Science.gov

Sample records for a1555g 12s rrna

  1. The coexistence of mitochondrial ND6 T14484C and 12S rRNA A1555G mutations in a Chinese family with Leber's hereditary optic neuropathy and hearing loss

    SciTech Connect

    Wei Qiping; Zhou Xiangtian; Yang Li

    2007-06-15

    We report here the clinical, genetic and molecular characterization of one three-generation Han Chinese family with Leber's hereditary optic neuropathy (LHON) and hearing loss. Four of 14 matrilineal relatives exhibited the moderate central vision loss at the average age of 12.5 years. Of these, one subject exhibited both LHON and mild hearing impairment. Sequence analysis of the complete mitochondrial genomes in the pedigree showed the presence of homoplasmic LHON-associated ND6 T14484C mutation, deafness-associated 12S rRNA A1555 mutation and 47 other variants belonging to Eastern Asian haplogroup H2. None of other mitochondrial variants was evolutionarily conserved and functional significance. Therefore, themore » coexistence of the A1555G mutation and T14484C mutations in this Chinese family indicate that the A1555G mutation may play a synergistic role in the phenotypic manifestation of LHON associated ND6 T14484C mutation. However, the incomplete penetrance of vision and hearing loss suggests the involvement of nuclear modifier genes and environmental factors in the phenotypic expression of these mtDNA mutations.« less

  2. Prevalence of Mitochondrial 12S rRNA Mutations Associated with Aminoglycoside Ototoxicity

    ERIC Educational Resources Information Center

    Guan, Min-Xin

    2005-01-01

    The mitochondrial DNA (mtDNA) 12S rRNA is a hot spot for mutations associated with both aminoglycoside-induced and nonsyndromic hearing loss. Of those, the homoplasmic A1555G and C1494T mutations at a highly conserved decoding region of the 12S rRNA have been associated with hearing loss. These two mutations account for a significant number of…

  3. [Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia].

    PubMed

    Dzhemileva, L U; Posukh, O L; Tazetdinov, A M; Barashkov, N A; Zhuravskiĭ, S G; Ponidelko, S N; Markova, T G; Tadinova, V N; Fedorova, S A; Maksimova, N R; Khusnutdinova, E K

    2009-07-01

    Mitochondrial DNA (mtDNA) mutations play an important role in etiology of hereditary hearing loss. In various regions of the world, patients suffer from nonsyndromic sensorineural hearing loss initiated by aminoglycoside antibiotics. Mutations that had been shown as pathogenetically important for hearing function disturbance were identified in mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes while pathogenic role of several DNA sequences requires additional studies. This work presents the results of studying the spectrum of mutations and polymorphic variations in mtDNA genes 12S rRNA and tRNA(Ser(UGN)) in 410 patients with nonsyndromal sensoneural hearing impairment/loss from the Volga Ural region, St Petersburg, Yakutia, and Altai and in 520 individuals with normal hearing, which represent several ethnic groups (Russians, Tatars, Bashkirs, Yakuts, Altaians) residing in the Russian Federation. Pathogenetically significant mutation A1555G (12S rRNA) was found in two families (from Yakutia and St Peresburg) with hearing loss, probably caused by treatment with aminoglucosides, and in the population sample of Yakuts with a frequency of 0.83%. Further research is needed to confirm the role in hearing impairment of mutations 961insC, 961insC(n), 961delTinsC(n), T961G, T1095C (12S rRNA) and G7444A, A7445C (tRNA(Ser(UGN revealed in the patients. In addition, in the patients and the population groups, polymorphic mt DNA variants were detected, which are characteristic also of other Eurasian populations both in spectrum and frequency.

  4. Molecular evolution of the mitochondrial 12S rRNA in Ungulata (mammalia).

    PubMed

    Douzery, E; Catzeflis, F M

    1995-11-01

    The complete 12S rRNA gene has been sequenced in 4 Ungulata (hoofed eutherians) and 1 marsupial and compared to 38 available mammalian sequences in order to investigate the molecular evolution of the mitochondrial small-subunit ribosomal RNA molecule. Ungulata were represented by one artiodactyl (the collared peccary, Tayassu tajacu, suborder Suiformes), two perissodactyls (the Grevy's zebra, Equus grevyi, suborder Hippomorpha; the white rhinoceros, Ceratotherium simum, suborder Ceratomorpha), and one hyracoid (the tree hyrax, Dendrohyrax dorsalis). The fifth species was a marsupial, the eastern gray kangaroo (Macropus giganteus). Several transition/transversion biases characterized the pattern of changes between mammalian 12S rRNA molecules. A bias toward transitions was found among 12S rRNA sequences of Ungulata, illustrating the general bias exhibited by ribosomal and protein-encoding genes of the mitochondrial genome. The derivation of a mammalian 12S rRNA secondary structure model from the comparison of 43 eutherian and marsupial sequences evidenced a pronounced bias against transversions in stems. Moreover, transversional compensatory changes were rare events within double-stranded regions of the ribosomal RNA. Evolutionary characteristics of the 12S rRNA were compared with those of the nuclear 18S and 28S rRNAs. From a phylogenetic point of view, transitions, transversions and indels in stems as well as transversional and indels events in loops gave congruent results for comparisons within orders. Some compensatory changes in double-stranded regions and some indels in single-stranded regions also constituted diagnostic events. The 12S rRNA molecule confirmed the monophyly of infraorder Pecora and order Cetacea and demonstrated the monophyly of the suborder Ruminantia was not supported and the branching pattern between Cetacea and the artiodacytyl suborders Ruminantia and Suiformes was not established. The monophyly of the order Perissodactyla was evidenced

  5. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  6. Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

    PubMed

    van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

    1995-06-01

    Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

  7. Molecular phylogeny of mitochondrial cytochrome b and 12S rRNA sequences in the Felidae: ocelot and domestic cat lineages.

    PubMed

    Masuda, R; Lopez, J V; Slattery, J P; Yuhki, N; O'Brien, S J

    1996-12-01

    Molecular phylogeny of the cat family Felidae is derived using two mitochondrial genes, cytochrome b and 12S rRNA. Phylogenetic methods of weighted maximum parsimony and minimum evolution estimated by neighbor-joining are employed to reconstruct topologies among 20 extant felid species. Sequence analyses of 363 bp of cytochrome b and 376 bp of the 12S rRNA genes yielded average pair-wise similarity values between felids ranging from 94 to 99% and from 85 to 99%, respectively. Phylogenetic reconstruction supports more recent, intralineage associations but fails to completely resolve interlineage relationships. Both genes produce a monophyletic group of Felis species but vary in the placement of the pallas cat. The ocelot lineage represents an early divergence within the Felidae, with strong associations between ocelot and margay, Geoffroy's cat and kodkod, and pampas cat and tigrina. Implications of the relative recency of felid evolution, presence of ancestral polymorphisms, and influence of outgroups in placement of the topological root are discussed.

  8. The role of the mitochondrial ribosome in human disease: searching for mutations in 12S mitochondrial rRNA with high disruptive potential

    PubMed Central

    Smith, Paul M.; Elson, Joanna L.; Greaves, Laura C.; Wortmann, Saskia B.; Rodenburg, Richard J.T.; Lightowlers, Robert N.; Chrzanowska-Lightowlers, Zofia M.A.; Taylor, Robert W.; Vila-Sanjurjo, Antón

    2014-01-01

    Mutations of mitochondrial DNA are linked to many human diseases. Despite the identification of a large number of variants in the mitochondrially encoded rRNA (mt-rRNA) genes, the evidence supporting their pathogenicity is, at best, circumstantial. Establishing the pathogenicity of these variations is of major diagnostic importance. Here, we aim to estimate the disruptive effect of mt-rRNA variations on the function of the mitochondrial ribosome. In the absence of direct biochemical methods to study the effect of mt-rRNA variations, we relied on the universal conservation of the rRNA fold to infer their disruptive potential. Our method, named heterologous inferential analysis or HIA, combines conservational information with functional and structural data obtained from heterologous ribosomal sources. Thus, HIA's predictive power is superior to the traditional reliance on simple conservation indexes. By using HIA, we have been able to evaluate the disruptive potential for a subset of uncharacterized 12S mt-rRNA variations. Our analysis revealed the existence of variations in the rRNA component of the human mitoribosome with different degrees of disruptive power. In cases where sufficient information regarding the genetic and pathological manifestation of the mitochondrial phenotype is available, HIA data can be used to predict the pathogenicity of mt-rRNA mutations. In other cases, HIA analysis will allow the prioritization of variants for additional investigation. Eventually, HIA-inspired analysis of potentially pathogenic mt-rRNA variations, in the context of a scoring system specifically designed for these variants, could lead to a powerful diagnostic tool. PMID:24092330

  9. Molecular phylogeny of the Cricetinae subfamily based on the mitochondrial cytochrome b and 12S rRNA genes and the nuclear vWF gene.

    PubMed

    Neumann, Karsten; Michaux, Johan; Lebedev, Vladimir; Yigit, Nuri; Colak, Ercument; Ivanova, Natalia; Poltoraus, Andrey; Surov, Alexei; Markov, Georgi; Maak, Steffen; Neumann, Sabine; Gattermann, Rolf

    2006-04-01

    Despite some popularity of hamsters as pets and laboratory animals there is no reliable phylogeny of the subfamily Cricetinae available so far. Contradicting views exist not only about the actual number of species but also concerning the validity of several genera. We used partial DNA sequences of two mitochondrial (cytochrome b, 12S rRNA) and one partial nuclear gene (von Willebrand Factor exon 28) to provide a first gene tree of the Cricetinae based on 15 taxa comprising six genera. According to our data, Palaearctic hamsters fall into three distinct phylogenetic groups: Phodopus, Mesocricetus, and Cricetus-related species which evolved during the late Miocene about 7-12MY ago. Surprisingly, the genus Phodopus, which was previously thought to have appeared during the Pleistocene, forms the oldest clade. The largest number of extant hamster genera is found in a group of Cricetus-related hamsters. The genus Cricetulus itself proved to be not truly monophyletic with Cricetulus migratorius appearing more closely related to Tscherskia, Cricetus, and Allocricetulus. We propose to place the species within a new monotypic genus. Molecular clock calculations are not always in line with the dating of fossil records. DNA based divergence time estimates as well as taxonomic relationships demand a reevaluation of morphological characters previously used to identify fossils and extant hamsters.

  10. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  11. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  12. [Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

    PubMed

    Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

    2017-01-06

    Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

  13. Nuclear modifier MTO2 modulates the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    PubMed

    He, Xiangyu; Zhu, Xiaoyu; Wang, Xuexiang; Wang, Wei; Dai, Yu; Yan, Qingfeng

    2013-01-01

    The phenotypic manifestations of mitochondrial DNA (mtDNA) mutations are modulated by mitochondrial DNA haplotypes, nuclear modifier genes and environmental factors. The yeast mitochondrial 15S rRNA C1477G (P(R) or P(R) 454) mutation corresponds to the human 12S rRNA C1494T and A1555G mutations, which are well known as primary factors for aminoglycoside-induced nonsyndromic deafness. Here we report that the deletion of the nuclear modifier gene MTO2 suppressed the aminoglycoside-sensitivity of mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae. First, the strain with a single mtDNA C1477G mutation exhibited hypersensitivity to neomycin. Functional assays indicated that the steady-state transcription level of mitochondrial DNA, the mitochondrial respiratory rate, and the membrane potential decreased significantly after neomycin treatment. The impaired mitochondria could not produce sufficient energy to maintain cell viability. Second, when the mto2 null and the mitochondrial C1477G mutations co-existed (mto2(P(R))), the oxygen consumption rate in the double mutant decreased markedly compared to that of the control strains (MTO2(P(S)), mto2(P(S)) and MTO2(P(R))). The expression levels of the key glycolytic genes HXK2, PFK1 and PYK1 in the mto2(P(R)) strain were stimulated by neomycin and up-regulated by 89%, 112% and 55%, respectively. The enhanced glycolysis compensated for the respiratory energy deficits, and could be inhibited by the glycolytic enzyme inhibitor. Our findings in yeast will provide a new insight into the pathogenesis of human deafness.

  14. An MRPS12 mutation modifies aminoglycoside sensitivity caused by 12S rRNA mutations

    PubMed Central

    Emperador, Sonia; Pacheu-Grau, David; Bayona-Bafaluy, M. Pilar; Garrido-Pérez, Nuria; Martín-Navarro, Antonio; López-Pérez, Manuel J.; Montoya, Julio; Ruiz-Pesini, Eduardo

    2015-01-01

    Several homoplasmic pathologic mutations in mitochondrial DNA, such as those causing Leber hereditary optic neuropathy or non-syndromic hearing loss, show incomplete penetrance. Therefore, other elements must modify their pathogenicity. Discovery of these modifying factors is not an easy task because in multifactorial diseases conventional genetic approaches may not always be informative. Here, we have taken an evolutionary approach to unmask putative modifying factors for a particular homoplasmic pathologic mutation causing aminoglycoside-induced and non-syndromic hearing loss, the m.1494C>T transition in the mitochondrial DNA. The mutation is located in the decoding site of the mitochondrial ribosomal RNA. We first looked at mammalian species that had fixed the human pathologic mutation. These mutations are called compensated pathogenic deviations because an organism carrying one must also have another that suppresses the deleterious effect of the first. We found that species from the primate family Cercopithecidae (old world monkeys) harbor the m.1494T allele even if their auditory function is normal. In humans the m.1494T allele increases the susceptibility to aminoglycosides. However, in primary fibroblasts from a Cercopithecidae species, aminoglycosides do not impair cell growth, respiratory complex IV activity and quantity or the mitochondrial protein synthesis. Interestingly, this species also carries a fixed mutation in the mitochondrial ribosomal protein S12. We show that the expression of this variant in a human m.1494T cell line reduces its susceptibility to aminoglycosides. Because several mutations in this human protein have been described, they may possibly explain the absence of pathologic phenotype in some pedigree members with the most frequent pathologic mutations in mitochondrial ribosomal RNA. PMID:25642242

  15. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  16. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  17. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  18. Control of rRNA transcription in Escherichia coli.

    PubMed Central

    Condon, C; Squires, C; Squires, C L

    1995-01-01

    The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889

  19. Inhibitory activity of Juniperus communis on 12(S)-HETE production in human platelets.

    PubMed

    Schneider, Isabella; Gibbons, Simon; Bucar, Franz

    2004-05-01

    Extracts of Juniperus communis L. (Cupressaceae) have been evaluated for their inhibitory activity on human platelet-type 12(S)-lipoxygenase [12(S)-LOX]. The methylene chloride extracts of Juniperi lignum, Juniperi pseudo-fructus and the ethyl acetate extract of Juniperi pseudo-fructus showed a significant inhibition on the production of 12(S)-HETE [12(S)-hydroxy-5,8,10,14-eicosatetraenoic acid] at 100 microg/mL (54.0 +/- 6.73, 66.2 +/- 4.03 and 76.2 +/- 3.36%, respectively). From the methylene chloride extract of the wood, cryptojaponol and beta-sitosterol were isolated as compounds with inhibitory activity (inhibition at 100 microg/mL = 55.4 +/- 2.80% [IC50 = 257.5 microM] and 25.0 +/- 2.15%, respectively). In addition, a lipid fraction containing unsaturated fatty acids contributed to the in vitro activity of the crude extract.

  20. Impact of 12-s Rule on Performance and Muscle Damage of Baseball Pitchers.

    PubMed

    Yang, Sun-Chin; Wang, Chia-Chi; Lee, Shin-DA; Lee, Y U Chung; Chan, Kuei-Hui; Chen, Yi-Liang; Fogt, Donovan L; Kuo, Chia-Hua

    2016-12-01

    A recent US Major League Baseball (MLB) rule change requires baseball pitchers to deliver pitches within 12 s. To examine the effect of three between-pitch rest intervals on throwing performance during a simulated seven-inning game and muscle damage during postgame recovery. A randomized counterbalanced study. Seven intercollegiate pitchers threw 15 pitches per inning for seven innings with rest interval trials of 8, 12, and 20 s between pitches and 5 min between innings. Pitchers threw aimed fastballs at their best effort. Trials were separated by ≥2 wk. Progressive decreases in pitching speed and accuracy below baseline (first inning of 20-s trial) occurred after fourth inning during the 8-s and 12-s trials, but not the 20-s trial. Plasma creatine kinase elevated 48 h later for the 8-s and 12-s trials (+105% and +75%, P < 0.01), but not the 20-s trial (+26%, no significance). A transient interleukin (IL)-6 surges immediately after the game for the 8- and 12-s trials (+265%, +128%, P < 0.01) above baseline. IL-6 reversed below the level of 20-s trial at 48 h after game, whereas IL-10 increased significantly above the level of 20-s trial. Under the same pitching load, decreasing rest interval from 20 to 12 s or less results in an early-onset performance loss during a game and increases in muscle damage and inflammation for more than 2 d after a game. Our data do not favor the current rule change in concern of keeping musculoskeletal health of pitchers.

  1. Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective

    NASA Technical Reports Server (NTRS)

    Gutell, R. R.; Larsen, N.; Woese, C. R.

    1994-01-01

    The 16S and 23S rRNA higher-order structures inferred from comparative analysis are now quite refined. The models presented here differ from their immediate predecessors only in minor detail. Thus, it is safe to assert that all of the standard secondary-structure elements in (prokaryotic) rRNAs have been identified, with approximately 90% of the individual base pairs in each molecule having independent comparative support, and that at least some of the tertiary interactions have been revealed. It is interesting to compare the rRNAs in this respect with tRNA, whose higher-order structure is known in detail from its crystal structure (36) (Table 2). It can be seen that rRNAs have as great a fraction of their sequence in established secondary-structure elements as does tRNA. However, the fact that the former show a much lower fraction of identified tertiary interactions and a greater fraction of unpaired nucleotides than the latter implies that many of the rRNA tertiary interactions remain to be located. (Alternatively, the ribosome might involve protein-rRNA rather than intramolecular rRNA interactions to stabilize three-dimensional structure.) Experimental studies on rRNA are consistent to a first approximation with the structures proposed here, confirming the basic assumption of comparative analysis, i.e., that bases whose compositions strictly covary are physically interacting. In the exhaustive study of Moazed et al. (45) on protection of the bases in the small-subunit rRNA against chemical modification, the vast majority of bases inferred to pair by covariation are found to be protected from chemical modification, both in isolated small-subunit rRNA and in the 30S subunit. The majority of the tertiary interactions are reflected in the chemical protection data as well (45). On the other hand, many of the bases not shown as paired in Fig. 1 are accessible to chemical attack (45). However, in this case a sizeable fraction of them are also protected against chemical

  2. rRNA fragmentation induced by a yeast killer toxin.

    PubMed

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

  3. An intergenic non-coding rRNA correlated with expression of the rRNA and frequency of an rRNA single nucleotide polymorphism in lung cancer cells.

    PubMed

    Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M

    2009-10-19

    Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.

  4. Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

    USDA-ARS?s Scientific Manuscript database

    This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

  5. Culturing immobilized plant cells for the TUBUL space experiments on the DELTA and 12S Missions

    NASA Astrophysics Data System (ADS)

    Sieberer, Björn J.; Emons, Anne Mie C.; Vos, Jan W.

    2007-09-01

    For the TUBUL experiments during the DELTA mission in April 2004 and 12S mission in March/April 2006 on board the Soyuz capsule and the International Space Station we developed a method to culture and chemically fix plant suspension culture cells. The aim of the ten day experiment was to investigate the effect of microgravity on single plant cells. Fully automated experiment cassettes (Plunger Box Units) were developed by Centre for Concepts in Mechatronics (Nuenen, the Netherlands). Tobacco BY- 2 cells were immobilized in a semi- solid agarose matrix that was reinforced by a nylon mesh. This assembly allowed liquid medium refreshment, oxygen supply and chemical fixation, including a post- fixative wash. The method was optimized for post- flight analysis of cell structure, shape and size, cell division, and the microtubule cytoskeleton. The viability of cells in the agarose matrix was similar to cells grown in liquid medium under laboratory conditions, only the stationary growth phase was reached six days later.

  6. Chromosomal Organization of Rrna Operons in Bacillus Subtilis

    PubMed Central

    Jarvis, E. D.; Widom, R. L.; LaFauci, G.; Setoguchi, Y.; Richter, I. R.; Rudner, R.

    1988-01-01

    Integrative mapping with vectors containing ribosomal DNA sequences were used to complete the mapping of the 10 rRNA gene sets in the endospore forming bacterium Bacillus subtilis. Southern hybridizations allowed the assignment of nine operons to distinct BclI restriction fragments and their genetic locus identified by transductional crosses. Nine of the ten rRNA gene sets are located between 0 and 70° on the genomic map. In the region surrounding cysA14, two sets of closely spaced tandem clusters are present. The first (rrnJ and rrnW) is located between purA16 and cysA14 closely linked to the latter; the second (rrnI, rrnH and rrnG) previously mapped within this area is located between attSPO2 and glpT6. The operons at or near the origin of replication (rrnO,rrnA and rrnJ,rrnW) represent ``hot spots'' of plasmid insertion. PMID:2465199

  7. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  8. Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

    PubMed

    Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

    2012-12-01

    Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

  9. Identification of an Alternative rRNA Post-transcriptional Maturation of 26S rRNA in the Kingdom Fungi.

    PubMed

    Navarro-Ródenas, Alfonso; Carra, Andrea; Morte, Asunción

    2018-01-01

    Despite of the integrity of their RNA, some desert truffles present a non-canonical profile of rRNA where 3.3 kb is absent, 1.8 kb is clear and a band of 1.6 kb is observed. A similar rRNA profile was identified in organisms belonging to different life kingdoms, with the exception of the Kingdom Fungi, as a result of a split LSU rRNA called hidden gap . rRNA profiles of desert truffles were analyzed to verify the presence of the non-canonical profile. The RNA of desert truffles and yeast were blotted and hybridized with probes complementary to LSU extremes. RACE of LSU rRNA was carried out to determine the LSU rRNA breakage point. LSU rRNA of desert truffles presents a post-transcriptional cleavage of five nucleotides that generates a hidden gap located in domain D7. LSU splits into two molecules of 1.6 and 1.8 kb. Similar to other organisms, a UAAU tract, downstream of the breakage point, was identified. Phylogenetic comparison suggests that during fungi evolution mutations were introduced in the hypervariable D7 domain, resulting in a sequence that is specifically post-transcriptionally cleaved in some desert truffles.

  10. SAXS and other spectroscopic analysis of 12S cruciferin isolated from the seeds of Brassica nigra

    NASA Astrophysics Data System (ADS)

    Khaliq, Binish; Falke, Sven; Negm, Amr; Buck, Friedrich; Munawar, Aisha; Saqib, Maria; Mahmood, Seema; Ahmad, Malik Shoaib; Betzel, Christian; Akrem, Ahmed

    2017-06-01

    Oilseeds of the plant family Brassicaceae are important for providing both lipid and protein contents to human nutrition. Cruciferins (12S globulins) are seed storage proteins, which are getting attention due to their allergenic and pathogenicity related nature. This study describes the purification and characterization of a trimeric (∼190 kDa) cruciferin protein from the seeds of Brassica nigra (L.). Cruciferin was first partially purified by ammonium sulfate precipitation (30% saturation constant) and further purified by size exclusion chromatography. The N-terminal amino-acid sequence analysis showed 82% sequence homology with cruciferin from Arabidopsis thaliana. The 50-55 kDa monomeric cruciferin produced multiple bands of two major molecular weight ranges (α-polypeptides of 28-32 kDa and β-polypeptides of 17-20 kDa) under reduced conditions of SDS-PAGE. The 2D gel electrophoretic analysis showed the further separation of the bands into their isoforms with major pI ranges between 5.7 and 8.0 (α-polypeptides) and 5.5-8.5 (β-polypeptides). The Dynamic Light Scattering (DLS) showed the monodisperse nature of the cruciferin with hydrodynamic radius of 5.8 ± 0.1 nm confirming the trimeric nature of the protein. The Circular Dichroism (CD) spectra showed both α-helices and β-sheets in the native conformation of the trimeric protein. The pure cruciferin protein (40 mg/ml) was successfully crystallized; however, the crystals diffracted only to low resolution data (8 Å). Small-angle x-ray scattering (SAXS) was applied to gain insights into the three-dimensional structure in solution. SAXS showed that the radius of gyration is 4.24 ± 0.25 nm and confirmed the nearly globular shape. The SAXS based ab initio dummy model of B. nigra cruciferin was compared with 11S globulins.

  11. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  12. Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

    PubMed Central

    Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

    2012-01-01

    Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

  13. Maternal serum ADAM12s as a marker of rare aneuploidies in the first or second trimester of pregnancy.

    PubMed

    Spencer, Kevin; Cowans, Nicholas J; Stamatopoulou, Anastasia

    2007-12-01

    To assess whether the maternal serum ADAM12s concentrations are altered in the first and second trimester of pregnancies complicated by rare aneuploides. ADAM12s was measured by a semi-automated time-resolved immunofluorometric assay in a series of 60 first-trimester cases with trisomy 13, 78 first-trimester cases with Turner's syndrome, 38 first-trimester cases with triploidy and 24 first-trimester cases with sex aneuploidy-the cases were compared with the data from 389 first-trimester controls. In the second trimester, a smaller number of 6, 7, 2 and 13 cases, respectively, were compared with the data from 341 controls. All data were expressed as multiple of the median (MoM) and corrected for maternal weight. Correlation with previously analysed markers (PAPP-A, free beta-hCG and delta NT) was performed. The first-trimester median MoM ADAM12s was significantly lower than 1.0 in all types of rare aneuploidy with the possible exception of triploidy type II. A significant positive correlation with gestational age was reported for trisomy 13 and Turner's syndrome. ADAM12s was not significantly correlated with any other first-trimester marker. In the second trimester, ADAM12s values were marginally increased in these rare aneuploidies. ADAM12s has already been shown to be a possible early first- and second-trimester marker of trisomies 21 and 18. Our data also show the possibility of levels of this marker being altered in the first and second trimester of pregnancies with rare aneuploidies. This may be a useful addition to screening strategies in the future. Copyright (c) 2007 John Wiley & Sons, Ltd.

  14. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  15. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  16. Attempts on producing lymphoid cell line from Penaeus monodon by induction with SV40-T and 12S EIA oncogenes.

    PubMed

    Puthumana, Jayesh; Prabhakaran, Priyaja; Philip, Rosamma; Singh, I S Bright

    2015-12-01

    In an attempt of in vitro transformation, transfection mediated expression of Simian virus-40 (T) antigen (SV40-T) and transduction mediated expression of Adenovirus type 12 early region 1A (12S E1A) oncogene were performed in Penaeus monodon lymphoid cells. pSV3-neo vector encoding SV40-T oncogene and a recombinant baculovirus BacP2-12S E1A-GFP encoding 12S E1A oncogene under the control of hybrid promoters were used. Electroporation and lipofection mediated transformation of SV40-T in lymphoid cells confirmed the transgene expression by phenotypic variation and the expression of GFP in co-transfection experiment. The cells transfected by lipofection (≥ 5%) survived for 14 days with lower toxicity (30%), whilst on electroporation, most of the cells succumbed to death (60%) and survived cells lived up to 7 days. Transduction efficiency in primary lymphoid cells was more than 80% within 14 days of post-transduction, however, an incubation period of 7 days post-transduction was observed without detectable expression of 12S E1A. High level of oncogenic 12S E1A expression were observed after 14 day post-transduction and the proliferating cells survived for more than 90 days with GFP expression, however, without in vitro transformation and immortalization. The study put forth the requirement of transduction mediated 'specific' oncogene expression along with telomerase activation and epigenetic induction for the immortalization and establishment of shrimp cell line. Copyright © 2015. Published by Elsevier Ltd.

  17. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

    PubMed

    Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

    1989-10-20

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

  18. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  19. Arabidopsis Chloroplast Mini-Ribonuclease III Participates in rRNA Maturation and Intron Recycling

    PubMed Central

    Hotto, Amber M.; Castandet, Benoît; Gilet, Laetitia; Higdon, Andrea; Condon, Ciarán; Stern, David B.

    2015-01-01

    RNase III proteins recognize double-stranded RNA structures and catalyze endoribonucleolytic cleavages that often regulate gene expression. Here, we characterize the functions of RNC3 and RNC4, two Arabidopsis thaliana chloroplast Mini-RNase III-like enzymes sharing 75% amino acid sequence identity. Whereas rnc3 and rnc4 null mutants have no visible phenotype, rnc3/rnc4 (rnc3/4) double mutants are slightly smaller and chlorotic compared with the wild type. In Bacillus subtilis, the RNase Mini-III is integral to 23S rRNA maturation. In Arabidopsis, we observed imprecise maturation of 23S rRNA in the rnc3/4 double mutant, suggesting that exoribonucleases generated staggered ends in the absence of specific Mini-III-catalyzed cleavages. A similar phenotype was found at the 3′ end of the 16S rRNA, and the primary 4.5S rRNA transcript contained 3′ extensions, suggesting that Mini-III catalyzes several processing events of the polycistronic rRNA precursor. The rnc3/4 mutant showed overaccumulation of a noncoding RNA complementary to the 4.5S-5S rRNA intergenic region, and its presence correlated with that of the extended 4.5S rRNA precursor. Finally, we found rnc3/4-specific intron degradation intermediates that are probable substrates for Mini-III and show that B. subtilis Mini-III is also involved in intron regulation. Overall, this study extends our knowledge of the key role of Mini-III in intron and noncoding RNA regulation and provides important insight into plastid rRNA maturation. PMID:25724636

  20. Uncultivated Microbial Eukaryotic Diversity: A Method to Link ssu rRNA Gene Sequences with Morphology

    PubMed Central

    Hirst, Marissa B.; Kita, Kelley N.; Dawson, Scott C.

    2011-01-01

    Protists have traditionally been identified by cultivation and classified taxonomically based on their cellular morphologies and behavior. In the past decade, however, many novel protist taxa have been identified using cultivation independent ssu rRNA sequence surveys. New rRNA “phylotypes” from uncultivated eukaryotes have no connection to the wealth of prior morphological descriptions of protists. To link phylogenetically informative sequences with taxonomically informative morphological descriptions, we demonstrate several methods for combining whole cell rRNA-targeted fluorescent in situ hybridization (FISH) with cytoskeletal or organellar immunostaining. Either eukaryote or ciliate-specific ssu rRNA probes were combined with an anti-α-tubulin antibody or phalloidin, a common actin stain, to define cytoskeletal features of uncultivated protists in several environmental samples. The eukaryote ssu rRNA probe was also combined with Mitotracker® or a hydrogenosomal-specific anti-Hsp70 antibody to localize mitochondria and hydrogenosomes, respectively, in uncultivated protists from different environments. Using rRNA probes in combination with immunostaining, we linked ssu rRNA phylotypes with microtubule structure to describe flagellate and ciliate morphology in three diverse environments, and linked Naegleria spp. to their amoeboid morphology using actin staining in hay infusion samples. We also linked uncultivated ciliates to morphologically similar Colpoda-like ciliates using tubulin immunostaining with a ciliate-specific rRNA probe. Combining rRNA-targeted FISH with cytoskeletal immunostaining or stains targeting specific organelles provides a fast, efficient, high throughput method for linking genetic sequences with morphological features in uncultivated protists. When linked to phylotype, morphological descriptions of protists can both complement and vet the increasing number of sequences from uncultivated protists, including those of novel lineages

  1. Small RNA populations revealed by blocking rRNA fragments in Drosophila melanogaster reproductive tissues

    PubMed Central

    Dalmay, Tamas

    2018-01-01

    RNA interference (RNAi) is a complex and highly conserved regulatory mechanism mediated via small RNAs (sRNAs). Recent technical advances in high throughput sequencing have enabled an increasingly detailed analysis of sRNA abundances and profiles in specific body parts and tissues. This enables investigations of the localized roles of microRNAs (miRNAs) and small interfering RNAs (siRNAs). However, variation in the proportions of non-coding RNAs in the samples being compared can hinder these analyses. Specific tissues may vary significantly in the proportions of fragments of longer non-coding RNAs (such as ribosomal RNA or transfer RNA) present, potentially reflecting tissue-specific differences in biological functions. For example, in Drosophila, some tissues contain a highly abundant 30nt rRNA fragment (the 2S rRNA) as well as abundant 5’ and 3’ terminal rRNA fragments. These can pose difficulties for the construction of sRNA libraries as they can swamp the sequencing space and obscure sRNA abundances. Here we addressed this problem and present a modified “rRNA blocking” protocol for the construction of high-definition (HD) adapter sRNA libraries, in D. melanogaster reproductive tissues. The results showed that 2S rRNAs targeted by blocking oligos were reduced from >80% to < 0.01% total reads. In addition, the use of multiple rRNA blocking oligos to bind the most abundant rRNA fragments allowed us to reveal the underlying sRNA populations at increased resolution. Side-by-side comparisons of sequencing libraries of blocked and non-blocked samples revealed that rRNA blocking did not change the miRNA populations present, but instead enhanced their abundances. We suggest that this rRNA blocking procedure offers the potential to improve the in-depth analysis of differentially expressed sRNAs within and across different tissues. PMID:29474379

  2. KMo12S14

    NASA Astrophysics Data System (ADS)

    Villars, P.; Cenzual, K.; Daams, J.; Gladyshevskii, R.; Shcherban, O.; Dubenskyy, V.; Melnichenko-Koblyuk, N.; Pavlyuk, O.; Savysyuk, I.; Stoyko, S.; Sysa, L.

    This document is part of Subvolume A6 `Structure Types. Part 6: Space Groups (166) R-3m - (160) R3m' of Volume 43 `Crystal Structures of Inorganic Compounds' of Landolt-Börnstein - Group III `Condensed Matter'.

  3. Sources of Blood Meals of Sylvatic Triatoma guasayana near Zurima, Bolivia, Assayed with qPCR and 12S Cloning

    PubMed Central

    Lucero, David E.; Ribera, Wilma; Pizarro, Juan Carlos; Plaza, Carlos; Gordon, Levi W.; Peña, Reynaldo; Morrissey, Leslie A.; Rizzo, Donna M.; Stevens, Lori

    2014-01-01

    Background In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps). Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia. Methodology/Principal Findings We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens), five for chicken (Gallus gallus) and unicolored blackbird (Agelasticus cyanopus), and one for opossum (Monodelphis domestica). Using the qPCR assay we detected chicken (13 vectors), and human (14 vectors) blood meals as well as an additional blood meal source, Canis sp. (4 vectors). Conclusions/Significance We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors. PMID:25474154

  4. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  5. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Epigenetic regulation of TTF-I-mediated promoter–terminator interactions of rRNA genes

    PubMed Central

    Németh, Attila; Guibert, Sylvain; Tiwari, Vijay Kumar; Ohlsson, Rolf; Längst, Gernot

    2008-01-01

    Ribosomal RNA synthesis is the eukaryotic cell's main transcriptional activity, but little is known about the chromatin domain organization and epigenetics of actively transcribed rRNA genes. Here, we show epigenetic and spatial organization of mouse rRNA genes at the molecular level. TTF-I-binding sites subdivide the rRNA transcription unit into functional chromatin domains and sharply delimit transcription factor occupancy. H2A.Z-containing nucleosomes occupy the spacer promoter next to a newly characterized TTF-I-binding site. The spacer and the promoter proximal TTF-I-binding sites demarcate the enhancer. DNA from both the enhancer and the coding region is hypomethylated in actively transcribed repeats. 3C analysis revealed an interaction between promoter and terminator regions, which brings the beginning and end of active rRNA genes into close contact. Reporter assays show that TTF-I mediates this interaction, thereby linking topology and epigenetic regulation of the rRNA genes. PMID:18354495

  7. Alternative splicing of anciently exonized 5S rRNA regulates plant transcription factor TFIIIA

    PubMed Central

    Fu, Yan; Bannach, Oliver; Chen, Hao; Teune, Jan-Hendrik; Schmitz, Axel; Steger, Gerhard; Xiong, Liming; Barbazuk, W. Brad

    2009-01-01

    Identifying conserved alternative splicing (AS) events among evolutionarily distant species can prioritize AS events for functional characterization and help uncover relevant cis- and trans-regulatory factors. A genome-wide search for conserved cassette exon AS events in higher plants revealed the exonization of 5S ribosomal RNA (5S rRNA) within the gene of its own transcription regulator, TFIIIA (transcription factor for polymerase III A). The 5S rRNA-derived exon in TFIIIA gene exists in all representative land plant species but not in green algae and nonplant species, suggesting it is specific to land plants. TFIIIA is essential for RNA polymerase III-based transcription of 5S rRNA in eukaryotes. Integrating comparative genomics and molecular biology revealed that the conserved cassette exon derived from 5S rRNA is coupled with nonsense-mediated mRNA decay. Utilizing multiple independent Arabidopsis overexpressing TFIIIA transgenic lines under osmotic and salt stress, strong accordance between phenotypic and molecular evidence reveals the biological relevance of AS of the exonized 5S rRNA in quantitative autoregulation of TFIIIA homeostasis. Most significantly, this study provides the first evidence of ancient exaptation of 5S rRNA in plants, suggesting a novel gene regulation model mediated by the AS of an anciently exonized noncoding element. PMID:19211543

  8. Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.

    PubMed Central

    Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L

    1996-01-01

    Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200

  9. Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

    PubMed

    Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

    2018-06-08

    Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Bioluminescent symbionts of the Caribbean flashlight fish (Kryptophanaron alfredi) have a single rRNA operon.

    PubMed

    Wolfe, C J; Haygood, M G

    1993-08-01

    Ribosomal RNA (rRNA) operon copy number and gene order were determined for the luminous bacterial symbiont of Kryptophanaron alfredi, an anomalopid (flashlight) fish, and estimated for the luminous symbionts of 3 other fish families and of 3 luminous seawater isolates. Compared with the seawater isolates and other fish symbionts, the copy number of rRNA genes in the K. alfredi symbiont was radically reduced, although gene order appeared conserved among all the strains. The K. alfredi symbiont possesses only a single rRNA operon, whereas the other strains examined have minimum copy numbers ranging from 8 to 11. No difference in copy number was observed between light organ and seawater isolates of the same species, or between isolates of the same species from the light organs of 2 different host families. Thus, the anomalopid symbiosis appears unique among characterized light organ symbioses.

  11. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

    PubMed

    Wickersheim, Michelle L; Blumenstiel, Justin P

    2013-11-01

    A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

  12. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  13. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    PubMed

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  14. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda

    PubMed Central

    Wu, Shu; Xiong, Jie; Yu, Yuhe

    2015-01-01

    Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258

  15. How Much Do rRNA Gene Surveys Underestimate Extant Bacterial Diversity?

    PubMed

    Rodriguez-R, Luis M; Castro, Juan C; Kyrpides, Nikos C; Cole, James R; Tiedje, James M; Konstantinidis, Konstantinos T

    2018-03-15

    The most common practice in studying and cataloguing prokaryotic diversity involves the grouping of sequences into operational taxonomic units (OTUs) at the 97% 16S rRNA gene sequence identity level, often using partial gene sequences, such as PCR-generated amplicons. Due to the high sequence conservation of rRNA genes, organisms belonging to closely related yet distinct species may be grouped under the same OTU. However, it remains unclear how much diversity has been underestimated by this practice. To address this question, we compared the OTUs of genomes defined at the 97% or 98.5% 16S rRNA gene identity level against OTUs of the same genomes defined at the 95% whole-genome average nucleotide identity (ANI), which is a much more accurate proxy for species. Our results show that OTUs resulting from a 98.5% 16S rRNA gene identity cutoff are more accurate than 97% compared to 95% ANI (90.5% versus 89.9% accuracy) but indistinguishable from any other threshold in the 98.29 to 98.78% range. Even with the more stringent thresholds, however, the 16S rRNA gene-based approach commonly underestimates the number of OTUs by ∼12%, on average, compared to the ANI-based approach (∼14% underestimation when using the 97% identity threshold). More importantly, the degree of underestimation can become 50% or more for certain taxa, such as the genera Pseudomonas , Burkholderia , Escherichia , Campylobacter , and Citrobacter These results provide a quantitative view of the degree of underestimation of extant prokaryotic diversity by 16S rRNA gene-defined OTUs and suggest that genomic resolution is often necessary. IMPORTANCE Species diversity is one of the most fundamental pieces of information for community ecology and conservational biology. Therefore, employing accurate proxies for what a species or the unit of diversity is are cornerstones for a large set of microbial ecology and diversity studies. The most common proxies currently used rely on the clustering of 16S rRNA

  16. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

    PubMed Central

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

    2011-01-01

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  17. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  18. Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

    PubMed Central

    O’Farrell, Katrina A.; Janssen, Peter H.

