, Nicolette; Ford, James M; Ladabaum, Uri; McKinnon, Wendy C; Greenblatt, Marc S; Hitchins, Megan P

    2014-05-01

    Germline mutations of the DNA mismatch repair genes MLH1, MSH2, MSH6 or PMS2, and deletions affecting the EPCAM gene adjacent to MSH2, underlie Lynch syndrome by predisposing to early-onset colorectal, endometrial and other cancers. An alternative but rare cause of Lynch syndrome is constitutional epimutation of MLH1, whereby promoter methylation and transcriptional silencing of one allele occurs throughout normal tissues. A dominantly transmitted constitutional MLH1 epimutation has been linked to an MLH1 haplotype bearing two single-nucleotide variants, NM_000249.2: c.-27C>A and c.85G>T, in a Caucasian family with Lynch syndrome from Western Australia. Subsequently, a second seemingly unrelated Caucasian Australian case with the same MLH1 haplotype and concomitant epimutation was reported. We now describe three additional, ostensibly unrelated, cancer-affected families of European heritage with this MLH1 haplotype in association with constitutional epimutation, bringing the number of index cases reported to five. Array-based genotyping in four of these families revealed shared haplotypes between individual families that extended across ≤2.6-≤6.4 megabase regions of chromosome 3p, indicating common ancestry. A minimal ≤2.6 megabase founder haplotype common to all four families was identified, which encompassed MLH1 and additional flanking genes and segregated with the MLH1 epimutation in each family. Our findings indicate that the MLH1 c.-27C>A and c.85G>T variants are borne on a European ancestral haplotype and provide conclusive evidence for its pathogenicity via a mechanism of epigenetic silencing of MLH1 within normal tissues. Additional descendants bearing this founder haplotype may exist who are also at high risk of developing Lynch syndrome-related cancers.

  11. Milder clinical and biochemical phenotypes associated with the c.482G>A (p.Arg161Gln) pathogenic variant in cobalamin C disease: Implications for management and screening.

    PubMed

    Almannai, Mohammed; Marom, Ronit; Divin, Kristian; Scaglia, Fernando; Sutton, V Reid; Craigen, William J; Lee, Brendan; Burrage, Lindsay C; Graham, Brett H

    2017-09-01

    Cobalamin C disease is a multisystemic disease with variable manifestations and age of onset. Genotype-phenotype correlations are well-recognized in this disorder. Here, we present a large cohort of individuals with cobalamin C disease, several of whom are heterozygous for the c.482G>A pathogenic variant (p.Arg161Gln). We compared clinical characteristics of individuals with this pathogenic variant to those who do not have this variant. To our knowledge, this study represents the largest single cohort of individuals with the c.482G>A (p.Arg161Gln) pathogenic variant. A retrospective chart review of 27 individuals from 21 families with cobalamin C disease who are followed at our facility was conducted. 13 individuals (48%) are compound heterozygous with the c.482G>A (p.Arg161Gln) on one allele and a second pathogenic variant on the other allele. Individuals with the c.482G>A (p.Arg161Gln) pathogenic variant had later onset of symptoms and easier metabolic control. Moreover, they had milder biochemical abnormalities at presentation which likely contributed to the observation that 4 individuals (31%) in this group were missed by newborn screening. The c.482G>A (p.Arg161Gln) pathogenic variant is associated with milder disease. These individuals may not receive a timely diagnosis as they may not be identified on newborn screening or because of unrecognized, late onset symptoms. Despite the milder presentation, significant complications can occur, especially if treatment is delayed. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Isoelectric point and adsorption activity of porous g-C3N4

    NASA Astrophysics Data System (ADS)

    Zhu, Bicheng; Xia, Pengfei; Ho, Wingkei; Yu, Jiaguo

    2015-07-01

    The isoelectric point (IEP) is an important physicochemical parameter of many compounds, such as oxides, hydroxides, and nitrides, and can contribute to estimation of the surface charges of compound particles at various pH conditions. In this work, three types of graphitic carbon nitrides (g-C3N4) were synthesized by directly heating melamine, thiourea, and urea. The prepared samples showed different microstructures and IEPs that influenced their adsorption activity. Differences in microstructure resulted from the various precursors used during synthesis. The IEPs of the obtained g-C3N4 were measured to be approximately 4-5, which is due to the equilibrium of chemical reactions between hydrogen ions, hydroxyl ions, and amine groups on the g-C3N4 surface. The IEP of g-C3N4 prepared from thiourea was lower than those of the corresponding samples prepared from melamine and urea. The adsorption activity of methylene blue on g-C3N4 prepared from urea and thiourea was excellent, which indicates that g-C3N4 is a promising adsorbent. This work provides a useful reference for choosing precursors with which to prepare g-C3N4 and combining g-C3N4 with other compounds in solution.

  13. Personalized Nutrition-Genes, Diet, and Related Interactive Parameters as Predictors of Cancer in Multiethnic Colorectal Cancer Families.

    PubMed

    Shiao, S Pamela K; Grayson, James; Lie, Amanda; Yu, Chong Ho

    2018-06-20

    To personalize nutrition, the purpose of this study was to examine five key genes in the folate metabolism pathway, and dietary parameters and related interactive parameters as predictors of colorectal cancer (CRC) by measuring the healthy eating index (HEI) in multiethnic families. The five genes included methylenetetrahydrofolate reductase ( MTHFR ) 677 and 1298, methionine synthase ( MTR ) 2756, methionine synthase reductase ( MTRR 66), and dihydrofolate reductase ( DHFR ) 19bp , and they were used to compute a total gene mutation score. We included 53 families, 53 CRC patients and 53 paired family friend members of diverse population groups in Southern California. We measured multidimensional data using the ensemble bootstrap forest method to identify variables of importance within domains of genetic, demographic, and dietary parameters to achieve dimension reduction. We then constructed predictive generalized regression (GR) modeling with a supervised machine learning validation procedure with the target variable (cancer status) being specified to validate the results to allow enhanced prediction and reproducibility. The results showed that the CRC group had increased total gene mutation scores compared to the family members ( p < 0.05). Using the Akaike's information criterion and Leave-One-Out cross validation GR methods, the HEI was interactive with thiamine (vitamin B1), which is a new finding for the literature. The natural food sources for thiamine include whole grains, legumes, and some meats and fish which HEI scoring included as part of healthy portions (versus limiting portions on salt, saturated fat and empty calories). Additional predictors included age, as well as gender and the interaction of MTHFR 677 with overweight status (measured by body mass index) in predicting CRC, with the cancer group having more men and overweight cases. The HEI score was significant when split at the median score of 77 into greater or less scores, confirmed through

  14. Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek women.

    PubMed

    Chatzidimitriou, M; Chatzidimitriou, D; Mavridou, M; Anetakis, C; Chatzopoulou, F; Lialiaris, T; Mitka, S

    2017-12-01

    Recurrent pregnancy loss (RPL) is a multifactorial disorder. The aim of this study was the detection of various genetic polymorphisms and their correlation to RPL, in Greek women. The impact of 12 thrombophilic polymorphisms was evaluated, among 48 Greek women with a history of RPL, vs 27 healthy parous women. Multiplex PCR and in situ hybridization on nitrocellulose films were performed, to investigate 12 genetic polymorphisms previously reported as risk factors for RPL. Heterozygous FV Leiden, homozygous PAI-1 4G/4G, heterozygous MTHFR C677T, homozygous MTHFR A1298C, as much as the combined thrombophilic genotypes MTHFR 677T + ACE Ι/D, MTHFR 677T/1298C + ACE D/D, ACE I/D + b-fibrinogen -455 G/A, FV HR2 + b-fibrinogen -455 G/A showed a correlation as risk factors for RPL, whereas the rest of the investigated polymorphisms and their combinations did not render statistically significant differences between the two groups in study. The results of this study, as well as those of similar studies, concerning the detection of genetic, environmental, and physiological factors underlying RPL, will prove of critical significance in the investigation and treatment of thrombophilic predisposition, in cases of RPL. © 2017 John Wiley & Sons Ltd.

  15. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  16. Characterization of the c.(-203)A>G variant in the glucocerebrosidase gene and its association with phenotype in Gaucher disease.

    PubMed

    Alfonso, Pilar; Pampín, Sandra; García-Rodríguez, Beatriz; Tejedor, Teresa; Domínguez, Carmen; Rodríguez-Rey, Jose C; Giraldo, Pilar; Pocoví, Miguel

    2011-01-30

    Gaucher disease (GD) is a rare autosomal recessive disorder caused mainly by mutations in the glucocerebrosidase (GBA) gene. Great phenotypic variability has been observed among patients with the same genotype, suggesting other factors, such as polymorphic variants, might influence GD phenotypes. We previously reported the c.(-203)A>G (g.1256A>G) variant in exon 1 of the GBA gene in Spanish GD patients. We analyzed the frequency and transcriptional activity of the promoter carrying the G-allele using restriction isotyping, electrophoretic mobility shift assay, cell culture, transfection, and luciferase assays. We found the variant is present at a similar frequency to the control group. In our patients, the G-allele was always found in combination with another mutation in the same allele, and patients carrying the c.(-203)A>G variant showed a more severe GD phenotype. The promoter containing the G-allele showed a 35% reduction in promoter activity when transfected into HepG2 cells. The c.(-203)A>G variant seems to be a polymorphism resulting in a decrease in activity of the GBA promoter. The change, per se, is not enough to elicit a GD phenotype, but it may produce a more severe phenotype in GD patients when combined with an already defective GBA protein. Copyright © 2010 Elsevier B.V. All rights reserved.

  17. Different Dynamics for IgG and IgA Memory B Cells in Adolescents following a Meningococcal Serogroup C Tetanus Toxoid Conjugate Booster Vaccination Nine Years after Priming: A Role for Priming Age?

    PubMed Central

    Stoof, Susanne P.; Buisman, Anne-Marie; van Rooijen, Debbie M.; Boonacker, Rianne; van der Klis, Fiona R. M.; Sanders, Elisabeth A. M.; Berbers, Guy A. M.

    2015-01-01

    Background Antibody levels wane rapidly after Meningococcal serogroup C conjugate (MenCC) vaccination in young children, rendering the need for an adolescent booster dose. It is not clear whether circulating memory B cells are associated with persistence of MenC-specific antibody levels. Methods Measurement of MenC-specific IgG and IgA memory B cells and levels of serum and salivary MenC-specific IgG and IgA in healthy 10-, 12- and 15-year-olds prior to and one month and one year after a MenCC booster vaccination. All participants had received a primary MenCC vaccination nine years earlier. Results The number of circulating MenC-specific IgG memory B cells prior to booster was low and not predictive for MenC-specific IgG responses in serum or saliva post-booster, whereas the number of MenC-specific IgA memory B cells pre-booster positively correlated with MenC-specific IgA levels in saliva post-booster (R = 0.5, P<0.05). The booster induced a clear increase in the number of MenC-specific IgG and IgA memory B cells. The number of MenC-PS-specific IgG memory B cells at 1 month post-booster was highest in the 12-year-olds. The number of MenC-specific memory B cells at one month post-booster showed no correlation with the rate of MenC-specific antibody decay throughout the first year post-booster. Conclusions Circulating MenC-specific IgA memory B cells correlate with IgA responses in saliva, whereas circulating MenC-specific IgG memory B cells are not predictive for MenC-specific IgG responses in serum or saliva. Our results are suggestive for age-dependent differences in pre-existing memory against MenC. PMID:26458006

  18. Different Dynamics for IgG and IgA Memory B Cells in Adolescents following a Meningococcal Serogroup C Tetanus Toxoid Conjugate Booster Vaccination Nine Years after Priming: A Role for Priming Age?

    PubMed

    Stoof, Susanne P; Buisman, Anne-Marie; van Rooijen, Debbie M; Boonacker, Rianne; van der Klis, Fiona R M; Sanders, Elisabeth A M; Berbers, Guy A M

    2015-01-01

    Antibody levels wane rapidly after Meningococcal serogroup C conjugate (MenCC) vaccination in young children, rendering the need for an adolescent booster dose. It is not clear whether circulating memory B cells are associated with persistence of MenC-specific antibody levels. Measurement of MenC-specific IgG and IgA memory B cells and levels of serum and salivary MenC-specific IgG and IgA in healthy 10-, 12- and 15-year-olds prior to and one month and one year after a MenCC booster vaccination. All participants had received a primary MenCC vaccination nine years earlier. The number of circulating MenC-specific IgG memory B cells prior to booster was low and not predictive for MenC-specific IgG responses in serum or saliva post-booster, whereas the number of MenC-specific IgA memory B cells pre-booster positively correlated with MenC-specific IgA levels in saliva post-booster (R = 0.5, P<0.05). The booster induced a clear increase in the number of MenC-specific IgG and IgA memory B cells. The number of MenC-PS-specific IgG memory B cells at 1 month post-booster was highest in the 12-year-olds. The number of MenC-specific memory B cells at one month post-booster showed no correlation with the rate of MenC-specific antibody decay throughout the first year post-booster. Circulating MenC-specific IgA memory B cells correlate with IgA responses in saliva, whereas circulating MenC-specific IgG memory B cells are not predictive for MenC-specific IgG responses in serum or saliva. Our results are suggestive for age-dependent differences in pre-existing memory against MenC.

  19. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

  20. Graphitic Carbon Nitride (g-C3N4)-Based Photocatalysts for Artificial Photosynthesis and Environmental Remediation: Are We a Step Closer To Achieving Sustainability?

    PubMed

    Ong, Wee-Jun; Tan, Lling-Lling; Ng, Yun Hau; Yong, Siek-Ting; Chai, Siang-Piao

    2016-06-22

    As a fascinating conjugated polymer, graphitic carbon nitride (g-C3N4) has become a new research hotspot and drawn broad interdisciplinary attention as a metal-free and visible-light-responsive photocatalyst in the arena of solar energy conversion and environmental remediation. This is due to its appealing electronic band structure, high physicochemical stability, and "earth-abundant" nature. This critical review summarizes a panorama of the latest progress related to the design and construction of pristine g-C3N4 and g-C3N4-based nanocomposites, including (1) nanoarchitecture design of bare g-C3N4, such as hard and soft templating approaches, supramolecular preorganization assembly, exfoliation, and template-free synthesis routes, (2) functionalization of g-C3N4 at an atomic level (elemental doping) and molecular level (copolymerization), and (3) modification of g-C3N4 with well-matched energy levels of another semiconductor or a metal as a cocatalyst to form heterojunction nanostructures. The construction and characteristics of each classification of the heterojunction system will be critically reviewed, namely metal-g-C3N4, semiconductor-g-C3N4, isotype g-C3N4/g-C3N4, graphitic carbon-g-C3N4, conducting polymer-g-C3N4, sensitizer-g-C3N4, and multicomponent heterojunctions. The band structures, electronic properties, optical absorption, and interfacial charge transfer of g-C3N4-based heterostructured nanohybrids will also be theoretically discussed based on the first-principles density functional theory (DFT) calculations to provide insightful outlooks on the charge carrier dynamics. Apart from that, the advancement of the versatile photoredox applications toward artificial photosynthesis (water splitting and photofixation of CO2), environmental decontamination, and bacteria disinfection will be presented in detail. Last but not least, this comprehensive review will conclude with a summary and some invigorating perspectives on the challenges and future directions

  1. The -765G>C polymorphism in the cyclooxygenase-2 gene and digestive system cancer: a meta-analysis.

    PubMed

    Zhao, Fen; Cao, Yue; Zhu, Hong; Huang, Min; Yi, Cheng; Huang, Ying

    2014-01-01

    Published data regarding associations between the -765G>C polymorphism in cyclooxygenase-2 (COX-2) gene and digestive system cancer risk have been inconclusive. The aim of this study was to comprehensively evaluate the genetic risk of the -765G>C polymorphism in the COX-2 gene for digestive system cancer. A search was performed in Pubmed, Medline (Ovid), Embase, CNKI, Weipu, Wanfang and CBM databases, covering all studies until Feb 10, 2014. Statistical analysis was performed using Revman5.2. A total of 10,814 cases and 16,174 controls in 38 case-control studies were included in this meta-analysis. The results indicated that C allele carriers (GC+CC) had a 20% increased risk of digestive system cancer when compared with the homozygote GG (odds ratio (OR)=1.20, 95% confidence interval (CI), 1.00-1.44 for GC+CC vs GG). In the subgroup analysis by ethnicity, significant elevated risks were associated with C allele carriers (GC+CC) in Asians (OR = 1.46, 95% CI=1.07-2.01, and p=0.02) and Africans (OR=2.12, 95% CI=1.57-2.87, and p< 0.00001), but not among Caucasians, Americans and mixed groups. For subgroup analysis by cancer type (GC+CC vs GG), significant associations were found between the -765G>C polymorphism and higher risk for gastric cancer (OR=1.64, 95% CI=1.03-2.61, and p=0.04), but not for colorectal cancer, oral cancer, esophageal cancer, and others. Regarding study design (GC+CC vs GG), no significant associations were found in then population-based case-control (PCC), hospital-based case-control (HCC) and family-based case-control (FCC) studies. This meta-analysis suggested that the -765G>C polymorphism of the COX-2 gene is a potential risk factor for digestive system cancer in Asians and Africans and gastric cancer overall.

  2. Metabolism of 5-methylthioribose to methionine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyazaki, J.H.; Yang, S.F.

    1987-06-01

    During ethylene biosynthesis, the H/sub 3/CS-group of S-adenosylmethionine is released as 5'-methylthioadenosine, which is recycled to methionine via 5-methylthioribose (MTR). In mungbean hypocotyls and cell-free extracts of avocado, (/sup 14/C)MTR was converted into labeled methionine via 2-keto-4-methylthiobutyric acid (KMB) and 2-hydroxy-4-methylthiobutyric acid (HMB), as intermediates. Incubation of (ribose-U-/sup 14/C)MTR with avocado extract resulted in the production of (/sup 14/C)formate, indicating the conversion of MTR to KMB involves a loss of formate, presumably from C-1 of MTR. Tracer studies showed that KMB was converted readily in vivo and in vitro to methionine, while HMB was converted much more slowly. The conversionmore » of KMB to methionine by dialyzed avocado extract requires an amino donor. Among several potential donors examined, L-glutamine was the most efficient. Anaerobiosis inhibited only partially the oxidation of MTR to formate, KMB/HMB, and methionine by avocado extract. The role of O/sub 2/ in the conversion of MTR to methionine is discussed.« less

  3. TiO{sub 2} nanobelts with a uniform coating of g-C{sub 3}N{sub 4} as a highly effective heterostructure for enhanced photocatalytic activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhong, Xing; Jin, Meimei; Dong, Huaqing

    2014-12-15

    A novel g-C{sub 3}N{sub 4}/TiO{sub 2} nanobelt (NB) heterostructure was successfully designed and prepared. The as-prepared g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructure exhibited high photocatalytic activity not only in the photodegradation of Rhodamine B (RhB) but also in photocatalytic H{sub 2} production. The g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructure with a mass ratio of 1:1 demonstrated the best performance in the photodegradation of RhB, whereas a mass ratio of 3:1 demonstrated the highest H{sub 2} production rate of 46.6 μmol h{sup −1} in photocatalytic H{sub 2} production. We conclude that the synergistic effect between g-C{sub 3}N{sub 4} and TiO{sub 2}more » NBs promotes the photogenerated carrier separation in space. This valuable insight into the rational architectural design of nanostructure-based photocatalysts is expected to shed light on other photocatalytic reaction systems in the future. - Graphical abstract: A novel strategy to fabricate the g-C{sub 3}N{sub 4}/TiO{sub 2} nanobelt (NB) heterostructures was reported. The g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructures exhibited highly effective photocatalytic activities for photodegradation of Rhodamine B and H{sub 2} production. - Highlights: • A novel strategy to fabricate the g-C{sub 3}N{sub 4}/TiO{sub 2} NB heterostructures was reported. • The heterostructure exhibited high catalytic activity in photodegradation of RhB. • The heterostructure showed good H{sub 2} productivity in photocatalytic water splitting. • The synergistic effect between g-C{sub 3}N{sub 4} and TiO{sub 2} NBs are important. • This study shows that the heterostructure can be an effective photocatalyst.« less

  4. Crambescin C1 Exerts a Cytoprotective Effect on HepG2 Cells through Metallothionein Induction

    PubMed Central

    Roel, María; Rubiolo, Juan A.; Ternon, Eva; Thomas, Olivier P.; Vieytes, Mercedes R.; Botana, Luis M.

    2015-01-01

    The Mediterranean marine sponge Crambe crambe is the source of two families of guanidine alkaloids known as crambescins and crambescidins. Some of the biological effects of crambescidins have been previously reported while crambescins have undergone little study. Taking this into account, we performed comparative transcriptome analysis to examine the effect of crambescin-C1 (CC1) on human tumor hepatocarcinoma cells HepG2 followed by validation experiments to confirm its predicted biological activities. We report herein that, while crambescin-A1 has a minor effect on these cells, CC1 protects them against oxidative injury by means of metallothionein induction even at low concentrations. Additionally, at high doses, CC1 arrests the HepG2 cell cycle in G0/G1 and thus inhibits tumor cell proliferation. The findings presented here provide the first detailed approach regarding the different effects of crambescins on tumor cells and provide a basis for future studies on other possible cellular mechanisms related to these bioactivities. PMID:26225985

  5. Unanticipated error in HbA(1c) measurement on the HLC-723 G7 analyzer.

    PubMed

    van den Ouweland, Johannes M W; de Keijzer, Marinus H; van Daal, Henny

    2010-04-01

    Investigation of falsely elevated HbA(1c) measurements on the HLC-723 G7 analyser. Comparison of HbA(1c) in blood samples that were diluted either in hemolysis reagent or water. HbA(1c) results became falsely elevated when samples were diluted in hemolysis reagent, but not in water. QC-procedures failed to detect this error as calibrator and QC samples were manually diluted in water, according to manufacturer's instructions, whereas patient samples were automatically diluted using hemolysing reagent. After replacement of the instruments' sample-loop and rotor seal comparable HbA(1c) results were obtained, irrespective of dilution with hemolysing reagent or water. This case illustrates the importance of treating calibrator and QC materials similar to routine patient samples in order to prevent unnoticed drift in patient HbA(1c) results. Copyright 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  6. Thymidylate synthase and methionine synthase polymorphisms are not associated with susceptibility to childhood acute lymphoblastic leukemia in Kurdish population from Western Iran.

    PubMed

    Rahimi, Zohreh; Ahmadian, Zainab; Akramipour, Reza; Vaisi-Raygani, Asad; Rahimi, Ziba; Parsian, Abbas

    2012-03-01

    In order to determine the influence of polymorphism in thymidylate synthase (TS 28-bp repeat) and methionine synthase (MS A2756G) genes on the susceptibility to acute lymphoblastic leukemia (ALL), 73 children with ALL and 128 age and sex matched unrelated healthy individuals from the Kermanshah Province of Iran were screened. The genotyping of TS 28-bp repeat and MS A2756G polymorphisms were performed by polymerase chain reaction (PCR) and PCR-RFLP, respectively. The frequency of TS 2R allele in patients and controls were 41.5 and 38%, respectively (Odds ratios (OR) = 1.13, 95%CI 0.73-1.74, P = 0.56). The allelic frequency of G allele of MS was higher (25%) in patients compared with healthy subjects (23%) (OR = 1.09, 95%CI 0.67-1.75, P = 0.71). Considering MS AA and TS 3R3R genotypes as reference indicated that individuals with MS GG + TS 2R2R genotypes have 1.3-fold increase in the risk of ALL (OR = 1.3, 95%CI 0.6-2.7, P = 0.5). Our results showed that neither TS 28-bp repeat nor MS A2756G polymorphisms are risk factors for susceptibility to ALL in Western Iran.

  7. Mucin-like Region of Herpes Simplex Virus Type 1 Attachment Protein Glycoprotein C (gC) Modulates the Virus-Glycosaminoglycan Interaction*

    PubMed Central

    Altgärde, Noomi; Eriksson, Charlotta; Peerboom, Nadia; Phan-Xuan, Tuan; Moeller, Stephanie; Schnabelrauch, Matthias; Svedhem, Sofia; Trybala, Edward; Bergström, Tomas; Bally, Marta

    2015-01-01

    Glycoprotein C (gC) mediates the attachment of HSV-1 to susceptible host cells by interacting with glycosaminoglycans (GAGs) on the cell surface. gC contains a mucin-like region located near the GAG-binding site, which may affect the binding activity. Here, we address this issue by studying a HSV-1 mutant lacking the mucin-like domain in gC and the corresponding purified mutant protein (gCΔmuc) in cell culture and GAG-binding assays, respectively. The mutant virus exhibited two functional alterations as compared with native HSV-1 (i.e. decreased sensitivity to GAG-based inhibitors of virus attachment to cells and reduced release of viral particles from the surface of infected cells). Kinetic and equilibrium binding characteristics of purified gC were assessed using surface plasmon resonance-based sensing together with a surface platform consisting of end-on immobilized GAGs. Both native gC and gCΔmuc bound via the expected binding region to chondroitin sulfate and sulfated hyaluronan but not to the non-sulfated hyaluronan, confirming binding specificity. In contrast to native gC, gCΔmuc exhibited a decreased affinity for GAGs and a slower dissociation, indicating that once formed, the gCΔmuc-GAG complex is more stable. It was also found that a larger number of gCΔmuc bound to a single GAG chain, compared with native gC. Taken together, our data suggest that the mucin-like region of HSV-1 gC is involved in the modulation of the GAG-binding activity, a feature of importance both for unrestricted virus entry into the cells and release of newly produced viral particles from infected cells. PMID:26160171

  8. Persulfate enhanced photocatalytic degradation of bisphenol A by g-C3N4 nanosheets under visible light irradiation.

    PubMed

    Liu, Bochuan; Qiao, Meng; Wang, Yanbin; Wang, Lijuan; Gong, Yan; Guo, Tao; Zhao, Xu

    2017-12-01

    The enhancement of g-C 3 N 4 photocatalytic degradation of bisphenol A (BPA) via persulfate (PS) addition was investigated under visible light irradiation. The effects of various parameters on the BPA degradation were investigated, such as catalysts dosage, PS concentrations, initial pH value and BPA concentration. The results showed that g-C 3 N 4 nanosheets exhibited superior photocatalytic activity toward BPA degradation as compared with bulk g-C 3 N 4 . The addition of PS can further improve the g-C 3 N 4 photocatalytic performance for BPA degradation. With 5 mM PS, the degradation rate of BPA was increased from 72.5% to 100% at 90 min, and the corresponding first-order kinetic constants were increased from 0.0028 to 0.0140 min -1 . The removal efficiency of BPA increased with the decrease of solution pH value. The active radicals in the reaction system were tested by electron spin resonance (ESR) and radicals quenching experiments. Instead of persulfate radicals' oxidation, it was proposed that the main active radicals for BPA degradation were superoxide radicals and the photogenerated holes. Copyright © 2017. Published by Elsevier Ltd.

  9. Laboratory Observation of the Rotational Spectrum of a Potential Interstellar Sugar, Erythrose

    NASA Astrophysics Data System (ADS)

    Pena, I.; Cabezas, C.; Daly, A. M.; Mata, S.; Alonso, J. L.

    2013-06-01

    The rotational spectrum of erythrose has been recorded in the frequency region 6 -- 12 GHz using a chirped-pulse Fourier transform microwave spectrometer (CP-FTMW) combined with a laser ablation (LA) source. The investigation of rotational spectra of erythrose is of astrophysical and biological relevance. However, no gas-phase data were available on erythrose. It is syrup at room temperature and vaporization using conventional methods leads to decomposition. A non convetional laser ablation method has been successfully used to vaporize erythrose and two cyclic forms have been observed using rotational spectroscopy. α-erythrose has been found to have rotational constants are A = 2586.8998 (21) MHz, B = 2353.0837 (41) MHz and C = 1773.2378 (18) MHz and β-erythrose is characterized with rotational constants A = 3109.2005 (46) MHz, B = 1856.1298 (15) MHz, C = 1616.5557 (18) MHz. G. G. Brown, B. C. Dian, K. O. Douglass, S. M. Geyer, S. T. Shipman, B. H. Pate, Rev. Sci. Instrum. 2008, 79, 053103. S. Mata, I. Peña, C. Cabezas, J. C. López, J. L. Alonso, J. Mol. Spectrosc. 2012, 280, 91.

  10. 5,10-Methylenetetrahydrofolate reductase polymorphisms and acute lymphoblastic leukemia risk: a meta-analysis.

    PubMed

    Pereira, Tiago Veiga; Rudnicki, Martina; Pereira, Alexandre Costa; Pombo-de-Oliveira, Maria S; Franco, Rendrik França

    2006-10-01

    There is evidence supporting a role for 5-10 methylenetetrahydrofolate reductase (MTHFR) gene variants in acute lymphoblastic leukemia (ALL). To provide a more robust estimate of the effect of MTHFR polymorphisms on the risk of ALL, we did a meta-analysis to reevaluate the association between the two most commonly studied MTHFR polymorphisms (C677T and A1298C) and ALL risk. All case-control studies investigating an association between the C677T or A1298C polymorphisms and risk of ALL were included. We applied both fixed-effects and random-effects models to combine odds ratio (OR) and 95% confidence intervals (95% CI). Q-statistic was used to evaluate the homogeneity and both Egger and Begg-Mazumdar tests were used to assess publication bias. The meta-analysis of the C677T polymorphism and risk of childhood ALL included 13 studies with a total of 4,894 individuals. Under a fixed-effects model, the TT genotype failed to be associated with a statistically significant reduction of childhood ALL risk (TT versus CT + CC: OR, 0.88; 95% CI, 0.73-1.06; P = 0.18). However, individuals homozygous for the 677T allele exhibited a 2.2-fold decrease in risk of adult ALL (TT versus CT + CC: OR, 0.45; 95% CI, 0.26-0.77; P = 0.004). In both cases, no evidence of heterogeneity was observed. No association between the A1298C variant and susceptibility to both adult and childhood ALL was disclosed. Our findings support the proposal that the common genetic C677T polymorphism in the MTHFR contributes to the risk of adult ALL, but not to the childhood ALL susceptibility.

  11. Association of FAS-670A/G and FASL-844C/T polymorphisms with idiopathic azoospermia in Western Iran.

    PubMed

    Asgari, Rezvan; Mansouri, Kamran; Bakhtiari, Mitra; Bidmeshkipour, Ali; Yari, Kheirollah; Shaveisi-Zadeh, Farhad; Vaisi-Raygani, Asad

    2017-11-01

    The FAS/FASL interaction plays a central role in up-regulation of apoptosis in testis. Studies indicated that the FAS-670A/G and FASL-844C/T polymorphisms are associated with the risk of idiopathic azoospermia in different ethnic groups. Therefore, the current study aims to investigate the association between FAS-670A/G and FASL-844C/T polymorphisms with male idiopathic infertility in Western Iran. The analysis of FAS-670A/G and FASL-844C/T polymorphisms were carried out using the PCR-RFLP approach, on 102 infertile men and 110 normal fertile men as control group. The results suggested that there were no significant difference in genotypic frequencies of FAS-670A/G polymorphism between infertile and control groups. On the other hand, significant result was observed for the frequency of FASL-844C/T polymorphism in infertile men in comparison to control group (P=0.02). Indeed, men with FASL-844TT and CT genotypes had an increased risk of idiopathic azoospermia in comparison to those with CC genotype (OR=2.02, 95% CI [1.05-3.88, P=0.03] and OR=1.44, 95% CI [0.46-4.49, P=0.53]), respectively. Our findings speculate that the FASL-844C/T polymorphism is associated with the risk of male infertility and this variation can be considered as a genetic risk factor for idiopathic azoospermia among Western Iranian men population. Summing up, these data indicated that the genetic variations in FAS/FASL system have a critical role in spermatogenesis defects and subsequent male infertility. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Association between VEGF polymorphisms (936c/t, -460t/c and -634g/c) with haplotypes and coronary heart disease susceptibility.

    PubMed

    Han, Xia; Liu, Lili; Niu, Jiamin; Yang, Jun; Zhang, Zengtang; Zhang, Zhiqiang

    2015-01-01

    Our aim was to investigate the association between single nucleotide polymorphisms (SNPs) of vascular endothelial growth factor (VEGF) and coronary heart disease (CHD) susceptibility in Chinese Han population. 144 CHD patients and 150 healthy individuals were enrolled in the study. Three SNPs (936C/T, -460T/C and -634G/C) of VEGF were chose and then were genotyped with Sequenom time-of-flight mass spectrometry (TOFMS). Odds ratio (OR) with 95% confidence interval (CI) were used to evaluate the association of genotypes and haplotypes and CHD susceptibility. The frequencies of -460T/C CC genotype (13.6%) was found higher in the case group than that of control group (6.7%), which indicated that CC genotype was a risk factor for CHD (OR=2.50, 95% CI=1.10-5.68). Correspondently, the C allele appeared to increase the risk of CHD (OR=1.54, 95% CI=1.07-2.22). For -634G/C polymorphism, the risk of the CC genotype carrier for CHD increased 2.24 fold compared to the wild genotype. Moreover, -634G/CC allele was significantly associated with CHD susceptibility (OR=1.65, 95% CI=1.15-2.36). In addition, +936C/T CT genotype and C allele appeared to be a genetic-susceptibility factors for CHD (OR=2.43, 95% CI=1.44-4.10; OR=1.95, 95% CI=1.26-3.02). The haplotype analysis showed that T-C-T, C-C-C and C-G-C haplotypes all could increase the risk for CHD (OR: 2.43, 2.77 and 2.33). we concluded VEGF polymorphisms were associated with CHD susceptibility. Moreover, the haplotypes of T-C-T, C-C-C and C-G-C all could increase the risk for CHD.

  13. CYP3A4-dependent cellular response does not relate to CYP3A4-catalysed metabolites of C-1748 and C-1305 acridine antitumor agents in HepG2 cells.