    1999-01-01

    Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

  19. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin

    PubMed Central

    Chahine, Sarah; Okafor, Darius; Ong, Ana C.; Maybank, Rosslyn; Kwak, Yoon I.; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2015-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. PMID:26537447

  20. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    PubMed

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  1. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  2. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    PubMed

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  3. Involvement of the BLT2 receptor in the itch-associated scratching induced by 12-(S)-lipoxygenase products in ICR mice

    PubMed Central

    Kim, H J; Kim, D K; Kim, H; Koh, J Y; Kim, K M; Noh, M S; Lee, S; Kim, S; Park, S H; Kim, J J; Kim, S Y; Lee, C H

    2008-01-01

    Background and purpose: Recently, we reported that 12(S)-HPETE (12(S)-hydroperoxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid) induces scratching in ICR mice. We hypothesized that 12(S)-HPETE might act as an agonist of the low-affinity leukotriene B4 receptor BLT2. To confirm the involvement of the BLT2 receptor in 12(S)-HPETE-induced scratching, we studied the scratch response using the BLT2 receptor agonists compound A (4′-{[pentanoyl (phenyl) amino]methyl}-1,1′-biphenyl-2-carboxylic acid) and 12(S)-HETE (12(S)-hydroxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid). Experimental approach: A video recording was used to determine whether the BLT2 receptor agonists caused itch-associated scratching in ICR mice. Selective antagonists and several chemicals were used. Key results: Both 12(S)-HETE and compound A dose dependently induced scratching in the ICR mice. The dose–response curve for compound A showed peaks at around 0.005–0.015 nmol per site. Compound A- and 12(S)-HETE-induced scratching was suppressed by capsaicin and naltrexon. We examined the suppressive effects of U75302 (6-[6-(3-hydroxy-1E,5Z-undecadienyl)-2-pyridinyl]-1,5-hexanediol, the BLT1 receptor antagonist) and LY255283 (1-[5-ethyl-2-hydroxy-4-[[6-methyl-6-(1H-tetrazol-5-yl)heptyl]oxy]phenyl]-ethanone, the BLT2 receptor antagonist) on the BLT2 agonist-induced scratching. LY255283 suppressed compound A- and 12(S)-HETE-induced scratching, but U75302 did not. LY255283 required a higher dose to suppress the compound A-induced scratching than it did to suppress the 12(S)-HETE-induced scratching. One of the BLT2 receptor agonists, 12(R)-HETE (12(R)-hydroxyeicosa-5Z,8Z,10E,14Z-tetraenoic acid), also induced scratching in the ICR mice. Conclusions and implications: Our present results corroborate the hypothesis that the BLT2 receptor is involved in 12(S)-lipoxygenase-product-induced scratching in ICR mice. We also confirmed that this animal model could be a valuable means of evaluating the effects of BLT2 receptor

  4. EXTraS discovery of a 1.2-s X-ray pulsar in M31

    NASA Astrophysics Data System (ADS)

    Esposito, P.; Israel, G.; Belfiore, A.; Novara, G.; Sidoli, L.; Rodriguez Castillo, G.; De Luca, A.; Tiengo, A.; Haberl, F.; Salvaterra, R.

    2017-10-01

    A systematic search for periodic signals in the XMM-Newton's EPIC archive carried out within the EXTraS project resulted in the discovery of a 1.2-s flux modulation in 3XMM J004301.4+413017. It is the first accreting neutron star in M31 for which the spin period has been detected. Besides this distinction, 3XMM J0043 proved to be an interesting system. Doppler shifts of the spin modulation revealed an orbital motion with period of 1.27 d and the analysis of optical data shows that, while the source is likely associated to a globular cluster, a counterpart with V ˜ 22 outside the cluster cannot be excluded. The emission of the pulsar appears rather hard (most data are described by a power law with photon index <1) and, assuming the distance to M31, the 0.3-10 keV luminosity was variable, from ˜3×10^{37} to 2×10^{38} erg/s. Based on this, we discuss two main possible scenarios for 3X J0043: a peculiar low-mass X-ray binary, perhaps similar to 4U 1822-37 or 4U 1626-67, or an intermediate-mass X-ray binary akin Her X-1.

  5. Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

    PubMed Central

    Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

    2017-01-01

    Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

  6. 16S rRNA beacons for bacterial monitoring during human space missions.

    PubMed

    Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

    2007-04-01

    Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

  7. Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.

    PubMed

    McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary

    2016-01-01

    16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Novel variants of the 5S rRNA genes in Eruca sativa.

    PubMed

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro

    PubMed Central

    Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.

    2011-01-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395

  10. Nucleation by rRNA Dictates the Precision of Nucleolus Assembly.

    PubMed

    Falahati, Hanieh; Pelham-Webb, Bobbie; Blythe, Shelby; Wieschaus, Eric

    2016-02-08

    Membrane-less organelles are intracellular compartments specialized to carry out specific cellular functions. There is growing evidence supporting the possibility that such organelles form as a new phase, separating from cytoplasm or nucleoplasm. However, a main challenge to such phase separation models is that the initial assembly, or nucleation, of the new phase is typically a highly stochastic process and does not allow for the spatiotemporal precision observed in biological systems. Here, we investigate the initial assembly of the nucleolus, a membrane-less organelle involved in different cellular functions including ribosomal biogenesis. We demonstrate that the nucleolus formation is precisely timed in D. melanogaster embryos and follows the transcription of rRNA. We provide evidence that transcription of rRNA is necessary for overcoming the highly stochastic nucleation step in the formation of the nucleolus, through a seeding mechanism. In the absence of rDNA, the nucleolar proteins studied are able to form high-concentration assemblies. However, unlike the nucleolus, these assemblies are highly variable in number, location, and time at which they form. In addition, quantitative study of the changes in the nucleoplasmic concentration and distribution of these nucleolar proteins in the wild-type embryos is consistent with the role of rRNA in seeding the nucleolus formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

    PubMed Central

    Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

    2017-01-01

    Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

  12. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    PubMed

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  13. Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.

    PubMed Central

    Ryals, J; Little, R; Bremer, H

    1982-01-01

    The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924

  14. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    PubMed

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  15. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    PubMed Central

    Ziesemer, Kirsten A.; Mann, Allison E.; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T.; Brandt, Bernd W.; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C.; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A.; MacDonald, Sandy J.; Thomas, Gavin H.; Collins, Matthew J.; Lewis, Cecil M.; Hofman, Corinne; Warinner, Christina

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341–534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions. PMID:26563586

  16. Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

    PubMed

    Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

    2008-10-31

    A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  17. Pre-45s rRNA promotes colon cancer and is associated with poor survival of CRC patients.

    PubMed

    Tsoi, H; Lam, K C; Dong, Y; Zhang, X; Lee, C K; Zhang, J; Ng, S C; Ng, S S M; Zheng, S; Chen, Y; Fang, J; Yu, J

    2017-11-02

    One characteristic of cancer cells is the abnormally high rate of cell metabolism to sustain their enhanced proliferation. However, the behind mechanism of this phenomenon is still elusive. Here we find that enhanced precursor 45s ribosomal RNA (pre-45s rRNA) is one of the core mechanisms in promoting the pathogenesis of colorectal cancer (CRC). Pre-45s rRNA expression is significantly higher in primary CRC tumor tissues samples and cancer cell lines compared with the non-tumorous colon tissues, and is associated with tumor sizes. Knockdown of pre-45s rRNA inhibits G1/S cell-cycle transition by stabilizing p53 through inducing murine double minute 2 (MDM2) and ribosomal protein L11 (RpL11) interaction. In addition, we revealed that high rate of cancer cell metabolism triggers the passive release of calcium ion from endoplasmic reticulum to the cytoplasm. The elevated calcium ion in the cytoplasm activates the signaling cascade of calcium/calmodulin-dependent protein kinase II, ribosomal S6 kinase (S6K) and ribosomal S6K (CaMKII-S6K-UBF). The activated UBF promotes the transcription of rDNA, which therefore increases pre-45s rRNA. Disruption of CaMKII-S6K-UBF axis by either RNAi or pharmaceutical approaches leads to reduction of pre-45s rRNA expression, which subsequently suppresses cell proliferation in colon cancer cells by causing cell-cycle arrest. Knockdown of APC activates CaMKII-S6K-UBF cascade and thus enhances pre-45s rRNA expression. Moreover, the high expression level of pre-45s rRNA is associated with poor survival of CRC patients in two independent cohorts. Our study identifies a novel mechanism in CRC pathogenesis mediated by pre-45s rRNA and a prognostic factor of pre-45s rRNA in CRC patients.

  18. Identification of Actinomyces meyeri actinomycosis in middle ear and mastoid by 16S rRNA analysis.

    PubMed

    Kakuta, Risako; Hidaka, Hiroshi; Yano, Hisakazu; Miyazaki, Hiromitsu; Suzaki, Hiroshi; Nakamura, Yasuhiro; Kanamori, Hajime; Endo, Shiro; Hirakata, Yoichi; Kaku, Mitsuo; Kobayashi, Toshimitsu

    2013-08-01

    Actinomycosis of the middle ear and mastoid is extremely rare. Here, we report a unique case of actinomycosis of the middle ear and mastoid caused by Actinomyces meyeri diagnosed by 16S rRNA gene sequence analysis.

  19. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  20. Optimisation of 16S rRNA gut microbiota profiling of extremely low birth weight infants.

    PubMed

    Alcon-Giner, Cristina; Caim, Shabhonam; Mitra, Suparna; Ketskemety, Jennifer; Wegmann, Udo; Wain, John; Belteki, Gusztav; Clarke, Paul; Hall, Lindsay J

    2017-11-02

    Infants born prematurely, particularly extremely low birth weight infants (ELBW) have altered gut microbial communities. Factors such as maternal health, gut immaturity, delivery mode, and antibiotic treatments are associated with microbiota disturbances, and are linked to an increased risk of certain diseases such as necrotising enterocolitis. Therefore, there is a requirement to optimally characterise microbial profiles in this at-risk cohort, via standardisation of methods, particularly for studying the influence of microbiota therapies (e.g. probiotic supplementation) on community profiles and health outcomes. Profiling of faecal samples using the 16S rRNA gene is a cost-efficient method for large-scale clinical studies to gain insights into the gut microbiota and additionally allows characterisation of cohorts were sample quantities are compromised (e.g. ELBW infants). However, DNA extraction method, and the 16S rRNA region targeted can significantly change bacterial community profiles obtained, and so confound comparisons between studies. Thus, we sought to optimise a 16S rRNA profiling protocol to allow standardisation for studying ELBW infant faecal samples, with or without probiotic supplementation. Using ELBW faecal samples, we compared three different DNA extraction methods, and subsequently PCR amplified and sequenced three hypervariable regions of the 16S rRNA gene (V1 + V2 + V3), (V4 + V5) and (V6 + V7 + V8), and compared two bioinformatics approaches to analyse results (OTU and paired end). Paired shotgun metagenomics was used as a 'gold-standard'. Results indicated a longer bead-beating step was required for optimal bacterial DNA extraction and that sequencing regions (V1 + V2 + V3) and (V6 + V7 + V8) provided the most representative taxonomic profiles, which was confirmed via shotgun analysis. Samples sequenced using the (V4 + V5) region were found to be underrepresented in specific taxa including Bifidobacterium, and had

  1. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Treesearch

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  2. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

    PubMed Central

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-01

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

  3. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  4. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    PubMed

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  5. RNase MRP is required for entry of 35S precursor rRNA into the canonical processing pathway.

    PubMed

    Lindahl, Lasse; Bommankanti, Ananth; Li, Xing; Hayden, Lauren; Jones, Adrienne; Khan, Miriam; Oni, Tolulope; Zengel, Janice M

    2009-07-01

    RNase MRP is a nucleolar RNA-protein enzyme that participates in the processing of rRNA during ribosome biogenesis. Previous experiments suggested that RNase MRP makes a nonessential cleavage in the first internal transcribed spacer. Here we report experiments with new temperature-sensitive RNase MRP mutants in Saccharomyces cerevisiae that show that the abundance of all early intermediates in the processing pathway is severely reduced upon inactivation of RNase MRP. Transcription of rRNA continues unabated as determined by RNA polymerase run-on transcription, but the precursor rRNA transcript does not accumulate, and appears to be unstable. Taken together, these observations suggest that inactivation of RNase MRP blocks cleavage at sites A0, A1, A2, and A3, which in turn, prevents precursor rRNA from entering the canonical processing pathway (35S > 20S + 27S > 18S + 25S + 5.8S rRNA). Nevertheless, at least some cleavage at the processing site in the second internal transcribed spacer takes place to form an unusual 24S intermediate, suggesting that cleavage at C2 is not blocked. Furthermore, the long form of 5.8S rRNA is made in the absence of RNase MRP activity, but only in the presence of Xrn1p (exonuclease 1), an enzyme not required for the canonical pathway. We conclude that RNase MRP is a key enzyme for initiating the canonical processing of precursor rRNA transcripts, but alternative pathway(s) might provide a backup for production of small amounts of rRNA.

  6. Bacillus nanhaiisediminis sp. nov., an alkalitolerant member of Bacillus rRNA group 6.

    PubMed

    Zhang, Jianli; Wang, Jiewei; Song, Fei; Fang, Caiyuan; Xin, Yuhua; Zhang, Yabo

    2011-05-01

    A Gram-stain-positive, rod-shaped bacterium, designated strain NH3(T), was isolated from a sediment sample from the South China Sea and was subjected to a polyphasic taxonomic study. The isolate grew optimally at 37 °C and pH 9. Strain NH3(T) had cell-wall peptidoglycan based on meso-diaminopimelic acid and MK-7 as the predominant menaquinone. The cellular fatty acid profile included significant amounts of iso-C(15 : 0) and iso-C(14 : 0). The major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content of strain NH3(T) was 40.3 mol%. Phylogenetic analysis of the 16S rRNA gene sequence revealed that strain NH3(T) was a member of rRNA group 6 of the genus Bacillus, which includes alkalitolerant, alkaliphilic and halotolerant species. The closest phylogenetic relatives were Bacillus akibai 1139(T) (96.82 % 16S rRNA gene sequence similarity), B. pseudofirmus DSM 8715(T) (96.76 %), B. okhensis Kh10-101(T) (96.76 %) and B. alkalidiazotrophicus MS 6(T) (96.47 %). Strain NH3(T) could be distinguished from these phylogenetically close neighbours based on a number of phenotypic properties. On the basis of phenotypic and chemotaxonomic characteristics and phylogenetic data, we conclude that strain NH3(T) ( = CGMCC 1.10116(T)  = JCM 16507(T)) merits classification as the type strain of a novel species, for which the name Bacillus nanhaiisediminis sp. nov. is proposed.

  7. Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

    PubMed

    Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

    2003-12-06

    Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

  8. Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

    NASA Technical Reports Server (NTRS)

    Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1991-01-01

    Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

  9. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    PubMed

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  10. Horizontal Transfer of Segments of the 16S rRNA Genes between Species of the Streptococcus anginosus Group

    PubMed Central

    Schouls, Leo M.; Schot, Corrie S.; Jacobs, Jan A.

    2003-01-01

    The nature in variation of the 16S rRNA gene of members of the Streptococcus anginosus group was investigated by hybridization and DNA sequencing. A collection of 708 strains was analyzed by reverse line blot hybridization. This revealed the presence of distinct reaction patterns representing 11 different hybridization groups. The 16S rRNA genes of two strains of each hybridization group were sequenced to near-completion, and the sequence data confirmed the reverse line blot hybridization results. Closer inspection of the sequences revealed mosaic-like structures, strongly suggesting horizontal transfer of segments of the 16S rRNA gene between different species belonging to the Streptococcus anginosus group. Southern blot hybridization further showed that within a single strain all copies of the 16S rRNA gene had the same composition, indicating that the apparent mosaic structures were not PCR-induced artifacts. These findings indicate that the highly conserved rRNA genes are also subject to recombination and that these events may be fixed in the population. Such recombination may lead to the construction of incorrect phylogenetic trees based on the 16S rRNA genes. PMID:14645285

  11. Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.

    PubMed

    Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S

    2014-07-24

    The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated. © 2014 by The American Society of Hematology.

  12. Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

    PubMed Central

    Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

    2010-01-01

    N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

  13. Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

    PubMed

    Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

    2007-02-23

    N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

  14. The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing

    PubMed Central

    Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

    2016-01-01

    ABSTRACT Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation. PMID:26918764

  15. The cytoplasmic mRNA degradation factor Pat1 is required for rRNA processing.

    PubMed

    Muppavarapu, Mridula; Huch, Susanne; Nissan, Tracy

    2016-01-01

    Pat1 is a key cytoplasmic mRNA degradation factor, the loss of which severely increases mRNA half-lives. Several recent studies have shown that Pat1 can enter the nucleus and can shuttle between the nucleus and the cytoplasm. As a result, many nuclear roles have been proposed for Pat1. In this study, we analyzed four previously suggested nuclear roles of Pat1 and show that Pat1 is not required for efficient pre-mRNA splicing or pre-mRNA decay in yeast. However, lack of Pat1 results in accumulation of pre-rRNA processing intermediates. Intriguingly, we identified a novel genetic relationship between Pat1 and the rRNA decay machinery, specifically the exosome and the TRAMP complex. While the pre-rRNA processing intermediates that accumulate in the pat1 deletion mutant are, at least to some extent, recognized as aberrant by the rRNA degradation machinery, it is unlikely that these accumulations are the cause of their synthetic sick relationship. Here, we show that the dysregulation of the levels of mRNAs related to ribosome biogenesis could be the cause of the accumulation of the pre-rRNA processing intermediates. Although our results support a role for Pat1 in transcription, they nevertheless suggest that the primary cause of the dysregulated mRNA levels is most likely due to Pat1's role in mRNA decapping and mRNA degradation.

  16. Oxidative stress damages rRNA inside the ribosome and differentially affects the catalytic center

    PubMed Central

    Willi, Jessica; Küpfer, Pascal; Evéquoz, Damien; Fernandez, Guillermo; Polacek, Norbert

    2018-01-01

    Abstract Intracellular levels of reactive oxygen species (ROS) increase as a consequence of oxidative stress and represent a major source of damage to biomolecules. Due to its high cellular abundance RNA is more frequently the target for oxidative damage than DNA. Nevertheless the functional consequences of damage on stable RNA are poorly understood. Using a genome-wide approach, based on 8-oxo-guanosine immunoprecipitation, we present evidence that the most abundant non-coding RNA in a cell, the ribosomal RNA (rRNA), is target for oxidative nucleobase damage by ROS. Subjecting ribosomes to oxidative stress, we demonstrate that oxidized 23S rRNA inhibits the ribosome during protein biosynthesis. Placing single oxidized nucleobases at specific position within the ribosome's catalytic center by atomic mutagenesis resulted in markedly different functional outcomes. While some active site nucleobases tolerated oxidative damage well, oxidation at others had detrimental effects on protein synthesis by inhibiting different sub-steps of the ribosomal elongation cycle. Our data provide molecular insight into the biological consequences of RNA oxidation in one of the most central cellular enzymes and reveal mechanistic insight on the role of individual active site nucleobases during translation. PMID:29309687

  17. Detection of bacterial 16S rRNA using a molecular beacon-based X sensor

    PubMed Central

    Gerasimova, Yulia V.; Kolpashchikov, Dmitry M.

    2012-01-01

    We demonstrate how a long structurally constrained RNA can be analyzed in homogeneous solution at ambient temperatures with high specificity using a sophisticated biosensor. The sensor consists of a molecular beacon probe as a signal reporter and two DNA adaptor strands, which have fragments complementary to the reporter and to the analyzed RNA. One adaptor strand uses its long RNA-binding arm to unwind the RNA secondary structure. Second adaptor strand with a short RNA-binding arm hybridizes only to a fully complementary site, thus providing high recognition specificity. Overall the three-component sensor and the target RNA form a four-stranded DNA crossover (X) structure. Using this sensor, E.coli 16S rRNA was detected in real time with the detection limit of ~ 0.17 nM. The high specificity of the analysis was proven by differentiating B.subtilus from E.coli 16S rRNA sequences. The sensor responds to the presence of the analyte within seconds. PMID:23021850

  18. Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences

    PubMed Central

    2018-01-01

    Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA) is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%), all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal. PMID:29682424

  19. Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

    PubMed Central

    Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

    1992-01-01

    Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

  20. Three Cases of Anaerobiospirillum succiniciproducens Bacteremia Confirmed by 16S rRNA Gene Sequencing

    PubMed Central

    Tee, Wee; Korman, Tony M.; Waters, Mary Jo; Macphee, Andrew; Jenney, Adam; Joyce, Linda; Dyall-Smith, Michael L.

    1998-01-01

    We describe three cases of Anaerobiospirillum succiniciproducens bacteremia from Australia. We believe one of these cases represents the first report of A. succiniciproducens bacteremia in a human immunodeficiency virus (HIV)-infected individual. The other two patients had an underlying disorder (one patient had bleeding esophageal varices complicating alcohol liver disease and one patient had non-Hodgkin’s lymphoma). A motile, gram-negative, spiral anaerobe was isolated by culturing blood from all patients. Electron microscopy showed a curved bacterium with bipolar tufts of flagella resembling Anaerobiospirillum spp. Sequencing of the 16S rRNA genes of the isolates revealed no close relatives (organisms likely to be in the same genus) in the sequence databases, nor were any sequence data available for A. succiniciproducens. This report presents for the first time the 16S rRNA gene sequence of the type strain of A. succiniciproducens, strain ATCC 29305. Two of the three clinical isolates have sequences identical to that of the type strain, while the sequence of the other strain differs from that of the type strain at 4 nucleotides. PMID:9574678

  1. Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

    PubMed

    Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

    2002-12-01

    Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

  2. AHR/CYP1A1 interplay triggers lymphatic barrier breaching in breast cancer spheroids by inducing 12(S)-HETE synthesis.

    PubMed

    Nguyen, Chi Huu; Brenner, Stefan; Huttary, Nicole; Atanasov, Atanas Georgiev; Dirsch, Verena Maria; Chatuphonprasert, Waranya; Holzner, Sivio; Stadler, Serena; Riha, Juliane; Krieger, Sigurd; de Martin, Rainer; Bago-Horvath, Zsuzsanna; Krupitza, Georg; Jäger, Walter

    2016-11-15

    A causal link between overexpression of aryl hydrocarbon receptor (AHR) and its target cytochrome P450 1A1 (CYP1A1) and metastatic outgrowth of various cancer entities has been established. Nevertheless, the mechanism how AHR/CYP1A1 support metastasis formation is still little understood. In vitro we discovered a potential mechanism facilitating tumour dissemination based on the production of 12(S)-hydroxyeicosatetraenoic acid (12(S)-HETE). Utilising a three-dimensional lymph endothelial cell (LEC) monolayer & MDA-MB231 breast cancer cell spheroid co-culture model in combination with knock-down approach allowed elucidation of the molecular/biochemical basis of AHR/CYP1A1-induced tumour breaching through the LEC barrier. Enzyme immunoassay evidenced the potential of recombinant CYP1A1 to synthesise 12(S)-HETE in vitro and qPCR and Western blotting measured gene and protein expression in specific experimental settings. In detail, AHR induced CYP1A1 expression and 12(S)-HETE secretion in tumour spheroids, which caused LEC junction retraction thereby forming large discontinuities allowing transmigration of the tumour. This was enforced by the activating AHR ligand 6-formylindolo (3,3-b)carbazole (FICZ), or inhibited by the AHR antagonist 3,3’-diindolylmethane (DIM) as well as by siRNA against AHR and CYP1A1. AHR and NF-κB were negatively cross talking and therefore, the inhibition of AHR (but not CYP1A1) induced RELA, RELB, NFKB1, NFKB2 and the NF-κB target MMP1, which itself promotes tumour intravasation by a mechanism that is different from 12(S)-HETE. Conversely, the inhibition of NFKB2 induced AHR, CYP1A1 and 12(S)-HETE synthesis. The approved clinical drugs guanfacine and vinpocetine, which inhibit CYP1A1 and NF-κB, respectively, significantly inhibited LEC barrier breaching in vitro indicating an option to reduce metastatic dissemination.

  3. The repeat organizer, a specialized insulator element within the intergenic spacer of the Xenopus rRNA genes.

    PubMed Central

    Robinett, C C; O'Connor, A; Dunaway, M

    1997-01-01

    We have identified a novel activity for the region of the intergenic spacer of the Xenopus laevis rRNA genes that contains the 35- and 100-bp repeats. We devised a new assay for this region by constructing DNA plasmids containing a tandem repeat of rRNA reporter genes that were separated by the 35- and 100-bp repeat region and a rRNA gene enhancer. When the 35- and 100-bp repeat region is present in its normal position and orientation at the 3' end of the rRNA reporter genes, the enhancer activates the adjacent downstream promoter but not the upstream rRNA promoter on the same plasmid. Because this element can restrict the range of an enhancer's activity in the context of tandem genes, we have named it the repeat organizer (RO). The ability to restrict enhancer action is a feature of insulator elements, but unlike previously described insulator elements the RO does not block enhancer action in a simple enhancer-blocking assay. Instead, the activity of the RO requires that it be in its normal position and orientation with respect to the other sequence elements of the rRNA genes. The enhancer-binding transcription factor xUBF also binds to the repetitive sequences of the RO in vitro, but these sequences do not activate transcription in vivo. We propose that the RO is a specialized insulator element that organizes the tandem array of rRNA genes into single-gene expression units by promoting activation of a promoter by its proximal enhancers. PMID:9111359

  4. Technologically important extremophile 16S rRNA sequence Shannon entropy and fractal property comparison with long term dormant microbes

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Gadura, N.; Dehipawala, S.; Cheung, E.; Tuffour, M.; Schneider, P.; Tremberger, G., Jr.; Lieberman, D.; Cheung, T.

    2011-10-01

    Technologically important extremophiles including oil eating microbes, uranium and rocket fuel perchlorate reduction microbes, electron producing microbes and electrode electrons feeding microbes were compared in terms of their 16S rRNA sequences, a standard targeted sequence in comparative phylogeny studies. Microbes that were reported to have survived a prolonged dormant duration were also studied. Examples included the recently discovered microbe that survives after 34,000 years in a salty environment while feeding off organic compounds from other trapped dead microbes. Shannon entropy of the 16S rRNA nucleotide composition and fractal dimension of the nucleotide sequence in terms of its atomic number fluctuation analyses suggest a selected range for these extremophiles as compared to other microbes; consistent with the experience of relatively mild evolutionary pressure. However, most of the microbes that have been reported to survive in prolonged dormant duration carry sequences with fractal dimension between 1.995 and 2.005 (N = 10 out of 13). Similar results are observed for halophiles, red-shifted chlorophyll and radiation resistant microbes. The results suggest that prolonged dormant duration, in analogous to high salty or radiation environment, would select high fractal 16S rRNA sequences. Path analysis in structural equation modeling supports a causal relation between entropy and fractal dimension for the studied 16S rRNA sequences (N = 7). Candidate choices for high fractal 16S rRNA microbes could offer protection for prolonged spaceflights. BioBrick gene network manipulation could include extremophile 16S rRNA sequences in synthetic biology and shed more light on exobiology and future colonization in shielded spaceflights. Whether the high fractal 16S rRNA sequences contain an asteroidlike extra-terrestrial source could be speculative but interesting.

  5. Cancer cells cause vascular endothelial cell (vEC) retraction via 12(S)HETE secretion; the possible role of cancer cell derived microparticle.

    PubMed

    Uchide, Keiji; Sakon, Masato; Ariyoshi, Hideo; Nakamori, Syouji; Tokunaga, Masaru; Monden, Morito

    2007-02-01

    Cancer cell mediated vascular endothelial cell (vEC) retraction plays a pivotal role in cancer metastasis. The aim of this study is to clarify the biochemical character of vEC retraction factor derived from human breast cancer cell line, MCF-7. In order to estimate vEC retracting activity, transwell chamber assay system was employed. We first tested the effects of trypsin digestion as well as lipid extraction of culture medium (CM). Trypsin digestion of CM resulted in approximately 40% loss of vEC retracting activity and lipid extraction of CM by Brigh and Dyer methods recovered approximately 60% of vEC retracting activity, suggesting that approximately 60% of vEC retracting activity in MCF-7 derived CM is due to lipid. Although Nordihydroguaiaretic acid (NDGA), the specific lipoxygenase inhibitor, suppressed vEC retracting activity in CM, Acetyl salicylic acid (ASA), a specific cyclooxygenase inhibitor, did not affect the activity, suggesting that lipid exerting vEC retracting activity in CM belongs to lipoxygenase mediated arachidonate metabolites. Thin layer chromatography clearly demonstrated that Rf value of lipid vEC retracting factor in CM is identical to 12HETE. Authentic 12(S)HETE, but not 12(R)HETE, showed vEC retracting activity. After the ultracentrifugation of CM, most lipid vEC retracting activity was recovered from the pellet fraction, and flow cytometric analysis using specific antibody against 12(S)HETE clearly showed the association of 12(S)HETE with small particle in CM. These findings suggested the principal involvement of 12(S)HETE in cancer cell derived microparticles in cancer cell mediated vEC retraction.

  6. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    PubMed Central

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  7. Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

    PubMed

    Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

    2018-05-03

    The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

  8. Conserved Curvature of RNA Polymerase I Core Promoter Beyond rRNA Genes: The Case of the Tritryps

    PubMed Central

    Smircich, Pablo; Duhagon, María Ana; Garat, Beatriz

    2015-01-01

    In trypanosomatids, the RNA polymerase I (RNAPI)-dependent promoters controlling the ribosomal RNA (rRNA) genes have been well identified. Although the RNAPI transcription machinery recognizes the DNA conformation instead of the DNA sequence of promoters, no conformational study has been reported for these promoters. Here we present the in silico analysis of the intrinsic DNA curvature of the rRNA gene core promoters in Trypanosoma brucei, Trypanosoma cruzi, and Leishmania major. We found that, in spite of the absence of sequence conservation, these promoters hold conformational properties similar to other eukaryotic rRNA promoters. Our results also indicated that the intrinsic DNA curvature pattern is conserved within the Leishmania genus and also among strains of T. cruzi and T. brucei. Furthermore, we analyzed the impact of point mutations on the intrinsic curvature and their impact on the promoter activity. Furthermore, we found that the core promoters of protein-coding genes transcribed by RNAPI in T. brucei show the same conserved conformational characteristics. Overall, our results indicate that DNA intrinsic curvature of the rRNA gene core promoters is conserved in these ancient eukaryotes and such conserved curvature might be a requirement of RNAPI machinery for transcription of not only rRNA genes but also protein-coding genes. PMID:26718450

  9. Group I introns are inherited through common ancestry in the nuclear-encoded rRNA of Zygnematales (Charophyceae).

    PubMed Central

    Bhattacharya, D; Surek, B; Rüsing, M; Damberger, S; Melkonian, M

    1994-01-01

    Group I introns are found in organellar genomes, in the genomes of eubacteria and phages, and in nuclear-encoded rRNAs. The origin and distribution of nuclear-encoded rRNA group I introns are not understood. To elucidate their evolutionary relationships, we analyzed diverse nuclear-encoded small-subunit rRNA group I introns including nine sequences from the green-algal order Zygnematales (Charophyceae). Phylogenetic analyses of group I introns and rRNA coding regions suggest that lateral transfers have occurred in the evolutionary history of group I introns and that, after transfer, some of these elements may form stable components of the host-cell nuclear genomes. The Zygnematales introns, which share a common insertion site (position 1506 relative to the Escherichia coli small-subunit rRNA), form one subfamily of group I introns that has, after its origin, been inherited through common ancestry. Since the first Zygnematales appear in the middle Devonian within the fossil record, the "1506" group I intron presumably has been a stable component of the Zygnematales small-subunit rRNA coding region for 350-400 million years. PMID:7937917

  10. MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.

    PubMed

    Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier

    2016-10-25

    MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.

  11. MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis

    PubMed Central

    Lafita-Navarro, Maria del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T.; Lafarga, Miguel; León, Javier

    2016-01-01

    MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells. PMID:27588501

  12. rRNA Genes Are Not Fully Activated in Mouse Somatic Cell Nuclear Transfer Embryos*

    PubMed Central

    Zheng, Zhong; Jia, Jia-Lin; Bou, Gerelchimeg; Hu, Li-Li; Wang, Zhen-Dong; Shen, Xing-Hui; Shan, Zhi-Yan; Shen, Jing-Ling; Liu, Zhong-Hua; Lei, Lei

    2012-01-01

    The well known and most important function of nucleoli is ribosome biogenesis. However, the nucleolus showed delayed development and malfunction in somatic cell nuclear transfer (NT) embryos. Previous studies indicated that nearly half rRNA genes (rDNA) in somatic cells were inactive and not transcribed. We compared the rDNA methylation level, active nucleolar organizer region (NORs) numbers, nucleolar proteins (upstream binding factor (UBF), nucleophosmin (B23)) distribution, and nucleolar-related gene expression in three different donor cells and NT embryos. The results showed embryonic stem cells (ESCs) had the most active NORs and lowest rDNA methylation level (7.66 and 6.76%), whereas mouse embryonic fibroblasts (MEFs) were the opposite (4.70 and 22.57%). After the donor cells were injected into enucleated MII oocytes, cumulus cells and MEFs nuclei lost B23 and UBF signals in 20 min, whereas in ESC-NT embryos, B23 and UBF signals could still be detected at 60 min post-NT. The embryos derived from ESCs, cumulus cells, and MEFs showed the same trend in active NORs numbers (7.19 versus 6.68 versus 5.77, p < 0.05) and rDNA methylation levels (6.36 versus 9.67% versus 15.52%) at the 4-cell stage as that in donor cells. However, the MEF-NT embryos displayed low rRNA synthesis/processing potential at morula stage and had an obvious decrease in blastocyst developmental rate. The results presented clear evidences that the rDNA reprogramming efficiency in NT embryos was determined by the rDNA activity in donor cells from which they derived. PMID:22467869

  13. Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

    PubMed Central

    Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

    2017-01-01

    Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

  14. Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

    PubMed

    Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

    2017-11-01

    Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

  15. Identification of the Microbiota in Carious Dentin Lesions Using 16S rRNA Gene Sequencing

    PubMed Central

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4–76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating. PMID:25083880

  16. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing.

    PubMed

    Obata, Junko; Takeshita, Toru; Shibata, Yukie; Yamanaka, Wataru; Unemori, Masako; Akamine, Akifumi; Yamashita, Yoshihisa

    2014-01-01

    While mutans streptococci have long been assumed to be the specific pathogen responsible for human dental caries, the concept of a complex dental caries-associated microbiota has received significant attention in recent years. Molecular analyses revealed the complexity of the microbiota with the predominance of Lactobacillus and Prevotella in carious dentine lesions. However, characterization of the dentin caries-associated microbiota has not been extensively explored in different ethnicities and races. In the present study, the bacterial communities in the carious dentin of Japanese subjects were analyzed comprehensively with molecular approaches using the16S rRNA gene. Carious dentin lesion samples were collected from 32 subjects aged 4-76 years, and the 16S rRNA genes, amplified from the extracted DNA with universal primers, were sequenced with a pyrosequencer. The bacterial composition was classified into clusters I, II, and III according to the relative abundance (high, middle, low) of Lactobacillus. The bacterial composition in cluster II was composed of relatively high proportions of Olsenella and Propionibacterium or subdominated by heterogeneous genera. The bacterial communities in cluster III were characterized by the predominance of Atopobium, Prevotella, or Propionibacterium with Streptococcus or Actinomyces. Some samples in clusters II and III, mainly related to Atopobium and Propionibacterium, were novel combinations of microbiota in carious dentin lesions and may be characteristic of the Japanese population. Clone library analysis revealed that Atopobium sp. HOT-416 and P. acidifaciens were specific species associated with dentinal caries among these genera in a Japanese population. We summarized the bacterial composition of dentinal carious lesions in a Japanese population using next-generation sequencing and found typical Japanese types with Atopobium or Propionibacterium predominating.

  17. Chromatin structure and methylation of rat rRNA genes studied by formaldehyde fixation and psoralen cross-linking.

    PubMed Central

    Stancheva, I; Lucchini, R; Koller, T; Sogo, J M

    1997-01-01

    By using formaldehyde cross-linking of histones to DNA and gel retardation assays we show that formaldehyde fixation, similar to previously established psoralen photocross-linking, discriminates between nucleosome- packed (inactive) and nucleosome-free (active) fractions of ribosomal RNA genes. By both cross-linking techniques we were able to purify fragments from agarose gels, corresponding to coding, enhancer and promoter sequences of rRNA genes, which were further investigated with respect to DNA methylation. This approach allows us to analyse independently and in detail methylation patterns of active and inactive rRNA gene copies by the combination of Hpa II and Msp I restriction enzymes. We found CpG methylation mainly present in enhancer and promoter regions of inactive rRNA gene copies. The methylation of one single Hpa II site, located in the promoter region, showed particularly strong correlation with the transcriptional activity. PMID:9108154

  18. Salinity inhibits post transcriptional processing of chloroplast 16S rRNA in shoot cultures of jojoba (Simmondsia chinesis).

    PubMed

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2005-03-01

    Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.

  19. Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864

  20. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    PubMed Central

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  1. A comparative study of COI and 16 S rRNA genes for DNA barcoding of cultivable carps in India.

    PubMed

    Mohanty, Mausumee; Jayasankar, Pallipuram; Sahoo, Lakshman; Das, Paramananda

    2015-02-01

    The 5' region of the mitochondrial DNA gene cytochrome c oxidase subunit I (COI) is the standard marker for DNA barcoding. However, 16 S rRNA has also been advocated for DNA barcoding in many animal species. Herein, we directly compare the usefulness of COI and 16 S rRNA in discriminating six cultivable carp species: Labeo rohita, Catla catla, Cirrhinus mrigala, Labeo fimbriatus, Labeo bata and Cirrhinus reba from India. Analysis of partial sequences of these two gene fragments from 171 individuals indicated close genetic relationship between Catla catla and Labeo rohita. The results of the present study indicated COI to be more useful than 16 S rRNA for DNA barcoding of Indian carps.

  2. Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

    PubMed Central

    Sato, Mitsuharu; Miyazaki, Kentaro

    2017-01-01

    Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination

  3. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  4. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-05-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

  5. Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

    PubMed Central

    Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I

    2001-01-01

    Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding. PMID:11350033

  6. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    PubMed Central

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  8. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  9. Nucleosome Translational Position, Not Histone Acetylation, Determines TFIIIA Binding to Nucleosomal Xenopus laevis 5S rRNA Genes

    PubMed Central

    Howe, LeAnn; Ausió, Juan

    1998-01-01

    We sought to study the binding constraints placed on the nine-zinc-finger protein transcription factor IIIA (TFIIIA) by a histone octamer. To this end, five overlapping fragments of the Xenopus laevis oocyte and somatic 5S rRNA genes were reconstituted into nucleosomes, and it was subsequently shown that nucleosome translational positioning is a major determinant of the binding of TFIIIA to the 5S rRNA genes. Furthermore, it was found that histone acetylation cannot override the TFIIIA binding constraints imposed by unfavorable translational positions. PMID:9488430

  10. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility

    PubMed Central

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-01-01

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmAII enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmAII, rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmAII in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmAII activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmAII, thereby facilitating TEL binding to the ribosome. PMID:26365244

  11. RlmCD-mediated U747 methylation promotes efficient G748 methylation by methyltransferase RlmAII in 23S rRNA in Streptococcus pneumoniae; interplay between two rRNA methylations responsible for telithromycin susceptibility.