    PubMed

    Augustin, Ewa; Niemira, Magdalena; Hołownia, Adam; Mazerska, Zofia

    2014-11-01

    High CYP3A4 expression sensitizes tumor cells to certain antitumor agents while for others it can lower their therapeutic efficacy. We have elucidated the influence of CYP3A4 overexpression on the cellular response induced by antitumor acridine derivatives, C-1305 and C-1748, in two hepatocellular carcinoma (HepG2) cell lines, Hep3A4 stably transfected with CYP3A4 isoenzyme, and HepC34 expressing empty vector. The compounds were selected considering their different chemical structures and different metabolic pathways seen earlier in human and rat liver microsomes C-1748 was transformed to several metabolites at a higher rate in Hep3A4 than in HepC34 cells. In contrast, C-1305 metabolism in Hep3A4 cells was unchanged compared to HepC34 cells, with each cell line producing a single metabolite of comparable concentration. C-1748 resulted in a progressive appearance of sub-G1 population to its high level in both cell lines. In turn, the sub-G1 fraction was dominated in CYP3A4-overexpressing cells following C-1305 exposure. Both compounds induced necrosis and to a lesser extent apoptosis, which were more pronounced in Hep3A4 than in wild-type cells. In conclusion, CYP3A4-overexpressing cells produce higher levels of C-1748 metabolites, but they do not affect the cellular responses to the drug. Conversely, cellular response was modulated following C-1305 treatment in CYP3A4-overexpressing cells, although metabolism of this drug was unaltered. © 2014 International Federation for Cell Biology.

  14. Functional studies of p.R132C, p.R149C, p.M283V, p.E431K, and a novel c.652-2A>G mutations of the CYP21A2 gene.

    PubMed

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D; Buzzalino, Noemí; Stivel, Mirta; Ceballos, Nora R; Dain, Liliana

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90-95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream.

  15. Functional Studies of p.R132C, p.R149C, p.M283V, p.E431K, and a Novel c.652-2A>G Mutations of the CYP21A2 Gene

    PubMed Central

    Taboas, Melisa; Gómez Acuña, Luciana; Scaia, María Florencia; Bruque, Carlos D.; Buzzalino, Noemí; Stivel, Mirta

    2014-01-01

    Congenital adrenal hyperplasia (CAH) due to 21-hydroxylase deficiency is the most frequent inborn error of metabolism and accounts for 90–95% of CAH cases. In the present work, we analyzed the functional consequence of four novel previously reported point CYP21A2 mutations -p.R132C, p.R149C, p.M283V, p.E431K- found in Argentinean 21-hydroxylase deficient patients. In addition, we report an acceptor splice site novel point mutation, c.652-2A>G, found in a classical patient in compound heterozygosity with the rare p.R483Q mutation. We performed bioinformatic and functional assays to evaluate the biological implication of the novel mutation. Our analyses revealed that the residual enzymatic activity of the isolated mutants coding for CYP21A2 aminoacidic substitutions was reduced to a lesser than 50% of the wild type with both progesterone and 17-OH progesterone as substrates. Accordingly, all the variants would predict mild non-classical alleles. In one non-classical patient, the p.E431K mutation was found in cis with the p.D322G one. The highest decrease in enzyme activity was obtained when both mutations were assayed in the same construction, with a residual activity most likely related to the simple virilizing form of the disease. For the c.652-2A>G mutation, bioinformatic tools predicted the putative use of two different cryptic splicing sites. Nevertheless, functional analyses revealed the use of only one cryptic splice acceptor site located within exon 6, leading to the appearance of an mRNA with a 16 nt deletion. A severe allele is strongly suggested due to the presence of a premature stop codon in the protein only 12 nt downstream. PMID:24667412

  16. Involvement of MTHFR and TPMT genes in susceptibility to childhood acute lymphoblastic leukemia (ALL) in Mexicans.

    PubMed

    Gutiérrez-Álvarez, Ossyneidee; Lares-Asseff, Ismael; Galaviz-Hernández, Carlos; Reyes-Espinoza, Elio-Aarón; Almanza-Reyes, Horacio; Sosa-Macías, Martha; Chairez Hernández, Isaías; Salas-Pacheco, José-Manuel; Bailón-Soto, Claudia E

    2016-03-01

    Folate metabolism plays an essential role in the processes of DNA synthesis and methylation. Deviations in the folate flux resulting from single-nucleotide polymorphisms in genes encoding folate-dependent enzymes may affect the susceptibility to leukemia. This case-control study aimed to assess associations among MTHFR (C677T, A1298C) and TPMT (*2, *3A) mutations as well as to evaluate the synergistic effects of combined genotypes for both genes. Therefore, these genetic variants may lead to childhood acute lymphoblastic leukemia (ALL) susceptibility, in a Mexican population study. DNA samples obtained from 70 children with ALL and 152 age-matched controls (range, 1-15 years) were analyzed by real-time reverse transcription polymerase chain reaction (RT-qPCR) to detect MTHFR C677T and A1298C and TPMT*2 and TPMT*3A genotypes. The frequency of the MTHFR A1298C CC genotype was statistically significant (odds ratio [OR], 6.48; 95% 95% confidence intervals [CI], 1.26-33.2; p=0.025). In addition, the combined 677CC+1298AC genotype exhibited a statistically significant result (OR, 0.23; 95% CI, 0.06-0.82; p=0.023). No significant results were obtained from the MTHFR (C677T CT, C677T TT) or TPMT (*2, *3A) genotypes. More importantly, no association between the synergistic effects of either gene (MTHFR and/or TPMT) and susceptibility to ALL was found. The MTHFR A1298C CC genotype was associated with an increased risk of developing childhood ALL. However, a decreased risk to ALL with the combination of MTHFR 677CC+1298AC genotypes was found.

  17. An amphioxus gC1q protein binds human IgG and initiates the classical pathway: Implications for a C1q-mediated complement system in the basal chordate.

    PubMed

    Gao, Zhan; Li, Mengyang; Ma, Jie; Zhang, Shicui

    2014-12-01

    The origin of the classical complement pathway remains open during chordate evolution. A C1q-like member, BjC1q, was identified in the basal chordate amphioxus. It is predominantly expressed in the hepatic caecum, hindgut, and notochord, and is significantly upregulated following challenge with bacteria or lipoteichoic acid and LPS. Recombinant BjC1q and its globular head domain specifically interact with lipoteichoic acid and LPS, but BjC1q displays little lectin activity. Moreover, rBjC1q can assemble to form the high molecular weight oligomers necessary for binding to proteases C1r/C1s and for complement activation, and binds human C1r/C1s/mannan-binding lectin-associated serine protease-2 as well as amphioxus serine proteases involved in the cleavage of C4/C2, and C3 activation. Importantly, rBjC1q binds with human IgG as well as an amphioxus Ig domain containing protein, resulting in the activation of the classical complement pathway. This is the first report showing that a C1q-like protein in invertebrates is able to initiate classical pathway, raising the possibility that amphioxus possesses a C1q-mediated complement system. It also suggests a new scenario for the emergence of the classical complement pathway, in contrast to the proposal that the lectin pathway evolved into the classical pathway. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Compressible and Recyclable Monolithic g-C3N4/Melamine Sponge: A Facile Ultrasonic-coating Approach and Enhanced Visible-light Photocatalytic Activity

    NASA Astrophysics Data System (ADS)

    Yang, Ye; Zhang, Qian; Zhang, Ruiyang; Ran, Tao; Wan, Wenchao; Zhou, Ying

    2018-05-01

    Powdery photocatalysts seriously restrict their practical application due to the difficult recycle and low photocatalytic activity. In this work, a monolithic g-C3N4/melamine sponge (g-C3N4/MS) was successfully fabricated by a cost-effective ultrasonic-coating route, which is easy to achieve the uniform dispersion and firm loading of g-C3N4 on MS skeleton. The monolithic g-C3N4/MS entirely inherits the porous structure of MS and results in a larger specific surface area (SSA) than its powdery counterpart. Benefit from this monolithic structure, g-C3N4/MS gains more exposed active sites, enhanced visible-light absorption and separation of photogenerated carriers, thus achieving noticeable photocatalytic activity on nitric oxide (NO) removal, rhodamine B (RhB) degradation and CO2 reduction. Specifically, NO removal ratio is as high as 78.6% which is 4.5 times higher than that of the powdery g-C3N4, while RhB degradation rate reaches 97.88%, and yield rate of CO and CH4 attains 7.48 and 3.93 μmol g-1 h-1. Importantly, the features of low-density, high porosity, good elasticity and firmness, not only endow g-C3N4/MS with flexibility in various environmental applications, but also make it easy to recycle and stable for long-time application. Our work provides a feasible approach to fabricate novel monolithic photocatalysts with large-scale production and application.

  19. Compressible and Recyclable Monolithic g-C3N4/Melamine Sponge: A Facile Ultrasonic-Coating Approach and Enhanced Visible-Light Photocatalytic Activity.

    PubMed

    Yang, Ye; Zhang, Qian; Zhang, Ruiyang; Ran, Tao; Wan, Wenchao; Zhou, Ying

    2018-01-01

    Powdery photocatalysts seriously restrict their practical application due to the difficult recycle and low photocatalytic activity. In this work, a monolithic g-C 3 N 4 /melamine sponge (g-C 3 N 4 /MS) was successfully fabricated by a cost-effective ultrasonic-coating route, which is easy to achieve the uniform dispersion and firm loading of g-C 3 N 4 on MS skeleton. The monolithic g-C 3 N 4 /MS entirely inherits the porous structure of MS and results in a larger specific surface area (SSA) than its powdery counterpart. Benefit from this monolithic structure, g-C 3 N 4 /MS gains more exposed active sites, enhanced visible-light absorption and separation of photogenerated carriers, thus achieving noticeable photocatalytic activity on nitric oxide (NO) removal and CO 2 reduction. Specifically, NO removal ratio is as high as 78.6% which is 4.5 times higher than that of the powdery g-C 3 N 4 , and yield rate of CO and CH 4 attains 7.48 and 3.93 μmol g -1 h -1 . Importantly, the features of low-density, high porosity, good elasticity, and firmness, not only endow g-C 3 N 4 /MS with flexibility in various environmental applications, but also make it easy to recycle and stable for long-time application. Our work provides a feasible approach to fabricate novel monolithic photocatalysts with large-scale production and application.

  20. Characterization of a rare variant (c.2635-2A>G) of the MSH2 gene in a family with Lynch syndrome.

    PubMed

    Cariola, Filomena; Disciglio, Vittoria; Valentini, Anna M; Lotesoriere, Claudio; Fasano, Candida; Forte, Giovanna; Russo, Luciana; Di Carlo, Antonio; Guglielmi, Floranna; Manghisi, Andrea; Lolli, Ivan; Caruso, Maria L; Simone, Cristiano

    2018-04-01

    Lynch syndrome is caused by germline mutations in one of the mismatch repair genes ( MLH1, MSH2, MSH6, and PMS2) or in the EPCAM gene. Lynch syndrome is defined on the basis of clinical, pathological, and genetic findings. Accordingly, the identification of predisposing genes allows for accurate risk assessment and tailored screening protocols. Here, we report a family case with three family members manifesting the Lynch syndrome phenotype, all of which harbor the rare variant c.2635-2A>G affecting the splice site consensus sequence of intron 15 of the MSH2 gene. This mutation was previously described only in one family with Lynch syndrome, in which mismatch repair protein expression in tumor tissues was not assessed. In this study, we report for the first time the molecular characterization of the MSH2 c.2635-2A>G variant through in silico prediction analysis, microsatellite instability, and mismatch repair protein expression experiments on tumor tissues of Lynch syndrome patients. The potential effect of the splice site variant was revealed by three splicing prediction bioinformatics tools, which suggested the generation of a new cryptic splicing site. The potential pathogenic role of this variant was also revealed by the presence of microsatellite instability and the absence of MSH2/MSH6 heterodimer protein expression in the tumor cells of cancer tissues of the affected family members. We provide compelling evidence in favor of the pathogenic role of the MSH2 variant c.2635-2A>G, which could induce an alteration of the canonical splice site and consequently an aberrant form of the protein product (MSH2).

  1. Zinc induces exposure of hydrophobic sites in the C-terminal domain of gC1q-R/p33.

    PubMed

    Kumar, Rajeev; Peerschke, Ellinor I B; Ghebrehiwet, Berhane

    2002-09-01

    Endothelial cells and platelets are known to express gC1q-R on their surface. In addition to C1q, endothelial cell gC1q-R has been shown to bind high molecular weight kininogen (HK) and factor XII (FXII). However, unlike C1q, whose interaction with gC1q-R does not require divalent ions, the binding of HK to gC1q-R is absolutely dependent on the presence of zinc. However, the mechanism by which zinc modulates this interaction is not fully understood. To investigate the role of zinc, binding studies were done using the hydrophobic dye, bis-ANS. The fluorescence intensity of bis-ANS, greatly increases and the emission maximum is blue-shifted from 525 to 485nm upon binding to hydrophobic sites on proteins. In this report, we show that a blue-shift in emission maximum is also observed when bis-ANS binds to gC1q-R in the presence but not in the absence of zinc suggesting that zinc induces exposure of hydrophobic sites in the molecule. The binding of bis-ANS to gC1q-R is specific, dose-dependent, and reversible. In the presence of zinc, this binding is abrogated by monoclonal antibody 74.5.2 directed against gC1q-R residues 204-218. This segment of gC1q-R, which corresponds to the beta6 strand in the crystal structure, has been shown previously to be the binding site for HK. A similar trend in zinc-induced gC1q-R binding was also observed using the hydrophobic matrix octyl-Sepharose. Taken together, our data suggest that zinc can induce the exposure of hydrophobic sites in the C-terminal domain of gC1q-R involved in binding to HK/FXII.

  2. 52. Photocopy of Outboard Profile, Booklet of General Plans, U.S.C.G.C. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photocopy of Outboard Profile, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department. U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 2 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  3. 57. Photocopy of Hold, Booklet of General Plans, U.S.C.G.C. White ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    57. Photocopy of Hold, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 7 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  4. 51. Photocopy of Title Sheet, Booklet of General Plans, U.S.C.G.C ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    51. Photocopy of Title Sheet, Booklet of General Plans, U.S.C.G.C White Heath, WLM-545, U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 1 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  5. 53. Photocopy of Inboard Profile, Booklet of General Plans, U.S.C.G.C. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photocopy of Inboard Profile, Booklet of General Plans, U.S.C.G.C. White Heath, WLM-545. U.S. Coast Guard Naval Engineering Department. U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 3 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  6. 56. Photocopy of Main Deck, Booklet of General Plans, U.S.C.G.C. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. Photocopy of Main Deck, Booklet of General Plans, U.S.C.G.C. White Heath WLM-545. U.S. Coast Guard Naval Engineering Department, U.S.C.G. Headquarters, Washington, D.C. Coast Guard Headquarters Drawing No. 540-WAGL-0103-019 C. sheet 6 of 7, dated May 1967; revised June 1971, December 1976, and April 1989. Original drawing property of the U.S. Coast Guard. - U.S. Coast Guard Cutter WHITE HEATH, USGS Integrated Support Command Boston, 427 Commercial Street, Boston, Suffolk County, MA

  7. A weak-light-responsive TiO2/g-C3N4 composite film: photocatalytic activity under low-intensity light irradiation.

    PubMed

    Wang, Peifang; Guo, Xiang; Rao, Lei; Wang, Chao; Guo, Yong; Zhang, Lixin

    2018-05-10

    A TiO 2 /g-C 3 N 4 composite photocatalytic film was prepared by in situ synthesis method and its photocatalytic capability under weak-visible-light condition was studied. The co-precursor with different ratio of melamine and TiO 2 sol-gel precursor were treated using ultrasonic mixing, physical deposition, and co-sintering method to form the smooth, white-yellow, and compact TiO 2 /g-C 3 N 4 composite films. The prepared TiO 2 /g-C 3 N 4 materials were characterized by SEM, TEM, EDS, XRD, BET, VBXPS, and UV-vis diffuse reflectance spectra. The results of composite showed that TiO 2 and g-C 3 N 4 have close interfacial connections which are favorable to charge transfer between these two semiconductors with suitable band structure, g-C 3 N 4 retard the anatase-to-rutile phase transition of TiO 2 significantly, the specific surface area were increased with g-C 3 N 4 ratio raised. Under weak-light irradiation, composite films photocatalytic experiments exhibited RhB removal efficiency approaching 90% after three recycles. Powders suspension degradation experiments revealed the removal efficiency of TiO 2 /g-C 3 N 4 (90.8%) was higher than pure TiO 2 (52.1%) and slightly lower than pure g-C 3 N 4 (96.6%). By control experiment, the enhanced photocatalysis is ascribed to the combination of TiO 2 and g-C 3 N 4 , which not only produced thin films with greater stability but also formed heterojunctions that can be favorable to charge transfer between these two semiconductors with suitable band structure. This study presents the potential application of photocatalytic film in the wastewater treatment under weak-light situation.