    PubMed

    Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko

    2015-10-15

    Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    PubMed

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. 16S rRNA Amplicon Sequencing for Epidemiological Surveys of Bacteria in Wildlife

    PubMed Central

    Razzauti, Maria; Bard, Emilie; Bernard, Maria; Brouat, Carine; Charbonnel, Nathalie; Dehne-Garcia, Alexandre; Loiseau, Anne; Tatard, Caroline; Tamisier, Lucie; Vayssier-Taussat, Muriel; Vignes, Helene

    2016-01-01

    ABSTRACT The human impact on natural habitats is increasing the complexity of human-wildlife interactions and leading to the emergence of infectious diseases worldwide. Highly successful synanthropic wildlife species, such as rodents, will undoubtedly play an increasingly important role in transmitting zoonotic diseases. We investigated the potential for recent developments in 16S rRNA amplicon sequencing to facilitate the multiplexing of the large numbers of samples needed to improve our understanding of the risk of zoonotic disease transmission posed by urban rodents in West Africa. In addition to listing pathogenic bacteria in wild populations, as in other high-throughput sequencing (HTS) studies, our approach can estimate essential parameters for studies of zoonotic risk, such as prevalence and patterns of coinfection within individual hosts. However, the estimation of these parameters requires cleaning of the raw data to mitigate the biases generated by HTS methods. We present here an extensive review of these biases and of their consequences, and we propose a comprehensive trimming strategy for managing these biases. We demonstrated the application of this strategy using 711 commensal rodents, including 208 Mus musculus domesticus, 189 Rattus rattus, 93 Mastomys natalensis, and 221 Mastomys erythroleucus, collected from 24 villages in Senegal. Seven major genera of pathogenic bacteria were detected in their spleens: Borrelia, Bartonella, Mycoplasma, Ehrlichia, Rickettsia, Streptobacillus, and Orientia. Mycoplasma, Ehrlichia, Rickettsia, Streptobacillus, and Orientia have never before been detected in West African rodents. Bacterial prevalence ranged from 0% to 90% of individuals per site, depending on the bacterial taxon, rodent species, and site considered, and 26% of rodents displayed coinfection. The 16S rRNA amplicon sequencing strategy presented here has the advantage over other molecular surveillance tools of dealing with a large spectrum of bacterial

  14. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    PubMed

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

    PubMed Central

    Heilek, G M; Noller, H F

    1996-01-01

    Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

  16. Tomato (Solanum lycopersicum) variety discrimination and hybridization analysis based on the 5S rRNA region.

    PubMed

    Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan

    2014-05-04

    The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.

  17. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    EPA Science Inventory

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  18. Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

    PubMed Central

    Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

    2012-01-01

    Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

  19. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    USDA-ARS?s Scientific Manuscript database

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  20. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  1. The Role of 16S rRNA Gene Sequencing in Identification of Microorganisms Misidentified by Conventional Methods

    PubMed Central

    Petti, C. A.; Polage, C. R.; Schreckenberger, P.

    2005-01-01

    Traditional methods for microbial identification require the recognition of differences in morphology, growth, enzymatic activity, and metabolism to define genera and species. Full and partial 16S rRNA gene sequencing methods have emerged as useful tools for identifying phenotypically aberrant microorganisms. We report on three bacterial blood isolates from three different College of American Pathologists-certified laboratories that were referred to ARUP Laboratories for definitive identification. Because phenotypic identification suggested unusual organisms not typically associated with the submitted clinical diagnosis, consultation with the Medical Director was sought and further testing was performed including partial 16S rRNA gene sequencing. All three patients had endocarditis, and conventional methods identified isolates from patients A, B, and C as a Facklamia sp., Eubacterium tenue, and a Bifidobacterium sp. 16S rRNA gene sequencing identified the isolates as Enterococcus faecalis, Cardiobacterium valvarum, and Streptococcus mutans, respectively. We conclude that the initial identifications of these three isolates were erroneous, may have misled clinicians, and potentially impacted patient care. 16S rRNA gene sequencing is a more objective identification tool, unaffected by phenotypic variation or technologist bias, and has the potential to reduce laboratory errors. PMID:16333109

  2. Phylogenetic Analysis of Bacteroidales 16S rRNA Genes Unveils Sequences Specific to Diverse Swine Fecal Sources

    EPA Science Inventory

    Two of the currently available methods to assess swine fecal pollution (Bac1 and PF163) target Bacteroidales 16S rRNA genes. However, these assays have been shown to exhibit poor host-specificity and low detection limits in environmental waters, in part due to the limited number...

  3. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    PubMed Central

    2011-01-01

    Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

  4. The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA

    PubMed Central

    Toh, Seok-Ming; Xiong, Liqun; Bae, Taeok; Mankin, Alexander S.

    2008-01-01

    A2503 in 23S rRNA of the Gram-negative bacterium Escherichia coli is located in a functionally important region of the ribosome, at the entrance to the nascent peptide exit tunnel. In E. coli, and likely in other species, this adenosine residue is post-transcriptionally modified to m2A. The enzyme responsible for this modification was previously unknown. We identified E. coli protein YfgB, which belongs to the radical SAM enzyme superfamily, as the methyltransferase that modifies A2503 of 23S rRNA to m2A. Inactivation of the yfgB gene in E. coli led to the loss of modification at nucleotide A2503 of 23S rRNA as revealed by primer extension analysis and thin layer chromatography. The A2503 modification was restored when YfgB protein was expressed in the yfgB knockout strain. A similar protein was shown to catalyze post-transcriptional modification of A2503 in 23S rRNA in Gram-positive Staphylococcus aureus. The yfgB knockout strain loses in competition with wild type in a co-growth experiment, indicating functional importance of A2503 modification. The location of A2503 in the exit tunnel suggests its possible involvement in interaction with the nascent peptide and raises the possibility that its post-transcriptional modification may influence such an interaction. PMID:18025251

  5. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses

    PubMed Central

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Background Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. Methods The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Results Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Conclusion Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3–100%. However, the

  6. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    PubMed

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

  7. Prevalence of 16S rRNA methylase genes among β-lactamase-producing Enterobacteriaceae clinical isolates in Saudi Arabia

    PubMed Central

    Al Sheikh, Yazeed A.; Marie, Mohammed Ali M.; John, James; Krishnappa, Lakshmana Gowda; Dabwab, Khaled Homoud M.

    2014-01-01

    Background Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and β-Lactamase (blaTEM-1, blaSHV-12, blaCTX-M-14) genes, we screened all phenotypic positive β-Lactamase producing enterobacteriaceae by polymerase chain reaction (PCR) targeting above genes. A total of 330 enterobacteriaceae strains were collected during study period out of that 218 isolates were identified phenotypically as β-Lactamase producers, which include 50 (22.9%) Escherichia coli; 92 (42.2%) Klebsiella pneumoniae, 44 (20.2%), Citrobactor freundii and 32 (14.7%) Enterobacter spp. Results Among this 218, only 188 isolates harbored the resistant gene for β-Lactamase production. Major β-Lactamase producing isolates were bla TEM-1 type. 122 (56 %) isolates were found to produce any one of the 16S rRNA methylase genes. A total of 116 isolates co produced β-Lactamase and at least one 16S rRNA methylases gene Co production of armA gene was found in 26 isolates with rmtB and in 4 isolates with rmtC. The rmtA and rmtD genes were not detected in any of the tested isolates. Six isolates were positive for a 16S rRNA methylase gene alone. Conclusion β-Lactamase producing isolates appears to coexist with 16S rRNA methylase predominantly armA and rmtB genes in the same isolate. We conclude the major β-Lactamase and 16S rRNA methylases co-producer was K. pneumoniae followed by E. coli. We suggest further work on evaluating other β-lactamases types and novel antibiotic resistance mechanisms among Enterobacteriaceae. PMID:25005152

  8. Calculations of the excitation energies of all-trans and 11,12s-dicis retinals using localized molecular orbitals obtained by the elongation method

    NASA Astrophysics Data System (ADS)

    Kurihara, Youji; Aoki, Yuriko; Imamura, Akira

    1997-09-01

    In the present article, the excitation energies of the all-trans and the 11,12s-dicis retinals were calculated by using the elongation method. The geometries of these molecules were optimized with the 4-31G basis set by using the GAUSSIAN 92 program. The wave functions for the calculation of the excitation energies were obtained with CNDO/S approximation by the elongation method, which enables us to analyze electronic structures of aperiodic polymers in terms of the exciton-type local excitation and the charge transfer-type excitation. The excitation energies were calculated by using the single excitation configuration interaction (SECI) on the basis of localized molecular orbitals (LMOs). The LMOs were obtained in the process of the elongation method. The configuration interaction (CI) matrices were diagonalized by Davidson's method. The calculated results were in good agreement with the experimental data for absorption spectra. In order to consider the isomerization path from 11,12s-dicis to all-trans retinals, the barriers to the rotations about C11-C12 double and C12-C13 single bonds were evaluated.

  9. A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

    PubMed

    Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

    2015-03-01

    The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

  10. CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.

    PubMed

    Bai, Baoyan; Moore, Henna M; Laiho, Marikki

    2013-01-01

    CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.

  11. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    PubMed

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons

    PubMed Central

    Pagano, Johanna F.B.; Ensink, Wim A.; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P.; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J.; Dekker, Rob J.

    2017-01-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. PMID:28003516

  13. Selective phylogenetic analysis targeting 16S rRNA genes of hyperthermophilic archaea in the deep-subsurface hot biosphere.

    PubMed

    Kimura, Hiroyuki; Ishibashi, Jun-Ichiro; Masuda, Harue; Kato, Kenji; Hanada, Satoshi

    2007-04-01

    International drilling projects for the study of microbial communities in the deep-subsurface hot biosphere have been expanded. Core samples obtained by deep drilling are commonly contaminated with mesophilic microorganisms in the drilling fluid, making it difficult to examine the microbial community by 16S rRNA gene clone library analysis. To eliminate mesophilic organism contamination, we previously developed a new method (selective phylogenetic analysis [SePA]) based on the strong correlation between the guanine-plus-cytosine (G+C) contents of the 16S rRNA genes and the optimal growth temperatures of prokaryotes, and we verified the method's effectiveness (H. Kimura, M. Sugihara, K. Kato, and S. Hanada, Appl. Environ. Microbiol. 72:21-27, 2006). In the present study we ascertained SePA's ability to eliminate contamination by archaeal rRNA genes, using deep-sea hydrothermal fluid (117 degrees C) and surface seawater (29.9 degrees C) as substitutes for deep-subsurface geothermal samples and drilling fluid, respectively. Archaeal 16S rRNA gene fragments, PCR amplified from the surface seawater, were denatured at 82 degrees C and completely digested with exonuclease I (Exo I), while gene fragments from the deep-sea hydrothermal fluid remained intact after denaturation at 84 degrees C because of their high G+C contents. An examination using mixtures of DNAs from the two environmental samples showed that denaturation at 84 degrees C and digestion with Exo I completely eliminated archaeal 16S rRNA genes from the surface seawater. Our method was quite useful for culture-independent community analysis of hyperthermophilic archaea in core samples recovered from deep-subsurface geothermal environments.

  14. New clades of euthyneuran gastropods (Mollusca) from 28S rRNA sequences.

    PubMed

    Dayrat, B; Tillier, A; Lecointre, G; Tillier, S

    2001-05-01

    Recent morphological and molecular results on phylogeny of euthyneuran gastropods, which include opisthobranchs and pulmonates, have greatly diminished previous supposed resolution of their phylogenetic relationships. In addition to recent morphological results, sequences of the D1 and D2 domains of the 28S rRNA are here analyzed by parsimony for 31 euthyneuran species. The molecular and previous morphological data sets were not congruent according to an ILD test, and morphological and molecular data could not be analyzed simultaneously. Consequently Bremer's Combinable Component Consensus was used to obtain a new tree, with the following supported molecular results: monophyly of a new clade of opisthobranchs including actively swimming Euthyneura, i.e., pelagic Gymnosomata and Thecosomata plus benthic Anaspidea; first molecular confirmation of monophylies of Hygrophila, including Chilina, Acteonoidea, and Sacoglossa, which include both shell-bearing species and slugs; and new confirmation of the monophyly of Stylommatophora. Morphological characters which support the new clades obtained here are discussed. Copyright 2001 Academic Press.

  15. 16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria

    PubMed Central

    Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A.; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J.; Thomas, David J.

    2018-01-01

    The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12–14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa. PMID:29551950

  16. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  17. Cleavage of rRNA ensures translational cessation in sperm at fertilization

    PubMed Central

    Johnson, G.D.; Sendler, E.; Lalancette, C.; Hauser, R.; Diamond, M.P.; Krawetz, S.A.

    2011-01-01

    Intact ribosomal RNAs (rRNAs) comprise the majority of somatic transcripts, yet appear conspicuously absent in spermatozoa, perhaps reflecting cytoplasmic expulsion during spermatogenesis. To discern their fate, total RNA retained in mature spermatozoa from three fertile donors was characterized by Next Generation Sequencing. In all samples, >75% of total sequence reads aligned to rRNAs. The distribution of reads along the length of these transcripts exhibited a high degree of non-uniformity that was reiterated between donors. The coverage of sequencing reads was inversely correlated with guanine-cytosine (GC)-richness such that sequences greater than ∼70% GC were virtually absent in all sperm RNA samples. To confirm the loss of sequence, the relative abundance of specific regions of the 28S transcripts in sperm was established by 7-Deaza-2′-deoxy-guanosine-5′-triphosphate RT–PCR. The inability to amplify specific regions of the 28S sequence from sperm despite the abundant representation of this transcript in the sequencing libraries demonstrates that approximately three-quarters of RNA retained in the mature male gamete are products of rRNA fragmentation. Hence, cleavage (not expulsion of the RNA component of the translational machinery) is responsible for preventing spurious translation following spermiogenesis. These results highlight the potential importance of those transcripts, including many mRNAs, which evade fragmentation and remain intact when sperm are delivered at fertilization. Sequencing data are deposited in GEO as: GSE29160. PMID:21831882

  18. 16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria.

    PubMed

    Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J; Thomas, David J

    2017-09-01

    The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12-14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa.

  19. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    PubMed

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  20. The Cladophora complex (Chlorophyta): new views based on 18S rRNA gene sequences.

    PubMed

    Bakker, F T; Olsen, J L; Stam, W T; van den Hoek, C

    1994-12-01

    Evolutionary relationships among species traditionally ascribed to the Siphonocladales/Cladophorales have remained unclear due to a lack of phylogenetically informative characters and extensive morphological plasticity resulting in morphological convergence. This study explores some of the diversity within the generic complex Cladophora and its siphonocladalaen allies. Twelve species of Cladophora representing 6 of the 11 morphological sections recognized by van den Hoek were analyzed along with 8 siphonocladalaen species using 18S rRNA gene sequences. The final alignment consisted of 1460 positions containing 92 phylogenetically informative substitutions. Weighting schemes (EOR weighting, combinatorial weighting) were applied in maximum parsimony analysis to correct for substitution bias. Stem characters were weighted 0.66 relative to single-stranded characters to correct for secondary structural constraints. Both weighting approaches resulted in greater phylogenetic resolution. Results confirm that there is no basis for the independent recognition of the Cladophorales and Siphonocladales. The Siphonocladales is polyphyletic, and Cladophora is paraphyletic. All analyses support two principal lineages, of which one contains predominantly tropical members including almost all siphonocladalean taxa, while the other lineage consists of mostly warm- to cold-temperate species of Cladophora.

  1. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  2. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

    PubMed

    Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

    2006-05-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

  3. Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

    PubMed Central

    Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

    2006-01-01

    The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

  4. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  5. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  6. CATCh, an Ensemble Classifier for Chimera Detection in 16S rRNA Sequencing Studies

    PubMed Central

    Mysara, Mohamed; Saeys, Yvan; Leys, Natalie; Raes, Jeroen

    2014-01-01

    In ecological studies, microbial diversity is nowadays mostly assessed via the detection of phylogenetic marker genes, such as 16S rRNA. However, PCR amplification of these marker genes produces a significant amount of artificial sequences, often referred to as chimeras. Different algorithms have been developed to remove these chimeras, but efforts to combine different methodologies are limited. Therefore, two machine learning classifiers (reference-based and de novo CATCh) were developed by integrating the output of existing chimera detection tools into a new, more powerful method. When comparing our classifiers with existing tools in either the reference-based or de novo mode, a higher performance of our ensemble method was observed on a wide range of sequencing data, including simulated, 454 pyrosequencing, and Illumina MiSeq data sets. Since our algorithm combines the advantages of different individual chimera detection tools, our approach produces more robust results when challenged with chimeric sequences having a low parent divergence, short length of the chimeric range, and various numbers of parents. Additionally, it could be shown that integrating CATCh in the preprocessing pipeline has a beneficial effect on the quality of the clustering in operational taxonomic units. PMID:25527546

  7. Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis

    PubMed Central

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2002-01-01

    An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128

  8. Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

    2012-12-01

    Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

  9. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  10. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    EPA Science Inventory

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  11. Anaplasma phagocytophilum in questing Ixodes ricinus ticks: comparison of prevalences and partial 16S rRNA gene variants in urban, pasture, and natural habitats.

    PubMed

    Overzier, Evelyn; Pfister, Kurt; Thiel, Claudia; Herb, Ingrid; Mahling, Monia; Silaghi, Cornelia

    2013-03-01

    Urban, natural, and pasture areas were investigated for prevalences and 16S rRNA gene variants of Anaplasma phagocytophilum in questing Ixodes ricinus ticks. The prevalences differed significantly between habitat types, and year-to-year variations in prevalence and habitat-dependent occurrence of 16S rRNA gene variants were detected.

  12. Product operator descriptions of INEPT and RINEPT NMR spectroscopies for ISn (I=1/2, S=3/2) spin systems.

    PubMed

    Tokatli, Ahmet; Gençten, Azmi; Sahin, Mükerrem; Tezel, Ozden; Bahçeli, Semiha

    2004-07-01

    The product operator descriptions of INEPT and reverse INEPT (RINEPT) NMR experiments are introduced for weakly coupled ISn (I=1/2, S=3/2 with n=1,2,3) spin systems. Explicit expressions for polarization transfer from spin-3/2 quadrupolar nuclei to spin-1/2 nuclei (and reversed polarization transfer) are given in detail by using the evolutions of product operators under the spin-spin coupling Hamiltonian. The results calculated for the intensities and positions of the observable signals are simulated in the molecules containing the 119Sn (I=1/2) and 35Cl (S=3/2) nuclei at the coupling constant of J(Sn-Cl)=375 Hz by using the Maple programme on computer.

  13. Product operator descriptions of INEPT and RINEPT NMR spectroscopies for ISn ( I=1/2, S=3/2) spin systems

    NASA Astrophysics Data System (ADS)

    Tokatlı, Ahmet; Gençten, Azmi; Şahin, Mükerrem; Tezel, Özden; Bahçeli, Semiha

    2004-07-01

    The product operator descriptions of INEPT and reverse INEPT (RINEPT) NMR experiments are introduced for weakly coupled ISn ( I=1/2, S=3/2 with n=1,2,3) spin systems. Explicit expressions for polarization transfer from spin-3/2 quadrupolar nuclei to spin-1/2 nuclei (and reversed polarization transfer) are given in detail by using the evolutions of product operators under the spin-spin coupling Hamiltonian. The results calculated for the intensities and positions of the observable signals are simulated in the molecules containning the 119Sn ( I=1/2) and 35Cl ( S=3/2) nuclei at the coupling constant of JSn-Cl=375 Hz by using the Maple programme on computer.

  14. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    PubMed

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  15. 16S rRNA Gene Survey of Microbial Communities in Winogradsky Columns

    PubMed Central

    Rundell, Ethan A.; Banta, Lois M.; Ward, Doyle V.; Watts, Corey D.; Birren, Bruce; Esteban, David J.

    2014-01-01

    A Winogradsky column is a clear glass or plastic column filled with enriched sediment. Over time, microbial communities in the sediment grow in a stratified ecosystem with an oxic top layer and anoxic sub-surface layers. Winogradsky columns have been used extensively to demonstrate microbial nutrient cycling and metabolic diversity in undergraduate microbiology labs. In this study, we used high-throughput 16s rRNA gene sequencing to investigate the microbial diversity of Winogradsky columns. Specifically, we tested the impact of sediment source, supplemental cellulose source, and depth within the column, on microbial community structure. We found that the Winogradsky columns were highly diverse communities but are dominated by three phyla: Proteobacteria, Bacteroidetes, and Firmicutes. The community is structured by a founding population dependent on the source of sediment used to prepare the columns and is differentiated by depth within the column. Numerous biomarkers were identified distinguishing sample depth, including Cyanobacteria, Alphaproteobacteria, and Betaproteobacteria as biomarkers of the soil-water interface, and Clostridia as a biomarker of the deepest depth. Supplemental cellulose source impacted community structure but less strongly than depth and sediment source. In columns dominated by Firmicutes, the family Peptococcaceae was the most abundant sulfate reducer, while in columns abundant in Proteobacteria, several Deltaproteobacteria families, including Desulfobacteraceae, were found, showing that different taxonomic groups carry out sulfur cycling in different columns. This study brings this historical method for enrichment culture of chemolithotrophs and other soil bacteria into the modern era of microbiology and demonstrates the potential of the Winogradsky column as a model system for investigating the effect of environmental variables on soil microbial communities. PMID:25101630

  16. Bacterial DNA detected on pathologically changed heart valves using 16S rRNA gene amplification.

    PubMed

    Chalupova, Miroslava; Skalova, Anna; Hajek, Tomas; Geigerova, Lenka; Kralova, Dana; Liska, Pavel; Hecova, Hana; Molacek, Jiri; Hrabak, Jaroslav

    2018-05-22

    Nowadays, dental diseases are one of the most common illnesses in the world. Some of them can lead to translocation of oral bacteria to the bloodstream causing intermittent bacteraemia. Therefore, a potential association between oral infection and cardiovascular diseases has been discussed in recent years as a result of adhesion of oral microbes to the heart valves. The aim of this study was to detect oral bacteria on pathologically changed heart valves not caused by infective endocarditis. In the study, patients with pathologically changed heart valves were involved. Samples of heart valves removed during heart valve replacement surgery were cut into two parts. One aliquot was cultivated aerobically and anaerobically. Bacterial DNA was extracted using Ultra-Deep Microbiome Prep (Molzym GmbH, Bremen, Germany) followed by a 16S rRNA gene PCR amplification using Mastermix 16S Complete kit (Molzym GmbH, Bremen, Germany). Positive PCR products were sequenced and the sequences were analyzed using BLAST database ( http://www.ncbi.nlm.nih/BLAST ). During the study period, 41 samples were processed. Bacterial DNA of the following bacteria was detected in 21 samples: Cutibacterium acnes (formerly Propionibacterium acnes) (n = 11; 52.38% of patients with positive bacterial DNA detection), Staphylococcus sp. (n = 9; 42.86%), Streptococcus sp. (n = 1; 4.76%), Streptococcus sanguinis (n = 4; 19.05%), Streptococcus oralis (n = 1; 4.76%), Carnobacterium sp. (n = 1; 4.76%), Bacillus sp. (n = 2; 9.52%), and Bergeyella sp. (n = 1; 4.76%). In nine samples, multiple bacteria were found. Our results showed significant appearance of bacteria on pathologically changed heart valves in patients with no symptoms of infective endocarditis.

  17. 16S rRNA analysis of diversity of manure microbial community in dairy farm environment

    PubMed Central

    Miao, Max; Wang, Yi; Settles, Matthew; del Rio, Noelia Silva; Castillo, Alejandro; Souza, Alex; Pereira, Richard

    2018-01-01

    Dairy farms generate a considerable amount of manure, which is applied in cropland as fertilizer. While the use of manure as fertilizer reduces the application of chemical fertilizers, the main concern with regards to manure application is microbial pollution. Manure is a reservoir of a broad range of microbial populations, including pathogens, which have potential to cause contamination and pose risks to public and animal health. Despite the widespread use of manure fertilizer, the change in microbial diversity of manure under various treatment processes is still not well-understood. We hypothesize that the microbial population of animal waste changes with manure handling used in a farm environment. Consequential microbial risk caused by animal manure may depend on manure handling. In this study, a reconnaissance effort for sampling dairy manure in California Central Valley followed by 16S rRNA analysis of content and diversity was undertaken to understand the microbiome of manure after various handling processes. The microbial community analysis of manure revealed that the population in liquid manure differs from that in solid manure. For instance, the bacteria of genus Sulfuriomonas were unique in liquid samples, while the bacteria of genus Thermos were observed only in solid samples. Bacteria of genus Clostridium were present in both solid and liquid samples. The population among liquid samples was comparable, as was the population among solid samples. These findings suggest that the mode of manure application (i.e., liquid versus solid) could have a potential impact on the microbiome of cropland receiving manure as fertilizers. PMID:29304047

  18. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    PubMed

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains < 0.1%. The abundance of some Pseudomonas species in wastewaters containing algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  19. Microbial community in persistent apical periodontitis: a 16S rRNA gene clone library analysis.

    PubMed

    Zakaria, M N; Takeshita, T; Shibata, Y; Maeda, H; Wada, N; Akamine, A; Yamashita, Y

    2015-08-01

    To characterize the microbial composition of persistent periapical lesions of root filled teeth using a molecular genetics approach. Apical lesion samples were collected from 12 patients (23-80 years old) who visited the Kyushu University Hospital for apicectomy with persistent periapical lesions associated with root filled teeth. DNA was directly extracted from each sample and the microbial composition was comprehensively analysed using clone library analysis of the 16S rRNA gene. Enterococcus faecalis, Candida albicans and specific fimA genotypes of Porphyromonas gingivalis were confirmed using polymerase chain reaction (PCR) analysis with specific primers. Bacteria were detected in all samples, and the dominant findings were P. gingivalis (19.9%), Fusobacterium nucleatum (11.2%) and Propionibacterium acnes (9%). Bacterial diversity was greater in symptomatic lesions than in asymptomatic ones. In addition, the following bacteria or bacterial combinations were characteristic to symptomatic lesions: Prevotella spp., Treponema spp., Peptostreptococcaceae sp. HOT-113, Olsenella uli, Slackia exigua, Selemonas infelix, P. gingivalis with type IV fimA, and a combination of P. gingivalis, F. nucleatum, and Peptostreptococcaceae sp. HOT-113 and predominance of Streptococcus spp. On the other hand, neither Enterococcus faecalis nor C. albicans were detected in any of the samples. Whilst a diverse bacterial species were observed in the persistent apical lesions, some characteristic patterns of bacterial community were found in the symptomatic lesions. The diverse variation of community indicates that bacterial combinations as a community may cause persistent inflammation in periapical tissues rather than specific bacterial species. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  20. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota

    PubMed Central

    Ellegaard, Kirsten M.; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities. PMID:27708630

  1. Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.

    PubMed

    Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane

    2018-05-14

    The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the

  2. Accurate, Rapid Taxonomic Classification of Fungal Large-Subunit rRNA Genes

    PubMed Central

    Liu, Kuan-Liang; Porras-Alfaro, Andrea; Eichorst, Stephanie A.

    2012-01-01

    Taxonomic and phylogenetic fingerprinting based on sequence analysis of gene fragments from the large-subunit rRNA (LSU) gene or the internal transcribed spacer (ITS) region is becoming an integral part of fungal classification. The lack of an accurate and robust classification tool trained by a validated sequence database for taxonomic placement of fungal LSU genes is a severe limitation in taxonomic analysis of fungal isolates or large data sets obtained from environmental surveys. Using a hand-curated set of 8,506 fungal LSU gene fragments, we determined the performance characteristics of a naïve Bayesian classifier across multiple taxonomic levels and compared the classifier performance to that of a sequence similarity-based (BLASTN) approach. The naïve Bayesian classifier was computationally more rapid (>460-fold with our system) than the BLASTN approach, and it provided equal or superior classification accuracy. Classifier accuracies were compared using sequence fragments of 100 bp and 400 bp and two different PCR primer anchor points to mimic sequence read lengths commonly obtained using current high-throughput sequencing technologies. Accuracy was higher with 400-bp sequence reads than with 100-bp reads. It was also significantly affected by sequence location across the 1,400-bp test region. The highest accuracy was obtained across either the D1 or D2 variable region. The naïve Bayesian classifier provides an effective and rapid means to classify fungal LSU sequences from large environmental surveys. The training set and tool are publicly available through the Ribosomal Database Project (http://rdp.cme.msu.edu/classifier/classifier.jsp). PMID:22194300

  3. DECIPHER, a Search-Based Approach to Chimera Identification for 16S rRNA Sequences

    PubMed Central

    Wright, Erik S.; Yilmaz, L. Safak

    2012-01-01

    DECIPHER is a new method for finding 16S rRNA chimeric sequences by the use of a search-based approach. The method is based upon detecting short fragments that are uncommon in the phylogenetic group where a query sequence is classified but frequently found in another phylogenetic group. The algorithm was calibrated for full sequences (fs_DECIPHER) and short sequences (ss_DECIPHER) and benchmarked against WigeoN (Pintail), ChimeraSlayer, and Uchime using artificially generated chimeras. Overall, ss_DECIPHER and Uchime provided the highest chimera detection for sequences 100 to 600 nucleotides long (79% and 81%, respectively), but Uchime's performance deteriorated for longer sequences, while ss_DECIPHER maintained a high detection rate (89%). Both methods had low false-positive rates (1.3% and 1.6%). The more conservative fs_DECIPHER, benchmarked only for sequences longer than 600 nucleotides, had an overall detection rate lower than that of ss_DECIPHER (75%) but higher than those of the other programs. In addition, fs_DECIPHER had the lowest false-positive rate among all the benchmarked programs (<0.20%). DECIPHER was outperformed only by ChimeraSlayer and Uchime when chimeras were formed from closely related parents (less than 10% divergence). Given the differences in the programs, it was possible to detect over 89% of all chimeras with just the combination of ss_DECIPHER and Uchime. Using fs_DECIPHER, we detected between 1% and 2% additional chimeras in the RDP, SILVA, and Greengenes databases from which chimeras had already been removed with Pintail or Bellerophon. DECIPHER was implemented in the R programming language and is directly accessible through a webpage or by downloading the program as an R package (http://DECIPHER.cee.wisc.edu). PMID:22101057

  4. Beyond 16S rRNA Community Profiling: Intra-Species Diversity in the Gut Microbiota.

    PubMed

    Ellegaard, Kirsten M; Engel, Philipp

    2016-01-01

    Interactions with microbes affect many aspects of animal biology, including immune system development, nutrition and health. In vertebrates, the gut microbiota is dominated by a small subset of phyla, but the species composition within these phyla is typically not conserved. Moreover, several recent studies have shown that bacterial species in the gut are composed of a multitude of strains, which frequently co-exist in their host, and may be host-specific. However, since the study of intra-species diversity is challenging, particularly in the setting of complex, host-associated microbial communities, our current understanding of the distribution, evolution and functional relevance of intra-species diversity in the gut is scarce. In order to unravel how genomic diversity translates into phenotypic diversity, community analyses going beyond 16S rRNA profiling, in combination with experimental approaches, are needed. Recently, the honeybee has emerged as a promising model for studying gut bacterial communities, particularly in terms of strain-level diversity. Unlike most other invertebrates, the honeybee gut is colonized by a remarkably consistent and specific core microbiota, which is dominated by only eight bacterial species. As for the vertebrate gut microbiota, these species are composed of highly diverse strains suggesting that similar evolutionary forces shape gut community structures in vertebrates and social insects. In this review, we outline current knowledge on the evolution and functional relevance of strain diversity within the gut microbiota, including recent insights gained from mammals and other animals such as the honeybee. We discuss methodological approaches and propose possible future avenues for studying strain diversity in complex bacterial communities.

  5. Peroxygenase-Catalyzed Fatty Acid Epoxidation in Cereal Seeds (Sequential Oxidation of Linoleic Acid into 9(S),12(S),13(S)-Trihydroxy-10(E)-Octadecenoic Acid).

    PubMed Central

    Hamberg, M.; Hamberg, G.

    1996-01-01

    Peroxygenase-catalyzed epoxidation of oleic acid in preparations of cereal seeds was investigated. The 105,000g particle fraction of oat (Avena sativa) seed homogenate showed high peroxygenase activity, i.e. 3034 [plus or minus] 288 and 2441 [plus or minus] 168 nmol (10 min)-1 mg-1 protein in two cultivars, whereas the corresponding fraction obtained from barley (Hordeum vulgare and Hordeum distichum), rye (Secale cereale), and wheat (Triticum aestivum) showed only weak activity, i.e. 13 to 138 nmol (10 min)-1 mg-1 protein. In subcellular fractions of oat seed homogenate, peroxygenase specific activity was highest in the 105,000g particle fraction, whereas lipoxygenase activity was more evenly distributed and highest in the 105,000g supernatant fraction. Incubation of [1-14C]linoleic acid with the 105,000g supernatant of oat seed homogenate led to the formation of several metabolites, i.e. in order of decreasing abundance, 9(S)-hydroxy-10(E),12(Z)-octadecadienoic acid, 9(S),12(S),13(S)-trihydroxy-10(E)-octadecenoic acid, cis-9,10-epoxy-12(Z)-octadecenoic acid [mainly the 9(R),10(S) enantiomer], cis-12,13-epoxy-9(Z)-octadecenoic acid [mainly the 12(R),13(S) enantiomer], threo-12,13-dihydroxy-9(Z)-octadecenoic acid, and 12(R),13(S)-epoxy-9(S)-hydroxy-10(E)-octadecenoic acid. Incubation of linoleic acid with the 105,000g particle fraction gave a similar, but not identical, pattern of metabolites. Conversion of linoleic acid into 9(S),12(S),13(S)-trihydroxy-10(E)-octadecenoic acid, a naturally occurring oxylipin with antifungal properties, took place by a pathway involving sequential catalysis by lipoxygenase, peroxygenase, and epoxide hydrolase. PMID:12226220

  6. rRNA gene restriction patterns as an epidemiological marker in nosocomial outbreaks of Staphylococcus aureus infections.

    PubMed

    Meugnier, H; Fernandez, M P; Bes, M; Brun, Y; Bornstein, N; Freney, J; Fleurette, J

    1993-01-01

    rRNA gene restriction patterns (ribotyping) were compared with phage typing, serotyping, enterotoxins and exfoliatin production in the analysis of 26 Staphylococcus aureus strains isolated from two different nosocomial outbreaks. Total DNA was cleaved by EcoRI restriction endonuclease. After agarose gel electrophoresis and Southern transfer, the hybridization of the membranes was done with radiolabelled 16S rRNA gene from Bacillus subtilis inserted into a plasmid vector. Six to 13 fragments were visualized. A core of common fragments was discerned for all strains tested. A full correlation between ribotyping and conventional markers was observed in only one of the outbreaks studied. In both outbreaks, ribotyping proved helpful in characterizing otherwise untypable strains.

  7. Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

    PubMed Central

    Berry, David; Gutierrez, Tony

    2017-01-01

    Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

  8. Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

    PubMed

    Berry, David; Gutierrez, Tony

    2017-01-01

    Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

  9. SHPRH regulates rRNA transcription by recognizing the histone code in an mTOR-dependent manner.

    PubMed

    Lee, Deokjae; An, Jungeun; Park, Young-Un; Liaw, Hungjiun; Woodgate, Roger; Park, Jun Hong; Myung, Kyungjae

    2017-04-25

    Many DNA repair proteins have additional functions other than their roles in DNA repair. In addition to catalyzing PCNA polyubiquitylation in response to the stalling of DNA replication, SHPRH has the additional function of facilitating rRNA transcription by localizing to the ribosomal DNA (rDNA) promoter in the nucleoli. SHPRH was recruited to the rDNA promoter using its plant homeodomain (PHD), which interacts with histone H3 when the fourth lysine of H3 is not trimethylated. SHPRH enrichment at the rDNA promoter was inhibited by cell starvation, by treatment with actinomycin D or rapamycin, or by depletion of CHD4. SHPRH also physically interacted with the RNA polymerase I complex. Taken together, we provide evidence that SHPRH functions in rRNA transcription through its interaction with histone H3 in a mammalian target of rapamycin (mTOR)-dependent manner.

  10. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    NASA Technical Reports Server (NTRS)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  11. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences].

    PubMed

    Petrov, N B; Vladychenskaia, N S

    2005-01-01

    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

  12. Identification of a novel 16S rRNA gene variant of Actinomyces funkei from six patients with purulent infections.

    PubMed

    Hinić, V; Straub, C; Schultheiss, E; Kaempfer, P; Frei, R; Goldenberger, D

    2013-07-01

    Little is known about the clinical significance and laboratory diagnosis of Actinomyces funkei. In this report we describe six clinical cases where A. funkei was isolated from purulent, polymicrobial infections. Conventional identification procedures were compared with molecular methods including matrix-assisted laser desorption/ionization time-of-flight mass spectrometry technique. Analysis of the full 16S rRNA gene sequence of the six investigated strains revealed differences from the A. funkei type strain. DNA-DNA hybridization showed that the clinical strains represent a novel 16S rRNA gene variant within the species of A. funkei. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  13. Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

    PubMed Central

    Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

    1996-01-01

    Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

  14. Use of 16S rRNA Sequencing for Identification of Actinobacillus ureae Isolated from a Cerebrospinal Fluid Sample

    PubMed Central

    Whitelaw, A. C.; Shankland, I. M.; Elisha, B. G.

    2002-01-01

    Actinobacillus ureae, previously Pasteurella ureae, has on rare occasions been described as a cause of human infection. Owing to its rarity, it may not be easily identified in clinical microbiology laboratories by standard tests. This report describes a patient with acute bacterial meningitis due to A. ureae. The identity of the isolate was determined by means of DNA sequence analysis of a portion of the 16S rRNA gene. PMID:11825992

  15. rRNA and Poly-β-Hydroxybutyrate Dynamics in Bioreactors Subjected to Feast and Famine Cycles

    PubMed Central

    Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

    2006-01-01

    Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-β-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

  16. rRNA and poly-beta-hydroxybutyrate dynamics in bioreactors subjected to feast and famine cycles.

    PubMed

    Frigon, Dominic; Muyzer, Gerard; van Loosdrecht, Mark; Raskin, Lutgarde

    2006-04-01

    Feast and famine cycles are common in activated sludge wastewater treatment systems, and they select for bacteria that accumulate storage compounds, such as poly-beta-hydroxybutyrate (PHB). Previous studies have shown that variations in influent substrate concentrations force bacteria to accumulate high levels of rRNA compared to the levels in bacteria grown in chemostats. Therefore, it can be hypothesized that bacteria accumulate more rRNA when they are subjected to feast and famine cycles. However, PHB-accumulating bacteria can form biomass (grow) throughout a feast and famine cycle and thus have a lower peak biomass formation rate during the cycle. Consequently, PHB-accumulating bacteria may accumulate less rRNA when they are subjected to feast and famine cycles than bacteria that are not capable of PHB accumulation. These hypotheses were tested with Wautersia eutropha H16 (wild type) and W. eutropha PHB-4 (a mutant not capable of accumulating PHB) grown in chemostat and semibatch reactors. For both strains, the cellular RNA level was higher when the organism was grown in semibatch reactors than when it was grown in chemostats, and the specific biomass formation rates during the feast phase were linearly related to the cellular RNA levels for cultures. Although the two strains exhibited maximum uptake rates when they were grown in semibatch reactors, the wild-type strain responded much more rapidly to the addition of fresh medium than the mutant responded. Furthermore, the chemostat-grown mutant culture was unable to exhibit maximum substrate uptake rates when it was subjected to pulse-wise addition of fresh medium. These data show that the ability to accumulate PHB does not prevent bacteria from accumulating high levels of rRNA when they are subjected to feast and famine cycles. Our results also demonstrate that the ability to accumulate PHB makes the bacteria more responsive to sudden increases in substrate concentrations, which explains their ecological

  17. Sequence data for two large-subunit rRNA genes from an Asian strain of Alexandrium catenella.

    PubMed Central

    Yeung, P K; Kong, K F; Wong, F T; Wong, J T

    1996-01-01

    PCR generated two distinct products from a toxic isolate of Alexandrium catenella, which had been taken from Dai Ya Bay (southern China), by using primers for large-subunit rRNA. This pattern is distinct from published data for North American Alexandrium species. Sequences of the two products suggest that the smaller was generated by a deletion event. Single-cell PCR generated the same pattern, confirming that the two products were not the results from different individuals. PMID:8900010

  18. Genotypic variation of Pneumocystis jirovecii isolates in India based on sequence diversity at mitochondrial large subunit rRNA.

    PubMed

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Agarwal, Sanjay Kumar; Samantaray, Jyotish Chandra; Kumar, Lalit; Kabra, Sushil Kumar; Luthra, Kalpana; Sreenivas, Vishnubhatla; Iyer, Venkateswaran K

    2011-03-01

    Pneumocystis pneumonia (PCP), a common and serious opportunistic infection in immunocompromised patients, is caused by Pneumocystis jirovecii (formerly known as Pneumocystis carinii f. sp. hominis). The aim of the present study was to describe the prevalence and distribution of genotypes of P. jirovecii based on sequence polymorphisms at mitochondrial large subunit ribosomal RNA (mt LSU rRNA) region in both HIV and non-HIV immunocompromised individuals with a positive PCR result for PCP in a tertiary health care centre in northern India. From January 2005 to October 2008, 50 patients [22 HIV-seropositive individuals, 10 post-renal transplant (PRT) recipients, 3 cancer patients, and 15 patients with various other kinds of immunosuppression] were found to be positive for P. jirovecii using PCR at the mt LSU rRNA gene. Genotyping of the positive samples was performed at the mt LSU rRNA locus. Genotype 2 was the most common accounting for 42% of total types. This was followed by the genotypes 3 (24%), 1 (20%), and 4 (8%). Mixed infection was observed in 3 cases (6%). The rates of genotype distribution were similar in HIV-seropositive individuals, cancer patients, and in patients with other kinds of immunosuppression. In the PRT recipients, genotype 1 was the most prevalent type (80%). This is the first study describing the prevalence of genotypes in HIV-infected and HIV-uninfected, immunocompromised patients based on the mt LSU rRNA gene from the Indian subcontinent. The most prevalent genotype observed was type 2 in contrast to many studies from other parts of the world where genotype 1 was the most prevalent type, suggesting geographical variation. Copyright © 2010 Elsevier GmbH. All rights reserved.

  19. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    PubMed

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  20. Identification of culturable stream water bacteria from urban, agricultural, and forested watersheds using 16S rRNA gene sequencing

    Treesearch

    Kenneth T. Belt; Christina Hohn; Aiah Gbakima; James A. Higgins

    2007-01-01

    Bacteria present in water samples taken on a weekly basis, from June 2004 through June 2005, from three streams, were cultured on Coliscan® Easygel® agar plates. Colonies representative of a variety of colors and morphologies were subjected to amplification and sequencing of a 1000-1100 nt portion of the 16S rRNA gene. A total of 528 colonies were...

  1. Benchmarking taxonomic assignments based on 16S rRNA gene profiling of the microbiota from commonly sampled environments.

    PubMed

    Almeida, Alexandre; Mitchell, Alex L; Tarkowska, Aleksandra; Finn, Robert D

    2018-05-01

    Taxonomic profiling of ribosomal RNA (rRNA) sequences has been the accepted norm for inferring the composition of complex microbial ecosystems. Quantitative Insights Into Microbial Ecology (QIIME) and mothur have been the most widely used taxonomic analysis tools for this purpose, with MAPseq and QIIME 2 being two recently released alternatives. However, no independent and direct comparison between these four main tools has been performed. Here, we compared the default classifiers of MAPseq, mothur, QIIME, and QIIME 2 using synthetic simulated datasets comprised of some of the most abundant genera found in the human gut, ocean, and soil environments. We evaluate their accuracy when paired with both different reference databases and variable sub-regions of the 16S rRNA gene. We show that QIIME 2 provided the best recall and F-scores at genus and family levels, together with the lowest distance estimates between the observed and simulated samples. However, MAPseq showed the highest precision, with miscall rates consistently <2%. Notably, QIIME 2 was the most computationally expensive tool, with CPU time and memory usage almost 2 and 30 times higher than MAPseq, respectively. Using the SILVA database generally yielded a higher recall than using Greengenes, while assignment results of different 16S rRNA variable sub-regions varied up to 40% between samples analysed with the same pipeline. Our results support the use of either QIIME 2 or MAPseq for optimal 16S rRNA gene profiling, and we suggest that the choice between the two should be based on the level of recall, precision, and/or computational performance required.

  2. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    PubMed

    Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

    2011-04-28

    The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  3. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing.

    PubMed

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0-9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community.

  4. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing.

    PubMed

    Tourlousse, Dieter M; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro; Sekiguchi, Yuji

    2017-02-28

    High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Unusual intraindividual variation of the nuclear 18S rRNA gene is widespread within the Acipenseridae.

    PubMed

    Krieger, Jeannette; Hett, Anne Kathrin; Fuerst, Paul A; Birstein, Vadim J; Ludwig, Arne

    2006-01-01

    Significant intraindividual variation in the sequence of the 18S rRNA gene is unusual in animal genomes. In a previous study, multiple 18S rRNA gene sequences were observed within individuals of eight species of sturgeon from North America but not in the North American paddlefish, Polyodon spathula, in two species of Polypterus (Polypterus delhezi and Polypterus senegalus), in other primitive fishes (Erpetoichthys calabaricus, Lepisosteus osseus, Amia calva) or in a lungfish (Protopterus sp.). These observations led to the hypothesis that this unusual genetic characteristic arose within the Acipenseriformes after the presumed divergence of the sturgeon and paddlefish families. In the present study, a survey of nearly all Eurasian acipenseriform species was conducted to examine 18S rDNA variation. Intraindividual variation was not found in the polyodontid species, the Chinese paddlefish, Psephurus gladius, but variation was detected in all Eurasian acipenserid species. The comparison of sequences from two major segments of the 18S rRNA gene and identification of sites where insertion/deletion events have occurred are placed in the context of evolutionary relationships within the Acipenseriformes and the evolution of rDNA variation in this group.

  6. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    PubMed

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  7. Studies on transcription termination and splicing of the rRNA precursor in vivo in the presence of proflavine.

    PubMed Central

    Nielsen, O F; Carin, M; Westergaard, O

    1984-01-01

    In isolated nucleoli from Tetrahymena thermophila, low concentrations of the intercalating agent proflavine inhibit both transcription termination and splicing of the rRNA precursor. Proflavine also exerts an in vivo effect on the process of transcription termination under conditions, where the growth rate is only slightly reduced. Thus, approximately 40% of the rRNA precursor molecules, accumulated in nucleoli during 60 min of treatment with the drug, are longer than the normal 35S rRNA precursor. R-Loop mapping of these longer precursor molecules isolated after 30 and 60 min of incubation demonstrates that the RNA polymerases have a 50 fold lower elongation rate in the spacer region than in the coding region. Proflavine in the given concentration is found to have no significant effect on the splicing of properly terminated precursor molecules. In contrast, none of the longer non-terminated molecules are found to be spliced. These results indicate that proflavine primarily affects the process of transcription termination and that the splicing event is inhibited due to the improper termination of the precursor molecule. Images PMID:6694912

  8. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

    PubMed

    Wang, R F; Cao, W W; Cerniglia, C E

    1996-01-01

    In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

  9. IMNGS: A comprehensive open resource of processed 16S rRNA microbial profiles for ecology and diversity studies.

    PubMed

    Lagkouvardos, Ilias; Joseph, Divya; Kapfhammer, Martin; Giritli, Sabahattin; Horn, Matthias; Haller, Dirk; Clavel, Thomas

    2016-09-23

    The SRA (Sequence Read Archive) serves as primary depository for massive amounts of Next Generation Sequencing data, and currently host over 100,000 16S rRNA gene amplicon-based microbial profiles from various host habitats and environments. This number is increasing rapidly and there is a dire need for approaches to utilize this pool of knowledge. Here we created IMNGS (Integrated Microbial Next Generation Sequencing), an innovative platform that uniformly and systematically screens for and processes all prokaryotic 16S rRNA gene amplicon datasets available in SRA and uses them to build sample-specific sequence databases and OTU-based profiles. Via a web interface, this integrative sequence resource can easily be queried by users. We show examples of how the approach allows testing the ecological importance of specific microorganisms in different hosts or ecosystems, and performing targeted diversity studies for selected taxonomic groups. The platform also offers a complete workflow for de novo analysis of users' own raw 16S rRNA gene amplicon datasets for the sake of comparison with existing data. IMNGS can be accessed at www.imngs.org.

  10. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants.

  11. Synthetic spike-in standards for high-throughput 16S rRNA gene amplicon sequencing

    PubMed Central

    Tourlousse, Dieter M.; Yoshiike, Satowa; Ohashi, Akiko; Matsukura, Satoko; Noda, Naohiro

    2017-01-01

    Abstract High-throughput sequencing of 16S rRNA gene amplicons (16S-seq) has become a widely deployed method for profiling complex microbial communities but technical pitfalls related to data reliability and quantification remain to be fully addressed. In this work, we have developed and implemented a set of synthetic 16S rRNA genes to serve as universal spike-in standards for 16S-seq experiments. The spike-ins represent full-length 16S rRNA genes containing artificial variable regions with negligible identity to known nucleotide sequences, permitting unambiguous identification of spike-in sequences in 16S-seq read data from any microbiome sample. Using defined mock communities and environmental microbiota, we characterized the performance of the spike-in standards and demonstrated their utility for evaluating data quality on a per-sample basis. Further, we showed that staggered spike-in mixtures added at the point of DNA extraction enable concurrent estimation of absolute microbial abundances suitable for comparative analysis. Results also underscored that template-specific Illumina sequencing artifacts may lead to biases in the perceived abundance of certain taxa. Taken together, the spike-in standards represent a novel bioanalytical tool that can substantially improve 16S-seq-based microbiome studies by enabling comprehensive quality control along with absolute quantification. PMID:27980100

  12. Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis.

    PubMed

    Virtanen, Seppo; Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne

    2017-01-01

    Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal microbiota studies employing different

  13. Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis

    PubMed Central

    Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne

    2017-01-01

    Background Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. Results The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). Conclusions The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal

  14. Transcriptional analysis of nucleolar dominance in polyploid plants: Biased expression/silencing of progenitor rRNA genes is developmentally regulated in Brassica

    PubMed Central

    Chen, Z. Jeffrey; Pikaard, Craig S.

    1997-01-01

    Nucleolar dominance is an epigenetic phenomenon that describes the formation of nucleoli around rRNA genes inherited from only one parent in the progeny of an interspecific hybrid. Despite numerous cytogenetic studies, little is known about nucleolar dominance at the level of rRNA gene expression in plants. We used S1 nuclease protection and primer extension assays to define nucleolar dominance at a molecular level in the plant genus Brassica. rRNA transcription start sites were mapped in three diploids and in three allotetraploids (amphidiploids) and one allohexaploid species derived from these diploid progenitors. rRNA transcripts of only one progenitor were detected in vegetative tissues of each polyploid. Dominance was independent of maternal effect, ploidy, or rRNA gene dosage. Natural and newly synthesized amphidiploids yielded the same results, arguing against substantial evolutionary effects. The hypothesis that nucleolar dominance in plants is correlated with physical characteristics of rRNA gene intergenic spacers is not supported in Brassica. Furthermore, in Brassica napus, rRNA genes silenced in vegetative tissues were found to be expressed in all floral organs, including sepals and petals, arguing against the hypothesis that passage through meiosis is needed to reactivate suppressed genes. Instead, the transition of inflorescence to floral meristem appears to be a developmental stage when silenced genes can be derepressed. PMID:9096413

  15. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    PubMed

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  16. Regulation of Plasmodium yoelii oocyst development by strain- and stage-specific small-subunit rRNA.

    PubMed

    Qi, Yanwei; Zhu, Feng; Eastman, Richard T; Fu, Young; Zilversmit, Martine; Pattaradilokrat, Sittiporn; Hong, Lingxian; Liu, Shengfa; McCutchan, Thomas F; Pan, Weiqing; Xu, Wenyue; Li, Jian; Huang, Fusheng; Su, Xin-zhuan

    2015-03-10

    One unique feature of malaria parasites is the differential transcription of structurally distinct rRNA (rRNA) genes at different developmental stages: the A-type genes are transcribed mainly in asexual stages, whereas the S-type genes are expressed mostly in sexual or mosquito stages. Conclusive functional evidence of different rRNAs in regulating stage-specific parasite development, however, is still absent. Here we performed genetic crosses of Plasmodium yoelii parasites with one parent having an oocyst development defect (ODD) phenotype and another producing normal oocysts to identify the gene(s) contributing to the ODD. The parent with ODD--characterized as having small oocysts and lacking infective sporozoites--was obtained after introduction of a plasmid with a green fluorescent protein gene into the parasite genome and subsequent passages in mice. Quantitative trait locus analysis of genome-wide microsatellite genotypes of 48 progeny from the crosses linked an ~200-kb segment on chromosome 6 containing one of the S-type genes (D-type small subunit rRNA gene [D-ssu]) to the ODD. Fine mapping of the plasmid integration site, gene expression pattern, and gene knockout experiments demonstrated that disruption of the D-ssu gene caused the ODD phenotype. Interestingly, introduction of the D-ssu gene into the same parasite strain (self), but not into a different subspecies, significantly affected or completely ablated oocyst development, suggesting a stage- and subspecies (strain)-specific regulation of oocyst development by D-ssu. This study demonstrates that P. yoelii D-ssu is essential for normal oocyst and sporozoite development and that variation in the D-ssu sequence can have dramatic effects on parasite development. Malaria parasites are the only known organisms that express structurally distinct rRNA genes at different developmental stages. The differential expression of these genes suggests that they play unique roles during the complex life cycle of the

  17. Theileria sp. Infections Associated with Bovine Fatalities in the United States Confirmed by Small-Subunit rRNA Gene Analyses of Blood and Tick Samples

    PubMed Central

    Chae, Joon-seok; Levy, Michael; Hunt, John; Schlater, Jack; Snider, Glen; Waghela, Suryakant D.; Holman, Patricia J.; Wagner, G. Gale

    1999-01-01

    Theileria sp.-specific small subunit (SSU) rRNA gene amplification confirmed the presence of the organism in cattle and in Amblyomma americanum and Dermacentor variabilis ticks collected from a cattle herd in Missouri. Blood from the index animal had type A and type D Theileria SSU rRNA genes. The type D gene was also found in blood from two cohort cattle and tick tissues. The type A SSU rRNA gene was previously reported from bovine Theileria isolates from Texas and North Carolina; the type D gene was reported from a Texas cow with theileriosis. PMID:10449501

  18. Short alleles revealed by PCR demonstrate no heterozygote deficiency at minisatellite loci D1S7, D7S21, and D12S11

    SciTech Connect

    Alonso, S.; Castro, A.; Fernandez-Fernandez, I.

    1997-02-01

    Short VNTR alleles that go undetected after conventional Southern blot hybridization may constitute an alternative explanation for the heterozygosity deficiency observed at some minisatellite loci. To examine this hypothesis, we have employed a screening procedure based on PCR amplification of those individuals classified as homozygotes in our databases for the loci D1S7, D7S21, and D12S11. The results obtained indicate that the frequency of these short alleles is related to the heterozygosity deficiency observed. For the most polymorphic locus, D1S7, {approximately}60% of those individuals previously classified as homozygotes were in fact heterozygotes for a short allele. After the inclusion of thesemore » new alleles, the agreement between observed and expected heterozygosity, along with other statistical tests employed, provide additional evidence for lack of population substructuring. Comparisons of allele frequency distributions reveal greater differences between racial groups than between closely related populations. 45 refs., 3 figs., 6 tabs.« less

  19. Whole mitochondrial genome screening in maternally inherited non-syndromic hearing impairment using a microarray resequencing mitochondrial DNA chip.

    PubMed

    Lévêque, Marianne; Marlin, Sandrine; Jonard, Laurence; Procaccio, Vincent; Reynier, Pascal; Amati-Bonneau, Patrizia; Baulande, Sylvain; Pierron, Denis; Lacombe, Didier; Duriez, Françoise; Francannet, Christine; Mom, Thierry; Journel, Hubert; Catros, Hélène; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Dollfus, Hélène; Eliot, Marie-Madeleine; Faivre, Laurence; Duvillard, Christian; Couderc, Remy; Garabedian, Eréa-Noël; Petit, Christine; Feldmann, Delphine; Denoyelle, Françoise

    2007-11-01

    Mitochondrial DNA (mtDNA) mutations have been implicated in non-syndromic hearing loss either as primary or as predisposing factors. As only a part of the mitochondrial genome is usually explored in deafness, its prevalence is probably under-estimated. Among 1350 families with non-syndromic sensorineural hearing loss collected through a French collaborative network, we selected 29 large families with a clear maternal lineage and screened them for known mtDNA mutations in 12S rRNA, tRNASer(UCN) and tRNALeu(UUR) genes. When no mutation could be identified, a whole mitochondrial genome screening was performed, using a microarray resequencing chip: the MitoChip version 2.0 developed by Affymetrix Inc. Known mtDNA mutations was found in nine of the 29 families, which are described in the article: five with A1555G, two with the T7511C, one with 7472insC and one with A3243G mutation. In the remaining 20 families, the resequencing Mitochip detected 258 mitochondrial homoplasmic variants and 107 potentially heteroplasmic variants. Controls were made by direct sequencing on selected fragments and showed a high sensibility of the MitoChip but a low specificity, especially for heteroplasmic variations. An original analysis on the basis of species conservation, frequency and phylogenetic investigation was performed to select the more probably pathogenic variants. The entire genome analysis allowed us to identify five additional families with a putatively pathogenic mitochondrial variant: T669C, C1537T, G8078A, G12236A and G15077A. These results indicate that the new MitoChip platform is a rapid and valuable tool for identification of new mtDNA mutations in deafness.

  20. Comparison of 16S rRNA sequencing with biochemical testing for species-level identification of clinical isolates of Neisseria spp.

    PubMed

    Mechergui, Arij; Achour, Wafa; Ben Hassen, Assia

    2014-08-01

    We aimed to compare accuracy of genus and species level identification of Neisseria spp. using biochemical testing and 16S rRNA sequence analysis. These methods were evaluated using 85 Neisseria spp. clinical isolates initially identified to the genus level by conventional biochemical tests and API NH system (Bio-Mérieux(®)). In 34 % (29/85), more than one possibility was given by 16S rRNA sequence analysis. In 6 % (5/85), one of the possibilities offered by 16S rRNA gene sequencing, agreed with the result given by biochemical testing. In 4 % (3/85), the same species was given by both methods. 16S rRNA gene sequencing results did not correlate well with biochemical tests.

  1. Growth properties associated with A-U replacement of specific G-C base pairs in 16S rRNA from Escherichia coli.

    PubMed Central

    Triman, K L

    1995-01-01

    Mutations that disrupt each of seven specific G-C base pairs in 16S rRNA from Escherichia coli confer loss of expression of a plasmid-encoded 16S rRNA selectable marker (spectinomycin resistance). However, A-U replacement of G-C base pairs at nucleotides 359/52 or 1292/1245 in 16S rRNA permits normal expression of the marker. By contrast, A-U replacements at 146/176, 153/168, 350/339, or 1293/1244 are associated with loss of expression of the marker. These genetic studies are designed to determine the importance of specific base pairs by assessment of the structural and functional impairments of 16S rRNA molecules resulting from expression of base pair substitutions at these positions. PMID:7543481

  2. Comparative analysis of the 5S rRNA and its associated proteins reveals unique primitive rather than parasitic features in Giardia lamblia.

    PubMed

    Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.

  3. Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

    PubMed

    Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

    2012-04-01

    Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

  4. Rapid in situ hybridization technique using 16S rRNA segments for detecting and differentiating the closely related gram-positive organisms Bacillus polymyxa and Bacillus macerans

    NASA Technical Reports Server (NTRS)

    Jurtshuk, R. J.; Blick, M.; Bresser, J.; Fox, G. E.; Jurtshuk, P. Jr

    1992-01-01

    A rapid, sensitive, inexpensive in situ hybridization technique, using 30-mer 16S rRNA probes, can specifically differentiate two closely related Bacillus spp., B. polymyxa and B. macerans. The 16S rRNA probes were labeled with a rhodamine derivative (Texas Red), and quantitative fluorescence measurements were made on individual bacterial cells. The microscopic fields analyzed were selected by phase-contrast microscopy, and the fluorescence imaging analyses were performed on 16 to 67 individual cells. The labeled 16S rRNA probe, POL, whose sequence was a 100% match with B. polymyxa 16S rRNA but only a 60% match with B. macerans 16S rRNA, gave quantitative fluorescence ratio measurements that were 34.8-fold higher for B. polymyxa cells than for B. macerans cells. Conversely, the labeled probe, MAC, which matched B. polymyxa 16S rRNA in 86.6% of its positions and B. macerans 16S rRNA in 100% of its positions, gave quantitative fluorescence measurements that were 59.3-fold higher in B. macerans cells than in B. polymyxa cells. Control probes, whose 16S rRNA sequence segment (P-M) was present in both B. polymyxa and B. macerans as well as a panprokaryotic probe (16S), having a 100% match with all known bacteria, hybridized equally well with both organisms. These latter hybridizations generated very high fluorescence signals, but their comparative fluorescence ratios (the differences between two organisms) were low. The control paneukaryotic probe (28S), which had less than 30% identity for both B. macerans and B. polymyxa, did not hybridize with either organism.

  5. Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

    2010-01-01

    Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

  6. Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

    PubMed

    Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

    2010-06-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

  7. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  8. Methylation of 23S rRNA Nucleotide G748 by RlmAII Methyltransferase Renders Streptococcus pneumoniae Telithromycin Susceptible

    PubMed Central

    Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-01-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmAII, which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmAII to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmAII renders S. pneumoniae TEL susceptible. PMID:23716046

  9. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    PubMed

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  10. Application of rRNA probes and fluorescence in situ hybridization for rapid detection of the toxic dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Tang, Xianghai; Yu, Rencheng; Zhou, Mingjiang; Yu, Zhigang

    2012-03-01

    The dinoflagellate Alexandrium minutum is often associated with harmful algal blooms (HABs). This species consists of many strains that differ in their ability to produce toxins but have similar morphology, making identification difficult. In this study, species-specific rRNA probes were designed for whole-cell fluorescence in situ hybridization (FISH) to distinguish A. minutum from two phylogenetic clades. We acquired the complete SSU to LSU rDNA sequences (GenBank accession numbers JF906989-JF906999) of 11 Alexandrium strains and used these to design rRNA targeted oligonucleotide probes. Three ribotype-specific probes, M-GC-1, M-PC-2, and M-PC-3, were designed. The former is specific for the GC clade ("Global clade") of A. minutum, the majority of which have been found non-toxic, and the latter two are specific for the PSP (paralytic shellfish poisoning)-producing PC clade ("Pacific clade"). The specificity of these three probes was confirmed by FISH. All cells in observed fields of view were fluorescently labeled when probes and target species were incubated under optimized FISH conditions. However, the accessibility of rRNA molecules in ribosomes varied among the probe binding positions. Thus, there was variation in the distribution of positive signals in labeled cells within nucleolus and cytosol (M-GC-1, M-PC-3), or just nucleolus (M-PC-2). Our results provide a methodological basis for studying the biogeography and population dynamics of A. minutum, and providing an early warning of toxic HABs.

  11. Analysis of the function of E. coli 23S rRNA helix-loop 69 by mutagenesis

    PubMed Central

    Liiv, Aivar; Karitkina, Diana; Maiväli, Ülo; Remme, Jaanus

    2005-01-01

    Background The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors. Results We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during in vitro protein synthesis, and under-represented in the polysomes. Mutation Ψ1917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome. Conclusion Mutations A1912G, A1919G, and Ψ1917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations Ψ1911C, A1913G, C1914A, Ψ1915C, and A1918G lack clear phenotypes. PMID:16053518

  12. The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

    PubMed Central

    Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

    2014-01-01

    Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

  13. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    PubMed

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  14. Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

    PubMed Central

    Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

    2012-01-01

    Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

  15. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing

    PubMed Central

    Chan, Chia Sing; Chan, Kok-Gan; Tay, Yea-Ling; Chua, Yi-Heng; Goh, Kian Mau

    2015-01-01

    The Sungai Klah (SK) hot spring is the second hottest geothermal spring in Malaysia. This hot spring is a shallow, 150-m-long, fast-flowing stream, with temperatures varying from 50 to 110°C and a pH range of 7.0–9.0. Hidden within a wooded area, the SK hot spring is continually fed by plant litter, resulting in a relatively high degree of total organic content (TOC). In this study, a sample taken from the middle of the stream was analyzed at the 16S rRNA V3-V4 region by amplicon metagenome sequencing. Over 35 phyla were detected by analyzing the 16S rRNA data. Firmicutes and Proteobacteria represented approximately 57% of the microbiome. Approximately 70% of the detected thermophiles were strict anaerobes; however, Hydrogenobacter spp., obligate chemolithotrophic thermophiles, represented one of the major taxa. Several thermophilic photosynthetic microorganisms and acidothermophiles were also detected. Most of the phyla identified by 16S rRNA were also found using the shotgun metagenome approaches. The carbon, sulfur, and nitrogen metabolism within the SK hot spring community were evaluated by shotgun metagenome sequencing, and the data revealed diversity in terms of metabolic activity and dynamics. This hot spring has a rich diversified phylogenetic community partly due to its natural environment (plant litter, high TOC, and a shallow stream) and geochemical parameters (broad temperature and pH range). It is speculated that symbiotic relationships occur between the members of the community. PMID:25798135

  16. Concurrent speciation in the eastern woodland salamanders (Genus Plethodon):DNA sequences of the complete albumin nuclear and partialmitochondrial 12s genes

    USGS Publications Warehouse

    Highton, Richard; Hastings, Amy Picard; Palmer, Catherine; Watts, Richard; Hass, Carla A.; Culver, Melanie; Arnold, Stevan

    2012-01-01

    Salamanders of the North American plethodontid genus Plethodon are important model organisms in a variety of studies that depend on a phylogenetic framework (e.g., chemical communication, ecological competition, life histories, hybridization, and speciation), and consequently their systematics has been intensively investigated over several decades. Nevertheless, we lack a synthesis of relationships among the species. In the analyses reported here we use new DNA sequence data from the complete nuclear albumin gene (1818 bp) and the 12s mitochondrial gene (355 bp), as well as published data for four other genes (Wiens et al., 2006), up to a total of 6989 bp, to infer relationships. We relate these results to past systematic work based on morphology, allozymes, and DNA sequences. Although basal relationships show a strong consensus across studies, many terminal relationships remain in flux despite substantial sequencing and other molecular and morphological studies. This systematic instability appears to be a consequence of contemporaneous bursts of speciation in the late Miocene and Pliocene, yielding many closely related extant species in each of the four eastern species groups. Therefore we conclude that many relationships are likely to remain poorly resolved in the face of additional sequencing efforts. On the other hand, the current classification of the 45 eastern species into four species groups is supported. The Plethodon cinereus group (10 species) is the sister group to the clade comprising the other three groups, but these latter groups (Plethodon glutinosus [28 species], Plethodon welleri [5 species], and Plethodon wehrlei [2 species]) probably diverged from each other at approximately the same time.

  17. Purpura fulminans mimicking toxic epidermal necrolysis - additional value of 16S rRNA sequencing and skin biopsy.

    PubMed

    Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M

    2017-05-01

    Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.

  18. Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

    PubMed

    Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

    2017-06-01

    We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues

  19. Development of an Analysis Pipeline Characterizing Multiple Hypervariable Regions of 16S rRNA Using Mock Samples.

    PubMed

    Barb, Jennifer J; Oler, Andrew J; Kim, Hyung-Suk; Chalmers, Natalia; Wallen, Gwenyth R; Cashion, Ann; Munson, Peter J; Ames, Nancy J

    2016-01-01

    There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology. This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9) processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY). Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies) and their sequencing data is subjected to a novel analytical pipeline. Results are presented at family and genus level. The Kullback-Leibler divergence (DKL), a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst) average DKL while the V4 gave the lowest (best) average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria. The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points throughout a

  20. A Bayesian taxonomic classification method for 16S rRNA gene sequences with improved species-level accuracy.

    PubMed

    Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng

    2017-05-10

    Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite

  1. Linear programming model to construct phylogenetic network for 16S rRNA sequences of photosynthetic organisms and influenza viruses.

    PubMed

    Mathur, Rinku; Adlakha, Neeru

    2014-06-01

    Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.

  2. Co-localization of polar replication fork barriers and rRNA transcription terminators in mouse rDNA.

    PubMed

    López-estraño, C; Schvartzman, J B; Krimer, D B; Hernández, P

    1998-03-27

    We investigated the replication of the region where transcription terminates in mouse rDNA. It contains a replication fork barrier (RFB) that behaves in a polar manner, arresting only replication forks moving in the direction opposite to transcription. This RFB consists of several closely spaced fork arrest sites that co-localize with the transcription terminator elements, known as Sal boxes. Sal boxes are the target for mTTF-I (murine transcription termination factor I). These results suggest that both termination of rRNA transcription and replication fork arrest may share cis-acting as well as trans-acting factors. Copyright 1998 Academic Press Limited.

  3. Cyanobacterial endobionts within a major marine planktonic calcifier (Globigerina bulloides, Foraminifera) revealed by 16S rRNA metabarcoding

    NASA Astrophysics Data System (ADS)

    Bird, Clare; Darling, Kate F.; Russell, Ann D.; Davis, Catherine V.; Fehrenbacher, Jennifer; Free, Andrew; Wyman, Michael; Ngwenya, Bryne T.

    2017-02-01

    We investigated the possibility of bacterial symbiosis in Globigerina bulloides, a palaeoceanographically important, planktonic foraminifer. This marine protist is commonly used in micropalaeontological investigations of climatically sensitive subpolar and temperate water masses as well as wind-driven upwelling regions of the world's oceans. G. bulloides is unusual because it lacks the protist algal symbionts that are often found in other spinose species. In addition, it has a large offset in its stable carbon and oxygen isotopic compositions compared to other planktonic foraminifer species, and also that predicted from seawater equilibrium. This is suggestive of novel differences in ecology and life history of G. bulloides, making it a good candidate for investigating the potential for bacterial symbiosis as a contributory factor influencing shell calcification. Such information is essential to evaluate fully the potential response of G. bulloides to ocean acidification and climate change. To investigate possible ecological interactions between G. bulloides and marine bacteria, 18S rRNA gene sequencing, fluorescence microscopy, 16S rRNA gene metabarcoding and transmission electron microscopy (TEM) were performed on individual specimens of G. bulloides (type IId) collected from two locations in the California Current. Intracellular DNA extracted from five G. bulloides specimens was subjected to 16S rRNA gene metabarcoding and, remarkably, 37-87 % of all 16S rRNA gene sequences recovered were assigned to operational taxonomic units (OTUs) from the picocyanobacterium Synechococcus. This finding was supported by TEM observations of intact Synechococcus cells in both the cytoplasm and vacuoles of G. bulloides. Their concentrations were up to 4 orders of magnitude greater inside the foraminifera than those reported for the California Current water column and approximately 5 % of the intracellular Synechococcus cells observed were undergoing cell division. This suggests

  4. The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

    PubMed

    van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

    1992-10-01

    The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

  5. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA.

    PubMed

    Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K

    2000-06-15

    Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.

  6. Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes

    SciTech Connect

    Gihring, Thomas; Green, Stefan; Schadt, Christopher Warren

    2011-01-01

    Technologies for massively parallel sequencing are revolutionizing microbial ecology and are vastly increasing the scale of ribosomal RNA (rRNA) gene studies. Although pyrosequencing has increased the breadth and depth of possible rRNA gene sampling, one drawback is that the number of reads obtained per sample is difficult to control. Pyrosequencing libraries typically vary widely in the number of sequences per sample, even within individual studies, and there is a need to revisit the behaviour of richness estimators and diversity indices with variable gene sequence library sizes. Multiple reports and review papers have demonstrated the bias in non-parametric richness estimators (e.g.more » Chao1 and ACE) and diversity indices when using clone libraries. However, we found that biased community comparisons are accumulating in the literature. Here we demonstrate the effects of sample size on Chao1, ACE, CatchAll, Shannon, Chao-Shen and Simpson's estimations specifically using pyrosequencing libraries. The need to equalize the number of reads being compared across libraries is reiterated, and investigators are directed towards available tools for making unbiased diversity comparisons.« less

  7. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

    PubMed Central

    Fischer, Sandra; Kumar, Neeraj

    2017-01-01

    The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea. PMID:28097056

  8. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

    PubMed

    Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

    2017-01-01

    The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

  9. Alternative reverse genetics system for influenza viruses based on a synthesized swine 45S rRNA promoter.

    PubMed

    Wang, Kai; Huang, Qi; Yang, Zhiwei; Qi, Kezong; Liu, Hongmei; Chen, Hongjun

    2017-08-01

    We generated an alternative reverse genetics (RG) system based on a synthesized swine 45S rRNA promoter to rescue the H3N2 subtype swine influenza virus. All eight flanking segment cassettes of A/swine/Henan/7/2010 (H3N2) were amplified with ambisense expression elements from RG plasmids. All segments were then recombined with the pHC2014 vector, which contained the synthesized swine 45S rRNA promoter (spol1) and its terminal sequence (t1) in a pcDNA3 backbone. As a result, we obtained a set of RG plasmids carrying the corresponding eight-segment cassettes. We efficiently generated the H3N2 virus after transfection into 293T/PK15, PK15, and 293T cells. The efficiency of spol1-driven influenza virus rescue in PK15 cells was similar to that in 293T cells by titration using the human pol1 RG system. Our approach suggests that an alternative spol1-based RG system can produce influenza viruses.

  10. 16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances.

    PubMed

    Piwat, S; Teanpaisan, R

    2013-01-01

    This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances.

  11. 16S rRNA PCR-Denaturing Gradient Gel Electrophoresis of Oral Lactobacillus casei Group and Their Phenotypic Appearances

    PubMed Central

    Piwat, S.; Teanpaisan, R.

    2013-01-01

    This study aimed to develop a 16S rRNA PCR-denaturing gradient gel electrophoresis (DGGE) to identify the species level of Lactobacillus casei group and to investigate their characteristics of acid production and inhibitory effect. PCR-DGGE has been developed based on the 16S rRNA gene, and a set of HDA-1-GC and HDA-2, designed at V2-V3 region, and another set of CARP-1-GC and CARP-2, designed at V1 region, have been used. The bacterial strains included L. casei ATCC 393, L. paracasei CCUG 32212, L. rhamnosus ATCC 7469, L. zeae CCUG 35515, and 46 clinical strains of L. casei/paracasei/rhamnosus. Inhibitory effect against Streptococcus mutans and acid production were examined. Results revealed that each type species strain and identified clinical isolate showed its own unique DGGE pattern using CARP1-GC and CARP2 primers. HDA1-GC and HDA2 primers could distinguish the strains of L. paracasei from L. casei. It was found that inhibitory effect of L. paracasei was stronger than L. casei and L. rhamnosus. The acid production of L. paracasei was lower than L. casei and L. rhamnosus. In conclusion, the technique has been proven to be able to differentiate between closely related species in L. casei group and thus provide reliable information of their phenotypic appearances. PMID:24191230

  12. 16S rRNA Gene Sequencing for Deciphering the Colorectal Cancer Gut Microbiome: Current Protocols and Workflows.

    PubMed

    Osman, Muhammad-Afiq; Neoh, Hui-Min; Ab Mutalib, Nurul-Syakima; Chin, Siok-Fong; Jamal, Rahman

    2018-01-01

    The human gut holds the densest microbiome ecosystem essential in maintaining a healthy host physiology, whereby disruption of this ecosystem has been linked to the development of colorectal cancer (CRC). The advent of next-generation sequencing technologies such as the 16S rRNA gene sequencing has enabled characterization of the CRC gut microbiome architecture in an affordable and culture-free approach. Nevertheless, the lack of standardization in handling and storage of biospecimens, nucleic acid extraction, 16S rRNA gene primer selection, length, and depth of sequencing and bioinformatics analyses have contributed to discrepancies found in various published studies of this field. Accurate characterization of the CRC microbiome found in different stages of CRC has the potential to be developed into a screening tool in the clinical setting. This mini review aims to concisely compile all available CRC microbiome studies performed till end of 2016 and to suggest standardized protocols that are crucial in developing a gut microbiome screening panel for CRC.

  13. Use of 16S-23S rRNA spacer-region (SR)-PCR for identification of intestinal clostridia.

    PubMed

    Song, Yuli; Liu, Chengxu; Molitoris, Denise; Tomzynski, Thomas J; Mc Teague, Maureen; Read, Erik; Finegold, Sydney M

    2002-12-01

    The suitability of a species identification technique based on PCR analysis of 16S-23S rRNA spacer region (SR) polymorphism for human intestinal Clostridium species was evaluated. This SR-PCR based technique is highly reproducible and successfully differentiated the strains tested, which included 17 ATCC type strains of Clostridium and 152 human stool Clostridium isolates, at the species or intraspecies level. Ninety-eight of 152 stool isolates, including C. bifermentans, C. butyricum, C. cadaveris, C. orbiscindens, C. paraputrificum, C. pefringens, C. ramosum, C. scindens, C. spiroforme, C. symbiosum and C. tertium, were identified to species level by SR-PCR patterns that were identical to those of their corresponding ATCC type strains. The other 54 stool isolates distributed among ten SR-PCR patterns that are unique and possibly represent ten novel Clostridium species or subspecies. The species identification obtained by SR-PCR pattern analysis completely agreed with that obtained by 16S rRNA sequencing, and led to identification that clearly differed from that obtained by cellular fatty acid analysis for 23/152 strains (15%). These results indicate that SR-PCR provides an accurate and rapid molecular method for the identification of human intestinal Clostridium species.

  14. Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

    PubMed Central

    Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

    1999-01-01

    The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

  15. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    PubMed

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  16. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling

    PubMed Central

    Ferrocino, Ilario; Di Cagno, Raffaella; De Angelis, Maria; Turroni, Silvia; Vannini, Lucia; Bancalari, Elena; Rantsiou, Kalliopi; Cardinali, Gianluigi; Neviani, Erasmo; Cocolin, Luca

    2015-01-01

    In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE). The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples. PMID:26035837

  17. Fecal Microbiota in Healthy Subjects Following Omnivore, Vegetarian and Vegan Diets: Culturable Populations and rRNA DGGE Profiling.

    PubMed

    Ferrocino, Ilario; Di Cagno, Raffaella; De Angelis, Maria; Turroni, Silvia; Vannini, Lucia; Bancalari, Elena; Rantsiou, Kalliopi; Cardinali, Gianluigi; Neviani, Erasmo; Cocolin, Luca

    2015-01-01

    In this study, the fecal microbiota of 153 healthy volunteers, recruited from four different locations in Italy, has been studied by coupling viable counts, on different microbiological media, with ribosomal RNA Denaturing Gradient Gel Electrophoresis (rRNA-DGGE). The volunteers followed three different diets, namely omnivore, ovo-lacto-vegetarian and vegan. The results obtained from culture-dependent and -independent methods have underlined a high level of similarity of the viable fecal microbiota for the three investigated diets. The rRNA DGGE profiles were very complex and comprised a total number of bands that varied from 67 to 64 for the V3 and V9 regions of the 16S rRNA gene, respectively. Only a few bands were specific in/of all three diets, and the presence of common taxa associated with the dietary habits was found. As far as the viable counts are concerned, the high similarity of the fecal microbiota was once again confirmed, with only a few of the investigated groups showing significant differences. Interestingly, the samples grouped differently, according to the recruitment site, thus highlighting a higher impact of the food consumed by the volunteers in the specific geographical locations than that of the type of diet. Lastly, it should be mentioned that the fecal microbiota DGGE profiles obtained from the DNA were clearly separated from those produced using RNA, thus underlining a difference between the total and viable populations in the fecal samples.

  18. Identification and phylogeny of Arabian snakes: Comparison of venom chromatographic profiles versus 16S rRNA gene sequences.

    PubMed

    Al Asmari, Abdulrahman; Manthiri, Rajamohammed Abbas; Khan, Haseeb Ahmad

    2014-11-01

    Identification of snake species is important for various reasons including the emergency treatment of snake bite victims. We present a simple method for identification of six snake species using the gel filtration chromatographic profiles of their venoms. The venoms of Echis coloratus, Echis pyramidum, Cerastes gasperettii, Bitis arietans, Naja arabica, and Walterinnesia aegyptia were milked, lyophilized, diluted and centrifuged to separate the mucus from the venom. The clear supernatants were filtered and chromatographed on fast protein liquid chromatography (FPLC). We obtained the 16S rRNA gene sequences of the above species and performed phylogenetic analysis using the neighbor-joining method. The chromatograms of venoms from different snake species showed peculiar patterns based on the number and location of peaks. The dendrograms generated from similarity matrix based on the presence/absence of particular chromatographic peaks clearly differentiated Elapids from Viperids. Molecular cladistics using 16S rRNA gene sequences resulted in jumping clades while separating the members of these two families. These findings suggest that chromatographic profiles of snake venoms may provide a simple and reproducible chemical fingerprinting method for quick identification of snake species. However, the validation of this methodology requires further studies on large number of specimens from within and across species.

  19. Evidence for Context-Dependent Complementarity of Non-Shine-Dalgarno Ribosome Binding Sites to Escherichia coli rRNA

    PubMed Central

    Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.

    2013-01-01

    While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812

  20. Classification of Rhizomonas suberifaciens, an unnamed Rhizomonas species, and Sphingomonas spp. in rRNA superfamily IV.