  8. Association between thrombophilia gene polymorphisms and recurrent pregnancy loss risk in the Iranian population.

    PubMed

    Bigdeli, Razieh; Younesi, Mohammad Reza; Panahnejad, Erfan; Asgary, Vahid; Heidarzadeh, Samaneh; Mazaheri, Hoda; Aligoudarzi, Samira Louni

    2018-04-15

    Miscarriage is the most common complication in pregnancy. Considering the importance of the problem thrombophilia in pregnant women and its association with recurrent pregnancy loss (RPL), analysis of polymorphisms of genes involved in thrombophilia can be useful. We investigated the frequency and association between ten polymorphisms of seven thrombophilia genes and RPL in an Iranian population. This case-control study was conducted on 200 women with recurrent pregnancy loss and also on 200 women with at least one successful pregnancy as the control group. Using PCR-RFLP, DNA from samples were analyzed for carrying A5279G, A4070G, and FV Leiden of factor V; FXIII (Val34Leu); FII (A20210G); BF (-455 G⁄A); ITGB3 (1565T⁄C); 677C/T and 1298A/C of MTHFR; and PAI-1 (-675 I/D, 5G/4G) polymorphisms. The BF(-455 G⁄A), MTHFR (677 C⁄T, 1298A⁄ C), PAI-1 (-675 I/D,4G⁄ 5G), FV Leiden, FV (A5279G), FXIII (Val34Leu) polymorphisms, which had shown positive relation, and ITGB3 1565T⁄C were the polymorphisms with negative relation to RPL. But in this study it is indicated that there is no significant association between FII (A20210G) and FV (A4070G) polymorphism and RPL. All the data acquired from the RPL patients in this experiment illustrate the importance of screening thrombophilia. Nevertheless, more studies on large-scale populations may be needed to identify novel genetic variants. ASRM: American Society of Reproductive Medicine; HHCY: hyperhomocysteinemia; MTHFR: methylenetetrahydrofolate reductase; PCR: polymerase chain reaction; PAGE: poly-acrylamide gel electrophoresis; RPL: recurrent pregnancy loss.

  9. Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

    PubMed Central

    Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

    2016-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

  10. Associations between Methylenetetrahydrofolate Reductase (MTHFR) Polymorphisms and Non-Alcoholic Fatty Liver Disease (NAFLD) Risk: A Meta-Analysis

    PubMed Central

    Sun, Man-Yi; Zhang, Li; Shi, Song-Li; Lin, Jing-Na

    2016-01-01

    Background C677T and A1298C are the most common allelic variants of Methylenetetrahydrofolate Reductase (MTHFR) gene. The association between MTHFR polymorphisms and the occurrence of non-alcoholic fatty liver disease (NAFLD) remains controversial. This study was thus performed to examine whether MTHFR mutations are associated with the susceptibility to NAFLD. Methods A first meta-analysis on the association between the MTHFR polymorphisms and NAFLD risks was carried out via Review Manager 5.0 and Stata/SE 12.0 software. The on-line databases, such as PubMed, EMBASE, CENTRAL, WOS, Scopus and EBSCOhost (updated to April 1st, 2016), were searched for eligible case-control studies. The odd radio (OR), 95% confidence interval (CI) and P value were calculated through Mantel-Haenszel statistics under random- or fixed-effect model. Results Eight articles (785 cases and 1188 controls) contributed data to the current meta-analysis. For C677T, increased NAFLD risks were observed in case group under homozygote model (T/T vs C/C, OR = 1.49, 95% CI = 1.03~2.15, P = 0.04) and recessive model (T/T vs C/C+C/T, OR = 1.42, 95% CI = 1.07~1.88, P = 0.02), but not the other genetics models, compared with control group. For A1298C, significantly increased NAFLD risks were detected in allele model (C vs A, OR = 1.53, 95% CI = 1.13~2.07, P = 0.006), homozygote model (C/C vs A/A, OR = 2.81, 95% CI = 1.63~4.85, P = 0.0002), dominant model (A/C+C/C vs A/A, OR = 1.60, 95% CI = 1.06~2.41, P = 0.03) and recessive model (C/C vs A/A+A/C, OR = 2.08, 95% CI = 1.45~3.00, P<0.0001), but not heterozygote model. Conclusion T/T genotype of MTHFR C677T polymorphism and C/C genotype of MTHFR A1298C are more likely to be associated with the susceptibility to NAFLD. PMID:27128842

  11. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 31 Money and Finance: Treasury 1 2014-07-01 2014-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  12. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 31 Money and Finance: Treasury 1 2013-07-01 2013-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  13. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance: Treasury 1 2011-07-01 2011-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  14. 31 CFR Appendix G to Subpart C of... - Financial Management Service

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance: Treasury 1 2012-07-01 2012-07-01 false Financial Management Service G Appendix G to Subpart C of Part 1 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Privacy Act Pt. 1, Subpt. C, App. G Appendix G to Subpart C of Part 1—Financial...

  15. Compressible and Recyclable Monolithic g-C3N4/Melamine Sponge: A Facile Ultrasonic-Coating Approach and Enhanced Visible-Light Photocatalytic Activity

    PubMed Central

    Yang, Ye; Zhang, Qian; Zhang, Ruiyang; Ran, Tao; Wan, Wenchao; Zhou, Ying

    2018-01-01

    Powdery photocatalysts seriously restrict their practical application due to the difficult recycle and low photocatalytic activity. In this work, a monolithic g-C3N4/melamine sponge (g-C3N4/MS) was successfully fabricated by a cost-effective ultrasonic-coating route, which is easy to achieve the uniform dispersion and firm loading of g-C3N4 on MS skeleton. The monolithic g-C3N4/MS entirely inherits the porous structure of MS and results in a larger specific surface area (SSA) than its powdery counterpart. Benefit from this monolithic structure, g-C3N4/MS gains more exposed active sites, enhanced visible-light absorption and separation of photogenerated carriers, thus achieving noticeable photocatalytic activity on nitric oxide (NO) removal and CO2 reduction. Specifically, NO removal ratio is as high as 78.6% which is 4.5 times higher than that of the powdery g-C3N4, and yield rate of CO and CH4 attains 7.48 and 3.93 μmol g−1 h−1. Importantly, the features of low-density, high porosity, good elasticity, and firmness, not only endow g-C3N4/MS with flexibility in various environmental applications, but also make it easy to recycle and stable for long-time application. Our work provides a feasible approach to fabricate novel monolithic photocatalysts with large-scale production and application.

  16. Is the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene due to a founder effect in Chinese head and neck paraganglioma patients?

    PubMed

    Zha, Yang; Chen, Xing-ming; Lam, Ching-wan; Lee, Soo-chin; Tong, Sui-fan; Gao, Zhi-qiang

    2011-08-01

    Three Chinese patients with head and neck paragangliomas have been reported to carry the c.3G>C mutation in the succinate dehydrogenase subunit D (SDHD) gene. In addition, in our hospital, two further patients were identified who have the same mutation. It is unclear whether the c.3G>C mutation in Chinese patients is a recurrent mutation or if it is due to a founder effect. We conducted haplotype analysis on these patients to answer this question. Individual case-control study. Germ-line mutations were confirmed in the patients and their families examined in this study using direct sequencing. We also constructed and analyzed haplotypes in four Chinese families. Genotype frequencies were compared to the control group. Three of four families shared the same haplotype, which rarely occurred in the control group. The last family shared a very short area on the physical map with the other three families. There is a founder effect in Chinese head and neck paraganglioma patients carrying the SDHD c.3G>C mutation. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society, Inc.

  17. Kinetics of template-directed pyrophosphate-linked dideoxyguanylate synthesis as a function of 2-MeImpdG and poly(C) concentration: insights into the mechanism

    NASA Technical Reports Server (NTRS)

    Kanavarioti, A.; Gangopadhyay, S.

    1999-01-01

    Aqueous solutions of deoxyguanosine 5'-monophosphate 2-methylimidazolide, 2-MeImpdG, yield primarily deoxyguanosine 5'-monophosphate, 5'dGMP, and pyrophosphate-linked dideoxyguanylate, dG5'ppdG, abbreviated G2p (see Chart 1). The initial rate of G2p formation, d[G2p]/dt in M h-1, determined at 23 degrees C, pH 7.8, 1.0 M NaCl and 0.2 M Mg2+ by timed high-performance liquid chromatography (HPLC) analysis, exhibits a second-order dependence on 2-MeImpdG concentration, [G]o, indicating a bimolecular mechanism of dimerization in the range 0.02 M < or = [G]o < or = 0.09 M. In the presence of polycytidylate, poly(C), G2p synthesis is accelerated and oligodeoxyguanylate products are formed by incorporation of 2-MeImpdG molecules. The kinetics of G2p formation as a function of both monomer and polymer concentration, expressed in C equivalents, were also determined under the above conditions and exhibited a complex behavior. Specifically, at a constant [poly(C)], values of d[G2p]/dt typically increased with [G]o with a parabolic upward curvature. At a constant [G]o, values of d[G2p]/dt increase with [poly(C)], but level off at the higher poly(C) concentrations. As [G]o increases this saturation occurs at a higher poly(C) concentration, a result opposite to expectation for a simple complexation of two reacting monomers with the catalyst prior to reaction. Nevertheless, these results are shown to be quantitatively consistent with a template-directed (TD) mechanism of dimerization where poly(C) acts as the template to bind 2-MeImpdG in a cooperative manner and lead, for the first time, to the formulation of principles that govern template-directed chemistry. Analysis of the kinetic data via a proposed TD cooperative model provides association constants for the affinity between polymer and monomer and the intrinsic reactivity of 2-MeImpdG toward pyrophosphate synthesis. To the best of our knowledge, poly(C)/2-MeImpdG is the first system that could serve as a textbook example of

  18. Confirmation of the pathogenicity of a mutation p.G337C in the COL1A2 gene associated with osteogenesis imperfecta

    PubMed Central

    Jia, Mingrui; Shi, Ranran; Zhao, Xuli; Fu, Zhijian; Bai, Zhijing; Sun, Tao; Zhao, Xuejun; Wang, Wenbo; Xu, Chao; Yan, Fang

    2017-01-01

    Abstract Mutation analysis as the gold standard is particularly important in diagnosis of osteogenesis imperfecta (OI) and it may be preventable upon early diagnosis. In this study, we aimed to analyze the clinical and genetic materials of an OI pedigree as well as to confirm the deleterious property of the mutation. A pedigree with OI was identified. All family members received careful clinical examinations and blood was drawn for genetic analyses. Genes implicated in OI were screened for mutation. The function and structure of the mutant protein were predicted using bioinformatics analysis. The proband, a 9-month fetus, showed abnormal sonographic images. Disproportionately short and triangular face with blue sclera was noticed at birth. She can barely walk and suffered multiple fractures till 2-year old. Her mother appeared small stature, frequent fractures, blue sclera, and deformity of extremities. A heterozygous missense mutation c.1009G>T (p.G337C) in the COL1A2 gene was identified in her mother and her. Bioinformatics analysis showed p.G337 was well-conserved among multiple species and the mutation probably changed the structure and damaged the function of collagen. We suggest that the mutation p.G337C in the COL1A2 gene is pathogenic for OI by affecting the protein structure and the function of collagen. PMID:28953610

  19. Methylenetetrahydrofolate reductase gene polymorphisms and risk of acute lymphoblastic leukemia in children.

    PubMed

    Sadananda Adiga, M N; Chandy, S; Ramachandra, N; Appaji, L; Aruna Kumari, B S; Ramaswamy, G; Savithri, H S; Krishnamoorthy, L

    2010-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. Genetic polymorphisms of this enzyme have been shown to impact several diseases, including cancer. Leukemias are malignancies arising from rapidly proliferating hematopoietic cells having great requirement of DNA synthesis. This case-control study was undertaken to analyze the association of the MTHFR gene polymorphisms 677 C"T and 1298 A"C and the risk of acute lymphoblastic leukemia in children. Eighty-six patients aged below 15 years with a confirmed diagnosis of acute lymphoblastic leukemia (ALL) and 99 matched controls were taken for this study. Analysis of the polymorphisms was done using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Frequency of MTHFR 677 CC and CT were 85.9% and 14.1% in the controls, and 84.9% and 15.1% in the cases. The 'T' allele frequency was 7% and 7.5% in cases and controls respectively. The frequency of MTHFR 1298 AA, AC, and CC were 28.3%, 55.6% and 16.1% for controls and 23.3%, 59.3% and 17.4% for cases respectively. The 'C' allele frequency for 1298 A-->C was 43.9% and 47% respectively for controls and cases. The odds ratio (OR) for C677T was 1.08 (95% CI 0.48-2.45, p = 0.851) and OR for A1298C was 1.29 (95% CI 0.65-2.29, p = 0.46) and OR for 1298 CC was 1.31 (95% CI 0.53-3.26, p = 0.56). The OR for the combined heterozygous status (677 CT and 1298 AC) was 1.94 (95% CI 0.58-6.52, p = 0.286). The prevalence of 'T' allele for 677 MTHFR polymorphism was low in the population studied. There was no association between MTHFR 677 C-->T and 1298 A-->C gene polymorphisms and risk of ALL, which may be due to the small sample size.

  20. Calcination Method Synthesis of SnO2/g-C3N4 Composites for a High-Performance Ethanol Gas Sensing Application

    PubMed Central

    Cao, Jianliang; Qin, Cong; Wang, Yan; Zhang, Bo; Gong, Yuxiao; Zhang, Huoli; Sun, Guang; Bala, Hari; Zhang, Zhanying

    2017-01-01

    The SnO2/g-C3N4 composites were synthesized via a facile calcination method by using SnCl4·5H2O and urea as the precursor. The structure and morphology of the as-synthesized composites were characterized by the techniques of X-ray diffraction (XRD), the field-emission scanning electron microscopy and transmission electron microscopy (SEM and TEM), energy dispersive spectrometry (EDS), thermal gravity and differential thermal analysis (TG-DTA), and N2-sorption. The analysis results indicated that the as-synthesized samples possess the two dimensional structure. Additionally, the SnO2 nanoparticles were highly dispersed on the surface of the g-C3N4nanosheets. The gas-sensing performance of the as-synthesized composites for different gases was tested. Moreover, the composite with 7 wt % g-C3N4 content (SnO2/g-C3N4-7) SnO2/g-C3N4-7 exhibits an admirable gas-sensing property to ethanol, which possesses a higher response and better selectivity than that of the pure SnO2-based sensor. The high surface area of the SnO2/g-C3N4 composite and the good electronic characteristics of the two dimensional graphitic carbon nitride are in favor of the elevated gas-sensing property. PMID:28468245

  1. Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

    PubMed

    Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah

    2014-01-01

    The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

  2. Comparison of the Specificities of IgG, IgG-Subclass, IgA and IgM Reactivities in African and European HIV-Infected Individuals with an HIV-1 Clade C Proteome-Based Array

    PubMed Central

    Gallerano, Daniela; Ndlovu, Portia; Makupe, Ian; Focke-Tejkl, Margarete; Fauland, Kerstin; Wollmann, Eva; Puchhammer-Stöckl, Elisabeth; Keller, Walter; Sibanda, Elopy; Valenta, Rudolf

    2015-01-01

    A comprehensive set of recombinant proteins and peptides of the proteome of HIV-1 clade C was prepared and purified and used to measure IgG, IgG-subclass, IgA and IgM responses in HIV-infected patients from Sub-Saharan Africa, where clade C is predominant. As a comparison group, HIV-infected patients from Europe were tested. African and European patients showed an almost identical antibody reactivity profile in terms of epitope specificity and involvement of IgG, IgG subclass, IgA and IgM responses. A V3-peptide of gp120 was identified as major epitope recognized by IgG1>IgG2 = IgG4>IgG3, IgA>IgM antibodies and a C-terminal peptide represented another major peptide epitope for the four IgG subclasses. By contrast, gp41-derived-peptides were mainly recognized by IgG1 but not by the other IgG subclasses, IgA or IgM. Among the non-surface proteins, protease, reverse transcriptase+RNAseH, integrase, as well as the capsid and matrix proteins were the most frequently and strongly recognized antigens which showed broad IgG subclass and IgA reactivity. Specificities and magnitudes of antibody responses in African patients were stable during disease and antiretroviral treatment, and persisted despite severe T cell loss. Using a comprehensive panel of gp120, gp41 peptides and recombinant non-surface proteins of HIV-1 clade C we found an almost identical antibody recognition profile in African and European patients regarding epitopes and involved IgG-sublass, IgA- and IgM-responses. Immune recognition of gp120 peptides and non-surface proteins involved all four IgG subclasses and was indicative of a mixed Th1/Th2 immune response. The HIV-1 clade C proteome-based test allowed diagnosis and monitoring of antibody responses in the course of HIV-infections and assessment of isotype and subclass responses. PMID:25658330

  3. Association of alpha-thalassemia, TNF-alpha (-308G>A) and VCAM-1 (c.1238G>C) gene polymorphisms with cerebrovascular disease in a newborn cohort of 411 children with sickle cell anemia.

    PubMed

    Belisário, André Rolim; Nogueira, Frederico Lisboa; Rodrigues, Rahyssa Sales; Toledo, Nayara Evelin; Cattabriga, Ana Luiza Moreira; Velloso-Rodrigues, Cibele; Duarte, Filipe Otávio Chaves; Silva, Célia Maria; Viana, Marcos Borato

    2015-01-01

    Cerebrovascular disease (CVD) is a severe complication associated with sickle cell anemia. Abnormal transcranial Doppler (TCD) identifies some children at high risk, but other markers would be helpful. This cohort study was aimed at evaluating the effects of genetic biomarkers on the risk of developing CVD in children from Minas Gerais, Brazil. Clinical and hematological data were retrieved from children's records. Outcomes studied were overt ischemic stroke and CVD (overt ischemic stroke, transient ischemic attack, abnormal TCD, or abnormal cerebral angiography). Out of 411 children, 386 (93.9%) had SS genotype, 23 (5.6%) had Sβ(0)-thal and two had severe Sβ(+)-thal (0.5%). Frequency of CVD was lower in Sβ-thal group (p=0.05). No effect of VCAM-1 polymorphism on stroke or CVD risks was detected. Cumulative incidence of stroke was significantly higher for children with TNF-α A allele (p=0.02) and lower for children with HBA deletion (p=0.02). However, no association between CVD and TNF-α -308G>A was found. CVD cumulative incidence was significantly lower for children with HBA deletion (p=0.004). This study found no association between VCAM1 c.1238G>C and stroke. An association between stroke and TNF-α -308A allele has been suggested. Our results have confirmed the protective role of HBA deletion against stroke and CVD. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Cold-sensitive mutants G680V and G691C of Dictyostelium myosin II confer dramatically different biochemical defects.

    PubMed

    Patterson, B; Ruppel, K M; Wu, Y; Spudich, J A

    1997-10-31

    Cold-sensitive myosin mutants represent powerful tools for dissecting discrete deficiencies in myosin function. Biochemical characterization of two such mutants, G680V and G691C, has allowed us to identify separate facets of myosin motor function perturbed by each alteration. Compared with wild type, the G680V myosin exhibits a substantially enhanced affinity for several nucleotides, decreased ATPase activity, and overoccupancy or creation of a novel strongly actin-binding state. The properties of the novel strong binding state are consistent with a partial arrest or pausing at the onset of the mechanical stroke. The G691C mutant, on the other hand, exhibits an elevated basal ATPase indicative of premature phosphate release. By releasing phosphate without a requirement for actin binding, the G691C can bypass the part of the cycle involving the mechanical stroke. The two mutants, despite having alterations in glycine residues separated by only 11 residues, have dramatically different consequences on the mechanochemical cycle.

  5. The RET p.G533C mutation confers predisposition to multiple endocrine neoplasia type 2A in a Brazilian kindred and is able to induce a malignant phenotype in vitro and in vivo.

    PubMed

    Oliveira, Mariana N L; Hemerly, Jefferson P; Bastos, André U; Tamanaha, Rosana; Latini, Flavia R M; Camacho, Cléber P; Impellizzeri, Anelise; Maciel, Rui M B; Cerutti, Janete M

    2011-09-01

    We have previously described a p.G533C substitution in the rearranged during transfection (RET) oncogene in a large family with medullary thyroid carcinoma. Here, we explore the functional transforming potential of RET p.G533C mutation. Plasmids expressing RET mutants (p.G533C and p.C634Y) and RET wild type were stable transfected into a rat thyroid cell line (PCCL3). Biological and biochemical effects of RET p.G533C were investigated both in vitro and in vivo. Moreover, we report the first case of pheochromocytoma among the RET p.G533C-carriers in this Brazilian family and explore the RET mutational status in DNA isolated from pheochromocytoma. Ectopic expression of RET p.G533C and p.C634Y activates RET/MAPK/ERK pathway at similar levels and significantly increased cell proliferation, compared with RET wild type. We additionally show that p.G533C increased cell viability, anchorage-independent growth, and micronuclei formation while reducing apoptosis, hallmarks of the malignant phenotype. RET p.G533C down-regulates the expression of thyroid specific genes in PCCL3. Moreover, RET p.G533C-expressing cells were able to induce liver metastasis in nude mice. Finally, we described two novel RET variants (G548V and S556T) in the DNA isolated from pheochromocytoma while they were absent in the DNA isolated from blood. Our in vitro and in vivo analysis indicates that this mutation confers a malignant phenotype to PCCL3 cells. These findings, in association with the report of first case of pheochromocytoma in the Brazilian kindred, suggest that this noncysteine mutation may be more aggressive than was initially considered.

  6. A novel mutation MT-COIII m.9267G>C and MT-COI m.5913G>A mutation in mitochondrial genes in a Tunisian family with maternally inherited diabetes and deafness (MIDD) associated with severe nephropathy.

    PubMed

    Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza

    2015-04-10

    Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. Copyright © 2015. Published by Elsevier Inc.

  7. Gene polymorphisms of TNF-alpha-308 (G/A), IL-10(-1082) (G/A), IL-6(-174) (G/C) and IL-1Ra (VNTR) in Egyptian cases with type 1 diabetes mellitus.

    PubMed

    Settin, Ahmad; Ismail, Azza; El-Magd, Megahed Abo; El-Baz, Rizk; Kazamel, Amira

    2009-01-01

    Type 1 diabetes (T1D) is a genetically conditioned autoimmune disease in which cytokines play an important role. Objectives. To check for the association of polymorphisms of cytokine genes with type 1 diabetes. Subjects. This work included 50 cases with T1D and 98 healthy individuals from the Nile Delta region of Egypt. Cases included 20 males and 30 females with a median age of 25 and range of 15-50 years. DNA was amplified using PCR with sequence-specific primers for detection of polymorphisms related to tumor necrosis factor (TNF)-alpha(- 308) (G/A), interleukin (IL)-10(- 1082) (G/A), IL-6(- 174) (G/C), and IL-1Ra (VNTR). Cases with T1D showed significant higher frequency of genotypes of TNF-alpha(- 308) AA (p < 0.001, odds ratio (OR) = 7.91), IL-6-17CC (p < 0.05, OR = 3.36) and IL-1Ra A1A1 (p < 0.05, OR = 3.68) with significant lower frequencies of TNF-alpha(- 308) GA, and IL-1Ra A1A2 genotypes (p < 0.001 and < 0.05, respectively). They also showed significant higher frequency of TNF-alpha(- 308) allele A (p < 0.05, OR = 2.0), IL-1Ra allele A1 (p < 0.05, OR = 2.98) with a significant lower frequency of TNF-alpha(- 308) G allele and IL-1Ra A2 allele (p < 0.05). No significant difference was detected among cases in relation to IL-10(- 1082) (G/A) genotypes or alleles nor in relation to age, sex, consanguinity or family history of the disease. Polymorphisms related to TNF-alpha and IL-1Ra genes may be considered genetic markers for T1D among Egyptians with a potential impact on family counseling and management.

  8. Resistin -420C>G promoter variant and colorectal cancer risk.

    PubMed

    Mahmoudi, Touraj; Karimi, Khatoon; Arkani, Maral; Farahani, Hamid; Vahedi, Mohsen; Dabiri, Reza; Nobakht, Hossein; Asadi, Asadollah; Mirakhorli, Mojgan; Arshi, Benafsheh; Derakhshan, Arash; Zali, Mohammad Reza

    2014-09-30

    Obesity is associated with an increased risk of colorectal cancer (CRC), and ghrelin (GHRL) and resistin (RETN) are thought to be related to obesity. Our aim was to investigate whether GHRL and RETN gene variants are associated with CRC risk. All 414 subjects, including 197 cases with CRC and 217 controls, were genotyped for the GHRL (rs26802) and RETN (rs1862513) or -420 C>G gene variants using the PCR-RFLP method. Our findings indicated that the RETN -420 C>G "CC" genotype, compared with the "GG" and "GC" genotypes, was a marker of decreased CRC susceptibility; the difference remained significant after adjustment for age, BMI, gender, smoking status, NSAID use, and family history of CRC (p=0.020; OR=0.52, 95% CI=0.30-0.90). Furthermore, after adjustment for confounding factors, the -420 C>G "CC" genotype, compared with the "GG" genotype, was associated with a decreased risk for CRC (p=0.044; OR=0.53, 95% CI=0.29-0.98). In addition, no significant difference was observed for the GHRL (rs26802) gene variant. To our knowledge, this is the first study suggesting that the RETN -420 C>G "CC" genotype is a marker of decreased CRC susceptibility. This observation is relevant from a scientific perspective and deserves further investigations.

  9. C (G)-Band & X (I) - Band Noncoherent Radar Transponder Performance Specification Standard

    DTIC Science & Technology

    2002-04-01

    TRAINING RANGE NEVADA TEST SITE STANDARD 262-02 ELECTRONIC TRAJECTORY MEASUREMENTS GROUP C (G) – BAND & X (I) – BAND NONCOHERENT RADAR...Date 00 Apr 2002 Report Type N/A Dates Covered (from... to) - Title and Subtitle C (G)-Band & X (I) - Band Noncoherent Radar Transponder...Number of Pages 157 i STANDARD 262-02 C (G) – BAND & X (I) – BAND NONCOHERENT RADAR TRANSPONDER PERFORMANCE SPECIFICATION STANDARD APRIL 2002 Prepared by

  10. Correlation between methyltetrahydrofolate reductase (MTHFR) polymorphisms and isolated patent ductus arteriosus in Taiwan.

    PubMed

    Chao, Chia-Sheng; Wei, Jeng; Huang, Hurng-Wern; Yang, Shyh-Chyun

    2014-07-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C gene polymorphisms are associated with the risk of patent ductus arteriosus (PDA) congenital heart defects. This study aimed to determine the association of these polymorphisms in patients with isolated PDA and in non-PDA patients group without congenital heart disease. This retrospective case-controlled study was undertaken in 17 patients with isolated PDA and a control non-PDA group consisting of 34 subjects without congenital heart disease. MTHFR gene polymorphisms were analysed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). In addition, the genotype distribution of the MTHFR gene was compared among different ethnicities using the HapMap database. In contrast to the MTHFR C677T polymorphism, differences in the MTHFR A1298C genotype were observed between the two groups (P=0.002); a greater proportion of the PDA patients had the MTHFR 1298CC and 1298AA genotypes as compared to the non-PDA control group. After merging the data obtained from the Taiwanese participants with that from the HapMap database, genetic diversity of the MTHFR 1298AA genotype was observed. Thus, the MTHFR A1298C polymorphism is associated with isolated PDA in Taiwan. Larger studies are necessary to evaluate the prognostic value of determining MTHFR polymorphism in PDA. Copyright © 2014 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

  11. A hantavirus causing hemorrhagic fever with renal syndrome requires gC1qR/p32 for efficient cell binding and infection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choi, Yun; Kwon, Young-Chan; Kim, Soo-In

    Hantaan virus (HTNV) is a pathogenic hantavirus that causes hemorrhagic fever with renal syndrome (HFRS). HTNV infection is mediated by {alpha}v{beta}3 integrin. We used protein blots of Vero E6 cell homogenates to demonstrate that radiolabeled HTNV virions bind to gC1qR/p32, the acidic 32-kDa protein known as the receptor for the globular head domain of complement C1q. RNAi-mediated suppression of gC1qR/p32 markedly reduced HTNV binding and infection in human lung epithelial A549 cells. Conversely, transient expression of either simian or human gC1qR/p32 rendered non-permissive CHO cells susceptible to HTNV infection. These results suggest an important role for gC1qR/p32 in HTNV infectionmore » and pathogenesis.« less

  12. The interleukin-6-572G/C gene polymorphism and the risk of intracranial aneurysms in a Chinese population.

    PubMed

    Liu, Yi; Sun, Jidong; Wu, Cong; Cao, Xudong; He, Min; You, Chao

    2012-07-01

    Interleukin-6 (IL-6) is an important proinflammatory cytokine that plays an important role in the pathogenesis of intracranial aneurysms (IAs). The aim of this study was to investigate the association between the IL-6-572G/C polymorphism and the risk of IAs in a Chinese population. The IL-6-572G/C gene polymorphisms in 220 IA cases and 220 controls were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. The IL-6-572GG (odds ratio [OR]=3.35, 95% confidence intervals [CIs]=1.65, 6.82; p=0.001) and G allele frequencies (OR=1.48, 95% CIs=1.09, 2.00; p=0.01) in the IA group were higher than those in the control group. The C allele frequencies (OR=0.68, 95% CIs=0.50, 0.92; p=0.01) were significantly lower in patients than in controls. When stratified by the site, shape, size, and the Fisher Grade of IAs, no statistically significant result was observed. This study suggested that the IL-6-572GG genotype was associated with a higher risk of IA in a Chinese population.

  13. Association of polymorphisms G(-174)C in IL-6 gene and G(-1082)A in IL-10 gene with traditional cardiovascular risk factors in patients with coronary artery disease.

    PubMed

    Elsaid, Afaf; Abdel-Aziz, A F; Elmougy, Rehab; Elwaseef, A M

    2014-08-01

    Interleukin-6 (IL-6) polymorphism has been associated with the genetic susceptibility to coronary artery disease (CAD) and also with the lipid profile in different populations. The present work aimed at studying the association, if any between the IL-6 (174) G/C and IL-10 (1082) G/A genes with hypertension or hyperlipidimia in Egyptian patients with CAD and the association of the IL-6 -174 G/C polymorphism with serum IL-6 levels. 108 Egyptian patients with CAD and 143 unrelated healthy subjects were included in the study. The different genotypes of IL-6 and IL-10 were detected by polymerase chain reaction. Serum levels of lipoprotein(a) [Lp(a)] and IL-6 were estimated in the patients, as well as in the healthy subjects. Increased frequency of G allele, GG and GC genotypes in IL-6, as well as decreased frequency of C allele and CC genotype were found in CAD patients, compared to healthy subjects [P = < 0.0001, OR = 3.95, 95% CI (2.16-7.22) for GG and GC vs CC genotype], [P = < 0.0001, OR = 3.44, 95% CI (2.26-5.23) for G allele]. There was an increased frequency of G allele vs A allele in IL-10 genotype in CAD patients, compared to healthy subjects [P = 0.005, OR = 1.866, 95% CI (1.2-2.9]. Higher levels of both Lp(a) and IL-6 were observed in CAD patients, compared to control subjects (P = 0.0012, P = 0.0346, respectively). Increased frequency of IL-6 -174 G-allele was implicated in a greater cardiovascular risk and the presence of G allele or homozygosity for G allele of IL-10 G/A (1082) was associated with an increased prevalence of CAD. The GC genotype and G allele in IL-6 had significant correlation with hyperlipidimic CAD patients; however, G allele in IL-6 and IL-10 showed significant association with hypertension. Thus, G allele in IL-6 and IL-10 was considered as an independent risk factor in hypertensive CAD patients.

  14. Molecular Structure and Free Energy Landscape for Electron Transport in the Deca-Heme Cytochrome MtrF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Breuer, Marian; Zarzycki, Piotr P.; Shi, Liang

    2012-12-01

    The free energy profile for electron flow through the bacterial deca-heme cytochrome MtrF has been computed using thermodynamic integration and classical molecular dynamics. The extensive calculations on two versions of the structure help validate the method and results, because differences in the profiles can be related to differences in the charged amino acids local to specific heme groups. First estimates of reorganization free energies λ yield a range consistent with expectations for partially solvent exposed cofactors, and reveal an activation energy range surmountable for electron flow. Future work will aim at increasing the accuracy of λ with polarizable force fieldmore » dynamics and quantum chemical energy gap calculations, as well as quantum chemical computation of electronic coupling matrix elements.« less

  15. Generation and evaluation of a LaSota strain-based recombinant Newcastle disease virus (NDV) expressing the glycoprotein (G) of avian metapneumovirus subgroup C (aMPV-C) as a bivalent vaccine

    USDA-ARS?s Scientific Manuscript database

    To develop a bivalent vaccine, a recombinant Newcastle disease virus was generated by using the NDV LaSota strain with insertion of the G gene of aMPV-C. The biological assessments of the recombinant virus, rLS/aMPV-CG, by conducting the mean death time, intracerebral pathogenicity index, and growth...

  16. Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

    PubMed

    Zhu, L

    2015-07-28

    We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion.

  17. Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging

    PubMed Central

    Bhargava, Yogesh; Hampden-Smith, Kathryn; Chachlaki, Konstantina; Wood, Katherine C.; Vernon, Jeffrey; Allerston, Charles K.; Batchelor, Andrew M.; Garthwaite, John

    2013-01-01

    Genetically-encoded biosensors are powerful tools for understanding cellular signal transduction mechanisms. In aiming to investigate cGMP signaling in neurones using the EGFP-based fluorescent biosensor, FlincG (fluorescent indicator for cGMP), we encountered weak or non-existent fluorescence after attempted transfection with plasmid DNA, even in HEK293T cells. Adenoviral infection of HEK293T cells with FlincG, however, had previously proved successful. Both constructs were found to harbor a mutation in the EGFP domain and had a tail of 17 amino acids at the C-terminus that differed from the published sequence. These discrepancies were systematically examined, together with mutations found beneficial for the related GCaMP family of Ca2+ biosensors, in a HEK293T cell line stably expressing both nitric oxide (NO)-activated guanylyl cyclase and phosphodiesterase-5. Restoring the mutated amino acid improved basal fluorescence whereas additional restoration of the correct C-terminal tail resulted in poor cGMP sensing as assessed by superfusion of either 8-bromo-cGMP or NO. Ultimately, two improved FlincGs were identified: one (FlincG2) had the divergent tail and gave moderate basal fluorescence and cGMP response amplitude and the other (FlincG3) had the correct tail, a GCaMP-like mutation in the EGFP region and an N-terminal tag, and was superior in both respects. All variants tested were strongly influenced by pH over the physiological range, in common with other EGFP-based biosensors. Purified FlincG3 protein exhibited a lower cGMP affinity (0.89 μM) than reported for the original FlincG (0.17 μM) but retained rapid kinetics and a 230-fold selectivity over cAMP. Successful expression of FlincG2 or FlincG3 in differentiated N1E-115 neuroblastoma cells and in primary cultures of hippocampal and dorsal root ganglion cells commends them for real-time imaging of cGMP dynamics in neural (and other) cells, and in their subcellular specializations. PMID:24068983

  18. Effect of the G375C and G346E achondroplasia mutations on FGFR3 activation.

    PubMed

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism.