    PubMed

    van Bruggen, A H; Jochimsen, K N; Steinberger, E M; Segers, P; Gillis, M

    1993-01-01

    Thermal melting profiles of hybrids between 3H-labeled rRNA of Rhizomonas suberifaciens, the causal agent of corky root of lettuce, and chromosomal DNAs from 27 species of gram-negative bacteria indicated that the genus Rhizomonas belongs to superfamily IV of De Ley. On the basis of the melting temperatures of DNA hybrids with rRNAs from the type strains of R. suberifaciens, Sphingomonas paucimobilis, and Sphingomonas capsulata, Rhizomonas strains constitute a separate branch in superfamily IV, which is closely related to but separate from branches containing Zymomonas mobilis, Sphingomonas spp., and S. capsulata. Sphingomonas yanoikuyae and Rhizomonas sp. strain WI4 are located toward the base of the Rhizomonas rRNA branch. DNA-DNA hybridization indicated that S. yanoikuyae is equidistant from Rhizomonas sp. strain WI4 and S. paucimobilis. Sequences of 270 bp of 16S ribosomal DNAs from eight strains of Rhizomonas spp., eight strains of Sphingomonas spp., and Agrobacterium tumefaciens indicated that S. yanoikuyae and Rhizomonas sp. strains WI4 and CA16 are genetically more closely related to R. suberifaciens than to Sphingomonas spp. Thus, S. yanoikuyae may need to be transferred to the genus Rhizomonas on the basis of the results of further study.

  1. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  2. hUTP24 is essential for processing of the human rRNA precursor at site A1, but not at site A0

    PubMed Central

    Tomecki, Rafal; Labno, Anna; Drazkowska, Karolina; Cysewski, Dominik; Dziembowski, Andrzej

    2015-01-01

    Production of ribosomes relies on more than 200 accessory factors to ensure the proper sequence of steps and faultless assembly of ribonucleoprotein machinery. Among trans-acting factors are numerous enzymes, including ribonucleases responsible for processing the large rRNA precursor synthesized by RNA polymerase I that encompasses sequences corresponding to mature 18S, 5.8S, and 25/28S rRNA. In humans, the identity of most enzymes responsible for individual processing steps, including endoribonucleases that cleave pre-rRNA at specific sites within regions flanking and separating mature rRNA, remains largely unknown. Here, we investigated the role of hUTP24 in rRNA maturation in human cells. hUTP24 is a human homolog of the Saccharomyces cerevisiae putative PIN domain-containing endoribonuclease Utp24 (yUtp24), which was suggested to participate in the U3 snoRNA-dependent processing of yeast pre-rRNA at sites A0, A1, and A2. We demonstrate that hUTP24 interacts to some extent with proteins homologous to the components of the yeast small subunit (SSU) processome. Moreover, mutation in the putative catalytic site of hUTP24 results in slowed growth of cells and reduced metabolic activity. These effects are associated with a defect in biogenesis of the 40S ribosomal subunit, which results from decreased amounts of 18S rRNA as a consequence of inaccurate pre-rRNA processing at the 5′-end of the 18S rRNA segment (site A1). Interestingly, and in contrast to yeast, site A0 located upstream of A1 is efficiently processed upon UTP24 dysfunction. Finally, hUTP24 inactivation leads to aberrant processing of 18S rRNA 2 nucleotides downstream of the normal A1 cleavage site. PMID:26237581

  3. Selective Phylogenetic Analysis Targeted at 16S rRNA Genes of Thermophiles and Hyperthermophiles in Deep-Subsurface Geothermal Environments

    PubMed Central

    Kimura, Hiroyuki; Sugihara, Maki; Kato, Kenji; Hanada, Satoshi

    2006-01-01

    Deep-subsurface samples obtained by deep drilling are likely to be contaminated with mesophilic microorganisms in the drilling fluid, and this could affect determination of the community structure of the geothermal microflora using 16S rRNA gene clone library analysis. To eliminate possible contamination by PCR-amplified 16S rRNA genes from mesophiles, a combined thermal denaturation and enzyme digestion method, based on a strong correlation between the G+C content of the 16S rRNA gene and the optimum growth temperatures of most known prokaryotic cultures, was used prior to clone library construction. To validate this technique, hot spring fluid (76°C) and river water (14°C) were used to mimic a deep-subsurface sample contaminated with drilling fluid. After DNA extraction and PCR amplification of the 16S rRNA genes from individual samples separately, the amplified products from river water were observed to be denatured at 82°C and completely digested by exonuclease I (Exo I), while the amplified products from hot spring fluid remained intact after denaturation at 84°C and enzyme digestion with Exo I. DNAs extracted from the two samples were mixed and used as a template for amplification of the 16S rRNA genes. The amplified rRNA genes were denatured at 84°C and digested with Exo I before clone library construction. The results indicated that the 16S rRNA gene sequences from the river water were almost completely eliminated, whereas those from the hot spring fluid remained. PMID:16391020

  4. The nucleotide sequence of the intergenic region between the 5.8S and 26S rRNA genes of the yeast ribosomal RNA operon. Possible implications for the interaction between 5.8S and 26S rRNA and the processing of the primary transcript.

    PubMed Central

    Veldman, G M; Klootwijk, J; van Heerikhuizen, H; Planta, R J

    1981-01-01

    We have determined the nucleotide sequence of part of a cloned yeast ribosomal RNA operon extending from the 5.8S RNA gene downstream into the 5' -terminal region of the 26S RNA gene. We mapped the pertinent processing sites, viz. the 5' end of 26S rRNA and the 3'ends of 5.8S rRNA and its immediate precursor, 7S RNA. At the 3' end of 7S RNA we find the sequence UCGUUU which is very similar to the type I consensus sequence UCAUUA/U present at the 3' ends of 17S, 5.8S and 26S rRNA as well as 18S precursor rRNA in yeast. At the 5' end of the 26S RNA gene we find a sequence of thirteen nucleotides which is homologous to the type II sequence present at the 5' termini of both the 17S and the 5.8S RNA gene. These findings further support the suggestion put forward earlier (G.M. Veldman et al. (1980) Nucl. Acids Res. 8, 2907-2920) that both consensus sequences are involved in the recognition of precursor rRNA by the processing nuclease(s). We discuss a model for the processing of yeast rRNA in which a processing enzyme sequentially recognizes several combinations of a type I and a type II consensus sequence. We also describe the existence of a significant base complementarity between sequences in the 5' -terminal region of 26S rRNA and the 3' -terminal region of 5.8S rRNA. We suggest that base pairing between these sequences contributes to the binding between 5.8S and 26S rRNA. Images PMID:7312619

  5. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    PubMed

    Viscogliosi, E; Edgcomb, V P; Gerbod, D; Noël, C; Delgado-Viscogliosi, P

    1999-12-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  6. Guanosine 3'-diphosphate 5'-diphosphate is not required for growth rate-dependent control of rRNA synthesis in Escherichia coli.

    PubMed Central

    Gaal, T; Gourse, R L

    1990-01-01

    rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571

  7. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  8. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    PubMed Central

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

  9. Molecular evolution inferred from small subunit rRNA sequences: what does it tell us about phylogenetic relationships and taxonomy of the parabasalids?

    NASA Technical Reports Server (NTRS)

    Viscogliosi, E.; Edgcomb, V. P.; Gerbod, D.; Noel, C.; Delgado-Viscogliosi, P.; Sogin, M. L. (Principal Investigator)

    1999-01-01

    The Parabasala are a primitive group of protists divided into two classes: the trichomonads and the hypermastigids. Until recently, phylogeny and taxonomy of parabasalids were mainly based on the comparative analysis of morphological characters primarily linked to the development of their cytoskeleton. Recent use of molecular markers, such as small subunit (SSU) rRNA has led to now insights into the systematics of the Parabasala and other groups of prolists. An updated phylogeny based on SSU rRNA is provided and compared to that inferred from ultrastructural data. The SSU rRNA phylogeny contradicts the dogma equating simple characters with pumitive characters. Hypermastigids, possessing a hyperdeveloped cytoskeleton, exhibit the most basal emergence in the parabasalid lineage. Other observations emerge from the SSU rRNA analysis, such as the secondary loss of some cytoskeleton structures in all representatives of the Monocercomonadidae, the existence of secondarily free living taxa (reversibility of parasitism) and the evidence against the co-evolution of the endobiotic parabasalids and their animal hosts. According to phylogenies based on SSU rRNA, all the trichomonad families are not monophyletic groups, putting into question the validity of current taxonomic assignments. The precise branching order of some taxa remains unclear, but this issue can possibly be addressed by the molecular analysis of additional parabasalids. The goal of such additional analyses would be to propose, in a near future, a revision of the taxonomy of this group of protists that takes into account both molecular and morphological data.

  10. Cordblood-Based High-Throughput Screening for Deafness Gene of 646 Newborns in Jinan Area of China

    PubMed Central

    Li, Shou-Xia; Chen, Ding-Li; Zhao, Su-Bin; Guo, Li-Li; Feng, Hai-Qin; Zhang, Xiao-Fang; Ping, Li-Li; Yang, Zhi-Ming; Sun, Cai-Xia

    2015-01-01

    Objectives Infants with slight/mild or late-onset hearing impairment might be missed in universal newborn hearing screening (UNHS). We identified the mutation hot spot of common deaf gene in the newborns in Jinan area population by screening the mutation spot with neonate cord blood, in order to make clear whether the neonate cord blood for screening is feasible. Methods Six hundred and forty-six newborns were subjected to both UNHS and genetic screening for deafness by using neonate cord blood. The newborn genetic screening targeted four deafness-associated genes, which were commonly found in the Chinese population including gap junction beta-2 protein (GJB2), gap junction beta-3 protein (GJB3), solute carrier family 26 member 4 (SLC26A4), and mtDNA 12S rRNA. The most common 20 spot mutations in 4 deaf genes were detected by MassARRAY iPLEX platform and mitochondrial 12S rRNA A1555G and C1494T mutations were sequenced using Sanger sequencing. Results Among the 646 newborns, 635 cases passed the UNHS and the other 11 cases (1.7%) did not. Of the 11 failures, two cases were found to carry homozygous GJB2 p.R143W pathogenic mutation, one case was found to have heterozygous GJB2 235delC mutation, and another one case carried heterozygous GJB3 p.R180X pathogenic mutation. Six hundred and thirty-five babies passed the newborn hearing screening, in which 25 babies were identified to carry pathogenic mutations, including 12 heterozygotes (1.9%) for GJB2 235delC, eight heterozygotes (1.3%) for SLC26A4 IVS7-2A>G, one heterozygote (0.2%) for p.R409H, two homozygotes (0.3%) for m.1494C>T, and two homozygotes (0.3%) for m.1555A>G. Conclusion Newborn genetic screening through the umbilical cord blood for common deafness-associated mutations may identify carriers sensitive to aminoglycoside antibiotic, and can effectively prevent or delay hearing loss occurs. PMID:26330914

  11. Detection of Porphyromonas endodontalis in infected root canals by 16S rRNA gene-directed polymerase chain reaction.

    PubMed

    Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F

    2000-12-01

    Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.

  12. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii.

  13. Effect of condensed tannins on bovine rumen protist diversity based on 18S rRNA gene sequences.

    PubMed

    Tan, Hui Yin; Sieo, Chin Chin; Abdullah, Norhani; Liang, Juan Boo; Huang, Xiao Dan; Ho, Yin Wan

    2013-01-01

    Molecular diversity of protists from bovine rumen fluid incubated with condensed tannins of Leucaena leucocephala hybrid-Rendang at 20 mg/500 mg dry matter (treatment) or without condensed tannins (control) was investigated using 18S rRNA gene library. Clones from the control library were distributed within nine genera, but clones from the condensed tannin treatment clone library were related to only six genera. Diversity estimators such as abundance-based coverage estimation and Chao1 showed significant differences between the two libraries, although no differences were found based on Shannon-Weaver index and Libshuff. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.

  14. MetaDP: a comprehensive web server for disease prediction of 16S rRNA metagenomic datasets.

    PubMed

    Xu, Xilin; Wu, Aiping; Zhang, Xinlei; Su, Mingming; Jiang, Taijiao; Yuan, Zhe-Ming

    2016-01-01

    High-throughput sequencing-based metagenomics has garnered considerable interest in recent years. Numerous methods and tools have been developed for the analysis of metagenomic data. However, it is still a daunting task to install a large number of tools and complete a complicated analysis, especially for researchers with minimal bioinformatics backgrounds. To address this problem, we constructed an automated software named MetaDP for 16S rRNA sequencing data analysis, including data quality control, operational taxonomic unit clustering, diversity analysis, and disease risk prediction modeling. Furthermore, a support vector machine-based prediction model for intestinal bowel syndrome (IBS) was built by applying MetaDP to microbial 16S sequencing data from 108 children. The success of the IBS prediction model suggests that the platform may also be applied to other diseases related to gut microbes, such as obesity, metabolic syndrome, or intestinal cancer, among others (http://metadp.cn:7001/).

  15. Sequence heterogeneity in the 18S rRNA gene in Theileria equi from horses presented in Switzerland.

    PubMed

    Liu, Qin; Meli, Marina L; Zhang, Yi; Meili, Theres; Stirn, Martina; Riond, Barbara; Weibel, Beatrice; Hofmann-Lehmann, Regina

    2016-05-15

    A reverse line blot (RLB) hybridization assay was adapted and applied for equine blood samples collected at the animal hospital of the University of Zurich to determine the presence of piroplasms in horses in Switzerland. A total of 100 equine blood samples were included in the study. The V4 hypervariable region of the 18S rRNA gene was amplified by polymerase chain reaction and analyzed using the RLB assay. Samples from seven horses hybridized to a Theileria/Babesia genus-specific and a Theileria genus-specific probe. Of these, two hybridized also to the Theileria equi-specific probe. The other five positive samples did not hybridize to any of the species-specific probes, suggesting the presence of unrecognized Theileria variants or genotypes. The 18S rRNA gene of the latter five samples were sequenced and found to be closely related to T. equi isolated from horses in Spain (AY534822) and China (KF559357) (≥98.4% identity). Four of the seven horses that tested positive had a documented travel history (France, Italy, and Spain) or lived abroad (Hungary). The present study adds new insight into the presence and sequence heterogeneity of T. equi in Switzerland. The results prompt that species-specific probes must be designed in regions of the gene unique to T. equi. Of note, none of the seven positive horses were suspected of having Theileria infection at the time of presentation to the clinic. Clinicians should be aware of the possibility of equine piroplasma infections outside of endemic areas and in horses without signs of piroplasmosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. [Phylogenetic and diversity analysis of Acidithiobacillus spp. based on 16S rRNA and RubisCO genes homologues].

    PubMed

    Liu, Minrui; Lin, Pengwu; Qi, Xing'e; Ni, Yongqing

    2016-04-14

    The purpose of the study was to reveal geographic region-related Acidithiobacillus spp. distribution and allopatric speciation. Phylogenetic and diversity analysis was done to expand our knowledge on microbial phylogeography, diversity-maintaining mechanisms and molecular biogeography. We amplified 16S rRNA gene and RubisCO genes to construct corresponding phylogenetic trees based on the sequence homology and analyzed genetic diversity of Acidithiobacillus spp.. Thirty-five strains were isolated from three different regions in China (Yunnan, Hubei, Xinjiang). The whole isolates were classified into five groups. Four strains were identified as A. ferrivorans, six as A. ferridurans, YNTR4-15 Leptspirillum ferrooxidans and HBDY3-31 as Leptospirillum ferrodiazotrophum. The remaining strains were identified as A. ferrooxidans. Analysis of cbbL and cbbM genes sequences of representative 26 strains indicated that cbbL gene of 19 were two copies (cbbL1 and cbbL2) and 7 possessed only cbbL1. cbbM gene was single copy. In nucleotide-based trees, cbbL1 gene sequences of strains were separated into three sequence types, and the cbbL2 was similar to cbbL1 with three types. Codon bias of RubisCO genes was not obvious in Acidithiobacillus spp.. Strains isolated from three different regions in China indicated a great genetic diversity in Acidithiobacillus spp. and their 16S rRNA/RubisCO genes sequence was of significant difference. Phylogenetic tree based on 16S rRNA genes and RubisCO genes was different in Acidithiobacillus spp..

  17. PCR-enzyme-linked immunosorbent assay and partial rRNA gene sequencing: a rational approach to identifying mycobacteria.

    PubMed Central

    Patel, S; Yates, M; Saunders, N A

    1997-01-01

    A PCR-enzyme-linked immunosorbent assay (ELISA) for amplification and rapid identification of mycobacterial DNA coding for 16S rRNA was developed. The PCR selectively targeted and amplified part of the 16S rRNA gene from all mycobacteria while simultaneously labelling one strand of the amplified product with a 5' fluorescein-labelled primer. The identity of the labelled strand was subsequently determined by hybridization to a panel of mycobacterial species-specific capture probes, which were immobilized via their 5' biotin ends to a streptavidin-coated microtiter plate. Specific hybridization of a 5' fluorescein-labelled strand to a species probe was detected colorimetrically with an anti-fluorescein enzyme conjugate. The assay was able to identify 10 Mycobacterium spp. A probe able to hybridize to all Mycobacterium species (All1) was also included. By a heminested PCR, the assay was sensitive enough to detect as little as 10 fg of DNA, which is equivalent to approximately three bacilli. The assay was able to detect and identify mycobacteria directly from sputa. The specificities of the capture probes were assessed by analysis of 60 mycobacterial strains corresponding to 18 species. Probes Avi1, Int1, Kan1, Xen1, Che1, For1, Mal1, Ter1, and Gor1 were specific. The probe Tbc1 cross-hybridized with the Mycobacterium terrae amplicon. Analysis of 35 strains tested blind resulted in 34 strains being correctly identified. This method could be used for rapid identification of early cultures and may be suitable for the detection and concurrent identification of mycobacteria within clinical specimens. PMID:9276419

  18. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

    PubMed

    Suchodolski, Jan S; Dowd, Scot E; Wilke, Vicky; Steiner, Jörg M; Jergens, Albert E

    2012-01-01

    Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

  19. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

    PubMed

    Chun, J; Huq, A; Colwell, R R

    1999-05-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

  20. Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

    PubMed Central

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

    2015-01-01

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

  1. 16S rRNA Gene Pyrosequencing Reveals Bacterial Dysbiosis in the Duodenum of Dogs with Idiopathic Inflammatory Bowel Disease

    PubMed Central

    Suchodolski, Jan S.; Dowd, Scot E.; Wilke, Vicky; Steiner, Jörg M.; Jergens, Albert E.

    2012-01-01

    Background Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Methodology/Principal Findings Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. Conclusions/Significance In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation. PMID:22720094

  2. Nucleolar Targeting by Platinum: p53-Independent Apoptosis Follows rRNA Inhibition, Cell-Cycle Arrest, and DNA Compaction

    PubMed Central

    2015-01-01

    TriplatinNC is a highly positively charged, substitution-inert derivative of the phase II clinical anticancer drug, BBR3464. Such substitution-inert complexes form a distinct subset of polynuclear platinum complexes (PPCs) interacting with DNA and other biomolecules through noncovalent interactions. Rapid cellular entry is facilitated via interaction with cell surface glycosoaminoglycans and is a mechanism unique to PPCs. Nanoscale secondary ion mass spectrometry (nanoSIMS) showed rapid distribution within cytoplasmic and nucleolar compartments, but not the nucleus. In this article, the downstream effects of nucleolar localization are described. In human colon carcinoma cells, HCT116, the production rate of 47S rRNA precursor transcripts was dramatically reduced as an early event after drug treatment. Transcriptional inhibition of rRNA was followed by a robust G1 arrest, and activation of apoptotic proteins caspase-8, -9, and -3 and PARP-1 in a p53-independent manner. Using cell synchronization and flow cytometry, it was determined that cells treated while in G1 arrest immediately, but cells treated in S or G2 successfully complete mitosis. Twenty-four hours after treatment, the majority of cells finally arrest in G1, but nearly one-third contained highly compacted DNA; a distinct biological feature that cannot be associated with mitosis, senescence, or apoptosis. This unique effect mirrored the efficient condensation of tRNA and DNA in cell-free systems. The combination of DNA compaction and apoptosis by TriplatinNC treatment conferred striking activity in platinum-resistant and/or p53 mutant or null cell lines. Taken together, our results support that the biological activity of TriplatinNC reflects reduced metabolic deactivation (substitution-inert compound not reactive to sulfur nucleophiles), high cellular accumulation, and novel consequences of high-affinity noncovalent DNA binding, producing a new profile and a further shift in the structure

  3. Investigation of postpartum dairy cows' uterine microbial diversity using metagenomic pyrosequencing of the 16S rRNA gene.

    PubMed

    Machado, V S; Oikonomou, G; Bicalho, M L S; Knauer, W A; Gilbert, R; Bicalho, R C

    2012-10-12

    The objective of this study was the use of metagenomic pyrosequencing of the 16S rRNA gene for the investigation of postpartum dairy cows' uterine bacterial diversity. The effect of subcutaneous supplementation of a trace mineral supplement containing Zn, Mn, Se, and Cu (Multimin North America, Inc., Fort Collins, CO) at 230 days of gestation and 260 days of gestation on dairy cows' uterine microbiota was also evaluated. Uterine lavage samples were collected at 35 DIM and were visually scored for the presence of purulent or mucopurulent secretion. The same samples were also used for the acquisition of bacterial DNA. The 16S rRNA genes were individually amplified from each sample. Pyrosequencing of the samples was carried at the Cornell University Life Sciences Core Laboratories Center using Roche 454 GS-FLX System Titanium Chemistry. The Ribosomal Database Project online tools were used for the analysis of the obtained sequences library. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., Peptostreptococcus spp., Sneathia spp., Prevotella spp. and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that had a higher uterine lavage sample score. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that were not pregnant by 200 DIM. Anaerococcus spp., Peptostreptococcus spp., Parabacteroides spp., and Propionibacterium spp. prevalence was significantly (P<0.05) lower in samples derived from cows that were trace mineral supplemented. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

    DOE PAGES

    Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

    2015-02-06

    According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

  5. Analysis of the 16S–23S rRNA Gene Internal Transcribed Spacer Region in Klebsiella Species▿

    PubMed Central

    Wang, Min; Cao, Boyang; Yu, Qunfang; Liu, Lei; Gao, Qili; Wang, Lei; Feng, Lu

    2008-01-01

    The 16S-23S rRNA gene internal transcribed spacer (ITS) regions of Klebsiella spp., including Klebsiella pneumoniae subsp. pneumoniae, Klebsiella pneumoniae subsp. ozaenae, Klebsiella pneumoniae subsp. rhinoscleromatis, Klebsiella oxytoca, Klebsiella planticola, Klebsiella terrigena, and Klebsiella ornithinolytica, were characterized, and the feasibility of using ITS sequences to discriminate Klebsiella species and subspecies was explored. A total of 336 ITS sequences from 21 representative strains and 11 clinical isolates of Klebsiella were sequenced and analyzed. Three distinct ITS types—ITSnone (without tRNA genes), ITSglu [with a tRNAGlu (UUC) gene], and ITSile+ala [with tRNAIle (GAU) and tRNAAla (UGC) genes]—were detected in all species except for K. pneumoniae subsp. rhinoscleromatis, which has only ITSglu and ITSile+ala. The presence of ITSnone in Enterobacteriaceae had never been reported before. Both the length and the sequence of each ITS type are highly conserved within the species, with identity levels from 0.961 to 1.000 for ITSnone, from 0.967 to 1.000 for ITSglu, and from 0.968 to 1.000 for ITSile+ala. Interspecies sequence identities range from 0.775 to 0.989 for ITSnone, from 0.798 to 0.997 for ITSglu, and from 0.712 to 0.985 for ITSile+ala. Regions with significant interspecies variations but low intraspecies polymorphisms were identified; these may be targeted in the design of probes for the identification of Klebsiella to the species level. Phylogenetic analysis based on ITS regions reveals the relationships among Klebsiella species similarly to that based on 16S rRNA genes. PMID:18753345

  6. RNomics in Archaea reveals a further link between splicing of archaeal introns and rRNA processing

    PubMed Central

    Tang, Thean Hock; Rozhdestvensky, Timofey S.; d’Orval, Béatrice Clouet; Bortolin, Marie-Line; Huber, Harald; Charpentier, Bruno; Branlant, Christiane; Bachellerie, Jean-Pierre; Brosius, Jürgen; Hüttenhofer, Alexander

    2002-01-01

    The bulge–helix–bulge (BHB) motif recognised by the archaeal splicing endonuclease is also found in the long processing stems of archaeal rRNA precursors in which it is cleaved to generate pre-16S and pre-23S rRNAs. We show that in two species, Archaeoglobus fulgidus and Sulfolobus solfataricus, representatives from the two major archaeal kingdoms Euryarchaeota and Crenarchaeota, respectively, the pre-rRNA spacers cleaved at the BHB motifs surrounding pre-16S and pre-23S rRNAs subsequently become ligated. In addition, we present evidence that this is accompanied by circularisation of ribosomal pre-16S and pre-23S rRNAs in both species. These data reveal a further link between intron splicing and pre-rRNA processing in Archaea, which might reflect a common evolutionary origin of the two processes. One spliced RNA species designated 16S-D RNA, resulting from religation at the BHB motif of 16S pre-rRNA, is a highly abundant and stable RNA which folds into a three-stem structure interrupted by two single-stranded regions as assessed by chemical probing. It spans a region of the pre-rRNA 5′ external transcribed spacer exhibiting a highly conserved folding pattern in Archaea. Surprisingly, 16S-D RNA contains structural motifs found in archaeal C/D box small RNAs and binds to the L7Ae protein, a core component of archaeal C/D box RNPs. This supports the notion that it might have an important but still unknown role in pre-rRNA biogenesis or might even target RNA molecules other than rRNA. PMID:11842103

  7. Rapid differentiation of Francisella species and subspecies by fluorescent in situ hybridization targeting the 23S rRNA

    PubMed Central

    2010-01-01

    Background Francisella (F.) tularensis is the causative agent of tularemia. Due to its low infectious dose, ease of dissemination and high case fatality rate, F. tularensis was the subject in diverse biological weapons programs and is among the top six agents with high potential if misused in bioterrorism. Microbiological diagnosis is cumbersome and time-consuming. Methods for the direct detection of the pathogen (immunofluorescence, PCR) have been developed but are restricted to reference laboratories. Results The complete 23S rRNA genes of representative strains of F. philomiragia and all subspecies of F. tularensis were sequenced. Single nucleotide polymorphisms on species and subspecies level were confirmed by partial amplification and sequencing of 24 additional strains. Fluorescent In Situ Hybridization (FISH) assays were established using species- and subspecies-specific probes. Different FISH protocols allowed the positive identification of all 4 F. philomiragia strains, and more than 40 F. tularensis strains tested. By combination of different probes, it was possible to differentiate the F. tularensis subspecies holarctica, tularensis, mediasiatica and novicida. No cross reactivity with strains of 71 clinically relevant bacterial species was observed. FISH was also successfully applied to detect different F. tularensis strains in infected cells or tissue samples. In blood culture systems spiked with F. tularensis, bacterial cells of different subspecies could be separated within single samples. Conclusion We could show that FISH targeting the 23S rRNA gene is a rapid and versatile method for the identification and differentiation of F. tularensis isolates from both laboratory cultures and clinical samples. PMID:20205957

  8. The rRNA methyltransferase Bud23 shows functional interaction with components of the SSU processome and RNase MRP.

    PubMed

    Sardana, Richa; White, Joshua P; Johnson, Arlen W

    2013-06-01

    Bud23 is responsible for the conserved methylation of G1575 of 18S rRNA, in the P-site of the small subunit of the ribosome. bud23Δ mutants have severely reduced small subunit levels and show a general failure in cleavage at site A2 during rRNA processing. Site A2 is the primary cleavage site for separating the precursors of 18S and 25S rRNAs. Here, we have taken a genetic approach to identify the functional environment of BUD23. We found mutations in UTP2 and UTP14, encoding components of the SSU processome, as spontaneous suppressors of a bud23Δ mutant. The suppressors improved growth and subunit balance and restored cleavage at site A2. In a directed screen of 50 ribosomal trans-acting factors, we identified strong positive and negative genetic interactions with components of the SSU processome and strong negative interactions with components of RNase MRP. RNase MRP is responsible for cleavage at site A3 in pre-rRNA, an alternative cleavage site for separating the precursor rRNAs. The strong negative genetic interaction between RNase MRP mutants and bud23Δ is likely due to the combined defects in cleavage at A2 and A3. Our results suggest that Bud23 plays a role at the time of A2 cleavage, earlier than previously thought. The genetic interaction with the SSU processome suggests that Bud23 could be involved in triggering disassembly of the SSU processome, or of particular subcomplexes of the processome.

  9. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekova, legal representative, Natalia V.; Mirzabekov, deceased, Andrei D.

    2007-12-04

    The present invention relates to methods and compositions for using nucleotide sequence variations of 16S and 23S rRNA within the B. cereus group to discriminate a highly infectious bacterium B. anthracis from closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations and discriminate B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed samples, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  10. Redescriptions of three trachelocercid ciliates (Protista, Ciliophora, Karyorelictea), with notes on their phylogeny based on small subunit rRNA gene sequences.

    PubMed

    Yan, Ying; Xu, Yuan; Yi, Zhenzhen; Warren, Alan

    2013-09-01

    Three trachelocercid ciliates, Kovalevaia sulcata (Kovaleva, 1966) Foissner, 1997, Trachelocerca sagitta (Müller, 1786) Ehrenberg, 1840 and Trachelocerca ditis (Wright, 1982) Foissner, 1996, isolated from two coastal habitats at Qingdao, China, were investigated using live observation and silver impregnation methods. Data on their infraciliature and morphology are supplied. The small subunit rRNA (SSU rRNA) genes of K. sulcata and Trachelocerca sagitta were sequenced for the first time. Phylogenetic analyses based on SSU rRNA gene sequence data indicate that both organisms, and the previously sequenced Trachelocerca ditis, are located within the trachelocercid assemblage and that K. sulcata is sister to an unidentified taxon forming a clade that is basal to the core trachelocercids.

  11. Location of rRNA transcription to the nucleolar components: disappearance of the fibrillar centers in nucleoli of regenerating rat hepatocytes.

    PubMed

    Montanaro, Lorenzo; Govoni, Marzia; Orrico, Catia; Treré, Davide; Derenzini, Massimo

    2011-01-01

    The precise location of rDNA transcription to the components of mammalian cell nucleolus is still debated. This was due to the fact that all the molecules necessary for rRNA synthesis are located in two of the three components, the fibrillar centers (FCs) and the dense fibrillar component (DFC), which together with the granular component (GC) are considered to be constantly present in mammalian cell nucleoli. In the present study we demonstrated that in nucleoli of many regenerating rat hepatocytes at 15 h after partial hepatectomy the FCs were no longer present, only the DFC and the GC being detected. At this time of regeneration the rRNA transcriptional activity was three fold that of resting hepatocytes, while the synthesis of DNA was not yet significantly increased, indicating that these nucleolar changes were due to the rRNA synthesis up-regulation. The DFC appeared to be organized in numerous, small, roundish tufts of fibrils. The silver staining procedure for AgNOR proteins, which are associated with the ribosomal genes, selectively and homogeneously stained these fibrillar tufts. Immuno-gold visualization of the Upstream Binding Factor (UBF), which is associated with the promoter region and the transcribed portion of the rRNA 45S gene, demonstrated that UBF was selectively located in the fibrillar tufts. We concluded that in proliferating rat hepatocytes the increased synthesis of rRNA induced an activation of the rRNA transcription machinery located in the fibrillar centers which, by becoming associated with the ribonucleoprotein transcripts, assumed the morphological pattern of the DFC.

  12. Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

    PubMed

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

    2008-08-01

    Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

  13. Mapping of chloroplast mutations conferring resistance to antibiotics in Chlamydomonas: evidence for a novel site of streptomycin resistance in the small subunit rRNA.

    PubMed

    Gauthier, A; Turmel, M; Lemieux, C

    1988-10-01

    A major obstacle to our understanding of the mechanisms governing the inheritance, recombination and segregation of chloroplast genes in Chlamydomonas is that the majority of antibiotic resistance mutations that have been used to gain insights into such mechanisms have not been physically localized on the chloroplast genome. We report here the physical mapping of two chloroplast antibiotic resistance mutations: one conferring cross-resistance to erythromycin and spiramycin in Chlamydomonas moewusii (er-nM1) and the other conferring resistance to streptomycin in the interfertile species C. eugametos (sr-2). The er-nM1 mutation results from a C to G transversion at a well-known site of macrolide resistance within the peptidyl transferase loop region of the large subunit rRNA gene. This locus, designated rib-2 in yeast mitochondrial DNA, corresponds to residue C-2611 in the 23 S rRNA of Escherichia coli. The sr-2 locus maps within the small subunit (SSU) rRNA gene at a site that has not been described previously. The mutation results from an A to C transversion at a position equivalent to residue A-523 in the E. coli 16 S rRNA. Although this region of the E. coli SSU rRNA has no binding affinity for streptomycin, it binds to ribosomal protein S4, a protein that has long been associated with the response of bacterial cells to this antibiotic. We propose that the sr-2 mutation indirectly affects the nearest streptomycin binding site through an altered interaction between a ribosomal protein and the SSU rRNA.

  14. Comparative Analysis of the 5S rRNA and Its Associated Proteins Reveals Unique Primitive Rather Than Parasitic Features in Giardia lamblia

    PubMed Central

    Xin, De-Dong; Wen, Jian-Fan

    2012-01-01

    Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID

  15. Expression stability of two housekeeping genes (18S rRNA and G3PDH) during in vitro maturation of follicular oocytes in buffalo (Bubalus bubalis).

    PubMed

    Aswal, Ajay Pal Singh; Raghav, Sarvesh; De, Sachinandan; Thakur, Manish; Goswami, Surender Lal; Datta, Tirtha Kumar

    2008-01-15

    The present study was undertaken to evaluate the expression stability of two housekeeping genes (HKGs), 18S rRNA and G3PDH during in vitro maturation (IVM) of oocytes in buffalo, which qualifies their use as internal controls for valid qRT-PCR estimation of other oocyte transcripts. A semi quantitative RT-PCR system was used with optimised qRT-PCR parameters at exponential PCR cycle for evaluation of temporal expression pattern of these genes over 24 h of IVM. 18S rRNA was found more stable in its expression pattern than G3PDH.

  16. Molecular analysis of the rRNA genes of Babesia spp and Ehrlichia canis detected in dogs from RibeirÃo Preto, Brazil

    PubMed Central

    Oliveira, L.P.; Cardozo, G.P.; Santos, E.V.; Mansur, M.A.B.; Donini, I.A.N.; Zissou, V.G.; Roberto, P.G.; Marins, M.

    2009-01-01

    The partial DNA sequences of the 18S rRNA gene of Babesia canis and the 16S rRNA gene of Ehrlichia canis detected in dogs from Ribeirão Preto, Brazil, were compared to sequences from other strains deposited in GenBank. The E. canis strain circulating in Ribeirão Preto is identical to other strains previously detected in the region, whereas the subspecies Babesia canis vogeli is the main Babesia strain circulating in dogs from Ribeirão Preto. PMID:24031351

  17. Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

    PubMed Central

    Pan, W J; Blackburn, E H

    1995-01-01

    The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

  18. A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

    PubMed

    Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

    2018-05-15

    Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

  19. Methanosarcina acetivorans 16S rRNA and transcription factor nucleotide fluctuation with implications in exobiology and pathology

    NASA Astrophysics Data System (ADS)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Marchese, P.; Hiciano, O.; Yao, H.; Lieberman, D.; Cheung, T.

    2008-08-01

    Cultures of the methane-producing archaea Methanosarcina, have recently been isolated from Alaskan sediments. It has been proposed that methanogens are strong candidates for exobiological life in extreme conditions. The spatial environmental gradients, such as those associated with the polygons on Mars' surface, could have been produced by past methanogenesis activity. The 16S rRNA gene has been used routinely to classify phenotypes. Using the fractal dimension of nucleotide fluctuation, a comparative study of the 16S rRNA nucleotide fluctuation in Methanosarcina acetivorans C2A, Deinococcus radiodurans, and E. coli was conducted. The results suggest that Methanosarcina acetivorans has the lowest fractal dimension, consistent with its ancestral position in evolution. Variation in fluctuation complexity was also detected in the transcription factors. The transcription factor B (TFB) was found to have a higher fractal dimension as compared to transcription factor E (TFE), consistent with the fact that a single TFB in Methanosarcina acetivorans can code three different TATA box proteins. The average nucleotide pair-wise free energy of the DNA repair genes was found to be highest for Methanosarcina acetivorans, suggesting a relatively weak bonding, which is consistent with its low prevalence in pathology. Multitasking capacity comparison of type-I and type-II topoisomerases has been shown to correlate with fractal dimension using the methicillin-resistant strain MRSA 252. The analysis suggests that gene adaptation in a changing chemical environment can be measured in terms of bioinformatics. Given that the radiation resistant Deinococcus radiodurans is a strong candidate for an extraterrestrial origin and that the cold temperature Psychrobacter cryohalolentis K5 can function in Siberian permafrost, the fractal dimension comparison in this study suggests that a chemical resistant methanogen could exist in extremely cold conditions (such as that which existed on early

  20. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets

    PubMed Central

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J.; Ravel, Jacques; Goldstein, Alisa M.

    2015-01-01

    Background Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. Results In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon’s index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Conclusions Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work

  1. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    PubMed

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

    2015-01-01

    Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (P<0.01), but not between nested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance <0.167) accounted for most of the distortion (>27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by

  2. [Ultrastructural observation on nymphal Armillifer sp. by scanning electron microscopy and phylogenetic analysis based on 18S rRNA].

    PubMed

    Li, Jian; Shi, Yun-Liang; Shi, Wei; Fang, Fang; Zhou, Qing-An; Li, Wen-Wen; He, Guo-Sheng; Huang, Wei-Yi

    2012-04-30

    To observe the ultrastructure of nymphal Armillifer sp. isolated from Macaca fascicularis by using scanning electron microscope (SEM), and analyze the phylogenetic relationships based on 18S rRNA gene sequences. The parasite samples stored in 70% alcohol were fixed by glutaraldehyde and osmium peroxide. Ultrastructural characters of those samples were observed under SEM. Amplification and sequencing of the 18S rRNA gene were performed following the extraction of total genome DNA. Sequence analysis was performed based on multiple alignment using ClustalX1.83, while phylogenetic analysis was made by Neighbor-Joining method using MEGA4.0. The nymphs were in cylindrical shape, the body slightly claviform tapering to posterior end. Abdominal annuli were gradually widened from anterior to posterior parts, the 12th-13th abdominal annuli of which were similar in width. The annuli ranged closer in the front half body, whereas in the latter part there were certain gaps between them. The circular-shaped mouth located in the middle of head ventrally. Folds were seen in inner margin of the mouth with a pair of curved hooks on both sides above it which practically disposed in a straight line. Two pairs of large sensory papillae were observed symmetrically over the last thoracic annulus of cephalothoraxs lying below the outer hook, and the first abdominal annulus was near the median ventral line. The number of abdominal annuli was 29, not including 2 incomplete terminal annuli. Rounded sensory papillae were fully distributed on the body surface, except the dorsal side of head and the ventral part of the terminal annulus. Agglomerate-like anus opening was observed at the end of ventral abdominal annuli and distinctly sub-terminal. These morphological features demonstrated that the nymphs were highly similar with that of Armillifer moniliformis Diesing, 1835. A fragment of 18SrRNA gene (1 836 bp) sequences was obtained by PCR combined with sequencing, and was registered to the Gene

  3. Bacteria evade immune recognition via TLR13 and binding of their 23S rRNA by MLS antibiotics by the same mechanisms

    PubMed Central

    Hochrein, Hubertus; Kirschning, Carsten J.

    2013-01-01

    The immune system recognizes pathogens and other danger by means of pattern recognition receptors. Recently, we have demonstrated that the orphan Toll-like receptor 13 (TLR13) senses a defined sequence of the bacterial rRNA and that bacteria use specific mechanisms to evade macrolide lincosamide streptogramin (MLS) antibiotics detection via TLR13. PMID:23802068

  4. Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

    PubMed Central

    Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

    2007-01-01

    Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

  5. Microbial Diversity in Commercial Bee Pollen from Europe, Chile, and Mexico, Based on 16S rRNA Gene Amplicon Metagenome Sequencing

    PubMed Central

    Moreno Andrade, Vicente D.; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P.; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A.; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A.; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B.; Ramírez, Natanahel Salvador; Jones, George H.

    2018-01-01

    ABSTRACT Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. PMID:29773615

  6. Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

    PubMed

    Wieckowski, Yana; Schiefelbein, John

    2012-07-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

  7. Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

    PubMed Central

    Wieckowski, Yana; Schiefelbein, John

    2012-01-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

  8. Comparison between rpoB and 16S rRNA Gene Sequencing for Molecular Identification of 168 Clinical Isolates of Corynebacterium

    PubMed Central

    Khamis, Atieh; Raoult, Didier; La Scola, Bernard

    2005-01-01

    Higher proportions (91%) of 168 corynebacterial isolates were positively identified by partial rpoB gene determination than by that based on 16S rRNA gene sequences. This method is thus a simple, molecular-analysis-based method for identification of corynebacteria, but it should be used in conjunction with other tests for definitive identification. PMID:15815024

  9. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  10. A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex

    PubMed Central

    Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981

  11. A Simple Method to Decode the Complete 18-5.8-28S rRNA Repeated Units of Green Algae by Genome Skimming.

    PubMed

    Lin, Geng-Ming; Lai, Yu-Heng; Audira, Gilbert; Hsiao, Chung-Der

    2017-11-06

    Green algae, Chlorella ellipsoidea , Haematococcus pluvialis and Aegagropila linnaei (Phylum Chlorophyta) were simultaneously decoded by a genomic skimming approach within 18-5.8-28S rRNA region. Whole genomic DNAs were isolated from green algae and directly subjected to low coverage genome skimming sequencing. After de novo assembly and mapping, the size of complete 18-5.8-28S rRNA repeated units for three green algae were ranged from 5785 to 6028 bp, which showed high nucleotide diversity (π is around 0.5-0.6) within ITS1 and ITS2 (Internal Transcribed Spacer) regions. Previously, the evolutional diversity of algae has been difficult to decode due to the inability design universal primers that amplify specific marker genes across diverse algal species. In this study, our method provided a rapid and universal approach to decode the 18-5.8-28S rRNA repeat unit in three green algal species. In addition, the completely sequenced 18-5.8-28S rRNA repeated units provided a solid nuclear marker for phylogenetic and evolutionary analysis for green algae for the first time.

  12. The Human RNA Polymerase I Transcription Terminator Complex Acts as a Replication Fork Barrier That Coordinates the Progress of Replication with rRNA Transcription Activity.

    PubMed

    Akamatsu, Yufuko; Kobayashi, Takehiko

    2015-05-01

    In S phase, the replication and transcription of genomic DNA need to accommodate each other, otherwise their machineries collide, with chromosomal instability as a possible consequence. Here, we characterized the human replication fork barrier (RFB) that is present downstream from the 47S pre-rRNA gene (ribosomal DNA [rDNA]). We found that the most proximal transcription terminator, Sal box T1, acts as a polar RFB, while the other, Sal box T4/T5, arrests replication forks bidirectionally. The fork-arresting activity at these sites depends on polymerase I (Pol I) transcription termination factor 1 (TTF-1) and a replisome component, TIMELESS (TIM). We also found that the RFB activity was linked to rDNA copies with hypomethylated CpG and coincided with the time that actively transcribed rRNA genes are replicated. Failed fork arrest at RFB sites led to a slowdown of fork progression moving in the opposite direction to rRNA transcription. Chemical inhibition of transcription counteracted this deceleration of forks, indicating that rRNA transcription impedes replication in the absence of RFB activity. Thus, our results reveal a role of RFB for coordinating the progression of replication and transcription activity in highly transcribed rRNA genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    SciTech Connect

    Tremblay, Julien

    2012-06-01

    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  14. Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)

    ScienceCinema

    Tremblay, Julien

    2018-01-22

    Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

  15. Identification by 16S rRNA gene sequencing of an Actinomyces hongkongensis isolate recovered from a patient with pelvic actinomycosis.

    PubMed

    Flynn, A N; Lyndon, C A; Church, D L

    2013-08-01

    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software.

  16. Identification by 16S rRNA Gene Sequencing of an Actinomyces hongkongensis Isolate Recovered from a Patient with Pelvic Actinomycosis

    PubMed Central

    Flynn, A. N.; Lyndon, C. A.

    2013-01-01

    A case of Actinomyces hongkongensis pelvic actinomycosis in an adult woman is described. Conventional phenotypic tests failed to identify the Gram-positive bacillus isolated from a fluid aspirate of a pelvic abscess. The bacterium was identified by 16S rRNA gene sequencing and analysis using the SmartGene Integrated Database Network System software. PMID:23698532

  17. [Identification of Hydrocarbon-Oxidizing Dietzia Bacteria from Petroleum Reservoirs Based on Phenotypic Properties and Analysis of the 16S rRNA and gyrB Genes].

    PubMed

    Nazina, T N; Shumkova, E S; Sokolova, D Sh; Babich, T L; Zhurina, M V; Xue, Yan-Fen; Osipov, G A; Poltaraus, A B; Tourova, T P

    2015-01-01

    The taxonomic position of hydrocarbon-oxidizing bacterial strains 263 and 32d isolated from formation water of the Daqing petroleum reservoir (PRC) was determined by polyphasic taxonomy techniques, including analysis of the 16S rRNA and the gyrB genes. The major chemotaxonomic characteristics of both strains, including the IV type cell wall, composition of cell wall fatty acids, mycolic acids, and menaquinones, agreed with those typical of Dietzia strains. The DNA G+C content of strains 263 and 32d were 67.8 and 67.6 mol%, respectively. Phylogenetic analysis of the 16S rRNA gene of strain 32d revealed 99.7% similarity to the gene of D. maris, making it possible to identify strain 32d as belonging to this species. The 16S rRNA gene sequence of strain 263 exhibited 99.7 and 99.9% similarity to those of D. natronolimnaea and D. cercidiphylli YIM65002(T), respectively. Analysis of the gyrB genes of the subterranean isolates and of a number of Dietzia type strains confirmed classiffication of strain 32d as a D. maris strain and of strain 263, as a D. natronolimnaea strain. A conclusion was made concerning higher resolving power of phylogenetic analysis of the gyrB gene compared to the 16S rRNA gene analysis in the case of determination of the species position of Dietzia isolates.

  18. Species-specific identification of Dekkera/Brettanomyces yeasts by fluorescently labeled DNA probes targeting the 26S rRNA.

    PubMed

    Röder, Christoph; König, Helmut; Fröhlich, Jürgen

    2007-09-01

    Sequencing of the complete 26S rRNA genes of all Dekkera/Brettanomyces species colonizing different beverages revealed the potential for a specific primer and probe design to support diagnostic PCR approaches and FISH. By analysis of the complete 26S rRNA genes of all five currently known Dekkera/Brettanomyces species (Dekkera bruxellensis, D. anomala, Brettanomyces custersianus, B. nanus and B. naardenensis), several regions with high nucleotide sequence variability yet distinct from the D1/D2 domains were identified. FISH species-specific probes targeting the 26S rRNA gene's most variable regions were designed. Accessibility of probe targets for hybridization was facilitated by the construction of partially complementary 'side'-labeled probes, based on secondary structure models of the rRNA sequences. The specificity and routine applicability of the FISH-based method for yeast identification were tested by analyzing different wine isolates. Investigation of the prevalence of Dekkera/Brettanomyces yeasts in the German viticultural regions Wonnegau, Nierstein and Bingen (Rhinehesse, Rhineland-Palatinate) resulted in the isolation of 37 D. bruxellensis strains from 291 wine samples.

  19. Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  20. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  1. Evaluation of 16S Rrna amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers

    USDA-ARS?s Scientific Manuscript database

    Next generation sequencing technologies have vastly changed the approach of sequencing of the 16S rRNA gene for studies in microbial ecology. Three distinct technologies are available for large-scale 16S sequencing. All three are subject to biases introduced by sequencing error rates, amplificatio...

  2. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    EPA Science Inventory

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  3. Increased expression of LD1 genes transcribed by RNA polymerase I in Leishmania donovani as a result of duplication into the rRNA gene locus

    SciTech Connect

    Lodes, M.J.; Merlin, G.; DeVos, T.

    1995-12-01

    This report investigates the duplication of two LD1 genes into the rRNA locus and the resultant transcription by RNA polymerase I, which has a faster transcription rate than that of RNA polymerase II. This was conducted using a 2.2-Mb chromosome in Leishmania donovani. 55 refs., 6 figs.

  4. Evidence That Intergenic Spacer Repeats of Drosophila Melanogaster Rrna Genes Function as X-Y Pairing Sites in Male Meiosis, and a General Model for Achiasmatic Pairing

    PubMed Central

    McKee, B. D.; Habera, L.; Vrana, J. A.

    1992-01-01

    In Drosophila melanogaster males, X-Y meiotic chromosome pairing is mediated by the nucleolus organizers (NOs) which are located in the X heterochromatin (Xh) and near the Y centromere. Deficiencies for Xh disrupt X-Y meiotic pairing and cause high frequencies of X-Y nondisjunction. Insertion of cloned rRNA genes on an Xh(-) chromosome partially restores normal X-Y pairing and disjunction. To map the sequences within an inserted, X-linked rRNA gene responsible for stimulating X-Y pairing, partial deletions were generated by P element-mediated destabilization of the insert. Complete deletions of the rRNA transcription unit did not interfere with the ability to stimulate X-Y pairing as long as most of the intergenic spacer (IGS) remained. Within groups of deletions that lacked the entire transcription unit and differed only in length of residual IGS material, pairing ability was proportional to the dose of 240-bp intergenic spacer repeats. Deletions of the complete rRNA transcription unit or of the 28S sequences alone blocked nucleolus formation, as determined by binding of an antinucleolar antibody, yet did not interfere with pairing ability, suggesting that X-Y pairing may not be mechanistically related to nucleolus formation. A model for achiasmatic pairing in Drosophila males based upon the combined action of topoisomerase I and a strand transferase is proposed. PMID:1330825

  5. [Archaeal diversity in permafrost deposits of Bunger Hills Oasis and King George Island (Antarctica) according to the 16S rRNA gene sequencing].

    PubMed

    Karaevskaia, E S; Demchenko, L S; Demidov, N É; Rivkina, E M; Bulat, S A; Gilichinskiĭ, D A

    2014-01-01

    Archaeal communities of permafrost deposits of King George Island and Bunger Hills Oasis (Antarctica) differing in the content of biogenic methane were analyzed using clone libraries of two 16S rRNA gene regions. Phylotypes belonging to methanogenic archaea were identified in all horizons.

  6. Degradation of a Polyadenylated rRNA Maturation By-Product Involves One of the Three RRP6-Like Proteins in Arabidopsis thaliana▿

    PubMed Central

    Lange, Heike; Holec, Sarah; Cognat, Valérie; Pieuchot, Laurent; Le Ret, Monique; Canaday, Jean; Gagliardi, Dominique

    2008-01-01

    Yeast Rrp6p and its human counterpart, PM/Scl100, are exosome-associated proteins involved in the degradation of aberrant transcripts and processing of precursors to stable RNAs, such as the 5.8S rRNA, snRNAs, and snoRNAs. The activity of yeast Rrp6p is stimulated by the polyadenylation of its RNA substrates. We identified three RRP6-like proteins in Arabidopsis thaliana: AtRRP6L3 is restricted to the cytoplasm, whereas AtRRP6L1 and -2 have different intranuclear localizations. Both nuclear RRP6L proteins are functional, since AtRRP6L1 complements the temperature-sensitive phenotype of a yeast rrp6Δ strain and mutation of AtRRP6L2 leads to accumulation of an rRNA maturation by-product. This by-product corresponds to the excised 5′ part of the 18S-5.8S-25S rRNA precursor and accumulates as a polyadenylated transcript, suggesting that RRP6L2 is involved in poly(A)-mediated RNA degradation in plant nuclei. Interestingly, the rRNA maturation by-product is a substrate of AtRRP6L2 but not of AtRRP6L1. This result and the distinctive subcellular distribution of AtRRP6L1 to -3 indicate a specialization of RRP6-like proteins in Arabidopsis. PMID:18285452

  7. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    EPA Science Inventory

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  8. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    EPA Science Inventory

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  9. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

    EPA Science Inventory

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  10. Ocular Hypotensive Response in Nonhuman Primates of (8R)-1-[(2S)-2-Aminopropyl]-8,9-dihydro-7H-pyrano[2,3-g]indazol-8-ol a Selective 5-HT2 Receptor Agonist.

    PubMed

    May, Jesse A; Sharif, Najam A; McLaughlin, Marsha A; Chen, Hwang-Hsing; Severns, Bryon S; Kelly, Curtis R; Holt, William F; Young, Richard; Glennon, Richard A; Hellberg, Mark R; Dean, Thomas R

    2015-11-25

    Recently, it has been reported that 5-HT2 receptor agonists effectively reduce intraocular pressure (IOP) in a nonhuman primate model of glaucoma. Although 1-[(2S)-2-aminopropyl]indazol-6-ol (AL-34662) was shown to have good efficacy in this nonhuman primate model of ocular hypertension as well as a desirable physicochemical and permeability profile, subsequently identified cardiovascular side effects in multiple species precluded further clinical evaluation of this compound. Herein, we report selected structural modifications that resulted in the identification of (8R)-1-[(2S)-2-aminopropyl]-8,9-dihydro-7H-pyrano[2,3-g]indazol-8-ol (13), which displayed an acceptable profile to support advancement for further preclinical evaluation as a candidate for proof-of-concept studies in humans.

  11. Modified RNA-seq method for microbial community and diversity analysis using rRNA in different types of environmental samples

    PubMed Central

    Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.

    2017-01-01

    RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse

  12. Enterotoxigenic Escherichia coli heat-stable toxin and heat-labile toxin toxoid fusion 3xSTaN12S-dmLT induces neutralizing anti-STa antibodies in subcutaneously immunized mice.

    PubMed

    Nandre, Rahul; Ruan, Xiaosai; Duan, Qiangde; Zhang, Weiping

    2016-11-02

    Enterotoxigenic Escherichia coli (ETEC) bacteria producing heat-stable toxin (STa) and/or heat-labile toxin (LT) are among top causes of children's diarrhea and travelers' diarrhea. Currently no vaccines are available for ETEC associated diarrhea. A major challenge in developing ETEC vaccines is the inability to stimulate protective antibodies against the key STa toxin which is potently toxic and also poorly immunogenic. A recent study suggested toxoid fusion 3xSTa N12S -dmLT, which consists of a monomer LT toxoid (LT R192G/L211A ) and three copies of STa toxoid STa N12S , may represent an optimal immunogen inducing neutralizing antibodies against STa toxin [IAI 2014, 82(5):1823-32]. In this study, we immunized mice with this fusion protein following a different parenteral route and using different adjuvants to further characterize immunogenicity of this toxoid fusion. Data from this study showed that 3xSTa N12S -dmLT toxoid fusion induced neutralizing anti-STa antibodies in the mice following subcutaneous immunization, as effectively as in the mice under intraperitoneal route. Data also indicated that double mutant LT (dmLT) can be an effective adjuvant for this toxoid fusion in mice subcutaneous immunization. Results from this study affirmed that toxoid fusion 3xSTa N12S -dmLT induces neutralizing antibodies against STa toxin, suggesting this toxoid fusion is potentially a promising immunogen for ETEC vaccine development. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    PubMed

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  14. Sequence variation identified in the 18S rRNA gene of Theileria mutans and Theileria velifera from the African buffalo (Syncerus caffer).

    PubMed

    Chaisi, Mamohale E; Collins, Nicola E; Potgieter, Fred T; Oosthuizen, Marinda C

    2013-01-16

    The African buffalo (Syncerus caffer) is a natural reservoir host for both pathogenic and non-pathogenic Theileria species. These often occur naturally as mixed infections in buffalo. Although the benign and mildly pathogenic forms do not have any significant economic importance, their presence could complicate the interpretation of diagnostic test results aimed at the specific diagnosis of the pathogenic Theileria parva in cattle and buffalo in South Africa. The 18S rRNA gene has been used as the target in a quantitative real-time PCR (qPCR) assay for the detection of T. parva infections. However, the extent of sequence variation within this gene in the non-pathogenic Theileria spp. of the Africa buffalo is not well known. The aim of this study was, therefore, to characterise the full-length 18S rRNA genes of Theileria mutans, Theileria sp. (strain MSD) and T. velifera and to determine the possible influence of any sequence variation on the specific detection of T. parva using the 18S rRNA qPCR. The reverse line blot (RLB) hybridization assay was used to select samples which either tested positive for several different Theileria spp., or which hybridised only with the Babesia/Theileria genus-specific probe and not with any of the Babesia or Theileria species-specific probes. The full-length 18S rRNA genes from 14 samples, originating from 13 buffalo and one bovine from different localities in South Africa, were amplified, cloned and the resulting recombinants sequenced. Variations in the 18S rRNA gene sequences were identified in T. mutans, Theileria sp. (strain MSD) and T. velifera, with the greatest diversity observed amongst the T. mutans variants. This variation possibly explained why the RLB hybridization assay failed to detect T. mutans and T. velifera in some of the analysed samples. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  16. Base Pairing between U3 Small Nucleolar RNA and the 5′ End of 18S rRNA Is Required for Pre-rRNA Processing

    PubMed Central

    Sharma, Kishor; Tollervey, David

    1999-01-01

    The loop of a stem structure close to the 5′ end of the 18S rRNA is complementary to the box A region of the U3 small nucleolar RNA (snoRNA). Substitution of the 18S loop nucleotides inhibited pre-rRNA cleavage at site A1, the 5′ end of the 18S rRNA, and at site A2, located 1.9 kb away in internal transcribed spacer 1. This inhibition was largely suppressed by a compensatory mutation in U3, demonstrating functional base pairing. The U3–pre-rRNA base pairing is incompatible with the structure that forms in the mature 18S rRNA and may prevent premature folding of the pre-rRNA. In the Escherichia coli pre-rRNA the homologous region of the 16S rRNA is also sequestered, in that case by base pairing to the 5′ external transcribed spacer (5′ ETS). Cleavage at site A0 in the yeast 5′ ETS strictly requires base pairing between U3 and a sequence within the 5′ ETS. In contrast, the U3-18S interaction is not required for A0 cleavage. U3 therefore carries out at least two functionally distinct base pair interactions with the pre-rRNA. The nucleotide at the site of A1 cleavage was shown to be specified by two distinct signals; one of these is the stem-loop structure within the 18S rRNA. However, in contrast to the efficiency of cleavage, the position of A1 cleavage is not dependent on the U3-loop interaction. We conclude that the 18S stem-loop structure is recognized at least twice during pre-rRNA processing. PMID:10454548

  17. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    PubMed Central

    Ngugi, David Kamanda; Stingl, Ulrich

    2012-01-01

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  18. Pyrosequencing of mcrA and Archaeal 16S rRNA Genes Reveals Diversity and Substrate Preferences of Methanogen Communities in Anaerobic Digesters

    PubMed Central

    Wilkins, David; Lu, Xiao-Ying; Shen, Zhiyong; Chen, Jiapeng

    2014-01-01

    Methanogenic archaea play a key role in biogas-producing anaerobic digestion and yet remain poorly taxonomically characterized. This is in part due to the limitations of low-throughput Sanger sequencing of a single (16S rRNA) gene, which in the past may have undersampled methanogen diversity. In this study, archaeal communities from three sludge digesters in Hong Kong and one wastewater digester in China were examined using high-throughput pyrosequencing of the methyl coenzyme M reductase (mcrA) and 16S rRNA genes. Methanobacteriales, Methanomicrobiales, and Methanosarcinales were detected in each digester, indicating that both hydrogenotrophic and acetoclastic methanogenesis was occurring. Two sludge digesters had similar community structures, likely due to their similar design and feedstock. Taxonomic classification of the mcrA genes suggested that these digesters were dominated by acetoclastic methanogens, particularly Methanosarcinales, while the other digesters were dominated by hydrogenotrophic Methanomicrobiales. The proposed euryarchaeotal order Methanomassiliicoccales and the uncultured WSA2 group were detected with the 16S rRNA gene, and potential mcrA genes for these groups were identified. 16S rRNA gene sequencing also recovered several crenarchaeotal groups potentially involved in the initial anaerobic digestion processes. Overall, the two genes produced different taxonomic profiles for the digesters, while greater methanogen richness was detected using the mcrA gene, supporting the use of this functional gene as a complement to the 16S rRNA gene to better assess methanogen diversity. A significant positive correlation was detected between methane production and the abundance of mcrA transcripts in digesters treating sludge and wastewater samples, supporting the mcrA gene as a biomarker for methane yield. PMID:25381241

  19. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    PubMed

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  20. Distribution of 16S rRNA Methylases Among Different Species of Aminoglycoside-Resistant Enterobacteriaceae in a Tertiary Care Hospital in Poland.

    PubMed

    Piekarska, Katarzyna; Zacharczuk, Katarzyna; Wołkowicz, Tomasz; Rzeczkowska, Magdalena; Bareja, Elżbieta; Olak, Monika; Gierczyński, Rafał

    2016-01-01

    Aminoglycosides are a group of antimicrobial agents still the most commonly used in the treatment of life-threatening bacterial infections in human and animals. The emergence and spread of 16S rRNA methylases, which confer high-level resistance to the majority of clinically relevant aminoglycosides, constitute a major public health concern. Our goal was to evaluate the distribution of 16S rRNA methylases among different species of Enterobacteriaceae during a five month-long survey in a tertiary hospital in Warszawa, Poland. In the survey, a total of 1770 non-duplicate clinical isolates were collected from all hospital wards in a tertiary hospital in Warszawa, Poland. The survey was conducted between 19 April and 19 September 2010. The ability to produce 16S rRNA methylase was examined by determining MICs for gentamicin, kanamycin, amikacin by means of the agar dilution method. The isolates resistant to high concentration of aminoglycosides were PCR tested for genes: armA, rmtA, rmtB and rmtC. PCR products were subjected to DNA sequencing by the Sanger method. The genetic similarity of the ArmA-producing isolates was analysed by pulsed-filed gel electrophoresis (PFGE). ArmA was the only 16S rRNA methylase detected in 20 of 1770 tested isolates. The overall prevalence rate of ArmA was 1.13%. In K. pneumoniae (n = 742), P. mirabilis (n = 130), and E. cloacae (n = 253) collected in the survey, the prevalence of ArmA was 0.4%, 0.8% and 5.9%, respectively. The PFGE revealed both horizontal and clonal spread of the armA gene in the hospital. The prevalence of 16S rRNA methylase ArmA reported in this study is significantly higher than observed in other countries in Europe.

  1. Comparison of PCR-Electrospray Ionization Mass Spectrometry with 16S rRNA PCR and Amplicon Sequencing for Detection of Bacteria in Excised Heart Valves

    PubMed Central

    Peeters, Bart; Herijgers, Paul; Beuselinck, Kurt; Peetermans, Willy E.; Herregods, Marie-Christin

    2016-01-01

    Identification of the causative pathogen of infective endocarditis (IE) is crucial for adequate management and therapy. A broad-range PCR-electrospray ionization mass spectrometry (PCR-ESI-MS) technique was compared with broad-spectrum 16S rRNA PCR and amplicon sequencing (16S rRNA PCR) for the detection of bacterial pathogens in 40 heart valves obtained from 34 definite infective endocarditis patients according to the modified Duke criteria and six nonendocarditis patients. Concordance between the two molecular techniques was 98% for being positive or negative, 97% for concordant identification up to the genus level, and 77% for concordant identification up to the species level. Sensitivity for detecting the causative pathogen (up to the genus level) in excised heart valves was 88% for 16S rRNA PCR and 85% for PCR-ESI-MS; the specificity was 83% for both methods. The two molecular techniques were significantly more sensitive than valve culture (18%) and accurately identified bacteria in excised heart valves. In eight patients with culture-negative IE, the following results were obtained: concordant detection of Coxiella burnetii (n = 2), Streptococcus gallolyticus (n = 1), Propionibacterium acnes (n = 1), and viridans group streptococci (n = 1) by both molecular tests, detection of P. acnes by PCR-ESI-MS whereas the 16S rRNA PCR was negative (n = 1), and a false-negative result by both molecular techniques (n = 2). In one case of IE caused by viridans streptococci, PCR-ESI-MS was positive for Enterococcus spp. The advantages of PCR-ESI-MS compared to 16S rRNA PCR are its automated workflow and shorter turnaround times. PMID:27629895

  2. A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

    PubMed Central

    Tadmor, Arbel D.; Tlusty, Tsvi

    2008-01-01

    We propose a biophysical model of Escherichia coli that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity. PMID:18437222

  3. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling

    PubMed Central

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991

  4. Microbial Contaminants of Cord Blood Units Identified by 16S rRNA Sequencing and by API Test System, and Antibiotic Sensitivity Profiling.

    PubMed

    França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S

    2015-01-01

    Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.

  5. Overexpression of a natural chloroplast-encoded antisense RNA in tobacco destabilizes 5S rRNA and retards plant growth.

    PubMed

    Hotto, Amber M; Huston, Zoe E; Stern, David B

    2010-09-29

    The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs) in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. AS5-overexpressing (AS5ox) plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT) and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.

  6. Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

    PubMed

    Tian, Yang; Li, Yan Hong

    2017-01-01

    To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Potential applications of next generation DNA sequencing of 16S rRNA gene amplicons in microbial water quality monitoring

    PubMed Central

    Vierheilig, J.; Savio, D.; Ley, R. E.; Mach, R. L.; Farnleitner, A. H.

    2016-01-01

    The applicability of next generation DNA sequencing (NGS) methods for water quality assessment has so far not been broadly investigated. This study set out to evaluate the potential of an NGS-based approach in a complex catchment with importance for drinking water abstraction. In this multicompartment investigation, total bacterial communities in water, faeces, soil, and sediment samples were investigated by 454 pyrosequencing of bacterial 16S rRNA gene amplicons to assess the capabilities of this NGS method for (i) the development and evaluation of environmental molecular diagnostics, (ii) direct screening of the bulk bacterial communities, and (iii) the detection of faecal pollution in water. Results indicate that NGS methods can highlight potential target populations for diagnostics and will prove useful for the evaluation of existing and the development of novel DNA-based detection methods in the field of water microbiology. The used approach allowed unveiling of dominant bacterial populations but failed to detect populations with low abundances such as faecal indicators in surface waters. In combination with metadata, NGS data will also allow the identification of drivers of bacterial community composition during water treatment and distribution, highlighting the power of this approach for monitoring of bacterial regrowth and contamination in technical systems. PMID:26606090

  8. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    PubMed

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  9. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  10. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    PubMed

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-09-24

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  11. On the structural features of hairpin triloops in rRNA: from nucleotide to global conformational change upon ligand binding.

    PubMed

    Mitrasinovic, Petar M

    2006-03-01

    RNA structure can be viewed as both a construct composed of various structural motifs and a flexible polymer that is substantially influenced by its environment. In this light, the present paper represents an attempt to reconcile the two standpoints. By using the 3D structures both of four (16S and 23S) portions of unbound 50S, H50S, and T30S ribosomal subunits and of 38 large ribonucleoligand complexes as the starting point, the behavior, which is induced by ligand binding, of 73 hairpin triloops with closing g-c and c-g base pairs was investigated using root-mean-square deviation (RMSD) approach and pseudotorsional (eta,theta) convention at the nucleotide-by-nucleotide level. Triloops were annotated in accordance with a recent proposal of geometric nomenclature. A simple measure for the determination of the strain of a triloop is introduced. It is believed that a possible classification of the interior triloops, based on the 2D eta-theta unique path, will aid to conceive their local behavior upon ligand binding. All rRNA residues in contact with ligands as well as regions of considerable conformational changes upon complex formation were identified. The analysis offers the answer to: how proximal to and how far from the actual ligand-binding sites the structural changes occur?

  12. Comparison of bacteroides-prevotella 16S rRNA genetic markers for fecal samples from different animal species.

    PubMed

    Fogarty, Lisa R; Voytek, Mary A

    2005-10-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  13. Comparison of Bacteroides-Prevotella 16S rRNA Genetic Markers for Fecal Samples from Different Animal Species

    PubMed Central

    Fogarty, Lisa R.; Voytek, Mary A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment. PMID:16204514

  14. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    PubMed

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  15. Phylogenic inference using alignment-free methods for applications in microbial community surveys using 16s rRNA gene

    PubMed Central

    2017-01-01

    The diversity of microbiota is best explored by understanding the phylogenetic structure of the microbial communities. Traditionally, sequence alignment has been used for phylogenetic inference. However, alignment-based approaches come with significant challenges and limitations when massive amounts of data are analyzed. In the recent decade, alignment-free approaches have enabled genome-scale phylogenetic inference. Here we evaluate three alignment-free methods: ACS, CVTree, and Kr for phylogenetic inference with 16s rRNA gene data. We use a taxonomic gold standard to compare the accuracy of alignment-free phylogenetic inference with that of common microbiome-wide phylogenetic inference pipelines based on PyNAST and MUSCLE alignments with FastTree and RAxML. We re-simulate fecal communities from Human Microbiome Project data to evaluate the performance of the methods on datasets with properties of real data. Our comparisons show that alignment-free methods are not inferior to alignment-based methods in giving accurate and robust phylogenic trees. Moreover, consensus ensembles of alignment-free phylogenies are superior to those built from alignment-based methods in their ability to highlight community differences in low power settings. In addition, the overall running times of alignment-based and alignment-free phylogenetic inference are comparable. Taken together our empirical results suggest that alignment-free methods provide a viable approach for microbiome-wide phylogenetic inference. PMID:29136663

  16. Analysis of large 16S rRNA Illumina data sets: Impact of singleton read filtering on microbial community description.

    PubMed

    Auer, Lucas; Mariadassou, Mahendra; O'Donohue, Michael; Klopp, Christophe; Hernandez-Raquet, Guillermina

    2017-11-01

    Next-generation sequencing technologies give access to large sets of data, which are extremely useful in the study of microbial diversity based on 16S rRNA gene. However, the production of such large data sets is not only marred by technical biases and sequencing noise but also increases computation time and disc space use. To improve the accuracy of OTU predictions and overcome both computations, storage and noise issues, recent studies and tools suggested removing all single reads and low abundant OTUs, considering them as noise. Although the effect of applying an OTU abundance threshold on α- and β-diversity has been well documented, the consequences of removing single reads have been poorly studied. Here, we test the effect of singleton read filtering (SRF) on microbial community composition using in silico simulated data sets as well as sequencing data from synthetic and real communities displaying different levels of diversity and abundance profiles. Scalability to large data sets is also assessed using a complete MiSeq run. We show that SRF drastically reduces the chimera content and computational time, enabling the analysis of a complete MiSeq run in just a few minutes. Moreover, SRF accurately determines the actual community diversity: the differences in α- and β-community diversity obtained with SRF and standard procedures are much smaller than the intrinsic variability of technical and biological replicates. © 2017 John Wiley & Sons Ltd.

  17. Identification and Characterization of a Pesticide Degrading Flavobacterium Species EMBS0145 by 16S rRNA Gene Sequencing.

    PubMed

    Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S

    2015-06-01

    Organophosphates like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, and this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon, or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted, and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with Accession Number: JN794045.

  18. Identification and characterization of a pesticide degrading flavobacterium species EMBS0145 by 16S rRNA gene sequencing.

    PubMed

    Nayarisseri, Anuraj; Suppahia, Anjana; Nadh, Anuroopa G; Nair, Achuthsankar S

    2014-08-09

    Organophosphates (OPs) like chlorpyrifos, diazinon, or malathion have become most common and indisputably most toxic pest-control agents that adversely affects the human nervous system even at low levels of exposure. Because of their relatively low cost and ability to be applied on a wide range of target insects and crop, organophosphorus pesticides account for a large share of all insecticides used in India, this in turn raises severe health concerns. In this view, the present investigation was aimed to identify novel species of Flavobacterium bacteria which is bestowed with the capacity to degrade pesticides like chlorpyrifos, diazinon or malathion. The bacterium was isolated from agricultural soil collected from Guntur District, Andhra Pradesh, India. The samples were serially diluted and the aliquots were incubated for a suitable time following which the suspected colony was subjected to 16S rRNA gene sequencing. The sequence thus obtained was aligned pairwise against Flavobacterium species, which resulted in identification of novel species of Flavobacterium later which was named as EMBS0145 and sequence was deposited in GenBank with accession number JN794045.

  19. Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

    PubMed

    Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying

    2017-01-01

    The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

  20. Comparison of synovial fluid culture and 16S rRNA PCR in dogs with suspected septic arthritis.

    PubMed

    Scharf, V F; Lewis, D D; Wellehan, J F; Wamsley, H L; Richardson, R

    2015-06-01

    To prospectively compare the sensitivity and specificity of 16S rRNA PCR with culture for identifying the causative organism in synovial fluid obtained from dogs with suspected septic arthritis. Synovial fluid cytology, PCR analysis and aerobic, anaerobic and Mycoplasma culture of samples from the affected joints of 18 dogs presenting with suspected septic arthritis were performed. Synovial fluid samples from the corresponding contralateral joints of 7 dogs were also analysed as negative controls. There was no significant difference between the sensitivity of bacterial detection via culture (63.2%) versus PCR (73.7%) of synovial fluid (P=0.728) or between culture and combined PCR and culture (89.5%) of synovial fluid (P=0.124). The specificity of PCR (42.9%) was significantly lower than culture specificity (100%) (P=0.07). Although 16S PCR may hold potential as an ancillary diagnostic test for identifying the causative organism in dogs with septic arthritis, our study failed to demonstrate improved accuracy compared with traditional synovial fluid culture. © 2015 Australian Veterinary Association.

  1. Bacterial taxa abundance pattern in an industrial wastewater treatment system determined by the full rRNA cycle approach.

    PubMed

    Figuerola, Eva L M; Erijman, Leonardo

    2007-07-01

    The description of the diversity and structure of microbial communities through quantification of the constituent populations is one of the major objectives in environmental microbiology. The implications of models for community assembly are practical as well as theoretical, because the extent of biodiversity is thought to influence the function of ecosystems. Current attempts to predict species diversity in different environments derive the numbers of individuals for each operational taxonomic unit (OTU) from the frequency of clones in 16S rDNA gene libraries, which are subjected to a number of inherent biases and artefacts. We show that diversity of the bacterial community present in a complex microbial ensemble can be estimated by fitting the data of the full-cycle rRNA approach to a model of species abundance distribution. Sequences from a 16S rDNA gene library from activated sludge were reliably assigned to OTUs at a genetic distance of 0.04. A group of 17 newly designed rRNA-targeted oligonucleotide probes were used to quantify by fluorescence in situ hybridization, OTUs represented with more than three clones in the 16S rDNA clone library. Cell abundance distribution was best described by a geometric series, after the goodness of fit was evaluated by the Kolmogorov-Smirnov test. Although a complete mechanistic understanding of all the ecological processes involved is still not feasible, describing the distribution pattern of a complex bacterial assemblage model can shed light on the way bacterial communities operate.

  2. Physical Localization and DNA Methylation of 45S rRNA Gene Loci in Jatropha curcas L.

    PubMed Central

    Gong, Zhiyun; Xue, Chao; Zhang, Mingliang; Guo, Rui; Zhou, Yong; Shi, Guoxin

    2013-01-01

    In eukaryotes, 45S rRNA genes are arranged in tandem arrays of repeat units, and not all copies are transcribed during mitosis. DNA methylation is considered to be an epigenetic marker for rDNA activation. Here, we established a clear and accurate karyogram for Jatropha curcas L. The chromosomal formula was found to be 2n = 2x = 22 = 12m+10sm. We found that the 45S rDNA loci were located at the termini of chromosomes 7 and 9 in J. curcas. The distribution of 45S rDNA has no significant difference in J. curcas from different sources. Based on the hybridization signal patterns, there were two forms of rDNA - dispersed and condensed. The dispersed type of signals appeared during interphase and prophase, while the condensed types appeared during different stages of mitosis. DNA methylation analysis showed that when 45S rDNA stronger signals were dispersed and connected to the nucleolus, DNA methylation levels were lower at interphase and prophase. However, when the 45S rDNA loci were condensed, especially during metaphase, they showed different forms of DNA methylation. PMID:24386362

  3. mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability

    PubMed Central

    Mayer, Christine; Zhao, Jian; Yuan, Xuejun; Grummt, Ingrid

    2004-01-01

    In cycling cells, transcription of ribosomal RNA genes by RNA polymerase I (Pol I) is tightly coordinated with cell growth. Here, we show that the mammalian target of rapamycin (mTOR) regulates Pol I transcription by modulating the activity of TIF-IA, a regulatory factor that senses nutrient and growth-factor availability. Inhibition of mTOR signaling by rapamycin inactivates TIF-IA and impairs transcription-initiation complex formation. Moreover, rapamycin treatment leads to translocation of TIF-IA into the cytoplasm. Rapamycin-mediated inactivation of TIF-IA is caused by hypophosphorylation of Ser 44 (S44) and hyperphosphorylation of Ser 199 (S199). Phosphorylation at these sites affects TIF-IA activity in opposite ways, for example, phosphorylation of S44 activates and S199 inactivates TIF-IA. The results identify a new target for mTOR-signaling pathways and elucidate the molecular mechanism underlying mTOR-dependent regulation of rRNA synthesis. PMID:15004009

  4. Comparison of Bacteroides-Prevotella 16S rRNA genetic markers for fecal samples from different animal species

    USGS Publications Warehouse

    Fogarty, L.R.; Voytek, M.A.

    2005-01-01

    To effectively manage surface and ground waters it is necessary to improve our ability to detect and identify sources of fecal contamination. We evaluated the use of the anaerobic bacterial group Bacteroides-Prevotella as a potential fecal indicator. Terminal restriction length polymorphism (T-RFLP) of the 16S rRNA genes from this group was used to determine differences in populations and to identify any unique populations in chickens, cows, deer, dogs, geese, horses, humans, pigs, and seagulls. The group appears to be a good potential fecal indicator in all groups tested except for avians. Cluster analysis of Bacteroides-Prevotella community T-RFLP profiles indicates that Bacteroides-Prevotella populations from samples of the same host species are much more similar to each other than to samples from different source species. We were unable to identify unique peaks that were exclusive to any source species; however, for most host species, at least one T-RFLP peak was identified to be more commonly found in that species, and a combination of peaks could be used to identify the source. T-RFLP profiles obtained from water spiked with known-source feces contained the expected diagnostic peaks from the source. These results indicate that the approach of identifying Bacteroides-Prevotella molecular markers associated with host species might be useful in identifying sources of fecal contamination in the environment.

  5. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    PubMed

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  6. Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

    PubMed Central

    Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

    2012-01-01

    Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

  7. Assessing Cat Flea Microbiomes in Northern and Southern California by 16S rRNA Next-Generation Sequencing.

    PubMed

    Vasconcelos, Elton J R; Billeter, Sarah A; Jett, Lindsey A; Meinersmann, Richard J; Barr, Margaret C; Diniz, Pedro P V P; Oakley, Brian B

    2018-06-12

    Flea-borne diseases (FBDs) impact both human and animal health worldwide. Because adult fleas are obligately hematophagous and can harbor potential pathogens, fleas act as ectoparasites of vertebrates, as well as zoonotic disease vectors. Cat fleas (Ctenocephalides felis) are important vectors of two zoonotic bacterial genera listed as priority pathogens by the National Institute of Allergy and Infectious Diseases (NIAID-USA): Bartonella spp. and Rickettsia spp., causative agents of bartonelloses and rickettsioses, respectively. In this study, we introduce the first microbiome analysis of C. felis samples from California, determining the presence and abundance of relevant pathogenic genera by characterizing the cat flea microbiome through 16S rRNA next-generation sequencing (16S-NGS). Samples from both northern (NoCal) and southern (SoCal) California were assessed to expand current knowledge regarding FBDs in the state. We identified Rickettsia and Bartonella, as well as the endosymbiont Wolbachia, as the most abundant genera, followed by less abundant taxa. In comparison to our previous study screening Californian cat fleas for rickettsiae using PCR/digestion/sequencing of the ompB gene, the 16S-NGS approach applied herein showed a 95% level of agreement in detecting Rickettsia spp. There was no overall difference in microbiome diversity between NoCal and SoCal samples. Bacterial taxa identified by 16S-NGS in this study may help to improve epidemiological investigations, pathogen surveillance efforts, and clinical diagnostics of FBDs in California and elsewhere.

  8. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons

    PubMed Central

    Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.

    2011-01-01

    Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162

  9. Pseudomonas sp. strain CA5 (a selenite-reducing bacterium) 16S rRNA gene complete sequence. National Institute of Health, National Center for Biotechnology Information, GenBank sequence. Accession FJ422810.1.

    USDA-ARS?s Scientific Manuscript database

    This study used 1321 base pair 16S rRNA gene sequence methods to confirm the phylogenetic position of a soil isolate as a bacterium belonging to the genus Pesudomonas sp. Morphological, biochemical characteristics, and fatty acid profiles are consistent with the 16S rRNA gene sequence identification...

  10. Denitrification potential of the eastern oyster microbiome using a 16S rRNA gene based metabolic inference approach

    PubMed Central

    Bowman, Jeff S.; Piehler, Michael

    2017-01-01

    The eastern oyster (Crassostrea virginica) is a foundation species providing significant ecosystem services. However, the roles of oyster microbiomes have not been integrated into any of the services, particularly nitrogen removal through denitrification. We investigated the composition and denitrification potential of oyster microbiomes with an approach that combined 16S rRNA gene analysis, metabolic inference, qPCR of the nitrous oxide reductase gene (nosZ), and N2 flux measurements. Microbiomes of the oyster digestive gland, the oyster shell, and sediments adjacent to the oyster reef were examined based on next generation sequencing (NGS) of 16S rRNA gene amplicons. Denitrification potentials of the microbiomes were determined by metabolic inferences using a customized denitrification gene and genome database with the paprica (PAthway PRediction by phylogenetIC plAcement) bioinformatics pipeline. Denitrification genes examined included nitrite reductase (nirS and nirK) and nitrous oxide reductase (nosZ), which was further subdivided by genotype into clade I (nosZI) or clade II (nosZII). Continuous flow through experiments measuring N2 fluxes were conducted with the oysters, shells, and sediments to compare denitrification activities. Paprica properly classified the composition of microbiomes, showing similar classification results from Silva, Greengenes and RDP databases. Microbiomes of the oyster digestive glands and shells were quite different from each other and from the sediments. The relative abundance of denitrifying bacteria inferred by paprica was higher in oysters and shells than in sediments suggesting that oysters act as hotspots for denitrification in the marine environment. Similarly, the inferred nosZI gene abundances were also higher in the oyster and shell microbiomes than in the sediment microbiome. Gene abundances for nosZI were verified with qPCR of nosZI genes, which showed a significant positive correlation (F1,7 = 14.7, p = 6.0x10-3, R2 = 0

  11. Denitrification potential of the eastern oyster microbiome using a 16S rRNA gene based metabolic inference approach.

    PubMed

    Arfken, Ann; Song, Bongkeun; Bowman, Jeff S; Piehler, Michael

    2017-01-01

    The eastern oyster (Crassostrea virginica) is a foundation species providing significant ecosystem services. However, the roles of oyster microbiomes have not been integrated into any of the services, particularly nitrogen removal through denitrification. We investigated the composition and denitrification potential of oyster microbiomes with an approach that combined 16S rRNA gene analysis, metabolic inference, qPCR of the nitrous oxide reductase gene (nosZ), and N2 flux measurements. Microbiomes of the oyster digestive gland, the oyster shell, and sediments adjacent to the oyster reef were examined based on next generation sequencing (NGS) of 16S rRNA gene amplicons. Denitrification potentials of the microbiomes were determined by metabolic inferences using a customized denitrification gene and genome database with the paprica (PAthway PRediction by phylogenetIC plAcement) bioinformatics pipeline. Denitrification genes examined included nitrite reductase (nirS and nirK) and nitrous oxide reductase (nosZ), which was further subdivided by genotype into clade I (nosZI) or clade II (nosZII). Continuous flow through experiments measuring N2 fluxes were conducted with the oysters, shells, and sediments to compare denitrification activities. Paprica properly classified the composition of microbiomes, showing similar classification results from Silva, Greengenes and RDP databases. Microbiomes of the oyster digestive glands and shells were quite different from each other and from the sediments. The relative abundance of denitrifying bacteria inferred by paprica was higher in oysters and shells than in sediments suggesting that oysters act as hotspots for denitrification in the marine environment. Similarly, the inferred nosZI gene abundances were also higher in the oyster and shell microbiomes than in the sediment microbiome. Gene abundances for nosZI were verified with qPCR of nosZI genes, which showed a significant positive correlation (F1,7 = 14.7, p = 6.0x10-3, R2 = 0

  12. An 18S rRNA Workflow for Characterizing Protists in Sewage, with a Focus on Zoonotic Trichomonads.

    PubMed

    Maritz, Julia M; Rogers, Krysta H; Rock, Tara M; Liu, Nicole; Joseph, Susan; Land, Kirkwood M; Carlton, Jane M

    2017-11-01

    Microbial eukaryotes (protists) are important components of terrestrial and aquatic environments, as well as animal and human microbiomes. Their relationships with metazoa range from mutualistic to parasitic and zoonotic (i.e., transmissible between humans and animals). Despite their ecological importance, our knowledge of protists in urban environments lags behind that of bacteria, largely due to a lack of experimentally validated high-throughput protocols that produce accurate estimates of protist diversity while minimizing non-protist DNA representation. We optimized protocols for detecting zoonotic protists in raw sewage samples, with a focus on trichomonad taxa. First, we investigated the utility of two commonly used variable regions of the 18S rRNA marker gene, V4 and V9, by amplifying and Sanger sequencing 23 different eukaryotic species, including 16 protist species such as Cryptosporidium parvum, Giardia intestinalis, Toxoplasma gondii, and species of trichomonad. Next, we optimized wet-lab methods for sample processing and Illumina sequencing of both regions from raw sewage collected from a private apartment building in New York City. Our results show that both regions are effective at identifying several zoonotic protists that may be present in sewage. A combination of small extractions (1 mL volumes) performed on the same day as sample collection, and the incorporation of a vertebrate blocking primer, is ideal to detect protist taxa of interest and combat the effects of metazoan DNA. We expect that the robust, standardized methods presented in our workflow will be applicable to investigations of protists in other environmental samples, and will help facilitate large-scale investigations of protistan diversity.

  13. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  14. Characterization of the vaginal fungal flora in pregnant diabetic women by 18S rRNA sequencing.

    PubMed

    Zheng, N-N; Guo, X-C; Lv, W; Chen, X-X; Feng, G-F

    2013-08-01

    Pregnancy and diabetes are regarded as individual risk factors for vaginal candidiasis. The high prevalence of vaginal candidiasis in pregnant diabetic women can be explained by disruption of the balance of the vaginal normal flora. However, little is known about the overall structure and composition of the vaginal fungal flora in pregnant diabetic women. In the present study, the diversity and richness of the vaginal fungal flora in healthy non-pregnant women (group HN), healthy pregnant women (group HP), women with gestational diabetes mellitus (group GDM), and pregnant women with diabetes mellitus type I (group T1DM) were investigated using an 18S rRNA gene clone library method. Our data demonstrated that the composition of the vaginal fungal flora in the four groups could be divided into two phyla (Ascomycetes, 20/26, and Basidiomycetes, 6/26). The most predominant vaginal fungal species belonged to the Candida and Saccharomyces genera, uncultured fungi, and a large number of low-abundance taxa that were unrecorded or underrepresented in previous studies using cultivation-dependent methods. Variation in operational taxonomic units (OTUs) between the study cohorts was generally high in the clone libraries, as 9, 13, 17, and 20 phylotypes were identified in groups HN, HP, GDM, and T1DM, respectively. The Shannon indices of groups GDM and T1DM (with poorer glycemic control) were significantly higher compared to groups HN and HP (p < 0.05). The data presented here revealed an increased diversity and varied composition of the vaginal fungal flora in pregnant diabetic women and demonstrated that poor glycemic control might be associated with disturbances in the vaginal fungal flora.

  15. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, human papilloma virus infection and surgical treatment.

    PubMed

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodríguez-Hilario, Arnold; González, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G; Westra, William; Koch, Wayne; Sidransky, David

    2016-08-09

    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropharyngeal (OPSCC), Oral Cavity Squamous Cell Carcinoma (OCSCC) patients and normal epithelium controls, to characterize the HNSCC saliva microbiota and examine their abundance before and after surgical resection.The analyses identified a predominance of Firmicutes, Proteobacteria and Bacteroidetes, with less frequent presence of Actinobacteria and Fusobacteria before surgery. At lower taxonomic levels, the most abundant genera were Streptococcus, Prevotella, Haemophilus, Lactobacillus and Veillonella, with lower numbers of Citrobacter and Neisseraceae genus Kingella. HNSCC patients had a significant loss in richness and diversity of microbiota species (p<0.05) compared to the controls. Overall, the Operational Taxonomic Units network shows that the relative abundance of OTU's within genus Streptococcus, Dialister, and Veillonella can be used to discriminate tumor from control samples (p<0.05). Tumor samples lost Neisseria, Aggregatibacter (Proteobacteria), Haemophillus (Firmicutes) and Leptotrichia (Fusobacteria). Paired taxa within family Enterobacteriaceae, together with genus Oribacterium, distinguish OCSCC samples from OPSCC and normal samples (p<0.05). Similarly, only HPV positive samples have an abundance of genus Gemellaceae and Leuconostoc (p<0.05). Longitudinal analyses of samples taken before and after surgery, revealed a reduction in the alpha diversity measure after surgery, together with an increase of this measure in patients that recurred (p<0.05). These results suggest that microbiota may be used as HNSCC diagnostic and prognostic biomonitors.

  16. Combining flow cytometry and 16S rRNA gene pyrosequencing: a promising approach for drinking water monitoring and characterization.

    PubMed

    Prest, E I; El-Chakhtoura, J; Hammes, F; Saikaly, P E; van Loosdrecht, M C M; Vrouwenvelder, J S

    2014-10-15

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5 min intervals for 1 h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345 ± 15 × 10(3) to 425 ± 35 × 10(3) cells mL(-1)) and in the percentage of intact bacterial cells (from 39 ± 3.5% to 53 ± 4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Beyond Streptococcus mutans: Dental Caries Onset Linked to Multiple Species by 16S rRNA Community Analysis

    PubMed Central

    Gross, Erin L.; Beall, Clifford J.; Kutsch, Stacey R.; Firestone, Noah D.; Leys, Eugene J.; Griffen, Ann L.

    2012-01-01

    Dental caries in very young children may be severe, result in serious infection, and require general anesthesia for treatment. Dental caries results from a shift within the biofilm community specific to the tooth surface, and acidogenic species are responsible for caries. Streptococcus mutans, the most common acid producer in caries, is not always present and occurs as part of a complex microbial community. Understanding the degree to which multiple acidogenic species provide functional redundancy and resilience to caries-associated communities will be important for developing biologic interventions. In addition, microbial community interactions in health and caries pathogenesis are not well understood. The purpose of this study was to investigate bacterial community profiles associated with the onset of caries in the primary dentition. In a combination cross-sectional and longitudinal design, bacterial community profiles at progressive stages of caries and over time were examined and compared to those of health. 16S rRNA gene sequencing was used for bacterial community analysis. Streptococcus mutans was the dominant species in many, but not all, subjects with caries. Elevated levels of S. salivarius, S. sobrinus, and S. parasanguinis were also associated with caries, especially in subjects with no or low levels of S. mutans, suggesting these species are alternative pathogens, and that multiple species may need to be targeted for interventions. Veillonella, which metabolizes lactate, was associated with caries and was highly correlated with total acid producing species. Among children without previous history of caries, Veillonella, but not S. mutans or other acid-producing species, predicted future caries. Bacterial community diversity was reduced in caries as compared to health, as many species appeared to occur at lower levels or be lost as caries advanced, including the Streptococcus mitis group, Neisseria, and Streptococcus sanguinis. This may have

  18. Low bacterial community diversity in two introduced aphid pests revealed with 16S rRNA amplicon sequencing

    PubMed Central

    Ortiz-Martínez, Sebastían; Silva, Andrea X.; Lavandero, Blas

    2018-01-01

    Bacterial endosymbionts that produce important phenotypic effects on their hosts are common among plant sap-sucking insects. Aphids have become a model system of insect-symbiont interactions. However, endosymbiont research has focused on a few aphid species, making it necessary to make greater efforts to other aphid species through different regions, in order to have a better understanding of the role of endosymbionts in aphids as a group. Aphid endosymbionts have frequently been studied by PCR-based techniques, using species-specific primers, nevertheless this approach may omit other non-target bacteria cohabiting a particular host species. Advances in high-throughput sequencing technologies are complementing our knowledge of microbial communities by allowing us the study of whole microbiome of different organisms. We used a 16S rRNA amplicon sequencing approach to study the microbiome of aphids in order to describe the bacterial community diversity in introduced populations of the cereal aphids, Sitobion avenae and Rhopalosiphum padi in Chile (South America). An absence of secondary endosymbionts and two common secondary endosymbionts of aphids were found in the aphids R. padi and S. avenae, respectively. Of those endosymbionts, Regiella insecticola was the dominant secondary endosymbiont among the aphid samples. In addition, the presence of a previously unidentified bacterial species closely related to a phytopathogenic Pseudomonad species was detected. We discuss these results in relation to the bacterial endosymbiont diversity found in other regions of the native and introduced range of S. avenae and R. padi. A similar endosymbiont diversity has been reported for both aphid species in their native range. However, variation in the secondary endosymbiont infection could be observed among the introduced and native populations of the aphid S. avenae, indicating that aphid-endosymbiont associations can vary across the geographic range of an aphid species. In

  19. Dry reagent dipstick test combined with 23S rRNA PCR for molecular diagnosis of bacterial infection in arthroplasty.

    PubMed

    Kalogianni, Despina P; Goura, Sophia; Aletras, Alexios J; Christopoulos, Theodore K; Chanos, Michalis G; Christofidou, Myrto; Skoutelis, Athanasios; Ioannou, Penelope C; Panagiotopoulos, Elias

    2007-02-15

    Periprosthetic joint infections present a challenging problem in orthopaedics. Conventional methods for detection of arthroplasty infections rely on bacterial culture of synovial fluid aspirates. During recent years, however, molecular tests that are based on DNA amplification by the polymerase chain reaction (PCR), followed by electrophoretic analysis of the products, have been introduced. We report a simple and inexpensive assay that allows visual detection and confirmation of the PCR-amplified sequences by hybridization within minutes. The assay is performed in a dry reagent dipstick format (strip) and does not require special instrumentation. Universal primers are used for PCR of the 23S ribosomal RNA (rRNA) gene. The biotinylated amplification product is hybridized with dA-tailed probes that are specific for six pathogens commonly involved in periprosthetic joint infections. The mixture is applied to the strip, which is then immersed in the appropriate buffer. The buffer migrates along the strip by capillary action and rehydrates gold nanoparticles with oligo(dT) strands attached to their surface. The nanoparticles bind to the target DNA through hybridization, and the hybrids are captured by immobilized streptavidin at the test zone of the strip, producing a characteristic red line. Unbound nanoparticles are captured by immobilized oligo(dT) strands at the control zone of the strip, generating a second line. The dipstick test was applied to the detection of Escherichia coli, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pneumoniae, Enterococcus faesium, and Haemophilus influenza. Twelve samples of synovial fluids from patients were analyzed for the detection and identification of the infection caused by the six pathogens. The results were compared with bacterial cultures.

  20. 16S rRNA amplicon sequencing identifies microbiota associated with oral cancer, human papilloma virus infection and surgical treatment

    PubMed Central

    Guerrero-Preston, Rafael; Godoy-Vitorino, Filipa; Jedlicka, Anne; Rodríguez-Hilario, Arnold; González, Herminio; Bondy, Jessica; Lawson, Fahcina; Folawiyo, Oluwasina; Michailidi, Christina; Dziedzic, Amanda; Thangavel, Rajagowthamee; Hadar, Tal; Noordhuis, Maartje G.; Westra, William; Koch, Wayne; Sidransky, David

    2016-01-01

    Systemic inflammatory events and localized disease, mediated by the microbiome, may be measured in saliva as head and neck squamous cell carcinoma (HNSCC) diagnostic and prognostic biomonitors. We used a 16S rRNA V3-V5 marker gene approach to compare the saliva microbiome in DNA isolated from Oropharyngeal (OPSCC), Oral Cavity Squamous Cell Carcinoma (OCSCC) patients and normal epithelium controls, to characterize the HNSCC saliva microbiota and examine their abundance before and after surgical resection. The analyses identified a predominance of Firmicutes, Proteobacteria and Bacteroidetes, with less frequent presence of Actinobacteria and Fusobacteria before surgery. At lower taxonomic levels, the most abundant genera were Streptococcus, Prevotella, Haemophilus, Lactobacillus and Veillonella, with lower numbers of Citrobacter and Neisseraceae genus Kingella. HNSCC patients had a significant loss in richness and diversity of microbiota species (p<0.05) compared to the controls. Overall, the Operational Taxonomic Units network shows that the relative abundance of OTU's within genus Streptococcus, Dialister, and Veillonella can be used to discriminate tumor from control samples (p<0.05). Tumor samples lost Neisseria, Aggregatibacter (Proteobacteria), Haemophillus (Firmicutes) and Leptotrichia (Fusobacteria). Paired taxa within family Enterobacteriaceae, together with genus Oribacterium, distinguish OCSCC samples from OPSCC and normal samples (p<0.05). Similarly, only HPV positive samples have an abundance of genus Gemellaceae and Leuconostoc (p<0.05). Longitudinal analyses of samples taken before and after surgery, revealed a reduction in the alpha diversity measure after surgery, together with an increase of this measure in patients that recurred (p<0.05). These results suggest that microbiota may be used as HNSCC diagnostic and prognostic biomonitors. PMID:27259999

  1. Nucleotides in 16S rRNA that are required in unmodified form for features recognized by ribosomal protein S8.

    PubMed Central

    Thurlow, D L; Ehresmann, C; Ehresmann, B

    1983-01-01

    Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037

  2. Sequence Variation in the Small-Subunit rRNA Gene of Plasmodium malariae and Prevalence of Isolates with the Variant Sequence in Sichuan, China

    PubMed Central

    Liu, Qing; Zhu, Shenghua; Mizuno, Sahoko; Kimura, Masatsugu; Liu, Peina; Isomura, Shin; Wang, Xingzhen; Kawamoto, Fumihiko

    1998-01-01

    By two PCR-based diagnostic methods, Plasmodium malariae infections have been rediscovered at two foci in the Sichuan province of China, a region where no cases of P. malariae have been officially reported for the last 2 decades. In addition, a variant form of P. malariae which has a deletion of 19 bp and seven substitutions of base pairs in the target sequence of the small-subunit (SSU) rRNA gene was detected with high frequency. Alignment analysis of Plasmodium sp. SSU rRNA gene sequences revealed that the 5′ region of the variant sequence is identical to that of P. vivax or P. knowlesi and its 3′ region is identical to that of P. malariae. The same sequence variations were also found in P. malariae isolates collected along the Thai-Myanmar border, suggesting a wide distribution of this variant form from southern China to Southeast Asia. PMID:9774600

  3. Panel of 23S rRNA Gene-Based Real-Time PCR Assays for Improved Universal and Group-Specific Detection of Phytoplasmas▿ †

    PubMed Central

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Dickinson, Matthew

    2009-01-01

    Primers and probes based on the 23S rRNA gene have been utilized to design a range of real-time PCR assays for routine phytoplasma diagnostics. These assays have been authenticated as phytoplasma specific and shown to be at least as sensitive as nested PCR. A universal assay to detect all phytoplasmas has been developed, along with a multiplex assay to discriminate 16SrI group phytoplasmas from members of all of the other 16Sr groups. Assays for the 16SrII, 16SrIV, and 16SrXII groups have also been developed to confirm that the 23S rRNA gene can be used to design group-specific assays. PMID:19270148

  4. Discrimination of Bacillus anthracis from closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microchips

    DOEpatents

    Bavykin, Sergei G.; Mirzabekov, Andrei D.

    2007-10-30

    The present invention is directed to a novel method of discriminating a highly infectious bacterium Bacillus anthracis from a group of closely related microorganisms. Sequence variations in the 16S and 23S rRNA of the B. cereus subgroup including B. anthracis are utilized to construct an array that can detect these sequence variations through selective hybridizations. The identification and analysis of these sequence variations enables positive discrimination of isolates of the B. cereus group that includes B. anthracis. Discrimination of single base differences in rRNA was achieved with a microchip during analysis of B. cereus group isolates from both single and in mixed probes, as well as identification of polymorphic sites. Successful use of a microchip to determine the appropriate subgroup classification using eight reference microorganisms from the B. cereus group as a study set, was demonstrated.

  5. Partial 16S rRNA primary structure of five Actinomyces species: phylogenetic implications and development of an Actinomyces israelii-specific oligonucleotide probe.

    PubMed

    Stackebrandt, E; Charfreitag, O

    1990-01-01

    The intra- and intergeneric relationships of the genus Actinomyces were determined by comparing long 16S rRNA sequences, generated by reverse transcriptase. All species formed a phylogenetically coherent cluster in which Actinomyces bovis, A. viscosus, A. naeslundii, A. odontolyticus and A. israelii constituted genetically well defined species. A. israelii DSM 43322 (serotype 2) was not closely related to three other strains of this species (serotype 1) and, as judged from phylogenetic distances, could be accommodated within A. naeslundii, or represent a new species. In contrast to previous findings, members of the genus Actinomyces appear to be related to Bifidobacterium bifidum. Sequence information was used to develop an oligonucleotide probe for the A. israelii serotype 1 strains, which did not react with the serotype 2 strain or with rRNA from strains of eight Actinomyces species.

  6. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  7. Molecular phylogenetics and systematics of the bivalve family Ostreidae based on rRNA sequence-structure models and multilocus species tree.

    PubMed

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.

  8. Nucleolar sub-compartments in motion during rRNA synthesis inhibition: Contraction of nucleolar condensed chromatin and gathering of fibrillar centers are concomitant

    PubMed Central

    Tchelidze, Pavel; Benassarou, Aassif; Kaplan, Hervé; O’Donohue, Marie-Françoise; Lucas, Laurent; Terryn, Christine; Rusishvili, Levan; Mosidze, Giorgi; Lalun, Nathalie

    2017-01-01

    The nucleolus produces the large polycistronic transcript (47S precursor) containing the 18S, 5.8S and 28S rRNA sequences and hosts most of the nuclear steps of pre-rRNA processing. Among numerous components it contains condensed chromatin and active rRNA genes which adopt a more accessible conformation. For this reason, it is a paradigm of chromosome territory organization. Active rRNA genes are clustered within several fibrillar centers (FCs), in which they are maintained in an open configuration by Upstream Binding Factor (UBF) molecules. Here, we used the reproducible reorganization of nucleolar components induced by the inhibition of rRNA synthesis by Actinomycin D (AMD) to address the steps of the spatiotemporal reorganization of FCs and nucleolar condensed chromatin. To reach that goal, we used two complementary approaches: i) time-lapse confocal imaging of cells expressing one or several GFP-tagged proteins (fibrillarin, UBF, histone H2B) and ii) ultrastructural identification of nucleolar components involved in the reorganization. Data obtained by time lapse confocal microscopy were analyzed through detailed 3D imaging. This allowed us to demonstrate that AMD treatment induces no fusion and no change in the relative position of the different nucleoli contained in one nucleus. In contrast, for each nucleolus, we observed step by step gathering and fusion of both FCs and nucleolar condensed chromatin. To analyze the reorganization of FCs and condensed chromatin at a higher resolution, we performed correlative light and electron microscopy electron microscopy (CLEM) imaging of the same cells. We demonstrated that threads of intranucleolar condensed chromatin are localized in a complex 3D network of vacuoles. Upon AMD treatment, these structures coalesce before migrating toward the perinucleolar condensed chromatin, to which they finally fuse. During their migration, FCs, which are all linked to ICC, are pulled by the latter to gather as caps disposed at the

  9. Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

    PubMed

    Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

    2010-04-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

  10. Microbial community profiling of fresh basil and pitfalls in taxonomic assignment of enterobacterial pathogenic species based upon 16S rRNA amplicon sequencing.

    PubMed

    Ceuppens, Siele; De Coninck, Dieter; Bottledoorn, Nadine; Van Nieuwerburgh, Filip; Uyttendaele, Mieke

    2017-09-18

    Application of 16S rRNA (gene) amplicon sequencing on food samples is increasingly applied for assessing microbial diversity but may as unintended advantage also enable simultaneous detection of any human pathogens without a priori definition. In the present study high-throughput next-generation sequencing (NGS) of the V1-V2-V3 regions of the 16S rRNA gene was applied to identify the bacteria present on fresh basil leaves. However, results were strongly impacted by variations in the bioinformatics analysis pipelines (MEGAN, SILVAngs, QIIME and MG-RAST), including the database choice (Greengenes, RDP and M5RNA) and the annotation algorithm (best hit, representative hit and lowest common ancestor). The use of pipelines with default parameters will lead to discrepancies. The estimate of microbial diversity of fresh basil using 16S rRNA (gene) amplicon sequencing is thus indicative but subject to biases. Salmonella enterica was detected at low frequencies, between 0.1% and 0.4% of bacterial sequences, corresponding with 37 to 166 reads. However, this result was dependent upon the pipeline used: Salmonella was detected by MEGAN, SILVAngs and MG-RAST, but not by QIIME. Confirmation of Salmonella sequences by real-time PCR was unsuccessful. It was shown that taxonomic resolution obtained from the short (500bp) sequence reads of the 16S rRNA gene containing the hypervariable regions V1-V3 cannot allow distinction of Salmonella with closely related enterobacterial species. In conclusion 16S amplicon sequencing, getting the status of standard method in microbial ecology studies of foods, needs expertise on both bioinformatics and microbiology for analysis of results. It is a powerful tool to estimate bacterial diversity but amenable to biases. Limitations concerning taxonomic resolution for some bacterial species or its inability to detect sub-dominant (pathogenic) species should be acknowledged in order to avoid overinterpretation of results. Copyright © 2017 Elsevier B

  11. PICT-1 triggers a pro-death autophagy through inhibiting rRNA transcription and AKT/mTOR/p70S6K signaling pathway.

    PubMed

    Chen, Hongbo; Duo, Yanhong; Hu, Bo; Wang, Zhiwei; Zhang, Fang; Tsai, Hsiangi; Zhang, Jianping; Zhou, Lanzhen; Wang, Lijun; Wang, Xinyu; Huang, Laiqiang

    2016-11-29

    PICT-1 was originally identified as a tumor suppressor. Here, we found that PICT-1 overexpression triggered pro-death autophagy without nucleolar disruption or p53 accumulation in U251 and MCF7 cells. Truncated PICT-1 fragments 181-346 and 1-346, which partly or totally lack nucleolar localization, showed weaker autophagy-inducing effects than full-length PICT-1 and a well-defined nucleolar mutant (181-479). Furthermore, PICT-1 partly localizes to the nucleolar fibrillar center (FC) and directly binds to ribosomal DNA (rDNA) gene loci, where it interacts with upstream binding factor (UBF). Overexpression of PICT-1 or the 181-479 mutant, but not the 1-346 or 181-346 mutants, markedly inhibited the phosphorylation of UBF and the recruitment of rRNA polymerase I (Pol I) to the rDNA promoter in response to serum stimulation, thereby suppressing rRNA transcription, suggesting that rRNA transcription inhibition might be an important contributor to PICT-1-induced autophagy. This is supported by the finding that CX-5461, a specific Pol I inhibitor, also induced autophagy. In addition, both CX-5461 and PICT-1, but not the 1-346 or 181-346 mutants, significantly suppressed the activation of the Akt/mTOR/p70S6K signaling pathway. Our data show that PICT-1 triggers pro-death autophagy through inhibition of rRNA transcription and the inactivation of AKT/mTOR/p70S6K pathway, independent of nucleolar disruption and p53 activation.

  12. Nucleolus-like bodies of fully-grown mouse oocytes contain key nucleolar proteins but are impoverished for rRNA.

    PubMed

    Shishova, Kseniya V; Lavrentyeva, Elena A; Dobrucki, Jurek W; Zatsepina, Olga V

    2015-01-15

    It is well known that fully-grown mammalian oocytes, rather than typical nucleoli, contain prominent but structurally homogenous bodies called "nucleolus-like bodies" (NLBs). NLBs accumulate a vast amount of material, but their biochemical composition and functions remain uncertain. To clarify the composition of the NLB material in mouse GV oocytes, we devised an assay to detect internal oocyte proteins with fluorescein-5-isothiocyanate (FITC) and applied the fluorescent RNA-binding dye acridine orange to examine whether NLBs contain RNA. Our results unequivocally show that, similarly to typical nucleoli, proteins and RNA are major constituents of transcriptionally active (or non-surrounded) NLBs as well as of transcriptionally silent (or surrounded) NLBs. We also show, by exposing fixed oocytes to a mild proteinase K treatment, that the NLB mass in oocytes of both types contains nucleolar proteins that are involved in all major steps of ribosome biogenesis, including rDNA transcription (UBF), early rRNA processing (fibrillarin), and late rRNA processing (NPM1/nucleophosmin/B23, nucleolin/C23), but none of the nuclear proteins tested, including SC35, NOBOX, topoisomerase II beta, HP1α, and H3. The ribosomal RPL26 protein was detected within the NLBs of NSN-type oocytes but is virtually absent from NLBs of SN-type oocytes. Taking into account that the major class of nucleolar RNA is ribosomal RNA (rRNA), we applied fluorescence in situ hybridization with oligonucleotide probes targeting 18S and 28S rRNAs. The results show that, in contrast to active nucleoli, NLBs of fully-grown oocytes are impoverished for the rRNAs, which is consistent with the absence of transcribed ribosomal genes in the NLB mass. Overall, the results of this study suggest that NLBs of fully-grown mammalian oocytes serve for storing major nucleolar proteins but not rRNA. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Microbial Diversity in Commercial Bee Pollen from Europe, Chile, and Mexico, Based on 16S rRNA Gene Amplicon Metagenome Sequencing.

    PubMed

    Moreno Andrade, Vicente D; Saldaña Gutiérrez, Carlos; Calvillo Medina, Rosa P; Cruz Hérnandez, Andrés; Vázquez Cruz, Moisés A; Torres Ruíz, Alfonso; Romero Gómez, Sergio; Ramos López, Miguel A; Álvarez-Hidalgo, Erika; López-Gaytan, Silvia B; Ramírez, Natanahel Salvador; Jones, George H; Hernandez-Flores, Jose Luis; Campos-Guillén, Juan

    2018-05-17

    Bee pollen is a highly nutritive natural foodstuff. Because of its use as a comestible, the association of bacteria with bee pollen is commercially and biologically important. We report here the bacterial diversity of seven bee pollen samples (five from Europe, one from Chile, and one from Mexico) based on 16S rRNA gene amplicon metagenome sequencing. Copyright © 2018 Moreno Andrade et al.

  14. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    PubMed

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  15. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing

    PubMed Central

    Mehetre, Gajanan T.; Paranjpe, Aditi; Dastager, Syed G.

    2016-01-01

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. PMID:26950332

  16. Characterization of the two intra-individual sequence variants in the 18S rRNA gene in the plant parasitic nematode, Rotylenchulus reniformis.

    PubMed

    Nyaku, Seloame T; Sripathi, Venkateswara R; Kantety, Ramesh V; Gu, Yong Q; Lawrence, Kathy; Sharma, Govind C

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene.

  17. Characterization of the Two Intra-Individual Sequence Variants in the 18S rRNA Gene in the Plant Parasitic Nematode, Rotylenchulus reniformis

    PubMed Central

    Nyaku, Seloame T.; Sripathi, Venkateswara R.; Kantety, Ramesh V.; Gu, Yong Q.; Lawrence, Kathy; Sharma, Govind C.

    2013-01-01

    The 18S rRNA gene is fundamental to cellular and organismal protein synthesis and because of its stable persistence through generations it is also used in phylogenetic analysis among taxa. Sequence variation in this gene within a single species is rare, but it has been observed in few metazoan organisms. More frequently it has mostly been reported in the non-transcribed spacer region. Here, we have identified two sequence variants within the near full coding region of 18S rRNA gene from a single reniform nematode (RN) Rotylenchulus reniformis labeled as reniform nematode variant 1 (RN_VAR1) and variant 2 (RN_VAR2). All sequences from three of the four isolates had both RN variants in their sequences; however, isolate 13B had only RN variant 2 sequence. Specific variable base sites (96 or 5.5%) were found within the 18S rRNA gene that can clearly distinguish the two 18S rDNA variants of RN, in 11 (25.0%) and 33 (75.0%) of the 44 RN clones, for RN_VAR1 and RN_VAR2, respectively. Neighbor-joining trees show that the RN_VAR1 is very similar to the previously existing R. reniformis sequence in GenBank, while the RN_VAR2 sequence is more divergent. This is the first report of the identification of two major variants of the 18S rRNA gene in the same single RN, and documents the specific base variation between the two variants, and hypothesizes on simultaneous co-existence of these two variants for this gene. PMID:23593343

  18. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment.

    PubMed

    Oh, Jeongsu; Choi, Chi-Hwan; Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology-a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in JAVA

  19. First Report of the 23S rRNA Gene A2058G Point Mutation Associated With Macrolide Resistance in Treponema pallidum From Syphilis Patients in Cuba.

    PubMed

    Noda, Angel A; Matos, Nelvis; Blanco, Orestes; Rodríguez, Islay; Stamm, Lola Virginia

    2016-05-01

    This study aimed to assess the presence of macrolide-resistant Treponema pallidum subtypes in Havana, Cuba. Samples from 41 syphilis patients were tested for T. pallidum 23S rRNA gene mutations. Twenty-five patients (61%) harbored T. pallidum with the A2058G mutation, which was present in all 8 subtypes that were identified. The A2059G mutation was not detected.

  20. Rapid detection of rRNA group I pseudomonads in contaminated metalworking fluids and biofilm formation by fluorescent in situ hybridization.

    PubMed

    Saha, Ratul; Donofrio, Robert S; Goeres, Darla M; Bagley, Susan T

    2012-05-01

    Metalworking fluids (MWFs), used in different machining operations, are highly prone to microbial degradation. Microbial communities present in MWFs lead to biofilm formation in the MWF systems, which act as a continuous source of contamination. Species of rRNA group I Pseudomonas dominate in contaminated MWFs. However, their actual distribution is typically underestimated when using standard culturing techniques as most fail to grow on the commonly used Pseudomonas Isolation Agar. To overcome this, fluorescent in situ hybridization (FISH) was used to study their abundance along with biofilm formation by two species recovered from MWFs, Pseudomonas fluorescens MWF-1 and the newly described Pseudomonas oleovorans subsp. lubricantis. Based on 16S rRNA sequences, a unique fluorescent molecular probe (Pseudo120) was designed targeting a conserved signature sequence common to all rRNA group I Pseudomonas. The specificity of the probe was evaluated using hybridization experiments with whole cells of different Pseudomonas species. The probe's sensitivity was determined to be 10(3) cells/ml. It successfully detected and enumerated the abundance and distribution of Pseudomonas indicating levels between 3.2 (± 1.1) × 10(6) and 5.0 (± 2.3) × 10(6) cells/ml in four different industrial MWF samples collected from three different locations. Biofilm formation was visualized under stagnant conditions using high and low concentrations of cells for both P. fluorescens MWF-1 and P. oleovorans subsp. lubricantis stained with methylene blue and Pseudo120. On the basis of these observations, this molecular probe can be successfully be used in the management of MWF systems to monitor the levels and biofilm formation of rRNA group I pseudomonads.

  1. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    PubMed

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  2. Investigation of Microbial Diversity in Geothermal Hot Springs in Unkeshwar, India, Based on 16S rRNA Amplicon Metagenome Sequencing.

    PubMed

    Mehetre, Gajanan T; Paranjpe, Aditi; Dastager, Syed G; Dharne, Mahesh S

    2016-02-25

    Microbial diversity in geothermal waters of the Unkeshwar hot springs in Maharashtra, India, was studied using 16S rRNA amplicon metagenomic sequencing. Taxonomic analysis revealed the presence of Bacteroidetes, Proteobacteria, Cyanobacteria, Actinobacteria, Archeae, and OD1 phyla. Metabolic function prediction analysis indicated a battery of biological information systems indicating rich and novel microbial diversity, with potential biotechnological applications in this niche. Copyright © 2016 Mehetre et al.

  3. Diversity and distribution of 16S rRNA and phenol monooxygenase genes in the rhizosphere and endophytic bacteria isolated from PAH-contaminated sites

    NASA Astrophysics Data System (ADS)

    Peng, Anping; Liu, Juan; Ling, Wanting; Chen, Zeyou; Gao, Yanzheng

    2015-07-01

    This is the first investigation of the diversity and distribution of 16S rRNA and phenol monooxygenase (PHE) genes in endophytic and rhizosphere bacteria of plants at sites contaminated with different levels of PAHs. Ten PAHs at concentrations from 34.22 to 55.29 and 45.79 to 97.81 mg·kg-1 were measured in rhizosphere soils of Alopecurus aequalis Sobol and Oxalis corniculata L., respectively. The diversity of 16S rRNA and PHE genes in rhizosphere soils or plants changed with varying PAH pollution levels, as shown based on PCR-DGGE data. Generally, higher Shannon-Weiner indexes were found in mild or moderate contaminated areas. A total of 82 different bacterial 16S rRNA gene sequences belonging to five phyla; namely, Acfinobacteria, Proteobacteria, Chloroflexi, Cyanophyta, and Bacteroidetes, were obtained from rhizosphere soils. For the 57 identified PHE gene sequences, 18 were excised from rhizosphere bacteria and 39 from endophytic bacteria. The copy numbers of 16S rRNA and PHE genes in rhizosphere and endophytic bacteria varied from 3.83 × 103 to 2.28 × 106 and 4.17 × 102 to 1.99 × 105, respectively. The copy numbers of PHE genes in rhizosphere bacteria were significantly higher than in endophytic bacteria. Results increase our understanding of the diversity of rhizosphere and endophytic bacteria from plants grown in PAH-contaminated sites.

  4. The avilamycin resistance determinants AviRa and AviRb methylate 23S rRNA at the guanosine 2535 base and the uridine 2479 ribose.

    PubMed

    Treede, Irina; Jakobsen, Lene; Kirpekar, Finn; Vester, Birte; Weitnauer, Gabriele; Bechthold, Andreas; Douthwaite, Stephen

    2003-07-01

    Avilamycin is an orthosomycin antibiotic that has shown considerable potential for clinical use, although it is presently used as a growth promoter in animal feed. Avilamycin inhibits bacterial protein synthesis by binding to the 50S ribosomal subunit. The ribosomes of the producer strain, Streptomyces viridochromogenes Tü57, are protected from the drug by the action of three resistance factors located in the avilamycin biosynthetic gene cluster. Two of the resistance factors, aviRa and aviRb, encode rRNA methyltransferases that specifically target 23S rRNA. Recombinant AviRa and AviRb proteins retain their activity after purification, and both specifically methylate in vitro transcripts of 23S rRNA domain V. Reverse transcriptase primer extension indicated that AviRa is an N-methyltransferase that targets G2535 within helix 91 of the rRNA, whereas AviRb modified the 2'-O-ribose position of nucleotide U2479 within helix 89. MALDI mass spectrometry confirmed the exact positions of each of these modifications, and additionally established that a single methyl group is added at each nucleotide. Neither of these two nucleotides have previously been described as a target for enzymatic methylation. Molecular models of the 50S subunit crystal structure show that the N-1 of the G2535 base and the 2'-hydroxyl of U2479 are separated by approximately 10 A, a distance that can be spanned by avilamycin. In addition to defining new resistance mechanisms, these data refine our understanding of the probable ribosome contacts made by orthosomycins and of how these antibiotics inhibit protein synthesis.

  5. Crystal Structure of the Escherichia coli 23S rRNA: m{5}C Methyltransferase RlmI (YccW) Reveals Evolutionary Links Between RNA Modification Enzymes

    SciTech Connect

    Sunita, S.; Tkaczuk, K; Purta, E

    2008-01-01

    Methylation is the most common RNA modification in the three domains of life. Transfer of the methyl group from S-adenosyl-l-methionine (AdoMet) to specific atoms of RNA nucleotides is catalyzed by methyltransferase (MTase) enzymes. The rRNA MTase RlmI (rRNA large subunit methyltransferase gene I; previously known as YccW) specifically modifies Escherichia coli 23S rRNA at nucleotide C1962 to form 5-methylcytosine. Here, we report the crystal structure of RlmI refined at 2 {angstrom} to a final R-factor of 0.194 (R{sub free} = 0.242). The RlmI molecule comprises three domains: the N-terminal PUA domain; the central domain, which resembles a domain previously foundmore » in RNA:5-methyluridine MTases; and the C-terminal catalytic domain, which contains the AdoMet-binding site. The central and C-terminal domains are linked by a {Beta}-hairpin structure that has previously been observed in several MTases acting on nucleic acids or proteins. Based on bioinformatics analyses, we propose a model for the RlmI-AdoMet-RNA complex. Comparative structural analyses of RlmI and its homologs provide insight into the potential function of several structures that have been solved by structural genomics groups and furthermore indicate that the evolutionary paths of RNA and DNA 5-methyluridine and 5-methylcytosine MTases have been closely intertwined.« less

  6. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    PubMed

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  7. Verification of clinical samples, positive in AMPLICOR Neisseria gonorrhoeae polymerase chain reaction, by 16S rRNA and gyrA compared with culture.

    PubMed

    Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt

    2005-06-01

    We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.

  8. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5′ UTRs and its implications for eukaryotic gene translation regulation

    PubMed Central

    Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš

    2013-01-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757

  9. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

    PubMed

    Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

    2002-10-15

    Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

  10. Identification of Entamoeba polecki with Unique 18S rRNA Gene Sequences from Celebes Crested Macaques and Pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia.

    PubMed

    Tuda, Josef; Feng, Meng; Imada, Mihoko; Kobayashi, Seiki; Cheng, Xunjia; Tachibana, Hiroshi

    2016-09-01

    Unique species of macaques are distributed across Sulawesi Island, Indonesia, and the details of Entamoeba infections in these macaques are unknown. A total of 77 stool samples from Celebes crested macaques (Macaca nigra) and 14 stool samples from pigs were collected in Tangkoko Nature Reserve, North Sulawesi, and the prevalence of Entamoeba infection was examined by PCR. Entamoeba polecki was detected in 97% of the macaques and all of the pigs, but no other Entamoeba species were found. The nucleotide sequence of the 18S rRNA gene in E. polecki from M. nigra was unique and showed highest similarity with E. polecki subtype (ST) 4. This is the first case of identification of E. polecki ST4 from wild nonhuman primates. The sequence of the 18S rRNA gene in E. polecki from pigs was also unique and showed highest similarity with E. polecki ST1. These results suggest that the diversity of the 18S rRNA gene in E. polecki is associated with differences in host species and geographic localization, and that there has been no transmission of E. polecki between macaques and pigs in the study area. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  11. Use of rpoB gene analysis for identification of nitrogen-fixing Paenibacillus species as an alternative to the 16S rRNA gene.

    PubMed

    da Mota, F F; Gomes, E A; Paiva, E; Rosado, A S; Seldin, L

    2004-01-01

    To avoid the limitations of 16S rRNA-based phylogenetic analysis for Paenibacillus species, the usefulness of the RNA polymerase beta-subunit encoding gene (rpoB) was investigated as an alternative to the 16S rRNA gene for taxonomic studies. Partial rpoB sequences were generated for the type strains of eight nitrogen-fixing Paenibacillus species. The presence of only one copy of rpoB in the genome of P. graminis strain RSA19(T) was demonstrated by denaturing gradient gel electrophoresis and hybridization assays. A comparative analysis of the sequences of the 16S rRNA and rpoB genes was performed and the eight species showed between 91.6-99.1% (16S rRNA) and 77.9-97.3% (rpoB) similarity, allowing a more accurate discrimination between the different species using the rpoB gene. Finally, 24 isolates from the rhizosphere of different cultivars of maize previously identified as Paenibacillus spp. were assigned correctly to one of the nitrogen-fixing species. The data obtained in this study indicate that rpoB is a powerful identification tool, which can be used for the correct discrimination of the nitrogen-fixing species of agricultural and industrial importance within the genus Paenibacillus.

  12. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

    PubMed

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-12-31

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

  13. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    PubMed Central

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification. PMID:21347215

  14. Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

    NASA Astrophysics Data System (ADS)

    Hidayat, Habibi

    2017-03-01

    16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

  15. Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

    PubMed

    Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

    2018-03-09

    Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Crystal structure of RlmAI: Implications for understanding the 23S rRNA G745/G748-methylation at the macrolide antibiotic-binding site

    PubMed Central

    Das, Kalyan; Acton, Thomas; Chiang, Yiwen; Shih, Lydia; Arnold, Eddy; Montelione, Gaetano T.

    2004-01-01

    The RlmA class of enzymes (RlmAI and RlmAII) catalyzes N1-methylation of a guanine base (G745 in Gram-negative and G748 in Gram-positive bacteria) of hairpin 35 of 23S rRNA. We have determined the crystal structure of Escherichia coli RlmAI at 2.8-Å resolution, providing 3D structure information for the RlmA class of RNA methyltransferases. The dimeric protein structure exhibits features that provide new insights into its molecular function. Each RlmAI molecule has a Zn-binding domain, responsible for specific recognition and binding of its rRNA substrate, and a methyltransferase domain. The asymmetric RlmAI dimer observed in the crystal structure has a well defined W-shaped RNA-binding cleft. Two S-adenosyl-l-methionine substrate molecules are located at the two valleys of the W-shaped RNA-binding cleft. The unique shape of the RNA-binding cleft, different from that of known RNA-binding proteins, is highly specific and structurally complements the 3D structure of hairpin 35 of bacterial 23S rRNA. Apart from the hairpin 35, parts of hairpins 33 and 34 also interact with the RlmAI dimer. PMID:14999102

  17. Deciphering chicken gut microbial dynamics based on high-throughput 16S rRNA metagenomics analyses.

    PubMed

    Mohd Shaufi, Mohd Asrore; Sieo, Chin Chin; Chong, Chun Wie; Gan, Han Ming; Ho, Yin Wan

    2015-01-01

    Chicken gut microbiota has paramount roles in host performance, health and immunity. Understanding the topological difference in gut microbial community composition is crucial to provide knowledge on the functions of each members of microbiota to the physiological maintenance of the host. The gut microbiota profiling of the chicken was commonly performed previously using culture-dependent and early culture-independent methods which had limited coverage and accuracy. Advances in technology based on next-generation sequencing (NGS), offers unparalleled coverage and depth in determining microbial gut dynamics. Thus, the aim of this study was to investigate the ileal and caecal microbiota development as chicken aged, which is important for future effective gut modulation. Ileal and caecal contents of broiler chicken were extracted from 7, 14, 21 and 42-day old chicken. Genomic DNA was then extracted and amplified based on V3 hyper-variable region of 16S rRNA. Bioinformatics, ecological and statistical analyses such as Principal Coordinate Analysis (PCoA) was performed in mothur software and plotted using PRIMER 6. Additional analyses for predicted metagenomes were performed through PICRUSt and STAMP software package based on Greengenes databases. A distinctive difference in bacterial communities was observed between ilea and caeca as the chicken aged (P < 0.001). The microbial communities in the caeca were more diverse in comparison to the ilea communities. The potentially pathogenic bacteria such as Clostridium were elevated as the chicken aged and the population of beneficial microbe such as Lactobacillus was low at all intervals. On the other hand, based on predicted metagenomes analysed, clear distinction in functions and roles of gut microbiota such as gene pathways related to nutrient absorption (e.g. sugar and amino acid metabolism), and bacterial proliferation and colonization (e.g. bacterial motility proteins, two-component system and bacterial secretion

  18. Skeletal muscle plasticity induced by seasonal acclimatization in carp involves differential expression of rRNA and molecules that epigenetically regulate its synthesis.

    PubMed

    Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco

    2014-01-01

    Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    PubMed

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  20. Relative expression of rRNA transcripts and 45S rDNA promoter methylation status are dysregulated in tumors in comparison with matched-normal tissues in breast cancer.

    PubMed

    Karahan, Gurbet; Sayar, Nilufer; Gozum, Gokcen; Bozkurt, Betul; Konu, Ozlen; Yulug, Isik G

    2015-06-01

    Ribosomal RNA (rRNA) expression, one of the most important factors regulating ribosome production, is primarily controlled by a CG-rich 45 S rDNA promoter. However, the DNA methylation state of the 45 S rDNA promoter, as well as its effect on rRNA gene expression in types of human cancers is controversial. In the present study we analyzed the methylation status of the rDNA promoter (-380 to +53 bp) as well as associated rRNA expression levels in breast cancer cell lines and breast tumor-normal tissue pairs. We found that the aforementioned regulatory region was extensively methylated (74-96%) in all cell lines and in 68% (13/19 tumor-normal pairs) of the tumors. Expression levels of rRNA transcripts 18 S, 28 S, 5.8 S and 45 S external transcribed spacer (45 S ETS) greatly varied in the breast cancer cell lines regardless of their methylation status. Analyses of rRNA transcript expression levels in the breast tumor and normal matched tissues showed no significant difference when normalized with TBP. On the other hand, using the geometric mean of the rRNA expression values (GM-rRNA) as reference enabled us to identify significant changes in the relative expression of rRNAs in the tissue samples. We propose GM-rRNA normalization as a novel strategy to analyze expression differences between rRNA transcripts. Accordingly, the 18S rRNA/GM-rRNA ratio was significantly higher whereas the 5.8S rRNA/GM-rRNA ratio was significantly lower in breast tumor samples than this ratio in the matched normal samples. Moreover, the 18S rRNA/GM-rRNA ratio was negatively correlated with the 45 S rDNA promoter methylation level in the normal breast tissue samples, yet not in the breast tumors. Significant correlations observed between the expression levels of rRNA transcripts in the normal samples were lost in the tumor samples. We showed that the expression of rRNA transcripts may not be based solely on promoter methylation. Carcinogenesis may cause dysregulation of the correlation

  1. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  2. La Deletion from Mouse Brain Alters Pre-tRNA Metabolism and Accumulation of Pre-5.8S rRNA, with Neuron Death and Reactive Astrocytosis

    PubMed Central

    Blewett, Nathan H.; Iben, James R.; Gaidamakov, Sergei

    2017-01-01

    ABSTRACT Human La antigen (Sjögren's syndrome antigen B [SSB]) is an abundant multifunctional RNA-binding protein. In the nucleoplasm, La binds to and protects from 3′ exonucleases, the ends of precursor tRNAs, and other transcripts synthesized by RNA polymerase III and facilitates their maturation, while a nucleolar isoform has been implicated in rRNA biogenesis by multiple independent lines of evidence. We showed previously that conditional La knockout (La cKO) from mouse cortex neurons results in defective tRNA processing, although the pathway(s) involved in neuronal loss thereafter was unknown. Here, we demonstrate that La is stably associated with a spliced pre-tRNA intermediate. Microscopic evidence of aberrant nuclear accumulation of 5.8S rRNA in La cKO is supported by a 10-fold increase in a pre-5.8S rRNA intermediate. To identify pathways involved in subsequent neurodegeneration and loss of brain mass in the cKO cortex, we employed mRNA sequencing (mRNA-Seq), immunohistochemistry, and other approaches. This revealed robust enrichment of immune and astrocyte reactivity in La cKO cortex. Immunohistochemistry, including temporal analyses, demonstrated neurodegeneration, followed by astrocyte invasion associated with immune response and decreasing cKO cortex size over time. Thus, deletion of La from postmitotic neurons results in defective pre-tRNA and pre-rRNA processing and progressive neurodegeneration with loss of cortical brain mass. PMID:28223366

  3. Occurrence of Acquired 16S rRNA Methyltransferase-Mediated Aminoglycoside Resistance in Clinical Isolates of Enterobacteriaceae within a Tertiary Referral Hospital of Northeast India

    PubMed Central

    Wangkheimayum, Jayalaxmi; Paul, Deepjyoti; Dhar, Debadatta; Nepram, Rajlakshmi; Chetri, Shiela; Bhowmik, Deepshikha; Chakravarty, Atanu

    2017-01-01

    ABSTRACT The methylation of a ribosomal target leads to a high level of resistance to all clinically relevant aminoglycoside antibiotics, so early detection of these resistance determinants will help to reduce the incidence of treatment failures as well as lessen the dissemination rate. Here, we characterized different 16S rRNA methyltransferases responsible for aminoglycoside resistance and their epidemiological background in clinical isolates of Enterobacteriaceae in a tertiary referral hospital in India. All aminoglycoside-resistant isolates were screened for different 16S rRNA methyltransferases by PCR assay, and incompatibility typing of the conjugable plasmid harboring resistance genes was performed by PCR-based replicon typing. An assay for the stability and elimination of these resistance plasmids was performed. The coexistence of extended-spectrum β-lactamases and metallo-β-lactamases was also detected, and the heterogeneity of these isolates was determined by enterobacterial repetitive intergenic consensus PCR. The PCR assay revealed the presence of armA, rmtA, rmtB, rmtC, and rmtD in single and multiple combinations, and these were carried by a diverse group of Inc plasmids. Plasmids harboring these resistance determinants were highly stable and maintained until the 55th serial passage, but SDS treatment could easily eliminate the plasmids harboring the resistance determinants. The coexistence of blaTEM, blaPER, blaGES, and blaSHV, as well as blaVIM and blaNDM, within these isolates was also detected. Strains with different clonal patterns of aminoglycoside resistance were found to spread in this hospital setting. We observed that the 16S rRNA methyltransferase genes were encoded within different Inc plasmid types, suggesting diverse origins and sources of acquisition. Therefore, the present study is of epidemiological importance and can have a role in infection control policy in hospital settings. PMID:28320725

  4. Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

    PubMed

    Mundus, D; Wollenzien, P

    1998-11-01

    Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was derivitized with azidophenacylbromide (APAB) resulting in the photoreactive azido moiety at a maximum of 25 A from the 4' position on psoralen (SSP25APA). 16S rRNA containing SSP, SSP25APA or control 16S rRNA were reconstituted and 30S particles were isolated. The reconstituted subunits containing SSP or SSP25APA had normal protein composition, were active in tRNA binding and had the usual pattern of chemical reactivity except for increased kethoxal reactivity at G791 and modest changes in four other regions. Irradiation of the derivatized 30S subunits in activation buffer produced several intramolecular RNA crosslinks that were visualized and separated by gel electrophoresis and characterized by primer extension. Four major crosslink sites made by the SSP reagent were identified at positions U561/U562, U920/U921, C866 and U723; a fifth major crosslink at G693 was identified when the SSP25APA reagent was used. A number of additional crosslinks of lower frequency were seen, particularly with the APA reagent. These data indicate a central location close to the decoding region and central pseudoknot for nucleotides U788/U789 in the activated 30S subunit.

  5. Binding of the 3' terminus of tRNA to 23S rRNA in the ribosomal exit site actively promotes translocation.

    PubMed Central

    Lill, R; Robertson, J M; Wintermeyer, W

    1989-01-01

    A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120

  6. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  7. Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial.

    PubMed

    Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul

    2018-04-01

    Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.

  8. Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial

    PubMed Central

    Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R.; Kelly, Paul

    2018-01-01

    Abstract. Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower (P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased (P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS. PMID:29436337

  9. Biphasic Study to Characterize Agricultural Biogas Plants by High-Throughput 16S rRNA Gene Amplicon Sequencing and Microscopic Analysis.

    PubMed

    Maus, Irena; Kim, Yong Sung; Wibberg, Daniel; Stolze, Yvonne; Off, Sandra; Antonczyk, Sebastian; Pühler, Alfred; Scherer, Paul; Schlüter, Andreas

    2017-02-28

    Process surveillance within agricultural biogas plants (BGPs) was concurrently studied by high-throughput 16S rRNA gene amplicon sequencing and an optimized quantitative microscopic fingerprinting (QMF) technique. In contrast to 16S rRNA gene amplicons, digitalized microscopy is a rapid and cost-effective method that facilitates enumeration and morphological differentiation of the most significant groups of methanogens regarding their shape and characteristic autofluorescent factor 420. Moreover, the fluorescence signal mirrors cell vitality. In this study, four different BGPs were investigated. The results indicated stable process performance in the mesophilic BGPs and in the thermophilic reactor. Bacterial subcommunity characterization revealed significant differences between the four BGPs. Most remarkably, the genera Defluviitoga and Halocella dominated the thermophilic bacterial subcommunity, whereas members of another taxon, Syntrophaceticus , were found to be abundant in the mesophilic BGP. The domain Archaea was dominated by the genus Methanoculleus in all four BGPs, followed by Methanosaeta in BGP1 and BGP3. In contrast, Methanothermobacter members were highly abundant in the thermophilic BGP4. Furthermore, a high consistency between the sequencing approach and the QMF method was shown, especially for the thermophilic BGP. The differences elucidated that using this biphasic approach for mesophilic BGPs provided novel insights regarding disaggregated single cells of Methanosarcina and Methanosaeta species. Both dominated the archaeal subcommunity and replaced coccoid Methanoculleus members belonging to the same group of Methanomicrobiales that have been frequently observed in similar BGPs. This work demonstrates that combining QMF and 16S rRNA gene amplicon sequencing is a complementary strategy to describe archaeal community structures within biogas processes.

  10. Comparison of reduced metagenome and 16S rRNA gene sequencing for determination of genetic diversity and mother-child overlap of the gut associated microbiota.

    PubMed

    Ravi, Anuradha; Avershina, Ekaterina; Angell, Inga Leena; Ludvigsen, Jane; Manohar, Prasanth; Padmanaban, Sumathi; Nachimuthu, Ramesh; Snipen, Lars; Rudi, Knut

    2018-06-01

    Use of the 16S rRNA gene in microbiota studies is limited by the lack of taxonomic and functional resolution. High resolution analyses are particularly important for understanding transmission and persistence of bacteria. The aim of our work was therefore to compare a novel reduced metagenome sequencing (RMS) approach with 16S rRNA gene sequencing to determine both the metagenome genetic diversity and the mother-to-child sharing of the microbiota in a cohort of 17 mother-child pairs. We found that although both approaches gave comparable results with respect to sample separation and taxonomy, RMS gave higher resolution and the potential for genomic-/functional assignment. Using RMS we estimated that the metagenome size increased from about 60 Mbp for 4-day-old children to about 225 Mbp for mothers. The 4-day-old children shared 7% of the metagenome sequences with the mothers, while the metagenome sequence sharing was >30% among the mothers. We found 15 genomes shared across >50% of the mothers, of which 10 belonged to Clostridia. Only Bacteroides showed a direct mother-child association, with B. vulgatus being abundant in both 4-day-old children and mothers. For the functional assignments, we identified a significant association between antibiotic usage during labor, and quantity of Fosfomycin resistance genes. In conclusion, our results show a higher functional and taxonomic resolution for RMS compared to 16S rRNA gene sequencing, where RMS enabled a detailed description of mother to child gut microbiota transmission - supporting a late recruitment of most gut bacteria and an effect of antibiotic treatment during labor on infant antibiotic resistance gene patterns. Copyright © 2018. Published by Elsevier B.V.

  11. Resistance mechanisms of linezolid-nonsusceptible enterococci in Korea: low rate of 23S rRNA mutations in Enterococcus faecium.

    PubMed

    Lee, Sae-Mi; Huh, Hee Jae; Song, Dong Joon; Shim, Hyang Jin; Park, Kyung Sun; Kang, Cheol-In; Ki, Chang-Seok; Lee, Nam Yong

    2017-12-01

    To investigate linezolid-resistance mechanisms in linezolid-nonsusceptible enterococci (LNSE) isolated from a tertiary hospital in Korea. Enterococcal isolates exhibiting linezolid MICs ≥4 mg l -1 that were isolated between December 2011 and May 2016 were investigated by PCR and sequencing for mutations in 23S rRNA or ribosomal proteins (L3, L4 and L22) and for the presence of cfr, cfr(B) and optrA genes.Results/Key findings. Among 135 LNSE (87 Enterococcus faecium and 48 Enterococcus faecalis isolates), 39.1 % (34/87) of E. faecium and 18.8 % (9/48) of E. faecalis isolates were linezolid-resistant. The optrA carriage was the dominant mechanism in E. faecalis: 13 isolates, including 10 E. faecalis [70 % (7/10) linezolid-resistant and 30 % (3/10) linezolid-intermediate] and three E. faecium [33.3 % (1/3) linezolid-resistant and 66.7 % (2/3) linezolid-intermediate], contained the optrA gene. G2576T mutations in the 23S rRNA gene were detected only in E. faecium [14 isolates; 71.4 % (10/14) linezolid-resistant and 28.6 % (4/14) linezolid-intermediate]. One linezolid-intermediate E. faecium harboured a L22 protein alteration (Ser77Thr). No isolates contained cfr or cfr(B) genes and any L3 or L4 protein alterations. No genetic mechanism of resistance was identified for 67.6 % (23/34) of linezolid-resistant E. faecium. A low rate of 23S rRNA mutations and the absence of known linezolid-resistance mechanisms in the majority of E. faecium isolates suggest regional differences in the mechanisms of linezolid resistance and the possibility of additional mechanisms.

  12. Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

    PubMed Central

    Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

    2001-01-01

    The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

  13. An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes Tü57

    PubMed Central

    Weitnauer, Gabriele; Gaisser, Sibylle; Trefzer, Axel; Stockert, Sigrid; Westrich, Lucy; Quiros, Luis M.; Mendez, Carmen; Salas, Jose A.; Bechthold, Andreas

    2001-01-01

    Three different resistance factors from the avilamycin biosynthetic gene cluster of Streptomyces viridochromogenes Tü57, which confer avilamycin resistance when expressed in Streptomyces lividans TK66, were isolated. Analysis of the deduced amino acid sequences showed that AviABC1 is similar to a large family of ATP-binding transporter proteins and that AviABC2 resembles hydrophobic transmembrane proteins known to act jointly with the ATP-binding proteins. The deduced amino acid sequence of aviRb showed similarity to those of other rRNA methyltransferases, and AviRa did not resemble any protein in the databases. Independent expression in S. lividans TK66 of aviABC1 plus aviABC2, aviRa, or aviRb conferred different levels of resistance to avilamycin: 5, 10, or 250 μg/ml, respectively. When either aviRa plus aviRb or aviRa plus aviRb plus aviABC1 plus aviABC2 was coexpressed in S. lividans TK66, avilamycin resistance levels reached more than 250 μg/ml. Avilamycin A inhibited poly(U)-directed polyphenylalanine synthesis in an in vitro system using ribosomes of S. lividans TK66(pUWL201) (GWO), S. lividans TK66(pUWL201-Ra) (GWRa), or S. lividans TK66(pUWL201-Rb) (GWRb), whereas ribosomes of S. lividans TK66 containing pUWL201-Ra+Rb (GWRaRb) were highly resistant. aviRa and aviRb were expressed in Escherichia coli, and both enzymes were purified as fusion proteins to near homogeneity. Both enzymes showed rRNA methyltransferase activity using a mixture of 16S and 23S rRNAs from E. coli as the substrate. Coincubation experiments revealed that the enzymes methylate different positions of rRNA. PMID:11181344

  14. An ATP-binding cassette transporter and two rRNA methyltransferases are involved in resistance to avilamycin in the producer organism Streptomyces viridochromogenes Tü57.

    PubMed

    Weitnauer, G; Gaisser, S; Trefzer, A; Stockert, S; Westrich, L; Quiros, L M; Mendez, C; Salas, J A; Bechthold, A

    2001-03-01

    Three different resistance factors from the avilamycin biosynthetic gene cluster of Streptomyces viridochromogenes Tü57, which confer avilamycin resistance when expressed in Streptomyces lividans TK66, were isolated. Analysis of the deduced amino acid sequences showed that AviABC1 is similar to a large family of ATP-binding transporter proteins and that AviABC2 resembles hydrophobic transmembrane proteins known to act jointly with the ATP-binding proteins. The deduced amino acid sequence of aviRb showed similarity to those of other rRNA methyltransferases, and AviRa did not resemble any protein in the databases. Independent expression in S. lividans TK66 of aviABC1 plus aviABC2, aviRa, or aviRb conferred different levels of resistance to avilamycin: 5, 10, or 250 microg/ml, respectively. When either aviRa plus aviRb or aviRa plus aviRb plus aviABC1 plus aviABC2 was coexpressed in S. lividans TK66, avilamycin resistance levels reached more than 250 microg/ml. Avilamycin A inhibited poly(U)-directed polyphenylalanine synthesis in an in vitro system using ribosomes of S. lividans TK66(pUWL201) (GWO), S. lividans TK66(pUWL201-Ra) (GWRa), or S. lividans TK66(pUWL201-Rb) (GWRb), whereas ribosomes of S. lividans TK66 containing pUWL201-Ra+Rb (GWRaRb) were highly resistant. aviRa and aviRb were expressed in Escherichia coli, and both enzymes were purified as fusion proteins to near homogeneity. Both enzymes showed rRNA methyltransferase activity using a mixture of 16S and 23S rRNAs from E. coli as the substrate. Coincubation experiments revealed that the enzymes methylate different positions of rRNA.

  15. Evaluations of Different Hypervariable Regions of Archaeal 16S rRNA Genes in Profiling of Methanogens by Archaea-Specific PCR and Denaturing Gradient Gel Electrophoresis▿

    PubMed Central

    Yu, Zhongtang; García-González, Rubén; Schanbacher, Floyd L.; Morrison, Mark

    2008-01-01

    Different hypervariable (V) regions of the archaeal 16S rRNA gene (rrs) were compared systematically to establish a preferred V region(s) for use in Archaea-specific PCR-denaturing gradient gel electrophoresis (DGGE). The PCR products of the V3 region produced the most informative DGGE profiles and permitted identification of common methanogens from rumen samples from sheep. This study also showed that different methanogens might be detected when different V regions are targeted by PCR-DGGE. Dietary fat appeared to transiently stimulate Methanosphaera stadtmanae but inhibit Methanobrevibacter sp. strain AbM4 in rumen samples. PMID:18083874

  16. Phylogenetic relationship of psychoactive fungi based on rRNA gene for a large subunit and their identification using the TaqMan assay (II).

    PubMed

    Maruyama, Takuro; Kawahara, Nobuo; Yokoyama, Kazumasa; Makino, Yukiko; Fukiharu, Toshimitsu; Goda, Yukihiro

    2006-11-10

    "Magic mushroom (MM)" is the name most commonly given to psychoactive fungi containing the hallucinogenic components: psilocin (1) and psilocybin (2). We investigated the rRNA gene (internal transcribed spacer (ITS) and large subunit (LSU)) of two Panaeolus species and four Psilocybe species fungi (of these, two are non-psilocybin species). On the basis of sequence alignment, we improved the identification system developed in our previous study. In this paper, we describe the new system capable of distinguishing MMs from non-psilocybin Psilocybe species, its application data and the phylogeny of MM species.

  17. CLUSTOM-CLOUD: In-Memory Data Grid-Based Software for Clustering 16S rRNA Sequence Data in the Cloud Environment

    PubMed Central

    Park, Min-Kyu; Kim, Byung Kwon; Hwang, Kyuin; Lee, Sang-Heon; Hong, Soon Gyu; Nasir, Arshan; Cho, Wan-Sup; Kim, Kyung Mo

    2016-01-01

    High-throughput sequencing can produce hundreds of thousands of 16S rRNA sequence reads corresponding to different organisms present in the environmental samples. Typically, analysis of microbial diversity in bioinformatics starts from pre-processing followed by clustering 16S rRNA reads into relatively fewer operational taxonomic units (OTUs). The OTUs are reliable indicators of microbial diversity and greatly accelerate the downstream analysis time. However, existing hierarchical clustering algorithms that are generally more accurate than greedy heuristic algorithms struggle with large sequence datasets. To keep pace with the rapid rise in sequencing data, we present CLUSTOM-CLOUD, which is the first distributed sequence clustering program based on In-Memory Data Grid (IMDG) technology–a distributed data structure to store all data in the main memory of multiple computing nodes. The IMDG technology helps CLUSTOM-CLOUD to enhance both its capability of handling larger datasets and its computational scalability better than its ancestor, CLUSTOM, while maintaining high accuracy. Clustering speed of CLUSTOM-CLOUD was evaluated on published 16S rRNA human microbiome sequence datasets using the small laboratory cluster (10 nodes) and under the Amazon EC2 cloud-computing environments. Under the laboratory environment, it required only ~3 hours to process dataset of size 200 K reads regardless of the complexity of the human microbiome data. In turn, one million reads were processed in approximately 20, 14, and 11 hours when utilizing 20, 30, and 40 nodes on the Amazon EC2 cloud-computing environment. The running time evaluation indicates that CLUSTOM-CLOUD can handle much larger sequence datasets than CLUSTOM and is also a scalable distributed processing system. The comparative accuracy test using 16S rRNA pyrosequences of a mock community shows that CLUSTOM-CLOUD achieves higher accuracy than DOTUR, mothur, ESPRIT-Tree, UCLUST and Swarm. CLUSTOM-CLOUD is written in

  18. 18S rRNA data indicate that Aschelminthes are polyphyletic in origin and consist of at least three distinct clades.

    PubMed

    Winnepenninckx, B; Backeljau, T; Mackey, L Y; Brooks, J M; De Wachter, R; Kumar, S; Garey, J R

    1995-11-01

    The Aschelminthes is a collection of at least eight animal phyla, historically grouped together because the absence of a true body cavity was perceived as a pseudocoelom. Analyses of 18S rRNA sequences from six Aschelminth phyla (including four previously unpublished sequences) support polyphyly for the Aschelminthes. At least three distinct groups of Aschelminthes were detected: the Priapulida among the protostomes, the Rotifera-Acanthocephala as a sister group to the protostomes, and the Nematoda as a basal group to the triploblastic Eumetazoa.

  19. Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

    PubMed

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2017-01-01

    Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and

  20. Microbial composition analyses by 16S rRNA sequencing: A proof of concept approach to provenance determination of archaeological ochre.

    PubMed

    Lenehan, Claire E; Tobe, Shanan S; Smith, Renee J; Popelka-Filcoff, Rachel S

    2017-01-01

    Many archaeological science studies use the concept of "provenance", where the origins of cultural material can be determined through physical or chemical properties that relate back to the origins of the material. Recent studies using DNA profiling of bacteria have been used for the forensic determination of soils, towards determination of geographic origin. This manuscript presents a novel approach to the provenance of archaeological minerals and related materials through the use of 16S rRNA sequencing analysis of microbial DNA. Through the microbial DNA characterization from ochre and multivariate statistics, we have demonstrated the clear discrimination between four distinct Australian cultural ochre sites.

  1. Metaxa: a software tool for automated detection and discrimination among ribosomal small subunit (12S/16S/18S) sequences of archaea, bacteria, eukaryotes, mitochondria, and chloroplasts in metagenomes and environmental sequencing datasets.

    PubMed

    Bengtsson, Johan; Eriksson, K Martin; Hartmann, Martin; Wang, Zheng; Shenoy, Belle Damodara; Grelet, Gwen-Aëlle; Abarenkov, Kessy; Petri, Anna; Rosenblad, Magnus Alm; Nilsson, R Henrik

    2011-10-01

    The ribosomal small subunit (SSU) rRNA gene has emerged as an important genetic marker for taxonomic identification in environmental sequencing datasets. In addition to being present in the nucleus of eukaryotes and the core genome of prokaryotes, the gene is also found in the mitochondria of eukaryotes and in the chloroplasts of photosynthetic eukaryotes. These three sets of genes are conceptually paralogous and should in most situations not be aligned and analyzed jointly. To identify the origin of SSU sequences in complex sequence datasets has hitherto been a time-consuming and largely manual undertaking. However, the present study introduces Metaxa ( http://microbiology.se/software/metaxa/ ), an automated software tool to extract full-length and partial SSU sequences from larger sequence datasets and assign them to an archaeal, bacterial, nuclear eukaryote, mitochondrial, or chloroplast origin. Using data from reference databases and from full-length organelle and organism genomes, we show that Metaxa detects and scores SSU sequences for origin with very low proportions of false positives and negatives. We believe that this tool will be useful in microbial and evolutionary ecology as well as in metagenomics.

  2. Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

    PubMed

    Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

    1995-04-01

    Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

  3. Comparative analysis of 16S rRNA and amoA genes from archaea selected with organic and inorganic amendments in enrichment culture.

    PubMed

    Xu, Mouzhong; Schnorr, Jon; Keibler, Brandon; Simon, Holly M

    2012-04-01

    We took advantage of a plant-root enrichment culture system to characterize mesophilic soil archaea selected through the use of organic and inorganic amendments. Comparative analysis of 16S rRNA and amoA genes indicated that specific archaeal clades were selected under different conditions. Three amoA sequence clades were identified, while for a fourth group, identified by 16S rRNA gene analysis alone and referred to as the "root" clade, we detected no corresponding amoA gene. The amoA-containing archaea were present in media with either organic or inorganic amendments, whereas archaea representing the root clade were present only when organic amendment was used. Analysis of amoA gene abundance and expression, together with nitrification-coupled growth assays, indicated potential growth by autotrophic ammonia oxidation for members of two group 1.1b clades. Increased abundance of one of these clades, however, also occurred upon the addition of organic amendment. Finally, although amoA-containing group 1.1a archaea were present in enrichments, we detected neither expression of amoA genes nor evidence for nitrification-coupled growth of these organisms. These data support a model of a diverse metabolic community in mesophilic soil archaea that is just beginning to be characterized.

  4. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    PubMed Central

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  5. Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing

    PubMed Central

    Angell, Inga Leena; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut

    2018-01-01

    The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation. PMID:29724017

  6. Application of DNA probes for rRNA and vanA genes to investigation of a nosocomial cluster of vancomycin-resistant enterococci.

    PubMed Central

    Woodford, N; Morrison, D; Johnson, A P; Briant, V; George, R C; Cookson, B

    1993-01-01

    DNA probes specific for genes encoding rRNA and the glycopeptide resistance gene vanA were used to investigate a cluster of vancomycin-resistant (MICs, > 512 mg/liter) Enterococcus faecalis and Enterococcus faecium isolated from separate patients in a renal unit in a London hospital. When digested with BamHI, 12 of 13 vancomycin-resistant E. faecalis isolates exhibited a common restriction fragment length polymorphism pattern of rRNA genes (ribotype). A vanA probe hybridized with chromosomal DNA in these 12 isolates. The other isolate of vancomycin-resistant E. faecalis had a different ribotype and the vanA gene was located on plasmid DNA. These data suggest that cross-infection with a single strain of vancomycin-resistant E. faecalis occurred in most instances. In contrast, 23 vancomycin-resistant E. faecium isolates showed greater heterogeneity, comprising 8 ribotypes, suggesting that multiple strains were present in the unit. Twenty-one of these 23 isolates harbored a 24-MDa plasmid which hybridized with the vanA probe, implying that interstrain dissemination of a vancomycin resistance plasmid may have occurred among E. faecium isolates in the renal unit. Images PMID:8096216

  7. Specific detection and identification of [Actinobacillus] muris by PCR using primers targeting the 16S-23S rRNA internal transcribed spacer regions.

    PubMed

    Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin

    2013-08-01

    [Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing.

    PubMed

    Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S

    2016-08-01

    Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site.

  9. Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos) Shown with 16S rRNA Gene-Based Microbial Community Analysis

    PubMed Central

    Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei

    2013-01-01

    Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms. PMID:24058905

  10. Population abundance of potentially pathogenic organisms in intestinal microbiome of jungle crow (Corvus macrorhynchos) shown with 16S rRNA gene-based microbial community analysis.

    PubMed

    Maeda, Isamu; Siddiki, Mohammad Shohel Rana; Nozawa-Takeda, Tsutomu; Tsukahara, Naoki; Tani, Yuri; Naito, Taki; Sugita, Shoei

    2013-01-01

    Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

  11. Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

    PubMed

    Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

    2004-02-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

  12. Detection and Characterization of a Dehalogenating Microorganism by Terminal Restriction Fragment Length Polymorphism Fingerprinting of 16S rRNA in a Sulfidogenic, 2-Bromophenol-Utilizing Enrichment

    PubMed Central

    Fennell, Donna E.; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M.; Kerkhof, Lee J.

    2004-01-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate. PMID:14766602

  13. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    PubMed

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  14. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  15. Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

    PubMed

    Ahuja, Richa; Kumar, Vijay

    2017-07-01

    RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

  16. Bacterial 16S rRNA gene analysis revealed that bacteria related to Arcobacter spp. constitute an abundant and common component of the oyster microbiota (Tiostrea chilensis).

    PubMed

    Romero, J; García-Varela, M; Laclette, J P; Espejo, R T

    2002-11-01

    To explore the bacterial microbiota in Chilean oyster (Tiostrea chilensis), a molecular approach that permits detection of different bacteria, independently of their capacity to grow in culture media, was used. Bacterial diversity was assessed by analysis of both the 16S rDNA and the 16S-23S intergenic region, obtained by PCR amplifications of DNA extracted from depurated oysters. RFLP of the PCR amplified 16S rDNA showed a prevailing pattern in most of the individuals analyzed, indicating that a few bacterial species were relatively abundant and common in oysters. Cloning and sequencing of the 16S rDNA with the prevailing RFLP pattern indicated that this rRNA was most closely related to Arcobacter spp. However, analysis by the size of the amplified 16S-23S rRNA intergenic regions revealed not Arcobacter spp. but Staphylococcus spp. related bacteria as a major and common component in oyster. These different results may be caused by the absence of target for one of the primers employed for amplification of the intergenic region. Neither of the two bacteria species found in large abundance was recovered after culturing under aerobic, anaerobic, or microaerophilic conditions. This result, however, is expected because the number of bacteria recovered after cultivation was less than 0.01% of the total. All together, these observations suggest that Arcobacter-related strains are probably abundant and common in the Chilean oyster bacterial microbiota.

  17. Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

    PubMed Central

    Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

    2002-01-01

    For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

  18. 23S rRNA gene-based enterococci community signatures in Lake Pontchartrain, Louisiana, USA, following urban runoff inputs after Hurricane Katrina.

    PubMed

    Bae, Hee-Sung; Hou, Aixin

    2013-02-01

    Little is known about the impacts of fecal polluted urban runoff inputs on the structure of enterococci communities in estuarine waters. This study employed a 23S rRNA gene-based polymerase chain reaction (PCR) assay with newly designed genus-specific primers, Ent127F-Ent907R, to determine the possible impacts of Hurricane Katrina floodwaters via the 17th Street Canal discharge on the community structure of enterococci in Lake Pontchartrain. A total of 94 phylotypes were identified through the restriction fragment length polymorphism (RFLP) screening of 494 clones while only 8 phylotypes occurred among 88 cultivated isolates. Sequence analyses of representative phylotypes and their temporal and spatial distribution in the lake and the canal indicated the Katrina floodwater input introduced a large portion of Enterococcus flavescens, Enterococcus casseliflavus, and Enterococcus dispar into the lake; typical fecal groups Enterococcus faecium, Enterococcus durans, Enterococcus hirae, and Enterococcus mundtii were detected primarily in the floodwater-impacted waters. This study provides a global picture of enterococci in estuarine waters impacted by Hurricane Katrina-derived urban runoff. It also demonstrates the culture-independent PCR approach using 23S rRNA gene as a molecular marker could be a good alternative in ecological studies of enterococci in natural environments to overcome the limitation of conventional cultivation methods.

  19. Assessment of fecal pollution sources in a small northern-plains watershed using PCR and phylogenetic analyses of Bacteroidetes 16S rRNA gene

    USGS Publications Warehouse

    Lamendella, R.; Domingo, J.W.S.; Oerther, D.B.; Vogel, J.R.; Stoeckel, D.M.

    2007-01-01

    We evaluated the efficacy, sensitivity, host-specificity, and spatial/temporal dynamics of human- and ruminant-specific 16S rRNA gene Bacteroidetes markers used to assess the sources of fecal pollution in a fecally impacted watershed. Phylogenetic analyses of 1271 fecal and environmental 16S rRNA gene clones were also performed to study the diversity of Bacteroidetes in this watershed. The host-specific assays indicated that ruminant feces were present in 28-54% of the water samples and in all sampling seasons, with increasing frequency in downstream sites. The human-targeted assays indicated that only 3-5% of the water samples were positive for human fecal signals, although a higher percentage of human-associated signals (19-24%) were detected in sediment samples. Phylogenetic analysis indicated that 57% of all water clones clustered with yet-to-be-cultured Bacteroidetes species associated with sequences obtained from ruminant feces, further supporting the prevalence of ruminant contamination in this watershed. However, since several clusters contained sequences from multiple sources, future studies need to consider the potential cosmopolitan nature of these bacterial populations when assessing fecal pollution sources using Bacteroidetes markers. Moreover, additional data is needed in order to understand the distribution of Bacteroidetes host-specific markers and their relationship to water quality regulatory standards. ?? 2006 Federation of European Microbiological Societies.

  20. Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

    PubMed

    Wei, Yulong; Silke, Jordan R; Xia, Xuhua

    2017-12-15

    Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

  1. Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing.

    PubMed

    Avershina, Ekaterina; Angell, Inga Leena; Simpson, Melanie; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; Rudi, Knut

    2018-05-01

    The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS) approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types ( Bifidobacterium longum and Enterococcus faecalis ). Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis . We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.

  2. Diversity of lactic acid bacteria associated with fish and the fish farm environment, established by amplified rRNA gene restriction analysis.

    PubMed

    Michel, Christian; Pelletier, Claire; Boussaha, Mekki; Douet, Diane-Gaëlle; Lautraite, Armand; Tailliez, Patrick

    2007-05-01

    Lactic acid bacteria have become a major source of concern for aquaculture in recent decades. In addition to true pathogenic species of worldwide significance, such as Streptococcus iniae and Lactococcus garvieae, several species have been reported to produce occasional fish mortalities in limited geographic areas, and many unidentifiable or ill-defined isolates are regularly isolated from fish or fish products. To clarify the nature and prevalence of different fish-associated bacteria belonging to the lactic acid bacterium group, a collection of 57 isolates of different origins was studied and compared with a set of 22 type strains, using amplified