  19. Effect of the G375C and G346E Achondroplasia Mutations on FGFR3 Activation

    PubMed Central

    He, Lijuan; Serrano, Christopher; Niphadkar, Nitish; Shobnam, Nadia; Hristova, Kalina

    2012-01-01

    Two mutations in FGFR3, G380R and G375C are known to cause achondroplasia, the most common form of human dwarfism. The G380R mutation accounts for 98% of the achondroplasia cases, and thus has been studied extensively. Here we study the effect of the G375C mutation on the phosphorylation and the cross-linking propensity of full-length FGFR3 in HEK 293 cells, and we compare the results to previously published results for the G380R mutant. We observe identical behavior of the two achondroplasia mutants in these experiments, a finding which supports a direct link between the severity of dwarfism phenotypes and the level and mechanism of FGFR3 over-activation. The mutations do not increase the cross-linking propensity of FGFR3, contrary to previous expectations that the achondroplasia mutations stabilize the FGFR3 dimers. Instead, the phosphorylation efficiency within un-liganded FGFR3 dimers is increased, and this increase is likely the underlying cause for pathogenesis in achondroplasia. We further investigate the G346E mutation, which has been reported to cause achondroplasia in one case. We find that this mutation does not increase FGFR3 phosphorylation and decreases FGFR3 cross-linking propensity, a finding which raises questions whether this mutation is indeed a genetic cause for human dwarfism. PMID:22529939

  20. Polymorphisms in the methylenetetrahydrofolate reductase gene (MTHFR) are associated with susceptibility to adult acute myeloid leukemia in a Chinese population.

    PubMed

    Huang, Lulu; Deng, Donghong; Peng, Zhigang; Ye, Fanghui; Xiao, Qiang; Zhang, Bing; Ye, Bingbing; Mo, Zengnan; Yang, Xiaobo; Liu, Zhenfang

    2015-06-01

    Methylenetetrahydrofolate reductase (MTHFR) is an essential enzyme in the metabolism of folate. Since acute myeloid leukemia (AML) is characterized by rapidly proliferating tissues that have a high requirement for DNA synthesis, it is possible that the presence of MTHFR polymorphisms could be linked to the multifactorial process of AML development. We evaluated the role of MTHFR C677T and A1298C polymorphisms in a case-control study comprising 98 AML patients and 2016 healthy controls in a Southern Chinese population. We further conducted a sub-study restricted to individuals who neither smoked nor drank alcohol (70 AML patients and 160 healthy controls). MTHFR polymorphisms in the patient and control groups were evaluated by SNaP shot genotype techniques and Illumina BeadChip, respectively. Logistic regression was used to assess the adjusted odds ratios (ORs) and 95% confidence intervals (95% CIs). The MTHFR 1298AC genotype and the 677CC/1298AC haplotype were significantly associated with a decreased risk of AML compared with the AA genotype and 677CC/1298AA haplotype (OR=0.60, 95% CI: 0.38-0.95, P=0.03; OR=0.49, 95% CI: 0.27-0.90, P=0.02, respectively). In addition, the 677TT genotype was significantly associated with an increased risk of AML compared with the AA genotype only in non-smokers and non-drinkers (OR=4.78; 95% CI=1.38-16.61, P=0.01). The results might suggest that MTHFR polymorphisms are significantly associated with AML risk. In addition, the role of MTHFR genetic susceptibility could be greater among non-smokers and non-drinkers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Identification of a novel COL1A1 frameshift mutation, c.700delG, in a Chinese osteogenesis imperfecta family

    PubMed Central

    Wang, Xiran; Pei, Yu; Dou, Jingtao; Lu, Juming; Li, Jian; Lv, Zhaohui

    2015-01-01

    Osteogenesis imperfecta (OI) is a family of genetic disorders associated with bone loss and fragility. Mutations associated with OI have been found in genes encoding the type I collagen chains. People with OI type I often produce insufficient α1-chain type I collagen because of frameshift, nonsense, or splice site mutations in COL1A1 or COL1A2. This report is of a Chinese daughter and mother who had both experienced two bone fractures. Because skeletal fragility is predominantly inherited, we focused on identifying mutations in COL1A1 and COL1A2 genes. A novel mutation in COL1A1, c.700delG, was detected by genomic DNA sequencing in the mother and daughter, but not in their relatives. The identification of this mutation led to the conclusion that they were affected by mild OI type I. Open reading frame analysis indicated that this frameshift mutation would truncate α1-chain type I collagen at residue p263 (p.E234KfsX264), while the wild-type protein would contain 1,464 residues. The clinical data were consistent with the patients’ diagnosis of mild OI type I caused by haploinsufficiency of α1-chain type I collagen. Combined with previous reports, identification of the novel mutation COL1A1-c.700delG in these patients suggests that additional genetic and environmental factors may influence the severity of OI. PMID:25983617

  2. Methylenetetrahydrofolate reductase polymorphisms and susceptibility to acute lymphoblastic leukemia in a Chinese population: a meta-analysis.

    PubMed

    Xiao, Yi; Deng, Tao-Ran; Su, Chang-Liang; Shang, Zhen

    2014-01-01

    Although many epidemiologic studies have investigated the methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and their association with acute lymphoblastic leukemia (ALL), definitive conclusions cannot be drawn. To clarify the effects of MTHFR polymorphisms on the risk of ALL, a meta-analysis was performed in a Chinese population. A computerized literature search was carried out in PubMed, the Chinese Biomedicine (CBM) database, China National Knowledge Infrastructure (CNKI) platform, and the Wanfang database (Chinese) to collect relevant articles. A total of 11 articles including 1,738 ALL cases and 2,438 controls were included in this meta-analysis. Overall, a significantly decreased association was found between the MTHFR C677T polymorphism and ALL risk when all studies in Chinese populations were pooled into the meta-analysis. In subgroup analyses stratified by age, ethnicity, and source of controls, the same results were observed in children, in population-based studies, and in people with no stated ethnicity. However, a significantly increased association was also found for MTHFR C677T in hospital-based studies, and for MTHFR A1298C in people with no stated ethnicity. Our results suggest that the MTHFR C677T and A1298C polymorphisms may be potential biomarkers for ALL risk in Chinese populations, and studies with a larger sample size and wider population spectrum are required before definitive conclusions can be drawn. © 2014 S. Karger GmbH, Freiburg.

  3. Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

    PubMed

    Mohamed Yusoff, Abdul Aziz; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

    2016-12-01

    Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. Creative Commons Attribution License

  4. Association of The IDH1 C.395G>A (R132H) Mutation with Histological Type in Malay Brain Tumors

    PubMed Central

    Yusoff, Abdul Aziz Mohamed; Zulfakhar, Fatin Najwa; Sul’ain, Mohd Dasuki; Idris, Zamzuri; Abdullah, Jafri Malin

    2016-01-01

    Background: Brain tumors, constituting one of the most deadly forms of cancer worldwide, result from the accumulation of multiple genetic and epigenetic alterations in genes and signaling pathways. Isocitrate dehydrogenase enzyme isoform 1 (IDH1) mutations are frequently identified in primary brain tumors and acute myeloid leukemia. Studies on IDH1 gene mutations have been extensively performed in various populations worldwide but not in Malaysia. This work was conducted to study the prevalence of IDH1 c.395G>A (R132H) hotspot mutations in a group of Malaysian patients with brain tumors in order to gain local data for the IDH1 mutation profile in our population. Methods: Mutation analysis of c.395G>A (R132H) of IDH1 was performed in 40 brain tumor specimens by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP) and then verified by direct sequencing. Associations between the IDH1 c.395G>A (R132H) mutation and clinicopathologic characteristics were also analyzed. Results: The IDH1 c.395G>A (R132H) mutation was detected in 14/40 patients (35%). A significant association was found with histological tumor types, but not with age, gender and race. Conclusions: IDH1 is frequently mutated and associated with histological subtypes in Malay brain tumors. PMID:28125199

  5. Associations of maternal PLA2G4C and PLA2G4D polymorphisms with the risk of spontaneous preterm birth in a Chinese population

    PubMed Central

    Liu, Guang-Jian; He, Jian-Rong; Kuang, Ya-Shu; Fan, Xue-Jiao; Li, Wei-Dong; Lu, Jin-Hua; Xia, Xiao-Yan; Liu, Xiao-Dan; Chen, Nian-Nian; Mai, Wei-Bi; Xia, Hui-Min; Qiu, Xiu

    2017-01-01

    Preterm birth is the leading cause of mortality and morbidity in infants. Its etiology is multifactorial with genes and immune homeostasis. The authors investigated whether prostaglandin (PG) synthesis related single nucleotide polymorphisms (SNPs) PLA2G4C rs1366442 and PLA2G4D rs4924618 were associated with the risk of spontaneous preterm birth (SPTB) in a Chinese population of 114 cases of SPTB and 250 controls of term delivery. The risk associations were determined by odds ratios (ORs) and their 95% confidence intervals (CIs) calculated using multivariate logistic regression. Homology modeling was performed to elucidate potential mechanism of the SNP function. The maternal AT/TT genotype of PLA2G4D rs4924618 was associated with a reduced risk of SPTB (OR, 0.61; 95% CI, 0.37–0.99), while no significant association between PLA2G4C rs1366442 and SPTB risk was identified. Structure and sequence analysis revealed that the amino acid substitution introduced by this SNP located at the conserved central core of the catalytic domain of cytosolic phospholipase A2 δ and was close to the active site. These findings suggested that the polymorphism of PLA2G4D rs4924618 may have a protective influence on the SPTB susceptibility in a Chinese population, supporting a role for genetics in the association between PG synthesis and preterm birth. PMID:28440406

  6. A Novel Mutation in DMD (c.10797+5G>A) Causes Becker Muscular Dystrophy Associated with Intellectual Disability.

    PubMed

    Banihani, Rudaina; Baskin, Berivan; Halliday, William; Kobayashi, Jeff; Kawamura, Anne; McAdam, Laura; Ray, Peter N; Yoon, Grace

    2016-04-01

    Severe intellectual disability has been reported in a subgroup of patients with Duchenne muscular dystrophy but is not typically associated with Becker muscular dystrophy. The authors report a 13-year-old boy, with severe intellectual disability (Wechsler Intelligence Scales for Children-IV, Full Scale IQ < 0.1 percentile), attention-deficit hyperactivity disorder, and mild muscle weakness. He had elevated serum creatine kinase and dystrophic changes on muscle biopsy. Dystrophin immunohistochemistry revealed decreased staining with the C-terminal and mid-rod antibodies and essentially absent staining of the N-terminal immunostain. Sequencing of muscle mRNA revealed aberrant splicing due to a c.10797+5G > A mutation in DMD. Dystrophinopathy may be associated with predominantly cognitive impairment and neurobehavioral disorder, and should be considered in the differential diagnosis of unexplained cognitive or psychiatric disturbance in males.

  7. A comparative evaluation of the analytical performances of Capillarys 2 Flex Piercing, Tosoh HLC-723 G8, Premier Hb9210, and Roche Cobas c501 Tina-quant Gen 2 analyzers for HbA1c determination.

    PubMed

    Wu, Xiaobin; Chao, Yan; Wan, Zemin; Wang, Yunxiu; Ma, Yan; Ke, Peifeng; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang

    2016-10-15

    Haemoglobin A 1c (HbA 1c ) is widely used in the management of diabetes. Therefore, the reliability and comparability among different analytical methods for its detection have become very important. A comparative evaluation of the analytical performances (precision, linearity, accuracy, method comparison, and interferences including bilirubin, triglyceride, cholesterol, labile HbA 1c (LA 1c ), vitamin C, aspirin, fetal haemoglobin (HbF), and haemoglobin E (Hb E)) were performed on Capillarys 2 Flex Piercing (Capillarys 2FP) (Sebia, France), Tosoh HLC-723 G8 (Tosoh G8) (Tosoh, Japan), Premier Hb9210 (Trinity Biotech, Ireland) and Roche Cobas c501 (Roche c501) (Roche Diagnostics, Germany). A good precision was shown at both low and high HbA 1c levels on all four systems, with all individual CVs below 2% (IFCC units) or 1.5% (NGSP units). Linearity analysis for each analyzer had achieved a good correlation coefficient (R 2 > 0.99) over the entire range tested. The analytical bias of the four systems against the IFCC targets was less than ± 6% (NGSP units), indicating a good accuracy. Method comparison showed a great correlation and agreement between methods. Very high levels of triglycerides and cholesterol (≥ 15.28 and ≥ 8.72 mmol/L, respectively) led to falsely low HbA 1c concentrations on Roche c501. Elevated HbF induced false HbA 1c detection on Capillarys 2FP (> 10%), Tosoh G8 (> 30%), Premier Hb9210 (> 15%), and Roche c501 (> 5%). On Tosoh G8, HbE induced an extra peak on chromatogram, and significantly lower results were reported. The four HbA 1c methods commonly used with commercial analyzers showed a good reliability and comparability, although some interference may falsely alter the result.

  8. 75 FR 57664 - Airworthiness Directives; G ROB-WERKE Model G120A Airplanes

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-22

    ... Airworthiness Directives; G ROB-WERKE Model G120A Airplanes AGENCY: Federal Aviation Administration (FAA), DOT.... The authority citation for part 39 continues to read as follows: Authority: 49 U.S.C. 106(g), 40113..., PART B, dated May 18, 2010. (g) You may at any time complete GROB Aircraft AG Repair Instruction No. RI...

  9. Fragment-Based Approaches to Enhance GTP Competitive KRAS G12C Inhibitors

    DTIC Science & Technology

    During the current period we completed work on a series of guanine nucleotide mimetics and published results. As part of this we developed and...reported a novel method of measuring small molecule binding to KRAS G12C active site. We also published 2 additional manuscripts about KRAS G12C directed

  10. Inherited thrombophilia in pregnant women with intrauterine growth restriction.

    PubMed

    Coriu, Letitia; Copaciu, Elena; Tulbure, Dan; Talmaci, Rodica; Secara, Diana; Coriu, Daniel; Cirstoiu, Monica

    2014-12-01

    Intrauterine growth restriction (IUGR) is a major cause of fetal morbidity and mortality during pregnancy. The role of mutation in the factor V gene, prothrombin gene, MTHFR gene, as risk factors for intrauterine growth restriction during pregnancy, is not very well known so far. This is a retrospective study of 151 pregnant women with a history of complicated pregnancy: intrauterine growth restriction, preeclampsia, recurrent pregnancy loss or maternal venous thromboembolism, who were admitted in Bucharest Emergency University Hospital, during the period January 2010 to July 2014. Genetic testing was performed for all the cases to detect: factor V Leiden mutation, G20210A mutation in the prothrombin gene, C677T mutation and A1298C mutation in methylenetetrahydrofolate reductase (MTHFR) gene. Blood samples were obtained as soon as the diagnosis of intrauterine growth restriction was established with ultrasonography. The following gene mutations were associated with increased risk of IUGR: G20210A prothrombin gene mutation (OR 4.81, 95% CI 1.05 - 2.22, p= 0.043), G1691A factor V gene mutation (factor V Leiden) (OR 1.58, 95% CI 0.61 - 4.080, p= 0.347), C677T MTHFR gene mutation (OR 1.61, 95% CI 0.79 to 3.26, p= 0.186), compound heterozygous MTHFR C677T and A1298C (OR 1.66, 95% CI 0.81- 3.42, p= 0.169). Particularly, for G20210A prothrombin gene mutation we found statistically significant risk (p≤0.05) of IUGR.

  11. 48 CFR 1827.302 - Policy. (NASA supplements paragraphs (a), (b), (c), (d), (e), (f), (g), and (i)).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Policy. (NASA supplements paragraphs (a), (b), (c), (d), (e), (f), (g), and (i)). 1827.302 Section 1827.302 Federal Acquisition... the performance of experimental, developmental, or research work with a small business firm or a...

  12. More severe toxicity of genetic polymorphisms on MTHFR activity in osteosarcoma patients treated with high-dose methotrexate

    PubMed Central

    Xie, Lu; Guo, Wei; Yang, Yi; Ji, Tao; Xu, Jie

    2018-01-01

    5,10-Methylenetrahydrofolate reductase (MTHFR), a key enzyme for folate metabolism, catalyses the irreversible conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, which is located at the end of the short arm (1p36.3). Two common non-synonymous variants, the C677T (Ala222Val) and A1298C (Glu429Ala), were mainly described with decreased enzymatic activity and an alteration of intracellular folate distribution. Osteosarcomas are currently treated with high dose of methotrexate (MTX). The decreased enzyme activity of MTHFR theoretically could increase the drug action of MTX and at the same time increase toxic and side effect. Germline variants of C677T and A1298C were studied in 59 osteosarcoma patients, with whom the A1298C is detected with particularly low rate of mutant genotype (N = 1, 0.8%) and could not proceed with statistical calculations. 15 patients were wild type of C677T (CC, 25.4%), 20 were heterozygous mutant genotype (CT, 33.9%) and 24 were homozygous mutant genotype (TT, 40.7%). Patients harboring the TT/CT genotype had the same progression-free survival and tumor necrosis rate in comparison with patients having the CC genotype (P = 0.349 and P = 0.465 respectively). And the C677T polymorphisms had no significant correlation with MTX initial plasma concentration (P = 0.867; r = 0.024) and delayed elimination (P = 0.305; r = −0.136). However patients with mutant genotype of C677T were associated with higher degree of liver toxicity (P = 0.043) and fever reaction of MTX (P = 0.050) while G3/G4 hematologic toxicity were more likely to be noticed with TT than CT/CC (P = 0.095). The study suggests that genetic polymorphism of MTHFR C677T in the MTX metabolic pathway seems to be associated with the trend for more side effects statistically, but has no obvious effect on histologic response and survival. PMID:29545912

  13. Hospital-based epidemiological and clinical characterisation of the malignant transformation of oral leukoplakia in a Chinese population.

    PubMed

    Lyu, Ming-Yue; Guo, Yu-Si; Li, Shuo; Yang, Di; Hua, Hong

    2017-08-01

    The aim of this review was to analyse, systematically, hospital-based epidemiological information concerning the malignant transformation rate (MTR) of oral leukoplakia (OL) in a Chinese population, as well as the associated risk factors. Four electronic databases were searched for studies dealing with OL and related risk factors, including age, gender, type of lesion, site, and smoking and drinking habits. The MTR of OL in the hospital-based Chinese population ranged from 4% to 13%, based on the studies analysed. Regarding risk factors, we found that female patients had a higher MTR than male patients, and that patients older than 50 years of age also had a higher MTR. Patients who smoked had a lower MTR, while alcohol consumption seemed to have no association with MTR. Malignant transformation occurred most commonly on the tongue. Regarding lesion type, non-homogeneous OL had a higher MTR, with the granular type having the highest MTR. Our results regarding the epidemiology of OL showed a similar trend to those reported in western populations and provided preliminary epidemiological information on the Chinese population. Our findings show that female gender, age >50 years and non-homogeneous OL are risk factors for malignant transformation. It is important to develop clinical strategies to educate, diagnose and treat patients with OL and to minimise the MTR of OL. © 2017 FDI World Dental Federation.

  14. BMP15 c.-9C>G promoter sequence variant may contribute to the cause of non-syndromic premature ovarian failure.

    PubMed

    Fonseca, Dora Janeth; Ortega-Recalde, Oscar; Esteban-Perez, Clara; Moreno-Ortiz, Harold; Patiño, Liliana Catherine; Bermúdez, Olga María; Ortiz, Angela María; Restrepo, Carlos M; Lucena, Elkin; Laissue, Paul

    2014-11-01

    BMP15 has drawn particular attention in the pathophysiology of reproduction, as its mutations in mammalian species have been related to different reproductive phenotypes. In humans, BMP15 coding regions have been sequenced in large panels of women with premature ovarian failure (POF), but only some mutations have been definitely validated as causing the phenotype. A functional association between the BMP15 c.-9C>G promoter polymorphism and cause of POF have been reported. The aim of this study was to determine the potential functional effect of this sequence variant on specific BMP15 promoter transactivation disturbances. Bioinformatics was used to identify transcription factor binding sites located on the promoter region of BMP15. Reverse transcription polymerase chain reaction was used to study specific gene expression in ovarian tissue. Luciferase reporter assays were used to establish transactivation disturbances caused by the BMP15 c.-9C>G variant. The c.-9C>G variant was found to modify the PITX1 transcription factor binding site. PITX1 and BMP15 co-expressed in human and mouse ovarian tissue, and PITX1 transactivated both BMP15 promoter versions (-9C and -9G). It was found that the BMP15 c.-9G allele was related to BMP15 increased transcription, supporting c.-9C>G as a causal agent of POF. Copyright © 2014 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  15. Apert Syndrome: Molecularly Confirmed C.758C>G (P.Pro253Arg) in FGFR2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cha Gon, Lee, E-mail: leechagon@eulji.ac.kr

    A 5-day-old girl was referred to our clinic for evaluation of congenital malformations. She was identified with a pathogenic mutation c.758C>G (p.Pro253Arg) in FGFR2 gene using targeted exome sequencing. The de novo mutation was confirmed with Sanger sequencing in the patient and her parents. She showed occipital plagiocephaly with frontal bossing (Figure A and B). Skull frontal and lateral radiography revealed fusion of most of the sutures except coronal suture, with convolutional markings (Figure D and E). She had complete cleft palate (Figure C). Her fused bilateral hands showed type II syndactyly with complete syndactyly between the ring and themore » little fingers (Figure F1-F3). Both toes were simple syndactyly with side-to-side fusion of skin (Figure G1-)« less

  16. The first step in using a robot in brain injury rehabilitation: patients' and health-care professionals' perspective.

    PubMed

    Boman, Inga-Lill; Bartfai, Aniko

    2015-01-01

    To evaluate the usability of a mobile telepresence robot (MTR) in a hospital training apartment (HTA). The MTR was manoeuvred remotely and was used for communication when assessing independent living skills, and for security monitoring of cognitively impaired patients. Occupational therapists (OTs) and nurses received training in how to use the MTR. The nurses completed a questionnaire regarding their expectations of using the MTR. OTs and patients staying in the HTA were interviewed about their experiences of the MTR. Interviews and questionnaires were analysed qualitatively. The HTA patients were very satisfied with the MTR. The OTs and nurses reported generally positive experiences. The OT's found that assessment via the MTR was more neutral than being physically present. However, the use of the MTR implied considerable difficulties for health-care professionals. The main obstacle for the nurses was the need for fast and easy access in emergency situations while protecting the patients' integrity. The results indicate that the MTR could be a useful tool to support daily living skills and safety monitoring of HTA patients. However, when designing technology for multiple users, such as health-care professionals, the needs of all users, their routines and support services involved, should also be considered. Implications for Rehabilitation A mobile telepresence robot (MTR) can be a useful tool for assessments and communication in rehabilitation. The design of the robot has to allow easy use by remote users, particularly in emergency situations. When designing MTRs the needs of ALL users have to be taken into consideration.

  17. Effect of the structure distortion on the high photocatalytic performance of C60/g-C3N4 composite

    NASA Astrophysics Data System (ADS)

    Ma, Xiaojuan; Li, Xinru; Li, Mengmeng; Ma, Xiangchao; Yu, Lin; Dai, Ying

    2017-08-01

    C60/g-C3N4 composite was reported experimentally to be of high photocatalytic activity in degrading organics. To investigate the underlying mechanism of high photocatalytic performance, the structural and electronic properties of g-C3N4 monolayers with adsorbing and removing fullerene C60 are studied by means of density functional theory calculations. After 25 possible configurations examination, it is found that C60 prefers to stay upon the ;junction nitrogen; with the carbon atom of fullerene being nearest to monolayers. Correspondingly, a type-I band alignment appears. Our results further demonstrate that the adsorption of C60 can lead to an irreversible structure distortion for g-C3N4 from flat to wrinkle, which plays a crucial role in improving photocatalytic performance other than the separation of carriers at interface due to the formation of type-II heterojunctions as previous report. Compared to flat one, the light absorption of wrinkled structure shows augmented, the valence band maximum shifts towards lower position along with a stronger photo-oxidation capability. Interestingly, the results indicate that the energy, light absorption and band edge all have a particular relationship with wrinkle degree. The work presented here can be helpful to understand the mechanism behind the better photocatalytic performance for C60 modified g-C3N4.

  18. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

    PubMed

    Branco, Claudia C; Gomes, Cidália T; De Fez, Laura; Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C

  19. Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal)

    PubMed Central

    Bulhões, Sara; Brilhante, Maria José; Pereirinha, Tânia; Cabral, Rita; Rego, Ana Catarina; Fraga, Cristina; Miguel, António G.; Brasil, Gracinda; Macedo, Paula; Mota-Vieira, Luisa

    2015-01-01

    Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations– c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family’s HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40−2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins—the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G

  20. A Phenotypic Cell-Binding Screen Identifies a Novel Compound Targeting Triple-Negative Breast Cancer.

    PubMed

    Chen, Luxi; Long, Chao; Youn, Jonghae; Lee, Jiyong

    2018-06-11

    We describe a "phenotypic cell-binding screen" by which therapeutic candidate targeting cancer cells of a particular phenotype can be isolated without knowledge of drug targets. Chemical library beads are incubated with cancer cells of the phenotype of interest in the presence of cancer cells lacking the phenotype of interest, and then the beads bound to only cancer cells of the phenotype of interest are selected as hits. We have applied this screening strategy in discovering a novel compound (LC129-8) targeting triple-negative breast cancer (TNBC). LC129-8 displayed highly specific binding to TNBC in cancer cell lines and patient-derived tumor tissues. LC129-8 exerted anti-TNBC activity by inducing apoptosis, inhibiting proliferation, reversing epithelial-mesenchymal transition, downregulating cancer stem cell activity and blocking in vivo tumor growth.

  1. A Conserved Interaction between a C-Terminal Motif in Norovirus VPg and the HEAT-1 Domain of eIF4G Is Essential for Translation Initiation

    PubMed Central

    Leen, Eoin N.; Sorgeloos, Frédéric; Correia, Samantha; Chaudhry, Yasmin; Cannac, Fabien; Pastore, Chiara; Xu, Yingqi; Graham, Stephen C.; Matthews, Stephen J.; Goodfellow, Ian G.; Curry, Stephen

    2016-01-01

    Translation initiation is a critical early step in the replication cycle of the positive-sense, single-stranded RNA genome of noroviruses, a major cause of gastroenteritis in humans. Norovirus RNA, which has neither a 5´ m7G cap nor an internal ribosome entry site (IRES), adopts an unusual mechanism to initiate protein synthesis that relies on interactions between the VPg protein covalently attached to the 5´-end of the viral RNA and eukaryotic initiation factors (eIFs) in the host cell. For murine norovirus (MNV) we previously showed that VPg binds to the middle fragment of eIF4G (4GM; residues 652–1132). Here we have used pull-down assays, fluorescence anisotropy, and isothermal titration calorimetry (ITC) to demonstrate that a stretch of ~20 amino acids at the C terminus of MNV VPg mediates direct and specific binding to the HEAT-1 domain within the 4GM fragment of eIF4G. Our analysis further reveals that the MNV C terminus binds to eIF4G HEAT-1 via a motif that is conserved in all known noroviruses. Fine mutagenic mapping suggests that the MNV VPg C terminus may interact with eIF4G in a helical conformation. NMR spectroscopy was used to define the VPg binding site on eIF4G HEAT-1, which was confirmed by mutagenesis and binding assays. We have found that this site is non-overlapping with the binding site for eIF4A on eIF4G HEAT-1 by demonstrating that norovirus VPg can form ternary VPg-eIF4G-eIF4A complexes. The functional significance of the VPg-eIF4G interaction was shown by the ability of fusion proteins containing the C-terminal peptide of MNV VPg to inhibit in vitro translation of norovirus RNA but not cap- or IRES-dependent translation. These observations define important structural details of a functional interaction between norovirus VPg and eIF4G and reveal a binding interface that might be exploited as a target for antiviral therapy. PMID:26734730

  2. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    PubMed

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  3. A population survey of the glucose-6-phosphate dehydrogenase (G6PD) 563C>T (Mediterranean) mutation in Afghanistan.

    PubMed

    Jamornthanyawat, Natsuda; Awab, Ghulam R; Tanomsing, Naowarat; Pukrittayakamee, Sasithon; Yamin, Fazel; Dondorp, Arjen M; Day, Nicholas P J; White, Nicholas J; Woodrow, Charles J; Imwong, Mallika

    2014-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common inherited enzyme defect and an important problem in areas with Plasmodium vivax infection because of the risk of haemolysis following administration of primaquine to treat the liver forms of the parasite. We undertook a genotypic survey of 713 male individuals across nine provinces of Afghanistan in which malaria is found, four in the north and five in the east. RFLP typing at nucleotide position 563 detected 40 individuals with the Mediterranean mutation 563C>T, an overall prevalence of 5.6%. This varied according to self-reported ethnicity, with prevalence in the Pashtun/Pashai group of 33/369 (8.9%) compared to 7/344 individuals in the rest of the population (2.0%; p<0.001, Chi-squared test). Multivariate analysis of ethnicity and geographical location indicated an adjusted odds ratio of 3.50 (95% CI 1.36-9.02) for the Pashtun/Pashai group, while location showed only a trend towards higher prevalence in eastern provinces (adjusted odds ratio = 1.73, 0.73-4.13). Testing of known polymorphic markers (1311C>T in exon 11, and C93T in intron XI) in a subset of 82 individuals wild-type at C563 revealed a mixture of 3 haplotypes in the background population and was consistent with data from the 1000 Genomes Project and published studies. By comparison individuals with G6PD deficiency showed a highly skewed haplotype distribution, with 95% showing the CT haplotype, a finding consistent with relatively recent appearance and positive selection of the Mediterranean variant in Afghanistan. Overall, the data confirm that the Mediterranean variant of G6PD is common in many ethnic groups in Afghanistan, indicating that screening for G6PD deficiency is required in all individuals before radical treatment of P. vivax with primaquine.

  4. Mutating the CX3C Motif in the G Protein Should Make a Live Respiratory Syncytial Virus Vaccine Safer and More Effective.

    PubMed

    Boyoglu-Barnum, S; Todd, S O; Meng, J; Barnum, T R; Chirkova, T; Haynes, L M; Jadhao, S J; Tripp, R A; Oomens, A G; Moore, M L; Anderson, L J

    2017-05-15

    Respiratory syncytial virus (RSV) belongs to the family Paramyxoviridae and is the single most important cause of serious lower respiratory tract infections in young children, yet no highly effective treatment or vaccine is available. Through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein, RSV binds to the corresponding chemokine receptor, CX3CR1. Since RSV binding to CX3CR1 contributes to disease pathogenesis, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), which is known to block binding to CX3CR1, might decrease disease. We studied the effect of the CX4C mutation in two strains of RSV (A2 and r19F) in a mouse challenge model. We included RSV r19F because it induces mucus production and airway resistance, two manifestations of RSV infection in humans, in mice. Compared to wild-type (wt) virus, mice infected with CX4C had a 0.7 to 1.2 log 10 -fold lower virus titer in the lung at 5 days postinfection (p.i.) and had markedly reduced weight loss, pulmonary inflammatory cell infiltration, mucus production, and airway resistance after challenge. This decrease in disease was not dependent on decrease in virus replication but did correspond to a decrease in pulmonary Th2 and inflammatory cytokines. Mice infected with CX4C viruses also had higher antibody titers and a Th1-biased T cell memory response at 75 days p.i. These results suggest that the CX4C mutation in the G protein could improve the safety and efficacy of a live attenuated RSV vaccine. IMPORTANCE RSV binds to the corresponding chemokine receptor, CX3CR1, through a CX3C chemokine motif ( 182 CWAIC 186 ) in the G protein. RSV binding to CX3CR1 contributes to disease pathogenesis; therefore, we investigated whether a mutation in the CX3C motif by insertion of an alanine, A 186 , within the CX3C motif, mutating it to CX4C ( 182 CWAIAC 187 ), known to block binding to CX3CR1, might decrease disease

  5. Methylenetetrahydrofolate reductase polymorphisms and risk of acute lymphoblastic leukemia-evidence from an updated meta-analysis including 35 studies.

    PubMed

    Wang, Haigang; Wang, Jiali; Zhao, Lixia; Liu, Xinchun; Mi, Wenjie

    2012-09-04

    5,10-methylenetetrahydrofolate reductase (MTHFR) variants, C677T and A1298C, have been reported to be associated with decreased risk of acute lymphoblastic leukemia (ALL). However, results derived from individually underpowered studies are conflicting. We carried out an updated meta-analysis on the association between MTHFR polymorphisms and ALL risk. Relevant publications were searched through PUBMED and EMBASE databases. The associations between MTHFR C677T and A1298C polymorphisms and the risk of ALL were evaluated by odds ratios (ORs). The heterogeneity and publication bias were estimated. Meta-regression analysis was performed to evaluate the potential sources of heterogeneity. C677T polymorphism was associated with a reduced risk of ALL (allele contrast: ORRE = 0.91, 95% CI: 0.83-0.99). Subgroup analysis showed MTHFR C677T variant was associated with decreased susceptibility to ALL in children and Caucasians. Meta-regression showed the logOR for the association between T allele and ALL increased as sex ratio (M/F) in the case group increased (P = 0.01). Regarding A1298C polymorphism, no significant association was observed (allele contrast: ORRE = 1.01, 95% CI: 0.91-1.11). There was no publication bias for C677T or A1298C polymorphism. The present meta-analysis suggests that the C677T polymorphism, not A1298C, in MTHFR gene is associated with a decreased risk of ALL, particularly among children and Caucasians subjects. Our findings suggest that the influence of the C677T polymorphism on ALL susceptibility is modified by sex ratio in cases (M/F). Since folate intake may be a possible confounding factor, including this factor in future prospective studies is warranted. Further meta-analysis studies should be at least stratified for folate levels and gender to give more powerful and informative results.

  6. An ingenious strategy of preparing TiO2/g-C3N4 heterojunction photocatalyst: In situ growth of TiO2 nanocrystals on g-C3N4 nanosheets via impregnation-calcination method

    NASA Astrophysics Data System (ADS)

    Zhang, Guanghui; Zhang, Tianyong; Li, Bin; Jiang, Shuang; Zhang, Xia; Hai, Li; Chen, Xingwei; Wu, Wubin

    2018-03-01

    An ingenious method was employed to design and fabricate the TiO2/g-C3N4 heterojunction photocatalysts in this study. The thermal oxidation etching of g-C3N4 nanosheets and the in situ growth of TiO2 nanocrystal on the surface of g-C3N4 nanosheets were completed simultaneously by the calcination process. The g-C3N4 nanosheets played a crucial role in regulating and assembling the structures and morphologies of TiO2. Furthermore, the thickness and content of g-C3N4, and the crystallinity of TiO2 in TiO2/g-C3N4 composites could be regulated and controlled by the calcination temperature. Among the resultant TiO2/g-C3N4 samples, the TiO2/g-C3N4 sample with 41.6 wt% g-C3N4 exhibited the highest photocatalytic activity. It could degrade almost all MO molecules under visible light irradiation within 3 h. Moreover, it displayed higher visible light photocatalytic performance for degrading MO solution than pure g-C3N4 and D-TiO2. The synergistic effect between TiO2 and g-C3N4 makes significant contributions to the enhancement of the visible light photocatalytic activity. In addition, the favorable photocatalytic performance of TiO2/g-C3N4 nanocomposites is also attributed to the porous structures and uniform morphologies, and large surface area. Furthermore, the resultant TiO2/g-C3N4 exhibits excellent photocatalytic stability. Radical trapping experiments indicated that rad O2- and h+ were the main reactive species during the photodegradation process under visible light irradiation. Hopefully, the results can offer new design and strategy for preparing other g-C3N4-based nanocomposites for environmental and energy applications.

  7. 5,10-methylenetetrahydrofolate reductase (MTHFR) polymorphisms and the risk of acute lymphoblastic leukemia (ALL) in Filipino children.

    PubMed

    Alcasabas, Patricia; Ravindranath, Yaddanapudi; Goyette, Gerard; Haller, Andrew; Del Rosario, Luz; Lesaca-Medina, Maria Ysabel; Darga, Linda; Ostrea, Enrique M; Taub, Jeffrey W; Everson, Richard B

    2008-08-01

    5,10-Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism. Polymorphisms at the C677T and A1298C loci are associated with reduced activity; consequently more folate substrates are shunted toward thymidylate and DNA synthesis. Several studies have reported a reduced risk of developing ALL in children with MTHFR polymorphisms. The objective of this study was to determine the association between MTHFR polymorphisms and ALL in Filipino children. We conducted a case control study in children diagnosed with ALL at the Philippine General Hospital from 1/2001 through 12/2005. Bone marrow aspirate slides were reviewed by two expert hematologists to verify the morphologic diagnosis of ALL. DNA was isolated from the slides and MTHFR polymorphisms, C677T and A1298C, were determined using Taqman real-time PCR. Cord blood of healthy Filipino newborns served as control. There were a total of 191 ALL and 394 controls genotyped. The distribution of C677T polymorphisms was similar in the two groups (P = 1.0). However, for A1298C, there was significantly more AC and CC genotypes in the ALL compared to controls (P = 0.02; OR 1.57; CI: 1.08-2.28). The 1298C allele frequency for the control group was 36.8% and 677T allele frequency was 9.9%. A1298C polymorphisms is associated with an increased risk for ALL in Filipino children. This may be due to a difference in leukemia biology or to a high prevalence of folate deficiency in Filipinos. Our study reiterates the gene and environment interaction in leukemogenesis.

  8. Self-assembled hierarchical carbon/g-C3N4 composite with high photocatalytic activity

    NASA Astrophysics Data System (ADS)

    Huang, Ru-Long; Huang, Wei-Qing; Li, Dong-Feng; Ma, Li-Li; Pan, Anlian; Hu, Wangyu; Fan, Xiaoxing; Huang, Gui-Fang

    2018-04-01

    Hierarchical carbon/g-C3N4 composites consisting of nanosheets are synthesized by a direct thermal diffusion and exfoliation approach with glucose acting as the intercalator and carbon source. This facile protocol not only renders nanosheets with a large surface area, but also carbon intercalation into the interlayer of g-C3N4. Therefore, the synthesized carbon/g-C3N4 composites exhibit superior photocatalytic performance for degrading representative methylene blue (MB) under visible light irradiatuon. Carbon/g-C3N4 composites with an optimal glucose mass ratio of 0.25% show the apparent reaction rate constant of 0.253 h-1, which is 9 times higher than that over bluk g-C3N4. The superior photocatalytic performance of carbon/g-C3N4 hierarchical architectures can be attributed to the synergic effects of large reactive sites, effective visible light adsorption and faster charge transfer owing to the superior electron transfer ability of carbon as verified by the PL and photoelectrochemical measurements. The main reactive species responsible for the photocatalytic degradation are photoinduced holes and ·OH radicals under visible light irradiation. This work provides a facile way to fabricate effecient g-C3N4-based photocatalysts for the potential application in dealing with environmental and energy shortage issues using solar energy.

  9. Effect of C-G (Hithiol capsule) on radiotoxemia (in Japanese)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huruta, A.; Nakada, J.

    1973-03-01

    C-G capsule was administered to the patients treated with a large quantity of remote cobalt irradiation, and its effect on symptoms of radiotoxemia was examined. One capsule of C-G containing 80 mg of cysteine and 120 mg of glucose within one capsule were administered three times a day and one capsule out of three was administered between meals. Symptoms of radiotoxemia such as total fatigue, nausea and vomiting, and anorexia were observed. Blood examination was carried out before irradiation, and after irradiation it was carried out once a week. The reported cases consist of 10 cases of breast cancer andmore » its metastasis, four of brain neoplasms, three of penis neoplasms, two of uterus cancer (cervical uterus), two of larynx cancer, and one case each of maxilla cancer, tonsil cancer, parotid gland cancer, lung cancer, ovarian tumor, malignant lympadenoma, and chondrosarcoma. Six control subjects were used. Out of 28 cases, a dramatic response of the patients was recognized in five cases, an effective response in 19 cases, and an ineffective response in four cases. Two cases out of five that were treated with other preventives against radiotoxemia showed an ineffective response, and three cases showed effects thought to be potentiation. Especially, decrease of leukocytes was mild with prompt recovery. In the case of the chest and abdomen irradiation, four control subjects showed strong general radiotoxemia and marked decrease of leukocytes, and in the group administered C-G, one case discontinued irradiation. Moreover, symptoms, radiotherapy, radiotoxemia, and blood findings of the group administered C-G were also explained. (JA)« less

  10. Imidazole modified g-C3N4 photocatalyst: Structural characterization and versatile energy applications

    NASA Astrophysics Data System (ADS)

    Zhang, Lu; Liu, Qianqian; Chai, Yuanyuan; Ren, Jia; Dai, Wei-Lin

    2018-02-01

    Novel imidazole modified g-C3N4 were firstly synthesized via a facile one-pot thermo-induced co-condensation method. Characterization results showed that imidazole modification can improve the visible light harvesting, interfacial charge transfer and separation of g-C3N4, without destroying its pristine framework structure. The as-obtained imidazole modified g-C3N4 showed remarkably enhanced and rather stable photocatalytic performance in H2 evolution, photo-degradation of water contaminants and selective photo-oxidation of benzyl alcohol, demonstrating its all-round applications as a versatile photocatalyst. The weight ratio between imidazole and urea was well tuned and the optimal photocatalytic activity was obtained, which shows CNU-I50 sample (50 mg imidazole in 15 g urea) possesses the highest hydrogen evolution rate of 2150 μmol g-1 h-1, superior to most of the previous reported g-C3N4 materials. These results suggest that those imidazole modified g-C3N4 materials are potential photocatalyst when applied to solar energy conversion, water purification and selective photosynthesis reactions.

  11. c-MYC G-quadruplex binding by the RNA polymerase I inhibitor BMH-21 and analogues revealed by a combined NMR and biochemical Approach.

    PubMed

    Musso, Loana; Mazzini, Stefania; Rossini, Anna; Castagnoli, Lorenzo; Scaglioni, Leonardo; Artali, Roberto; Di Nicola, Massimo; Zunino, Franco; Dallavalle, Sabrina

    2018-03-01

    Pyridoquinazolinecarboxamides have been reported as RNA polymerase I inhibitors and represent a novel class of potential antitumor agents. BMH-21, was reported to intercalate with GC-rich rDNA, resulting in nucleolar stress as a primary mechanism of cytotoxicity. The interaction of BMH-21 and analogues with DNA G-quadruplex structures was studied by NMR and molecular modelling. The cellular response was investigated in a panel of human tumor cell lines and protein expression was examined by Western Blot analysis. We explored the ability of BMH-21 and its analogue 2 to bind to G-quadruplex present in the c-MYC promoter, by NMR and molecular modelling studies. We provide evidence that both compounds are not typical DNA intercalators but are effective binders of the tested G-quadruplex. The interaction with c-MYC G-quadruplex was reflected in down-regulation of c-Myc expression in human tumor cells. The inhibitory effect was almost complete in lymphoma cells SUDHL4 characterized by overexpression of c-Myc protein. This downregulation reflected an early and persistent modulation of cMyc mRNA. Given the relevance of c-MYC in regulation of ribosome biogenesis, it is conceivable that the inhibition of c-MYC contributes to the perturbation of nuclear functions and RNA polymerase I activity. Similar experiments with CX-5461, another RNA polymerase I transcription inhibitor, indicate the same behaviour in G-quadruplex stabilization. Our results support the hypothesis that BMH-21 and analogue compounds share the same mechanism, i.e. G-quadruplex binding as a primary event of a cascade leading to inhibition of RNA polymerase I and apoptosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Methylenetetrahydrofolate reductase gene haplotypes affect toxicity during maintenance therapy for childhood acute lymphoblastic leukemia in Japanese patients.

    PubMed

    Tanaka, Yoichi; Manabe, Atsushi; Nakadate, Hisaya; Kondoh, Kensuke; Nakamura, Kozue; Koh, Katsuyoshi; Kikuchi, Akira; Komiyama, Takako

    2014-05-01

    Abstract The aim of this study was to investigate the influence of daily 6-mercaptopurine (6-MP) and low-dose weekly methotrexate (MTX) combination treatment and methylenetetrahydrofolate reductase (MTHFR) haplotypes on toxicity during maintenance therapy in Japanese childhood acute lymphoblastic leukemia (ALL). We retrospectively analyzed the MTHFR C677T and A1298C polymorphisms and influence of haplotypes on toxicity in 73 patients. Patients with the MTHFR 677TT and 677CT + 1298AC were associated with severe liver toxicity (p = 0.014, odds ratio [OR] = 3.82, 95% confidence interval [CI] = 1.27-11.46) and more rapid onset of liver toxicity (p = 0.010). Patients with MTHFR 677TT and 677CT + 1298AC were associated with lower frequency of 6-MP and MTX dose reduction due to leukopenia (p < 0.05). No difference was observed in average drug doses in the MTHFR genotypes. In conclusion, the MTHFR C677T and A1298C haplotypes might be useful for monitoring adverse effects in childhood ALL maintenance therapy in Japanese patients.

  13. Possible protective role of the ABCA4 gene c.1268A>G missense variant in Stargardt disease and syndromic retinitis pigmentosa in a Sicilian family: Preliminary data.

    PubMed

    D'Angelo, Rosalia; Donato, Luigi; Venza, Isabella; Scimone, Concetta; Aragona, Pasquale; Sidoti, Antonina

    2017-04-01

    In the wide horizon of ophthalmologically rare diseases among retinitis pigmentosa forms, Stargardt disease has gradually assumed a significant role due to its heterogeneity. In the present study, we aimed to support one of two opposite hypotheses concerning the causative or protective role of heterozygous c.1268A>G missense variant of the ABCA4 gene in Stargardt disease and in syndromic retinitis pigmentosa. This study was based on a family consisting of three members: proband, age 54, with high myopia, myopic chorioretinitis and retinal dystrophy; wife, age 65, with mild symptoms; daughter, age 29, asymptomatic. After genetic counseling, ABCA4 and RP1 gene analysis was performed. The results highlighted an important genetic picture. The proband was found to carry two variant RP1 SNPs, rs2293869 (c.2953A>T) and rs61739567 (c.6098G>A), and, a wild-type condition for four RP1 polymorphisms, rs444772 (c.2623G>A) and three SNPs in the 'hot-spot' region, exon 4. The proband's wife, instead, showed an opposite condition compared to her husband: a homozygous mutated condition for the first four SNPs analyzed, while the last two were wild-type. Regarding the ABCA4 gene, the proband evidenced a wild-type condition. Furthermore, the wife showed a heterozygous condition of ABCA4 rs3112831 (c.1268A>G). As expected, the daughter presented heterozygosity for all variants of both genes. In conclusion, even though the c.1268A>G missense variant of the ABCA4 gene has often been reported as causative of disease, and in other cases protective of disease, in our family case, the variant appears to reduce or delay the risk of onset of Stargardt disease.

  14. Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

    PubMed Central

    Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

    2016-01-01

    RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

  15. C9ORF72 G4C2-repeat expansion and frontotemporal dementia first reported case in Argentina.

    PubMed

    Fernández Suarez, M; Surace, Ezequiel; Harris, P; Tapajoz, F; Sevlever, G; Allegri, R; Russo, G N

    2016-06-01

    We present a female patient aged 51 who developed behavioral disorders followed by cognitive impairment over 3 years. Neuropsychological, neuropsychiatric, and radiological features suggested a probable behavioral variant of frontotemporal dementia (bvFTD). A family history of amyotrophic lateral sclerosis and parkinsonism suggested the hexanucleotide repeat expansion G4C2 in C9ORF72 . We set up a two-step genotyping algorithm for the detection of the expansion using fragment-length analysis polymerase chain reaction (PCR) and repeat-primed PCR with fluorescent primers. We confirmed the presence of an expanded G4C2 allele in the patient. This represents the first documented case of bvFTD due to a C9ORF72 expansion in Argentina.

  16. Solar promoted azo dye degradation and energy production in the bio-photoelectrochemical system with a g-C3N4/BiOBr heterojunction photocathode

    NASA Astrophysics Data System (ADS)

    Hou, Yanping; Gan, Yuanyuan; Yu, Zebin; Chen, Xixi; Qian, Lun; Zhang, Boge; Huang, Lirong; Huang, Jun

    2017-12-01

    In this study, a single-chamber bio-photoelectrochemical system (BPES), integrating advantages of bioelectrochemical system and photocatalysis process, is developed using a g-C3N4/BiOBr heterojunction photocathode for methyl orange (MO) degradation and simultaneous energy recovery. Photocatalytic activities of g-C3N4/BiOBr, g-C3N4 and BiOBr are characterized by UV-vis diffuse reflectance spectra (UV-vis DRS) and Photoluminescence (PL) spectra; and electrochemical activities of photocathodes are examined by linear sweep voltammetry (LSV) and electrochemical impedance spectroscopy (EIS). Results show that with an applied voltage of 0.8 V and under simulated solar irradiation, MO decolorization with g-C3N4/BiOBr photocathode reaches 97.8% within 4 h, higher than those with g-C3N4 (85.3%) and BiOBr (87.3%) photocathodes. Likewise, higher hydrogen production rate (143.8 L m-3d-1) is observed using g-C3N4/BiOBr photocathode; while values for g-C3N4 and BiOBr photocathodes are 124.3 L m-3d-1 and 117.1 L m-3d-1, respectively. PL and EIS reveal that superior performance of g-C3N4/BiOBr photocathode can be attributed to more efficient separation of photogenerated electron-hole pairs, lower resistance and better charge transfer. Synergistic effect occurs among biological, electrochemical and photocatalytic processes in illuminated BPES for MO removal. Photocathode optimization and system stability evaluation are conducted. This study demonstrates that the BPES holds great potential for efficient refractory organics degradation and energy production.

  17. Exploration of G-quadruplex function in c-Myb gene and its transcriptional regulation by topotecan.

    PubMed

    Li, Fangyuan; Zhou, Jiang; Xu, Ming; Yuan, Gu

    2018-02-01

    Our bioinformatics research shows that there are four G-rich sequences (S1-S4) in the upstream region of the transcription start site of c-Myb gene, and we have proved that these sequences have the ability to form G-quadruplex structures. This work mainly focuses on G-quadruplex function, recognition and transcription regulation in c-Myb gene, revealing a novel regulatory element in c-Myb proximal promoter region, and its transcription regulation by G-quadruplex binder. The research has identified that the enhancer effect in c-Myb transcription was primarily affected by the G-quadruplex formed by S1 sequence, and the up-regulation effect may due to the removal of repressive progress of MZF-1 by stabilizing G-quadruplex. Attentions were being paid to the development of G-quadruplex binders for selective recognition, and topotecan was found to have high binding affinity in vitro and could effectively affect the c-Myb transcription activities in cells. The regulation of G-quadruplex with binders in transcriptional, translational levels by Q-RT-PCR and western blot was in expectation of providing a strategy for gene expression modulation. In conclusion, our study revealed a G-quadruplex structure in c-Myb proximal promoter region, which was of great importance in the regulation of c-Myb function. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  19. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...

  20. 28 CFR 572.40 - Compassionate release under 18 U.S.C. 4205(g).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    .... 4205(g)) § 572.40 Compassionate release under 18 U.S.C. 4205(g). 18 U.S.C. 4205(g) was repealed... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Compassionate release under 18 U.S.C. 4205(g). 572.40 Section 572.40 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE...