Science.gov

Sample records for a2m alpha chain

  1. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  2. Marfan syndrome: abnormal alpha 2 chain in type I collagen.

    PubMed Central

    Byers, P H; Siegel, R C; Peterson, K E; Rowe, D W; Holbrook, K A; Smith, L T; Chang, Y H; Fu, J C

    1981-01-01

    Cells in culture from a woman with a variety of the Marfan syndrome produce two species of the alpha 2 chains of type I collagen. One alpha 2 chain appears normal; the abnormal chain has a higher apparent molecular weight than normal and migrates more slowly during electrophoresis in sodium dodecyl sulfate/polyacrylamide gels. A similar change in electrophoretic behavior is seen in the prepro alpha 2 chain and the pN alpha 2 chain (which contains the amino-terminal extension). Asymmetric cleavage of the pepsin-treated procollagens with a fibroblast collagenase locates the abnormal segment amino terminal to the cleavage site, and analysis of cyanogen bromide peptides of collagenase cleavage peptides and of whole collagens indicates that the abnormal segment is in either the alpha 2CB3 peptide or the short segment of alpha 2CB5 amino terminal to the collagenase site of the altered alpha 2 chain. The higher apparent molecular weight is consistent with the insertion of a small peptide fragment of approximately 20 amino acids. This alteration in chain size has marked effects on crosslinking because collagen from the patient's skin was 5-10 times more extractable in nondenaturing solvents than that from control skins. Although the abnormal chain was not found in several other individuals with the Marfan syndrome, these findings suggest that the phenotype may be the expression of a variety of primary structure alterations in the chains of type I collagen that interfere with normal crosslink formation. Images PMID:6950413

  3. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  4. Biosynthesis of alpha2(IV) and alpha1(IV) chains of collagen IV and interactions with matrix metalloproteinase-9.

    PubMed

    Toth, M; Sado, Y; Ninomiya, Y; Fridman, R

    1999-07-01

    In vitro binding studies with latent matrix metalloproteinase-9 (pro-MMP-9) have revealed the existence of nondisulfide-bonded alpha2(IV) chains on the cell surface capable of forming a high-affinity complex with the enzyme. Here we investigated the biosynthesis and cellular distribution of alpha2(IV) and alpha1(IV) chains in breast epithelial (MCF10A and MDA-MB-231) and fibrosarcoma (HT1080) cells by pulse-chase analysis followed by immunoprecipitation with chain-specific monoclonal antibodies (mAb). These studies showed that whereas the alpha1(IV) chain remained in the intracellular compartment, nondisulfide-bonded alpha2(IV) chains were secreted into the media in a stable form. Consistently, only alpha2(IV) was detected on the cell surface by surface biotinylation or indirect immunofluorescence. In agreement with the pulse-chase analysis, media subjected to co-precipitation experiments with pro-MMP-9 or pro-MMP-9-affinity chromatography followed by immunoblotting with chain-specific mAbs resulted in the detection of alpha2(IV). A preferential secretion of nondisulfide-bonded alpha2(IV) chains was also observed in CHO-K1 cells transiently transfected with full-length mouse alpha2(IV) or alpha (IV) cDNAs. However, a complex of mouse alpha1(IV) with pro-MMP-9 was coprecipitated with exogenous enzyme from lysates of CHO-K1 cells transfected with mouse alpha1(IV), suggesting that under overexpression conditions the enzyme can also interact with the alpha1 (IV) chain. Collectively, these studies further demonstrate the interactions of pro-MMP-9 with collagen IV chains and a unique processing and targeting of nondisulfide-bonded alpha2(IV) chains that may play a role in the surface/matrix association of pro-MMP-9.

  5. {alpha} decay chains in {sup 271-294}115 superheavy nuclei

    SciTech Connect

    Santhosh, K. P.; Priyanka, B.; Joseph, Jayesh George; Sahadevan, Sabina

    2011-08-15

    {alpha} decay of {sup 271-294}115 superheavy nuclei is studied using the Coulomb and proximity potential model for deformed nuclei (CPPMDN). The predicted {alpha} half-lives of {sup 287}115 and {sup 288}115 nuclei and their decay products are in good agreement with experimental values. Comparison of {alpha} and spontaneous fission half-lives predicts four-{alpha} chains and three-{alpha} chains, respectively, from {sup 287}115 and {sup 288}115 nuclei and are in agreement with experimental observation. Our study predicts two-{alpha} chains from {sup 273,274,289}115, three-{alpha} chains from {sup 275}115, and four-{alpha} chains consistently from {sup 284,285,286}115 nuclei. These observations will be useful for further experimental investigation in this region.

  6. Immunochemical studies in four cases of alpha chain disease

    PubMed Central

    Seligmann, Maxime; Mihaesco, Edith; Hurez, Daniel; Mihaesco, Constantin; Preud'homme, Jean-Louis; Rambaud, Jean-Claude

    1969-01-01

    Studies of a number of properties of the pathological γA-proteins in the first four cases of the recently recognized alpha-chain disease demonstrate that, as in γ-heavy-chain disease, the abnormal protein is devoid of light chains and represents a portion of the α-heavy chain related to the Fc-fragment. In two patients, serum electrophoresis showed a broad abnormal band, whereas in the two others the pathological protein was not noticeable on the electrophoretic pattern. The diagnosis of α-chain disease can be established without purification of the protein by immuno-electrophoresis and gel diffusion experiments using selected antisera to γA and a reference α-chain disease protein. All four proteins belonged to the α1-subclass, displayed electrophoretic heterogeneity, and showed a strong tendency to polymerize. The polymers occurred in vivo and were held together both by disulfide bonds and by strong noncovalent forces. Two of the three purified proteins had a very high carbohydrate content. The abnormal protein was always found in concentrated urines in variable but generally low amounts. It was not detected in parotid saliva but was present in significant amounts in jejunal fluid of all four patients. The α-chain disease protein was shown to be associated with the secretory piece in external secretions of two patients. The clinicopathological features were strikingly similar in the four patients. All patients were affected with a neoplastic and mostly plasmacytic proliferation involving primarily the whole length of the small intestine and the mesenteric nodes and all exhibited a severe malabsorption syndrome. While Israeli authors have emphasized the frequency of this type of abdominal lymphoma in young Arabs and non-Ashkenazi Jews, two of our patients were Kabyles, one a Syrian Arab, and one an Eurasian. Cellular studies showed that the pathological protein was synthesized by the proliferating cells in the lymphoid tissue of the digestive tract and in

  7. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha chains.

    PubMed

    Richards, A; Al-Imara, L; Pope, F M

    1996-06-15

    We previously localised the gene (LAMA4) encoding a novel laminin alpha 4 chain to chromosome 6q21. In this study, we describe the complete coding sequence and compare the protein with the other three known human laminin alpha chains. Although closely linked to LAMA2, the LAMA4 product most closely resembles laminin alpha 3, a constituent of laminin 5. Like laminin alpha 3A, the alpha 4 chain is a truncated version of the alpha 1 and alpha 2 chains, with a much reduced short arm. While the alpha 4 molecule is most similar to alpha 3, it shares some features of the C-terminal domains G4 and G5 in common with alpha 2. Unlike the LAMA3 gene, LAMA4 appears to encode only a single transcript, as determined by 5' rapid amplification of cDNA ends. The cDNA sequence encodes 1816 amino acids, which include a 24-residue signal peptide. The gene is expressed in skin, placenta, heart, lung, skeletal muscle, and pancreas. We have also shown that the mRNA can be readily reverse transcribed and amplified from cultured dermal fibroblasts. PMID:8706685

  8. Laminin alpha5 chain is required for intestinal smooth muscle development.

    PubMed

    Bolcato-Bellemin, Anne Laure; Lefebvre, Olivier; Arnold, Christiane; Sorokin, Lydia; Miner, Jeffrey H; Kedinger, Michèle; Simon-Assmann, Patricia

    2003-08-15

    Laminins (comprised of alpha, beta, and gamma chains) are heterotrimeric glycoproteins integral to all basement membranes. The function of the laminin alpha5 chain in the developing intestine was defined by analysing laminin alpha5(-/-) mutants and by grafting experiments. We show that laminin alpha5 plays a major role in smooth muscle organisation and differentiation, as excessive folding of intestinal loops and delay in the expression of specific markers are observed in laminin alpha5(-/-) mice. In the subepithelial basement membrane, loss of alpha5 expression was paralleled by ectopic or accelerated deposition of laminin alpha2 and alpha4 chains; this may explain why no obvious defects were observed in the villous form and enterocytic differentiation. This compensation process is attributable to mesenchyme-derived molecules as assessed by chick/mouse alpha5(-/-) grafted associations. Lack of the laminin alpha5 chain was accompanied by a decrease in epithelial alpha3beta1 integrin receptor expression adjacent to the epithelial basement membrane and of Lutheran blood group glycoprotein in the smooth muscle cells, indicating that these receptors are likely mediating interactions with laminin alpha5-containing molecules. Taken together, the data indicate that the laminin alpha5 chain is essential for normal development of the intestinal smooth muscle and point to possible mesenchyme-derived compensation to promote normal intestinal morphogenesis when laminin alpha5 is absent.

  9. Replacement of the DR alpha chain with the E alpha chain enhances presentation of Mycoplasma arthritidis superantigen by the human class II DR molecule.

    PubMed Central

    Sawada, T; Pergolizzi, R; Ito, K; Silver, J; Atkin, C; Cole, B C; Chang, M D

    1995-01-01

    Mycoplasma arthritidis mitogen (MAM) is produced by an organism which can cause chronic proliferative arthritis in rodents. MAM possesses a typical superantigenic activity; it has the ability to activate a large panel of T cells which express specific V beta segments of the T-cell receptor. The presentation of MAM to T cells by antigen-presenting cells is mediated primarily through its binding to the major histocompatibility complex (MHC) class II E alpha chain in mice and the DR alpha chain in humans. However, MAM is much less active for human peripheral blood lymphocytes than for mouse splenocytes. It was suggested that a difference in MAM binding affinity between human and mouse class II molecules may account for their different MAM activities. To examine this possibility, we generated a panel of B-cell transfectants whose DR molecule is composed of either the DR alpha or the E alpha chain paired with a DR3 beta chain. The ability of these transfectants to present MAM to human peripheral T cells was analyzed. Our data show that transfectants expressing E alpha DR beta chimeric molecules have higher MAM-presenting activity than transfectants expressing wild-type DR alpha DR beta molecules, while the latter have higher activity in stimulating DR3-alloreactive T cells. Since both types of transfectants present MAM to T cells expressing the same T-cell receptor V beta gene families, the higher MAM-presenting activity of the E alpha transfectant is not due to its ability to interact with a different set of T cells. Furthermore, both the E alpha 1 and E alpha 2 domains contribute to this increased affinity for MAM binding. Taken together, our data suggest that there may be multiple MAM binding sites on the E alpha and DR alpha chains and residues unique to the E alpha chain may provide additional affinity for MAM. PMID:7642264

  10. [A new alpha chain of jacalin from two wild species of jack-fruit seeds].

    PubMed

    Ngoc, L D; Brillard, M; Hoebeke, J; Aucouturier, P

    1995-02-01

    Jacalins, from jack-fruit seeds of 2 wild species (Artocarpus asperulus, Artocarpus masticata) were purified by mucine-sepharose 4B affinity chromatography. The alpha and beta chains were separated by reverse phase high pressure liquid chromatography (HPLC). Analysis by HPLC with a C8 column and the determination of the N-terminal sequence of the alpha-chain of these jacalins allowed the identification of a new alpha-chain. Immunological cross-reactivity and carbohydrate specificity indicate that jacalins possessing the new alpha-chain conserve structural and functional properties of the other members of Artocarpus genus.

  11. Family of G protein alpha chains: amphipathic analysis and predicted structure of functional domains.

    PubMed

    Masters, S B; Stroud, R M; Bourne, H R

    1986-01-01

    The G proteins transduce hormonal and other signals into regulation of enzymes such as adenylyl cyclase and retinal cGMP phosphodiesterase. Each G protein contains an alpha subunit that binds and hydrolyzes guanine nucleotides and interacts with beta gamma subunits and specific receptor and effector proteins. Amphipathic and secondary structure analysis of the primary sequences of five different alpha chains (bovine alpha s, alpha t1 and alpha t2, mouse alpha i, and rat alpha o) predicted the secondary structure of a composite alpha chain (alpha avg). The alpha chains contain four short regions of sequence homologous to regions in the GDP binding domain of bacterial elongation factor Tu (EF-Tu). Similarities between the predicted secondary structures of these regions in alpha avg and the known secondary structure of EF-Tu allowed us to construct a three-dimensional model of the GDP binding domain of alpha avg. Identification of the GDP binding domain of alpha avg defined three additional domains in the composite polypeptide. The first includes the amino terminal 41 residues of alpha avg, with a predicted amphipathic alpha helical structure; this domain may control binding of the alpha chains to the beta gamma complex. The second domain, containing predicted beta strands and alpha helices, several of which are strongly amphipathic, probably contains sequences responsible for interaction of alpha chains with effector enzymes. The predicted structure of the third domain, containing the carboxy terminal 100 amino acids, is predominantly beta sheet with an amphipathic alpha helix at the carboxy terminus. We propose that this domain is responsible for receptor binding.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:3148932

  12. Peptoid oligomers with alpha-chiral, aromatic side chains: effects of chain length on secondary structure.

    PubMed

    Wu, C W; Sanborn, T J; Zuckermann, R N; Barron, A E

    2001-04-01

    Oligomeric N-substituted glycines or "peptoids" with alpha-chiral, aromatic side chains can adopt stable helices in organic or aqueous solution, despite their lack of backbone chirality and their inability to form intrachain hydrogen bonds. Helical ordering appears to be stabilized by avoidance of steric clash as well as by electrostatic repulsion between backbone carbonyls and pi clouds of aromatic rings in the side chains. Interestingly, these peptoid helices exhibit intense circular dichroism (CD) spectra that closely resemble those of peptide alpha-helices. Here, we have utilized CD to systematically study the effects of oligomer length, concentration, and temperature on the chiral secondary structure of organosoluble peptoid homooligomers ranging from 3 to 20 (R)-N-(1-phenylethyl)glycine (Nrpe) monomers in length. We find that a striking evolution in CD spectral features occurs for Nrpe oligomers between 4 and 12 residues in length, which we attribute to a chain length-dependent population of alternate structured conformers having cis versus trans amide bonds. No significant changes are observed in CD spectra of oligomers between 13 and 20 monomers in length, suggesting a minimal chain length of about 13 residues for the formation of stable poly(Nrpe) helices. Moreover, no dependence of circular dichroism on concentration is observed for an Nrpe hexamer, providing evidence that these helices remain monomeric in solution. In light of these new data, we discuss chain length-related factors that stabilize organosoluble peptoid helices of this class, which are important for the design of helical, biomimetic peptoids sharing this structural motif.

  13. cDNA clone for the alpha-chain of human beta-hexosaminidase: deficiency of alpha-chain mRNA in Ashkenazi Tay-Sachs fibroblasts.

    PubMed Central

    Myerowitz, R; Proia, R L

    1984-01-01

    We have isolated a cDNA clone containing sequences complementary to mRNA encoding the alpha-chain of the lysosomal enzyme beta-hexosaminidase. RNA from a human lung fibroblast strain, IMR90, was enriched for beta-hexosaminidase messenger by polysome immunoselection with antiserum against beta-hexosaminidase A. This preparation was used to construct cDNA recombinant plasmids by the Okayama-Berg vector primer procedure. After transformation of Escherichia coli, 385 ampicillin-resistant colonies were obtained, 44 of which contained inserts in the plasmid DNA. Differential hybridization, with cDNA probes prepared from polysomal RNA enriched or depleted for beta-hexosaminidase messenger, was used to screen the recombinant plasmids for sequences encoding beta-hexosaminidase. One clone, p beta H alpha-1, containing a cDNA insert of approximately equal to 240 base pairs, was identified in this manner. The plasmid hybrid-selected a messenger from placental RNA that programed a translation system to synthesize the alpha-chain of beta-hexosaminidase. p beta H alpha-1 hybridized to an mRNA of approximately equal to 1.9 kilobases in preparations enriched separately in messenger for the alpha-chain or for both alpha- and beta-chains (by polysome immunoselection with antiserum against isolated alpha-chain or against beta-hexosaminidase A, respectively). It did not hybridize to an RNA preparation enriched for messenger of beta-chain by immunoselection with antiserum against beta-hexosaminidase B. The 1.9-kilobase mRNA was observed in poly(A)+ RNA preparations from control fibroblasts and from fibroblasts of a Tay-Sachs patient that synthesize an altered alpha-chain; however, it was not seen in similar preparations from fibroblasts of four Ashkenazi Tay-Sachs patients. Images PMID:6236461

  14. Structure and diversity of the TCR alpha-chain in a teleost fish.

    PubMed

    Partula, S; de Guerra, A; Fellah, J S; Charlemagne, J

    1996-07-01

    T cell receptor beta-chain genes are well characterized in representatives of most vertebrate phyla, from sharks to mammals, but the molecular structure of complete TCR alpha-chains has not yet been established in cold-blooded vertebrates. We used a PCR approach to isolate cDNAs encoding putative teleost fish (Oncorhynchus mykiss, rainbow trout) TCR alpha-chains. Eight V alpha segments were identified, belonging to six different families, and the best amino acid sequence identity scores for these trout V alpha were all provided by mammalian V alpha or V delta sequences. Twenty-four (60.1 %) of the 39 analyzed V alpha segments belong to the V alpha 2 family, which has limited homology with mammalian V alpha/delta sequences and with the human V pre-B sequence. A total of 32 different J alpha segments were identified from 40 J alpha regions sequenced, suggesting that a large repertoire of J alpha segments is a characteristic of most vertebrates. The structural properties of the TCR alpha-chain complementarity-determining region 3 loop are well conserved between trout and mammals, suggesting that this region has been under continuous selective pressure in jawed vertebrate evolution. The trout C alpha segment has conserved N-terminal and transmembrane domains, but the C alpha intercysteine distance contains only 40 residues, significantly smaller as compared with mammals (49-56 residues). The conserved features of teleost fish TCR beta- and alpha-chains with their mammalian equivalents suggest that TCR-alpha beta receptors were still present in the common Devonian ancestors of modern teleost fish and mammals, about 450 million years ago. PMID:8683116

  15. Transient expression of laminin {alpha}1 chain in regenerating murine liver: Restricted localization of laminin chains and nidogen-1

    SciTech Connect

    Kikkawa, Yamato . E-mail: yamato@sapmed.ac.jp; Mochizuki, Yoichi; Miner, Jeffrey H.; Mitaka, Toshihiro

    2005-04-15

    Most interstitia between epithelial and endothelial cells contain basal laminae (BLs), as defined by electron microscopy. However, in liver, the sinusoidal interstitium (called space of Disse) between hepatocytes and sinusoidal endothelial cells (SECs) lacks BLs. Because laminins are major components of BLs throughout the body, whether laminins exist in sinusoids has been a controversial issue. Despite recent advances, the distribution and expression of laminin chains have not been well defined in mammalian liver. Here, using a panel of antibodies, we examined laminins in normal and regenerating mouse livers. Of {alpha} chains, {alpha}5 was widely observed in all BLs except for sinusoids, while the other {alpha} chains were variously expressed in Glisson's sheath and central veins. Laminin {gamma}1 was also distributed to all BLs except for sinusoids. Although the {beta}2 chain was observed in all BLs and sinusoids, the expression of {beta}1 chain was restricted to Glisson's sheath. Detailed analysis of regenerating liver revealed that {alpha}1 and {gamma}1 chains appeared in sinusoids and were produced by stellate cells. The staining of {alpha}1 and {gamma}1 chains reached its maximum intensity at 6 days after two-thirds partial hepatectomy (PHx). Moreover, in vitro studies showed that {alpha}1-containing laminin promoted spreading of sinusoidal endothelial cells (SECs) isolated from normal liver, but not other hepatic cells. In addition, SECs isolated from regenerating liver elongated pseudopodia on {alpha}1-containing laminin more so than did cells from normal liver. The transient expression of laminin {alpha}1 may promote formation of sinusoids after PHx.

  16. Alpha heavy chain disease (report of 18 cases from Iraq).

    PubMed Central

    Al-Bahrani, Z; Al-Saleem, T; Al-Mondhiry, H; Bakir, F; Yahia, H; Taha, I; King, J

    1978-01-01

    The clinical and pathological features of 18 new patients with alpha heavy chain disease seen at two referral centres in Baghdad, Iraq, are described. The series included 14 males and four females ranging in age from 14 to 47 years. Almost all patients presented because of long-standing abdominal pain and diarrhoea. The tissue diagnosis and extent of the disease were established at laparotomy in most patients. Peroral jejunal biospy was used in a number of patients, mainly for follow-up. The serological abnormality was confirmed by immunoselection technique. Most of the patients had extensive thickening of the bowel wall and/or tumour masses of the small intestine and mesenteric nodes. Histopathological sections showed muscularis. Preliminary results of the treatment, including two long remissions, are reported. In general, our observations agree with those made by other authors, mostly from the Middle East and Africa. We believe that a high index of clinical suspicion, routine use of the immunoselection, and recognition of the early pathological changes may hopefully lead to the detection of more cases before the frank neoplastic phase of the disease. Images Figure PMID:98395

  17. A molecular map of G protein alpha chains in microdissected rat nephron segments.

    PubMed Central

    Senkfor, S I; Johnson, G L; Berl, T

    1993-01-01

    Membrane-associated guanine nucleotide binding proteins regulate many receptor-mediated signals. Heterogeneity of biochemical and functional properties in nephron segments could be due to differences in G protein expression. To ascertain whether such heterogeneity of G proteins is present in various nephron segments, this study examines the distribution and relative abundance of G protein alpha chains in microdissected medullary thick ascending limb, cortical collecting tubules, outer medullary collecting tubules, proximal inner medullary tubules, and distal inner medullary tubules. Reverse transcription and polymerase chain reactions were employed using oligonucleotides encoding highly conserved regions of all known alpha chains. The cDNA was sequenced for alpha chain identification. The alpha i2 versus alpha s distribution was different in the outer medullary collecting tubules, when compared with the medullary thick ascending limb (P < 0.001) or the cortical collecting tubule, the proximal inner medullary tubules, and the distal inner medullary tubules (P < 0.05). These latter four segments did not significantly differ from each other. A similar analysis was applied to the frequently used line of kidney cells, LLC-PK1, whose exact cellular origin remains unclear. Interestingly, we detected both alpha i2 and alpha i3, while only alpha i2 was detected in the rat distal nephron. No alpha o or alpha z reverse transcription PCR products were detected. In contrast alpha 11 and alpha 14 members of the more recently described alpha q family were detected in the outer medullary collecting tubules and the proximal inner medullary tubules, respectively. We conclude that the majority of nephron segments have a relatively constant distribution of G protein alpha chains. Images PMID:8349818

  18. Be-{alpha} correlations in the linear-chain structure of C isotopes

    SciTech Connect

    Suhara, Tadahiro; Kanada-En'yo, Yoshiko

    2011-08-15

    We investigate the linear-chain structures in highly excited states of {sup 14}C using a generalized molecular-orbital model, by which we incorporate an asymmetric configuration of three {alpha} clusters in the linear-chain states. By applying this model to the {sup 14}C system, we study the {sup 10}Be+{alpha} correlation in the linear-chain state of {sup 14}C. To clarify the origin of the {sup 10}Be+{alpha} correlation in the {sup 14}C linear-chain state, we analyze linear 3 {alpha} and 3{alpha} + n systems in a similar way. We find that a linear 3{alpha} system prefers the asymmetric 2{alpha} + {alpha} configuration, whose origin is the many-body correlation incorporated by the parity projection. This configuration causes an asymmetric mean field for two valence neutrons, which induces the concentration of valence neutron wave functions around the correlating 2{alpha}. A linear-chain structure of {sup 16}C is also discussed.

  19. Overexpression of laminin alpha1 chain in colonic cancer cells induces an increase in tumor growth.

    PubMed

    De Arcangelis, A; Lefebvre, O; Méchine-Neuville, A; Arnold, C; Klein, A; Rémy, L; Kedinger, M; Simon-Assmann, P

    2001-10-01

    Laminins represent a growing family of glycoproteins constituting the basement membrane. They are known to direct many biological processes. With respect to carcinogenesis, laminins play an important role in cell adhesion, mitogenesis, differentiation and even metastasis. To further study the biological significance of laminin-1 (composed of alpha1, beta1 and gamma1 chains) in intestinal cell differentiation or tumorigenesis, an alpha1-laminin expression vector was introduced into the HT29 colonic cancer cells, in which laminin alpha1 chain is not expressed. Upon transfection of the alpha1 chain, the alpha1beta1gamma1 trimer was found secreted in the media along with free alpha1 chain as assessed by immunoprecipitation. The presence of the laminin alpha1 chain did not significantly modify the levels of the other laminin chains nor the integrins expressed by the HT29 cells. In spite of similar growth properties with the control cells in vitro (plastic dish, soft agar), the laminin alpha1 transfectants showed a significantly increased tumor growth when injected in nude mice. Histologic and immunohistochemic examination of the laminin alpha1-expressing tumors points to an increased recruitment of the host stromal and vascular cells, without modification in the differentiation profile and invasion potential. In parallel, a clear accumulation of laminin-10 (alpha5beta1gamma1) at the carcinoma/stromal interface and a segregation of the integrin beta4 subunit at the basal pole of the cancer cells occurred, compared to control tumors. Overall, our observations emphasize the importance of laminin-1 as a chemoattractant of both stromal and vascular cells and in epithelial/stromal cell interactions for the organization of the basement membrane and segregation of integrins leading to an epithelial cell growth signal. Such a sequence of events is reminiscent of what occurs during development.

  20. Polymorphic expression in the CD8alpha chain surface receptor of African lions (Panthera leo).

    PubMed

    Bull, Marta E; Gebhard, Douglas G; Tompkins, Wayne A F; Kennedy-Stoskopf, Suzanne

    2002-01-15

    Free-ranging African lion (Panthera leo) peripheral blood mononuclear cells (PBMC) were examined using flow cytometry and antibodies developed for use in the domestic cat to determine if phenotypic changes occurred in lion lymphocytes as a result of feline immunodeficiency virus (FIV) infection. The percentage of CD8 cells from lion peripheral blood was considerably lower than in the domestic cat. Lions with elevated levels of CD8+ cells were typically infected with FIV, similar to observations in the domestic cat. Antibodies against the alpha chain of the CD8 receptor (monoclonal antibody (mAb) 3.357) did not react consistently in all lions examined. Flow cytometric analysis determined that approximately 82 and 80% of the animals from Kruger and Hluhluwe-Umfolozi National Parks in South Africa reacted with the monoclonal antibody against the alpha chain of CD8 receptor, while only 17% of the lions in Etosha National Park in Namibia cross-reacted with the CD8alpha chain. There was no apparent correlation between FIV status and CD8alpha chain reactivity. The relative isolation of Etosha from the other two parks could explain the marked difference in CD8alpha chain expression and suggests that lions similar to other mammalian species demonstrate polymorphic expression of the CD8alpha chain (197).

  1. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    PubMed

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  2. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    PubMed

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds. PMID:8752011

  3. The laminin alpha chains: expression, developmental transitions, and chromosomal locations of alpha1-5, identification of heterotrimeric laminins 8-11, and cloning of a novel alpha3 isoform.

    PubMed

    Miner, J H; Patton, B L; Lentz, S I; Gilbert, D J; Snider, W D; Jenkins, N A; Copeland, N G; Sanes, J R

    1997-05-01

    Laminin trimers composed of alpha, beta, and gamma chains are major components of basal laminae (BLs) throughout the body. To date, three alpha chains (alpha1-3) have been shown to assemble into at least seven heterotrimers (called laminins 1-7). Genes encoding two additional alpha chains (alpha4 and alpha5) have been cloned, but little is known about their expression, and their protein products have not been identified. Here we generated antisera to recombinant alpha4 and alpha5 and used them to identify authentic proteins in tissue extracts. Immunoprecipitation and immunoblotting showed that alpha4 and alpha5 assemble into four novel laminin heterotrimers (laminins 8-11: alpha4beta1gamma1, alpha4beta2gamma1, alpha5beta1gamma1, and alpha5beta2gamma1, respectively). Using a panel of nucleotide and antibody probes, we surveyed the expression of alpha1-5 in murine tissues. All five chains were expressed in both embryos and adults, but each was distributed in a distinct pattern at both RNA and protein levels. Overall, alpha4 and alpha5 exhibited the broadest patterns of expression, while expression of alpha1 was the most restricted. Immunohistochemical analysis of kidney, lung, and heart showed that the alpha chains were confined to extracellular matrix and, with few exceptions, to BLs. All developing and adult BLs examined contained at least one alpha chain, all alpha chains were present in multiple BLs, and some BLs contained two or three alpha chains. Detailed analysis of developing kidney revealed that some individual BLs, including those of the tubule and glomerulus, changed in laminin chain composition as they matured, expressing up to three different alpha chains and two different beta chains in an elaborate and dynamic progression. Interspecific backcross mapping of the five alpha chain genes revealed that they are distributed on four mouse chromosomes. Finally, we identified a novel full-length alpha3 isoform encoded by the Lama3 gene, which was previously

  4. Regulation of hepatic branched-chain alpha-keto acid dehydrogenase complex in rats fed a high-fat diet

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Branched-chain alpha-keto acid dehydrogenase complex (BCKDC) regulates branched-chain amino acid (BCAA) metabolism at the level of branched chain alpha-ketoacid (BCKA) catabolism. It has been demonstrated that the activity of hepatic BCKDC is markedly decreased in type 2 diabetic animal...

  5. Salt bridge residues between I-Ak dimer of dimers alpha-chains modulate antigen presentation.

    PubMed

    Yadati, S; Nydam, T; Demian, D; Wade, T K; Gabriel, J L; Barisas, B G; Wade, W F

    1999-03-15

    Class II dimers of dimers are predicted to have functional significance in antigen presentation. The putative contact amino acids of the I-Ak class II dimer of dimers have been identified by molecular modeling based on the DR1 crystal structure (Nydam et al., Int. Immunol. 10, 1237,1998). We have previously reported the role in antigen presentation of dimer of dimers contact amino acids located in the C-terminal domains of the alpha- and beta-chains of class II. Our calculations show that residues Ealpha89 and Ralpha145 in the alpha2-domain form an inter alpha-chain salt bridge between pairs of alphabeta-heterodimers. Other residues, Qalpha92 and Nalpha115, may be involved in close association in that part of the alpha-chain. We investigated the role of these amino acids on class II expression and antigen presentation. Class II composed of an Ealpha89K substituted alpha-chain paired with a wt beta-chain exhibited inhibited antigen presentation and expression of alpha-chain serologic epitopes. In contrast, mutation of Ralpha145E had less affect on antigen presentation and did not affect I-Ak serologic epitopes. Interchanging charges of the salt bridge residues by expressing both Ralpha145E and Ealpha89K on the same chain obviated the large negative effect of the Ealpha89K mutation on antigen presentation but not on the serologic epitopes. Our results are similar for those reported for mutation of DR3's inter-chain salt bridge with the exception that double mutants did not moderate the DR3 defect. Interestingly, the amino acids differences between I-A and DR change the location of the inter-chain salt bridges. In DR1 these residues are located at positions Ealpha88 and Kalpha111; in I-Ak these residues are located at position Ealpha89 and Ralpha145. Inter alpha-chain salt bridges are thus maintained in various class II molecules by amino acids located in different parts of the alpha2-domain. This conservation of structure suggests that considerable functional

  6. Interspecies hybrid HbS: complete neutralization of Val6(beta)-dependent polymerization of human beta-chain by pig alpha-chains.

    PubMed

    Rao, M J; Malavalli, A; Manjula, B N; Kumar, R; Prabhakaran, M; Sun, D P; Ho, N T; Ho, C; Nagel, R L; Acharya, A S

    2000-07-28

    Interspecies hybrid HbS (alpha(2)(P)beta(2)(S)), has been assembled in vitro from pig alpha-globin and human beta(S)-chain. The alpha(2)(P)beta(2)(S) retains normal tetrameric structure (alpha(2)beta(2)) of human Hb and an O(2) affinity comparable to that of HbS in 50 mM Hepes buffer; but, its O(2) affinity is slightly higher than that of HbS in the presence of allosteric effectors (chloride, DPG and phosphate). The (1)H-NMR spectroscopy detected distinct differences between the heme environments and alpha(1)beta(1) interfaces of pig Hb and HbS, while their alpha(1)beta(2) interfaces appear very similar. The interspecies hybrid alpha(2)(H)beta(2)(P) resembles pig Hb; the pig beta-chain dictated the conformation of the heme environment of the human alpha-subunit, and to the alpha(1)beta(1) interfaces of the hybrid. In the alpha(2)(P)beta(2)(S) hybrid, beta(S)-chain dictated the conformation of human heme environment to the pig alpha-chain in the hybrid; but the conformation of alpha(1)beta(1) interface of this hybrid is close to, but not identical to that of HbS. On the other hand, the alpha(1)beta(2) interface conformation is identical to that of HbS. More important, the alpha(2)(P)beta(2)(S) does not polymerize when deoxygenated; pig alpha-chain completely neutralizes the beta(S)-chain dependent polymerization. The polymerization inhibitory propensity of pig alpha-chain is higher when it is present in the cis alpha(P)beta(S) dimer relative to that in a trans alpha(P)beta(A) dimer. The semisynthetically generated chimeric pig-human and human-pig alpha-chains by exchanging the alpha(1-30) segments of human and pig alpha-chains have established that the sequence differences of pig alpha(31-141) segment can also completely neutralize the polymerization. Comparison of the electrostatic potential energy landscape of the alpha-chain surfaces of HbS and alpha(2)(P)beta(2)(S) suggests that the differences in electrostatic potential energy surfaces on the alpha-chain of

  7. Abnormal chromosomal marker (D14 q+) in a patient with alpha heavy chain disease.

    PubMed Central

    Gafter, U; Kessler, E; Shabtay, F; Shaked, P; Djaldetti, M

    1980-01-01

    A patient with alpha heavy chain disease (alphaHCD), who showed an abnormal chromosomal marker (D14 q+) in 10% of the bone marrow cells, is described. The mesenteric lymph nodes, which showed reactive hyperplasia in the first biopsy, transformed later to a malignant lymphoma and finally to a plasma cell tumour. The small intestine revealed villous atrophy, diminished crypts, and intact surface epithelium. The ultrastructure of the goblet and epithelial cells appeared to be normal, and the microvilli were preserved except for circumscribed areas of destruction. The lamina propria was heavily infiltrated with mononuclear cells, mainly mature plasma cells. Alpha heavy chains (alphaHC) were found in the patient's saliva. Images Fig. 6 Fig. 7 Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 Fig. 13 PMID:6767755

  8. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  9. Development of novel monoclonal antibody 4G8 against swine leukocyte antigen class I alpha chain.

    PubMed

    Tang, Wei-Ran; Kiyokawa, Nobutaka; Eguchi, Tomoko; Matsui, Jun; Takenouchi, Hisami; Honma, Daisuk; Yasue, Hiroshi; Enosawa, Shin; Mimori, Kenichi; Itagaki, Mitsuko; Taguchi, Tomoko; Katagiri, Yohko U; Okita, Hajime; Amemiya, Hiroshi; Fujimoto, Junichiro

    2004-06-01

    A mouse monoclonal antibody (MAb) was generated against swine leukocyte antigen (SLA) class I alpha chain. A newly developed series of MAb clones that react with pan leukocytes were selected and tested by immuno-histochemistry using SLA class I alpha chain expressing Cos-7 cells. Among them, MAb 4G8 was characterized by the following features: (1) 4G8 reacted with Cos-7 cells transfected with SLA class I alpha chain from the d haplotype, (2) 4G8 recognized epitopes that were different from those of commercially available anti-SLA class I MAbs 74-11-10 and PT85A, and (3) 4G8 could be used to immunostain frozen sections of thymus, spleen, lymph node, kidney, and liver tissues with good results.

  10. The amino-acid sequence of the alpha-crystallin A chains of red kangaroo and Virginia opossum.

    PubMed

    De Jong, W W; Terwindt, E C

    1976-08-16

    The amino acid sequence of the A chain of the eye lens protein alpha-crystallin from the red kangaroo (Macropus rufus) was completely determined by manual Edman degradation of tryptic, thermolytic and cyanogen bromide peptides. The sequence of the alpha-crystallin A chain from the Virginia opossum (Didelphis marsupialis) was deduced from amino acid analyses and partial Edman degradation of peptides. The 173-residue A chains of kangaroo and opossum differ in six positions, whereas comparison with the bovine alpha-crystallin A chain reveals 17 and 22 substitutions, respectively. Most substitutions occur in the COOH-terminal part of the chain.

  11. Comparative characteristics of mu chain and alpha chain transcripts expressed by individual tonsil plasma cells.

    PubMed

    Yavuz, S; Grammer, A C; Yavuz, A S; Nanki, T; Lipsky, P E

    2001-01-01

    Plasma cells (PCs) are one of the two major cell types generated during germinal center reactions. To test the hypothesis that PCs express a unique repertoire of immunoglobulin (Ig) genes resulting from intensive antigenic stimulation and selection, the mutational pattern and distribution of V(H) gene segments within 178 transcripts amplified from individual IgM and IgA secreting tonsil PCs were analyzed. The results demonstrated that both mu and alpha transcripts expressed repertoires with limited diversity. Moreover, both mu and alpha transcripts were heavily mutated, with a significantly increased mutational frequency noted for alpha compared to mu transcripts (5.0 x 10(-2) vs 1.8 x 10(-2), P<0.001). In addition, both mu and alpha transcripts showed significantly greater targeting of mutations to RGYW motifs (purine/guanine/pyrimidine/A or T) compared to memory B cells. Finally, clonally expanded cells were detected in alpha but not mu PC compartments. These results indicate that antigen driven stimulation and selection shape the entire expressed PC repertoire, but the impact is greater in alpha expressing PCs.

  12. Celluar immunoglobulins in human gamma- and alpha-heavy chain diseases.

    PubMed Central

    Preud'homme, J L; Brouet, J C; Seligmann, M

    1979-01-01

    Proliferating cells from twenty-four patients with alpha- or gamma-heavy chain disease (HCD) were studied by direct immunofluorescence and in several cases by biosynthesis experiments with 14C-amino acid incorporation. In twenty-two patients, the cells contained the HCD proteins only and no light chain synthesis could be detected. Conversely, apparently non-secreted monotypic light chains were found in one case of gamma-HCD and one case of alpha-HCD. The proportion of proliferating cells containing cytoplasmic heavy chains, their appearance and the presence or not of surface heavy chains showed great variation from patient to patient. In some cases, the proliferation predominantly affected either plasma cells or lymphocytes whereas in others the disease seemed to correspond to a proliferation of HCD protein-bearing lymphocytes with persistent maturation into plasma cells. Large cell lymphomas supervening on alpha-HCD belonged to the same proliferating clone as the clone secreting the HCD protein, as shown by surface markers and biosynthesis experiments which demonstrated synthesis but no secretion of HCD proteins. In one patient with gamma-HCD, the cells carried surface gamma and delta chains. PMID:115628

  13. Developmental characterization of the gene for laminin alpha-chain in sea urchin embryos.

    PubMed

    Benson, S; Page, L; Ingersoll, E; Rosenthal, E; Dungca, K; Signor, D

    1999-03-01

    We describe the isolation and characterization of a cDNA clone encoding a region of the carboxy terminal globular domain (G domain) of the alpha-1 chain of laminin from the sea urchin, Strongylocentrotus purpuratus. Sequence analysis indicates that the 1.3 kb cDNA (spLAM-alpha) encodes the complete G2 and G3 subdomains of sea urchin a-laminin. The 11 kb spLAM-alpha mRNA is present in the egg and declines slightly in abundance during development to the pluteus larva. The spLAM-alpha gene is also expressed in a variety of adult tissues. Whole mount in situ hybridization of gastrula stage embryos indicates that ectodermal and endodermal epithelia and mesenchyme cells contain the spLAM-alpha mRNA. Immunoprecipitation experiments using an antibody made to a recombinant fusion protein indicates spLAM-alpha protein is synthesized continuously from fertilization as a 420 kDa protein which accumulates from low levels in the egg to elevated levels in the pluteus larva. Light and electron microscopy identify spLAM-alpha as a component of the basal lamina. Blastocoelic microinjection of an antibody to recombinant spLAM-alpha perturbs gastrulation and skeleton formation by primary mesenchyme cells suggesting an important role for laminin in endodermal and mesodermal morphogenesis. PMID:10330483

  14. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  15. Amino acid sequences of the alpha and beta chains of adult hemoglobin of the slender loris, Loris tardigradus.

    PubMed

    Maita, T; Goodman, M; Matsuda, G

    1978-08-01

    alpha and beta chains from adult hemoglobin of the slender loris (Loris tardigradus) were isolated by Amberlite CG-50 column chromatography. After S-aminoethylation, both chains were digested with trypsin and the amino acid sequences of the tryptic peptides obtained were analyzed. Further, the order of these tryptic peptides in each chain was deduced from their homology with the primary structures of alpha and beta chains of human adult hemoglobin. Comparing the primary structures of the alpha and beta chains of adult hemoglobin of the slender loris thus obtained with those of adult hemoglobin of the slow loris, 4 amino acid substitutions in the alpha chains and 2 in the beta chains were recognized.

  16. Six HLA-D region alpha-chain genes on human chromosome 6: polymorphisms and associations of DC alpha-related sequences with DR types.

    PubMed Central

    Spielman, R S; Lee, J; Bodmer, W F; Bodmer, J G; Trowsdale, J

    1984-01-01

    Analysis of cosmid clones containing genes related to the HLA-DR alpha chain calls for at least six HLA-D region alpha-chain coding sequences in man; namely, DR alpha, DC alpha, DX alpha (very closely related to DC alpha), SB alpha 1, SB alpha 2 (two closely linked genes on the same cosmid clones), and DZ alpha. The first four genes have been described previously. SB alpha 2 and DZ alpha are recently identified genes, characterized by their unique and, from a limited study, nonpolymorphic bands when used as probes for human DNA on Southern blots. All of the genes are present in somatic cell hybrids containing a human X/6 translocation chromosome, and so they are all presumably in the HLA region. The polymorphisms in the region of the DC alpha and related DX alpha genes were studied with Southern blots of DNA from a set of mostly homozygous HLA-D-typing cell lines. With EcoRI, the band patterns for the DC alpha gene corresponded to the major cross-reactive HLA-DR serotypes associated with DC (namely MT1, -2, and -3) while the DX alpha band was invariant. Both genes were polymorphic with the enzyme Taq I. Within some DR types additional polymorphic variation was detected at the DNA level, implying the existence of subtypes. The pattern of polymorphisms for DC alpha, and to a lesser extent for DX alpha, suggests that these genes may play an important role in certain HLA-D associations with disease. Images PMID:6328517

  17. Sugar chain of alpha-fetoprotein produced in human yolk sac tumor.

    PubMed

    Yamashita, K; Hitoi, A; Tsuchida, Y; Nishi, S; Kobata, A

    1983-10-01

    The carbohydrate moiety of alpha-fetoprotein purified from human yolk sac tumors grown in nude mice was quantitatively released from the polypeptide chain as oligosaccharides by hydrazinolysis. The oligosaccharides were separated into a neutral and two acidic oligosaccharides by paper electrophoresis. By sequential exoglycosidase digestion in combination with per-O-methylation study and periodate oxidation, their structures were determined to be: Gal beta 1 leads to 4GlcNAc beta 1 leads to 2Man alpha 1 leads to 6(GlcNAc beta 1 leads to 4) (Gal beta 1 leads to 4GlcNAc beta 1 leads to 2Man alpha 1 leads to 3)Man beta 1 leads to 4GlcNAc beta 1 leads to 4(Fuc alpha 1 leads to 6)GlcNAcOT, Gal beta 1 leads to 4GlcNAc beta 1 leads to 2Man alpha 1 leads to 6(GlcNAc beta 1 leads to 4) (Sia alpha 2 leads to 6Gal beta 1 leads to 4GlcNAc beta 1 leads to 2Man alpha 1 leads to 3)Man beta 1 leads to 4GlcNAc beta 1 leads to 4(Fuc alpha 1 leads to 6)GlcNAcOT; and Sia alpha 2 leads to 6Gal beta 1 leads to 4GlcNAc beta 1 leads to 2Man alpha 1 leads to 6(GlcNAc beta 1 leads to 4) (Sia alpha 2 leads to 6Gal beta 1 leads to 4GlcNAc beta 1 leads to 2Man alpha 1 leads to 3)Man beta 1 leads to 4 GlcNAc beta 1 leads to 4(Fuc alpha 1 leads to 6)GlcNAcOT, in which Gal is galactose, GlcNac is N-acetylglucosamine, Man is mannose, Fuc is fucose, Sia is sialic acid, and Subscript OT is the NaB3H4-reduced oligosaccharide. PMID:6192908

  18. Normal transcription of the beta-hexosaminidase alpha-chain gene in the Ashkenazi Tay-Sachs mutation.

    PubMed

    Paw, B H; Neufeld, E F

    1988-02-25

    Tay-Sachs disease is a biochemically heterogeneous lysosomal storage disorder caused by lack of the A isoenzyme of beta-hexosaminidase; the underlying defect is a mutation in the gene encoding the alpha-chain. It has been shown that fibroblasts isolated from Tay-Sachs patients of Ashkenazi Jewish origin contain no alpha-chain mRNA detectable on Northern blots. We now have compared run-on transcription in nuclei isolated from three strains of Ashkenazi Tay-Sachs fibroblasts and from a strain of normal (IMR90) cells. Using alpha-chain and beta-chain cDNAs as probes, we found no difference in the relative amount of [32P]ribonucleotide added to nascent transcripts; the average ratio of alpha/beta hybridizable radioactivity was 1.3 and 1.4 for mutant and normal cells, respectively. The identity of the Tay-Sachs alpha-chain transcript was confirmed by competition hybridization with excess alpha-chain mRNA. The results indicate that the Ashkenazi Tay-Sachs mutation permits a normal level of transcription of the alpha-chain gene and points to a posttranscriptional defect, such as RNA processing, transport, or stability.

  19. Random length assortment of human and mouse T cell receptor for antigen alpha and beta chain CDR3.

    PubMed

    Johnson, G; Wu, T T

    1999-10-01

    In view of the recently determined three-dimensional structures of complexes formed by the T cell receptor for antigen (TCR), the processed peptide and the MHC class I molecule, it is expected that the combined configuration formed by the third complementarity determining regions (CDR3) of TCR alpha and beta chains will be very restricted in size and shape due to the limited length variations of the processed peptides. Thus, the combined TCR alpha and beta chain CDR3 lengths should have a fairly narrow distribution. This feature can be due to the selective association of long alpha chain CDR3 with short beta chain CDR3 and vice versa or due to random assortment of alpha and beta chain CDR3 of even narrower length distribution. Based on existing translated amino acid sequence data, it has been found that the latter mechanism is responsible.

  20. Prenatal diagnosis of alpha-thalassemia by polymerase chain reaction and dual restriction enzyme analysis.

    PubMed

    Lebo, R V; Saiki, R K; Swanson, K; Montano, M A; Erlich, H A; Golbus, M S

    1990-08-01

    Asian couples at risk for a fetus with homozygous alpha-thalassemia (hydrops fetalis) are often identified by their low erythrocyte mean corpuscular volume (MCV) and normal hemoglobin electrophoresis when little time remains to test their genotypes by restriction enzyme analysis. DNA analysis is performed directly on chorionic villi or amniocytes remaining after an aliquot is used to establish a backup cell culture. The polymerase chain reaction (PCR) protocol quickly determines whether the fetus has hydrops fetalis without waiting for cultured cells to grow. Previously, growing cultured fetal cells to obtain more fetal material to establish unambiguously the fetal genotype with two independent restriction enzyme digests absorbed a significant portion of the time remaining to complete prenatal diagnosis. A dual restriction enzyme digestion protocol was development using a 3' zeta-globin probe to clearly distinguish the most common alpha-thalassemia deletions that represent nearly all the alpha-thalassemia haplotypes in Southeast Asia.

  1. Chain-shortening of prostaglandin F2 alpha by rat liver peroxisomes.

    PubMed

    Diczfalusy, U; Alexson, S E; Pedersen, J I

    1987-05-14

    Liver peroxisomes were isolated from di(2-ethylhexyl)phthalate treated rats by isopycnic sucrose gradient centrifugation of a light mitochondrial fraction. Incubation of prostaglandin F2 alpha with purified peroxisomes resulted in conversion into a more polar product(s). In contrast, incubation with mitochondrial fractions and microsomal fractions under the same conditions did not result in any detectable conversion. The polar material obtained from a preparative incubation was purified by high performance liquid chromatography and characterized by radio-gas chromatography and gas chromatography-mass spectrometry. The structure of the polar compound was shown to be 5,7,11-trihydroxy-tetranorprost-9-enoic acid (tetranor-prostaglandin F1 alpha). Prostaglandin F2 alpha was thus chain-shortened by four carbon atoms. PMID:3472523

  2. Inhibition of laminin alpha 1-chain expression leads to alteration of basement membrane assembly and cell differentiation

    PubMed Central

    1996-01-01

    The expression of the constituent alpha 1 chain of laminin-1, a major component of basement membranes, is markedly regulated during development and differentiation. We have designed an antisense RNA strategy to analyze the direct involvement of the alpha 1 chain in laminin assembly, basement membrane formation, and cell differentiation. We report that the absence of alpha 1-chain expression, resulting from the stable transfection of the human colonic cancer Caco2 cells with an eukaryotic expression vector comprising a cDNA fragment of the alpha 1 chain inserted in an antisense orientation, led to (a) an incorrect secretion of the two other constituent chains of laminin-1, the beta 1/gamma 1 chains, (b) the lack of basement membrane assembly when Caco2-deficient cells were cultured on top of fibroblasts, assessed by the absence of collagen IV and nidogen deposition, and (c) changes in the structural polarity of cells accompanied by the inhibition of an apical digestive enzyme, sucrase-isomaltase. The results demonstrate that the alpha 1 chain is required for secretion of laminin-1 and for the assembly of basement membrane network. Furthermore, expression of the laminin alpha 1-chain gene may be a regulatory element in determining cell differentiation. PMID:8609173

  3. Structure and diversity of the T-cell receptor alpha chain in the Mexican axolotl.

    PubMed

    Fellah, J S; Kerfourn, F; Dumay, A M; Aubet, G; Charlemagne, J

    1997-01-01

    Polymerase chain reaction was used to isolate cDNA clones encoding putative T-cell receptor (TCR) alpha chains in an amphibian, the Mexican axolotl (Ambystoma mexicanum). Five TCRalpha-V chain-encoding segments were identified, each belonging to a separate family. The best identity scores for these axolotl TCRalpha-V segments were all provided by sequences belonging to the human TCRalpha-V1 family and the mouse TCRalpha-V3 and TCRalpha-V8 families. A total of 14 different TCRA-J segments were identified from 44 TCRA-V/TCRA-J regions sequenced, suggesting that a large repertoire of TCRA-J segments is a characteristic of most vertebrates. The structure of the axolotl CDR3 alpha chain loop is in good agreement with that of mammals, including a majority of small hydrophobic residues at position 92 and of charged, hydrophilic, or polar residues at positions 93 and 94, which are highly variable and correspond to the TCRA-V/J junction. This suggests that some positions of the axolotl CDR3 alpha chain loop are positively selected during T-cell differentiation, particularly around residue 93 that could be selected for its ability to makes contacts with major histocompatibility complex-associated antigenic peptides, as in mammals. The axolotl Calpha domain had the typical structure of mammalian and avian Calpha domains, including the charged residues in the TM segment that are thought to interact with other proteins in the membrane, as well as most of the residues forming the conserved antigen receptor transmembrane motif. PMID:9002443

  4. Structural organization of the human cardiac [alpha]-myosin heavy chain gene (MYH6)

    SciTech Connect

    Epp, T.A.; Dixon, I.M.C.; Wang, H.Y.; Sole, M.J.; Liew, C.C. )

    1993-12-01

    The human myocardium expresses two cardiac myosin heavy chain (MyHC) isoforms, [alpha] and [beta], that exist in tandem array on chromosome 14q12. The authors have previously sequenced the entire human cardiac [beta]-MyHC gene and now report the complete nucleotide sequence of the human cardiac [alpha]-MyHC, encompassing 26,159 bp as well as the entire 4484-bp 5'-flanking intergenic region. The gene (MYH6) consists of 39 exons, 37 of which contain coding information. The 5'-untranslated region is split into 3 exons, with the third exon containing the AUG translocation initiation codon. With the exception of the 13th intron of the human cardiac [beta]-MyHC, which is not present within the [alpha]-isogene, all exon/intron boundaries are conserved. Conspicuous sequence motifs contained within the [alpha]-MyHC gene include four Alu repeats, a single (GT)[sub n] element, and a homopurine-homopyrimidine tract containing 23 GAA repeating units followed by 10 GAG repeating units. Comparison of the encoded amino acid sequence with a previously reported human [alpha]-MyHC cDNA sequence reveals several potential polymorphisms. 29 refs., 1 fig., 1 tab.

  5. Altered enteroendocrine cell expression in T cell receptor alpha chain knock-out mice.

    PubMed

    Rubin, D C; Zhang, H; Qian, P; Lorenz, R G; Hutton, K; Peters, M G

    2000-10-15

    Mice lacking T cell receptor alpha chain (TCRalpha(-/-)) develop inflammation of the colon. We have examined the effect of this inflammation on the colonic epithelium by studying markers of epithelial cuff, enteroendocrine, and immune cell differentiation. Using immunohistochemical techniques, colons were compared in normal C57/BL6 and murine TCR alpha(-/-) mice aged 2 and 3 weeks and 3-11 months. TCR alpha(-/-) mice aged 3-11 months had histologic evidence of inflammation with increased expression of CD45, CD4+, CD8+, and B220+ cells and a decrease in expression of IgA+ cells. There was a decrease in the number of cholecystokinin, serotonin, and neurotensin enteroendocrine expressing cells in the colon of TCR alpha(-/-) mice. These changes were not present in 2-3-week-old suckling/weaning mice. In contrast, peptide tyrosine tyrosine (PYY), glucagon-like peptide-1, and gastrin expression did not change and small intestinal enteroendocrine cells remained unaltered. The change in colonic enteroendocrine cell expression appears to be a specific response, since only a subset of these cells was altered, and the epithelium was intact by histologic analysis. The absence of functional T cells in TCR alpha(-/-) colon has a marked effect on differentiation of a specific subpopulation of enteroendocrine cells, prior to loss of integrity of the epithelium. PMID:11054861

  6. Immunoblastic lymphoma involving the bone marrow in a patient with alpha chain disease. Clinical and immunoelectron microscopic study.

    PubMed

    Reyes, F; Piquet, J; Gourdin, M F; Haioun, C; Intrator, L; Tulliez, M; Roberti, A; Rambaud, J C

    1985-03-01

    A patient is reported who had disseminated immunoblastic proliferation that emerged during the course of alpha chain disease. This proliferation was characterized by overt marrow invasion together with osseous and neurologic manifestations. On immunoelectron microscopic study, the malignant immunoblasts displayed varying degrees of cytoplasmic maturation and constituted a morphologic spectrum of alpha-chain-synthesizing cells, ranging from immature blasts without endoplasmic reticulum development to relatively mature plasmablasts; alpha chain was not expressed at the surface of these cells. The general features of the overt malignant stage of alpha chain disease are reviewed in reference to this unusual case. The implications of the cellular findings are discussed with regard to the maturation stage of malignant immunoblasts. PMID:3917845

  7. Human collagen genes encoding basement membrane. cap alpha. 1(IV) and. cap alpha. 2(IV) chains map to the distal long arm of chromosome 13

    SciTech Connect

    Griffin, C.A.; Emanuel, B.S.; Hansen, J.R.; Cavenee, W.K.; Myers, J.C.

    1987-01-01

    At least 20 genes encode the structurally related collagen chains that comprise > 10 homo- or heterotrimeric types. Six members of this multigene family have been assigned to five chromosomes in the human genome. The two type I genes, ..cap alpha..1 and ..cap alpha..2, are located on chromosomes 17 and 7, respectively, and the ..cap alpha..1(II) gene is located on chromosome 12. Their recent mapping of the ..cap alpha..1(III) and ..cap alpha..2(V) genes to the q24.3 ..-->.. q31 region of chromosome 2 provided the only evidence that the collagen genes are not entirely dispersed. To further determine their organization, the authors and others localized the ..cap alpha..1(IV) gene to chromosome 13 and in their experiments sublocalized the gene to band q34 by in situ hybridization. Here they show the presence of the ..cap alpha..2 type IV locus also on the distal long arm of chromosome 13 by hybridizing a human ..cap alpha..2(IV) cDNA clone to rodent-human hybrids and to metaphase chromosomes. These studies represent the only demonstration of linkage between genes encoding both polypeptide chains of the same collagen type.

  8. [Antioxidant effectiveness of short-chain alpha-tocopherol acetate in acute paracetamol poisoning in rats].

    PubMed

    Shaiakhmetova, H M; Kovalenko, V M; Bondarenko, L B; Kuz'menko, I V

    2000-01-01

    In the experiments in vivo on white rats possibility of paracetamol hepatotoxic effects correction with synthetic short-chain alpha-tocopherol derivative and pharmacopeial preparation of vitamin E has been studied. Levels of superoxide anion generation in liver mitochondria fraction, catalase activity and reduced glutathione, serum aminotransferase and alcaline phosphatase activities and liver subcellular fractions lipid contents were investigated. It was shown that the short-chain vitamin E derivative and pharmacopeial preparation had a membranotropic effect, normalizing free and total cholesterol levels in liver mitochondria fraction and decreasing serum aminotransferase activity level. Investigated compounds also decreased levels of superoxide anions generation, increased catalase activity and level of reduced glutathione in liver. Antioxidative properties of this derivative and pharmacopeial preparation were demonstrated both at the primary (dienes, trienes) and at final steps of lipid peroxidation (TBA-products formation). This antioxidative activity of alpha-tocopherol acetate and its derivative depended on the structure of chromane cycle but not on the length of side chain.

  9. Differential transcription of multiple forms of alpha-2-macroglobulin in carp (Cyprinus carpio) infected with parasites.

    PubMed

    Onara, Dalia F; Forlenza, Maria; Gonzalez, Santiago F; Rakus, Krzysztof Ł; Pilarczyk, Andrzej; Irnazarow, Ilgiz; Wiegertjes, Geert F

    2008-01-01

    Alpha-2-macroglobulin (a2M) is a non-specific protease inhibitor involved in host defense mechanisms, inhibiting both endogenous and exogenous proteases. It is unique among the plasma anti-proteases with respect to the diversity of proteases that it can inactivate. Carp a2M consists of an alpha and beta chain of which the first includes the bioactive regions. Previously, three a2M alpha chain sequences were reported for East-Asian common carp. We studied a2M alpha chain variability in European common carp and report the cloning of a fourth a2M alpha chain with distinct sequence diversity in the bait region. The role of a2M in the immune response to parasites was studied in the liver of carp infected with Trypanoplasma borreli or with Ichthyophthirius multifiliis. Quantitative gene transcription analysis showed a differential regulation of the four isoforms, most clearly seen in infections with I. multifiliis. A2M3 was the only a2M isoform with a highly upregulated transcription during infection, suggesting that this particular isoform is of foremost biological importance.

  10. Characterization of the 5'-flanking region of the gene for the alpha chain of human fibrinogen.

    PubMed

    Hu, C H; Harris, J E; Davie, E W; Chung, D W

    1995-11-24

    The 5'-flanking region of the gene coding for the alpha chain of human fibrinogen was isolated, sequenced, and characterized. The principal site of transcription initiation was determined by primer extension analysis and the RNase protection assay and shown to be at an adenine residue located 55 nucleotides upstream from the initiator methionine codon, or 13,399 nucleotides down-stream from the polyadenylation site of the gene coding for the gamma chain. Transient expression of constructs containing sequentially deleted 5'-flanking sequences of the alpha chain gene fused to the chloramphenicol acetyltransferase reporter gene showed that the promoter was liver-specific and inducible by interleukin 6 (IL-6). The shortest DNA fragment with significant promoter activity and full response to IL-6 stimulation encompassed the region from -217 to +1 base pairs (bp). Although six potential IL-6 responsive sequences homologous to the type II IL-6 responsive element were present, a single sequence of CTGGGA localized from -122 to -127 bp was shown to be a functional element in IL-6 induction. A hepatocyte nuclear factor 1 (HNF-1) binding site, present from -47 to -59 bp, in combination with other upstream elements, was essential for liver-specific expression of the gene. A functional CCAAT/enhancer binding protein site (C/EBP, -134 to -142 bp) was also identified within 217 bp from the transcription initiation site. An additional positive element (-1393 to -1133 bp) and a negative element (-1133 to -749 bp) were also found in the upstream region of the alpha-fibrinogen gene. PMID:7499335

  11. Many-particle decays of {alpha}-chain structures in {sup 24}Mg

    SciTech Connect

    Wuosmaa, A.H.

    1993-12-31

    We have searched for evidence of exotic cluster configurations in {sup 24}Mg resembling a linear chain of {alpha} particles in various many-particle final states of the {sup 12}C+{sup 12}C system, including {sup 1}C(O{sub 2}{sup +})+{sup 12}C(O{sub 2}{sup +}) and {sup 8}Be+{sup 16}O*(4a). Such configurations are predicted to occur by a number of different theoretical models of the structure of {sup 24}Mg. An array of highly segmented Double-Sided Silicon Strip Detectors permits detailed, high resolution reconstruction of these many-charged-particle final states.

  12. Conformation Analysis of Peptides Derived from Laminin Alpha 1-2 Chain Using Molecular Dynamics Simulation

    NASA Astrophysics Data System (ADS)

    Yamada, Hironao; Fukuda, Masaki; Miyakawa, Takeshi; Morikawa, Ryota; Takasu, Masako

    Laminin is one of the components of the basement membrane and has diverse biological activities. Several functional peptides (EF1-EF5) are identified from LG4 modules of laminin alpha 1-5 chains. Thus, we perform conformation analysis of EF1 and EF2 using molecular dynamics simulations. In this study, we perform structure sampling with NPT ensemble (300 K, 1 bar). Our results show that EF1 peptide has β-sheet structure in water, and EF2 peptide does not have. Likewise, the EF2 peptide has unstable structure compared with the EF1 peptide in water.

  13. A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

    SciTech Connect

    Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y. )

    1989-11-15

    The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with ({sup 3}H)N-ethylmaleimide. This pool of soluble alpha chains was 0.067 {plus minus} 0.017% of hemoglobin in blood of normal adult, 0.11 {plus minus} 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using ({sup 3}H)N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups.

  14. Murine laminin alpha3A and alpha3B isoform chains are generated by usage of two promoters and alternative splicing.

    PubMed

    Ferrigno, O; Virolle, T; Galliano, M F; Chauvin, N; Ortonne, J P; Meneguzzi, G; Aberdam, D

    1997-08-15

    We already identified two distinct laminin alpha3A and alpha3B chain isoforms which differ in their amino-terminal ends and display different tissue-specific expression patterns. In this study we have investigated whether these two different isoforms are products of the same laminin alpha3 (lama3) gene and transcribed from one or two separate promoters. Genomic clones were isolated that encompass the sequences upstream to the 5' ends of both the alpha3A and the alpha3B cDNAs. Sequence analysis of the region upstream to the alpha3A open reading frame revealed the presence of a TATA box and potential binding sites for responsive elements. By primer extension analysis, the transcription start site of the alpha3B mRNA isoform was defined. The sequences upstream to the alpha3B mRNA transcription start site do not contain a TATA box near the transcription initiation sites, but AP-1, AP-2, and Sp1 consensus binding site sequences were identified. The genomic regions located immediately upstream of the alpha3A and alpha3B transcription start sites were shown to possess promoter activities in transfection experiments. In the promoter regions, response elements for the acute phase reactant signal and NF-interleukin 6 were found, and their possible relevance in the context of inflammation and wound healing is discussed. Our results demonstrate that the lama3 gene produces the two polypeptides by alternative splicing and contains two promoters, which regulate the production of the two isoforms alpha3A and alpha3B. PMID:9252362

  15. [Hemoglobin of the golden eagle (Aquila chrysaetos, Accipitriformes): amino acid sequence of the alpha A- and beta chains of the principal component].

    PubMed

    Oberthür, W; Braunitzer, G; Grimm, F; Kösters, J

    1983-07-01

    The primary structures of the alpha A- and beta-chains from the major hemoglobin component of Golden Eagle (Aquila chrysaetos) are given. By homologous comparison, Greylag Goose (Anser anser) hemoglobin and Golden Eagle alpha A-chains differ by 17 amino acids or 19 nucleotides (2 two-point mutations), beta-chains by 9 exchanges. Five substitutions have modified alpha 1 beta 1-contacts, one substitution, one alpha 1 beta 2-contact and one alpha 1 alpha 1-contact. Differences by homologous comparison to other hemoglobins of birds are discussed. PMID:6618445

  16. {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd elastic scattering and systematic investigation of elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chains

    SciTech Connect

    Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.; Elekes, Z.; Farkas, J.; Somorjai, E.; Mohr, P.; Yalcin, C.; Galaviz, D.; Gueray, R. T.; Oezkan, N.; Goerres, J.

    2011-06-15

    The elastic scattering cross sections for the reactions {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd at energies above and below the Coulomb barrier are presented to provide a sensitive test for the {alpha}-nucleus optical potential parameter sets. Additional constraints for the optical potential are taken from the analysis of elastic scattering excitation functions at backward angles which are available in literature. Moreover, the variation of the elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chain is investigated by the study of the ratios of the {sup 106,110,116}Cd({alpha},{alpha}){sup 106,110,116}Cd scattering cross sections at E{sub cm{approx_equal}}15.6and18.8 MeV and the ratio of the {sup 110}Cd({alpha},{alpha}){sup 110}Cd and {sup 112}Sn({alpha},{alpha}){sup 112}Sn reaction cross sections at E{sub cm{approx_equal}}18.8 MeV, respectively. These ratios are sensitive probes for the {alpha}-nucleus optical potential parametrizations. The potentials under study are a basic prerequisite for the prediction of {alpha}-induced reaction cross sections (e.g., for the calculation of stellar reaction rates in the astrophysical p or {gamma} process).

  17. Direct binding of F actin to the cytoplasmic domain of the alpha 2 integrin chain in vitro

    NASA Technical Reports Server (NTRS)

    Kieffer, J. D.; Plopper, G.; Ingber, D. E.; Hartwig, J. H.; Kupper, T. S.

    1995-01-01

    The transmembrane integrins have been shown to interact with the cytoskeleton via noncovalent binding between cytoplasmic domains (CDs) of integrin beta chains and various actin binding proteins within the focal adhesion complex. Direct or indirect integrin alpha chain CD binding to the actin cytoskeleton has not been reported. We show here that actin, as an abundant constituent of focal adhesion complex proteins isolated from fibroblasts, binds strongly and specifically to alpha 2 CD, but not to alpha 1 CD peptide. Similar specific binding to alpha 2 CD peptide was seen for highly purified F actin, free of putative actin-binding proteins. The bound complex of actin and peptide was visualized directly by coprecipitation, and actin binding was abrogated by removal of a five amino acid sequence from the alpha 2 CD peptide. Our findings may explain the earlier observation that, while integrins alpha 2 beta 1 and alpha 1 beta 1 both bind to collagen, only alpha 2 beta 1 can mediate contraction of extracellular collagen matrices.

  18. Murine branched chain alpha-ketoacid dehydrogenase kinase; cDNA cloning, tissue distribution, and temporal expression during embryonic development.

    PubMed

    Doering, C B; Coursey, C; Spangler, W; Danner, D J

    1998-06-01

    These studies were designed to demonstrate the structural and functional similarity of murine branched chain alpha-ketoacid dehydrogenase and its regulation by the complex-specific kinase. Nucleotide sequence and deduced amino acid sequence for the kinase cDNA demonstrate a highly conserved coding sequence between mouse and human. Tissue-specific expression in adult mice parallels that reported in other mammals. Kinase expression in female liver is influenced by circadian rhythm. Of special interest is the fluctuating expression of this kinase during embryonic development against the continuing increase in the catalytic subunits of this mitochondrial complex during development. The need for regulation of the branched chain alpha-ketoacid dehydrogenase complex by kinase expression during embryogenesis is not understood. However, the similarity of murine branched chain alpha-ketoacid dehydrogenase and its kinase to the human enzyme supports the use of this animal as a model for the human system. PMID:9611264

  19. Glucocorticoid regulation of branched-chain alpha-ketoacid dehydrogenase E2 subunit gene expression.

    PubMed Central

    Costeas, P A; Chinsky, J M

    2000-01-01

    Regulation of the mammalian branched-chain alpha-ketoacid dehydrogenase complex (BCKAD) occurs under a variety of stressful conditions associated with changes in circulating glucocorticoids. Multiple levels of regulation in hepatocytes, including alteration of the levels of the structural subunits available for assembly (E1, alpha-ketoacid decarboxylase; E2, dihydrolipoamide acyltransferase; and E3, dihydrolipoamide dehydrogenase), as well as BCKAD kinase, which serves to phosphorylate the E1alpha subunit and inactivate complex activity, have been proposed. The direct role of glucocorticoids in regulating the expression of the murine gene encoding the major BCKAD subunit E2, upon which the other BCKAD subunits assemble, was therefore examined. Deletion analysis of the 5' proximal 7.0 kb of the murine E2 promoter sequence, using E2 promoter/luciferase expression minigene plasmids introduced into the hepatic H4IIEC3 cell line, suggested a promoter proximal region responsive to glucocorticoid regulation. Linker-scanning mutagenesis combined with deletion analysis established this functional glucocorticoid-responsive unit (GRU) to be located near the murine E2 proximal promoter site at -140 to -70 bp upstream from the transcription initiation site. The presence of this region in plasmid minigenes, containing varying amounts of the murine genomic sequence 5' upstream from proximal E2 promoter sequences, conferred 2-10 fold increases in luciferase reporter gene expression in H4IIEC3 cells, whether introduced by transient transfection or following co-selection for stable transfectants. The GRU region itself appeared to contain multiple interacting elements that combine to regulate overall E2 promoter activity in response to changing physiological conditions associated with varying concentrations of glucocorticoids and likely other hormonal effectors. PMID:10749674

  20. Promiscuous presentation and recognition of nucleosomal autoepitopes in lupus: role of autoimmune T cell receptor alpha chain.

    PubMed

    Shi, Y; Kaliyaperumal, A; Lu, L; Southwood, S; Sette, A; Michaels, M A; Datta, S K

    1998-02-01

    T cells specific for nucleosomal autoepitopes are selectively expanded in lupus mice and these Th cells drive autoimmune B cells to produce pathogenic antinuclear antibodies. We transfected the TCR-alpha and -beta chain genes of a representative, pathogenic autoantibody-inducing Th clone specific for the nucleosomal core histone peptide H471-94 into TCR-negative recipient cells. Although the autoimmune TCRs were originally derived from SNF1 (I-Ad/q) mice, the transfectants could recognize the nucleosomal autoepitope presented by APC-bearing I-A molecules of all haplotypes tested, as well as human DR molecules. Competition assays indicated that the autoepitopes bound to the MHC class II groove. Most remarkably, MHC-unrestricted recognition of the nucleosomal peptide epitope was conferred by the lupus TCR-alpha chain even when it paired with a TCR-beta chain of irrelevant specificity. Several other disease-relevant Th clones and splenic T cells of lupus mice had similar properties. The TCR-alpha chains of these murine lupus Th clones shared related motifs and charged residues in their CDRs, and similar motifs were apparent even in TCR-alpha chains of human lupus Th clones. The lupus TCR-alpha chains probably contact the nucleosomal peptide complexed with MHC with relatively high affinity/avidity to sustain TCR signaling, because CD4 coreceptor was not required for promiscuous recognition. Indeed, pathogenic autoantibody-inducing, CD4-negative, TCR-alphabeta+ Th cells are expanded in systemic lupus erythematosus. These results have implications regarding thymic selection and peripheral expansion of nucleosome-specific T cells in lupus. They also suggest that universally tolerogenic epitopes could be designed for therapy of lupus patients with diverse HLA alleles. We propose to designate nucleosomes and other antigens bearing universal epitopes "Pantigens" (for promiscuous antigens).

  1. Complete primary structure of the triple-helical region and the carboxyl-terminal domain of a new type IV collagen chain, alpha 5(IV).

    PubMed

    Pihlajaniemi, T; Pohjolainen, E R; Myers, J C

    1990-08-15

    We have isolated and characterized overlapping cDNA clones which code for a previously unidentified human collagen chain. Although the cDNA-derived primary structure of this new polypeptide is very similar to the basement membrane collagen alpha 1(IV) and alpha 2(IV) chains, the carboxyl-terminal collagenous/non-collagenous junction sequence does not correspond to the junction sequence in either of the newly described alpha 3(IV) or alpha 4(IV) chains (Butkowski, R.J., Langeveld, J.P.M., Wieslander, J., Hamilton, J., and Hudson, B. G. (1987) J. Biol. Chem. 262, 7874-7877). Thus the protein presented here has been designated the alpha 5 chain of type IV collagen. Four clones encode an open reading frame of 1602 amino acids that cover about 95% of the entire chain including half of the amino-terminal 7S domain and all of the central triple-helical region and carboxyl-terminal NC1 domain. The collagenous region of the alpha 5(IV) chain contains 22 interruptions which are in most cases identical in distribution to those in both the alpha 1(IV) and alpha 2(IV) chains. Despite the relatively low degree of conservation among the amino acids in the triple-helical region of the three type IV collagen chains, analysis of the sequences clearly showed that alpha 5(IV) is more related to alpha 1(IV) than to alpha 2(IV). This similarity between the alpha 5(IV) and alpha 1(IV) chains is particularly evident in the NC1 domains where the two polypeptides are 83% identical in contrast to the alpha 5(IV) and alpha 2(IV) identity of 63%. In addition to greatly increasing the complexity of basement membranes, the alpha 5 chain of type IV collagen may be responsible for specialized functions of some of these extracellular matrices. In this regard, it is important to note that we have recently assigned the alpha 5(IV) gene to the region of the X chromosome containing the locus for a familial type of hereditary nephritis known as Alport syndrome (Myers, J.C., Jones, T.A., Pohjalainen, E

  2. Epoxidation of plasmalogens: source for long-chain alpha-hydroxyaldehydes in subcellular fractions of bovine liver.

    PubMed Central

    Loidl-Stahlhofen, A; Hannemann, K; Felde, R; Spiteller, G

    1995-01-01

    1. Masked long-chain alpha-hydroxyaldehydes were trapped in all subcellular fractions of bovine liver by application of pentafluorbenzyloxime derivatization [van Kuijk, Thomas, Stephens and Dratz (1986) Biochem. Biophys. Res. Commun. 139, 144-149] and quantified via GLC/MS using characteristic ion traces. 2. The chain-length profile of long-chain 2-hydroxyalkanales clearly indicates their relationship to plasmalogens as precursor molecules. 3. The previously postulated existence of alpha-acyloxyplasmalogens as precursor molecules of masked long-chain alpha-hydroxyaldehydes in bovine tissue lipids [Lutz and Spiteller (1991) Liebigs Ann. Chem. 1991, 563-567] was excluded. 4. The constant oxidation rate of plasmalogens in all subcellular fractions provides conclusive evidence for a non-enzymic plasmalogen epoxidation process (probably via hydroperoxy radicals). 5. The high reactivity of alpha-hydroxyaldehydes sheds some doubt on the postulation that plasmalogens protect mammalian cells against oxidative stress as postulated previously [Morand, Zoeller and Raetz (1988) J. Biol. Chem. 263, 11590-11596; Morand, Zoeller and Raetz (1988) J. Biol. Chem. 263, 11597-11606]. Images Figure 4 PMID:7639697

  3. Cloning of the LamA3 gene encoding the alpha 3 chain of the adhesive ligand epiligrin. Expression in wound repair.

    PubMed

    Ryan, M C; Tizard, R; VanDevanter, D R; Carter, W G

    1994-09-01

    We have isolated cDNA clones encoding the entire 170-kDa chain of epiligrin (alpha 3Ep) and a genomic clone encoding the alpha 3Ep gene (LamA3). Analysis of multiple cDNA clones revealed two distinct transcripts (alpha 3EpA and alpha 3EpB). Sequencing of the alpha 3EpA transcript indicated sequence and structural homology to laminin alpha 1 and alpha 2 chains that extend from domain IIIa through the carboxyl-terminal G domain. The alpha 3EpB transcript encodes a larger amino-terminal domain and contains additional epidermal growth factor repeats and sequences corresponding to domain IV of alpha 1 laminin. Fluorescence in situ hybridization indicated that the LamA3 gene is located on chromosome 18q11.2, a locus distinct from the LamA1 gene (18p11.3). The G domain of the epiligrin alpha 3 chain contains five subdomains that are individually related to the G subdomains reported for Drosophila and vertebrate laminin alpha chains. Sequence divergence within the G domain of alpha 3 epiligrin suggests that it is functionally distinct from laminin, consistent with our previous report showing that epiligrin interacts with different integrin adhesion receptors. Analysis of RNA from human foreskin keratinocytes (HFKs) identified multiple epiligrin transcripts that were down-regulated by viral transformation and differentiation. In contrast, epiligrin expression was up-regulated in wound sites of human skin. PMID:8077230

  4. Separation and characterization of alpha-chain subunits from tilapia (Tilapia zillii) skin gelatin using ultrafiltration.

    PubMed

    Chen, Shulin; Tang, Lanlan; Su, Wenjin; Weng, Wuyin; Osako, Kazufumi; Tanaka, Munehiko

    2015-12-01

    Alpha-chain subunits were separated from tilapia skin gelatin using ultrafiltration, and the physicochemical properties of obtained subunits were investigated. As a result, α1-subunit and α2-subunit could be successfully separated by 100 kDa MWCO regenerated cellulose membranes and 150 kDa MWCO polyethersulfone membranes, respectively. Glycine was the most dominant amino acid in both α1-subunit and α2-subunit. However, the tyrosine content was higher in α2-subunit than in α1-subunit, resulting in strong absorption near 280 nm observed in the UV absorption spectrum. Based on the DSC analysis, it was found that the glass transition temperatures of gelatin, α1-subunit and α2-subunit were 136.48 °C, 126.77 °C and 119.43 °C, respectively. Moreover, the reduced viscosity and denaturation temperature of α1-subunit were higher than those of α2-subunit, and the reduced viscosity reached the highest when α-subunits were mixed with α1/α2 ratio of approximately 2, suggesting that α1-subunit plays a more important role in the thermostability of gelatin than α2-subunit.

  5. Deletion of the fibrinogen [correction of fibrogen] alpha-chain gene (FGA) causes congenital afibrogenemia.

    PubMed

    Neerman-Arbez, M; Honsberger, A; Antonarakis, S E; Morris, M A

    1999-01-01

    Congenital afibrinogenemia is a rare autosomal recessive disorder characterized by the complete absence of detectable fibrinogen. Uncontrolled bleeding after birth from the umbilical cord is common, and spontaneous intracerebral bleeding and splenic rupture can occur throughout life. Patients respond well to fibrinogen replacement therapy, either prophylactically or on demand. Because the half-life of infused fibrinogen is essentially normal, the genetic defect is assumed to be at the level of synthesis, but no responsible locus has been identified. Preliminary studies using Southern blotting suggested that no gross structural changes of the fibrinogen genes were present in patients. We report the identification of causative mutations in a nonconsanguineous Swiss family with congenital afibrinogenemia. The four affected male individuals (two brothers and their two first cousins) have homozygous deletions of approximately 11 kb of the fibrinogen alpha-chain gene (FGA). Haplotype data suggest that these deletions occurred separately, on three distinct ancestral chromosomes, implying that the FGA region of the fibrinogen locus is susceptible to deletion by a common mechanism. Furthermore, our results demonstrate that humans, like mice, may be born without the capacity to synthesize functional fibrinogen.

  6. The PPFLMLLKGSTR motif in globular domain 3 of the human laminin-5 {alpha}3 chain is crucial for integrin {alpha}3{beta}1 binding and cell adhesion

    SciTech Connect

    Kim, Jin-Man; Park, Won Ho; Min, Byung-Moo . E-mail: bmmin@snu.ac.kr

    2005-03-10

    Laminin-5 regulates various cellular functions, including cell adhesion, spreading, and motility. Here, we expressed the five human laminin {alpha}3 chain globular (LG) domains as monomeric, soluble fusion proteins, and examined their biological functions and signaling. Recombinant LG3 (rLG3) protein, unlike rLG1, rLG2, rLG4, and rLG5, played roles in cell adhesion, spreading, and integrin {alpha}3{beta}1 binding. More significantly, we identified a novel motif (PPFLMLLKGSTR) in the LG3 domain that is crucial for these responses. Studies with the synthetic peptides delineated the PPFLMLLKGSTR peptide within LG3 domain as a major site for both integrin {alpha}3{beta}1 binding and cell adhesion. Substitution mutation experiments suggest that the Arg residue is important for these activities. rLG3 protein- and PPFLMLLKGSTR peptide-induced keratinocyte adhesion triggered cell signaling through FAK phosphorylation at tyrosine-397 and -577. To our knowledge, this is the first report demonstrating that the PPFLMLLKGSTR peptide within the LG3 domain is a novel motif that is capable of supporting integrin {alpha}3{beta}1-dependent cell adhesion and spreading.

  7. Structural Origins of Nitroxide Side Chain Dynamics on Membrane Protein [alpha]-Helical Sites

    SciTech Connect

    Kroncke, Brett M.; Horanyi, Peter S.; Columbus, Linda

    2010-12-07

    Understanding the structure and dynamics of membrane proteins in their native, hydrophobic environment is important to understanding how these proteins function. EPR spectroscopy in combination with site-directed spin labeling (SDSL) can measure dynamics and structure of membrane proteins in their native lipid environment; however, until now the dynamics measured have been qualitative due to limited knowledge of the nitroxide spin label's intramolecular motion in the hydrophobic environment. Although several studies have elucidated the structural origins of EPR line shapes of water-soluble proteins, EPR spectra of nitroxide spin-labeled proteins in detergents or lipids have characteristic differences from their water-soluble counterparts, suggesting significant differences in the underlying molecular motion of the spin label between the two environments. To elucidate these differences, membrane-exposed {alpha}-helical sites of the leucine transporter, LeuT, from Aquifex aeolicus, were investigated using X-ray crystallography, mutational analysis, nitroxide side chain derivatives, and spectral simulations in order to obtain a motional model of the nitroxide. For each crystal structure, the nitroxide ring of a disulfide-linked spin label side chain (R1) is resolved and makes contacts with hydrophobic residues on the protein surface. The spin label at site I204 on LeuT makes a nontraditional hydrogen bond with the ortho-hydrogen on its nearest neighbor F208, whereas the spin label at site F177 makes multiple van der Waals contacts with a hydrophobic pocket formed with an adjacent helix. These results coupled with the spectral effect of mutating the i {+-} 3, 4 residues suggest that the spin label has a greater affinity for its local protein environment in the low dielectric than on a water-soluble protein surface. The simulations of the EPR spectra presented here suggest the spin label oscillates about the terminal bond nearest the ring while maintaining weak contact

  8. Prevention of systemic lupus erythematosus in autoimmune BXSB mice by a transgene encoding I-E alpha chain

    PubMed Central

    1993-01-01

    Males from the BXSB murine strain (H-2b) spontaneously develop an autoimmune syndrome with features of systemic lupus erythematosus (SLE), which results in part from the action of a mutant gene (Yaa) located on the Y chromosome. Like other H-2b mice, the BXSB strain does not express the class II major histocompatibility complex antigen, I-E. Here we report that the expression of I-E (E alpha dE beta b) in BXSB males bearing an E alpha d transgene prevents hypergammaglobulinemia, autoantibody production, and subsequent autoimmune glomerulonephritis. These transgenic mice bear on the majority of their B cells not only I- E molecules, but also an I-E alpha chain-derived peptide presented by a higher number of I-Ab molecules, as recognized by the Y-Ae monoclonal antibody. The I-E+ B cells appear less activated in vivo than the I-E- B cells, a minor population. This limited activation of the I-E+ B cells does not reflect a functional deficiency of this cell population, since it can be stimulated to IgM production in vitro by lipopolysaccharides at an even higher level than the I-E- B cell population. The development of the autoimmune syndrome in the transgenic and nontransgenic bone marrow chimeric mice argues against the possibility that the induction of regulatory T cells or clonal deletion of potential autoreactive T cells as a result of I-E expression is a mechanism of the protection conferred by the E alpha d transgene. We propose a novel mechanism by which the E alpha d transgene protects BXSB mice against SLE: overexpression of I-E alpha chains results in the generation of excessive amounts of a peptide displaying a high affinity to the I-Ab molecule, thereby competing with pathogenic autoantigen-derived peptides for presentation by B lymphocytes and preventing their excessive stimulation. PMID:8376928

  9. Mutation in the gene encoding the. alpha. chain of platelet glycoprotein Ib in platelet-type von Willebrand disease

    SciTech Connect

    Miller, J.L.; Cunningham, D.; Lyle, V.A.; Finch, C.N. )

    1991-06-01

    Platelet-type von Willebrand disease (PT-vWD) is an autosomal dominant bleeding disorder characterized by abnormally enhanced binding of von Willebrand factor (vWF) by patient platelets. Although the platelet glycoprotein (GP) Ib/IX complex is known to constitute the platelet's ristocetin-dependent receptor for vWF, a unique structural abnormality within this complex has not previously been identified in PT-vWD. Using the poly merase chain reaction to amplify genomic DNA coding for the {alpha} chain of GP Ib (GP IB{alpha}) and then sequencing the amplified DNA following cloning into M13mp18 and M13mp19 phage vectors, the authors have found a single point mutation in the GP Ib{alpha} coding region of PT-vWD DNA resulting in the substitution of valine for glycine at residue 233. This substitution within the vWF-binding region of GP Ib{alpha} is likely to exert a significant influence on the conformation of the resulting protein. Competitive oligonucleotide primer assay for this mutation showed a homozygous wild-type pattern in genomic DNA from the 161 normal volunteers studied and from 6 phenotypically normal members of a PT-vWD family. All 7 affected members of this family studied were heterozygous for the mutant allele. Platelet GP Ib{alpha} mRNA reverse-transcribed and studied by competitive oligonucleotide primer assay showed similar expression of the mutant and wild-type alleles in the affected PT-vWD patients. Absence in the normal population, tight linkage with phenotypic expression of disease, and absence of any additional abnormality of GP Ib{alpha} in these patients identify the glycine-to-valine substitution as a point mutation underlying functional abnormality of the vWF receptor in PT-vWD.

  10. Substitution of a conserved cysteine-996 in a cysteine-rich motif of the laminin {alpha}2-chain in congenital muscular dystrophy with partial deficiency of the protein

    SciTech Connect

    Nissinen, M.; Xu Zhang; Tryggvason, K.

    1996-06-01

    Congenital muscular dystrophies (CMDs) are autosomal recessive muscle disorders of early onset. Approximately half of CMD patients present laminin {alpha}2-chain (merosin) deficiency in muscle biopsies, and the disease locus has been mapped to the region of the LAMA2 gene (6q22-23) in several families. Recently, two nonsense mutations in the laminin {alpha}2-chain gene were identified in CMD patients exhibiting complete deficiency of the laminin {alpha}2-chain in muscle biopsies. However, a subset of CMD patients with linkage to LAMA2 show only partial absence of the laminin {alpha}2-chain around muscle fibers, by immunocytochemical analysis. In the present study we have identified a homozygous missense mutation in the {alpha}2-chain gene of a consanguineous Turkish family with partial laminin {alpha}2-chain deficiency. The T{r_arrow}C transition at position 3035 in the cDNA sequence results in a Cys996{r_arrow}Arg substitution. The mutation that affects one of the conserved cysteine-rich repeats in the short arm of the laminin {alpha}2-chain should result in normal synthesis of the chain and in formation and secretion of a heterotrimeric laminin molecule. Muscular dysfunction is possibly caused either by abnormal disulfide cross-links and folding of the laminin repeat, leading to the disturbance of an as yet unknown binding function of the laminin {alpha}2-chain and to shorter half-life of the muscle-specific laminin-2 and laminin-4 isoforms, or by increased proteolytic sensitivity, leading to truncation of the short arm. 42 refs., 7 figs.

  11. Disruption by interferon-alpha of an autocrine interleukin-6 growth loop in IL-6-dependent U266 myeloma cells by homologous and heterologous down-regulation of the IL-6 receptor alpha- and beta-chains.

    PubMed Central

    Schwabe, M; Brini, A T; Bosco, M C; Rubboli, F; Egawa, M; Zhao, J; Princler, G L; Kung, H F

    1994-01-01

    IL-6 is an autocrine growth factor for U266 myeloma cells and their growth is inhibited by IFN-alpha or IL-6 mAb. We asked, therefore, whether IFN-alpha-induced growth inhibition involved IL-6. IFN-alpha and mAb against IL-6, the IL-6R alpha-(gp80) or beta-chain (gp130) potently inhibited U266 cells. Remarkably, this effect occurred despite IFN-alpha-augmented secretion of endogenous IL-6. However, examining the IL-6R revealed that IFN-alpha drastically curtailed expression of the IL-6R alpha- and beta-chain. This effect occurred on two different levels (protein and mRNA) and by two different mechanisms (directly and indirectly through IL-6). First, IFN-alpha, but not IL-6, greatly decreased gp80 and, to a lesser extent, gp130 mRNA levels which resulted in a loss of IL-6 binding sites. Second, IFN-alpha-induced IL-6 predominantly down-regulated membrane-bound gp130. IFN-alpha-mediated decrease of gp80 levels was not detected on IL-6-independent myeloma (RPMI 8226) or myeloid cells (U937). We conclude that IFN-alpha inhibited IL-6-dependent myeloma cell growth by depriving U266 cells of an essential component of their autocrine growth loop, a functional IL-6R. Images PMID:7989587

  12. cDNA sequence coding for the alpha'-chain of the third complement component in the African lungfish.

    PubMed

    Sato, A; Sültmann, H; Mayer, W E; Figueroa, F; Tichy, H; Klein, J

    1999-04-01

    cDNA clones coding for almost the entire C3 alpha-chain of the African lungfish (Protopterus aethiopicus), a representative of the Sarcopterygii (lobe-finned fishes), were sequenced and characterized. From the sequence it is deduced that the lungfish C3 molecule is probably a disulphide-bonded alpha:beta dimer similar to that of the C3 components of other jawed vertebrates. The deduced sequence contains conserved sites presumably recognized by proteolytic enzymes (e.g. factor I) involved in the activation and inactivation of the component. It also contains the conserved thioester region and the putative site for binding properdin. However, the site for the interaction with complement receptor 2 and factor H are poorly conserved. Either complement receptor 2 and factor H are not present in the lungfish or they bind to different residues at the same or a different site than mammalian complement receptor 2 and factor H. The C3 alpha-chain sequences faithfully reflect the phylogenetic relationships among vertebrate classes and can therefore be used to help to resolve the long-standing controversy concerning the origin of the tetrapods. PMID:10219761

  13. Surface active molecules: preparation and properties of long chain n-acyl-l-alpha-amino-omega-guanidine alkyl acid derivatives.

    PubMed

    Infante, R; Dominguez, J G; Erra, P; Julia, R; Prats, M

    1984-12-01

    Synopsis A new route for the synthesis of long chain N(alpha)-acyl-l-alpha-amino-omega-guamdine alkyl acid derivatives, with cationic or amphoteric character has been established. The general formula of these compounds is shown below. A physico-chemical and antimicrobial study of these products as a function of the alkyl ester or sodium salt (R), the straight chain length of the fatty acid residue (x) and the number of carbons between the omega-guanidine and omega-carboxyl group (n) has been investigated. The water solubility, surface tension, critical micelle concentration (c.m.c.) and minimum inhibitory concentration (MIC) against Gram-positive and Gram-negative bacteria (including Pseudomonas) has been determined. Dicyclohexylcarbodiimide has been used to condense fatty acids and alpha-amino-omega-guanidine alkyl acids. In these conditions protection of the omega-guanidine group is not necessary. The main characteristic of this synthetic procedure is the use of very mild experimental conditions (temperature, pH) to form the amide linkage which leads to pure optical compounds in high yield in the absence of electrolytes. The results show that some structural modifications, particularly the protection of the carboxyl group, promote variations of the surfactant and antimicrobial properties. Only those molecules with the blocked carboxyl group (cationic molecules, where R = Me, Et or Pr) showed a good surfactant and antimicrobial activity. When the carboxyl group was unprotected (amphoteric molecules, where R = Na(+)) the resulting compounds were inactive.

  14. Genomic clone encoding the. cap alpha. chain of the OKM1, LFA-1, and platelet glycoprotein IIb-IIIa molecules

    SciTech Connect

    Cosgrove, L.J.; Sandrin, M.S.; Rajasekariah, P.; McKenzie, I.F.C.

    1986-02-01

    LFA-1, an antigen involved in cytolytic T lymphocyte-mediated killing, and Mac-1, the receptor for complement component C3bi, constitute a family of structurally and functionally related cell surface glycoproteins involved in cellular interactions. In both mouse and man, Mac-1 (OKM1) and LFA-1 share a common 95-kDa ..beta.. subunit but are distinguished by their ..cap alpha.. chains, which have different cellular distributions, apparent molecular masses (165 and 177 kDa, respectively), and peptide maps. The authors report the isolation of a genomic clone from a human genomic library that on transfection into mouse fibroblasts produced a molecule(s) reactive with monoclonal antibodies to OKM1, to LFA-1, and to platelet glycoprotein IIb-IIIa. This gene was cloned by several cycles of transfection of L cells with a human genomic library cloned in lambda phase Charon 4A and subsequent rescue of the lambda phage. Transfection with the purified recombinant lambda DNA yielded a transfectant that expressed the three human ..cap alpha.. chains of OKM1, LFA-1, and glycoprotein IIb-IIIa, presumably in association with the murine ..beta.. chain.

  15. Targeted inhibition of tumour cell growth by a bispecific single-chain toxin containing an antibody domain and TGF alpha.

    PubMed Central

    Schmidt, M.; Wels, W.

    1996-01-01

    Overexpression of the epidermal growth factor receptor (EGFR) and ErbB-2 has been observed in a variety of human tumours, making these receptors promising targets for directed tumour therapy. Since many tumour cells express both ErbB-2 and EGFR and these receptors synergise in cellular transformation, therapeutic reagents simultaneously binding to ErbB-2 and EGFR might offer advantages for tumour therapy. We have previously described the potent anti-tumoral activity of a bispecific antibody toxin that contains ErbB-2- and EGFR-specific single-chain Fv (scFv) domains. Here we report the construction and functional characterisation of a novel bispecific recombinant toxin, scFv(FRP5)-TGF alpha-ETA. The fusion protein consists of the antigen-binding domain of the ErbB-2-specific MAb, FRP5, and the natural EGFR ligand, TGF alpha, inserted at different positions in truncated Pseudomonas exotoxin A. ScFv(FRP5)-TGF alpha-ETA protein displayed binding to EGFR and ErbB-2, thereby inducing activation of the receptors, which was dependent on the cellular context and the level of EGFR and ErbB-2 expression. The bispecific molecule was cytotoxic in vitro for tumour cells expressing various levels of the target receptors. In vivo scFv(FRP5)-TGF alpha-ETA potently inhibited the growth of established A431 tumour xenografts in nude mice. Images Figure 1 Figure 2 Figure 5 PMID:8826849

  16. Two distinct abnormalities in patients with C8 alpha-gamma deficiency. Low level of C8 beta chain and presence of dysfunctional C8 alpha-gamma subunit.

    PubMed Central

    Tedesco, F; Roncelli, L; Petersen, B H; Agnello, V; Sodetz, J M

    1990-01-01

    The sera from three C8 alpha-gamma deficient patients previously reported to have a selective C8 alpha-gamma defect were analyzed by SDS-PAGE and Western blot using two polyclonal antisera to C8 alpha-gamma and a monoclonal antibody to C8 alpha. All three sera exhibited C8 alpha-gamma bands that dissociated into alpha and gamma chains under reducing conditions. Quantitation of the alpha-gamma subunit in these sera by a sensitive ELISA revealed an amount approximately 1% of that found in normal human serum. A similar assay performed with a specific antiserum to C8 beta showed unexpectedly low levels of C8 beta in these sera, which were confirmed by hemolytic titration of C8 beta. The remarkable differences between C8 alpha-gamma and C8 beta in the C8 alpha-gamma deficient sera was that in spite of their comparable immunochemical levels, C8 beta still exhibited functional activity whereas C8 alpha-gamma was totally inactive. That the residual C8 alpha-gamma was inactive was also proved by its inability to show lytic bands in an overlay system after SDS-PAGE and subsequent removal of SDS. The implications of these findings for a novel concept of C8 deficiency are discussed. Images PMID:2394837

  17. Urine of patients with early prostate cancer contains lower levels of light chain fragments of inter-alpha-trypsin inhibitor and saposin B but increased expression of an inter-alpha-trypsin inhibitor heavy chain 4 fragment.

    PubMed

    Jayapalan, Jaime J; Ng, Keng L; Shuib, Adawiyah S; Razack, Azad H A; Hashim, Onn H

    2013-06-01

    The present study was aimed at the identification of proteins that are differentially expressed in the urine of patients with prostate cancer (PCa), those with benign prostatic hyperplasia (BPH) and age-matched healthy male control subjects. Using a combination of 2DE and MS/MS, significantly lower expression of urinary saposin B and two different fragments of inter-alpha-trypsin inhibitor light chain (ITIL) was demonstrated in the PCa patients compared to the controls. However, only one of the ITIL fragments was significantly different between the PCa and BPH patients. When image analysis was performed on urinary proteins that were transferred onto NC membranes and detected using a lectin that binds to O-glycans, a truncated fragment of inter-alpha-trypsin inhibitor heavy chain 4 was the sole protein found to be significantly enhanced in the PCa patients compared to the controls. Together, these urinary peptide fragments might be useful complementary biomarkers to indicate PCa as well as to distinguish it from BPH, although further epidemiological evidence on the specificity and sensitivity of the protein candidates is required. PMID:23417432

  18. Urine of patients with early prostate cancer contains lower levels of light chain fragments of inter-alpha-trypsin inhibitor and saposin B but increased expression of an inter-alpha-trypsin inhibitor heavy chain 4 fragment.

    PubMed

    Jayapalan, Jaime J; Ng, Keng L; Shuib, Adawiyah S; Razack, Azad H A; Hashim, Onn H

    2013-06-01

    The present study was aimed at the identification of proteins that are differentially expressed in the urine of patients with prostate cancer (PCa), those with benign prostatic hyperplasia (BPH) and age-matched healthy male control subjects. Using a combination of 2DE and MS/MS, significantly lower expression of urinary saposin B and two different fragments of inter-alpha-trypsin inhibitor light chain (ITIL) was demonstrated in the PCa patients compared to the controls. However, only one of the ITIL fragments was significantly different between the PCa and BPH patients. When image analysis was performed on urinary proteins that were transferred onto NC membranes and detected using a lectin that binds to O-glycans, a truncated fragment of inter-alpha-trypsin inhibitor heavy chain 4 was the sole protein found to be significantly enhanced in the PCa patients compared to the controls. Together, these urinary peptide fragments might be useful complementary biomarkers to indicate PCa as well as to distinguish it from BPH, although further epidemiological evidence on the specificity and sensitivity of the protein candidates is required.

  19. Affinity purification of human granulocyte macrophage colony-stimulating factor receptor alpha-chain. Demonstration of binding by photoaffinity labeling

    SciTech Connect

    Chiba, S.; Shibuya, K.; Miyazono, K.; Tojo, A.; Oka, Y.; Miyagawa, K.; Takaku, F. )

    1990-11-15

    The human granulocyte macrophage colony-stimulating factor (GM-CSF) receptor alpha-chain, a low affinity component of the receptor, was solubilized and affinity-purified from human placenta using biotinylated GM-CSF. Scatchard analysis of {sup 125}I-GM-CSF binding to the placental membrane extract disclosed that the GM-CSF receptor had a dissociation constant (Kd) of 0.5-0.8 nM, corresponding to the Kd value of the GM-CSF receptor alpha-chain on the intact placental membrane. Affinity labeling of the solubilized protein using a photoreactive cross-linking agent, N-hydroxysuccinimidyl-4-azidobenzoate (HSAB), demonstrated a single specific band of 70-95 kDa representing a ligand-receptor complex. Approximately 2 g of the placental membrane extract was subjected to a biotinylated GM-CSF-fixed streptavidin-agarose column, resulting in a single major band at 70 kDa on a silver-stained sodium dodecyl sulfate gel. The radioiodination for the purified material disclosed that the purified protein had an approximate molecular mass of 70 kDa and a pI of 6.6. Binding activity of the purified material was demonstrated by photoaffinity labeling using HSAB-{sup 125}I-GM-CSF, producing a similar specific band at 70-95 kDa as was demonstrated for the crude protein.

  20. Cloning of the laminin alpha 3 chain gene (LAMA3) and identification of a homozygous deletion in a patient with Herlitz junctional epidermolysis bullosa.

    PubMed

    Vidal, F; Baudoin, C; Miquel, C; Galliano, M F; Christiano, A M; Uitto, J; Ortonne, J P; Meneguzzi, G

    1995-11-20

    Laminin 5 and laminin 6 are basement membrane proteins synthesized by the basal cells of stratifying squamous epithelia. Altered expression of laminin 5 has been associated with Herlitz junctional epidermolysis bullosa (H-JEB), a severe epidermal blistering disorder inherited as an autosomal recessive disease. We have isolated cDNA clones encoding the alpha 3 chain of laminin 5 and searched for mutations in the LAMA3 gene in H-JEB patients. In one H-JEB family, an affected individual exhibited drastically reduced immunoreactivity to antibodies directed against the alpha 3 chain of laminin 5 and an impaired expression of the corresponding mRNA transcripts. RT-PCR analysis of mRNA extracted from the proband's keratinocytes identified a homozygous single basepair deletion in the transcripts encoding the laminin alpha 3A and alpha 3B isoforms. The mutation causes a frameshift and premature termination codon in both alleles of the LAMA3 gene. Inheritance of the clinical H-JEB phenotype was consistent with the segregation of the mutated allele in the family. We also report the identity of the alpha chains of laminin 5 and epiligrin and provide evidence that LAMA3 transcripts are distinct from the laminin 6 alpha chain mRNA. PMID:8586427

  1. Cloning of the laminin {alpha}3 chain gene (LAMA3) and identification of a homozygous deletion in a patient with Herlitz junctional epidermolysis bullosa

    SciTech Connect

    Vidal, F.; Ortonne, J.P. |; Galliano, M.F.

    1995-11-20

    Laminin 5 and laminin 6 are basement membrane proteins synthesized by the basal cells of stratifying squamous epithelia. Altered expression of laminin 5 has been associated with Herlitz junctional epidermolysis bullosa (H-JEB), a severe epidermal blistering disorder inherited as an autosomal recessive disease. We have isolated cDNA clones encoding the {alpha}3 chain of laminin 5 and searched for mutations in the LAMA3 gene in H-JEB patients. In one H-JEB family, an affected individual exhibited drastically reduced immunoreactivity to antibodies directed against the {alpha}3 chain of laminin 5 and an impaired expression of the corresponding mRNA transcripts. RT-PCR analysis of mRNA extracted from the proband`s keratinocytes identified a homozygous single basepair deletion in the transcripts encoding the laminin {alpha}3A and {alpha}3B isoforms. The mutation causes a frameshift and premature termination codon in both alleles of the LAMA3 gene. Inheritance of the clinical H-JEB phenotype was consistent with the segregation of the mutated allele in the family. We also report the identity of the {alpha} chains of laminin 5 and epiligrin and provide evidence that LAMA3 transcripts are distinct from the laminin 6 {alpha} chain mRNA. 35 refs., 5 figs., 1 tab.

  2. Chain length dependence of {alpha}-olefin readsorption in Fischer-Tropsch synthesis

    SciTech Connect

    Kuipers, E.W.; Vinkenburg, I.H.; Oosterbeek, H.

    1995-03-01

    The total product concentration and the paraffin/olefin ratio have been measured up to C{sub 14} for Fischer-Tropsch synthesis on polycrystalline Co foils. The influences due to surface area, a wax coating, the H{sub 2}/CO ratio and flow velocity on concentration and selectivity have been determined. The paraffin/olefin ratio increases exponentially with chain length which is attributed to a chain-length-dependent olefin readsorption mechanism. The probability of readsorption depends on the heat of physisorption of the olefins on the catalyst as well as on their heat of dissolution in and their diffusivity through the product wax. All three factors predict an increase of the paraffin/olefin ratio with carbon number. Physisorption and dissolution are shown to cause a much stronger chain-length dependence than diffusion and will usually dominate. 36 refs., 9 figs.

  3. Effect of swainsonine on the processing of the asparagine-linked carbohydrate chains of alpha 1-antitrypsin in rat hepatocytes. Evidence for the formation of hybrid oligosaccharides.

    PubMed

    Gross, V; Tran-Thi, T A; Vosbeck, K; Heinrich, P C

    1983-03-25

    The biosynthesis of the proteinase inhibitor alpha 1-antitrypsin has been studied in rat hepatocyte primary cultures. Newly synthesized alpha 1-antitrypsin was found in hepatocytes as a glycoprotein of an apparent molecular weight of 49,000 carrying oligosaccharide side chains of the high mannose type. In the hepatocyte medium a secreted alpha 1-antitrypsin of an apparent molecular weight of 54,000 could be identified as a glycoprotein with carbohydrate chains of the complex type. Pulse-chase experiments revealed a precursor-product relationship for the two forms of alpha 1-antitrypsin. When the hepatocytes were treated with swainsonine, an intracellular form of alpha 1-antitrypsin with an apparent molecular weight of 49,000 indistinguishable from that of control cells was found. However, the alpha 1-antitrypsin secreted from swainsonine-treated hepatocytes was different from that present in control media. It was characterized by a lower apparent molecular weight (51,000), a higher amount of [3H]mannose incorporation, half as much incorporation of [3H]galactose, and the same amount of [3H]fucose incorporation compared to alpha 1-antitrypsin of control media. In contrast to the 54,000 complex type alpha 1-antitrypsin from control media the 51,000 alpha 1-antitrypsin from the medium of swainsonine-treated cells was found to be susceptible to the action of endoglucosaminidase H, even when fucose was attached to the proximal GlcNAc residue. alpha 1-Antitrypsin secreted from swainsonine-treated cells combines features usually associated with either high mannose or complex type oligosaccharides and therefore represents a hybrid structure. In spite of its effect on the carbohydrate part of alpha 1-antitrypsin swainsonine did not impair the secretion of the incompletely processed glycoprotein. PMID:6403522

  4. Glucocorticoids induce the expression of CD8 alpha chains on concanavalin A-activated rat CD4+ T cells: induction is inhibited by rat recombinant interleukin 4

    PubMed Central

    1992-01-01

    Rat T lymphocytes, activated in vitro with concanavalin A (Con A), were shown by flow cytofluorographic analysis to contain a population of cells that simultaneously expressed CD4 and the alpha chain of CD8. The inclusion of the glucocorticoid hormone dexamethasone in the culture medium greatly increased both the frequency of these double-positive cells and the level of CD8 alpha chain expression. The level of expression of CD4 was not affected, and the cells that expressed CD8 antigen only also remained unchanged in surface phenotype. Detailed studies demonstrated unequivocally that the CD4+ CD8 alpha + cells were not artifacts produced by the random association of single-positive cells in the flow cytofluorograph, but arose from precursors that were single-positive CD4+ cells before activation. Furthermore, Con A activation of purified CD4+ T cells, in the presence of T cell-depleted accessory cells, showed that CD8+ T cells played no role in the induction process. However, the induction of CD8 alpha chain expression on CD4+ T cells and the enhancement of this expression by dexamethasone were almost completely inhibited by rat recombinant interleukin 4 (IL- 4). Detection of mRNA for rat CD8 alpha chain by Northern blot closely paralleled the cell surface expression of CD8 alpha antigen, indicating that dexamethasone and IL-4 had opposing effects on mRNA levels. In contrast, IL-4 and dexamethasone both induced CD8 alpha chain expression on a rat CD4+ T cell clone when this was activated by specific antigen, and, although the effect with IL-4 was relatively weak, it did not antagonize the effect of the glucocorticoid. The possible significance of these results is briefly discussed. PMID:1460418

  5. Motor domain-based motility system and motile properties of alpha heavy chain in Tetrahymena outer arm dynein.

    PubMed

    Edamatsu, Masaki

    2014-10-24

    Axonemal dynein plays an essential role in ciliary motility, and impaired ciliary motility causes human diseases such as primary ciliary dyskinesia (PCD). The motor domain of axonemal dynein powers ciliary motility and its function is regulated by several accessary proteins bound to the tail region. Therefore, to understand the essential properties of dynein motility, examining the motile properties of the motor domain without the tail is necessary. In this study, the functional motor domain of the alpha heavy chain in Tetrahymena outer arm dynein was purified, and its motile properties were examined using an in vitro motility system. The purified protein caused microtubules to glide at a velocity of 5.0μm/s with their minus-end trailing, and motility was inhibited in an ATP concentration-dependent manner, which is in contrast with kinesin1. This method could be applicable to other axonemal dyneins and will enable further molecular studies on diverse axonemal dyneins and ciliary motility.

  6. Hypodysfibrinogenaemia due to production of mutant fibrinogen alpha-chains lacking fibrinopeptide A and polymerisation knob ‘A’

    PubMed Central

    Vorjohann, Silja; Fish, Richard J.; Biron-Andreani, Christine; Nagaswami, Chandrasekaran; Weisel, John W.; Boulot, Pierre; Reyftmann, Lionel; de Moerloose, Philippe; Neerman-Arbez, Marguerite

    2011-01-01

    Summary Inherited disorders of fibrinogen are rare and affect either the quantity (hypofibrinogenaemia and afibrinogenaemia) or the quality of the circulating fibrinogen (dysfibrinogenaemia) or both (hypodysfibrinogenaemia). Extensive allelic heterogeneity has been found for all these disorders: in congenital afibrinogenaemia for example more than 40 mutations, the majority in FGA, have been identified in homozygosity or in compound heterozygosity. Numerous mutations have also been identified in patients with hypofibrinogenaemia, many of these patients are in fact heterozygous carriers of afibrinogenaemia mutations. Despite the number of genetic analyses performed, the study of additional patients still allows the identification of novel mutations. Here we describe the characterization of a novel FGA intron 2 donor splice-site mutation (Fibrinogen Montpellier II) identified in three siblings with hypodysfibrinogenaemia. Functional analysis of RNA produced by the mutant minigene in COS-7 cells revealed that the mutation led to the in-frame skipping of exon 2. Western blot analysis of COS-7 cells expressing an exon 2 deleted FGA cDNA revealed that an alpha-chain lacking exon 2, which codes in particular for fibrinopeptide A and polymerisation knob ‘A’, has the potential to be assembled into a hexamer and secreted. Analysis of precipitated fibrinogen from patient plasma showed that the defect leads to the presence in the circulation of alpha-chains lacking knob ‘A’ which is essential for the early stages of fibrin polymerisation. Fibrin made from purified patient fibrinogen clotted with thrombin displayed thinner fibers with frequent ends and large pores. PMID:20806111

  7. Radioimmunoassay of inhibin based on synthetic human inhibin alpha-chain peptide

    SciTech Connect

    Sinosich, M.J.; Sieg, S.; Zakher, A.; Ling, N.; Saunders, D.M.; Rosenwaks, Z.; Hodgen, G.D. )

    1991-01-01

    Polyclonal rabbit antisera were produced against cyclic human inhibin ((Cys6, Tyr7) alpha-(6-30)NH2) peptide, covalently conjugated to bovine serum albumin. The tyrosine residue introduced at position 7 facilitated the oxidative incorporation of radiolabel ({sup 125}I) to yield a tracer with specific activity of 73.9 Ci/g. These reagents were used to develop a homologous equilibrium radioimmunoassay for human inhibin, with polyethylene glycol, 200 g/L, serving as the separation phase. At a detection limit of 2 micrograms/L (n = 7), immunoactive inhibin was detectable in human pre-ovulatory follicular fluid (128 micrograms/L), seminal plasma (2374 micrograms/L), amniotic fluid (66 micrograms/L), and placental extract (347 micrograms/L). We also demonstrated inhibin immunoreactivity in biological fluids from other mammalian species: macaque, chimpanzee, porcine, and bovine, but not rodent (guinea pig). Although the antisera were raised against a nonbioactive inhibin peptide, immunoglobulins fractionated on Protein A-Sepharose neutralized the bioactivity of human ovarian inhibin. Further characterization of inhibin immuno- and bioactivity was undertaken with immobilized heparin, divalent metal cations, and dye ligands. Only heparin-Sepharose distinguished between immuno- and bioactive inhibin.

  8. An amino acid substitution (Gly853-->Glu) in the collagen alpha 1(II) chain produces hypochondrogenesis.

    PubMed

    Bogaert, R; Tiller, G E; Weis, M A; Gruber, H E; Rimoin, D L; Cohn, D H; Eyre, D R

    1992-11-01

    The spondyloepiphyseal dysplasia subclassification of bone dysplasias includes achondrogenesis, hypochondrogenesis, and spondyloepiphyseal dysplasia congenita. The phenotypic expression of these disorders ranges from mild to perinatal lethal forms. We report the detection and partial characterization of a defect in type II collagen in a perinatal lethal form of hypochondrogenesis. Electrophoresis in sodium dodecyl sulfate-polyacrylamide of CB peptides (where CB represents cyanogen bromide) from type II collagen of the diseased cartilage showed a doublet band for peptide alpha 1(II)CB10 and evidence for post-translational overmodification of the major peptides (CB8, CB10, and CB11) seen as a retarded electrophoretic mobility. Peptide CB10 was digested by endoproteinase Asp-N; and on reverse-phase high pressure liquid chromatography, fragments of abnormal mobility were noted. Sequence analysis of a unique peptide D12 revealed a single amino acid substitution (Gly-->Glu) at position 853 of the triple helical domain. This was confirmed by sequence analysis of amplified COL2A1 cDNA, which revealed a single nucleotide substitution (GGA-->GAA) in 5 of 10 clones. Electron micrographs of the diseased cartilage showed a sparse extracellular matrix and chondrocytes containing dilated rough endoplasmic reticulum, which suggested impaired assembly and secretion of the mutant protein. This case further documents the molecular basis of the spondyloepiphyseal dysplasia spectrum of chondrodysplasias as mutations in COL2A1. PMID:1429602

  9. Creatine, arginine alpha-ketoglutarate, amino acids, and medium-chain triglycerides and endurance and performance.

    PubMed

    Little, Jonathan P; Forbes, Scott C; Candow, Darren G; Cornish, Stephen M; Chilibeck, Philip D

    2008-10-01

    Creatine (Cr) supplementation increases muscle mass, strength, and power. Arginine a-ketoglutarate (A-AKG) is a precursor for nitric oxide production and has the potential to improve blood flow and nutrient delivery (i.e., Cr) to muscles. This study compared a commercial dietary supplement of Cr, A-AKG, glutamine, taurine, branched-chain amino acids, and medium-chain triglycerides with Cr alone or placebo on exercise performance and body composition. Thirty-five men (approximately 23 yr) were randomized to Cr + A-AKG (0.1 g . kg(-1) . d(-1) Cr + 0.075 g . kg(-1) . d(-1)A-AKG, n = 12), Cr (0.1 g . kg(-1) . d(-1), n = 11), or placebo (1 g . kg(-1) . d(-1) sucrose, n = 12) for 10 d. Body composition, muscle endurance (bench press), and peak and average power (Wingate tests) were measured before and after supplementation. Bench-press repetitions over 3 sets increased with Cr + A-AKG (30.9 +/- 6.6 +/- 34.9 +/- 8.7 reps; p < .01) and Cr (27.6 +/- 5.9 +/- 31.0 +/- 7.6 reps; p < .01), with no change for placebo (26.8 +/- 5.0 +/- 27.1 +/- 6.3 reps). Peak power significantly increased in Cr + A-AKG (741 +/- 112 +/- 794 +/- 92 W; p < .01), with no changes in Cr (722 +/- 138 +/- 730 +/- 144 W) and placebo (696 +/- 63 +/- 705 +/- 77 W). There were no differences in average power between groups over time. Only the Cr-only group increased total body mass (79.9 +/- 13.0 +/- 81.1 +/- 13.8 kg; p < .01), with no significant changes in lean-tissue or fat mass. These results suggest that Cr alone and in combination with A-AKG improves upper body muscle endurance, and Cr + A-AKG supplementation improves peak power output on repeated Wingate tests. PMID:19033611

  10. The genes for the alpha 1(IV) and alpha 2(IV) chains of human basement membrane collagen type IV are arranged head-to-head and separated by a bidirectional promoter of unique structure.

    PubMed Central

    Pöschl, E; Pollner, R; Kühn, K

    1988-01-01

    The human basement membrane specific collagen type IV is a heterotrimer composed of two alpha 1(IV) chains and one alpha 2(IV) chain. A partial genomic EcoRI library was screened with cDNA clones representing the 5' end regions of the alpha 1(IV) and the alpha 2(IV) mRNA. A 2.2-kb genomic fragment was isolated and sequenced, which contains the 5' terminal exons of both genes located in close vicinity. The two genes were found to be arranged in opposite direction, head-to-head, separated only by a short region of 127 bp, apparently representing promoters of both genes as indicated by the existence of typical sequence motifs (CAT-box, SP1 consensus sequence). These data suggest that the alpha 1(IV) and alpha 2(IV) genes use a common, bidirectional promoter. The striking symmetrical arrangement of sequence elements within the promoter may be of basic importance for the coordination of bidirectional transcription. The promoter region had no detectable transcriptional activity in transient gene expression assays after fusion to the chloramphenicol acetylase (CAT) gene in either direction, indicating the necessity of additional elements for efficient and tissue-specific expression of both genes. Constructs containing different segments of both genes failed to identify regions with enhancing activity for the homologous collagen type IV promoter. When the heterologous HSV thymidine kinase promoter was used, a negatively acting region was identified. This indicates that the alpha 1(IV) and alpha 2(IV) promoter activity is controlled by additional regulatory elements present on distant portions of both genes. Images PMID:2846280

  11. Molecular basis of maple syrup urine disease: Novel mutations at the E1[alpha] locus that impair E1([alpha][sub 2][beta][sub 2]) assembly or decrease steady-state E1[alpha] mRNA levels of branched-chain [alpha]-keto acid dehydrogenase complex

    SciTech Connect

    Chuang, J.L.; Fisher, C.R.; Chuang, D.T.; Cox, R.P. )

    1994-08-01

    The authors report the occurrence of three novel mutations in the E1[alpha] (BCKDHA) locus of the branched-chain [alpha]-keto acid dehydrogenase (BCKAD) complex that cause maple syrup urine disease (MSUD). An 8-bp deletion in exon 7 is present in one allele of a compound-heterozygous patient (GM-649). A single C nucleotide insertion in exon 2 occurs in one allele of an intermediate-MSUD patient (Lo). The second allele of patient Lo carries an A-to-G transition in exon 9 of the E1[alpha] gene. This missense mutation changes Tyr-368 to Cys (Y368C) in the E1[alpha] subunit. Both the 8-bp deletion and the single C insertion generate a downstream nonsense codon. Both mutations appear to be associated with a low abundance of the mutant E1[alpha] mRNA, as determined by allele-specific oligonucleotide probing. Transfection studies strongly suggest that the Y368C substitution in the E1[alpha] subunit impairs its proper assembly with the normal E1[beta]. Unassembled as well as misassembled E1[alpha] and E1[beta] subunits are degraded in the cell. 32 refs., 8 figs.

  12. Isomers in three doubly odd Fr-At-Bi. alpha. -decay chains

    SciTech Connect

    Huyse, M.; Decrock, P.; Dendooven, P.; Reusen, G.; Van Duppen, P.; Wauters, J. )

    1992-10-01

    The {sup 206}Fr{r arrow}{sup 202}At{r arrow}{sup 198}Bi, {sup 204}Fr{r arrow}{sup 200}At{r arrow}{sup 196}Bi, and {sup 202}Fr{r arrow}{sup 198}At{r arrow}{sup 194}Bi {ital a}-decay chains have been studied by standard spectroscopic techniques using an on-line isotope separator. All the studied doubly odd isotopes have at least two isomers, which decay by a combination of the following decay modes: {ital a} emission, {beta}{sup +}/EC (electron capture) decay, and internal transition (IT). The internal transition, a highly retarded {ital E}3, is the {ital j}-forbidden transition between the ({pi}{ital h}{sub 9/2}{direct product}{nu}{ital i}{sub 13/2}){sub 10}{sup {minus}} and the ({pi}{ital h}{sub 9/2}{direct product}{nu}{ital f}{sub 5/2}){sub 7}{sup +} states. The {ital B}({ital E}3) values of these IT's together with their energy behavior as a function of the neutron and proton number, compared to the energy difference between the 13/2{sup +}({nu}{ital i}{sub 13/2}) and 5/2{sup {minus}}({nu}{ital f}{sub 5/2}) states in the odd-mass Pb isotones, indicate that these proton-neutron-coupled states have a rather pure shell-model character.

  13. Role of the 7 alpha-methoxy and side-chain carboxyl of moxalactam in beta-lactamase stability and antibacterial activity.

    PubMed Central

    Murakami, K; Yoshida, T

    1981-01-01

    The effects of the alpha-carboxyl of the phenylmalonyl side chain and the 7 alpha-methoxy group in moxalactam (6059-S) (7 beta-[2-carboxy-2-(4-hydroxyphenyl) acetamido]-7 alpha-methoxy-3[[(1-methyl-1H-tetrazol-5-y])thio] methyl]-1-oxa-1-dethia-3-cephem-4-carboxylic acid) and in the 1-sulfur congener on the stability to beta-lactamase were investigated by spectrophotometric and microbiological assays. The 7 alpha-methoxy substituent stabilized the compounds against penicillinase hydrolysis, and the alpha-carboxyl group stabilized them against cephalosporinase. An exception is the beta-lactamase produced by Proteus vulgaris, an inducible cephalosporinase, which hydrolyzed compounds having the alpha-carboxyl group but not those having the 7 alpha-methoxy group. Both substituents exerted their stabilizing effects independently, and compounds with both substituents, e.g., moxalactam (6059-S) and its 1-sulfur congener, were resistant to both penicillinases and cephalosporinases. The stabilization of the compounds to beta-lactamase hydrolysis improved their antibacterial activity against beta-lactamase-producing strains. PMID:6454378

  14. In vivo Regulation of the Allergic Response by the Interleukin 4 Receptor Alpha Chain Immunoreceptor Tyrosine-based Inhibitory Motif

    PubMed Central

    Tachdjian, Raffi; Khatib, Shadi Al; Schwinglshackl, Andreas; Kim, Hong Sook; Chen, Andrew; Blasioli, Julie; Mathias, Clinton; Kim, Hye-Young; Umetsu, Dale T.; Oettgen, Hans C.; Chatila, Talal A.

    2010-01-01

    Background Signaling by IL-4 and IL-13 via the IL-4 receptor alpha chain (IL-4Rα) plays a critical role in the pathology of allergic diseases. The IL-4Rα is endowed with an immunoreceptor tyrosine-based inhibitory motif (ITIM), centered on tyrosine 709 (Y709) in the cytoplasmic domain, that binds a number of regulatory phosphatases. The function of the ITIM in the in vivo regulation of IL-4R signaling remains unknown. Objective To determine the in vivo function of the IL-4Rα ITIM using mice in which the ITIM was inactivated by mutagenesis of the tyrosine Y709 residue into phenylalanine (F709). Methods F709 ITIM mutant mice were derived by knockin mutagenesis. Activation of intracellular signaling cascades by IL-4 and IL-13 was assessed by intracellular staining of phosphorylated signaling intermediates and by gene expression analysis. In vivo responses to allergic sensitization were assessed using models of allergic airway inflammation. Results The F709 mutation increased STAT6 phosphorylation by IL-4 and, disproportionately, by IL-13. This was associated with exaggerated Th2 polarization, enhanced alternative macrophage activation by IL-13, augmented basal and antigen-induced IgE responses and intensified allergen-induced eosinophilic airway inflammation and hyperreactivity. Conclusions These results point to a physiologic negative regulatory role for the Y709 ITIM in signaling via IL-4Rα, especially by IL-13. PMID:20392476

  15. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk.

    PubMed

    McGrath, J A; Kivirikko, S; Ciatti, S; Moss, C; Dunnill, G S; Eady, R A; Rodeck, C H; Christiano, A M; Uitto, J

    1995-09-01

    Mutations in the three genes (LAMA3, LAMB3, and LAMC2) that encode the three chains (alpha 3, beta 3, and gamma 2, respectively) of laminin 5, a protein involved in epidermal-dermal adhesion, have been established as the genetic basis for the inherited blistering skin disorder, Herlitz junctional epidermolysis bullosa (H-JEB). In this study, we performed mutational analysis on genomic DNA from a child with H-JEB and identified a nonsense mutation in the alpha 3 chain gene (LAMA3) consisting of a homozygous C-to-T transition resulting in a premature termination codon (CGA-->TGA) on both alleles. The parents were shown to be heterozygous carriers of the same mutation. Direct mutation analysis was used to perform DNA-based prenatal diagnosis from a chorionic villus biopsy at 10 weeks' gestation in a subsequent pregnancy. The fetus was predicted to be genotypically normal with respect to the LAMA3 mutation. PMID:8530087

  16. Spontaneous multivessel cervical artery dissection in a patient with a substitution of alanine for glycine (G13A) in the alpha 1 (I) chain of type I collagen.

    PubMed

    Mayer, S A; Rubin, B S; Starman, B J; Byers, P H

    1996-08-01

    Cervical artery dissection occurs spontaneously and in multiple vessels with surprising frequency. An underlying arteriopathy is frequently suspected, but specific causes of vascular fragility are rarely identified. We describe a 35-year-old woman who developed multiple cervical artery dissections after scuba diving. She had no stigmata of connective tissue disease apart from bluish sclerae, and no family history of arterial dissection or congenital musculoskeletal disease. Analysis of the COL1A1 gene that encodes the pro alpha 1(I) chains of type I procollagen revealed a point mutation in one allele, resulting in substitution of alanine for glycine (G13A) in about half the alpha 1(I) chains of type I collagen. Genetic disorders of collagen, such as the mild phenotypic variant of osteogenesis imperfecta identified in our patient, should be considered in the differential diagnosis of unexplained cervical artery dissection.

  17. Stimulation of rat liver branched-chain alpha-keto acid dehydrogenase activity by low doses of bezafibrate.

    PubMed

    Knapik-Czajka, Malgorzata

    2013-04-01

    Multienzyme branched-chain alpha-ketoacid dehydrogenase complex (BCKDH) catalyzes the regulatory step of oxidative catabolism of indispensable branched-chain amino acids (BCAA). The activity of the BCKDH complex is regulated by a reversible phosphorylation, end-product inhibition and by changes in the gene expression of BCKDH component enzymes. It has been shown previously that a high dose of bezafibrate (an agent added to rat chow at final concentration of 0.5%) changes mRNA levels of BCKDH-related enzymes and increases dephosphorylation of the complex leading to stimulation of liver BCKDH activity and the enhanced BCAA catabolism. The aim of the present study was to determine an in vivo effect of low, clinically relevant doses of bezafibrate on BCKDH activity in rat liver. Bezafibrate was administrated for 14 days by gastric gavage to Wistar male rats (fed low-protein chow; 8% protein) at one of the following daily doses of 5, 10 and 20mg/kgb.wt. The control group was given the vehicle (0.3% methylcellulose) only. The actual BCKDH and total BCKDH activities were assayed spectrophotometrically before and after incubation with a broad-specificity phosphatase, respectively. The mRNA levels of the selected genes (BCKDH catalytic subunits and regulatory enzymes) were quantified by means of semi-quantitative RT-PCR. Current catalytic activity of BCKDH (described as BCKDH activity state - the proportion of the BCKDH complex in its active dephosphorylated form) increased by 2.1 ± 0.2, 2.3 ± 0.2 and 2.7 ± 0.2 fold (p<0.01). Changes in BCKDH activity did not correspond with changes in mRNA levels of the complex catalytic subunits. Moreover, mRNA levels of regulatory enzymes remained unaltered. Initially bezafibrate caused a transient insignificant reduction in body weight, but it had no effect on the final body weight. The highest dose of bezafibrate induced hepatomegaly. In conclusion, these data indicate that under conditions of dietary protein restriction low

  18. Tumor necrosis factor alpha induces proteins that bind specifically to kappa B-like enhancer elements and regulate interleukin 2 receptor alpha-chain gene expression in primary human T lymphocytes.

    PubMed Central

    Lowenthal, J W; Ballard, D W; Böhnlein, E; Greene, W C

    1989-01-01

    We have investigated the biochemical basis for the activation of interleukin 2 receptor alpha-subunit (IL-2R alpha) gene expression in primary human T lymphocytes by a cytokine (tumor necrosis factor alpha), a T-cell mitogen (phorbol 12-myristate 13-acetate), and the transactivator protein (Tax) from the type I human T-cell leukemia virus. Using in vivo transfection techniques specificially designed for these primary T cells in conjunction with in vitro gel retardation and DNA footprinting assays, we found that activation of the IL-2R alpha promoter by each of these agents involves the induction of nuclear proteins that specifically interact with a kappa B-like enhancer element (i.e., an element resembling the immunoglobulin kappa-chain enhancer sequence recognized by transcription factor NF-kappa B). DNA-protein crosslinking studies revealed that primary T cells express at least three different inducible DNA-binding proteins (50-55, 70-75, and 80-90 kDa) that specifically interact with this IL-2R alpha kappa B element. Images PMID:2494663

  19. Airway smooth muscle cells synthesize hyaluronan cable structures independent of inter-alpha-inhibitor heavy chain attachment.

    PubMed

    Lauer, Mark E; Fulop, Csaba; Mukhopadhyay, Durba; Comhair, Suzy; Erzurum, Serpil C; Hascall, Vincent C

    2009-02-20

    The covalent association of inter-alpha-inhibitor-derived heavy chains (HCs) with hyaluronan was first described in synovial fluid from arthritic patients and later described as a structural and functional component of hyaluronan "cable" structures produced by many different cells and stimuli. HC transfer has been shown to be mediated by the protein product of TSG-6 (tumor necrosis factor-stimulated gene 6). Considering the accumulation of hyaluronan in airways following asthmatic attacks and the subsequent infiltration of leukocytes, we sought to characterize HC substitution of hyaluronan "cables" in primary mouse airway smooth muscle cells (MASM) and primary human airway smooth muscle cells (HASM). We found that cells derived from mice lacking TSG-6 had no defect in hyaluronan production or hyaluronan-mediated leukocyte adhesion when treated with the viral mimic poly(I,C). Functional hyaluronan cables were induced by cycloheximide in the confirmed absence of protein synthesis, with or without simultaneous treatment with poly(I,C). We characterized the species specificity of the antibody other investigators used to describe the HC-hyaluronan complex of hyaluronan cables and found minimal affinity to bovine-derived HCs in contrast to HCs from mouse and human sera. Thus, we cultured MASM and HASM cells in serum from these three sources and analyzed hyaluronan extracts for HCs and other hyaluronan-binding proteins, using parallel cumulus cell-oocyte complex (COC) extracts as positive controls. We conclude that, if hyaluronan cables derived from MASM and HASM cells are substituted with HCs, the amount of substitution is significantly below the limit of detection when compared with COC extracts of similar hyaluronan mass.

  20. The interleukin-6 receptor alpha-chain (CD126) is expressed by neoplastic but not normal plasma cells.

    PubMed

    Rawstron, A C; Fenton, J A; Ashcroft, J; English, A; Jones, R A; Richards, S J; Pratt, G; Owen, R; Davies, F E; Child, J A; Jack, A S; Morgan, G

    2000-12-01

    Interleukin-6 (IL-6) is reported to be central to the pathogenesis of myeloma, inducing proliferation and inhibiting apoptosis in neoplastic plasma cells. Therefore, abrogating IL-6 signaling is of therapeutic interest, particularly with the development of humanized anti-IL-6 receptor (IL-6R) antibodies. The use of such antibodies clinically requires an understanding of IL-6R expression on neoplastic cells, particularly in the cycling fraction. IL-6R expression levels were determined on plasma cells from patients with myeloma (n = 93) and with monoclonal gammopathy of undetermined significance (MGUS) or plasmacytoma (n = 66) and compared with the levels found on normal plasma cells (n = 11). In addition, 4-color flow cytometry was used to assess the differential expression by stage of differentiation and cell cycle status of the neoplastic plasma cells. IL-6R alpha chain (CD126) was not detectable in normal plasma cells, but was expressed in approximately 90% of patients with myeloma. In all groups, the expression levels showed a normal distribution. In patients with MGUS or plasmacytoma, neoplastic plasma cells expressed significantly higher levels of CD126 compared with phenotypically normal plasma cells from the same marrow. VLA-5(-) "immature" plasma cells showed the highest levels of CD126 expression, but "mature" VLA-5(+) myeloma plasma cells also overexpressed CD126 when compared with normal subjects. This study demonstrates that CD126 expression is restricted to neoplastic plasma cells, with little or no detectable expression by normal cells. Stromal cells in the bone marrow microenvironment do not induce the overexpression because neoplastic cells express higher levels of CD126 than normal plasma cells from the same bone marrow in individuals with MGUS. (Blood. 2000;96:3880-3886)

  1. Novel recombinant adenoviral vector that targets the interleukin-13 receptor alpha2 chain permits effective gene transfer to malignant glioma.

    PubMed

    Ulasov, Ilya V; Tyler, Matthew A; Han, Yu; Glasgow, Joel N; Lesniak, Maciej S

    2007-02-01

    Transduction of malignant glioma with adenovirus serotype 5 (Ad5) vectors is limited by the low levels of coxsackievirus and adenovirus receptor (CAR) on tumor cells. However, malignant brain tumors have been found to overexpress a glioma-associated receptor, interleukin-13 receptor alpha2 chain (IL-13Ralpha2), a marker of both glial transformation and tumor grade. To selectively target Ad5 to IL-13Ralpha2, we constructed a replication-deficient adenoviral vector that possesses an IL-13 ligand presented by a T4 phage fibritin shaft, and designated the new virus LU-13. Western blot and sequence analyses confirmed proper trimerization and ligand presentation by the T4 fibritin shaft. Confocal microscopy analysis of primary glioma suspensions incubated with viral recombinants showed that LU-13 colocalized with IL-13Ralpha2. Luciferase transduction assays conducted in both primary and passaged glioma cell cultures exhibited at least 10-fold enhanced gene transduction. Moreover, the virus preferentially bound to glioma cells, as documented by increased adenoviral E4 DNA copy number. In vitro competition assays performed with anti-human IL-13 monoclonal antibody confirmed significant attenuation of LU-13 transduction. These results were further confirmed in vivo, where LU-13 showed a 300-fold increase in transgene expression. In summary, we describe here the development of a novel and targeted adenoviral vector that binds IL-13Ralpha2. Our findings confirm the ability of LU-13 to bind IL-13Ralpha2 and increase transgene expression, making it an attractive gene therapy vector for the treatment of malignant glioma in a clinical setting.

  2. Variability in the interaction of beta-thalassemia with the alpha-chain variants Hb G-Philadelphia and Hb Rampa.

    PubMed

    Huisman, T H; Gravely, M E; Henson, J; Felice, A; Wilson, J B; Abraham, E C; Vella, F; Little, M W

    1978-08-01

    Two unrelated families are reported in which beta-thalassemia trait occurred with a heterozygosity of Hb G-Philadelphia (alpha2 68(E17)Asn leads to Lys beta2) in one family and with Hb Rampa (alpha2 95(G2)Pro leads to Ser beta2) in the other. The percentage of Hb G-Philadelphia was not influenced by the simultaneous presence of a beta-thalassemai determinant, but that of Hb Rampa was descreased from 20% in the simple heterozygote to about 6% in persons with the Hb Rampa-beta-thalassemia combination. Data from in vitro recombination experiments with isolated alpha X, alpha A, and beta A chains, with heme attached, indicated a preferential formation of Hb A over Hb Rampa but not over Hb G-Philadelphia in conditions of relative beta-chain deficiency. This suggests that the rate of assembly of monomers to form dimers or tetramers can be an important mechanism of controlling the quantity of certain hemoglobin variants with critical substitutions in heterozygotes. PMID:681817

  3. Gene structure for the. alpha. 1 chain of a human short-chain collagen (type XIII) with alternatively spliced transcripts and translation termination codon at the 5' end of the last exon

    SciTech Connect

    Tikka, L.; Pihlajaniemi, T.; Henttu, P.; Prockop, D.J.; Tryggvason, K. )

    1988-10-01

    Two overlapping human genomic clones that encode a short-chain collagen, designated {alpha}1(XIII), were isolated by using recently described cDNA clones. Characterization of the cosmid clones that span {approx} 65,000 base pairs (bp) of the 3' end of the gene established several unusual features of this collagen gene. The last exon encodes solely the 3' untranslated region and it begins with a complete stop codon. The 10 adjacent exons vary in size from 27 to 87 bp and two of them are 54 bp. Therefore, the {alpha}1-chain gene of type XIII collagen has some features found in genes for fibrillar collagens but other features that are distinctly different. Previous analysis of overlapping cDNA clones and nuclease S1 mapping of mRNAs indicated one alternative splicing site causing a deletion of 36 bp from the mature mRNA. The present study showed that the 36 bp is contained within the gene as a single exon and also that the gene has a 45-bp -Gly-Xaa-Xaa- repeat coding exon not found in the cDNA clones previously characterized. Nuclease S1 mapping experiments indicated that this 45-bp exon is found in normal human skin fibroblast mRNAs. Accordingly, the data demonstrate that there is alternative splicing of at least two exons of the type {alpha}1(XIII)-chain gene.

  4. Chain length specificity for activation of cPLA2alpha by C1P: use of the dodecane delivery system to determine lipid-specific effects.

    PubMed

    Wijesinghe, Dayanjan S; Subramanian, Preeti; Lamour, Nadia F; Gentile, Luciana B; Granado, Maria H; Bielawska, Alicja; Szulc, Zdzislaw; Gomez-Munoz, Antonio; Chalfant, Charles E

    2009-10-01

    Previously, our laboratory demonstrated that ceramide-1-phosphate (C1P) specifically activated group IVA cytosolic phospholipase A(2) (cPLA(2)alpha) in vitro. In this study, we investigated the chain length specificity of this interaction. C1P with an acyl-chain of >or=6 carbons efficiently activated cPLA(2)alpha in vitro, whereas C(2)-C1P, was unable to do so. Delivery of C1P to cells via the newly characterized ethanol/dodecane system demonstrated a lipid-specific activation of cPLA(2)alpha, AA release, and PGE(2) synthesis (EC(50) = 400 nM) when compared to structurally similar lipids. C1P delivered as vesicles in water also induced a lipid-specific increase in AA release. Mass spectrometric analysis demonstrated that C1P delivered via ethanol/dodecane induced a 3-fold increase in endogenous C1P with little metabolism to ceramide. C1P was also more efficiently delivered (>3-fold) to internal membranes by ethanol/dodecane as compared to vesiculated C1P. Using this now established delivery method for lipids, C(2)-C1P was shown to be ineffective in the induction of AA release as compared with C(6)-C1P, C(16)-C1P, and C(18:1) C1P. Here, we demonstrate that C1P requires >or=6 carbon acyl-chain to activate cPLA(2)alpha. Thus, published reports on the biological activity of C(2)-C1P are not via eicosanoid synthesis. Furthermore, this study demonstrates that the alcohol/dodecane system can be used to efficiently deliver exogenous phospholipids to cells for the examination of specific biological effects.

  5. Restricted TCR-alpha CDR3 diversity disadvantages natural regulatory T cell development in the B6.2.16 beta-chain transgenic mouse.

    PubMed

    Singh, Yogesh; Ferreira, Cristina; Chan, Andrew C Y; Dyson, Julian; Garden, Oliver A

    2010-09-15

    To date, analysis of mice expressing TCR-beta transgenes derived from CD4(+) T cell clones has demonstrated equivalent or higher TCR diversity in naturally occurring regulatory CD4(+) T cells (Tregs) versus conventional CD4(+) T cells (Tcons). However, TCR-alpha-chain diversity in these mice may be influenced by the inherent bias toward the CD4(+) lineage in the selected repertoires. We wished to determine whether the choice of TCR-beta-chain influences the relative diversity of the Treg and Tcon repertoires, examining as a model the B6.2.16beta-transgenic mouse, in which the fixed beta-chain is derived from a CD8(+) T cell clone. B6.2.16beta Treg thymocytes showed significantly lower TRAV17 (AV9) CDR3 sequence diversity than both syngeneic Tcon thymocytes, and Treg and Tcon thymocytes from wild-type C57BL/6 (B6) mice. The ratio of single-positive CD4(+)/single-positive CD8(+) thymocytes in B6.2.16beta mice was similar to that in B6, yet both the proportional frequency and absolute number of CD4(+)Foxp3(+) cells was significantly lower in the thymi and peripheral lymph nodes of B6.2.16beta mice. Furthermore, B6 + B6.2.16beta-->B6 mixed bone marrow chimeras revealed that the transgenic beta-chain disadvantaged Treg development in a competitive environment. These data underline the importance of the beta-chain in assessments of Treg alpha-chain diversity and provide further support for the notion that interclonal competition for entry into the Treg lineage is a significant factor in determining the composition of this lineage.

  6. [Anomaly of the polypeptide and oligosaccharide chains of alpha-2-neuraminoglycoprotein in various types of hereditary angioneurotic edema].

    PubMed

    Ollier-Hartmann, M P; Hartmann, L

    1980-05-12

    Using two-dimensional immuno-electrophoresis to study a morphological abnormality of the alpha 2-neuramino-glycoprotein (alpha 2-NGP) we have been able to observe allelic exclusion in patients afflicted by hereditary angioneurotic oedema [1]. With the aid of two-dimensional immuno-affino-electrophoresis, we have been able to show that in some cases, there exists a double abnormality of alpha 2-NGP associating a deficiency in post translating glycosylation with a loss of the inhibitory function of the C1 esterase. PMID:6772326

  7. Vasoactive intestinal peptide-induced expression of cytochrome P450 cholesterol side-chain cleavage and 17 alpha-hydroxylase enzyme activity in hen granulosa cells.

    PubMed

    Johnson, A L; Li, Z; Gibney, J A; Malamed, S

    1994-08-01

    Experiments were conducted to determine whether vasoactive intestinal peptide (VIP) can regulate expression of cytochrome P450 side-chain cleavage (P450scc) and P450 17 alpha-hydroxylase (P450 17 alpha-OH) mRNA levels and enzyme activity in granulosa cells from nonhierarchal (6-8-mm) follicles. Initial studies demonstrated that immunoreactive VIP is localized within the theca (but not granulosa) layer of both resting (< 0.5-mm follicles) and 6-8-mm follicles, thus providing a potential paracrine mechanism of action for VIP. While short-term (3 h) incubation of granulosa cells with VIP (0.001-1.0 microM) failed to stimulate progesterone production from 6-8-mm follicle granulosa cells, a 4-h culture period in the presence of VIP resulted in increased cyclic AMP (cAMP) accumulation, and a 24-h culture period resulted in progesterone synthesis and increased P450scc mRNA levels; control levels of each endpoint measurement were not altered within the period observed. By contrast, culture with the growth factor transforming growth factor alpha (TGF alpha) in the presence of VIP (1 microM) prevented increases in P450scc mRNA levels and progesterone production. Similar effects of VIP and TGF alpha in the presence of VIP were demonstrated for P450 17 alpha-OH mRNA levels and enzyme activity. Finally, there was an additive effect of VIP (0.1 microM) plus recombinant human (rh) FSH (100 mIU) on the initiation of progesterone production in cultured 6-8-mm follicle granulosa cells compared to the addition of VIP or rhFSH alone.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Heterodimerization of the alpha and beta chains of the interleukin-3 (IL-3) receptor is necessary and sufficient for IL-3-induced mitogenesis.

    PubMed

    Orban, P C; Levings, M K; Schrader, J W

    1999-09-01

    The high-affinity receptor for interleukin-3 (IL-3) is a complex of the IL-3-binding subunit (alpha(IL-3)) and a larger beta chain-beta(c), or, in the mouse, beta(c) or its close relative beta(IL-3). There is evidence that the critical event that initiates signaling is not the approximation of the cytoplasmic domains of alpha(IL-3) and beta(IL-3), but is, rather, the formation of a beta-beta homodimer. Many of these studies involved the analyses of receptor chimeras where the cytoplasmic domains were derived from alpha(IL-3), beta(c) or beta(IL-3), and the extracellular domains were derived from other cytokine receptors, such as the erythropoietin receptor (EpoR). However, evidence that the EpoR may also associate with other receptors clouds the interpretation of these experiments. Therefore, we reevaluated the structure of the functional IL-3R using chimeric receptors with extracellular domains derived not from members of the cytokine-receptor family, but from CD8 or CD16. We show, by expression of these chimeras in Ba/F3 or CTLL-2 cells, that mitogenic signals were only generated by heterodimerization of the cytoplasmic domains of alpha(IL-3) and beta(IL-3). Homodimers of either alpha(IL-3) or beta(IL-3), alone or in combination, were nonfunctional. Furthermore, the ability of heterodimers to stimulate mitogenesis correlated with their ability to induce tyrosine phosphorylation of JAK-2. These data suggest that the physiological activation of the IL-3R involves the generation of simple heterodimers of alpha(IL-3) and beta(IL-3).

  9. Determination of molecular species composition of C80 or longer-chain alpha-mycolic acids in Mycobacterium spp. by gas chromatography-mass spectrometry and mass chromatography.

    PubMed

    Kaneda, K; Naito, S; Imaizumi, S; Yano, I; Mizuno, S; Tomiyasu, I; Baba, T; Kusunose, E; Kusunose, M

    1986-12-01

    The molecular species composition of alpha-mycolic acids ranging from C68 to C86 in 13 rapidly growing and 12 slowly growing mycobacterial species was determined by gas chromatography, gas chromatography-mass spectrometry, and mass chromatography. In gas chromatographic analysis, the molecular species of alpha-mycolic acids were well separated as trimethylsilyl ether derivatives of the methyl esters, according to their total carbon numbers. The total carbon and double-bond numbers of mycolic acids at each peak on gas chromatograms were determined from the [M]+, [M - 15]+, and [M - 90]+ ions on the mass spectrum, and straight and branched chain structures were identified by the mass fragment ions [A]+, due to C2--C3 cleavage [R-CH-O-Si(CH3)3]+, and [B]+, due to C3--C4 cleavage [(CH3)3-Si-O-CH-CH(R')-COOCH3]+. The concentration of odd- and even-carbon-numbered mycolic acids, which often overlap each other on gas chromatograms, and the composition of three homologous mycolic acids with different alpha units (C22:0, C24:0, and C26:0) were clearly determined by mass chromatography monitoring [M - 15]+ ions and [B - 29]+ ions, respectively. The molecular species composition of alpha-mycolic acids and their average carbon numbers (av. cn.) as a simple expression of the composition were calculated from the mass chromatograms. Each mycobacterial species examined was demonstrated to possess a characteristic profile of alpha-mycolic acid composition, and based on this the species were classified approximately into eight groups: C68 to C76 (av. cn. 72), dienoic, possessing a C20 alkyl branch at the 2 position (C22 alpha-unit) for Mycobacterium diernhoferi and Mycobacterium sp. strain 3707, a chromogenic rapid grower; C72 to C78 (av. cn. 75), dienoic with both C22 and C24 alpha units, containing a small or a large amount of odd-carbon-numbered molecules, for M. vaccae, M. rhodesiae, and M. phlei (chromogenic rapid growers); C72 to C80 (av. cn. 75 to 77), dienoic with C24 alpha

  10. Single-cell TCRseq: paired recovery of entire T-cell alpha and beta chain transcripts in T-cell receptors from single-cell RNAseq.

    PubMed

    Redmond, David; Poran, Asaf; Elemento, Olivier

    2016-01-01

    Accurate characterization of the repertoire of the T-cell receptor (TCR) alpha and beta chains is critical to understanding adaptive immunity. Such characterization has many applications across such fields as vaccine development and response, clone-tracking in cancer, and immunotherapy. Here we present a new methodology called single-cell TCRseq (scTCRseq) for the identification and assembly of full-length rearranged V(D)J T-cell receptor sequences from paired-end single-cell RNA sequencing reads. The method allows accurate identification of the V(D)J rearrangements for each individual T-cell and has the novel ability to recover paired alpha and beta segments. Source code is available at https://github.com/ElementoLab/scTCRseq . PMID:27460926

  11. Molecular requirements for MHC class II alpha-chain engagement and allelic discrimination by the bacterial superantigen streptococcal pyrogenic exotoxin C.

    PubMed

    Kasper, Katherine J; Xi, Wang; Rahman, A K M Nur-Ur; Nooh, Mohammed M; Kotb, Malak; Sundberg, Eric J; Madrenas, Joaquín; McCormick, John K

    2008-09-01

    Superantigens (SAgs) are microbial toxins that bind to both TCR beta-chain variable domains (Vbetas) and MHC class II molecules, resulting in the activation of T cells in a Vbeta-specific manner. It is now well established that different isoforms of MHC II molecules can play a significant role in the immune response to bacterial SAgs. In this work, using directed mutational studies in conjunction with functional analyses, we provide a complete functional map of the low-affinity MHC II alpha-chain binding interface of the SAg streptococcal pyrogenic exotoxin C (SpeC) and identify a functional epitope in the beta-barrel domain that is required for the activation of T cells. Using cell lines that exclusively express individual MHC II isoforms, our studies provide a molecular basis for the selectivity of SpeC-MHC II recognition, and provide one mechanism by how SAgs are capable of distinguishing between different MHC II alleles.

  12. Isolation and partial structural characterization of an equine fibrinogen CNBr fragment that exhibits immunologic cross-reactivity with an A alpha-chain cross-linking region of human fibrinogen.

    PubMed

    Sobel, J H; Thibodeau, C A; Kolks, M A; Canfield, R E

    1990-09-25

    Immunochemical studies of equine fibrinogen were conducted to characterize the structural basis for the immunologic cross-reactivity observed between human and equine A alpha chains when employing an antiserum to the 26K, human cyanogen bromide (CNBr) fragment, A alpha 241-476 (CNBr VIII). A 38K, equine CNBr fragment that reacts with this antiserum was isolated from CNBr-digested equine fibrinogen by Sephadex G-100 gel filtration. It was further purified by sequential hydrophobic chromatography on phenyl-Sepharose CL-4B, followed by reversed-phased (C-8) high-performance liquid chromatography (HPLC). NH2-Terminal analysis of the purified fragment, designated EqA alpha CNBr, identified one major sequence whose first three residues, E-L-E, were identical with those of human CNBr VIII. Tryptic and staphylococcal protease digests of the equine fragment were resolved by reversed-phase HPLC (C-4, C-18), and the separated components were characterized by amino acid analysis and automated Edman degradation. A total of 34 tryptic and 20 staph protease peptides yielded sequence information that permitted the alignment of 271 equine residues with residues A alpha 241-517 from the COOH-terminal two-thirds of the human A alpha chain so that 63% of the possible matches were identical. Other features of interest included (1) an amino acid substitution in which the methionine residue at A alpha 476 in the human A alpha chain was replaced by a valine residue, thus accounting, in part, for the larger EqA alpha CNBr fragment obtained from the equine molecule, and (2) a region of striking homology in which 36 successive residues, corresponding to A alpha 428-464 in the human A alpha chain, were identical in both species. These findings, together with available structural data for the COOH-terminal portion of the rat and bovine A alpha chains, indicate that the region corresponding to (human) A alpha 240-517 represents a conserved portion of the fibrinogen molecule. This may, in turn

  13. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in lethal (Herlitz) junctional epidermolysis bullosa.

    PubMed

    Kivirikko, S; McGrath, J A; Baudoin, C; Aberdam, D; Ciatti, S; Dunnill, M G; McMillan, J R; Eady, R A; Ortonne, J P; Meneguzzi, G

    1995-05-01

    The inherited mechanobullous disorder, junctional epidermolysis bullosa (JEB), is characterized by extensive blistering and erosions of the skin and mucous membranes. The diagnostic hallmarks of JEB include ultrastructural abnormalities in the hemidesmosomes of the cutaneous basement membrane zone, as well as an absence of staining with antibodies against the anchoring filament protein, laminin 5. Therefore, the three genes encoding alpha 3, beta 3 and gamma 2 chains of laminin 5, known as LAMA3, LAMB3 and LAMC2, are candidate genes for JEB. We have previously demonstrated mutations in the LAMB3 and LAMC2 genes in several families with JEB. We initiated mutation analysis from an affected child by PCR amplification of individual LAMA3 exons, followed by heteroduplex analysis. Nucleotide sequencing of heteroduplexes identified a homozygous nonsense mutation within domain I/II of the alpha 3 chain. These findings provide the first evidence that nonsense mutations within the LAMA3 gene are also involved in the pathogenesis of JEB, and indicate that mutations of all three genes of laminin 5 can result in the JEB phenotype. PMID:7633458

  14. Physical and linkage mapping of the human and murine genes for the [alpha]1 chain of type IX collagen (COL9A1)

    SciTech Connect

    Warman, M.L. Children's Hospital Tiller, G.E.; Polumbo, P.A. ); Seldin, M.F.; Rochelle, J.M. ); Knoll, J.H.M.; Cheng, Sou De ); Olsen, B.R. )

    1993-09-01

    The IX collagen, a member of the FACIT family of extracellular matrix proteins, is a heterotrimer composed of three genetically distinct [alpha] chains. The cDNAs for the human and mouse [alpha]1(IX) chains have been cloned. In this paper the authors confirm the mapping of the human COL9A1 gene to chromosome 6q12-q13 by fluorescence in situ hybridization utilizing two genomic clones which also contain short tandem repeat polymorphisms. They also report the characterization of these repeats and their incorporation into the chromosome 6 linkage map. The COL9A1 locus shows no recombination with the marker D6Z1 (Z = 27.61 at [theta] = 0) and identifies the most likely locus order of KRAS1P-[D6Z1-COL9A1]-D6S30. In addition, using an interspecific backcross panel, they have mapped murine Col9a1 to mouse chromosome 1. Together with other comparative mapping results, these data suggest that the pericentric region of human chromosome 6 is homologous to the most proximal segment of mouse chromosome 1. These data may facilitate linkage studies with COL9A1 (or col9a1) as a candidate gene for hereditary chondrodysplasias and osteoarthritis. 35 refs., 2 figs., 2 tabs.

  15. A homozygous nonsense mutation in the {alpha}3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: Prenatal exclusion in a fetus at risk

    SciTech Connect

    McGrath, J.A. |; Ciatti, S.; Christiano, A.M.

    1995-09-01

    Mutations in the three genes (LAMA3, LAMB3, and LAMC2) that encode the three chains ({alpha}3, {Beta}3, and {gamma}2, respectively) of laminin 5, a protein involved in epidermal-dermal adhesion, have been established as the genetic basis for the inherited blistering skin disorder, Herlitz junctional epidermolysis bullosa (H-JEB). In this study, we performed mutational analysis on genomic DNA from a child with H-JEB and identified a nonsense mutation in the {alpha}3 chain gene (LAMA3) consisting of a homozygous C-to-T transition resulting in a premature termination codon (CGA {r_arrow} TGA) on both alleles. The parents were shown to be heterozygous carriers of the same mutation. Direct mutation analysis was used to perform DNA-based prenatal diagnosis from a chorionic villus biopsy at 10 weeks` gestation in a subsequent pregnancy. The fetus was predicted to be genotypically normal with respect to the LAMA3 mutation. 15 refs., 1 fig.

  16. Effects of kinase inhibitors and potassium phosphate (KPi) on site-specific phosphorylation of branched chain. cap alpha. -ketoacid dehydrogenase (BCKDH)

    SciTech Connect

    Kuntz, M.J.; Shimomura, Y.; Ozawa, T.; Harris, R.A.

    1987-05-01

    BCKDH is phosphorylated by a copurifying kinase at two serine residues on the El..cap alpha.. subunit. Phosphorylation of both sites occurs at about the same rate initially, but inactivation is believed associated only with site 1 phosphorylation. The effects of KPi and known inhibitors of BCKDH kinase, ..cap alpha..-chloroisocaproate (CIC) and branched chain ..cap alpha..-ketoacids (BCKA), on the phosphorylation of purified rat liver BCKDH were studied. Site-specific phosphorylation was quantitated by thin-layer electrophoresis of tryptic peptides followed by densitometric scanning of autoradiograms. Addition of 5 mM KPi was found necessary to stabilize the BCKDH activity at 37/sup 0/C. Increasing the KPi to 50 mM dramatically increased the CIC and BCKA inhibition of site 1 and site 2 phosphorylation. The finding of enhanced sensitivity of inhibitors with 50 mM KPi may facilitate identification of physiologically important kinase effectors. Regardless of the KPi concentration, CIC and the BCKA showed much more effective inhibition of site 2 than site 1 phosphorylation. Although site 1 is the primary inactivating site, predominant inhibition of site 2 phosphorylation may provide a means of modulating kinase/phosphatase control of BCKDH activity under steady state conditions.

  17. Polymerase chain reaction analysis of TNF-alpha and IL-6 mRNA levels in whole blood from cattle naturally or experimentally infected with Mycobacterium paratuberculosis.

    PubMed

    Adams, J L; Collins, M T; Czuprynski, C J

    1996-10-01

    Johne's disease is characterized by a chronic enteritis that results in granulomatous inflammation, cachexia, and eventual death of cattle infected with Mycobacterium paratuberculosis. The cytokines tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6) have been associated with granuloma formation and wasting in other disease syndromes. The potential role of these cytokines in the development and progression of Johne's disease has not been investigated. Using the polymerase chain reaction (PCR) and specific bovine oligonucleotide cytokine primers and probes, we examined the expression of messenger RNA for these cytokines in whole blood from M. paratuberculosis infected and uninfected cattle. Cytokine mRNA levels were examined before and after in vitro incubation with E.coli lipopolysaccharide (LPS) and lipoarabinomannan (LAM) purified from M. paratuberculosis. Uninfected calves, experimentally infected calves, and naturally infected cattle all displayed similar cytokine mRNA expression patterns. However, individual animals demonstrated variability in the levels of IL-6 and TNF-alpha mRNA expression as determined by a semiquantitative PCR method using 32P-labelled oligonucleotide probes.

  18. IL-4 function can be transferred to the IL-2 receptor by tyrosine containing sequences found in the IL-4 receptor alpha chain.

    PubMed

    Wang, H Y; Paul, W E; Keegan, A D

    1996-02-01

    IL-4 binds to a cell surface receptor complex that consists of the IL-4 binding protein (IL-4R alpha) and the gamma chain of the IL-2 receptor complex (gamma c). The receptors for IL-4 and IL-2 have several features in common; both use the gamma c as a receptor component, and both activate the Janus kinases JAK-1 and JAK-3. In spite of these similarities, IL-4 evokes specific responses, including the tyrosine phosphorylation of 4PS/IRS-2 and the induction of CD23. To determine whether sequences within the cytoplasmic domain of the IL-4R alpha specify these IL-4-specific responses, we transplanted the insulin IL-4 receptor motif (I4R motif) of the huIL-4R alpha to the cytoplasmic domain of a truncated IL-2R beta. In addition, we transplanted a region that contains peptide sequences shown to block Stat6 binding to DNA. We analyzed the ability of cells expressing these IL-2R-IL-4R chimeric constructs to respond to IL-2. We found that IL-4 function could be transplanted to the IL-2 receptor by these regions and that proliferative and differentiative functions can be induced by different receptor sequences.

  19. Leucine-induced activation of translational initiation is partly regulated by the branched-chain {alpha}-keto acid dehydrogenase complex in C2C12 cells

    SciTech Connect

    Nakai, Naoya . E-mail: nakai@hss.osaka-u.ac.jp; Shimomura, Yoshiharu; Tamura, Tomohiro; Tamura, Noriko; Hamada, Koichiro; Kawano, Fuminori; Ohira, Yoshinobu

    2006-05-19

    Branched-chain amino acid leucine has been shown to activate the translational regulators through the mammalian target of rapamycin. However, the leucine's effects are self-limiting because leucine promotes its own disposal by an oxidative pathway. The irreversible and rate-limiting step in the leucine oxidation pathway is catalyzed by the branched-chain {alpha}-keto acid dehydrogenase (BCKDH) complex. The complex contains E1 ({alpha}2{beta}2), E2, and E3 subunits, and its activity is abolished by phosphorylation of the E1{alpha} subunit by BCKDH kinase. The relationship between the activity of BCKDH complex and leucine-mediated activation of the protein translation was investigated using the technique of RNA interference. The activity of BCKDH complex in C2C12 cell was modulated by transfection of small interfering RNA (siRNA) for BCKDH E2 subunit or BCKDH kinase. Transfection of siRNAs decreased the mRNA expression and protein amount of corresponding gene. Suppression of either E2 subunit or kinase produced opposite effects on the cell proliferation and the activation of translational regulators by leucine. Suppression of BCKDH kinase for 48 h resulted in decreasing cell proliferation. In contrast, E2 suppression led to increased amount of total cellular protein. The phosphorylation of p70 S6 kinase by leucine was increased in E2-siRNA transfected C2C12 cells, whereas the leucine's effect was diminished in kinase-siRNA transfected cells. These results suggest that the activation of the translational regulators by leucine was partly regulated by the activity of BCKDH complex.

  20. Use of the V delta 1 variable region in the functional T-cell receptor alpha chain of a WT31+ cytotoxic T lymphocyte clone which specifically recognizes HLA-A2 molecule.

    PubMed

    Castelli, C; Mazzocchi, A; Salvi, S; Anichini, A; Sensi, M

    1992-04-01

    We report here the molecular characterization of the T-cell receptor (TCR) expressed by a human HLA-A2 specific cytotoxic T-cell clone named CTL 49. Flow cytometry analysis with a panel of anti-TCR antibodies revealed an OKT3+, WT31+, A13+, BB3-, TCR delta-, delta TCS1-, TCR gamma/delta 1-, OKT4-, and OKT8+ phenotype, suggesting that, in CTL 49, the V delta 1-encoded A13 epitope could be included in its alpha beta TCR. Northern blot analysis confirmed the presence of C alpha, C beta and V delta 1 specific transcripts while no hybridization signal was detected by a C delta specific probe. Polymerase chain reaction (PCR) amplification of the first strand cDNA from CTL 49 with TCR-specific primers and sequence analysis revealed that V delta 1 region is productively rearranged to J alpha and to C alpha regions. This alpha chain pairs with a beta chain composed of V beta 13.2/D beta/J beta 2.3/C beta 2 leading to the expression of a functional TCR complex. These results, in addition to providing further evidence for the sharing of V delta 1 by alpha/beta and gamma/delta TCR, indicate that an alpha/beta T-cell receptor which includes the V delta 1 variable region can be involved in alloreactive recognition. PMID:1313600

  1. Fcγ Receptor I Alpha Chain (CD64) Expression in Macrophages Is Critical for the Onset of Meningitis by Escherichia coli K1

    PubMed Central

    Selvaraj, Suresh K.; Wooster, David G.; Babu, M. Madan; Schreiber, Alan D.; Verbeek, J. Sjef; Prasadarao, Nemani V.

    2010-01-01

    Neonatal meningitis due to Escherichia coli K1 is a serious illness with unchanged morbidity and mortality rates for the last few decades. The lack of a comprehensive understanding of the mechanisms involved in the development of meningitis contributes to this poor outcome. Here, we demonstrate that depletion of macrophages in newborn mice renders the animals resistant to E. coli K1 induced meningitis. The entry of E. coli K1 into macrophages requires the interaction of outer membrane protein A (OmpA) of E. coli K1 with the alpha chain of Fcγ receptor I (FcγRIa, CD64) for which IgG opsonization is not necessary. Overexpression of full-length but not C-terminal truncated FcγRIa in COS-1 cells permits E. coli K1 to enter the cells. Moreover, OmpA binding to FcγRIa prevents the recruitment of the γ-chain and induces a different pattern of tyrosine phosphorylation of macrophage proteins compared to IgG2a induced phosphorylation. Of note, FcγRIa−/− mice are resistant to E. coli infection due to accelerated clearance of bacteria from circulation, which in turn was the result of increased expression of CR3 on macrophages. Reintroduction of human FcγRIa in mouse FcγRIa−/− macrophages in vitro increased bacterial survival by suppressing the expression of CR3. Adoptive transfer of wild type macrophages into FcγRIa−/− mice restored susceptibility to E. coli infection. Together, these results show that the interaction of FcγRI alpha chain with OmpA plays a key role in the development of neonatal meningitis by E. coli K1. PMID:21124939

  2. Human and rat mast cell high-affinity immunoglobulin E receptors: Characterization of putative. alpha. -chain gene products

    SciTech Connect

    Shimizu, Akira; Benfey, P.N.; Leder, P. ); Tepler, I. Brigham and Women's Hospital, Boston, MA ); Berenstein, E.H.; Siraganian, R.P. )

    1988-03-01

    The authors have cloned and determined the entire nucleotide sequence of cDNAs corresponding to the putative {alpha} subunits of the human and rat mast cell high-affinity IgE receptors. Both human and rat cDNAs encode an NH{sub 2}-terminal signal peptide, two immunoglobulin-like extracellular domains (encoded by discrete exons), a hydrophobic transmembrane region, and a positively charged cytoplasmic tail. The human and rat {alpha} subunits share an overall homology with one another and the immunoglobulin gene family, suggesting that they arose from a common ancestral gene and continue to share structural homology with their ligands. In addition, the rat gene is transcribed into at least three distinct forms, each of which yields a somewhat different coding sequence.

  3. Three cases of congenital dysfibrinogenemia in unrelated Chinese families: heterozygous missense mutation in fibrinogen alpha chain Argl6His.

    PubMed

    Luo, Meiling; Deng, Donghong; Xiang, Liqun; Cheng, Peng; Liao, Lin; Deng, Xuelian; Yan, Jie; Lin, Faquan

    2016-09-01

    Congenital dysfibrinogenemia (CD) is a qualitative fibrinogen disorder caused by an abnormal fibrinogen molecule structure, leading to dysfunctional blood coagulation. This study describes 3 cases of dysfibrinogenemia identified in the unrelated Chinese pedigrees.Routine coagulation screening tests were performed on the probands and their families. The antigens and functionality of fibrinogen was measured using an immunoturbidimetry assay and the Clauss method, respectively. To identify the genetic mutation responsible for these dysfibrinogens, genomic DNA extracted from the blood was analyzed using PCR amplification and direct sequencing. The presence of the mutant chains was determined using matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectroscopy. Purified plasma fibrinogen of 3 probands was analyzed using SDS-PAGE, fibrinogen clottability, fibrin polymerization, fibrinopeptide release, and scanning electron microscopy (SEM).The 3 probands had a long thrombin time. Levels of functional fibrinogen were found to be very low, while the fibrinogen antigen was within the normal range. DNA sequencing revealed a heterozygous Arg16His substitution in the fibrinogen Aα chain (FGA). The mutant chains were found to be expressed using MALDI-TOF mass spectroscopy. SDS-PAGE did not reveal any difference in the molecular weights of 3 polypeptide chains between normal and abnormal fibrinogens. Fibrinogen clottability showed a slower fibrin clot formation than the healthy control. Fibrin polymerization, after addition of thrombin, showed a prolonged lag phase and decreased final turbidity. The kinetics of fibrinopeptides release revealed a decreased amount of the released fibrinopeptide A. SEM of the patient's fibrin clot was found to be abnormal.Results indicate that the 3 probands with dysfibrinogenemia were caused by mutations of Aα chain Arg16His. Mutation of this fibrinogen induced dysfunction of plasma fibrinogen. PMID:27684817

  4. Substitution of arginine for glycine at position 154 of the {alpha}1 chain of type I collagen in a variant of osteogenesis imperfecta: Comparison to previous cases with the same mutation

    SciTech Connect

    Zhuang, J.; Tromp, G.; Kuivaniemi, H.; Prockop, D.J.; Castells, S.

    1996-01-11

    A substitution of arginine for glycine at amino acid position 154 of the {alpha}1(I) collagen chain was found in a father and his three children. The phenotype of the patients includes manifestations of types I and III/IV osteogenesis imperfecta, but appears to be milder than that of the previously described two unrelated patients that had the identical mutation in the {alpha}1(I) collagen chain. The variability in the phenotype raises the possibility of epistatic loci or environmental effects on expression of the disorder. 35 refs., 3 figs., 2 tabs.

  5. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    SciTech Connect

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. ); Kalsheker, N. )

    1988-09-12

    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  6. Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

    PubMed

    Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

    1995-09-01

    Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

  7. Further investigations of enhancing effect of medium-chain triglycerides on d-alpha-tocopherol acetate absorption from lecithin-dispersed preparations in rat small intestine.

    PubMed

    Fukui, E; Tabuchi, H; Kurosaki, Y; Nakayama, T; Kimura, T

    1989-12-01

    The effect of medium-chain triglycerides (MCTG) in lecithin-dispersed d-alpha-tocopherol acetate (VEA) preparation on intestinal absorption of VEA was investigated in rats using the in situ loop experiment. When VEA preparations containing soybean phosphatidylcholine (PC) and various amounts of MCTG were administered, the amount of VEA absorbed in 2 h was not significantly different among them. However, the amounts of total VE, sum of VEA and d-alpha-tocopherol (VE), remaining in the luminal fluid and the intestinal tissue were dependent on the MCTG content. Total VE remaining in the intestinal tissue after the administration of a VEA/PC/MCTG (5/16/1 by weight) preparation was nearly twice of VEA/PC (5/16) preparation, although the effect of MCTG varied with the increase or decrease in the MCTG content. Moreover, the increased tissue accumulation of total VE by the VEA/PC/MCTG (5/16/1) preparation resulted in an increase in the plasma VE concentration after the removal of the luminal fluid. No effect of pretreatment with PC/MCTG (1/1) dispersion on the tissue accumulation of total VE from VEA/PC (5/16) preparation was observed. Furthermore, the plasma concentration of VE from VEA and/or VE taken up in the tissue from the VEA/PC preparation was not increased by the treatment with the PC/MCTG dispersion. These results suggest that MCTG should coexist in the luminal VEA preparation to enhance the mucosal uptake. A similar enhancing effect was also observed by the addition of the metabolite of MCTG, a medium-chain fatty acid.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Structural and Thermodynamic Basis for Weak Interactions between Dihydrolipoamide Dehydrogenase and Subunit-binding Domain of the Branched-chain [alpha]-Ketoacid Dehydrogenase Complex

    SciTech Connect

    Brautigam, Chad A.; Wynn, R. Max; Chuang, Jacinta L.; Naik, Mandar T.; Young, Brittany B.; Huang, Tai-huang; Chuang, David T.

    2012-02-27

    The purified mammalian branched-chain {alpha}-ketoacid dehydrogenase complex (BCKDC), which catalyzes the oxidative decarboxylation of branched-chain {alpha}-keto acids, is essentially devoid of the constituent dihydrolipoamide dehydrogenase component (E3). The absence of E3 is associated with the low affinity of the subunit-binding domain of human BCKDC (hSBDb) for hE3. In this work, sequence alignments of hSBDb with the E3-binding domain (E3BD) of the mammalian pyruvate dehydrogenase complex show that hSBDb has an arginine at position 118, where E3BD features an asparagine. Substitution of Arg-118 with an asparagine increases the binding affinity of the R118N hSBDb variant (designated hSBDb*) for hE3 by nearly 2 orders of magnitude. The enthalpy of the binding reaction changes from endothermic with the wild-type hSBDb to exothermic with the hSBDb* variant. This higher affinity interaction allowed the determination of the crystal structure of the hE3/hSBDb* complex to 2.4-{angstrom} resolution. The structure showed that the presence of Arg-118 poses a unique, possibly steric and/or electrostatic incompatibility that could impede E3 interactions with the wild-type hSBDb. Compared with the E3/E3BD structure, the hE3/hSBDb* structure has a smaller interfacial area. Solution NMR data corroborated the interactions of hE3 with Arg-118 and Asn-118 in wild-type hSBDb and mutant hSBDb*, respectively. The NMR results also showed that the interface between hSBDb and hE3 does not change significantly from hSBDb to hSBDb*. Taken together, our results represent a starting point for explaining the long standing enigma that the E2b core of the BCKDC binds E3 far more weakly relative to other {alpha}-ketoacid dehydrogenase complexes.

  9. Mutations within the gene encoding the alpha1(X) chain of type X collagen (COL10A1) occur in individuals with metaphyseal chondrodysplasia

    SciTech Connect

    Wallis, G.A.; Rash, B.; Grant, M.E.

    1994-09-01

    Type X collagen is specifically and transiently synthesized by hypertrophic chondrocytes at sites of endochondral ossification. The pattern of expression of type X collagen suggests that mutations within the encoding gene (COL10A1) may cause heritable forms of chondrodysplasia. We have previously identified two point mutations within the COL10A1 gene that would lead to amino acid substitutions within the carboxyl-terminal domain of the alpha1(X) chain in two unrelated individuals with metaphyseal condrodysplasia type Schmid (MCDS). We have now used PCR followed by SSCP to analyze the coding and promoter regions of the COL10A1 gene as well as the intron/extron boundaries in six further individuals with MCDS and in eleven individuals with related forms of chondrodysplasia. Using this approach, we identified mono- and dinucleotide deletions in four individuals with MCDS in the region of the gene encoding the carboxyl-terminal domain. In these instances, the deletions led to an alteration in reading frame and premature stop codons that would alter either chain recognition or assembly of the type X collagen molecule. In two individuals with MCDS we did not detect mutations within the COL10A1 gene despite extensive analysis of the coding regions. We also did not detect mutations within COL10A1 in two individuals with MCD type Jansen, one individual with MCD plus melabsorption and neutropenia, three individuals with spondylometaphyseal chondrodysplasia (SMD) type Kozlowski and five individuals with the unclassifiable forms of MCD and SMD.

  10. Intracellular dissociation and reassembly of prolyl 4-hydroxylase:the alpha-subunits associated with the immunoglobulin-heavy-chain binding protein (BiP) allowing reassembly with the beta-subunit.

    PubMed Central

    John, D C; Bulleid, N J

    1996-01-01

    Prolyl 4-hydroxylase (P4-H) consists of two distinct polypeptides; the catalytically more important alpha-subunit and the beta-subunit, which is identical to the multifunctional enzyme protein disulphide isomerase. The enzyme appears to be assembled in vivo into an alpha 2 beta 2 tetramer from newly synthesized alpha-subunits associating with an endogenous pool of beta-subunits. Using a cell-free system, we have shown previously that enzyme assembly is redox-dependent and that assembled alpha-subunits are intramolecularly disulphide-bonded [John and Bulleid (1994) Biochemistry 33, 14018-14025]. Here we have studied this assembly process within intact cells by expressing both subunits in COS-1 cells. Newly synthesized alpha-subunits were shown to assemble with the beta-subunit, to form insoluble aggregates, or to remain soluble but not associate with the beta-subunit. Treatment of cells with dithiothreitol (DTT) led to dissociation of P4-H into subunits and on removal of DTT the enzyme reassembled. This reassembly was ATP-dependent, suggesting an interaction with an ATP-dependent chaperone. This was confirmed when immunoglobulin-heavy-chain binding protein (BiP) and alpha-subunits were co-immunoprecipitated with antibodies against the alpha-subunit and BiP, respectively. These results indicate that unassembled alpha-subunits are maintained in an assembly-competent form by interacting with the molecular chaperone BiP. PMID:8760347

  11. Chain-length-dependent conformational transformation and melting behaviour of alkyl/oligo(oxyethylene)/alkyl triblock compounds: alpha-octyl-omega-octyloxyoligo(oxyethylene)s.

    PubMed

    Fukuhara, Koichi; Mizawa, Takahiro; Inoue, Tomohiro; Kumamoto, Hirotaka; Terai, Yoshihide; Matsuura, Hiroatsu; Viras, Kyriakos

    2005-04-01

    The chain-length-dependent conformational transformation and the melting behaviour of triblock compounds alpha-octyl-omega-octyloxyoligo(oxyethylene)s, H(CH2)8(OCH2CH2)mO(CH2)8H (abbreviated as C8EmC8) (m = 1-8), have been studied by infrared spectroscopy and differential scanning calorimetry. The compounds with m = 1-5 assume the all-trans planar form (gamma-form) in the solid state, while those with m = 7 and 8 assume the planar/ helical/planar form with conformational defects in the alkyl chain (beta'-form). Conformational polymorphism was observed for C8E6C8: the gamma-form for the annealed solid and the planar/helical/planar form without conformational defects (beta-form) for the unannealed solid. The conformational transformation from the planar form into the planar/helical/planar form takes place at a length of the oligo(oxyethylene) chain m = 6. This result for C8EmC8 and a similar conformational transformation for C6EmC6 at m = 5 (previous work) demonstrate that the conformation of the CnEmCn triblock compounds in the solid state is determined by intramolecular conformational restoring force in the central oligo(oxyethylene) block, intermolecular dipole-dipole interaction of the C-O bonds and intermolecular packing force in the end alkyl blocks. The melting points of the gamma-form solid of C8EmC8 are much lower than the melting points of n-alkanes with similar molecular masses. The observed thermodynamic quantities show that the planar structure of the oligo(oxyethylene) chain is stabilized by the force of the magnitude that maintains the rotator phase of n-alkanes. For the beta'-form solid of C8EmC8, the alkyl blocks, which are partially noncrystalline, and the oligo(oxyethylene) block melt together at the melting point, unlike the beta-form solid of C6EmC6, for which the melting of the alkyl blocks takes place before the melting of the oligo(oxyethylene) block. The beta-form solid of C8E6C8 (unannealed) melts via the gamma-form solid.

  12. Enhancing effect of medium-chain triglycerides on intestinal absorption of d-alpha-tocopherol acetate from lecithin-dispersed preparations in the rat.

    PubMed

    Fukui, E; Kurohara, H; Kageyu, A; Kurosaki, Y; Nakayama, T; Kimura, T

    1989-02-01

    The effect of formulations of lecithin-dispersed preparation on the absorption of d-alpha-tocopherol acetate (VEA) from the small intestine was investigated in rats. When lecithin-dispersed preparations containing VEA or polysorbate 80 (PS-80)-solubilized solution of VEA were intraduodenally administered, VEA was hydrolyzed to d-alpha-tocopherol (VE) and was not detected in the plasma nor in the thoracic lymph. The maximum plasma concentration (Cmax) of VE after the intraduodenal administration of a preparation consisting of VEA, soybean phosphatidylcholine (PC) and medium-chain triglycerides (MCTG) (VEA/PC/MCTG, 5/16/1 by weight) was highest among the VEA preparations, and PS-80-solubilized solution gave the lowest Cmax. AUC of VE up to 24 h was also increased by the addition of MCTG to VEA/PC preparation. In the thoracic duct-fistula rat, the transport of VE into the thoracic lymph was increased by the administration of the VEA/PC/MCTG preparation significantly more than the VEA/PC preparation; the cumulative amounts of VE recovered in the thoracic lymph up to 24 h were 23.2 +/- 0.5% and 10.9 +/- 1.5% of dose, respectively. The plasma concentration of VE was not increased in the thoracic duct-fistula rat even after the intraduodenal administration of VEA preparations, suggesting that VE is not transported directly to the systemic circulation, but by way of the lymphatic route. The lymphatic transport of VE following the intraduodenal administration of VEA/PC/MCTG preparation was markedly diminished by the simultaneous administration of Pluronic L-81 emulsion, an inhibitor of chylomicron formation. It is suggested that the chylomicron is essential to the lymphatic transport of VE from VEA preparations.

  13. Frequent expression loss of Inter-alpha-trypsin inhibitor heavy chain (ITIH) genes in multiple human solid tumors: A systematic expression analysis

    PubMed Central

    Hamm, Alexander; Veeck, Juergen; Bektas, Nuran; Wild, Peter J; Hartmann, Arndt; Heindrichs, Uwe; Kristiansen, Glen; Werbowetski-Ogilvie, Tamra; Del Maestro, Rolando; Knuechel, Ruth; Dahl, Edgar

    2008-01-01

    Background The inter-alpha-trypsin inhibitors (ITI) are a family of plasma protease inhibitors, assembled from a light chain – bikunin, encoded by AMBP – and five homologous heavy chains (encoded by ITIH1, ITIH2, ITIH3, ITIH4, and ITIH5), contributing to extracellular matrix stability by covalent linkage to hyaluronan. So far, ITIH molecules have been shown to play a particularly important role in inflammation and carcinogenesis. Methods We systematically investigated differential gene expression of the ITIH gene family, as well as AMBP and the interacting partner TNFAIP6 in 13 different human tumor entities (of breast, endometrium, ovary, cervix, stomach, small intestine, colon, rectum, lung, thyroid, prostate, kidney, and pancreas) using cDNA dot blot analysis (Cancer Profiling Array, CPA), semiquantitative RT-PCR and immunohistochemistry. Results We found that ITIH genes are clearly downregulated in multiple human solid tumors, including breast, colon and lung cancer. Thus, ITIH genes may represent a family of putative tumor suppressor genes that should be analyzed in greater detail in the future. For an initial detailed analysis we chose ITIH2 expression in human breast cancer. Loss of ITIH2 expression in 70% of cases (n = 50, CPA) could be confirmed by real-time PCR in an additional set of breast cancers (n = 36). Next we studied ITIH2 expression on the protein level by analyzing a comprehensive tissue micro array including 185 invasive breast cancer specimens. We found a strong correlation (p < 0.001) between ITIH2 expression and estrogen receptor (ER) expression indicating that ER may be involved in the regulation of this ECM molecule. Conclusion Altogether, this is the first systematic analysis on the differential expression of ITIH genes in human cancer, showing frequent downregulation that may be associated with initiation and/or progression of these malignancies. PMID:18226209

  14. Cleavage of functional IL-2 receptor alpha chain (CD25) from murine corneal and conjunctival epithelia by MMP-9

    PubMed Central

    De Paiva, Cintia S; Yoon, Kyung-Chul; Pangelinan, Solherny B; Pham, Sapa; Puthenparambil, Larry M; Chuang, Eliseu Y; Farley, William J; Stern, Michael E; Li, De-Quan; Pflugfelder, Stephen C

    2009-01-01

    Background IL-2 has classically been considered a cytokine that regulates T cell proliferation and differentiation, signaling through its heterotrimeric receptor (IL-2R) consisting of α (CD25), β (CD122), γ chains (CD132). Expression of IL-2R has also been detected in mucosal epithelial cells. Soluble IL-2Rα (CD25) has been reported as an inflammatory marker. We evaluated the expression of CD25 and CD122 in the ocular surface epithelium and investigated the mechanism of proteolytic cleavage of CD25 from these cells. Methods Desiccating stress (DS) was used as an inducer of matrix metalloproteinase 9 (MMP-9). DS was created by subjecting C57BL/6 and MMP-9 knockout (BKO) mice and their wild-type littermates (WT) mice to a low humidity and drafty environment for 5 days (DS5). A separate group of C57BL/6 mice was subjected to DS5 and treatment with topical 0.025% doxycycline, a MMP inhibitor, administered QID. The expression of CD25 and CD122 was evaluated in cryosections by dual-label laser scanning confocal microscopy. Western blot was used to measure relative levels of CD25 in epithelial lysates. Gelatinase activity was evaluated by in situ zymography. Soluble CD25 in tear fluid was measured by an immunobead assay. Results CD25 and CD122 were abundantly expressed in cornea (all layers) and conjunctiva epithelia (apical and subapical layers) in nonstressed control mice. After desiccating stress, we found that immunoreactivity to CD25, but not CD122, decreased by the ocular surface epithelia and concentration of soluble CD25 in tears increased as MMP-9 staining increased. CD25 was preserved in C57BL/6 mice topically treated with an MMP-9 inhibitor and in MMP-9 knock-out mice. MMP-9 treatment of human cultured corneal epithelial cells decreased levels of CD25 protein in a concentration dependent fashion. Conclusion Our results indicate that functional IL-2R is produced by the ocular surface epithelia and that CD25 is proteolytic cleaved to its soluble form by MMP-9

  15. The contribution of increased collagen synthesis to human glomerulosclerosis: a quantitative analysis of alpha 2IV collagen mRNA expression by competitive polymerase chain reaction

    PubMed Central

    1992-01-01

    We previously reported that one of the main components of the sclerotic material in human glomerular diseases was type IV collagen. In this study we examined the contribution of increased synthesis to this process at the gene expression level. Sufficient material has not been available to study type IV collagen synthesis by normal or sclerotic glomeruli in humans. We took advantage of the availability of nephrectomy specimens from patients with renal carcinoma, and of the observation that approximately 50% of these patients develop varying degrees of glomerulosclerosis. We microdissected glomeruli from 10 patients and analyzed them using in situ reverse transcription coupled with polymerase chain reaction (PCR) analyses (in situ RT-PCR). alpha 2IV collagen mRNA, after reverse transcription into cDNA, was detected in all patients and appeared to be increased in those with glomerulosclerosis (n = 5). A competitive PCR assay was developed to quantitate this change. There was an average 3.7-fold increase in glomerular type IV collagen cDNA in patients with significant sclerosis. This change was not due to an increased number of glomerular cells. Thus, glomerulosclerosis in humans is associated with an elevation of glomerular type IV collagen gene expression, suggesting that increased synthesis of type IV collagen may represent one component of this process. PMID:1281210

  16. Cloning of a murine IL-11 receptor alpha-chain; requirement for gp130 for high affinity binding and signal transduction.

    PubMed Central

    Hilton, D J; Hilton, A A; Raicevic, A; Rakar, S; Harrison-Smith, M; Gough, N M; Begley, C G; Metcalf, D; Nicola, N A; Willson, T A

    1994-01-01

    An adult mouse liver cDNA library was screened with oligonucleotides corresponding to the conserved WSXWS motif of the haemopoietin receptor family. Using this method, cDNA clones encoding a novel receptor were isolated. The new receptor, named NR1, was most similar in sequence and predicted structure to the alpha-chain of the IL-6 receptor and mRNA was expressed in the 3T3-L1 pre-adipocytic cell line and in a range of primary tissues. Expression of NR1 in the factor-dependent haemopoietic cell line Ba/F3 resulted in the generation of low affinity receptors for IL-11 (Kd approximately 10 nM). The capacity to bind IL-11 with high affinity (Kd = 300-800 pM) appeared to require coexpression of both NR1 and gp130, the common subunit of the IL-6, leukaemia inhibitory factor (LIF), oncostatin M (OSM) and ciliary neurotrophic factor (CNTF) receptors. The expression of both NR1 and gp130 was also necessary for Ba/F3 cells to proliferate and M1 cells to undergo macrophage differentiation in response to IL-11. Images PMID:7957045

  17. Alpha 1(XVIII), a collagen chain with frequent interruptions in the collagenous sequence, a distinct tissue distribution, and homology with type XV collagen.

    PubMed Central

    Rehn, M; Pihlajaniemi, T

    1994-01-01

    We report on the isolation of mouse cDNA clones which encode a collagenous sequence designated here as the alpha 1 chain of type XVIII collagen. The overlapping clones cover 2.8 kilobases and encode an open reading frame of 928 amino acid residues comprising a putative signal peptide of 25 residues, an amino-terminal noncollagenous domain of 301 residues, and a primarily collagenous stretch of 602 residues. The clones do not cover the carboxyl-terminal end of the polypeptide, since the translation stop codon is absent. Characteristic of the deduced polypeptide is the possession of eight noncollagenous interruptions varying in length from 10 to 24 residues in the collagenous amino acid sequence. Other features include the presence of several putative sites for both N-linked glycosylation and O-linked glycosaminoglycan attachment and homology of the amino-terminal noncollagenous domain with thrombospondin. It is of particular interest that five of the eight collagenous sequences of type XVIII show homology to the previously reported type XV collagen, suggesting that the two form a distinct subgroup among the diverse family of collagens. Northern blot hybridization analysis revealed a striking tissue distribution for type XVIII collagen mRNAs, as the clones hybridized strongly with mRNAs of 4.3 and 5.3 kilobases that were present only in lung and liver of the eight mouse tissues studied. Images PMID:8183894

  18. The candidate gene approach to susceptibility for abdominal aortic aneurysm: TIMP1, HLA-DR-15, ferritin light chain, and collagen XI-Alpha-1.

    PubMed

    Tilson, M David; Ro, Charles Y

    2006-11-01

    There are two approaches to gene discovery for diseases when genetic susceptibility has been implicated by clinical genetic or case-control studies: (1) genome-wide screening and (2) evaluation of candidate genes. Each has specific advantages and disadvantages. The principal advantage of genome-wide screening is that it is impeccably objective in as much as it proceeds without any presuppositions regarding the importance of specific pathobiological features of the disease process. The principal disadvantage is that such a study is expensive and resource intensive. A large population of enrolled patients and multidisciplinary teams of investigators cooperating from several institutions are usually required. The alternative approach of evaluating candidate genes can be pursued by a small independent laboratory with limited funding and resources, a small collection of clinical specimens, and a small number of team players. The disadvantage is that it is by necessity highly subjective in the process of selecting specific candidates among many reasonable possibilities. There is no a priori assurance that effort will not be expended on one or more candidates that turn out in the end to be failures. This report reviews efforts in our laboratory to evaluate four genes as candidates. One of these tissue inhibitor of metalloprotease 1(TIMP1) led to the description of a polymorphism, but not a conclusive mutation. The other three (HLA-DR-15, ferritin light chain (FTL), and collagen XI-alpha-1 (COL11A1) are subjects of continuing interest. PMID:17182944

  19. Development of a 2 m Pr2Fe14B Cryogenic Permanent Magnet Undulator at SOLEIL

    NASA Astrophysics Data System (ADS)

    Benabderrahmane, C.; Valléau, M.; Berteaud, P.; Tavakoli, K.; Marlats, J. L.; Nagaoka, R.; Béchu, N.; Zerbib, D.; Brunelle, P.; Chapuis, L.; Dallé, D.; Herbeaux, C.; Lestrade, A.; Louvet, M.; Couprie, M. E.

    2013-03-01

    A 2 m long 18 mm period Cryogenic Permanent Magnet Undulator (CPMU) has been constructed at SOLEIL. Praseodymium was chosen instead of Neodymium magnetic material, because of the absence of the Spin Reorientation Transition phenomenon. The use of Pr2Fe14B with a remnence Br of 1.35 T at room temperature enables to increase the peak magnetic field at 5.5 mm minimum gap, from 1.04 T at room temperature to 1.15 T at a cryogenic temperature of 77 K. The magnetic field reaches 1.91 T at a gap of 3 mm in case of FELs applications. Different corrections were performed first at room temperature to adjust the phase error, the electron trajectory and to reduce the multipolar components. A dedicated magnetic measurement bench to check the magnetic performance of the undulator at low temperature has been designed and assembled inside the vacuum chamber. The results of the magnetic measurements at low temperature and at room temperature are compared. The CPMU has been installed and commissioned in the storage ring.

  20. Results from recent hydrogen pellet acceleration studies with a 2-m railgun

    SciTech Connect

    Kim, K.; Zhang, D.J.; King, T.; Haywood, R.; Manns, W.; Venneri, F.

    1989-12-01

    A new 3.2-mm-diameter, two-stage, fuseless, plasma-arc-driven electromagnetic railgun has been designed, constructed, and successfully operated to achieve a record velocity of 2.67 km/s({sup b}) for 3.2 mmD {times} 4 mmL solid hydrogen pellet. The first stage of this hydrogen pellet injector is a combination of a hydrogen pellet generator and a gas fun. The second stage is a 2-m-long railgun which serves as a booster accelerator. The gas fun accelerates a frozen hydrogen pellet to a medium velocity and injects it into the railgun through a perforated coupling piece, which also serves a pressure-relieving mechanism. An electrical breakdown of the propellant gas, which has followed the pellet from the gas fun into the railgun, forms a conducting plasma-arc armature immediately behind the pellet allowing for fuseless operation of the railgun. Study of the pressure profile and the behavior of the plasma-arc armature inside the railgun bore led to elimination of spurious arcing, which prevents operation of the railgun at high voltages (and, therefore, at high currents). A timing circuit that can automatically measure the pellet input velocity and allows for accurate control of arc initiation behind the pellet helps prevent pellet disintegration and mistriggering of the arc initiation circuit. Results from the recent cryogenic operation of the two-stage pellet acceleration system are reported. 11 refs., 2 figs., 1 tab.

  1. The two active sites in human branched-chain alpha-keto acid dehydrogenase operate independently without an obligatory alternating-site mechanism.

    PubMed

    Li, Jun; Machius, Mischa; Chuang, Jacinta L; Wynn, R Max; Chuang, David T

    2007-04-20

    A long standing controversy is whether an alternating activesite mechanism occurs during catalysis in thiamine diphosphate (ThDP)-dependent enzymes. We address this question by investigating the ThDP-dependent decarboxylase/dehydrogenase (E1b) component of the mitochondrial branched-chain alpha-keto acid dehydrogenase complex (BCKDC). Our crystal structure reveals that conformations of the two active sites in the human E1b heterotetramer harboring the reaction intermediate are identical. Acidic residues in the core of the E1b heterotetramer, which align with the proton-wire residues proposed to participate in active-site communication in the related pyruvate dehydrogenase from Bacillus stearothermophilus, are mutated. Enzyme kinetic data show that, except in a few cases because of protein misfolding, these alterations are largely without effect on overall activity of BCKDC, ruling out the requirement of a proton-relay mechanism in E1b. BCKDC overall activity is nullified at 50% phosphorylation of E1b, but it is restored to nearly half of the pre-phosphorylation level after dissociation and reconstitution of BCKDC with the same phosphorylated E1b. The results suggest that the abolition of overall activity likely results from the specific geometry of the half-phosphorylated E1b in the BCKDC assembly and not due to a disruption of the alternating active-site mechanism. Finally, we show that a mutant E1b containing only one functional active site exhibits half of the wild-type BCKDC activity, which directly argues against the obligatory communication between active sites. The above results provide evidence that the two active sites in the E1b heterotetramer operate independently during the ThDP-dependent decarboxylation reaction. PMID:17329260

  2. Inter-alpha-trypsin inhibitor heavy chain 4: a novel biomarker for environmental exposure to particulate air pollution in patients with chronic obstructive pulmonary disease.

    PubMed

    Lee, Kang-Yun; Feng, Po-Hao; Ho, Shu-Chuan; Chuang, Kai-Jen; Chen, Tzu-Tao; Su, Chien-Ling; Liu, Wen-Te; Chuang, Hsiao-Chi

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is a chronic inflammatory disease that is correlated with environmental stress. Particulate matter ≤10 μm (PM10) is considered to be a risk factor for COPD development; however, the effects of PM10 on the protein levels in COPD remain unclear. Fifty subjects with COPD and 15 healthy controls were recruited. Gene ontology analysis of differentially expressed proteins identified immune system process and binding as the most important biological process and molecular function, respectively, in the responses of PM10-exposed patients with COPD. Biomarkers for PM10 in COPD were identified and compared with the same in healthy controls and included proteoglycan 4 (PRG4), inter-alpha-trypsin inhibitor heavy chain 4 (ITIH4), and apolipoprotein F (APOF). PRG4 and ITIH4 were associated with a past 3-year PM10 exposure level. The receiver operating characteristic curve analysis showed that ITIH4 is a sensitive and specific biomarker for PM10 exposure (area under the curve [AUC] =0.690, P=0.015) compared with PRG4 (AUC =0.636, P=0.083), APOF (AUC =0.523, P=0.766), 8-isoprostane (AUC =0.563, P=0.405), and C-reactive protein (CRP; AUC =0.634, P=0.086). ITIH4 levels were correlated with CRP (r=0.353, P=0.005), suggesting that ITIH4 may be involved in an inflammatory mechanism. In summary, serum ITIH4 may be a PM10-specific biomarker in COPD and may be related to inflammation.

  3. Inter-alpha-trypsin inhibitor heavy chain 4: a novel biomarker for environmental exposure to particulate air pollution in patients with chronic obstructive pulmonary disease

    PubMed Central

    Lee, Kang-Yun; Feng, Po-Hao; Ho, Shu-Chuan; Chuang, Kai-Jen; Chen, Tzu-Tao; Su, Chien-Ling; Liu, Wen-Te; Chuang, Hsiao-Chi

    2015-01-01

    Chronic obstructive pulmonary disease (COPD) is a chronic inflammatory disease that is correlated with environmental stress. Particulate matter ≤10 μm (PM10) is considered to be a risk factor for COPD development; however, the effects of PM10 on the protein levels in COPD remain unclear. Fifty subjects with COPD and 15 healthy controls were recruited. Gene ontology analysis of differentially expressed proteins identified immune system process and binding as the most important biological process and molecular function, respectively, in the responses of PM10-exposed patients with COPD. Biomarkers for PM10 in COPD were identified and compared with the same in healthy controls and included proteoglycan 4 (PRG4), inter-alpha-trypsin inhibitor heavy chain 4 (ITIH4), and apolipoprotein F (APOF). PRG4 and ITIH4 were associated with a past 3-year PM10 exposure level. The receiver operating characteristic curve analysis showed that ITIH4 is a sensitive and specific biomarker for PM10 exposure (area under the curve [AUC] =0.690, P=0.015) compared with PRG4 (AUC =0.636, P=0.083), APOF (AUC =0.523, P=0.766), 8-isoprostane (AUC =0.563, P=0.405), and C-reactive protein (CRP; AUC =0.634, P=0.086). ITIH4 levels were correlated with CRP (r=0.353, P=0.005), suggesting that ITIH4 may be involved in an inflammatory mechanism. In summary, serum ITIH4 may be a PM10-specific biomarker in COPD and may be related to inflammation. PMID:25977605

  4. A G {r_arrow} A transition at position IVS-11 +1 of the HEX A {alpha}-chain gene in a non-Ashkenazic Mexican Tay-Sachs infant

    SciTech Connect

    Miranda, S.R.P.; Gwon, S.; DeGasperi, R.

    1994-09-01

    Tay-Sachs disease (TSD) is an autosomal recessive storage disorder caused by a deficiency of the lysosomal enzyme, {beta}-N-acetylhexosaminidase A (Hex A), a heteropolymer composed of two polypeptides, {alpha} and {beta}. Mutations in the {alpha}-chain gene render the enzyme defective, resulting in the accumulation of g{sub m2} ganglioside in the nervous system. Deficiency of Hex A was detected in a non-Ashkenazic girl of Mexican origin indicating infantile onset of TSD. Molecular investigation of the {alpha}-chain gene excluded the typical Ashkenazic 4 bp insertion in the exon 11 and the intron 12 splice-junction mutations by Hae III and Dde I restriction analysis, respectively. Single strand conformation polymorphism (SSCP) analysis showed a different pattern in the sample where exon 11 and flanking regions were amplified in the patient DNA as compared to the migration of control DNA. Sequencing of PCR amplified genomic DNA containing exon 11 and flanking intronic regions showed a single base substitution (G {r_arrow} A) at position IVS-11 +1. This mutation creates a recognition site for the restriction enzyme Mbo II. Digestion of exon 11 and flanking regions with Mbo II demonstrated homozygosity of the patient for this mutation and heterozygosity in the mother. mRNA from cultured fibroblasts obtained from a normal control and from the propositus was reverse transcribed. The cDNAs coding for Hex A {alpha}-chain were amplified in four overlapping fragments. In the patient sample it was not possible to amplify the fragment containing the exon 11/intron 11 junction, indicating that this mutation alters normal RNA processing of the Hex A pre-mRNA resulting in the deficiency of Hex A activity.

  5. Pyriform cell differentiation in Podarcis sicula is accompanied by the appearance of surface glycoproteins bearing alpha-galNAc terminated chains.

    PubMed

    Andreuccetti, P; Famularo, C; Gualtieri, R; Prisco, M

    2001-05-01

    The present histochemical and cytochemical study using a lectin panel (WGA, GSI-A4, GSI-B4, PSA UEA-I, PNA, LCA, Con-A, DBA, MPA, BPA) has demonstrated that, in Podarcis sicula, the differentiation of small follicle cells into pyriform cells by means of intermediate cells is accompanied by the appearance of glycoproteins bearing alpha-GalNAc terminated O-linked side chains on the cell surface. The distribution of DBA- and MPA-binding sites over the follicular epithelium changed during the different stages of oocyte growth. DBA- and MPA-binding sites first appeared at the beginning of folliculogenesis within the zona pellucida (ZP) and on the surface of small cells, i.e., the stem cells of pyriform cells. Afterward, labeling was evident on the cell surfaces of intermediate cells and, later on, also of pyriform cells. On the other hand, no labeling was detected on the small cells located under the basal lamina, which, reportedly, do not differentiate into pyriform cells (Filosa et al. J. Embryol. Exp. Morphol., 1979; 15:297-316). Once pyriform cells were differentiated, the distribution of DBA- and MPA-binding sites over the follicular epithelium remained unchanged until intermediate and pyriform cells underwent apoptosis (Motta et al. J. Exp. Zool., 1996; 276:233-241) and the follicular epithelium transformed into a monolayer composed of small follicle cells only (Filosa Mon. Zool. Ital., 1973; 7:151-165). During this stage of oocyte growth, DBA and MPA labeling gradually decreased to completely disappear in the follicular epithelium of vitellogenic follicles. It is noteworthy that the observed changes in the distribution of DBA- and MPA-binding sites represent the first evidence recognized by lectins of a gradual modification of surface glycoprotein distribution over the follicular epithelium in the ovarian follicles of nonmammalian vertebrates so far studied. Finally, the zona pellucida (ZP), characterized by the presence of GalNAc, GluNAc, Man, and Gal, was

  6. Expression of the IL-7 receptor alpha-chain is down regulated on the surface of CD4 T-cells by the HIV-1 Tat protein.

    PubMed

    McLaughlin, Denny; Faller, Elliott; Sugden, Scott; MacPherson, Paul

    2014-01-01

    HIV infection elicits defects in CD4 T-cell homeostasis in both a quantitative and qualitative manner. Interleukin-7 (IL-7) is essential to T-cell homeostasis and several groups have shown reduced levels of the IL-7 receptor alpha-chain (CD127) on both CD4 and CD8 T-cells in viremic HIV+ patients. We have shown previously that soluble HIV Tat protein specifically down regulates cell surface expression of CD127 on human CD8 T-cells in a paracrine fashion. The effects of Tat on CD127 expression in CD4 T-cells has yet to be described. To explore this effect, CD4 T-cells were isolated from healthy individuals and expression levels of CD127 were examined on cells incubated in media alone or treated with Tat protein. We show here that, similar to CD8 T-cells, the HIV-1 Tat protein specifically down regulates CD127 on primary human CD4 T-cells and directs the receptor to the proteasome for degradation. Down regulation of CD127 in response to Tat was seen on both memory and naive CD4 T-cell subsets and was blocked using either heparin or anti-Tat antibodies. Tat did not induce apoptosis in cultured primary CD4 T-cells over 72 hours as determined by Annexin V and PI staining. Pre-incubation of CD4 T-cells with HIV-1 Tat protein did however reduce the ability of IL-7 to up regulate Bcl-2 expression. Similar to exogenous Tat, endogenously expressed HIV Tat protein also suppressed CD127 expression on primary CD4 T-cells. In view of the important role IL-7 plays in lymphocyte proliferation, homeostasis and survival, down regulation of CD127 by Tat likely plays a central role in immune dysregulation and CD4 T-cell decline. Understanding this effect could lead to new approaches to mitigate the CD4 T-cell loss evident in HIV infection. PMID:25333710

  7. Implications of the colonic deposition of free hemoglobin-alpha chain: a previously unknown tissue by-product in inflammatory bowel disease

    PubMed Central

    Myers, Jeremy N.; Schäffer, Michael W.; Korolkova, Olga Y.; Williams, Amanda D.; Gangula, Pandu R.; M’Koma, Amosy E.

    2014-01-01

    Purpose We analyzed inflamed mucosal/submucosal layers of ulcerative colitis (UC=63) and Crohn’s colitis (CC=50) and unexpectedly we unveiled a pool of free-hemoglobin-alpha (Hb-α) chain. Patients with colitides have increased ROS, DNA-oxidation products, free-iron in mucosa, in pre-neoplastic, and in colitis-cancers and increased risks of developing colorectal-cancer (CRC). All IBD-related-CRC lesions are found in segments with colitis. Linking this information we investigated whether free-Hb-α is key transformational stepping that increases colitis-related-CRC vulnerability. Methods UC/CC samples were profiled using MALDI-MS; protein identification was made by LCM. Diverticulitis (DV) was used as control (Ctrl). The presence of Hb(n) (n=α, β and hemin)/Hb was validated by Western blotting (WB) and immunohistochemistry (IHC). We tested for DNA-damage (DNAD) by exposing normal colonic-epithelial-cell-line, NCM460, to 10μM and 100μM of Hb(n)/Hb, individually for 2 h, 6 h, and 12 h. Quantification of Hb-α-staining was done by Nikon Elements Advance Research Analysis software. ROS was measured by the production of 8-OHdG. DNAD was assessed by Comet-assay. Colonic tissue homogenate antioxidants Nrf2-, CAT-, SOD- and GPx-expressions was analyzed densitometrically/ normalized by β-actin. Results IHC of CC/UC mucosal/submucosal-compartments stained strongly positive for Hb-α and significantly higher vs. Ctrl. NCM460 exposed to Hb(n)/Hb exhibited steadily-increasing ROS and subsequent DNAD. DNAD was higher in 10μM than 100μM in Hb-β/hemin the first 2 h then plateaued followed by DNAD-repair. This may be likely due to apoptosis in the later concentration. Nrf2 enzyme activities among UC, CC and UCAC were observed impaired in all IBD subjects. Decreased levels of Nrf2 among UC vs. CC patients with active disease was insignificant as well as vs. Ctrls but significantly lower in UCAC vs. Ctrl. SOD was decreased in UC and UCAC and GPx in CC but statistically not

  8. A substitution at a non-glycine position in the triple-helical domain of pro alpha 2(I) collagen chains present in an individual with a variant of the Marfan syndrome.

    PubMed Central

    Phillips, C L; Shrago-Howe, A W; Pinnell, S R; Wenstrup, R J

    1990-01-01

    A substitution for a highly conserved non-glycine residue in the triple-helical domain of the pro alpha 2(I) collagen molecule was found in an individual with a variant of the Marfan syndrome. A single base change resulted in substitution of arginine618 by glutamine at the Y position of a Gly-X-Y repeat, and is responsible for the decreased migration in SDS-polyacrylamide gels of some pro alpha 2(I) chains of type I collagen synthesized by dermal fibroblasts from this individual. Family studies suggest that this substitution was inherited from the individual's father who also produces abnormally migrating pro alpha 2(I) collagen chains and shares some of the abnormal skeletal features. This single base change creates a new Bsu36 I (Sau I, Mst II) restriction site detectable in genomic DNA by Southern blot analysis when probed with a COL1A2 fragment. The analysis of 52 control individuals (103 chromosomes) was negative for the new Bsu36 I site, suggesting that the substitution is not a common polymorphism. Images PMID:1978725

  9. Involvement of the alpha2,8-polysialyltransferases II/STX and IV/PST in the biosynthesis of polysialic acid chains on the O-linked glycoproteins in rainbow trout ovary.

    PubMed

    Asahina, Shinji; Sato, Chihiro; Matsuno, Midori; Matsuda, Tsukasa; Colley, Karen; Kitajima, Ken

    2006-11-01

    Polysialoglycoprotein (PSGP) in salmonid fish egg is a unique glycoprotein bearing alpha2,8-linked polysialic acid (polySia) on its O-linked glycans. Biosynthesis of the polySia chains is developmentally regulated and only occurs at later stage of oogenesis. Two alpha2,8-polysialyltransferases (alpha2,8-polySTs), PST (ST8Sia IV) and STX (ST8Sia II), responsible for the biosynthesis of polySia on N-glycans of glycoproteins, are known in mammals. However, nothing has been known about which alpha2,8-polySTs are involved in the biosynthesis of polySia on O-linked glycans in any glycoproteins. We thus sought to identify cDNA encoding the alpha2,8-polyST involved in polysialylation of PSGP. A clone for PST orthologue, rtPST, and two clones for the STX orthologue, rtSTX-ov and rtSTX-em, were identified in rainbow trout. The deduced amino acid sequence of rtPST shows a high identity (72-77%) to other vertebrate PSTs, while that of rtSTX-ov shows 92% identity with rtSTX-em and a significant identity (63-76%) to other vertebrate STXs. The rtPST exhibited the in vivo alpha2,8-polyST activity, although its in vitro activity was low. However, the rtSTXs showed no in vivo and very low in vitro activities. Interestingly, co-existence of rtPST and rSTX-ov in the reaction mixture synergistically enhanced the alpha2,8-polyST activity. During oogenesis, rtPST was constantly expressed, while the expression of rtSTX-ov was not increased until polySia chain is abundantly biosynthesized in the later stage. rtSTX-em was not expressed in ovary. These results suggest that the enhanced expression of rtSTX-ov under the co-expression with rtPST may be important for the biosynthesis of polySia on O-linked glycans of PSGP.

  10. Database algorithm for generating protein backbone and side-chain co-ordinates from a C alpha trace application to model building and detection of co-ordinate errors.

    PubMed

    Holm, L; Sander, C

    1991-03-01

    The problem of constructing all-atom model co-ordinates of a protein from an outline of the polypeptide chain is encountered in protein structure determination by crystallography or nuclear magnetic resonance spectroscopy, in model building by homology and in protein design. Here, we present an automatic procedure for generating full protein co-ordinates (backbone and, optionally, side-chains) given the C alpha trace and amino acid sequence. To construct backbones, a protein structure database is first scanned for fragments that locally fit the chain trace according to distance criteria. A best path algorithm then sifts through these segments and selects an optimal path with minimal mismatch at fragment joints. In blind tests, using fully known protein structures, backbones (C alpha, C, N, O) can be reconstructed with a reliability of 0.4 to 0.6 A root-mean-square position deviation and not more than 0 to 5% peptide flips. This accuracy is sufficient to identify possible errors in protein co-ordinate sets. To construct full co-ordinates, side-chains are added from a library of frequently occurring rotamers using a simple and fast Monte Carlo procedure with simulated annealing. In tests on X-ray structures determined at better than 2.5 A resolution, the positions of side-chain atoms in the protein core (less than 20% relative accessibility) have an accuracy of 1.6 A (r.m.s. deviation) and 70% of chi 1 angles are within 30 degrees of the X-ray structure. The computer program MaxSprout is available on request. PMID:2002501

  11. Occurrence of alpha-D-galactosyl residues in the thyroglobulins from several species. Localization in the saccharide chains of the complex carbohydrate units.

    PubMed

    Spiro, R G; Bhoyroo, V D

    1984-08-10

    Treatment of thyroglobulins from several mammalian sources (calf, sheep, pig, dog, rat, rabbit, guinea pig, and man) with alpha-galactosidase demonstrated a species-dependent occurrence of terminal alpha-D-galactosyl residues which ranged from 11 mol/mol of protein (23% of total galactose) in calf to a complete absence in man. The presence of the alpha-D-galactosyl groups resulted in a partial binding of the thyroglobulins (greater than 70% in calf and sheep) to Bandeiraea simplicifolia I-agarose, and this lectin-thyroglobulin interaction could be quantitated by a solid-phase assay utilizing 125I-labeled B. simplicifolia I. Sequential glycosidase digestions of calf thyroglobulin glycopeptides containing the complex carbohydrate unit (unit B) and characterization of oligosaccharide obtained by partial acid hydrolysis indicated that the alpha-D-galactosyl residues are located on oligosaccharide branches with an alpha-D-Gal-(1----3)-beta-D-Gal-(1----4)-D-GlcNAc sequence. While mild acid treatment of calf thyroglobulin glycopeptides yielded a disaccharide, alpha-D-Gal-(1----3)-D-Gal, and a trisaccharide, alpha-D-Gal-(1----3)-beta-D-Gal-(1----4)-D-GlcNAc, which could be resolved by B. simplicifolia I-agarose or thin-layer chromatography, similar hydrolysis of the human unit B-containing glycopeptides did not produce such components. A study of various glycopeptides indicated that the alpha-D-galactosyl residues are unevenly distributed among the multiple complex carbohydrate units of calf thyroglobulin and are preferentially located in units with a relatively low sialic acid content. During affinity chromatography on B. simplicifolia I-agarose, glycopeptides with multiple alpha-D-galactosyl groups bound more firmly to the lectin than those which contained only a single residue. In contrast to the alpha-D-galactosyl residues, beta-linked galactose of calf thyroglobulin was primarily bound in penultimate locations being susceptible to enzymatic release only after prior

  12. Subunit structure of the dihydrolipoyl transacylase component of branched-chain. cap alpha. -keto acid dehydrogenase complex from bovine liver: mapping of the lipoyl-bearing domain by limited proteolysis

    SciTech Connect

    Not Available

    1986-01-05

    To characterize the lipoyl-bearing domain of the dihydrolipoyl transacylase (E/sub 2/) component, purified branched-chain ..cap alpha..-keto acid dehydrogenase complex from bovine liver was reductively acylated with (U-/sup 14/C)..cap alpha..-ketoisovalerate in the presence of thiamin pyrophosphate and N-ethylmaleimide. Digestion of the modified complex with increasing concentrations of trypsin sequentially cleaved the E/sub 2/ polypeptide chain (M/sub r/ = 52,000) into five radiolabeled lipoyl-containing fragments, L/sub 1/-L/sub 5/. In addition, a lipoate-free inner E/sub 2/ core consisting of fragment A and fragment B was produced. Fragment A contains the active site for transacylation reaction and fragment B is the subunit-binding domain. Fragment L/sub 5/ and fragment B were stable and resistant to further tryptic digestion. Mouse antiserium against E/sub 2/ reacted only with fragments L/sub 1/, L/sub 2/, and L/sub 3/, and did not bind fragments L/sub 4/, L/sub 5/, A, and B as judged by immunoblotting analysis. The anti-E/sub 2/ serum-strongly inhibited the overall reaction catalyzed by the complex, but was without effect on the transacylation activity of E/sub 2/. Measurement of incorporation of (1-/sup 14/C)isobutyryl groups into the E/sub 2/ subunit indicated the presence of 1 lipoyl residue/E/sub 2/ chain.

  13. An atopy-associated polymorphism in the ectodomain of the IL-4R(alpha) chain (V50) regulates the persistence of STAT6 phosphorylation.

    PubMed

    Ford, Andrew Q; Heller, Nicola M; Stephenson, Linda; Boothby, Mark R; Keegan, Achsah D

    2009-08-01

    Several commonly occurring polymorphisms in the IL-4R(alpha) have been associated with atopy in humans; the Q576R and the S503P polymorphisms reside in the cytoplasmic domain, whereas the I50 to V50 polymorphism resides in the extracellular domain of the IL-4R(alpha). The effects of these polymorphisms on signaling remain controversial. To determine the effect of the polymorphisms on IL-4 signaling in human cells, we stably transfected the human monocytic cell line U937 with murine IL-4R(alpha) cDNA bearing the I or V at position 50 and the P503/R576 double mutant. Each form of the murine IL-4R(alpha) mediated tyrosine phosphorylation of STAT6 in response to murine IL-4 treatment similar to the induction of tyrosine phosphorylation by human IL-4 signaling through the endogenous human IL-4R(alpha). After IL-4 removal, tyrosine-phosphorylated STAT6 rapidly decayed in cells expressing I50 or P503R576 murine IL-4Ralpha. In contrast, STAT6 remained significantly phosphorylated for several hours after murine IL-4 withdrawal in cells expressing the V50 polymorphism. This persistence in tyrosine-phosphorylated STAT6 was associated with persistence in CIS mRNA expression. Blocking IL-4 signaling during the decay phase using the JAK inhibitor AG490 or the anti-IL-4R(alpha) Ab M1 abrogated the persistence of phosphorylated STAT6 observed in the V50-IL-4R(alpha)-expressing cells. These results indicate that the V50 polymorphism promotes sustained STAT6 phosphorylation and that this process is mediated by continued engagement of IL-4R(alpha), suggesting enhanced responses of V50 IL-4R when IL-4 is limiting.

  14. Non-Gaussian polymers described by alpha-stable chain statistics: Model, effective interactions in binary mixtures, and application to on-surface separation

    NASA Astrophysics Data System (ADS)

    Majka, M.; Góra, P. F.

    2015-05-01

    The Gaussian chain model is the classical description of a polymeric chain, which provides analytical results regarding end-to-end distance, the distribution of segments around the mass center of a chain, coarse-grained interactions between two chains and effective interactions in binary mixtures. This hierarchy of results can be calculated thanks to the α stability of the Gaussian distribution. In this paper we show that it is possible to generalize the model of Gaussian chain to the entire class of α -stable distributions, obtaining the analogous hierarchy of results expressed by the analytical closed-form formulas in the Fourier space. This allows us to establish the α -stable chain model. We begin with reviewing the applications of Levy flights in the context of polymer sciences, which include: chains described by the heavy-tailed distributions of persistence length; polymers adsorbed to the surface; and the chains driven by a noise with power-law spatial correlations. Further, we derive the distribution of segments around the mass center of the α -stable chain and construct the coarse-grained interaction potential between two chains. These results are employed to discuss the model of binary mixture consisting of the α -stable chains. In what follows, we establish the spinodal decomposition condition generalized to the mixtures of the α -stable polymers. This condition is further applied to compare the on-surface phase separation of adsorbed polymers (which are known to be described with heavy-tailed statistics) with the phase separation condition in the bulk. Finally, we predict the four different scenarios of simultaneous mixing and demixing in the two- and three-dimensional systems.

  15. Identification of monoclonal antibodies with specificity to alpha- or beta-chains of beta 2-integrins using peripheral blood leucocytes of normal and bovine leucocyte adhesion deficient (BLAD) cattle.

    PubMed

    Rutten, V P; Hoek, A; Müller, K E

    1996-08-01

    The reactivity of monoclonal antibodies entered in the panels of the Third Workshop on Ruminant Leucocyte Antigens with lymphocytes and monocytes of normal and beta 2-integrin deficient (Bovine Leucocyte Adhesion Deficiency: BLAD) animals was determined by flow cytometry to investigate potential specificities to alpha- or beta-chains of beta 2-integrins. From the 13 monoclonal antibodies that were entered as having specificity for CD11/CD18 antigens, ten were confirmed correct, but three had reactivity with cells from BLAD animals. We conclude that our approach provides an easy way to reliably identify the majority of beta 2-integrin specific monoclonal antibodies. PMID:8896223

  16. Increased frequency of CD4-8-T cells bearing T-cell receptor alpha beta chains in peripheral blood of atomic bomb survivors exposed to high doses.

    PubMed

    Kusunoki, Y; Kyoizumi, S; Hirai, Y; Fujita, S; Akiyama, M

    1994-07-01

    A rare T-cell subpopulation, CD4-8- alpha beta T cells, may be differentiated through a pathway (or pathways) different from the pathway(s) of conventional CD4+ or CD8+ T cells. In the present study, the frequencies of CD4-8-T cells in peripheral-blood alpha beta T cells in 409 atomic bomb survivors (160 estimated to have been exposed to 1.5 Gy or more and 249 controls) were determined to investigate late effects of radiation on the composition of human T-cell subpopulations. The frequency of CD4-8- alpha beta T-cell decreased significantly with the subject's age and was higher in females than males. A significant increase in the frequency was found in the survivors exposed to more than 1.5 Gy, suggesting that the previous radiation exposure altered differentiation and development of T cells.

  17. Tandem Sp1/Sp3 sites together with an Ets-1 site cooperate to mediate alpha11 integrin chain expression in mesenchymal cells.

    PubMed

    Lu, Ning; Heuchel, Rainer; Barczyk, Malgorzata; Zhang, Wan-Ming; Gullberg, Donald

    2006-03-01

    Alpha11beta1 integrin is a collagen receptor, which is expressed in a highly regulated manner in a specific subset of ectomesenchymally and mesodermally derived cells. We previously established that a 3 kb region upstream of the transcription start site of the ITGA11 gene efficiently induced alpha11 transcription in a cell-type specific manner. Using the human fibrosarcoma cell line HT1080 and human skin fibroblasts, we now report that the majority of the activity in the proximal promoter resides in a region spanning nt +25 to nt -176. Mutation and deletion analyses using luciferase reporter assays showed that tandem low affinity Sp1/Sp3 binding sites, together with an Ets-1-like binding site, were needed for the proximal promoter activity in mesenchymal cells. EMSAs and supershift assays showed that Sp1 and Sp3 both bind to the Sp1/Sp3 binding sites, whereas occupation of the Ets-1 binding site appears to be Sp3-dependent. Chromatin immunoprecipitation assays verified that Sp1, Sp3 and Ets-1 can bind the promoter in vivo. In heterologous Drosophila SL2 cells, Sp1, Sp3 and Ets-1 all transactivated the alpha11 promoter, with Sp1 being the most efficient activator. The lack of any synergistic effect of Sp1/Sp3 and Ets-1 in SL2 cells indicates that an Ets family member other than Ets-1 might be involved in regulating alpha11 transcription in mesenchymal cells. The central role of Sp1 in regulating alpha11 RNA transcription was further verified by the ability of the Sp1 inhibitor mithramycin A to efficiently attenuate alpha11 RNA and protein levels in primary fibroblasts. The proximal promoter itself was able to confer cell-type specific transcription on HT1080 cells and embryonic fibroblasts but not on U2OS and JAR cells. We speculate that the "mesenchymal signature" of alpha11 integrin gene expression is controlled by the activity of Sp1/Sp3, fibroblast-specific combinations of Ets family members and yet unidentified enhancer-binding transcription factors. PMID

  18. Permeation and metabolism of a series of novel lipophilic ascorbic acid derivatives, 6-O-acyl-2-O-alpha-D-glucopyranosyl-L-ascorbic acids with a branched-acyl chain, in a human living skin equivalent model.

    PubMed

    Tai, Akihiro; Goto, Satomi; Ishiguro, Yutaka; Suzuki, Kazuko; Nitoda, Teruhiko; Yamamoto, Itaru

    2004-02-01

    A series of novel lipophilic vitamin C derivatives, 6-O-acyl-2-O-alpha-D-glucopyranosyl-L-ascorbic acids possessing a branched-acyl chain of varying length from C(8) to C(16) (6-bAcyl-AA-2G), were evaluated as topical prodrugs of ascorbic acid (AA) with transdermal activity in a human living skin equivalent model. The permeability of 6-bAcyl-AA-2G was compared with those of the derivatives having a straight-acyl chain (6-sAcyl-AA-2G). Out of 10 derivatives of 6-sAcyl-AA-2G and 6-bAcyl-AA-2G, 6-sDode-AA-2G and 6-bDode-AA-2G exhibited most excellent permeability in this model. Measurement of the metabolites permeated from the skin model suggested that 6-bDode-AA-2G was mainly hydrolyzed via 6-O-acyl AA to AA by tissue enzymes, while 6-sDode-AA-2G was hydrolyzed via 2-O-alpha-D-glucopyranosyl-L-ascorbic acid to AA. The former metabolic pathway seems to be advantageous for a readily available source of AA, because 6-O-acyl AA, as well as AA, is able to show vitamin C activity.

  19. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  20. Enhancement of oral bioavailability of d-alpha-tocopherol acetate by lecithin-dispersed aqueous preparation containing medium-chain triglycerides in rats.

    PubMed

    Kimura, T; Fukui, E; Kageyu, A; Kurohara, H; Kurosaki, Y; Nakayama, T; Morita, Y; Shibusawa, K; Ohsawa, S; Takeda, Y

    1989-02-01

    In order to evaluate oral dosage forms of d-alpha-tocopherol acetate (VEA), d-alpha-tocopherol (VE) concentration in the plasma was examined following oral administration of three VEA preparations; lecithin-dispersed aqueous preparation, polysorbate 80 (PS-80)-solubilized aqueous solution and soybean oil solution. The lecithin-dispersed preparation gave the highest Cmax and the largest AUC0-24h, while Tmax was delayed. In the thoracic duct fistula rat, no increase in VE plasma concentration was observed after intraduodenal administration of lecithin-dispersed VEA preparation via the lymphatic route. The delayed Tmax and prolonged VE plasma concentration obtained with the lecithin-dispersed preparation in comparison with PS-80-solubilized aqueous solution could be explained by the different route of absorption.

  1. Direct measurement of the {sup 11}C({alpha},p){sup 14}N reaction at CRIB: A path from pp-chain to CNO

    SciTech Connect

    Hayakawa, S.; Kubono, S.; Kahl, D.; Yamaguchi, H.; Binh, D. N.; Hashimoto, T.; Wakabayashi, Y.; He, J. J.; Iwasa, N.; Kato, S.; Komatsubara, T.; Kwon, Y. K.; Teranishi, T.; Wanajo, S.

    2012-11-20

    We determined the total reaction rate of the {sup 11}C({alpha},p){sup 14}N reaction relevant to the nucleosynthesis in explosive hydrogen-burning stars. The measurement was performed by means of the thick target method in inverse kinematics with {sup 11}C RI beams. We performed the identification of the ground-state transition and excited-state transitions using time-of-flight information for the first time.

  2. T-cell receptor alpha-chain gene is split in a human T-cell leukemia cell line with a t(11;14)(p15;q11).

    PubMed Central

    Le Beau, M M; McKeithan, T W; Shima, E A; Goldman-Leikin, R E; Chan, S J; Bell, G I; Rowley, J D; Diaz, M O

    1986-01-01

    Chromosomal rearrangements in malignant T-cell disease frequently involve the chromosome bands containing the T-cell receptor genes. The RPMI 8402 cell line, which was established from the leukemia cells of a patient with T-cell acute lymphoblastic leukemia, is characterized by a translocation involving chromosome 14 (band q11) and chromosome 11 (band p15) [t(11;14)(p15;q11)]. By using in situ chromosomal hybridization and Southern blot analysis to examine RPMI 8402 cells, we determined that the break at 14q11 occurs within the variable region sequences of the T-cell receptor alpha-chain gene (TCRA); the break at 11p15 occurs between the HRAS1 gene and the genes for insulin and the insulin-like growth factor 2. These results suggest that the TCRA sequences activate a cellular gene located at 11p15 in malignant T-cell disorders. Images PMID:3540949

  3. Structure of the human gene and two rat cDNAs encoding the alpha chain of GTP-binding regulatory protein Go: two different mRNAs are generated by alternative splicing.

    PubMed Central

    Tsukamoto, T; Toyama, R; Itoh, H; Kozasa, T; Matsuoka, M; Kaziro, Y

    1991-01-01

    Go is a specific class ("other") of signal-transducing heterotrimeric GTP-binding proteins (G proteins) that is expressed in high levels in mammalian brain. We have cloned two different rat cDNAs encoding the alpha subunit of Go (Go alpha-1 and Go alpha-2) and a human Go alpha chromosomal gene. The human Go alpha gene spans more than 100 kilobases and contains 11 exons, including one noncoding exon in the 3' flanking region. The 5' flanking region is highly G + C-rich and contains five G.C boxes (Sp1 binding sites) but no TATA box. Exons 7 and 8 coding for amino acid residues 242-354 of Go alpha protein are duplicated (referred to as exons 7A, 7B, 8A, and 8B). It was found that exons 7A and 8A code for Go alpha-1, and 7B and 8B code for Go alpha-2. This indicates that two different Go alpha mRNAs may be generated by alternative splicing of a single Go alpha gene. The splice sites of the Go alpha-1 and Go alpha-2 genes are completely identical with those encoding human inhibitory G protein alpha subunits Gi2 alpha and Gi3 alpha [Itoh, H., Toyama, R., Kozasa, T., Tsukamoto, T., Matsuoka, M. & Kaziro, Y. (1988) J. Biol. Chem. 263, 6656-6664] and also transducin G protein alpha subunit Gt1 alpha [Raport, C. J., Dere, B. & Hurley, J. (1989) J. Biol. Chem. 264, 7122-7128]. Sequence homology and conservation of the exon-intron organization indicate that the genes coding for Go alpha, Gi2 alpha, Gi3 alpha, Gt1 alpha, and probably Gi1 alpha may be evolved from a common progenitor. Like Go alpha-1, Go alpha-2 is expressed mainly in brain. Images PMID:1901650

  4. Subtle side-chain modifications of the hop phytoestrogen 8-prenylnaringenin result in distinct agonist/antagonist activity profiles for estrogen receptors alpha and beta.

    PubMed

    Roelens, Frederik; Heldring, Nina; Dhooge, Willem; Bengtsson, Martin; Comhaire, Frank; Gustafsson, Jan-Ake; Treuter, Eckardt; De Keukeleire, Denis

    2006-12-14

    In search of therapeutic agents for estrogen-related pathologies, phytoestrogens are being extensively explored. In contrast to naringenin, 8-prenylnaringenin is a potent hop-derived estrogenic compound, highlighting the importance of the prenyl group for hormonal activity. We investigated the effects of substituting the prenyl group at C(8) with alkyl chains of varying lengths and branching patterns on estrogen receptor (ER) subtype ERalpha- and ERbeta-binding affinities and transcriptional activities. In addition, features of the ligand-induced receptor conformations were explored using a set of specific ER-binding peptides. The new 8-alkylnaringenins were found to span an activity spectrum ranging from full agonism to partial agonism to antagonism. Most strikingly, 8-(2,2-dimethylpropyl)naringenin exhibited full agonist character on ERalpha, but pronounced antagonist character on ERbeta. Knowledge on how ER-subtype-selective activities can be designed provides valuable information for future drug or tool compound discovery.

  5. Maple syrup urine disease: The E1{beta} gene of human branched-chain {alpha}-ketoacid dehydrogenase complex has 11 rather than 10 exons, and the 3{prime} UTR in one of the two E1{beta} mRNAs arises from intronic sequences

    SciTech Connect

    Chuang, J.L.; Chuang, D.T.; Cox, R.P.

    1996-06-01

    Maple syrup urine disease (MSUD) or branched-chain ketoaciduria is caused by a deficiency in the mitochondrial branched-chain {alpha}-ketoacid dehydrogenase (BCKAD) complex. The clinical manifestations are characterized by accumulation of branched chain amino and {alpha}-ketoacids, which leads to severe cerebral edema with seizures, ketoacidosis, and mental retardation. The BCKAD complex comprises three catalytic components, i.e., a decarboxylase (E1) consisting of two E1{alpha} (M{sub r} = 46,000) and two E1{Beta} (M{sub r} = 37,500) subunits, a transacylase (E2) that contains 24 lipoic acid-bearing subunits, and a dehydrogenase (E3), which is a homodimeric flavoprotein. MSUD is genetically heterogeneous, since mutations in the E1{alpha} subunit (type IA MSUD), the E1{Beta} subunit (type IB), the E2 subunit (type II) and the E3 subunit (type III) have been described. The functional consequences of certain mutations in the BCKAD complex have been studied. 23 refs., 3 figs.

  6. Molecular analysis of the human laminin alpha3a chain gene (LAMA3a): a strategy for mutation identification and DNA-based prenatal diagnosis in Herlitz junctional epidermolysis bullosa.

    PubMed

    Pulkkinen, L; Cserhalmi-Friedman, P B; Tang, M; Ryan, M C; Uitto, J; Christiano, A M

    1998-09-01

    Mutations in the genes (LAMA3, LAMB3, and LAMC2) encoding the subunit polypeptides of the cutaneous basement membrane zone protein laminin 5 have been reported in different forms of junctional epidermolysis bullosa (JEB), an inherited blistering skin disease. In this study, we present the complete exon-intron organization of the "a" transcript of the laminin alpha3 chain gene, LAMA3a, which is expressed primarily in the skin. We have performed fine-resolution mapping of this gene on chromosome 18q11.2 using a human-hamster radiation hybrid panel. We have also developed a mutation-detection strategy based on the exon-intron structure of LAMA3a. This strategy, based on PCR amplification of genomic sequences, followed by heteroduplex scanning and automated nucleotide sequencing, was used for successful mutation screening in a family with the lethal (Herlitz) type of JEB, and two novel LAMA3 mutations were identified in the proband. The mutations consisted of a single-base pair deletion in LAMA3a exon A11 on the paternal allele, designated 1239delC, and a two-base pair deletion in LAMA3a exon A23 on the maternal allele, designated 2959delGG. This information was also used for DNA-based prenatal testing in a subsequent pregnancy in this family. Collectively, these results attest to our expanding capability to elucidate the genetic basis of various forms of epidermolysis bullosa using molecular techniques. PMID:9759651

  7. Salicylic acid binding of mitochondrial alpha-ketoglutarate dehydrogenase E2 affects mitochondrial oxidative phosphorylation and electron transport chain components and plays a role in basal defense against tobacco mosaic virus in tomato.

    PubMed

    Liao, Yangwenke; Tian, Miaoying; Zhang, Huan; Li, Xin; Wang, Yu; Xia, Xiaojian; Zhou, Jie; Zhou, Yanhong; Yu, Jingquan; Shi, Kai; Klessig, Daniel F

    2015-02-01

    Salicylic acid (SA) plays a critical role in plant defense against pathogen invasion. SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense and involves a specific pathway mediated by mitochondria; however, the underlying mechanisms remain largely unknown. The SA-binding activity of the recombinant tomato (Solanum lycopersicum) alpha-ketoglutarate dehydrogenase (Slα-kGDH) E2 subunit of the tricarboxylic acid (TCA) cycle was characterized. The biological role of this binding in plant defenses against tobacco mosaic virus (TMV) was further investigated via Slα-kGDH E2 silencing and transient overexpression in plants. Slα-kGDH E2 was found to bind SA in two independent assays. SA treatment, as well as Slα-kGDH E2 silencing, increased resistance to TMV. SA did not further enhance TMV defense in Slα-kGDH E2-silenced tomato plants but did reduce TMV susceptibility in Nicotiana benthamiana plants transiently overexpressing Slα-kGDH E2. Furthermore, Slα-kGDH E2-silencing-induced TMV resistance was fully blocked by bongkrekic acid application and alternative oxidase 1a silencing. These results indicated that binding by Slα-kGDH E2 of SA acts upstream of and affects the mitochondrial electron transport chain, which plays an important role in basal defense against TMV. The findings of this study help to elucidate the mechanisms of SA-induced viral defense.

  8. Heavy Chain Diseases

    MedlinePlus

    ... cells often prevents proper absorption of nutrients from food (malabsorption), resulting in severe diarrhea and weight loss. A rare form that affects the respiratory tract also exists. Blood tests are done when alpha heavy chain disease is suspected. Serum protein electrophoresis, measurement of ...

  9. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  10. Conversion of linoleic acid and alpha-linolenic acid to long-chain polyunsaturated fatty acids (LCPUFAs), with a focus on pregnancy, lactation and the first 2 years of life.

    PubMed

    Gibson, Robert A; Muhlhausler, Bev; Makrides, Maria

    2011-04-01

    Over the past two decades, there has been a marked shift in the fatty acid composition of the diets of industrialized nations towards increased intake of the n-6 fatty acid linoleic acid (LA, 18:2n-6), largely as a result of the replacement of saturated fats with plant-based polyunsaturated fatty acid (PUFA). While health agencies internationally continue to advocate for high n-6 PUFA intake combined with increased intakes of preformed n-3 long-chain PUFAs (LCPUFA) docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3) to reduce the incidence of cardiovascular disease (CVD), there are questions as to whether this is the best approach. LA competes with alpha-linolenic acid (18:3n-3) for endogenous conversion to the LC derivatives EPA and DHA, and LA also inhibits incorporation of DHA and EPA into tissues. Thus, high-LA levels in the diet generally result in low n-3 LCPUFA status. Pregnancy and infancy are developmental periods during which the fatty acid supply is particularly critical. The importance of an adequate supply of n-3 LCPUFA for ensuring optimal development of infant brain and visual systems is well established, and there is now evidence that the supply of n-3 LCPUFA also influences a range of growth, metabolic and immune outcomes in childhood. This review will re-evaluate the health benefits of modern Western diets and pose the question of whether the introduction of similar diets to nations with emerging economies is the most prudent public health strategy for improving health in these populations.

  11. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  12. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  13. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  14. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  15. Falling chains

    NASA Astrophysics Data System (ADS)

    Wong, Chun Wa; Yasui, Kosuke

    2006-06-01

    The one-dimensional fall of a folded chain with one end suspended from a rigid support and a chain falling from a resting heap on a table is studied. Because their Lagrangians contain no explicit time dependence, the falling chains are conservative systems. Their equations of motion are shown to contain a term that enforces energy conservation when masses are transferred between subchains. We show that Cayley's 1857 energy nonconserving solution for a chain falling from a resting heap is incorrect because it neglects the energy gained when a link leaves a subchain. The maximum chain tension measured by Calkin and March for the falling folded chain is given a simple if rough interpretation. Other aspects of the falling folded chain are briefly discussed.

  16. Comparisons of the polypeptide chains of globins.

    NASA Technical Reports Server (NTRS)

    Jukes, T. H.

    1971-01-01

    Discussion of the amino acid differences and minimum base differences per codon due to mutations which took place during divergent evolution of vertebrates from a common ancestral gene. The ?random mutation model' of evolution is examined by comparing a carp alpha Hb chain and six mammalian alpha Hb chains in terms of the genetic code. The occurrence of recognizable three-base changes is analyzed and a summary of the distribution of changes in the hemoglobin and myoglobin chains is given for 148 sites.

  17. Monoclonal antibody based immunoassays to screen for alpha-thalassemia in adults

    SciTech Connect

    Epstein, N.; Than, K.A. Culp, K.M.

    1994-09-01

    Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that the presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.

  18. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  19. Human laminin B2 chain

    SciTech Connect

    Pikkarainen, T.; Kallunki, T.; Tryggvason, K.

    1988-05-15

    The complete amino acid sequence of the human laminin B2 chains has been determined by sequencing of cDNA clones. The six overlapping clones studied cover approximately 7.5 kilobases of which 5312 nucleotides were sequenced from the 5' end. The open reading frame codes for a 33-residue signal peptide and a 1576-residue B2 chain proper, which is 189 residues less than in the highly homologous B1 chain. Computer analysis revealed that the B2 chain consists of distinct domains that contain helical structures, cysteine-rich repeats, and globular regions, as does the B1 chain. However, domain ..cap alpha.. and domain ..beta.. of the B1 chain have no counterpart in B2, and the number of cysteine-rich repeats is 12, or 1 less than in the B1 chain. The degree of homology between the two chains is highest in the cysteine repeat-containing domains III and V where 40% of the residues match. However, in helical domains I/II only 16% of residues match. The results demonstrate that the B1 and B2 chains of laminin are highly homologous proteins that are probably the products of related genes.

  20. Characterization, cloning, and expression of porcine alpha B crystallin.

    PubMed

    Liao, J H; Hung, C C; Lee, J S; Wu, S H; Chiou, S H

    1998-03-01

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to compare this chaperone-like structural protein from the eye lenses of different mammalian species, we have cloned and expressed one of the main alpha-crystallin subunits, i.e., alpha B crystallin, from the porcine lenses in order to facilitate the structure-function evaluation and comparison of this chaperonin protein. cDNA encoding alpha B subunit chain was obtained using a new "Marathon cDNA amplification" protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then ligated into pGEM-T plasmid and prepared for nucleotide sequencing by the dideoxy-nucleotide chain-termination method. Sequencing several positive clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 525 base pairs similar to human and bovine alpha B subunits, covering a deduced protein sequence of 175 amino acids including the universal translation-initiating methionine. The porcine alpha B crystallin shows only 3 and 7 residues difference to bovine and human alpha B crystallins respectively, revealing the close relatedness among mammalian eye lens proteins. The sequence differences between porcine and sub-mammalian species such as chicken and bullfrog are much greater, especially at the N- and C-terminal regions of these alpha B crystallins. Expression of alpha B subunit chain in E. coli vector generated a polypeptide which can cross-react with the antiserum against the native and purified alpha B subunit from the native porcine lenses albeit with a much lower activity.

  1. Discovery, structural characterization and functional analysis of alpha-2-macroglobulin, a novel immune-related molecule from Holothuria atra.

    PubMed

    Qian, Jing; Ren, Chunhua; Xia, Jianjun; Chen, Ting; Yu, Zonghe; Hu, Chaoqun

    2016-07-10

    The non-specific protease inhibitor alpha-2-macroglobulin (A2M) is a key macromolecular glycoprotein that involved in host immune defense against pathogens in vertebrates and invertebrates. However, no research regarding A2M has been developed in echinoderms to date. In this study, the full-length cDNA of A2M was cloned from the sea cucumber (Holothuria atra), which is a tropical species widely distributed along the coasts of the South China Sea and designated HaA2M. HaA2M possesses all three conserved functional domains of known A2M proteins, including the bait region domain, thioester domain and receptor-binding domain. Compared to fish and shrimp A2Ms, the histidine residue from the catalytical regions is well conserved in HaA2M. HaA2M mRNA was predominantly expressed in coelomocytes and, to a lesser extent, in the body wall, intestine and respiratory tree. A2M activity was detected in the coelomic fluids of H. atra. The mRNA expression and activity levels were investigated in the major immune tissues and coelomic fluids of H. atra after challenge with inactivated Vibrio alginolyticus or polyriboinosinic polyribocytidylic acid [Poly (I: C)]. RNA interference (RNAi)-mediated knockdown of HaA2M resulted in a significant reduction of HaA2M gene transcript level (86%). RNAi-mediated silencing of HaA2M gene significantly decreased the A2M activity (38%) and increased the number of viable bacteria (2.8-fold) in the coelomic fluids of H. atra infected by V. alginolyticus. Our study, as a whole, supplied the evidences for HaA2M as an immune-relevant molecule and it might have multiple functions in the innate immune system of H. atra. PMID:27033585

  2. Discovery, structural characterization and functional analysis of alpha-2-macroglobulin, a novel immune-related molecule from Holothuria atra.

    PubMed

    Qian, Jing; Ren, Chunhua; Xia, Jianjun; Chen, Ting; Yu, Zonghe; Hu, Chaoqun

    2016-07-10

    The non-specific protease inhibitor alpha-2-macroglobulin (A2M) is a key macromolecular glycoprotein that involved in host immune defense against pathogens in vertebrates and invertebrates. However, no research regarding A2M has been developed in echinoderms to date. In this study, the full-length cDNA of A2M was cloned from the sea cucumber (Holothuria atra), which is a tropical species widely distributed along the coasts of the South China Sea and designated HaA2M. HaA2M possesses all three conserved functional domains of known A2M proteins, including the bait region domain, thioester domain and receptor-binding domain. Compared to fish and shrimp A2Ms, the histidine residue from the catalytical regions is well conserved in HaA2M. HaA2M mRNA was predominantly expressed in coelomocytes and, to a lesser extent, in the body wall, intestine and respiratory tree. A2M activity was detected in the coelomic fluids of H. atra. The mRNA expression and activity levels were investigated in the major immune tissues and coelomic fluids of H. atra after challenge with inactivated Vibrio alginolyticus or polyriboinosinic polyribocytidylic acid [Poly (I: C)]. RNA interference (RNAi)-mediated knockdown of HaA2M resulted in a significant reduction of HaA2M gene transcript level (86%). RNAi-mediated silencing of HaA2M gene significantly decreased the A2M activity (38%) and increased the number of viable bacteria (2.8-fold) in the coelomic fluids of H. atra infected by V. alginolyticus. Our study, as a whole, supplied the evidences for HaA2M as an immune-relevant molecule and it might have multiple functions in the innate immune system of H. atra.

  3. Identification of novel pro-alpha2(IX) collagen gene mutations in two families with distinctive oligo-epiphyseal forms of multiple epiphyseal dysplasia.

    PubMed Central

    Holden, P; Canty, E G; Mortier, G R; Zabel, B; Spranger, J; Carr, A; Grant, M E; Loughlin, J A; Briggs, M D

    1999-01-01

    Multiple epiphyseal dysplasia (MED) is a genetically heterogeneous disorder with marked clinical and radiographic variability. Traditionally, the mild "Ribbing" and severe "Fairbank" types have been used to define a broad phenotypic spectrum. Mutations in the gene encoding cartilage oligomeric-matrix protein have been shown to result in several types of MED, whereas mutations in the gene encoding the alpha2 chain of type IX collagen (COL9A2) have so far been found only in two families with the Fairbank type of MED. Type IX collagen is a heterotrimer of pro-alpha chains derived from three distinct genes-COL9A1, COL9A2, and COL9A3. In this article, we describe two families with distinctive oligo-epiphyseal forms of MED, which are heterozygous for different mutations in the COL9A2 exon 3/intron 3 splice-donor site. Both of these mutations result in the skipping of exon 3 from COL9A2 mRNA, but the position of the mutation in the splice-donor site determines the stability of the mRNA produced from the mutant COL9A2 allele. PMID:10364514

  4. Role of mitochondrial transamination in branched chain amino acid metabolism

    SciTech Connect

    Hutson, S.M.; Fenstermacher, D.; Mahar, C.

    1988-03-15

    Oxidative decarboxylation and transamination of 1-/sup 14/C-branched chain amino and alpha-keto acids were examined in mitochondria isolated from rat heart. Transamination was inhibited by aminooxyacetate, but not by L-cycloserine. At equimolar concentrations of alpha-ketoiso(1-/sup 14/C)valerate (KIV) and isoleucine, transamination was increased by disrupting the mitochondria with detergent which suggests transport may be one factor affecting the rate of transamination. Next, the subcellular distribution of the aminotransferase(s) was determined. Branched chain aminotransferase activity was measured using two concentrations of isoleucine as amino donor and (1-/sup 14/C)KIV as amino acceptor. The data show that branched chain aminotransferase activity is located exclusively in the mitochondria in rat heart. Metabolism of extramitochondrial branched chain alpha-keto acids was examined using 20 microM (1-/sup 14/C)KIV and alpha-ketoiso(1-/sup 14/C)caproate (KIC). There was rapid uptake and oxidation of labeled branched chain alpha-keto acid, and, regardless of the experimental condition, greater than 90% of the labeled keto acid substrate was metabolized during the 20-min incubation. When a branched chain amino acid (200 microM) or glutamate (5 mM) was present, 30-40% of the labeled keto acid was transaminated while the remainder was oxidized. Provision of an alternate amino acceptor in the form of alpha-keto-glutarate (0.5 mM) decreased transamination of the labeled KIV or KIC and increased oxidation. Metabolism of intramitochondrially generated branched chain alpha-keto acids was studied using (1-/sup 14/C)leucine and (1-/sup 14/C)valine. Essentially all of the labeled branched chain alpha-keto acid produced by transamination of (1-/sup 14/C)leucine or (1-/sup 14/C)valine with a low concentration of unlabeled branched chain alpha-keto acid (20 microM) was oxidized.

  5. The clinical features of Ehlers-Danlos syndrome type VII due to a deletion of 24 amino acids from the pro alpha 1(I) chain of type I procollagen.

    PubMed Central

    Cole, W G; Evans, R; Sillence, D O

    1987-01-01

    The clinical features and progress of a child with the type VII form of Ehlers-Danlos syndrome due to a deletion in the pro alpha 1(I) of type I procollagen were studied. The child was born with bilateral dislocations of hips and knees and all other joints were markedly hypermobile. Persistent severe joint instability was the major clinical abnormality. She had a depressed nasal bridge with prominent paranasal folds and deeply set eyes with mild hypertelorism and micrognathia. The skin was soft, moderately hyperelastic, and sagged over the face and knees. Skin fragility and easy bruising appeared when she started walking. Electron microscopy of the dermis showed irregular collagen fibrils. Images PMID:3430546

  6. Amino acid substitutions of conserved residues in the carboxyl-terminal domain of the [alpha]I(X) chain of type X collagen occur in two unrelated families with metaphyseal chondrodysplasia type Schmid

    SciTech Connect

    Wallis, G.A.; Rash, B.; Sweetman, W.A.; Thomas, J.T.; Grant, M.E.; Boot-Handford, R.P. ); Super, M. ); Evans, G. )

    1994-02-01

    Type X collagen is a homotrimeric, short-chain, nonfibrillar extracellular-matrix component that is specifically and transiently synthesized by hypertrophic chondrocytes at the site of endochondral ossification. The precise function of type X collagen is not known, but its specific pattern of expression suggests that mutations within the encoding gene (COL10A1) that alter the structure or synthesis of the protein may cause heritable forms of chondrodysplasia. The authors used the PCR and the SSCP techniques to analyze the coding and upstream promoter regions of the COL10A1 gene in a number of individuals with forms of chondrodysplasia. Using this approach, they identified two individuals with metaphyseal chondrodysplasia type Schmid (MCDS) with SSCP changes in the region of the gene encoding the carboxyl-terminal domain. Sequence analysis demonstrated that the individuals were heterozygous for two unique single-base-pair transitions that led to the substitution of the highly conserved amino acid residue tyrosine at position 598 by aspartic acid in one person and of leucine at position 614 by proline in the other. The substitution at residue 598 segregated with the phenotype in a family of eight (five affected and three unaffected) related persons. The substitutions at residue 614 occurred in a sporadically affected individual but not in her unaffected mother and brother. Additional members of this family were not available for further study. These results suggest that certain amino acid substitutions within the carboxyl-terminal domain of the chains of the type X collagen molecule cause MCDS. These amino acid substitutions are likely to alter either chain recognition or assembly of the type X collagen molecule, thereby depleting the amount of normal type X collagen deposited in the extracellular matrix, with consequent aberrations in bone growth and development. 36 refs., 5 figs.

  7. Two Cases of Heavy Chain MGUS

    PubMed Central

    Meijers, Björn; Delforge, Michel; Verhoef, Gregor; Poesen, Koen

    2016-01-01

    Heavy chain diseases are rare variants of B-cell lymphomas that produce one of three classes of immunoglobulin heavy chains, without corresponding light chains. We describe two patients with asymptomatic heavy chain monoclonal gammopathy. The first patient is a 51-year-old woman with alpha paraprotein on serum immunofixation. The second case is a 46-year-old woman with gamma paraprotein on urine immunofixation. Neither patient had corresponding monoclonal light chains. Workup for multiple myeloma and lymphoma was negative in both patients. These two cases illustrate that heavy chain monoclonal gammopathy can exist in the absence of clinically apparent malignancy. Only a few reports of “heavy chain MGUS” have been described before. In the absence of specialized guidelines, we suggest a similar follow-up as for MGUS, while taking into account the higher probability of progression to lymphoma than to myeloma. PMID:27213064

  8. Two Cases of Heavy Chain MGUS.

    PubMed

    Van Keer, Jan; Meijers, Björn; Delforge, Michel; Verhoef, Gregor; Poesen, Koen

    2016-01-01

    Heavy chain diseases are rare variants of B-cell lymphomas that produce one of three classes of immunoglobulin heavy chains, without corresponding light chains. We describe two patients with asymptomatic heavy chain monoclonal gammopathy. The first patient is a 51-year-old woman with alpha paraprotein on serum immunofixation. The second case is a 46-year-old woman with gamma paraprotein on urine immunofixation. Neither patient had corresponding monoclonal light chains. Workup for multiple myeloma and lymphoma was negative in both patients. These two cases illustrate that heavy chain monoclonal gammopathy can exist in the absence of clinically apparent malignancy. Only a few reports of "heavy chain MGUS" have been described before. In the absence of specialized guidelines, we suggest a similar follow-up as for MGUS, while taking into account the higher probability of progression to lymphoma than to myeloma. PMID:27213064

  9. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  10. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  11. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  12. HIV-1 p17 matrix protein interacts with heparan sulfate side chain of CD44v3, syndecan-2, and syndecan-4 proteoglycans expressed on human activated CD4+ T cells affecting tumor necrosis factor alpha and interleukin 2 production.

    PubMed

    De Francesco, Maria A; Baronio, Manuela; Poiesi, Claudio

    2011-06-01

    HIV-1 p17 contains C- and N-terminal sequences with positively charged residues and a consensus cluster for heparin binding. We have previously demonstrated by affinity chromatography that HIV-1 p17 binds strongly to heparin-agarose at physiological pH and to human activated CD4(+) T cells. In this study we demonstrated that the viral protein binds to heparan sulfate side chains of syndecan-2, syndecan-4, and CD44v3 purified from HeLa cells and that these heparan sulfate proteoglycans (HSPGs) co-localize with HIV-1 p17 on activated human CD4(+) T cells by confocal fluorescence analysis. Moreover, we observed a stimulatory or inhibitory activity when CD4(+) T cells were activated with mitogens together with nanomolar or micromolar concentrations of the matrix protein.

  13. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  14. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  15. Helix Bundle Quaternary Structure from [alpha]/[beta]-Peptide Foldamers

    SciTech Connect

    Horne, W. Seth; Price, Joshua L.; Keck, James L.; Gellman, Samuel H.

    2008-11-18

    The function of a protein generally depends on adoption of a specific folding pattern, which in turn is determined by the side chain sequence along the polypeptide backbone. Here we show that the sequence-encoded structural information in peptides derived from yeast transcriptional activator GCN4 can be used to prepare hybrid {alpha}/{beta}-peptide foldamers that adopt helix bundle quaternary structures. Crystal structures of two hybrid {alpha}/{beta}-peptides are reported along with detailed structural comparison to {alpha}-peptides of analogous side chain sequence. There is considerable homology between {alpha}- and {alpha}/{beta}-peptides at the level of helical secondary structure, with modest but significant differences in the association geometry of helices in the quaternary structure.

  16. Identification of a major continuous epitope of human alpha crystallin

    NASA Technical Reports Server (NTRS)

    Takemoto, L.; Emmons, T.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Human lens proteins were digested with trypsin or V8 protease, and the resulting peptides resolved on a C18 reverse phase column. Fractions from this column were probed with polyclonal antiserum made against the whole alpha crystallin molecule. Peptides in the seropositive fraction were purified to homogeneity, then characterized by mass spectral analysis and partial Edman degradation. The tryptic and V8 digests contained only one seropositive peptide that was derived from the C-terminal region of the alpha-A molecule. To determine the exact boundaries of the epitope, various size analogues of this region were synthesized and probed with anti-alpha serum. Together, these studies demonstrate that the major continuous epitope of the alpha-A chain includes the sequence KPTSAPS, corresponding to residues 166-172 of the human alpha-A crystallin chain.

  17. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  18. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  19. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  20. The human alpha 2(IV) collagen gene, COL4A2, is syntenic with the alpha 1(IV) gene, COL4A1, on chromosome 13.

    PubMed

    Solomon, E; Hall, V; Kurkinen, M

    1987-05-01

    We have previously assigned the gene for the alpha 1 chain of type IV collagen to chromosome 13. In this report we show that the gene coding for the second chain of this heterotrimer is on the same chromosome. This is the first example of the genes for both chains of one collagen molecule being syntenic. PMID:3674752

  1. Chain Gang

    NASA Technical Reports Server (NTRS)

    2006-01-01

    6 August 2006 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows a chain of clustered and battered craters. These were formed by secondary impact. That is, somewhere to the south (beyond the bottom of this image), a large impact crater formed. When this occurred, material ejected from the crater was thrown tens to hundreds of kilometers away. This material then impacted the martian surface, forming clusters and chains of smaller craters.

    Location near: 15.8oN, 35.6oW Image width: 3 km (1.9 mi) Illumination from: upper left Season: Northern Spring

  2. Increased cardiac alpha-myosin heavy chain in left atria and decreased myocardial insulin-like growth factor (Igf-I) expression accompany low heart rate in hibernating grizzly bears.

    PubMed

    Barrows, N D; Nelson, O L; Robbins, C T; Rourke, B C

    2011-01-01

    Grizzly bears (Ursus arctos horribilis) tolerate extended periods of extremely low heart rate during hibernation without developing congestive heart failure or cardiac chamber dilation. Left ventricular atrophy and decreased left ventricular compliance have been reported in this species during hibernation. We evaluated the myocardial response to significantly reduced heart rate during hibernation by measuring relative myosin heavy-chain (MyHC) isoform expression and expression of a set of genes important to muscle plasticity and mass regulation in the left atria and left ventricles of active and hibernating bears. We supplemented these data with measurements of systolic and diastolic function via echocardiography in unanesthetized grizzly bears. Atrial strain imaging revealed decreased atrial contractility, decreased expansion/reservoir function (increased atrial stiffness), and decreased passive-filling function (increased ventricular stiffness) in hibernating bears. Relative MyHC-α protein expression increased significantly in the atrium during hibernation. The left ventricle expressed 100% MyHC-β protein in both groups. Insulin-like growth factor (IGF-I) mRNA expression was reduced by ∼50% in both chambers during hibernation, consistent with the ventricular atrophy observed in these bears. Interestingly, mRNA expression of the atrophy-related ubiquitin ligases Muscle Atrophy F-box (MAFBx) and Muscle Ring Finger 1 did not increase, nor did expression of myostatin or hypoxia-inducible factor 1α (HIF-1α). We report atrium-specific decreases of 40% and 50%, respectively, in MAFBx and creatine kinase mRNA expression during hibernation. Decreased creatine kinase expression is consistent with lowered energy requirements and could relate to reduced atrial emptying function during hibernation. Taken together with our hemodynamic assessment, these data suggest a potential downregulation of atrial chamber function during hibernation to prevent fatigue and dilation

  3. Increased cardiac alpha-myosin heavy chain in left atria and decreased myocardial insulin-like growth factor (Igf-I) expression accompany low heart rate in hibernating grizzly bears.

    PubMed

    Barrows, N D; Nelson, O L; Robbins, C T; Rourke, B C

    2011-01-01

    Grizzly bears (Ursus arctos horribilis) tolerate extended periods of extremely low heart rate during hibernation without developing congestive heart failure or cardiac chamber dilation. Left ventricular atrophy and decreased left ventricular compliance have been reported in this species during hibernation. We evaluated the myocardial response to significantly reduced heart rate during hibernation by measuring relative myosin heavy-chain (MyHC) isoform expression and expression of a set of genes important to muscle plasticity and mass regulation in the left atria and left ventricles of active and hibernating bears. We supplemented these data with measurements of systolic and diastolic function via echocardiography in unanesthetized grizzly bears. Atrial strain imaging revealed decreased atrial contractility, decreased expansion/reservoir function (increased atrial stiffness), and decreased passive-filling function (increased ventricular stiffness) in hibernating bears. Relative MyHC-α protein expression increased significantly in the atrium during hibernation. The left ventricle expressed 100% MyHC-β protein in both groups. Insulin-like growth factor (IGF-I) mRNA expression was reduced by ∼50% in both chambers during hibernation, consistent with the ventricular atrophy observed in these bears. Interestingly, mRNA expression of the atrophy-related ubiquitin ligases Muscle Atrophy F-box (MAFBx) and Muscle Ring Finger 1 did not increase, nor did expression of myostatin or hypoxia-inducible factor 1α (HIF-1α). We report atrium-specific decreases of 40% and 50%, respectively, in MAFBx and creatine kinase mRNA expression during hibernation. Decreased creatine kinase expression is consistent with lowered energy requirements and could relate to reduced atrial emptying function during hibernation. Taken together with our hemodynamic assessment, these data suggest a potential downregulation of atrial chamber function during hibernation to prevent fatigue and dilation

  4. Introduction of the human pro. cap alpha. 1(I) collagen gene into pro. cap alpha. 1(I)-deficient Mov-13 mouse cells leads to formation of functional mouse-human hybrid type I collagen

    SciTech Connect

    Schnieke, A.; Dziadek, M.; Bateman, J.; Mascara, T.; Harbers, K.; Gelinas, R.; Jaenisch, R.

    1987-02-01

    The Mov-13 mouse strain carries a retroviral insertion in the pro..cap alpha..1(I) collagen gene that prevents transcription of the gene. Cell lines derived from homozygous embryos do not express type I collagen although normal amounts of pro..cap alpha..2 mRNA are synthesized. The authors have introduced genomic clones of either the human or mouse pro..cap alpha..1(I) collagen gene into homozygous cell lines to assess whether the human or mouse pro..cap alpha..1(I) chains can associate with the endogenous mouse pro..cap alpha..2(I) chain to form stable type I collagen. The human gene under control of the simian virus 40 promoter was efficiently transcribed in the transfected cells. Protein analyses revealed that stable heterotrimers consisting of two human ..cap alpha..1 chains and one mouse ..cap alpha..2 chain were formed and that type I collagen was secreted by the transfected cells at normal rates. However, the electrophoretic migration of both ..cap alpha..1(I) and ..cap alpha..2(I) chains in the human-mouse hybrid molecules were retarded, compared to the ..cap alpha..(I) chains in control mouse cells. Inhibition of the posttranslational hydroxylation of lysine and proline resulted in comigration of human and mouse ..cap alpha..1 and ..cap alpha..2 chains, suggesting that increased posttranslational modification caused the altered electrophoretic migration in the human-mouse hybrid molecules. Amino acid sequence differences between the mouse and human ..cap alpha.. chains may interfere with the normal rate of helix formation and increase the degree of posttranslational modifications similar to those observed in patients with lethal perinatal osteogenesis imperfecta. The Mov-13 mouse system should allow the authors to study the effect specific mutations introduced in transfected pro..cap alpha..1(I) genes have on the synthesis, assembly, and function of collagen I.

  5. Introduction of the human pro alpha 1(I) collagen gene into pro alpha 1(I)-deficient Mov-13 mouse cells leads to formation of functional mouse-human hybrid type I collagen.

    PubMed Central

    Schnieke, A; Dziadek, M; Bateman, J; Mascara, T; Harbers, K; Gelinas, R; Jaenisch, R

    1987-01-01

    The Mov-13 mouse strain carries a retroviral insertion in the pro alpha 1(I) collagen gene that prevents transcription of the gene. Cell lines derived from homozygous embryos do not express type I collagen although normal amounts of pro alpha 2 mRNA are synthesized. We have introduced genomic clones of either the human or mouse pro alpha 1(I) collagen gene into homozygous cell lines to assess whether the human or mouse pro alpha 1(I) chains can associate with the endogenous mouse pro alpha 2(I) chain to form stable type I collagen. The human gene under control of the simian virus 40 promoter was efficiently transcribed in the transfected cells. Protein analyses revealed that stable heterotrimers consisting of two human alpha 1 chains and one mouse alpha 2 chain were formed and that type I collagen was secreted by the transfected cells at normal rates. However, the electrophoretic migration of both alpha 1(I) and alpha 2(I) chains in the human-mouse hybrid molecules were retarded, compared to the alpha (I) chains in control mouse cells. Inhibition of the posttranslational hydroxylation of lysine and proline resulted in comigration of human and mouse alpha 1 and alpha 2 chains, suggesting that increased posttranslational modification caused the altered electrophoretic migration in the human-mouse hybrid molecules. Amino acid sequence differences between the mouse and human alpha chains may interfere with the normal rate of helix formation and increase the degree of posttranslational modifications similar to those observed in patients with lethal perinatal osteogenesis imperfecta. The Mov-13 mouse system should allow us to study the effect specific mutations introduced in transfected pro alpha 1(I) genes have on the synthesis, assembly, and function of collagen I. Images PMID:3468512

  6. Phytol directly activates peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) and regulates gene expression involved in lipid metabolism in PPAR{alpha}-expressing HepG2 hepatocytes

    SciTech Connect

    Goto, Tsuyoshi; Takahashi, Nobuyuki; Kato, Sota; Egawa, Kahori; Ebisu, Shogo; Moriyama, Tatsuya; Fushiki, Tohru; Kawada, Teruo . E-mail: fat@kais.kyoto-u.ac.jp

    2005-11-18

    The peroxisome proliferator-activated receptor (PPAR) is one of the indispensable transcription factors for regulating lipid metabolism in various tissues. In our screening for natural compounds that activate PPAR using luciferase assays, a branched-carbon-chain alcohol (a component of chlorophylls), phytol, has been identified as a PPAR{alpha}-specific activator. Phytol induced the increase in PPAR{alpha}-dependent luciferase activity and the degree of in vitro binding of a coactivator, SRC-1, to GST-PPAR{alpha}. Moreover, the addition of phytol upregulated the expression of PPAR{alpha}-target genes at both mRNA and protein levels in PPAR{alpha}-expressing HepG2 hepatocytes. These findings indicate that phytol is functional as a PPAR{alpha} ligand and that it stimulates the expression of PPAR{alpha}-target genes in intact cells. Because PPAR{alpha} activation enhances circulating lipid clearance, phytol may be important in managing abnormalities in lipid metabolism.

  7. Effect of chronic excess of tumour necrosis factor-alpha on contractile proteins in rat skeletal muscle.

    PubMed

    Cheema, I R; Hermann, C; Postell, S; Barnes, P

    2000-01-01

    The effect of chronic tumour necrosis factor-alpha (TNF-alpha) treatment on the synthesis of specific myofibrillar proteins such as heavy chain myosin, light chain myosin and G-actin in rat diaphragm were evaluated. Muscles (diaphragm) from control and experimental groups (TNF-alpha i.v. at 50 microg/kg body wt for 5 days) were incubated in the presence of 35S-methionine for 2 h. Myofibrillar protein extracts were prepared and protein was electrophoresed on sodium dodecyl sulphate-polyacrylamide gels. Heavy chain myosin, light chain myosin and G-actin were identified by Western blot analysis using specific monoclonal antibodies. Polyacrylamide gel electrophoresis (PAGE) followed by Western blot analysis revealed two types of heavy chain myosin (206 and 212 kD), all four types of light chain myosin (15, 16.5, 18 and 20 kD) and a single type of G-actin (42 kD). Chronic TNF-alpha treatment produced a significant decline in the synthesis of all types of myofibrillar proteins, namely heavy chain myosin, light chain myosin and G-actin. TNF-alpha impaired peptide-chain initiation in diaphragm muscle which was reversed by the branched-chain amino acids (BCAA) therapy of TNF-alpha treated rats. These findings indicate a significant role for TNF-alpha in the translational regulation of protein synthesis in skeletal muscle.

  8. Biosynthesis and secretion of alpha 1 acute-phase globulin in primary cultures of rat hepatocytes.

    PubMed

    Bauer, J; Kurdowska, A; Tran-Thi, T A; Budek, W; Koj, A; Decker, K; Heinrich, P C

    1985-01-15

    Experimental inflammation in rats led to a sevenfold increase in serum levels of alpha 1 acute-phase globulin. This increase is correlated with elevated levels of translatable mRNA for alpha 1 acute-phase globulin in the liver. Biosynthesis and secretion of alpha 1 acute-phase globulin were studied in rat hepatocyte primary cultures. An intracellular form of alpha 1 acute-phase globulin with an apparent relative molecular mass of 63 500 and a secreted form of 68 000 were found. The intracellular form of alpha 1 acute-phase globulin could be deglycosylated by endoglucosaminidase H treatment indicating that its oligosaccharide chains were of the high-mannose type. The secreted form of alpha 1 acute-phase globulin was not sensitive to endoglucosaminidase H, but was susceptible to the action of sialidase reflecting carbohydrate side-chains of the complex type. Pulse-chase experiments revealed a precursor-product relationship for the high-mannose and the complex type alpha 1 acute-phase globulin. In the hepatocyte medium newly synthesized alpha 1 acute-phase globulin was detected 30 min after the pulse. Unglycosylated alpha 1 acute-phase globulin was found in the cells as well as in the medium when the transfer of oligosaccharide chains onto the polypeptide chains was blocked by tunicamycin. Tunicamycin led to a marked delay in alpha 1 acute-phase globulin secretion. PMID:2578391

  9. alpha-decay half-lives and Q{sub a}lpha values of superheavy nuclei

    SciTech Connect

    Dong Jianmin; Zuo Wei; Gu Jianzhong; Wang Yanzhao; Peng Bangbao

    2010-06-15

    The alpha-decay half-lives of recently synthesized superheavy nuclei (SHN) are investigated by employing a unified fission model (UFM) where a new method to calculate the assault frequency of alpha emission is used. The excellent agreement with the experimental data indicates the UFM is a useful tool to investigate these alpha decays. It is found that the alpha-decay half-lives become more and more insensitive to the Q{sub a}lpha values as the atomic number increases on the whole, which is favorable for us to predict the half-lives of SHN. In addition, a formula is proposed to compute the Q{sub a}lpha values for the nuclei with Z>=92 and N>=140 with a good accuracy, according to which the long-lived SHN should be neutron rich. Several weeks ago, two isotopes of a new element with atomic number Z=117 were synthesized and their alpha-decay chains have been observed. The Q{sub a}lpha formula is found to work well for these nuclei, confirming its predictive power. The experimental half-lives are well reproduced by employing the UFM with the experimental Q{sub a}lpha values. This fact that the experimental half-lives are compatible with experimental Q{sub a}lpha values supports the synthesis of a new element 117 and the experimental measurements to a certain extent.

  10. A cis-proline in alpha-hemoglobin stabilizing protein directs the structural reorganization of alpha-hemoglobin.

    PubMed

    Gell, David A; Feng, Liang; Zhou, Suiping; Jeffrey, Philip D; Bendak, Katerina; Gow, Andrew; Weiss, Mitchell J; Shi, Yigong; Mackay, Joel P

    2009-10-23

    alpha-Hemoglobin (alphaHb) stabilizing protein (AHSP) is expressed in erythropoietic tissues as an accessory factor in hemoglobin synthesis. AHSP forms a specific complex with alphaHb and suppresses the heme-catalyzed evolution of reactive oxygen species by converting alphaHb to a conformation in which the heme is coordinated at both axial positions by histidine side chains (bis-histidyl coordination). Currently, the detailed mechanism by which AHSP induces structural changes in alphaHb has not been determined. Here, we present x-ray crystallography, NMR spectroscopy, and mutagenesis data that identify, for the first time, the importance of an evolutionarily conserved proline, Pro(30), in loop 1 of AHSP. Mutation of Pro(30) to a variety of residue types results in reduced ability to convert alphaHb. In complex with alphaHb, AHSP Pro(30) adopts a cis-peptidyl conformation and makes contact with the N terminus of helix G in alphaHb. Mutations that stabilize the cis-peptidyl conformation of free AHSP, also enhance the alphaHb conversion activity. These findings suggest that AHSP loop 1 can transmit structural changes to the heme pocket of alphaHb, and, more generally, highlight the importance of cis-peptidyl prolyl residues in defining the conformation of regulatory protein loops.

  11. Distinct and overlapping ligand specificities of the alpha 3A beta 1 and alpha 6A beta 1 integrins: recognition of laminin isoforms.

    PubMed Central

    Delwel, G O; de Melker, A A; Hogervorst, F; Jaspars, L H; Fles, D L; Kuikman, I; Lindblom, A; Paulsson, M; Timpl, R; Sonnenberg, A

    1994-01-01

    The ligand specificity of the alpha 3A beta 1 integrin was analyzed using K562 cells transfected with full-length alpha 3A cDNA and was compared with that of alpha 6A beta 1 in similarly transfected K562 cells. Clones were obtained that showed comparable surface expression of either alpha 3A beta 1 or alpha 6A beta 1 integrins. Those expressing alpha 3A beta 1 attached to and spread on immunopurified human kalinin and cellular matrices containing human kalinin, which is a particular isoform of laminin. In addition, alpha 3A transfectants adhered to bovine kidney laminins possessing a novel A chain variant. Binding to kalinin was blocked by a monoclonal antibody against the A chain constituent of kalinin and adhesion to both kalinin and kidney laminins by anti-alpha 3 and beta 1 monoclonal antibodies. The alpha 3A transfected cells bound more strongly to kalinin and bovine kidney laminins after treatment with the beta 1 stimulatory antibody TS2/16. A distinctly weaker and activation-dependent adhesion of alpha 3A transfectants was observed on human placental laminins possessing the Am chain variant (merosin), and no adhesion occurred on bovine heart laminins and murine EHS tumor laminin. Further inactive substrates were fibronectin, nidogen, and collagen types IV and VI, indicating that the alpha 3A beta 1 integrin is a much less promiscuous receptor than thought before. By contrast, alpha 6A transfected cells adhered to all laminin isoforms when stimulated with TS2/16. Adhesion also occurred only on bovine kidney laminins in the absence of TS2/16. These results demonstrate that both alpha 3A beta 1 and alpha 6A beta 1 integrins are typical laminin receptors but that their affinity and activation dependence for binding to various laminin isoforms differ considerably. Images PMID:8019006

  12. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  13. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  14. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  15. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  16. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  17. alpha-thalassemia mutations in Khuzestan Province, Southwest Iran.

    PubMed

    Zandian, Khodamorad; Nateghi, Jamal; Keikhaie, Bijan; Pedram, Mohammad; Hafezi-Nejad, Nima; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Law, Hai-Yang; Najmabadi, Hossein

    2008-01-01

    Although alpha-thalassemia (alpha-thal) is the most common hereditary hemoglobin (Hb) disorder in Iran, no comprehensive data are so far available on the prevalence of the disease in the province of Khuzestan in Southwest Iran. This study investigates the spectrum of alpha-thal mutations in this region. One hundred and twenty-one subjects from Khuzestan Province, Iran, were initially tested for the three most common Iranian alpha-thal mutations (- alpha3.7, -alpha4.2, and --MED) by gap-polymerase chain reaction (gap-PCR). Reverse hybridization test strips and DNA sequencing were used to identify additional alpha-globin mutations. A total of 131 mutated alpha-globin alleles were identified in these patients. Of the 13 mutations that were detected in Khuzestan Province, Iran, the - alpha3.7 single gene deletion was the most frequently identified variant, representing 62.6% of the total; we also observed significant numbers of individuals with compound heterozygous mutations. On the basis of our results, we strongly recommend screening for the most common mutations to improve the molecular diagnosis of anemia in this region.

  18. Alloprenols: novel alpha-trans-polyprenols of Allophylus caudatus.

    PubMed

    Ciepichal, Ewa; Wojcik, Jacek; Bienkowski, Tomasz; Kania, Magdalena; Swist, Malgorzata; Danikiewicz, Witold; Marczewski, Andrzej; Hertel, Jozefina; Matysiak, Zdzislaw; Swiezewska, Ewa; Chojnacki, Tadeusz

    2007-06-01

    A novel type of polyprenols, alloprenols, with an alpha-trans-isoprenoid unit was found in the leaves of Allophylus caudatus (Sapindaceae) besides typical alpha-cis-polyprenols. The polyprenol family (Prenol-11-13, Prenol-12 dominating) was accompanied by traces of dolichols of the same chain-length. Prenol alpha-cis- and alpha-trans-isomers were chromatographically separated and their structure was analyzed by HPLC/ESI-MS, HR-ESI-MS and 1H and 13C NMR spectroscopy. Model compounds, semi-synthetic alpha-isomers of all-trans-Pren-9 and mainly-cis-Pren-11, were obtained using an oxidation-reduction procedure. Comparison of their NMR spectra confirmed the structure of the newly identified polyprenols. The observed pattern of NMR signal shifts may be applied for elucidation of isoprenoid structure.

  19. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  20. The analysis of predictability of recent alpha decay formulae and the alpha partial half-lives of some exotic nuclei

    SciTech Connect

    Dasgupta-Schubert, N.; Reyes, M. A.; Tamez, V. A.

    2009-04-20

    Alpha decay is one of the two main decay modes of the heaviest nuclei, (SHE), and constitutes one of the dominant decay modes of highly neutron deficient medium mass nuclei ('exotics'). Thus identifying and characterizing the alpha decay chains form a crucial part of the identification of SHE. We report the extension of the previously developed method for the detailed and systematic investigation of the reliability of the three main extant analytical formulae of alpha decay half-lives: the generalized liquid drop model based formula of Royer et al. (FR), the Sobiczewski modified semi-empirical Viola-Seaborg formula (VSS) and the recent phenomenological formula of Sobiczewski and Parkhomenko (SP)

  1. Analysis of the specificity of sialyltransferases toward mucin core 2, globo, and related structures. identification of the sialylation sequence and the effects of sulfate, fucose, methyl, and fluoro substituents of the carbohydrate chain in the biosynthesis of selectin and siglec ligands, and novel sialylation by cloned alpha2,3(O)sialyltransferase.

    PubMed

    Chandrasekaran, E V; Xue, Jun; Xia, Jie; Chawda, Ram; Piskorz, Conrad; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L

    2005-11-29

    Sialic acids are key determinants in many carbohydrates involved in biological recognition. We studied the acceptor specificities of three cloned sialyltransferases (STs) [alpha2,3(N)ST, alpha2,3(O)ST, and alpha2,6(N)ST] and another alpha2,3(O)ST present in prostate cancer cell LNCaP toward mucin core 2 tetrasaccharide [Galbeta1,4GlcNAcbeta1,6(Galbeta1,3)GalNAcalpha-O-Bn] and Globo [Galbeta1,3GalNAcbeta1,3Galalpha-O-Me] structures containing sialyl, fucosyl, sulfo, methyl, or fluoro substituents by identifying the products by electrospray ionization tandem mass spectral analysis and other biochemical methods. The Globo precursor was an efficient acceptor for both alpha2,3(N)ST and alpha2,3(O)ST, whereas only alpha2,3(O)ST used its deoxy analogue (d-Fucbeta1,3GalNAcbeta1,3-Gal-alpha-O-Me); 2-O-MeGalbeta1,3GlcNAc and 4-OMeGalbeta1,4GlcNAc were specific acceptors for alpha2,3(N)ST. Other major findings of this study include: (i) alpha2,3 sialylation of beta1,3Gal in mucin core 2 can proceed even after alpha1,3 fucosylation of beta1,6-linked LacNAc. (ii) Sialylation of beta1,3Gal must precede the sialylation of beta1,4Gal for favorable biosynthesis of mucin core 2 compounds. (iii) alpha2,3 sialylation of the 6-O-sulfoLacNAc moiety in mucin core 2 (e.g., GlyCAM-1) is facilitated when beta1,3Gal has already been alpha2,3 sialylated. (iv) alpha2,6(N)ST was absolutely specific for the beta1,4Gal in mucin core 2. Either alpha1,3 fucosylation or 6-O-sulfation of the GlcNAc moiety reduced the activity. Sialylation of beta1,3Gal in addition to 6-O-sulfation of GlcNAc moiety abolished the activity. (v) Prior alpha2,3 sialylation or 3-O-sulfation of beta1,3Gal would not affect alpha2,6 sialylation of Galbeta1,4GlcNAc of mucin core 2. (vi) A 3- or 4-fluoro substituent in beta1,4Gal resulted in poor acceptors for the cloned alpha2,6(N)ST and alpha2,3(N)ST, whereas 4-fluoro- or 4-OMe-Galbeta1,3GalNAcalpha was a good acceptor for cloned alpha2,3(O)ST. (vii) 4-O-Methylation of beta1

  2. Analysis of the specificity of sialyltransferases toward mucin core 2, globo, and related structures. identification of the sialylation sequence and the effects of sulfate, fucose, methyl, and fluoro substituents of the carbohydrate chain in the biosynthesis of selectin and siglec ligands, and novel sialylation by cloned alpha2,3(O)sialyltransferase.

    PubMed

    Chandrasekaran, E V; Xue, Jun; Xia, Jie; Chawda, Ram; Piskorz, Conrad; Locke, Robert D; Neelamegham, Sriram; Matta, Khushi L

    2005-11-29

    Sialic acids are key determinants in many carbohydrates involved in biological recognition. We studied the acceptor specificities of three cloned sialyltransferases (STs) [alpha2,3(N)ST, alpha2,3(O)ST, and alpha2,6(N)ST] and another alpha2,3(O)ST present in prostate cancer cell LNCaP toward mucin core 2 tetrasaccharide [Galbeta1,4GlcNAcbeta1,6(Galbeta1,3)GalNAcalpha-O-Bn] and Globo [Galbeta1,3GalNAcbeta1,3Galalpha-O-Me] structures containing sialyl, fucosyl, sulfo, methyl, or fluoro substituents by identifying the products by electrospray ionization tandem mass spectral analysis and other biochemical methods. The Globo precursor was an efficient acceptor for both alpha2,3(N)ST and alpha2,3(O)ST, whereas only alpha2,3(O)ST used its deoxy analogue (d-Fucbeta1,3GalNAcbeta1,3-Gal-alpha-O-Me); 2-O-MeGalbeta1,3GlcNAc and 4-OMeGalbeta1,4GlcNAc were specific acceptors for alpha2,3(N)ST. Other major findings of this study include: (i) alpha2,3 sialylation of beta1,3Gal in mucin core 2 can proceed even after alpha1,3 fucosylation of beta1,6-linked LacNAc. (ii) Sialylation of beta1,3Gal must precede the sialylation of beta1,4Gal for favorable biosynthesis of mucin core 2 compounds. (iii) alpha2,3 sialylation of the 6-O-sulfoLacNAc moiety in mucin core 2 (e.g., GlyCAM-1) is facilitated when beta1,3Gal has already been alpha2,3 sialylated. (iv) alpha2,6(N)ST was absolutely specific for the beta1,4Gal in mucin core 2. Either alpha1,3 fucosylation or 6-O-sulfation of the GlcNAc moiety reduced the activity. Sialylation of beta1,3Gal in addition to 6-O-sulfation of GlcNAc moiety abolished the activity. (v) Prior alpha2,3 sialylation or 3-O-sulfation of beta1,3Gal would not affect alpha2,6 sialylation of Galbeta1,4GlcNAc of mucin core 2. (vi) A 3- or 4-fluoro substituent in beta1,4Gal resulted in poor acceptors for the cloned alpha2,6(N)ST and alpha2,3(N)ST, whereas 4-fluoro- or 4-OMe-Galbeta1,3GalNAcalpha was a good acceptor for cloned alpha2,3(O)ST. (vii) 4-O-Methylation of beta1

  3. Measurements and analysis of alpha-induced reactions of importance for nuclear astrophysics

    NASA Astrophysics Data System (ADS)

    de Messieres, Genevieve Escande

    2011-11-01

    Reactions during stellar helium burning are of primary importance for understanding nucleosynthesis. A detailed understanding of the critical reaction chain 4He(2alpha, gamma)12C( alpha, gamma)16O(alpha, gamma) 20Ne is necessary both because it is the primary energy source and because it determines the ratio of 12C to 16O produced, which in turn significantly effects subsequent nucleosynthesis. Also during Helium burning, the reactions 22Ne(alpha, n)25Mg and 22Ne(alpha, gamma )26Mg are crucial in determining the amount of neutrons available for the astrophysical s-process. This thesis presents new experimental results concerning the 16O(alpha, gamma) 20Ne, 22Ne(alpha, n)25Mg, and 22Ne(alpha, gamma)26Mg reaction rates. These results are then applied to the calculation of the associated stellar reaction rates in order to achieve better accuracy.

  4. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  5. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  6. Characterization of the major cyanogen bromide fragment of alpha-A crystallin

    NASA Technical Reports Server (NTRS)

    Ifeanyi, F.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1991-01-01

    Alpha crystallin from the bovine lens has been digested with cyanogen bromide, and the major fragment (CB-1) has been purified using reverse phase HPLC. Characterization of this fragment by Edman degradation and antisera to synthetic peptides indicates that it originates from alpha-A crystallin, but lacks the N-terminal methionine and the last 35 amino acids from the C-terminus of the molecule. The purified CB-1 fragment binds as well as native alpha crystallin to lens membrane, but is unable to self-assemble into the correct size of high molecular weight oligomeric complexes characteristic of the intact alpha-A chain. Together, these results demonstrate that the alpha-A chain is comprised of at least two functional domains, one of which is involved in binding of alpha-A crystallin to lens membrane, and another which is necessary for correct self-assembly of the molecule into high molecular weight oligomers.

  7. Long-term efficacy and downstream mechanism of anti-annexinA2 monoclonal antibody (anti-ANX A2 mAb) in a pre-clinical model of aggressive human breast cancer.

    PubMed

    Sharma, Mahesh C; Tuszynski, George P; Blackman, Marc R; Sharma, Meena

    2016-04-01

    There is considerable direct evidence that calcium binding protein ANX A2 is a potential target for treating aggressive breast cancer. The most compelling data are based on the finding of ANX A2 overexpression in aggressive triple negative human breast cancer (TNBC) cell lines and in human breast cancer tissues. Previously, we and others reported a unique role of ANX A2 in cancer invasion, including breast cancer. Moreover, we demonstrated that anti-ANX A2 mAb-mediated immunoneutralization of ANX A2 inhibited invasive human breast cancer growth in a xenograft model. We further evaluated the long-term effects of multiple treatments with anti-ANX A2 mAb and its mechanism of inhibition on human breast tumor growth. We now demonstrate that three treatments with anti-ANX A2 mAb led to significant inhibition of breast tumor growth in immunodeficient mice, and that the anti-tumor response was demonstrable from day 94. After treatment, we followed tumor growth for 172 days and demonstrated 67% inhibition of tumor growth without detectable adverse effects. Biochemical analysis demonstrated that anti-ANX A2 mAb treatment caused significant inhibition of conversion of tissue plasminogen activator (tPA) in the tumor microenvironment. This led to disruption of plasmin generation that consequently inhibited activation of MMP-9 and MMP-2. These results suggest that ANX A2 plays an important role in aggressive breast tumor growth by regulating proteolytic pathways in the tumor microenvironment. ANX A2 may represent a new target for the development of therapeutics for treatment of aggressive breast cancer.

  8. Acquired and congenital cholesteatoma: determination of tumor necrosis factor-alpha, intercellular adhesion molecule-1, interleukin-1-alpha and lymphocyte functional antigen-1 in the inflammatory process.

    PubMed

    Akimoto, R; Pawankar, R; Yagi, T; Baba, S

    2000-01-01

    The molecular and cellular factors resulting in the pathologic features of acquired and congenital cholesteatomas are not completely known. Recently, proinflammatory cytokines like interleukin-1 alpha (IL-1 alpha) and tumor necrosis factor-alpha (TNF-alpha) have been shown to induce bone resorption, in vitro. To elucidate the key molecules involved in bone resorption and cell infiltration associated with cholesteatoma, we examined the in vivo levels of IL-1 alpha and TNF-alpha, intercellular adhesion molecule-1 (ICAM-1) and lymphocyte functional antigen-1 (LFA-1) in acquired and congenital cholesteatomas, by reverse transcriptase-polymerase chain reaction, immunohistochemistry, and ELISA. Increased levels of IL-1 and TNF-alpha were detected in both types of cholesteatomas as compared to normal skin. Increased ICAM-1 expression and LFA-1+ cells were detected in acquired but not congenital cholesteatoma. Strong correlation was detected between TNF-alpha and bone resorption in both types of cholesteatoma, and between TNF-alpha and ICAM, TNF-alpha and severity of infection, or cell infiltration in acquired cholesteatoma. No correlation existed between various parameters and IL-1 alpha. These results suggest that TNF-alpha may play a crucial role in the pathogenesis of both acquired and congenital cholesteatomas by regulating bone resorption and cell infiltration.

  9. Hb Sun Prairie or alpha(2)130(H13)Ala----Pro beta 2, a new unstable variant occurring in low quantities.

    PubMed

    Harkness, M; Harkness, D R; Kutlar, F; Kutlar, A; Wilson, J B; Webber, B B; Codrington, J F; Huisman, T H

    1990-01-01

    A severe hemolytic anemia with microcytosis and hypochromia was present in a young adopted Indian patient. Reversed phase high performance liquid chromatographic methodology and heat stability tests detected an unstable alpha chain which was present in 3 to 5% of the total hemoglobin. A larger quantity of the alpha X chain was obtained by preparative reversed phase high performance liquid chromatography. Structural analyses identified an Ala----Pro replacement at position 130 of the alpha chain. The instability of the variant, named Hb Sun Prairie, is comparable to that of Hb Bibba [alpha 136 (H19)Leu----Pro]. Gene mapping failed to detect an alpha-thalassemia deletion (alpha alpha/alpha alpha), while dot-blot analysis of amplified DNA with synthetic probes localized a G----C mutation in codon 130 (resulting in the Ala----Pro mutation) of the alpha 2-globin genes of both chromosomes. These results suggest a homozygosity for the G----C mutation and the condition alpha 2(G----C)alpha 1/alpha 2(G----C)alpha 1 adequately explains the rather severe clinical status of this child, including the marked microcytosis and hypochromia. Unfortunately, family studies to exclude the presence of a large deletion involving all zeta- and alpha-globin genes were not possible.

  10. Laminin alpha 5, a major transcript of normal and malignant rat liver epithelial cells, is differentially expressed in developing and adult liver.

    PubMed

    Seebacher, T; Medina, J L; Bade, E G

    1997-11-25

    The laminin family of extracellular matrix glycoproteins plays a major role in cell migration and differentiation and in tumor cell invasion. As previously shown, the laminin deposited by normal and malignant rat liver epithelial cells in their extracellular matrix (ECM) and into their ECM migration tracks does not contain a typical (EHS-like) alpha 1 heavy chain. By RT-PCR screening we have now identified two alpha chains among a total of five additional laminin chains produced by these cells. Three of the newly identified chains were not previously known for the rat. Their sequences have been deposited in the EMBL nucleotide sequence data bank. The alpha 5 chain now identified is expressed at comparably high levels by both the normal and the malignant liver epithelial cells. The chain is also expressed in fetal liver together with the alpha 2 and beta 2 chains, but it is only vestigially expressed in the mature organ as shown by RT-PCR. These results suggest for alpha 5 a role in development and production of the chain by only a small subset of cells in adult liver. At the level of detection used, no changes were observed in regenerating liver after partial hepatectomy. In addition to the alpha 5 chain, the cultured cells express the beta 1 and beta 2 light chains, indicating the expression of more than one laminin isoform by the same cell line. The expression of the alpha 5 chain and of the other new non-EHS isoform chains was also analyzed in various tissues. The malignant liver epithelial cells, but not their nontumorigenic parental cells, also express, in addition to the alpha 5 chain the alpha 2 chain, which is expressed at high level by the NBT II bladder carcinoma cell line, suggesting a relationship with malignancy. PMID:9417868

  11. An unusually long non-coding region in rat lens alpha-crystallin messenger RNA.

    PubMed Central

    Moormann, R J; van der Velden, H M; Dodemont, H J; Andreoli, P M; Bloemendal, H; Schoenmakers, J G

    1981-01-01

    Most of the mRNA sequence coding for the alpha A2 chain of the ocular lens protein alpha-crystallin from rat, has been determined by sequencing cloned DNA copies of this mRNA. The 892-base pair cDNA sequence encompasses all but 52 N-terminal amino acids of the alpha A2 chain. It lacks the sequence characteristic for the 22 extra amino acids inserted in the alpha A2 -like chain, named alpha AIns. A stretch of 583 nuceotides, representing more than 50% of the entire mRNA sequence, is located 3' wards of the alpha A2 coding sequence. It contains the characteristic AAUAAA signal involved in poly(A) -addition and represents an unexpectedly long non-coding region. Examination of the total cytoplasmic poly(A) RNA of rat lens by filter-hybridization and subsequent translation of the electrophoretically separated mRNA fractions shows that the alpha A2 chain is encoded by mRNA species which are distinct from the alpha AIns encoding mRNA. No evidence is obtained for an extensive size heterogeneity in the 3' untranslated regions of these two different rat lens mRNAs. Images PMID:6171772

  12. Human {beta}2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

    SciTech Connect

    Wewer, U.M.; Durkin, M.E.; Albrechtsen, R.

    1994-11-15

    Overlapping cDNA clones that encode the full-length human laminin {beta}2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature {beta}2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human {beta}2 chain is predicted to have all of the seven structural domains typical of the {beta} chains of laminin, including the short cysteine-rich {alpha} region. The amino acid sequence of human {beta}2 chain showed 86.1% sequence identity to the rat {beta}2 chain, 50.0% to human {beta}1 chain, and 36.3% to the human {beta}3 chain. The greatest sequence identity was in domains VI, V, and III. The sequence of a 24-amino-acid peptide fragment isolated from the {beta}2 chain of laminin purified from human amniotic basement membrane matched the sequence predicted from the cDNA, confirming that the cDNA encodes human {beta}2 laminin. The cDNA was used to assign the gene (LAMB2) to human chromosome 3p21 by in situ hybridization. It is not linked to genes for human laminin chains {alpha}1, {beta}1, and {gamma}1 or other known laminin genes. Immunostaining showed that the {beta}2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous {beta}1 chain is confined to the subendothelial basement membranes. The {beta}2 chain was found in the basement membranes of ovarian carcinomas but not colon carcinomas. These results indicate that the expression of the {beta}2 chain gene is tightly regulated in normal human tissues and in disease. 43 refs., 6 figs., 1 tab.

  13. Structural Disorder and Thermal Properties of the Alpha' Phase of Poly(l-Lacitc Acid)

    NASA Astrophysics Data System (ADS)

    Kalish, Jeffrey; Hsu, Shaw Ling

    2011-03-01

    Poly(lactic acid) samples rich in alpha' or alpha crystals have been characterized using spectroscopic and thermal methods. Cryogenic infrared and Raman spectroscopy were used to probe the differences in chain conformation and packing. Compared to the alpha crystal, the alpha' crystal has weakened specific carbonyl and methyl interactions. Experimental spectroscopic analysis in conjunction with simulation studies have shown that the alpha' crystal has uniform chain conformational disorder. This disorder in chain conformation and packing leads to different crystalline forms with varying stabilities. The difference in thermal stability was quantified by measuring enthalpic change at melting for both crystalline forms by extrapolation of the glass transition as well as by using small molecule extrapolation. Equilibrium melting enthalpy was determined to be 57 J/g for alpha' and 96 J/g for the alpha crystal. The transformation from the less stable alpha' to the more stable alpha phase has been characterized. This analysis provides an explanation for the double melting peaks usually found in the PLLA samples.

  14. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  15. [DNA diagnosis of alpha-herpesvirinae infection].

    PubMed

    Hondo, R; Ito, S

    2000-04-01

    Herpesviruses have a characteristic of the latency after the primary infection. Advanced study on the causal relation between the reactivation of latent virus and the appearance of the symptoms would need both of the detection of viral genome by the DNA diagnosis method and the analysis of the kinetics of the virus. We developed a new quantitative method for the detection and the titration of copy number in the viral genome using the combination of polymerase chain reaction and microplate hybridization. The availability of the method was confirmed by the several cases of alpha-herpesvirinae infections.

  16. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  17. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  18. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  19. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  20. Rapid fractionation of collagen chains and peptides by high-performance liquid chromatography.

    PubMed

    Bateman, J F; Mascara, T; Chan, D; Cole, W G

    1986-04-01

    A strategy was developed, using a Pharmacia Fast Protein Liquid chromatography (FPLC) system, for the rapid preparation of the alpha-chains, cyanogen bromide peptides and tryptic peptides of type I collagen obtained from tissues and cultured fibroblasts. Collagen alpha-chains were prepared using a C18 PEP-RPC reverse-phase column and volatile solvents. Preliminary Superose 6 gel permeation chromatography was used to separate the crosslinked beta- and gamma-chains from the alpha-chains of tissue collagen samples. A Mono S cation-exchange column was used to resolve all of the major type I collagen cyanogen bromide peptides including the alpha 1(I)CB7 and CB8 peptides, which have not been well resolved by previously published methods. Collagen tryptic peptides were chromatographed on the PEP-RPC reverse-phase column.

  1. Involvement of N-linked carbohydrate chains of pig zona pellucida in sperm-egg binding.

    PubMed

    Yonezawa, N; Aoki, H; Hatanaka, Y; Nakano, M

    1995-10-01

    The sperm receptor activity of pig zona pellucida has been previously shown to exist in one of the components, pig zona protein 3 alpha (PZP3 alpha), that can be purified after the removal of sialylated and/or sulfated N-acetylpoly(lactosamine) by digestion with endo-beta-galactosidase. In this study, we examined whether N-linked or O-linked carbohydrate chains are involved in the sperm receptor activity of pig zona pellucida. The elimination of N-linked carbohydrate chains from endo-beta-galactosidase-digested PZP3 alpha by digestion with N-glycanase markedly reduced its inhibitory effect on sperm-egg binding in an in vitro competition assay, whereas the elimination of O-linked carbohydrate chains by alkali treatment hardly reduced the inhibitory effect. These results indicate that N-linked carbohydrate chains of PZP3 alpha play a major role in mediating the sperm binding of zona pellucida in pig.

  2. Molecular cloning of the. cap alpha. subunit of human and guinea pig leukocyte adhesion glycoprotein Mo1: Chromosomal localization and homology to the. cap alpha. subunits of integrins

    SciTech Connect

    Arnaout, M.A.; Remold-O'Donnell, E.; Pierce, M.W.; Harris, P.; Tenen, D.G.

    1988-04-01

    The cell surface-glycoprotein Mo1 is a member of the family of leukocyte cell adhesion molecules (Leu-CAMs) that includes lymphocyte function-associated antigen 1 (LFA-1) and p150,95. Each Leu-CAM is a heterodimer with a distinct ..cap alpha.. subunit noncovalently associated with a common ..beta.. subunit. The authors describe the isolation and analysis of two partial cDNA clones encoding the ..cap alpha.. subunit of the Leu-CAM Mo1 in humans and guinea pigs. A monoclonal antibody directed against an epitope in the carboxyl-terminal portion of the guinea pig ..cap alpha.. chain was used for immunoscreening a lambdagt11 expression library. The sequence of a 378-base-pair insert from one immunoreactive clone revealed a single continuous open reading frame encoding 126 amino acids including a 26-amino acid tryptic peptide isolated from the purified guinea pig ..cap alpha.. subunit. A cDNA clone of identical size was isolated from a human monocyte/lymphocyte cDNA library by using the guinea pig clone as a probe. The human clone also encoded a 126-amino acid peptide including the sequence of an additional tryptic peptide present in purified human Mo1..cap alpha.. chain. Southern analysis of DNA from hamster-human hybrids localized the human Mo1..cap alpha.. chain to chromosome 16, which has been shown to contain the gene for the ..cap alpha.. chain of lymphocyte function-associated antigen 1. These data suggest that the ..cap alpha.. subunits of Leu-CAMs evolved by gene duplication from a common ancestral gene and strengthen the hypothesis that the ..cap alpha.. subunits of these heterodimeric cell adhesion molecules on myeloid and lymphoid cells, platelets, and fibroblasts are evolutionary related.

  3. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  4. Laser amplifier chain

    DOEpatents

    Hackel, R.P.

    1992-10-20

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain. 6 figs.

  5. Laser amplifier chain

    DOEpatents

    Hackel, Richard P.

    1992-01-01

    A laser amplifier chain has a plurality of laser amplifiers arranged in a chain to sequentially amplify a low-power signal beam to produce a significantly higher-power output beam. Overall efficiency of such a chain is improved if high-gain, low efficiency amplifiers are placed on the upstream side of the chain where only a very small fraction of the total pumped power is received by the chain and low-gain, high-efficiency amplifiers are placed on the downstream side where a majority of pumping energy is received by the chain.

  6. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  7. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  8. Effects of increased anionic charge in the beta-globin chain on assembly of hemoglobin in vitro.

    PubMed

    Adachi, K; Yamaguchi, T; Pang, J; Surrey, S

    1998-02-15

    Studies on assembly in vitro of alpha-globin chains with recombinant beta16 Gly-->Asp, beta95 Lys-->Glu, beta120 Lys-->Glu and beta16 Gly-->Asp, 120 Lys-->Glu human beta-globin chain variants in addition to human betaA- and betaS-globin chains were performed to evaluate effects of increased anionic charge in the beta chain on hemoglobin assembly using soluble recombinant beta-globin chains expressed in bacteria. A beta112 Cys-->Asp change was also engineered to monitor effects on assembly of increased negative charge at alpha1beta1 interaction sites. Order of tetramer formation in vitro under limiting alpha-globin chain conditions showed Hb betaG16D, K120E = Hb betaK120E = Hb betaK95E > Hb betaG16D > Hb A > Hb S > Hb betaC112D. In addition, beta112 Cys-->Asp chains exist as monomers rather than beta4 tetramers in the absence of alpha chains, and the beta chain in Hb betaC112D tetramers was readily exchanged by addition of betas. These results suggest that affinity between alpha and beta chains is promoted by negatively-charged beta chains up to a maximum of two additional net negative charges and is independent of location on the surface except at the alpha1beta1 interaction site. In addition, our findings show that beta112 Cys on the G helix is critical for facilitating formation of stable alphabeta dimers, which then form functional hemoglobin tetramers, and that beta112 Cys-->Asp inhibits formation of stable alpha1beta1 and beta1beta2 interactions in alpha2beta2 and beta4 tetramers, respectively. PMID:9454775

  9. The mRNAs for the three chains of human collagen type XI are widely distributed but not necessarily co-expressed: implications for homotrimeric, heterotrimeric and heterotypic collagen molecules.

    PubMed Central

    Lui, V C; Kong, R Y; Nicholls, J; Cheung, A N; Cheah, K S

    1995-01-01

    In cartilage collagen type XI exists as heterotrimeric molecules composed of alpha 1(XI), alpha 2(XI) and alpha 3(XI) subunits. Messenger RNAs for some of the alpha chains of collagen type XI have also been found in non-chondrogenic tissues but the chain composition of the molecule in these sites is not known. Some non-chondrogenic tissues also contain heterotrimers containing collagen alpha 2(V) and alpha 1(XI) chains. We have explored the possibility that collagen type XI could exist in differing trimeric forms in non-chondrogenic tissues and aimed to predict the subunit composition of this collagen in those tissues. The distribution and relative levels of expression of collagen alpha 1(XI), alpha 2(XI) and alpha 3(XI)/alpha 1(II) mRNAs in different human fetal tissues were studied. Expression of mRNAs for all three genes of collagen type XI is not restricted to cartilage but is widespread. However, in some non-chondrogenic tissues, the mRNAs for all three alpha chains of collagen type XI were not co-expressed, but collagen alpha 1(XI) and alpha 2(XI) mRNAs were found either singly or without collagen alpha 3(XI) transcripts. Collagen type XI may therefore exist as homotrimers and/or heterotrimers composed of two collagen alpha(XI) chains in some tissues. The distribution of mRNAs for collagen alpha 2(V) and alpha 1(I) were also studied. Co-expression of collagen type XI, alpha 2(V) and alpha 1(I) mRNAs was found for many tissues. These findings have implications for the possibility of additional chain associations for collagen types XI and V in cross-type heterotrimers within heterotypic fibrils. Images Figure 1 Figure 2 Figure 3 PMID:7487888

  10. The role of alpha-methylacyl-CoA racemase in bile acid synthesis.

    PubMed

    Cuebas, Dean A; Phillips, Christopher; Schmitz, Werner; Conzelmann, Ernst; Novikov, Dmitry K

    2002-05-01

    According to current views, the second peroxisomal beta-oxidation pathway is responsible for the degradation of the side chain of bile acid intermediates. Peroxisomal multifunctional enzyme type 2 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(R)-3-hydroxyacyl-CoA dehydrogenase; MFE-2] catalyses the second (hydration) and third (dehydrogenation) reactions of the pathway. Deficiency of MFE-2 leads to accumulation of very-long-chain fatty acids, 2-methyl-branched fatty acids and C(27) bile acid intermediates in plasma, but bile acid synthesis is not blocked completely. In this study we describe an alternative pathway, which allows MFE-2 deficiency to be overcome. The alternative pathway consists of alpha-methylacyl-CoA racemase and peroxisomal multifunctional enzyme type 1 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(S)-3-hydroxyacyl-CoA dehydrogenase; MFE-1]. (24E)-3alpha,7alpha,12alpha-Trihydroxy-5beta-cholest-24-enoyl-CoA, the presumed physiological isomer, is hydrated by MFE-1 with the formation of (24S,25S)-3alpha,7alpha,12alpha,24-tetrahydroxy-5beta-cholestanoyl-CoA [(24S,25S)-24-OH-THCA-CoA], which after conversion by a alpha-methylacyl-CoA racemase into the (24S,25R) isomer can again be dehydrogenated by MFE-1 to 24-keto-3alpha,7alpha,12alpha-trihydroxycholestanoyl-CoA, a physiological intermediate in cholic acid synthesis. The discovery of the alternative pathway of cholesterol side-chain oxidation will improve diagnosis of peroxisomal deficiencies by identification of serum 24-OH-THCA-CoA diastereomer profiles.

  11. Hb Bart's levels in cord blood and alpha-thalassemia mutations in Cyprus.

    PubMed

    Kyriacou, K; Kyrri, A; Kalogirou, E; Vasiliades, P; Angastiniotis, M; Ioannou, P A; Kleanthous, M

    2000-08-01

    The purpose of this study was to examine the frequency of alpha-thalassemia in the population of Cyprus using cord blood samples. The levels of Hb Bart's were compared with the hematological indices and the results correlated with the presence of alpha-thalassemia mutations. The protocols for the polymerase chain reaction detection of the six most common alpha-globin mutations encountered in Cyprus were optimized, and the frequency of each mutation was determined through the screening of 495 random cord blood samples. The total allele frequency for the mutations examined was 10.6%, of which 1% is due to the triplication of the alpha-globin genes. The -alpha(3.7 kb) deletion accounts for 72.8% of all detectable mutations, while the--MED-I and -(alpha)-20.5 kb mutations account for 7.8%. The level of Hb Bart's and the MCV and MCH values in cord blood samples were found to correlate closely with the severity of alpha-thalassemia, although the -alpha(3.7 kb) deletion and perhaps other mild alpha-thalassemia mutations may not give detectable Hb Bart's levels. A reasonably accurate estimate of the alpha-thalassemia carrier frequency may be obtained from cord blood studies if Hb Bart's estimates are combined with hematological indices. When molecular methods are added, these give the best way to use cord bloods to survey populations for alpha-thalassemia. PMID:10975437

  12. Characterization of the bovine C alpha gene.

    PubMed Central

    Brown, W R; Rabbani, H; Butler, J E; Hammarström, L

    1997-01-01

    The complete genomic sequence of a bovine C alpha gene is reported here. The genomic sequence was obtained from a C alpha phage clone that had been cloned from a genomic EMBL4 phage vector library. The C alpha sequence had previously been expressed as a chimeric antibody and identified as IgA using IgA-specific antibodies. Intron/exon boundaries were determined by comparison of the genomic sequence with an expressed bovine C alpha sequence obtained from spleen by reverse transcription-polymerase chain reaction (RT-PCR). Analysis of 50 Swedish bovine genomic DNA samples using genomic blots and five different restriction enzymes failed to detect evidence of polymorphism. However, PstI digests of Brown Swiss DNA showed a restriction fragment length polymorphism (RFLP), suggesting that at least two allelic variants of bovine IgA exist. Comparison of the deduced amino acid sequence of bovine IgA with sequences available for other species indicated that the highest homology was with that of swine, another artiodactyl. This was the highest homology observed for all mammalian IgA compared except for that between IgA1 and IgA2 in humans. Bovine IgA shares with rabbit IgA3 and IgA4, an additional N-linked glycosylation site at position 282. However, the collective data indicate that cattle are like swine and rodents and unlike rabbits in having a single locus of the gene encoding IgA of this species. Images Figure 4 PMID:9203958

  13. Stability against {alpha} decay of some recently observed superheavy elements

    SciTech Connect

    Roy Chowdhury, Partha; Gangopadhyay, G.; Bhattacharyya, Abhijit

    2011-02-15

    The probability of {alpha}-particle emission for some recently observed superheavy nuclei (SHN) are investigated. The {alpha}-decay half-lives of SHN are calculated in a quantum tunneling model with density-dependent M3Y (DDM3Y) effective nuclear interaction using theoretical and measured Q{sub {alpha}} values. We determine the density distribution of {alpha} and daughter nuclei from the relativistic mean-field (RMF) theory using FSUGold force, NL3, and TM1 parameter sets. The double-folded nuclear potential is numerically calculated in a more microscopic manner using these density distributions. The estimated values of {alpha}-decay half-lives are in good agreement with the recent data. We compare our results with recently detected {alpha}-decay chains from a new element with atomic number Z=117 reported by the Joint Institute for Nuclear Research, Dubna. Finally, we determine the half-lives of superheavy elements with Z=108-120 and neutron number N=152-190 to explore the long-standing predictions of the existence of an 'island of stability' due to possible spherical proton (Z{approx}114) and neutron (N{approx}184) shell closures.

  14. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha-particle therapy applications

    PubMed Central

    Miederer, Matthias; Scheinberg, David A.; McDevitt, Michael R.

    2013-01-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225Ac to potently and specifically affect cancer. PMID:18514364

  15. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha particle therapy applications.

    PubMed

    Miederer, Matthias; Scheinberg, David A; McDevitt, Michael R

    2008-09-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225 Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209 Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225 Ac to potently and specifically affect cancer.

  16. Measurements of alpha-gamma coincidences with an optimized dual-parameter multichannel system.

    PubMed

    Jurado Vargas, M; Caro Marroyo, B; Martín Sánchez, A

    2013-12-01

    Measurements of alpha-gamma coincidences have usually been carried out using a single channel to detect alpha-particles of a given energy, and a multichannel analyser for the detection of the corresponding coincident gamma-rays. An alpha-gamma coincidence chamber coupled to the electronic chain ending with a dual-parameter multichannel analyser has been developed and optimized. This system simultaneously stores alpha-particle, gamma-ray, and alpha-gamma coincidence spectra, which allows a general analysis to be made of the degree of coincidence between each alpha-particle and each gamma-ray emission. With this technique, a two-dimensional spectrum was obtained and analysed using "contour graphics". An application to the study of the decay scheme of (241)Am is described. PMID:24140879

  17. Realizing the potential of the Actinium-225 radionuclide generator in targeted alpha particle therapy applications.

    PubMed

    Miederer, Matthias; Scheinberg, David A; McDevitt, Michael R

    2008-09-01

    Alpha particle-emitting isotopes have been proposed as novel cytotoxic agents for augmenting targeted therapy. Properties of alpha particle radiation such as their limited range in tissue of a few cell diameters and their high linear energy transfer leading to dense radiation damage along each alpha track are promising in the treatment of cancer, especially when single cells or clusters of tumor cells are targeted. Actinium-225 (225 Ac) is an alpha particle-emitting radionuclide that generates 4 net alpha particle isotopes in a short decay chain to stable 209 Bi, and as such can be described as an alpha particle nanogenerator. This article reviews the literature pertaining to the research, development, and utilization of targeted 225 Ac to potently and specifically affect cancer. PMID:18514364

  18. Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

    PubMed

    He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

    2004-09-01

    Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice. PMID:15302536

  19. Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

    PubMed

    He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

    2004-09-01

    Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

  20. Production in yeast of alpha-galactosidase A, a lysosomal enzyme applicable to enzyme replacement therapy for Fabry disease.

    PubMed

    Chiba, Yasunori; Sakuraba, Hitoshi; Kotani, Masaharu; Kase, Ryoichi; Kobayashi, Kazuo; Takeuchi, Makoto; Ogasawara, Satoshi; Maruyama, Yutaka; Nakajima, Tasuku; Takaoka, Yuki; Jigami, Yoshifumi

    2002-12-01

    A mammalian-like sugar moiety was created in glycoprotein by Saccharomyces cerevisiae in combination with bacterial alpha-mannosidase to produce a more economic enzyme replacement therapy for patients with Fabry disease. We introduced the human alpha-galactosidase A (alpha-GalA) gene into an S. cerevisiae mutant that was deficient in the outer chains of N-linked mannan. The recombinant alpha-GalA contained both neutral (Man(8)GlcNAc(2)) and acidic ([Man-P](1-2)Man(8)GlcNAc(2)) sugar chains. Because an efficient incorporation of alpha-GalA into lysosomes of human cells requires mannose-6-phosphate (Man-6-P) residues that should be recognized by the specific receptor, we trimmed down the sugar chains of the alpha-GalA by a newly isolated bacterial alpha-mannosidase. Treatment of the alpha-GalA with the alpha-mannosidase resulted in the exposure of a Man-6-P residue on a nonreduced end of oligosaccharide chains after the removal of phosphodiester-linked nonreduced-end mannose. The treated alpha-GalA was efficiently incorporated into fibroblasts derived from patients with Fabry disease. The uptake was three to four times higher than that of the nontreated alpha-GalA and was inhibited by the addition of 5 mM Man-6-P. Incorporated alpha-GalA was targeted to the lysosome, and hydrolyzed ceramide trihexoside accumulated in the Fabry fibroblasts after 5 days. This method provides an effective and economic therapy for many lysosomal disorders, including Fabry disease.

  1. A chimeric scorpion alpha-toxin displays de novo electrophysiological properties similar to those of alpha-like toxins.

    PubMed

    Bouhaouala-Zahar, Balkiss; Benkhalifa, Rym; Srairi, Najet; Zenouaki, Ilhem; Ligny-Lemaire, Caroline; Drevet, Pascal; Sampieri, François; Pelhate, Marcel; El Ayeb, Mohamed; Ménez, André; Karoui, Habib; Ducancel, Frédéric

    2002-06-01

    BotXIV and LqhalphaIT are two structurally related long chain scorpion alpha-toxins that inhibit sodium current inactivation in excitable cells. However, while LqhalphaIT from Leiurus quinquestriatus hebraeus is classified as a true and strong insect alpha-toxin, BotXIV from Buthus occitanus tunetanus is characterized by moderate biological activities. To assess the possibility that structural differences between these two molecules could reflect the localization of particular functional topographies, we compared their sequences. Three structurally deviating segments located in three distinct and exposed loops were identified. They correspond to residues 8-10, 19-22, and 38-43. To evaluate their functional role, three BotXIV/LqhalphaIT chimeras were designed by transferring the corresponding LqhalphaIT sequences into BotXIV. Structural and antigenic characterizations of the resulting recombinant chimera show that BotXIV can accommodate the imposed modifications, confirming the structural flexibility of that particular alpha/beta fold. Interestingly, substitution of residues 8-10 yields to a new electrophysiological profile of the corresponding variant, partially comparable to that one of alpha-like scorpion toxins. Taken together, these results suggest that even limited structural deviations can reflect functional diversity, and also that the structure-function relationships between insect alpha-toxins and alpha-like scorpion toxins are probably more complex than expected.

  2. Crater chains on Mercury

    NASA Astrophysics Data System (ADS)

    Shevchenko, V.; Skobeleva, T.

    After discovery of disruption comet Shoemaker-Levy 9 into fragment train before it's collision with Jupiter there was proposed that linear crater chains on the large satellites of Jupiter and on the Moon are impact scars of past tidally disrupted comets.It's known that radar images have revealed the possible presence of water ice deposits in polar regions of Mercury. Impacts by a few large comets seem to provide the best explanation for both the amount and cleanliness of the ice deposits on Mercury because they have a larger volatile content that others external sources, for example, asteroid. A number of crater chains on the surface of Mercury are most likely the impact tracks of "fragment trains" of comets tidally disrupted by Sun or by Mercury and are not secondary craters. Mariner 10 image set (the three Mariner 10 flybys in 1974-1975) was used to recognize the crater chains these did not associate with secondary crater ejecta from observed impact structures. As example, it can be shown such crater chain located near crater Imhotep and crater Ibsen (The Kuiper Quadrangle of Mercury). Resolution of the Mariner 10 image is about 0.54 km/pixel. The crater chain is about 50 km long. It was found a similar crater chain inside large crater Sophocles (The Tolstoj Quadrangle of Mercury). The image resolution is about 1.46 km/pixel. The chain about 50 km long is located in northen part of the crater. Image resolution limits possibility to examine the form of craters strongly. It seems the craters in chains have roughly flat floor and smooth form. Most chain craters are approximately circular. It was examined many images from the Mariner 10 set and there were identified a total 15 crater chains and were unable to link any of these directly to any specific large crater associated with ejecta deposits. Chain craters are remarkably aligned. All distinguished crater chains are superposed on preexisting formations. A total of 127 craters were identified in the 15 recognized

  3. New (alpha-Hydroxyalkyl)phosphorus Amphiphiles: Synthesis and Dissociation Constants.

    PubMed

    Albouy, Dominique; Brun, Alice; Munoz, Aurelio; Etemad-Moghadam, Guita

    1998-10-16

    Direct synthesis of free (alpha-hydroxyalkyl)phosphinic acid amphiphiles 1 can be readily realized by sonication of the heterogeneous mixture of 50% aqueous hypophosphorous acid and long-chain aldehydes in the presence of catalytic amounts of hydrochloric acid. Oxidation of these phosphinic acids by DMSO in the presence of catalytic amounts of iodine quantitatively leads to the corresponding phosphonic acids 3. IR spectra of the phosphinic acids 1 in the condensed phase and in solution reveal the presence of intra- and intermolecular associations. Dissociation constants of the phosphorus acids 1 and 3 determined by potentiometric and (31)P NMR titrations show a good correlation between the two methods. The phosphinic acid amphiphiles 1 are slightly stronger than the corresponding phosphonic acids 3. (alpha-Hydroxyalkyl)phosphonium chlorides are prepared in good yields from the phosphine PH(3) and long-chain aldehydes in acidic media.

  4. Different clinical and biochemical phenotypes resulting from the same substitution at the same glycine residue in different chains of the type I collagen molecule

    SciTech Connect

    Paepe, A. De; Nuytinck, L.; Spotila, L.

    1994-09-01

    Mutations in type I collagen produce osteogenesis imperfecta (OI; brittle bone disease), ranging in severity from lethal to very mild. This phenotypic variation is largely determined by the position and nature of the mutation. Because type I collagen consists of two {alpha}1 chains and one {alpha}2 chain, {alpha}1(I) mutations are generally regarded to have more serious consequences than {alpha}2(I) mutations. We have characterized a point mutation causing substitution of serine for glycine at position 661 of the {alpha}1(I) chain in a child with severe OI. This is precisely the same substitution that had been detected in the {alpha}2(I) chain in a woman with post-menopausal osteoporosis. She and two of her sons were heterozygous and the third son was homozygous as a result of uniparental disomy. Biochemical collagen profiles were studied in each of the patients and compared with a control. Medium and cell-layer collagens were overmodified in all patients. Overmodification was pronounced in the patient with the {alpha}1(I) mutation, but mild in the patients with the {alpha}2(I) mutation, being slightly less evident in the heterozygotes than in the homozygote. Thermal stability assays showed that the melting temperature of the mutant {alpha}1(I) chains was reduced by 3{degrees}C, whereas the melting curves in the patients with the {alpha}2(I) mutation were not significantly different from the control. These results show that the type of {alpha}-chain harboring the mutation influences the fundamental biochemical behavior of type I collagen molecules and strikingly emphasizes the predominant role of {alpha}1(I) chains compared with {alpha}2(I) in this respect.

  5. Hb Sallanches [alpha104(G11)Cys-->Tyr, TGC-->TAC (alpha2)]: an unstable hemoglobin variant found in an Indian child.

    PubMed

    Dash, Sumitra; Harano, Keiko; Menon, Santosh

    2006-01-01

    We report the fourth observation of Hb Sallanches [alpha104(G11)Cys-->Tyr, TGC-->TAC (alpha2)], an unstable alpha chain variant of intermediate severity in the homozygous state. Heterozygosity occasionally produces mild hypochromia and microcytosis in some patients. A balanced beta/alpha ratio, found in previously reported cases, points to unstable alphabeta dimers formed as a result of the Cys-->Tyr substitution at the alpha1beta1 contact site in this hemoglobin (Hb) variant. Our patient, and the previous two of the three cases reported in patients of Pakistani origin, points to a common population stock, separated by the mass population migration which occurred during the partition of Pakistan and India in 1947. PMID:16840231

  6. TNF-alpha SNP haplotype frequencies in equidae.

    PubMed

    Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D

    2006-05-01

    Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.

  7. [beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

    SciTech Connect

    Brown, C.A.; Mahuran, D.J. )

    1993-08-01

    In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

  8. Centrosymmetric bilayers in the 0.75 A resolution structure of a designed alpha-helical peptide, D,L-Alpha-1.

    PubMed Central

    Patterson, W. R.; Anderson, D. H.; DeGrado, W. F.; Cascio, D.; Eisenberg, D.

    1999-01-01

    We report the 0.75 A crystal structure of a racemic mixture of the 12-residue designed peptide "Alpha-1" (Acetyl-ELLKKLLEELKG), the L-enantiomer of which is described in the accompanying paper. Equivalent solutions of the centrosymmetric bilayers were determined by two direct phasing programs in space groups P1 and P1bar. The unit cell contains two L-alpha-helices and two D-alpha-helices. The columnar-sheet bilayer motif seen in L-Alpha-1 is maintained in the D,L-Alpha-1 structure except that each sheet of head-to-tail helices is composed of one enantiomer and is related to its neighboring sheets by inversion symmetry. Comparison to the L-Alpha-1 structure provides further insight into peptide design. The high resolution and small asymmetric unit allowed building an intricate model (R = 13.1%, Rfree = 14.5%) that incorporates much of the discrete disorder of peptide and solvent. Ethanolamine and 2-methyl-2,4-pentanediol (MPD) molecules bind near helix termini. Rigid body analysis identifies sites of restricted displacements and torsions. Side-chain discrete disorder propagates into the backbone of one helix but not the other. Although no side chain in Alpha-1 is rigid, the environments in the crystal restrict some of them to no or only one active torsion. PMID:10422829

  9. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  10. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  11. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  12. A comparative study of straight chain and branched chain fatty acid oxidation in skin fibroblasts from patients with peroxisomal disorders.

    PubMed

    Singh, H; Usher, S; Johnson, D; Poulos, A

    1990-02-01

    The beta-oxidation of stearic acid and of alpha- and gamma-methyl isoprenoid-derived fatty acids (pristanic and tetramethylheptadecanoic acids, respectively) was investigated in normal skin fibroblasts and in fibroblasts from patients with inherited defects in peroxisomal biogenesis. Stearic acid beta-oxidation by normal fibroblast homogenates was several-fold greater compared to the oxidation of the two branched chain fatty acids. The effect of phosphatidylcholine, alpha-cyclodextrin, and bovine serum albumin on the three activities suggests that different enzymes are involved in the beta-oxidation of straight chain and branched chain fatty acids. Homogenates of fibroblasts from patients with a deficiency in peroxisomes (Zellweger syndrome and infantile Refsum's disease) showed a normal ability to beta-oxidize stearic acid, but the oxidation of pristanic and tetramethylheptadecanoic acid was decreased. Concomitantly, 14CO2 production from the branched chain fatty acids by Zellweger fibroblasts in culture (but not from stearic acid) was greatly diminished. The Zellweger fibroblasts also showed a marked reduction in the amount of water-soluble metabolites from the radiolabeled branched chain fatty acids that are released into the culture medium. The data presented indicate that the oxidation of alpha- and gamma-methyl isoprenoid-derived fatty acids takes place largely in peroxisomes in human skin fibroblasts.

  13. Purification, characterization and gene cloning of two alpha-L-arabinofuranosidases from streptomyces chartreusis GS901.

    PubMed

    Matsuo, N; Kaneko, S; Kuno, A; Kobayashi, H; Kusakabe, I

    2000-02-15

    alpha-L-Arabinofuranosidases I and II were purified from the culture filtrate of Streptomyces chartreusis GS901 and were found to have molecular masses of 80 and 37 kDa and pI values of 6.6 and 7.5 respectively. Both enzymes demonstrated slight reactivity towards arabinoxylan and arabinogalactan as substrates but did not hydrolyse gum arabic or arabinoxylo-oligosaccharides. alpha-L-Arabinofuranosidase I hydrolysed all of the alpha-linkage types that normally occur between two alpha-L-arabinofuranosyl residues, with the following decreasing order of reactivity being observed for the respective disaccharide linkages: alpha-(1-->2) alpha-(1-->3) alpha-(1-->5). This enzyme cleaved the (1-->3) linkages of the arabinosyl side-chains of methyl 3, 5-di-O-alpha-L-arabinofuranosyl-alpha-L-arabinofuranoside in preference to the (1-->5) linkages. alpha-L-Arabinofuranosidase I hydrolysed approx. 30% of the arabinan but hydrolysed hardly any linear arabinan. In contrast, alpha-L-Arabinofuranosidase II hydrolysed only (1-->5)-arabinofuranobioside among the regioisomeric methyl arabinobiosides and did not hydrolyse the arabinotrioside. Linear 1-->5-linked arabinan was a good substrate for this enzyme, but it hydrolysed hardly any of the arabinan. Synergism between the two enzymes was observed in the conversion of arabinan and debranched arabinan into arabinose. Complete amino acid sequencing of alpha-L-arabinofuranosidase I indicated that the enzyme consists of a central catalytic domain that belongs to family 51 of the glycoside hydrolases and additionally that unknown functional domains exist in the N-terminal and C-terminal regions. The amino acid sequence of alpha-L-arabinofuranosidase II indicated that this enzyme belongs to family 43 of the glycoside hydrolase family and, as this is the first report of an exo-1, 5-alpha-L-arabinofuranosidase, it represents a novel type of enzyme.

  14. Amino-acid substitution in alpha-spectrin commonly coinherited with nondominant hereditary spherocytosis.

    PubMed

    Tse, W T; Gallagher, P G; Jenkins, P B; Wang, Y; Benoit, L; Speicher, D; Winkelmann, J C; Agre, P; Forget, B G; Marchesi, S L

    1997-03-01

    Nondominant hereditary spherocytosis (ndHS) is a disorder characterized in some patients by severe hemolytic anemia and marked deficiency of erythrocyte spectrin. This report describes the identification of a variant spectrin chain, alpha-spectrin Bughill or alpha(BH), that is associated with this disorder in a number of patients. Tryptic maps of spectrin from affected individuals revealed an acidic shift in isoelectric point of the alphaII domain peptides at 46 kD and 35 kD. A point mutation at codon 970 of the alpha-spectrin gene (GCT-->GAT), that changes the encoded amino acid from an alanine to an aspartic acid, was identified in genomic DNA of affected patients. The alpha(BH) variant was present in 8 patients with ndHS from five different kindreds but was absent in 4 patients from two other kindreds. The 8 ndHS patients with the alpha(BH) variant appeared to be homozygous for the alpha(BH) variant by analysis of peptide maps of limited tryptic digests of erythrocyte spectrin. However, following genomic DNA analysis, only 2 of these patients were true homozygotes, whereas 6 were found to be doubly heterozygous for the alpha(BH) allele and a second, presumably abnormal, alpha-spectrin gene. These results suggest that, in these 6 patients, the second alpha-spectrin allele is in fact associated with one or more genetic defect(s), causing decreased accumulation of alpha-spectrin. The pattern of transmission of the alpha(BH) allele in certain families suggests that the alpha(BH) amino-acid substitution is not itself responsible for ndHS but is more likely a polymorphic variant that, in some but not all cases, is in linkage disequilibrium with another uncharacterized alpha-spectrin gene defect that itself is a cause of ndHS. PMID:9067503

  15. A sulfated alpha-L-fucan from sea cucumber.

    PubMed

    Ribeiro, A C; Vieira, R P; Mourão, P A; Mulloy, B

    1994-03-01

    A purified sulfated alpha-L-fucan from the sea cucumber body wall was studied, before and after almost complete desulfation, using methylation analysis and NMR spectroscopy. NMR analysis indicates that 2,4-di-O-sulfo-L-fucopyranose and unsubstituted fucopyranose are present in equal proportions, and that 2-O-sulfo-L-fucopyranose is present in twice that proportion. There is some NMR evidence that a regular repeating sequence of four residues comprises most or all of the polysaccharide chain.

  16. Trypanosoma cruzi elongation factor 1-alpha: nuclear localization in parasites undergoing apoptosis.

    PubMed

    Billaut-Mulot, O; Fernandez-Gomez, R; Loyens, M; Ouaissi, A

    1996-09-26

    The cloning and sequencing of the gene coding for Trypanosoma cruzi elongation factor 1 alpha (TcEF-1 alpha) was performed by screening a T. cruzi genomic library with a probe obtained through the polymerase chain reaction (PCR) amplification of T. cruzi DNA using two oligonucleotides deduced from the sequence of T. brucei EF-1 alpha. Southern blot analysis of T. cruzi digested genomic DNA and Northern blot hybridized with the labeled probe revealed that one copy of TcEF-1 alpha exist in the genome of the parasite. Indirect immunofluorescence technique using anti-EF-1 alpha antibodies and epimastigotes harvested after different days of in vitro culture showed that EF-1 alpha is localised in the cytoplasm of the parasites from the exponential growth phase. Surprisingly, during the stationary phase (ageing parasites), EF-1 alpha was found in the nucleus. Furthermore, treatment of parasites with the antibiotic drug geneticin (G418) which induces the death of epimastigotes by apoptosis showed selective localization of EF-1 alpha in the nucleus of dying parasites. This observation supports the notion already reported in the case of mammalian cells that EF-1 alpha could participate in the transcription processes and possibly in the case of T. cruzi, in the expression regulation of genes involved in the control of cell death. The possible transfection and genomic manipulation of T. cruzi may provide a model to study the role of TcEF-1 alpha in this phenomenon. PMID:8863724

  17. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  18. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  19. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  20. Rhamnoarabinosyl and rhamnoarabinoarabinosyl side chains as structural features of coffee arabinogalactans.

    PubMed

    Nunes, Fernando M; Reis, Ana; Silva, Artur M S; Domingues, M Rosário M; Coimbra, Manuel A

    2008-05-01

    The hot water soluble green coffee arabinogalactans, representing nearly 7% of total coffee bean arabinogalactans, were characterized by (1)H and (13)C NMR and, after partial acid hydrolysis, by ESI-MS/MS. Data obtained showed that these are highly branched type II arabinogalactans covalently linked to proteins (AGP), with a protein moiety containing 10% of 4-hydroxyproline residues. They possess a beta-(1-->3)-Galp/beta-(1-->3,6)-Galp ratio of 0.80, with a sugars composition of Rha:Ara:Gal of 0.25:1.0:1.5, and containing 2mol% of glucuronic acid residues. Beyond the occurrence of single alpha-L-Araf residues and [alpha-L-Araf-(1-->5)-alpha-L-Araf-(1-->] disaccharide residues as side chains, these AGPs contain unusual side chains at O-3 position of the beta-(1-->6)-linked galactopyranosyl residues composed by [alpha-L-Rhap-(1-->5)-alpha-L-Araf-(1-->] and [alpha-L-Rhap-(1-->5)-alpha-L-Araf-(1-->5)-alpha-L-Araf-(1-->] oligosaccharides. Rhamnoarabinosyl and rhamnoarabinoarabinosyl side chains are reported for the first time as structural features of plant arabinogalactan-proteins.

  1. The breakpoint of an inversion of chromosome 14 in a T-cell leukemia: sequences downstream of the immunoglobulin heavy chain locus are implicated in tumorigenesis.

    PubMed

    Baer, R; Heppell, A; Taylor, A M; Rabbitts, P H; Boullier, B; Rabbitts, T H

    1987-12-01

    T-cell tumors are characterized by inversions or translocations of chromosome 14. The breakpoints of these karyotypic abnormalities occur in chromosome bands 14q11 and 14q32--the same bands in which the T-cell receptor (TCR) alpha-chain and immunoglobulin heavy chain genes have been mapped, respectively. Patients with ataxia-telangiectasia are particularly prone to development of T-cell chronic lymphocytic leukemia with such chromosomal abnormalities. We now describe DNA rearrangements of the TCR alpha-chain gene in an ataxia-telangiectasia-associated leukemia containing both a normal and an inverted chromosome 14. The normal chromosome 14 has undergone a productive join of TCR alpha-chain variable (V alpha) and joining (J alpha) gene segments. The other allele of the TCR alpha-chain gene features a DNA rearrangement, about 50 kilobases from the TCR alpha-chain constant (C alpha) gene, that represents the breakpoint of the chromosome 14 inversion; this breakpoint is comprised of a TCR J alpha segment (from 14q11) fused to sequences derived from 14q32 but on the centromeric side of C mu. These results imply that 14q32 sequences located at an undetermined distance downstream of the immunoglobulin C mu locus can contribute to the development of T-cell tumors.

  2. Analysis of Alpha-2 Macroglobulin from the Long-Lived and Cancer-Resistant Naked Mole-Rat and Human Plasma

    PubMed Central

    Thieme, René; Kurz, Susanne; Kolb, Marlen; Debebe, Tewodros; Holtze, Susanne; Morhart, Michaela; Huse, Klaus; Szafranski, Karol; Platzer, Matthias; Hildebrandt, Thomas B.; Birkenmeier, Gerd

    2015-01-01

    Background The naked mole-rat (NMR) is a long-lived and cancer resistant species. Identification of potential anti-cancer and age related mechanisms is of great interest and makes this species eminent to investigate anti-cancer strategies and understand aging mechanisms. Since it is known that the NMR expresses higher liver mRNA-levels of alpha 2-macroglobulin than mice, nothing is known about its structure, functionality or expression level in the NMR compared to the human A2M. Results Here we show a comprehensive analysis of NMR- and human plasma-A2M, showing a different prediction in glycosylation of NMR-A2M, which results in a higher molecular weight compared to human A2M. Additionally, we found a higher concentration of A2M (8.3±0.44 mg/mL vs. and 4.4±0.20 mg/mL) and a lower total plasma protein content (38.7±1.79 mg/mL vs. 61.7±3.20 mg/mL) in NMR compared to human. NMR-A2M can be transformed by methylamine and trypsin resulting in a conformational change similar to human A2M. NMR-A2M is detectable by a polyclonal antibody against human A2M. Determination of tryptic and anti-tryptic activity of NMR and human plasma revealed a higher anti-tryptic activity of the NMR plasma. On the other hand, less proteolytic activity was found in NMR plasma compared to human plasma. Conclusion We found transformed NMR-A2M binding to its specific receptor LRP1. We could demonstrate lower protein expression of LRP1 in the NMR liver tissue compared to human but higher expression of A2M. This was accompanied by a higher EpCAM protein expression as central adhesion molecule in cancer progression. NMR-plasma was capable to increase the adhesion in human fibroblast in vitro most probably by increasing CD29 protein expression. This is the first report, demonstrating similarities as well as distinct differences between A2M in NMR and human plasma. This might be directly linked to the intriguing phenotype of the NMR and suggests that A2M might probably play an important role in anti

  3. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  4. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  5. Chain entanglements. I. Theory

    NASA Astrophysics Data System (ADS)

    Fixman, Marshall

    1988-09-01

    A model of concentrated polymer solution dynamics is described. The forces in a linear generalized Langevin equation for the motion of a probe chain are derived on the assumption that all relaxation of the forces is due to motion of the surrounding matrix. Vicinal chain displacements are classified as viscoelastic deformation, reptation, and minor residual fluctuations. The latter provide a torsional relaxation of the primitive path that minimizes the significance of transverse forces on the probe chain. All displacements of vicinal segments are assumed proportional to the forces that they exert on the probe chain. In response to an external force, the displacement of the probe chain relative to a laboratory frame is increased by viscoelastic deformation of the matrix, but reptative diffusion relative to the deforming matrix is slowed down. The net effect on translational diffusion is negligible if the probe and vicinal chains have the same chain length N, but the friction constant for reptative motion is increased by a factor N1-xs. xs=1/2 if Gaussian conformational statistics applies during the disengagement process, while xs =0.6 if excluded volume statistics applies. The translational friction constant is βp ˜N2, as in reptation theory, but the viscosity is η˜N4-xs . The persistence of entanglements during the translational diffusion of the probe chain across many radii of gyration is rationalized pictorially in terms of correlated reptative motion of the probe and vicinal chains.

  6. Neutron chain length distributions in subcritical systems

    SciTech Connect

    Nolen, S.D.; Spriggs, G.

    1999-09-27

    In this paper, the authors present the results of the chain-length distribution as a function of k in subcritical systems. These results were obtained from a point Monte Carlo code and a three-dimensional Monte Carlo code, MC++. Based on these results, they then attempt to explain why several of the common neutron noise techniques, such as the Rossi-{alpha} and Feynman's variance-to-mean techniques, are difficult to perform in highly subcritical systems using low-efficiency detectors.

  7. T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

    SciTech Connect

    Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L. ); Sherritt, M.; Bernard, C.C. ); Begovich, A.B.; Erlich, H.A. )

    1989-02-01

    Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of the polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.

  8. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  9. The ability of lens alpha crystallin to protect against heat-induced aggregation is age-dependent

    NASA Technical Reports Server (NTRS)

    Horwitz, J.; Emmons, T.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Alpha crystallin was prepared from newborn and aged bovine lenses. SDS-PAGE and tryptic peptide mapping demonstrated that both preparations contained only the alpha-A and alpha-B chains, with no significant contamination of other crystallins. Compared with alpha crystallin from the aged lens, alpha crystallin from the newborn lens was much more effective in the inhibition of beta L crystallin denaturation and precipitation induced in vitro by heat. Together, these results demonstrate that during the aging process, the alpha crystallins lose their ability to protect against protein denaturation, consistent with the hypothesis that the alpha crystallins play an important role in the maintenance of protein native structure in the intact lens.

  10. The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.

    PubMed Central

    Barrett, A J; Brown, M A; Sayers, C A

    1979-01-01

    alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not

  11. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  12. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  13. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  14. Critical Chain Exercises

    ERIC Educational Resources Information Center

    Doyle, John Kevin

    2010-01-01

    Critical Chains project management focuses on holding buffers at the project level vs. task level, and managing buffers as a project resource. A number of studies have shown that Critical Chain project management can significantly improve organizational schedule fidelity (i.e., improve the proportion of projects delivered on time) and reduce…

  15. Exon/intron structure of the human alpha 3(IV) gene encompassing the Goodpasture antigen (alpha 3(IV)NC1). Identification of a potentially antigenic region at the triple helix/NC1 domain junction.

    PubMed

    Quinones, S; Bernal, D; García-Sogo, M; Elena, S F; Saus, J

    1992-10-01

    The Goodpasture antigen has been identified as the non-collagenous (NC1) domain of alpha 3(IV), a novel collagen IV chain (Saus, J., Wieslander, J., Langeveld, J., Quinones, S., and Hudson, B.G. (1988) J. Biol. Chem. 263, 13374-13380). In the present study, the exon/intron structure and sequence for 285 amino acids of human alpha 3(IV), comprising 53 amino acids of the triple-helical domain and the complete NC1 domain (232 amino acids), were determined. Based on the comparison of the amino acid sequences of the alpha 1(IV), alpha 2(IV), alpha 3(IV), and alpha 5(IV) NC1 domains, a phylogenetic tree was constructed which indicates that alpha 2(IV) was the first chain to evolve, followed by alpha 3(IV), and then by alpha 1(IV) and alpha 5(IV). The exon/intron structure of these domains is consistent with this evolution model. In addition, it appears that alpha 3(IV) changed most after diverging from the parental gene. Analysis of its primary structure reveals that, at the junction between the triple-helical and NC1 domains, there exists a previously unrecognized, highly hydrophilic region (GLKGKRGDSGSPATWTTR) which is unique to the human alpha 3(IV) chain, containing a cell adhesion motif (RGD) as an integral part of a sequence (KRGDSGSP) conforming to a number of protein kinase recognition sites. Based on primary structure data, we outline new aspects to be explored concerning the molecular basis of collagen IV function and Goodpasture syndrome.

  16. A thermostable alpha-galactosidase from Lactobacillus fermentum CRL722: genetic characterization and main properties.

    PubMed

    Carrera-Silva, E A; Silvestroni, A; LeBlanc, J G; Piard, J-C; Savoy de Giori, G; Sesma, F

    2006-11-01

    Alpha-galactosidase (alpha-Gal) enzyme, which is encoded by the melA gene hydrolyzes alpha-1,6 galactoside linkages found in sugars, such as raffinose and stachyose. These alpha-galacto-oligosaccharides (alpha-GOS), which are found in large quantities in vegetables, such as soy, can cause gastrointestinal disorders in sensitive individuals because monogastric animals (including humans) do not posses alpha-Gal in the gut. The use of microbial alpha-Gal is a promising alternative to eliminate alpha-GOS in soy-derived products. Using degenerate primers, the melA gene from Lactobacillus (L.) fermentum CRL722 was identified. The complete genomic sequence of melA (2223 bp), and of the genes flanking melA, were obtained using a combination of polymerase chain reaction-based techniques, and showed strong similarities with the alpha-Gal gene of thermophilic microorganisms. The alpha-Gal gene from L. fermentum CRL722 was cloned and the protein purified from cell-free extracts of the native and recombinant strains using various techniques (ion exchange chromatography, salt precipitation, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and ultra-filtration); Its main biochemical properties were determined. The enzyme was active at moderately high temperatures (55 degrees C) and stable at wide ranges of temperatures and pH. The thermostable alpha-Gal from L. fermentum CRL722 could thus be used for technological applications, such as the removal of alpha-GOS found in soy products. The complete melA gene could also be inserted in other micro-organisms, that can survive in the harsh conditions of the gut to degrade alpha-GOS in situ. Both strategies would improve the overall acceptability of soy-derived products by improving their nutritional value.

  17. Synthetic localization of a second toxin-binding region within residues. cap alpha. 182-198 of Torpedo acetylcholine receptor

    SciTech Connect

    Mulac-Jericevic, B.; Atassi, M.Z.

    1986-03-05

    A peptide, corresponding to the region 182-198 (peptide ..cap alpha..T182-198) of the ..cap alpha.. chain of Torpedo californica acetylcholine (AChR) was synthesized, purified and characterized. The binding activities of this peptide to ..cap alpha..-bungarotoxin and to cobratoxin were studied and compared to the activities of the previously reported synthetic peptide ..cap alpha..T125-147 of Torpedo ..cap alpha.. chain. Binding studies were performed by quantitative radiometric titrations by studying the binding of /sup 125/I-labelled peptides to toxin adsorbents and the binding of /sup 125/I labelled toxins to peptide adsorbents. The specificity of the binding was confirmed by appropriate inhibition experiments. The results showed unequivocally that the ..cap alpha.. chain of AChR contains a second toxin binding region which resides within, but may not comprise all of, the residues 182-198. The binding of toxins to one synthetic region is inhibited by the other. Thus, the ..cap alpha.. chain of AChR contains at least two toxin binding regions which may either be two faces of a larger single binding site or, alternatively, two binding sites that are spatially very close and thus the binding of one synthetic region to the toxin site could sterically obstruct the binding of the second synthetic region.

  18. Mouse alpha-macroglobulin. Structure, function and a molecular model.

    PubMed Central

    Hudson, N W; Kehoe, J M; Koo, P H

    1987-01-01

    Mouse alpha-macroglobulin (M-AMG) is believed to be a functional homologue of human alpha 2-macroglobulin (h-alpha 2M). The subunit composition, the tryptic cleavage pattern before and after methylamine incorporation and the two-dimensional tryptic-peptide mapping, however, indicate that these two proteins are structurally distinct. M-AMG is composed of two major types of polypeptides (Mr 163,000 and 35,000) together with a minor polypeptide (Mr 185,000), whereas h-alpha 2M has only one type of polypeptide (Mr 185,000). After incorporation of methylamine, there is no change in the normal tryptic-cleavage pattern of M-AMG; however, tryptic cleavage of h-alpha 2M is severely retarded [Hudson & Koo (1982) Biochim. Biophys. Acta 704, 290-303]. The N-terminal sequence of the 163,000-Mr polypeptide of M-AMG shows sequence homology with the N-terminal sequence of h-alpha 2M. The amino acid compositions of M-AMG and its two major polypeptide chains are compared. Thermal fragmentation studies show that the 163,000-Mr polypeptide is broken down into 125,000-Mr and 29,000-Mr fragments. Trypsin-binding studies show that M-AMG can bind two molecules of trypsin/molecule. Inactivations of the trypsin-binding property of M-AMG and h-alpha 2M with methylamine show similar kinetics of inhibition at 4 degrees C. A structural model of M-AMG is proposed, based on accumulated data. Images Fig. 3. PMID:2449173

  19. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  20. Enzymatic preparation of. cap alpha. - and. beta. -deuterated or tritiated amino acids with l-methionine. gamma. -lyase

    SciTech Connect

    Esaki, N.; Sawada, S.; Tanaka, H.; Soda, K.

    1982-01-15

    L-Methionine ..gamma..-lyase catalyzes the exchange of ..cap alpha..- and ..beta..-hydrogens of L-methionine and S-methyl-L-cysteine with deuterium or tritium of solvents. The rate of ..cap alpha..-hydrogen exchange with deuterium was about 40 times faster than that of the elimination reactions. The deuterium and tritium were exchanged also with the ..cap alpha..- and ..beta..-hydrogens of the straight-chain amino acids which do not undergo the elimination: L-alanine, L-..cap alpha..-aminobutyrate, L-norvaline, and L-norleucine. No exchange occurs for the D-isomers, acidic L-amino acids, basic L-amino acids, and branched-chain L-amino acids, although ..cap alpha..-hydrogen of glycine, L-trypotophan, and L-phenylalanine is exchanged slowly. These enzymatic hydrogen-exchange reactions facilitate specific labeling of the L-amino acids with deuterium and tritium.

  1. Alpha-oxidation of fatty acids in fasted or diabetic rats.

    PubMed

    Takahashi, T; Takahashi, H; Takeda, H; Shichiri, M

    1992-05-01

    Induction of alpha-oxidation, a possible gluconeogenic process, which should produce odd-chain fatty acids from even-chain fatty acids, was studied in rats fasted or made diabetic with streptozotocin. When a omega-phenylated even-chain fatty acid, phenylbutyric acid (1.2 mmol/kg), was administered to rats under these conditions, a significant increase in the urinary excretion of benzoic acid, the metabolic end-product of omega-phenylated odd-chain fatty acids, was observed in fasted (3.54 +/- 0.46 mumol/day) and diabetic (6.73 +/- 2.10) rats (control, 0.58 +/- 0.43; P less than 0.001). Phenylated longer chain fatty acids, phenylhexanoic and phenyldecanoic acid, did not produce significantly more benzoic acid than did phenylbutyric acid. Although the rate of alpha-oxidation was very low compared to that of beta-oxidation, these results suggested that alpha-oxidation of fatty acids was induced under fasting or diabetic conditions, and that alpha-oxidation might take place at the butyric acid stage. PMID:1600847

  2. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  3. Interferon-γ Protects from Staphylococcal Alpha Toxin-Induced Keratinocyte Death through Apolipoprotein L1.

    PubMed

    Brauweiler, Anne M; Goleva, Elena; Leung, Donald Y M

    2016-03-01

    Staphylococcus aureus is a bacterial pathogen that frequently infects the skin, causing lesions and cell destruction through its primary virulence factor, alpha toxin. Here we show that interferon gamma (IFN-?) protects human keratinocytes from cell death induced by staphylococcal alpha toxin. We find that IFN-? prevents alpha toxin binding and reduces expression of the alpha toxin receptor, a disintegrin and metalloproteinase 10 (ADAM10). We determine that the mechanism for IFN-?-mediated resistance to alpha toxin involves the induction of autophagy, a process of cellular adaptation to sublethal damage. We find that IFN-? potently stimulates activation of the primary autophagy effector, light chain 3 (LC3). This process is dependent on upregulation of apolipoprotein L1. Depletion of apolipoprotein L1 by small interfering RNA significantly increases alpha toxin-induced lethality and inhibits activation of light chain 3. We conclude that IFN-? plays a significant role in protecting human keratinocytes from the lethal effects of staphylococcal alpha toxin through apolipoprotein L1-induced autophagy.

  4. 1-deoxynojirimycin impairs oligosaccharide processing of alpha 1-proteinase inhibitor and inhibits its secretion in primary cultures of rat hepatocytes.

    PubMed

    Gross, V; Andus, T; Tran-Thi, T A; Schwarz, R T; Decker, K; Heinrich, P C

    1983-10-25

    1-Deoxynojirimycin was found to inhibit oligosaccharide processing of rat alpha 1-proteinase inhibitor. In normal hepatocytes alpha 1-proteinase inhibitor was present in the cells as a 49,000 Mr high mannose type glycoprotein with oligosaccharide side chains having the composition Man9GlcNAc and Man8GlcNAc with the former in a higher proportion. Hepatocytes treated with 5 mM 1-deoxynojirimycin accumulated alpha 1-proteinase inhibitor as a 51,000 Mr glycoprotein with carbohydrate side chains of the high mannose type, containing glucose as measured by their sensitivity against alpha-glucosidase, the largest species being Glc3Man9GlcNAc. Conversion to complex oligosaccharides was inhibited by the drug. In addition, increasing concentrations of 1-deoxynojirimycin inhibited glycosylation resulting in the formation of some alpha 1-proteinase inhibitor with two instead of three oligosaccharide side chains. 5 mM 1-deoxynojirimycin inhibited the secretion of alpha 1-proteinase inhibitor by about 50%, whereas secretion of albumin was unaffected. The oligosaccharides of alpha 1-proteinase inhibitor secreted from 1-deoxynojirimycin-treated cells were characterized by their susceptibility to endoglucosaminidase H, incorporation of [3H]galactose, and [3H]fucose and concanavalin A-Sepharose chromatography. It was found that 1-deoxynojirimycin did not completely block oligosaccharide processing, resulting in the formation of alpha 1-proteinase inhibitor molecules carrying one or two complex type oligosaccharides. Only these alpha 1-proteinase inhibitor molecules processed to the complex type in one or two of their oligosaccharide chains were nearly exclusively secreted. This finding demonstrates the importance of oligosaccharide processing for the secretion of alpha 1-proteinase inhibitor. PMID:6226656

  5. Cloning, expression, and chaperone-like activity of human alphaA-crystallin.

    PubMed

    Andley, U P; Mathur, S; Griest, T A; Petrash, J M

    1996-12-13

    One of the major protein components of the ocular lens, alpha-crystallin, is composed of alphaA and alphaB chain subunits that have structural homology to the family of mammalian small heat shock proteins. Like other small heat shock proteins, alpha-crystallin subunits associate to form large oligomeric aggregates that express chaperone-like activity, as defined by the ability to suppress nonspecific aggregation of proteins destabilized by treatment with a variety of denaturants including heat, UV irradiation, and chemical modification. It has been proposed that age-related loss of sequences at the C terminus of the alphaA chain subunit may be a factor in the pathogenesis of cataract due to diminished capacity of the truncated crystallin to protect against nonspecific aggregation of lens proteins. To evaluate the functional consequences of alpha-crystallin modification, two mutant forms of alphaA subunits were prepared by site-directed mutagenesis. Like wild type (WT), aggregates of approximately 540 kDa were formed from a tryptophan-free alphaA mutant (W9F). When added in stoichiometric amounts, both WT and W9F subunits completely suppressed the heat-induced aggregation of aldose reductase. In contrast, subunits encoded by a truncation mutant in which the C-terminal 17 residues were deleted (R157STOP), despite having spectroscopic properties similar to WT, formed much larger aggregates with a marked reduction in chaperone-like activity. Similar results were observed when the chaperone-like activity was assessed through inhibition of gamma-crystallin aggregation induced by singlet oxygen. These results demonstrate that the structurally conservative substitution of Phe for Trp-9 has a negligible effect on the functional interaction of alphaA subunits, and that deletion of C-terminal sequences from the alphaA subunit results in substantial loss of chaperone-like activity, despite overall preservation of secondary structure. PMID:8943244

  6. Recombinant human fibrinogen and sulfation of the. gamma. prime chain

    SciTech Connect

    Farrell, D.H.; Huang, S.; Chung, D.W.; Davie, E.W. ); Mulvihill, E.R. )

    1991-10-01

    Human fibrinogen and the homodimeric {gamma}{prime}-chain-containing variant have been expressed in BHK cells using cDNAs coding for the {alpha},{beta}, and {gamma} (or {gamma}{prime}) chains. The fibrinogens were secreted at levels greater than 4 {mu}g (mg of total cell protein){sup {minus}1}day{sup {minus}1} and were biologically active in clotting assays. Recombinant fibrinogen containing the {gamma}' chain incorporated {sup 35}SO{sub 4} into its chains during biosynthesis, while no incorporation occurred in the protein containing the {gamma} chain. The identity of the sulfated {gamma}{prime} chain was verified by its ability to form dimers during clotting. In addition, carboxypeptidase {Upsilon} digestion of the recombinant fibrinogen containing the {gamma}{prime} chain released 96% of the {sup 35}S label from the sulfated chain, and the radioactive material was identified as tyrosine O-sulfate. These results clarify previous findings of the sulfation of tyrosine in human fibrinogen.

  7. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  8. Atomic Chain Electronics

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Saini, Subhash (Technical Monitor)

    1998-01-01

    Adatom chains, precise structures artificially created on an atomically regulated surface, are the smallest possible candidates for future nanoelectronics. Since all the devices are created by combining adatom chains precisely prepared with atomic precision, device characteristics are predictable, and free from deviations due to accidental structural defects. In this atomic dimension, however, an analogy to the current semiconductor devices may not work. For example, Si structures are not always semiconducting. Adatom states do not always localize at the substrate surface when adatoms form chemical bonds to the substrate atoms. Transport properties are often determined for the entire system of the chain and electrodes, and not for chains only. These fundamental issues are discussed, which will be useful for future device considerations.

  9. Exon B of human surfactant protein A2 mRNA, alone or within its surrounding sequences, interacts with 14-3-3; role of cis-elements and secondary structure

    PubMed Central

    Noutsios, Georgios T.; Silveyra, Patricia; Bhatti, Faizah

    2013-01-01

    Human surfactant protein A, an innate immunity molecule, is encoded by two genes: SFTPA1 (SP-A1) and SFTPA2 (SP-A2). The 5′ untranslated (5′UTR) splice variant of SP-A2 (ABD), but not of SP-A1 (AD), contains exon B (eB), which is an enhancer for transcription and translation. We investigated whether eB contains cis-regulatory elements that bind trans-acting factors in a sequence-specific manner as well as the role of the eB mRNA secondary structure. Binding of cytoplasmic NCI-H441 proteins to wild-type eB, eB mutant, AD, and ABD 5′UTR mRNAs were studied by RNA electromobility shift assays (REMSAs). The bound proteins were identified by mass spectroscopy and specific antibodies (Abs). We found that 1) proteins bind eB mRNA in a sequence-specific manner, with two cis-elements identified within eB to be important; 2) eB secondary structure is necessary for binding; 3) mass spectroscopy and specific Abs in REMSAs identified 14-3-3 proteins to bind (directly or indirectly) eB and the natural SP-A2 (ABD) splice variant but not the SP-A1 (AD) splice variant; 4) other ribosomal and cytoskeletal proteins, and translation factors, are also present in the eB mRNA-protein complex; 5) knockdown of 14-3-3 β/α isoform resulted in a downregulation of SP-A2 expression. In conclusion, proteins including the 14-3-3 family bind two cis-elements within eB of hSP-A2 mRNA in a sequence- and secondary structure-specific manner. Differential regulation of SP-A1 and SP-A2 is mediated by the 14-3-3 protein family as well as by a number of other proteins that bind UTRs with or without eB mRNA. PMID:23525782

  10. New mooring chain designs

    SciTech Connect

    Canada, L.; Vicinay, J.; Sanz, A.; Lopez, E.

    1996-12-31

    The present work introduces the readers to the developments the high technology offshore chain industry has carried out in recent years, in an effort to offer products that meet the needs of petroleum exploration and production. In this manner the industry can continue to regard chain as a fundamental element in its moorings system, whether for projects with a 25 year life, or projects at depths of over 1,000 meters, or in such severe environments as those faced in the Sub-Arctic. Data are presented on Studless Chain and VGW or Variable Geometry and Weight chain. These will allow engineers designers to forget the needs for chains to be circumscribed to rigid guidelines of geometry or dimensions. Instead they can design mooring systems specific for the particular situations they face. No longer shall chain have to meet geometric standardization derived from the middle of the 19th century while meeting the requirements of the 2nd half of the 20th century.

  11. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  12. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  13. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  14. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  15. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  16. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  17. A delta T-cell receptor deleting element transgenic reporter construct is rearranged in alpha beta but not gamma delta T-cell lineages.

    PubMed Central

    Shutter, J; Cain, J A; Ledbetter, S; Rogers, M D; Hockett, R D

    1995-01-01

    T cells can be divided into two groups on the basis of the expression of either alpha beta or gamma delta T-cell receptors (TCRs). Because the TCR delta chain locus lies within the larger TCR alpha chain locus, control of the utilization of these two receptors is important in T-cell development, specifically for determination of T-cell type: rearrangement of the alpha locus results in deletion of the delta coding segments and commitment to the alpha beta lineage. In the developing thymus, a relative site-specific recombination occurs by which the TCR delta chain gene segments are deleted. This deletion removes all D delta, J delta, and C delta genes and occurs on both alleles. This delta deletional mechanism is evolutionarily conserved between mice and humans. Transgenic mice which contain the human delta deleting elements and as much internal TCR delta chain coding sequence as possible without allowing the formation of a complete delta chain gene were developed. Several transgenic lines showing recombinations between deleting elements within the transgene were developed. These lines demonstrate that utilization of the delta deleting elements occurs in alpha beta T cells of the spleen and thymus. These recombinations are rare in the gamma delta population, indicating that the machinery for utilization of delta deleting elements is functional in alpha beta T cells but absent in gamma delta T cells. Furthermore, a discrete population of early thymocytes containing delta deleting element recombinations but not V alpha-to-J alpha rearrangements has been identified. These data are consistent with a model in which delta deletion contributes to the implementation of a signal by which the TCR alpha chain locus is rearranged and expressed and thus becomes an alpha beta T cell. PMID:8524269

  18. Molecular dynamics in nanophase-separated comb-like poly(alpha-n-alkyl beta-L-aspartate)s.

    PubMed

    Grimau, M; Laredo, E; Sánchez, F; López-Carrasquero, F; Báez, M E; Bello, A

    2004-12-01

    A series of poly(alpha-n-alkyl beta-L-aspartates) which are nanophase self-assembled comb-like polymers has been studied by dielectric spectroscopy in a broad frequency range (10(-2) < or = nu < or = 3 x 10(6) Hz), with n-alkyls side chains of various lengths, 10 < or = n < or =18. In every member of the series the same relaxations were identified after the decomposition of the experimental isothermal trace in up to three peaks with relaxation times distributions. The strength, width and average relaxation time for all the relaxation modes were determined for each material. Besides the local low temperature, Arrhenius modes, two relaxation modes, alpha and alpha(PE), present a cooperative character whose dynamics are not affected by the side chains melting. The alpha(PE) relaxation is a polyethylene-like glass transition of the amorphous side chains and its dynamics is strongly dependent on the n value due to the increasing restrictions imposed by the self-assembled confinement. The strength of the alpha(PE) relaxation mode increases as the lateral chains loose their 2D order. The restricted chopstick motion of the rigid rods is thought to be the origin of the alpha mode; this motion is hindered at temperatures where the cage size decreases as a result of the increasing disorder with temperature.

  19. Confinement-induced order of tethered alkyl chains at the water/vapor interface.

    PubMed

    Fukuto, M; Heilmann, R K; Pershan, P S; Yu, S M; Soto, C M; Tirrell, D A

    2002-07-01

    Packing of tethered alkyl chains in Langmuir monolayers of a hairy-rod polypeptide poly[gamma-4-(n-hexadecyloxy)benzyl alpha,L-glutamate] on water has been studied by x-ray scattering measurements at room temperature. The rods lie parallel to the surface while the alkyl side chains segregate toward the vapor. Results indicate that the herringbone order of the alkyl chains is established initially by one-dimensionally confined chains between aligned rods and grows laterally with compression. PMID:12241332

  20. Localization of neuregulin-1alpha (heregulin-alpha) and one of its receptors, ErbB-4 tyrosine kinase, in developing and adult human brain.

    PubMed

    Bernstein, Hans-Gert; Lendeckel, Uwe; Bertram, Iris; Bukowska, Alicja; Kanakis, Dimitrios; Dobrowolny, Henrik; Stauch, Renate; Krell, Dieter; Mawrin, Christian; Budinger, Eike; Keilhoff, Gerburg; Bogerts, Bernhard

    2006-05-15

    Using immunohistochemistry, Western blot analysis, and RT-polymerase chain reaction, we studied the distribution of neuregulin-1 splice variant alpha (NRG-1alpha) and one of its putative receptors, ErbB-4 tyrosine kinase, in human brain. In the pre- and perinatal human brain immunoreactivity was confined to numerous neurons, with the highest cell density found in cortical gray matter, hypothalamus and cerebellum. In the adult brain, single cortical gray and white matter neurons showed NRG-1alpha immunoreactivity. Occasionally, immunoreactive oligodendrocytes were observed. NRG-1alpha-expressing neurons were also found in the hypothalamus, hippocampus, basal ganglia and brain stem. Application of two antibodies recognizing alpha and beta isoforms revealed a different distribution pattern in that many cortical and hippocampal pyramidal neurons were labeled. ErbB-4 immunoreactivity was expressed in both neurons and oligodendrocytes. Our data show that NRG-1alpha expression is lower in the adult human brain than in the developing brain, and, therefore, support a role for NRG-1alpha in brain development.

  1. Amino acid sequence of the alpha subunit and computer modelling of the alpha and beta subunits of echicetin from the venom of Echis carinatus (saw-scaled viper).

    PubMed

    Polgár, J; Magnenat, E M; Peitsch, M C; Wells, T N; Saqi, M S; Clemetson, K J

    1997-04-15

    Echicetin, a heterodimeric protein from the venom of Echis carinatus, binds to platelet glycoprotein Ib (GPIb) and so inhibits platelet aggregation or agglutination induced by various platelet agonists acting via GPIb. The amino acid sequence of the beta subunit of echicetin has been reported and found to belong to the recently identified snake venom subclass of the C-type lectin protein family. Echicetin alpha and beta subunits were purified. N-terminal sequence analysis provided direct evidence that the protein purified was echicetin. The paper presents the complete amino acid sequence of the alpha subunit and computer models of the alpha and beta subunits. The sequence of alpha echicetin is highly similar to the alpha and beta chains of various heterodimeric and homodimeric C-type lectins. Neither of the fully reduced and alkylated alpha or beta subunits of echicetin inhibited the platelet agglutination induced by von Willebrand factor-ristocetin or alpha-thrombin. Earlier reports about the inhibitory activity of reduced and alkylated echicetin beta subunit might have been due to partial reduction of the protein. PMID:9163349

  2. Phasic Triplet Markov Chains.

    PubMed

    El Yazid Boudaren, Mohamed; Monfrini, Emmanuel; Pieczynski, Wojciech; Aïssani, Amar

    2014-11-01

    Hidden Markov chains have been shown to be inadequate for data modeling under some complex conditions. In this work, we address the problem of statistical modeling of phenomena involving two heterogeneous system states. Such phenomena may arise in biology or communications, among other fields. Namely, we consider that a sequence of meaningful words is to be searched within a whole observation that also contains arbitrary one-by-one symbols. Moreover, a word may be interrupted at some site to be carried on later. Applying plain hidden Markov chains to such data, while ignoring their specificity, yields unsatisfactory results. The Phasic triplet Markov chain, proposed in this paper, overcomes this difficulty by means of an auxiliary underlying process in accordance with the triplet Markov chains theory. Related Bayesian restoration techniques and parameters estimation procedures according to the new model are then described. Finally, to assess the performance of the proposed model against the conventional hidden Markov chain model, experiments are conducted on synthetic and real data. PMID:26353069

  3. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  4. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  5. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  6. A genetic and biochemical analysis of a polymorphism of bovine alpha S2-casein.

    PubMed

    Grosclaude, F; Joudrier, P; Mahé, M F

    1979-04-01

    Using gel electrophoresis a genetic polymorphism of alpha S2-casein (Cn) was discovered in individual milk samples from 2 bovine breeds of the eastern part of France (Vosgienne and Montbéliarde). The 3 observed phenotypes (Plate 1) are determined by 2 co-dominant alleles at an autosomal locus. The alpha S2-Cn A variant was the only one known up to now in European breeds (reference variant) and alpha S2-Cn D is a new variant, whose bands overlap the beta-casein A band at pH 8.6, and migrate faster than alpha S2-Cn A at pH 3.0. The sequence of the polypeptide chain alpha S2-Cn D differs from that of alpha S2-Cn A by the deletion of a very acidic nonapeptide, which includes a cluster of 3 phosphoseryl residues. Due to the characteristics of the reference sequence, this deletion cannot be exactly located but it involves residues 50-58, or 51-59, or 52-60. A genetic analysis shows that locus alpha S2-Cn is closely linked to the cluster alpha S1-Cn--beta-Cn--kappa-Cn. The 4 casein species are thus synthesized by 4 closely linked loci.

  7. Mitochondria mediate tumor necrosis factor-alpha/NF-kappaB signaling in skeletal muscle myotubes

    NASA Technical Reports Server (NTRS)

    Li, Y. P.; Atkins, C. M.; Sweatt, J. D.; Reid, M. B.; Hamilton, S. L. (Principal Investigator)

    1999-01-01

    Tumor necrosis factor-alpha (TNF-alpha) is implicated in muscle atrophy and weakness associated with a variety of chronic diseases. Recently, we reported that TNF-alpha directly induces muscle protein degradation in differentiated skeletal muscle myotubes, where it rapidly activates nuclear factor kappaB (NF-kappaB). We also have found that protein loss induced by TNF-alpha is NF-kappaB dependent. In the present study, we analyzed the signaling pathway by which TNF-alpha activates NF-kappaB in myotubes differentiated from C2C12 and rat primary myoblasts. We found that activation of NF-kappaB by TNF-alpha was blocked by rotenone or amytal, inhibitors of complex I of the mitochondrial respiratory chain. On the other hand, antimycin A, an inhibitor of complex III, enhanced TNF-alpha activation of NK-kappaB. These results suggest a key role of mitochondria-derived reactive oxygen species (ROS) in mediating NF-kappaB activation in muscle. In addition, we found that TNF-alpha stimulated protein kinase C (PKC) activity. However, other signal transduction mediators including ceramide, Ca2+, phospholipase A2 (PLA2), and nitric oxide (NO) do not appear to be involved in the activation of NF-kappaB.

  8. Pharmacological properties of rat alpha 7 nicotinic receptors expressed in native and recombinant cell systems.

    PubMed

    Virginio, Caterina; Giacometti, Angelo; Aldegheri, Laura; Rimland, Joseph M; Terstappen, Georg C

    2002-06-12

    The pharmacological properties of the rat alpha7 nicotinic acetylcholine receptor endogenously expressed in PC12 cells and recombinantly expressed in GH4C1 cells (alpha7-GH4C1 cells) were characterized and compared. Patch-clamp recordings demonstrated that activation by choline and block by methyllycaconitine and dihydro-beta-erythroidine were similar, but block by mecamylamine was different. Whereas in alpha7-GH4C1 cells the inhibition curve for mecamylamine was monophasic (IC(50) of 1.6 microM), it was biphasic in PC12 cells (IC(50) values of 341 nM and 9.6 microM). The same rank order of potency was obtained for various nicotinic agonists, while acetylcholine was 3.7-fold less potent and 1.5-fold more effective in PC12 cells. Dihydro-beta-erythroidine differentially blocked acetylcholine-evoked currents in both systems. Since reverse transcriptase polymerase chain reaction (RT-PCR) experiments revealed expression of alpha3, alpha4, alpha5, alpha7 and beta4 subunits in PC12 cells, whereas GH4C1 cells express only the beta4 subunit, our results suggest that more than one form of alpha7 containing heteromeric nicotinic receptors might be functionally expressed in PC12 cells.

  9. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  10. [Perissodactyla: the primary structure of hemoglobins from the lowland tapir (Tapirus terrestris): glutamic acid in position 2 of the beta chains].

    PubMed

    Mazur, G; Braunitzer, G

    1984-09-01

    The hemoglobins from a lowland tapir (Tapirus terrestris) were analysed and the complete primary structure is described. The globin chains were separated on CM cellulose column in 8M urea and the amino-acid sequences were determined in the liquid phase sequenator. The results show that globin consists of two alpha chains (alpha I and alpha II) and beta major and beta minor components. The alpha chains differ only at one position: alpha I contains aspartic acid and alpha II glycine. The beta chains are heterogeneous: aspartic and glutamic acid were found at position beta 21 and beta 73 of the beta major components and asparagine and serine at position beta 139. In the beta minor components four positions were found with more than one amino acid, namely beta 2, beta 4, beta 6 and beta 56. The sequences are compared with those of man, horse and rhinoceros. Four residues of horse methemoglobin, which are involved in the alpha 1 beta 1 contacts are substituted in tapir hemoglobins. In the alpha chains: alpha 107(G14)Ser----Val, alpha 111-(G18) Val----Leu, alpha 115(GH3) Asn----Asp or Gly; in the beta chains: beta 116(G18) Arg----Gln. The amino acid at beta 2 of the major components is glutamic acid while glutamine and histidine are found in the minor components. Although glutamic acid, a binding site for ATP, does not interact with 2,3-bisphosphoglycerate, glutamine and histidine in the minor components are responsible for the slight effect of 2,3-bisphosphoglycerate on tapir hemoglobin.

  11. Interaction of alpha-tocopherol with fatty acids in membranes and ethanol.

    PubMed

    Stillwell, W; Ehringer, W; Wassall, S R

    1992-04-13

    The techniques of fluorescence polarization, ultraviolet light absorbance and fluorescence quenching by acrylamide are used to probe the structural role of alpha-tocopherol in phospholipid bilayers. Using 1,6-diphenyl-1,3,5-hexatriene (DPH) and a series of (anthroyloxy)stearic acid (AS) fluorescence probes, alpha-tocopherol is shown to increase fluidity and decrease order of gel state bilayers, and to decrease fluidity and increase order of bilayers in the liquid crystalline state. More complex behavior is noted for bilayers made from mixed acyl chain phosphatidylcholines (PCs) where the sn-1 position is saturated and the sn-2 position unsaturated compared to bilayers composed of PCs where both acyl chains are either saturated or unsaturated. Complexation between alpha-tocopherol and either free fatty acids or fatty acids esterified to the sn-2 position of PCs is indicated by ultraviolet light absorbance in both organic solution and in lipid bilayers. The strength of the complexes, expressed as interaction constants, are dependent upon the number of acyl chain unsaturations from 0 (stearic acid), to 6 (docosahexaenoic acid). Relation of the strength of these complexes to the degree of acyl chain unsaturation is confirmed by monitoring the fatty acid protection from acrylamide bleaching of alpha-tocopherol. These experiments suggest that the extent of acrylamide bleaching is related to the extent of association with the fatty acids.

  12. Spatial Data Supply Chains

    NASA Astrophysics Data System (ADS)

    Varadharajulu, P.; Azeem Saqiq, M.; Yu, F.; McMeekin, D. A.; West, G.; Arnold, L.; Moncrieff, S.

    2015-06-01

    This paper describes current research into the supply of spatial data to the end user in as close to real time as possible via the World Wide Web. The Spatial Data Infrastructure paradigm has been discussed since the early 1990s. The concept has evolved significantly since then but has almost always examined data from the perspective of the supplier. It has been a supplier driven focus rather than a user driven focus. The current research being conducted is making a paradigm shift and looking at the supply of spatial data as a supply chain, similar to a manufacturing supply chain in which users play a significant part. A comprehensive consultation process took place within Australia and New Zealand incorporating a large number of stakeholders. Three research projects that have arisen from this consultation process are examining Spatial Data Supply Chains within Australia and New Zealand and are discussed within this paper.

  13. Chain inflation revisited

    SciTech Connect

    Chialva, Diego; Danielsson, Ulf H E-mail: ulf.danielsson@fysast.uu.se

    2008-10-15

    This paper represents an in-depth treatment of the chain inflation scenario. We fully determine the evolution of the universe in the model, the conditions necessary in order to have a successful inflationary period, and the matching with the observational results regarding the cosmological perturbations. We study in great detail, and in general, the dynamics of the background, as well as the mechanism of generation of the perturbations. We also find an explicit formula for the spectrum of adiabatic perturbations. Our results prove that chain inflation is a viable model for solving the horizon, entropy and flatness problems of standard cosmology and for generating the right amount of adiabatic cosmological perturbations. The results are radically different from those found in previous works on the subject. Finally, we argue that there is a natural way to embed chain inflation into flux compactified string theory. We discuss the details of the implementation and how to fit observations.

  14. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  15. Supply-Chain Optimization Template

    NASA Technical Reports Server (NTRS)

    Quiett, William F.; Sealing, Scott L.

    2009-01-01

    The Supply-Chain Optimization Template (SCOT) is an instructional guide for identifying, evaluating, and optimizing (including re-engineering) aerospace- oriented supply chains. The SCOT was derived from the Supply Chain Council s Supply-Chain Operations Reference (SCC SCOR) Model, which is more generic and more oriented toward achieving a competitive advantage in business.

  16. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  17. Effect of chronic alcohol consumption on Hepatic SIRT1 and PGC-1{alpha} in rats

    SciTech Connect

    Lieber, Charles S. Leo, Maria A.; Wang Xiaolei; DeCarli, Leonore M.

    2008-05-23

    The nuclear genes, NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-{gamma} coactivator1{alpha} (PGC-1{alpha}) are regulators of energy metabolism. Here, we studied the role of alcohol consumption in expression of these sensing molecules. Alcohol significantly reduced hepatic SIRT1 mRNA by 50% and PGC-1{alpha} mRNA by 46% and it significantly inhibited the protein expression of SIRT1 and PGC-1{alpha}, while the transcription factor PPAR-{gamma} remained unchanged. However, when the lipid composition of the alcohol diet was changed by replacing long-chain triglycerides (LCT) with medium chain triglycerides (MCT), SIRT1 and PGC-1{alpha} mRNA were restored to near control levels. This study demonstrates that alcohol reduces key energy sensing proteins and that replacement of LCT by MCT affects the transcription of these genes. Since there is a pathophysiological link between SIRT1 and PGC-1{alpha} and mitochondrial energy, the implication of the study is that mitochondrial dysfunction due to alcohol abuse can be treated by dietary modifications.

  18. Mice lacking alpha 1 (IX) collagen develop noninflammatory degenerative joint disease.

    PubMed Central

    Fässler, R; Schnegelsberg, P N; Dausman, J; Shinya, T; Muragaki, Y; McCarthy, M T; Olsen, B R; Jaenisch, R

    1994-01-01

    Type IX collagen is a nonfibrillar collagen composed of three gene products, alpha 1(IX), alpha 2(IX), and alpha 3(IX). Type IX molecules are localized on the surface of type II-containing fibrils and consist of two arms, a long arm that is crosslinked to type II collagen and a short arm that projects into the perifibrillar space. In hyaline cartilage, the alpha 1(IX) collagen transcript encodes a polypeptide with a large N-terminal globular domain (NC4), whereas in many other tissues an alternative transcript encodes an alpha 1(IX) chain with a truncated NC4 domain. It has been proposed that type IX molecules are involved in the interaction of fibrils with each other or with other components of the extracellular matrix. To test this hypothesis, we have generated a mouse strain lacking both isoforms of the alpha 1(IX) chain. Homozygous mutant mice are viable and show no detectable abnormalities at birth but develop a severe degenerative joint disease resembling human osteoarthritis. Images PMID:8197187

  19. Interaction of cord factor (alpha, alpha'-trehalose-6,6'-dimycolate) with phospholipids.

    PubMed

    Crowe, L M; Spargo, B J; Ioneda, T; Beaman, B L; Crowe, J H

    1994-08-24

    We previously reported that cord factor (alpha,alpha'-trehalose-6,6'-dimycolate) isolated from Nocardia asteroides strain GUH-2 strongly inhibits fusion between unilamellar vesicles containing acidic phospholipid. We chose to study the effects of this molecule on liposome fusion since the presence of N. asteroides GUH-2 in the phagosomes of mouse macrophages had been shown to prevent phagosomal acidification and inhibit phagosome-lysosome fusion. A virtually non-virulent strain, N. asteroides 10905, does not prevent acidification or phagosome-lysosome fusion and, further, contains only trace amounts of cord factor. In the present paper, we have investigated the effects of cord factor on phospholipid bilayers that could be responsible for the inhibition of fusion. We show that cord factor increases molecular area, measured by isothermal compression of a monolayer film, in a mixed monolayer more than would be expected based in its individual contribution to molecular area. Cord factor, as well as other glycolipids investigated, increased the overall hydration of bilayers of dipalmitoylphosphatidylcholine by 50%, as estimated from the unfrozen water fraction measured by differential scanning calorimetry. The effect of calcium on this increased molecular area and headgroup hydration was measured by fluorescence anisotropy and FTIR spectroscopy of phosphatidylserine liposomes. Both techniques showed that cord factor, incorporated at 10 mol%, increased acyl chain disorder over controls in the presence of Ca2+. However, FTIR showed that cord factor did not prevent headgroup dehydration by the Ca2+. The other glycolipids tested did not prevent either the Ca(2+)-induced chain crystallization or headgroup dehydration of phosphatidylserine bilayers. These data point to a possible role of the bulky mycolic acids of cord factor in preventing Ca(2+)-induced fusion of liposomes containing acidic phospholipids. PMID:8075141

  20. Biosynthesis of open-chain tetrapyrroles in plants, algae, and cyanobacteria.

    PubMed

    Beale, S I

    1994-01-01

    Phycobilins are open-chain tetrapyrroles of plants and algae which act as the chromophores of phycobiliproteins where they function as light energy-harvesting pigments. Phytochromobilin, another open-chain tetrapyrrole, is the chromophore of phytochrome, which functions as a light-sensing pigment in plant development. These open-chain tetrapyrroles are biosynthetically derived from protohaem. Enzyme reactions that convert protohaem to biliverdin IX alpha, and biliverdin IX alpha to phycocyanobilin, have been detected and characterized in extracts of the unicellular rhodophyte Cyanidium caldarium. Algal haem oxygenase and algal biliverdin-IX alpha reductase are both soluble enzymes that use electrons derived from reduced ferredoxin. Biochemical intermediates in the conversion of biliverdin IX alpha to (3E)-phycocyanobilin were identified as 15, 16-dihydrobiliverdin IX alpha, (3Z)-phycoerythrobilin and (3Z)-phycocyanobilin. Separate enzymes catalyse the two two-electron reduction steps in the conversion of biliverdin IX alpha to (3Z)-phycoerythrobilin. Z-to-E isomerization of the phycobilin ethylidine group is catalysed by an enzyme that requires glutathione for activity. Protein-bound phycoerythrobilin can be chemically converted to phytochromobilin which can then be released from the protein by methanolysis. This procedure was used to produce phytochromobilin in quantities sufficient to allow its chemical characterization and use in phytochrome reconstitution experiments. The results indicate that (2R,3E)-phytochromobilin spontaneously condenses with recombinant oat apophytochrome to form photoreversible holoprotein that is spectrally identical to native phytochrome.

  1. Alpha-toxin of Staphylococcus aureus.

    PubMed Central

    Bhakdi, S; Tranum-Jensen, J

    1991-01-01

    Alpha-toxin, the major cytotoxic agent elaborated by Staphylococcus aureus, was the first bacterial exotoxin to be identified as a pore former. The protein is secreted as a single-chain, water-soluble molecule of Mr 33,000. At low concentrations (less than 100 nM), the toxin binds to as yet unidentified, high-affinity acceptor sites that have been detected on a variety of cells including rabbit erythrocytes, human platelets, monocytes and endothelial cells. At high concentrations, the toxin additionally binds via nonspecific absorption to lipid bilayers; it can thus damage both cells lacking significant numbers of the acceptor and protein-free artificial lipid bilayers. Membrane damage occurs in both cases after membrane-bound toxin molecules collide via lateral diffusion to form ring-structured hexamers. The latter insert spontaneously into the lipid bilayer to form discrete transmembrane pores of effective diameter 1 to 2 nm. A hypothetical model is advanced in which the pore is lined by amphiphilic beta-sheets, one surface of which interacts with lipids whereas the other repels apolar membrane constitutents to force open an aqueous passage. The detrimental effects of alpha-toxin are due not only to the death of susceptible targets, but also to the presence of secondary cellular reactions that can be triggered via Ca2+ influx through the pores. Well-studied phenomena include the stimulation of arachidonic acid metabolism, triggering of granule exocytosis, and contractile dysfunction. Such processes cause profound long-range disturbances such as development of pulmonary edema and promotion of blood coagulation.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1779933

  2. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  3. Structure, stability and folding of the alpha-helix.

    PubMed

    Doig, A J; Andrew, C D; Cochran, D A; Hughes, E; Penel, S; Sun, J K; Stapley, B J; Clarke, D T; Jones, G R

    2001-01-01

    Pauling first described the alpha-helix nearly 50 years ago, yet new features of its structure continue to be discovered, using peptide model systems, site-directed mutagenesis, advances in theory, the expansion of the Protein Data Bank and new experimental techniques. Helical peptides in solution form a vast number of structures, including fully helical, fully coiled and partly helical. To interpret peptide results quantitatively it is essential to use a helix/coil model that includes the stabilities of all these conformations. Our models now include terms for helix interiors, capping, side-chain interactions, N-termini and 3(10)-helices. The first three amino acids in a helix (N1, N2 and N3) and the preceding N-cap are unique, as their amide NH groups do not participate in backbone hydrogen bonding. We surveyed their structures in proteins and measured their amino acid preferences. The results are predominantly rationalized by hydrogen bonding to the free NH groups. Stabilizing side-chain-side-chain energies, including hydrophobic interactions, hydrogen bonding and polar/non-polar interactions, were measured accurately in helical peptides. Helices in proteins show a preference for having approximately an integral number of turns so that their N- and C-caps lie on the same side. There are also strong periodic trends in the likelihood of terminating a helix with a Schellman or alpha L C-cap motif. The kinetics of alpha-helix folding have been studied with stopped-flow deep ultraviolet circular dichroism using synchrotron radiation as the light source; this gives a far superior signal-to-noise ratio than a conventional instrument. We find that poly(Glu), poly(Lys) and alanine-based peptides fold in milliseconds, with longer peptides showing a transient overshoot in helix content.

  4. Supply chain quality.

    PubMed

    Feary, Simon

    2009-01-01

    As the development of complex manufacturing models and virtual companies become more prevalent in today's growing global markets, it is increasingly important to support the relationships between manufacturer and supplier. Utilising these relationships will ensure that supply chains operate more effectively and reduce costs, risks and time-to-market time frames, whilst maintaining product quality. PMID:20058652

  5. Supply chain management.

    PubMed

    Palevich, R F

    1999-02-01

    This article describes how Do It Best Corp. has used technology to improve its supply chain management. Among other topics it discusses the company's use of electronic data interchange, the Internet, electronic forecasting, and warehouse management systems to gain substantial savings and increase its competitiveness. PMID:10345634

  6. Breaking the Chains

    ERIC Educational Resources Information Center

    Stanistreet, Paul

    2007-01-01

    In 1792 more than 350,000 people in Britain signed a petition calling for an end to the slave trade. It was, writes historian Adam Hochschild in his book "Bury the Chains," "the first time in history that a large number of people became outraged, and stayed outraged for many years, over someone else's rights". In 1807--after 15 years of…

  7. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  8. INTERACTING QUANTUM SPIN CHAINS

    SciTech Connect

    ZHELUDEV,A.

    2001-09-09

    A brief review of recent advances in neutron scattering studies of low-dimensional quantum magnets is followed by a particular example. The separation of single-particle and continuum states in the weakly-coupled S = l/2 chains system BaCu{sub 2}Si{sub 2}O{sub 7} is described in some detail.

  9. Nodal-chain metals

    NASA Astrophysics Data System (ADS)

    Bzdušek, Tomáš; Wu, Quansheng; Rüegg, Andreas; Sigrist, Manfred; Soluyanov, Alexey A.

    2016-10-01

    The band theory of solids is arguably the most successful theory of condensed-matter physics, providing a description of the electronic energy levels in various materials. Electronic wavefunctions obtained from the band theory enable a topological characterization of metals for which the electronic spectrum may host robust, topologically protected, fermionic quasiparticles. Many of these quasiparticles are analogues of the elementary particles of the Standard Model, but others do not have a counterpart in relativistic high-energy theories. A complete list of possible quasiparticles in solids is lacking, even in the non-interacting case. Here we describe the possible existence of a hitherto unrecognized type of fermionic excitation in metals. This excitation forms a nodal chain—a chain of connected loops in momentum space—along which conduction and valence bands touch. We prove that the nodal chain is topologically distinct from previously reported excitations. We discuss the symmetry requirements for the appearance of this excitation and predict that it is realized in an existing material, iridium tetrafluoride (IrF4), as well as in other compounds of this class of materials. Using IrF4 as an example, we provide a discussion of the topological surface states associated with the nodal chain. We argue that the presence of the nodal-chain fermions will result in anomalous magnetotransport properties, distinct from those of materials exhibiting previously known excitations.

  10. Atwood's Heavy Chain

    ERIC Educational Resources Information Center

    Beeken, Paul

    2011-01-01

    While perusing various websites in search of a more challenging lab for my students, I came across a number of ideas where replacing the string in an Atwood's machine with a simple ball chain like the kind found in lamp pulls created an interesting system to investigate. The replacement of the string produced a nice nonuniform acceleration, but…

  11. [Ligase chain reaction (LCR)].

    PubMed

    Yamanishi, K; Yasuno, H

    1993-06-01

    Ligase chain reaction (LCR) is a ligation-mediated amplification technique of a target DNA sequence using oligonucleotides and thermostable ligase. LCR is useful for the detection of known DNA sequences and point mutations in a limited amount of DNA. We introduce the principle, development, and protocol of this simple and convenient technique for DNA analysis.

  12. Exploration Supply Chain Simulation

    NASA Technical Reports Server (NTRS)

    2008-01-01

    The Exploration Supply Chain Simulation project was chartered by the NASA Exploration Systems Mission Directorate to develop a software tool, with proper data, to quantitatively analyze supply chains for future program planning. This tool is a discrete-event simulation that uses the basic supply chain concepts of planning, sourcing, making, delivering, and returning. This supply chain perspective is combined with other discrete or continuous simulation factors. Discrete resource events (such as launch or delivery reviews) are represented as organizational functional units. Continuous resources (such as civil service or contractor program functions) are defined as enabling functional units. Concepts of fixed and variable costs are included in the model to allow the discrete events to interact with cost calculations. The definition file is intrinsic to the model, but a blank start can be initiated at any time. The current definition file is an Orion Ares I crew launch vehicle. Parameters stretch from Kennedy Space Center across and into other program entities (Michaud Assembly Facility, Aliant Techsystems, Stennis Space Center, Johnson Space Center, etc.) though these will only gain detail as the file continues to evolve. The Orion Ares I file definition in the tool continues to evolve, and analysis from this tool is expected in 2008. This is the first application of such business-driven modeling to a NASA/government-- aerospace contractor endeavor.

  13. Biosynthesis and regulation of rat alpha 1-inhibitor3, a negative acute-phase reactant of the macroglobulin family.

    PubMed Central

    Geiger, T; Lamri, Y; Tran-Thi, T A; Gauthier, F; Feldmann, G; Decker, K; Heinrich, P C

    1987-01-01

    The biosynthesis of rat alpha 1-inhibitor3, a negative acute-phase reactant specifically found in rodents, was studied in vitro in a cell-free translation system from rabbit reticulocytes, in rat hepatocyte primary cultures and in vivo by immunocytochemistry using normal and turpentine-injected rats. By sucrose-gradient centrifugation and subsequent translation of the fractionated RNA in vitro it was found that the mRNA coding for alpha 1-inhibitor3 exhibited a size of about 28S. For the alpha 1-inhibitor3 translated in vitro an apparent Mr of 155,000 was determined. A continuous decrease in the level of alpha 1-inhibitor3 in serum during experimental inflammation induced by turpentine injection was demonstrated by means of quantitative 'rocket' immunoelectrophoresis. This result agrees with the observation by immunocytochemistry of a drastic decrease in alpha 1-inhibitor3 levels in hepatocytes 24 h after turpentine injection. At that time alpha 1-inhibitor3 is mainly located in the Golgi apparatus, whereas it is also present in the membranes of the rough and smooth endoplasmic reticulum when normal liver is used. All hepatocytes, but no other hepatic cells, contain alpha 1-inhibitor3. When hepatocyte primary cultures were labelled with [35S]methionine and alpha 1-inhibitor3 was immunoprecipitated from the hepatocyte medium and the supernatant of homogenized cells, two different forms of alpha 1-inhibitor3 were found. The intracellular form of alpha 1-inhibitor3, with an apparent Mr of 173,000, is characterized by oligosaccharide side chains of the high-mannose type. The form of alpha 1-inhibitor3 in the medium exhibited an Mr of 186,000 and carried carbohydrate side chains of the complex type. After labelling hepatocytes with radioactive sugars, [3H]mannose was found in both forms of alpha 1-inhibitor3, whereas [3H]fucose and [3H]galactose were incorporated only into the form found in the medium. In the presence of tunicamycin an unglycosylated alpha 1-inhibitor3

  14. Structure and heterogeneity of the O-antigen chain of Salmonella Agona lipopolysaccharide.

    PubMed

    Szafranek, Janusz; Kumirska, Jolanta; Czerwicka, Małgorzata; Kunikowska, Danuta; Dziadziuszko, Halina; Głośnicka, Renata

    2006-11-01

    Lipopolysaccharide of Salmonella Agona smooth-type cells was obtained from bacteria by a hot phenol-water extraction procedure. Mild acid hydrolysis of lipopolysaccharide, followed by gel filtration, yielded the pure O-polysaccharide. Abequose, rhamnose, mannose, galactose and glucose in the molar ratio 0.8 : 1.0 : 1.0 : 1.1 : 0.5 were detected, and their linkages were established. Sugar configurations were determined by gas chromatography. Two repeating units, namely -->2)-[alpha-Abep-(1-->3)-]-alpha-d-Manp-(1-->4)-alpha-l-Rhap-(1-->3)-alpha-d-Galp-(1-->and -->2)-[alpha-Abep-(1-->3)-]-alpha-d-Manp-(1-->4)-alpha-l-Rhap-(1-->3)-[alpha-d-Glcp-(1-->4)-]-alpha-d-Galp-(1-->, were deduced from nuclear magnetic resonance studies. The effort to separate them was unsuccessful. An immunochemical test performed by means of Western blotting with anti O12 serum demonstrated that glucose was present in the longer lipopolysaccharide chains, at some distance from the core region.

  15. A sulfated alpha-L-fucan from sea cucumber.

    PubMed

    Ribeiro, A C; Vieira, R P; Mourão, P A; Mulloy, B

    1994-03-01

    A purified sulfated alpha-L-fucan from the sea cucumber body wall was studied, before and after almost complete desulfation, using methylation analysis and NMR spectroscopy. NMR analysis indicates that 2,4-di-O-sulfo-L-fucopyranose and unsubstituted fucopyranose are present in equal proportions, and that 2-O-sulfo-L-fucopyranose is present in twice that proportion. There is some NMR evidence that a regular repeating sequence of four residues comprises most or all of the polysaccharide chain. PMID:8181009

  16. The C-terminus of the {gamma}2 chain but not of the {beta}3 chain of laminin-332 is indirectly but indispensably necessary for integrin-mediated cell reactions

    SciTech Connect

    Navdaev, Alexei; Heitmann, Vanessa; Santana Evangelista, Karla de; Moergelin, Matthias; Wegener, Joachim; Eble, Johannes A.

    2008-02-01

    Using a recombinant mini-laminin-332, we showed that truncation of the three C-terminal amino acids of the {gamma}2 chain, but not of the C-terminal amino acid of the {beta}3 chain, completely abolished {alpha}3{beta}1 integrin binding and its cellular functions, such as attachment and spreading. However, a synthetic peptide mimicking the {gamma}2 chain C-terminus did not interfere with {alpha}3{beta}1 integrin binding or cell adhesion and spreading on laminin-332 as measured by protein interaction assays and electric cell-substrate impedance sensing. Nor was the soluble peptide able to restore the loss of integrin-mediated cell adhesiveness to mini-laminin-332 after deletion of the {gamma}2 chain C-terminus. These findings spoke against the hypothesis that the {gamma}2 chain C-terminus of laminin-332 is a part of the {alpha}3{beta}1 integrin interaction site. In addition, structural studies with electron microscopy showed that truncation of the {gamma}2 chain C-terminus opened up the compact supradomain structure of LG1-3 domains. Thus, by inducing or stabilizing an integrin binding-competent conformation or array of the LG1-3 domains, the {gamma}2 chain C-terminus plays an indirect but essential role in laminin-332 recognition by {alpha}3{beta}1 integrin and, hence, its cellular functions.

  17. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  18. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  19. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  20. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  1. Synthesis and evaluation of new omega-borono-alpha-amino acids as rat liver arginase inhibitors.

    PubMed

    Busnel, Olivier; Carreaux, François; Carboni, Bertrand; Pethe, Stephanie; Goff, Sandrine Vadon-Le; Mansuy, Daniel; Boucher, Jean-Luc

    2005-04-01

    Recent studies have demonstrated that arginase plays important roles in pathologies such as asthma or erectile dysfunctions. We have synthesized new omega-borono-alpha-amino acids that are analogues of the previously known arginase inhibitors S-(2-boronoethyl)-l-cysteine (BEC) and 2-amino-6-boronohexanoic acid (ABH) and evaluated them as inhibitors of purified rat liver arginase (RLA). In addition to the distance between the B(OH)(2) and the alpha-amino acid functions, the position of the sulfur atom in the side chain also appears as a key determinant for the interaction with the active site of RLA. Furthermore, substitution of the alkyl side chain of BEC by methyl groups and conformational restriction of ABH by incorporation of its side chain in a phenyl ring led to inactive compounds. These results suggest that subtle interactions govern the affinity of inhibitors for the active site of RLA.

  2. Acetylcholine receptor gating: movement in the alpha-subunit extracellular domain.

    PubMed

    Purohit, Prasad; Auerbach, Anthony

    2007-12-01

    Acetylcholine receptor channel gating is a brownian conformational cascade in which nanometer-sized domains ("Phi blocks") move in staggering sequence to link an affinity change at the transmitter binding sites with a conductance change in the pore. In the alpha-subunit, the first Phi-block to move during channel opening is comprised of residues near the transmitter binding site and the second is comprised of residues near the base of the extracellular domain. We used the rate constants estimated from single-channel currents to infer the gating dynamics of Y127 and K145, in the inner and outer sheet of the beta-core of the alpha-subunit. Y127 is at the boundary between the first and second Phi blocks, at a subunit interface. alphaY127 mutations cause large changes in the gating equilibrium constant and with a characteristic Phi-value (Phi = 0.77) that places this residue in the second Phi-block. We also examined the effect on gating of mutations in neighboring residues deltaI43 (Phi = 0.86), epsilonN39 (complex kinetics), alphaI49 (no effect) and in residues that are homologous to alphaY127 on the epsilon, beta, and delta subunits (no effect). The extent to which alphaY127 gating motions are coupled to its neighbors was estimated by measuring the kinetic and equilibrium constants of constructs having mutations in alphaY127 (in both alpha subunits) plus residues alphaD97 or deltaI43. The magnitude of the coupling between alphaD97 and alphaY127 depended on the alphaY127 side chain and was small for both H (0.53 kcal/mol) and C (-0.37 kcal/mol) substitutions. The coupling across the single alpha-delta subunit boundary was larger (0.84 kcal/mol). The Phi-value for K145 (0.96) indicates that its gating motion is correlated temporally with the motions of residues in the first Phi-block and is not synchronous with those of alphaY127. This suggests that the inner and outer sheets of the alpha-subunit beta-core do not rotate as a rigid body.

  3. Flexible chains of ferromagnetic nanoparticles.

    PubMed

    Townsend, James; Burtovyy, Ruslan; Galabura, Yuriy; Luzinov, Igor

    2014-07-22

    We report the fabrication of flexible chains of ferromagnetic Ni nanoparticles that possess the ability to adapt other than the typically observed rigid (nearly) straight configurations in the absence of an external magnetic field. The dynamic mobility of the ferromagnetic chains originates from a layer of densely grafted polyethylene glycol macromolecules enveloping each nanoparticle in the chain. While ferromagnetic chains of unmodified Ni nanoparticles behave as stiff nickel nanorods, the chains made of the grafted nanoparticles demonstrate extreme flexibility. Upon changing the direction of the field, and inevitably going through a zero-field point, the shorter chains undergo chain-globule-chain transformation. The longer chains can bend to a high degree, attaining "snake-like" configurations.

  4. Photoreduction of alkylmethylviologens with {alpha}-tocopherol in dioctadecyldimethylammonium chloride vesicles

    SciTech Connect

    Sakaguchi, M.; Baglioni, P.; Kevan, L.

    1992-03-19

    Electron spin resonance (ESR) spectroscopy is used to detect the photoreduction yield of alkylmethylviologens (AV{sup 2+}) in rapidly frozen dioctadecyldimethylammonium chloride (DODAC) vesicles containing concentrations of {alpha}-tocopherol (major component of vitamin E) from 0 to 23 mol %. The observed radicals are alkylmethylviologen cation radicals (AV{sup +}) from photoirradiated AV{sup 2+} in DODAC vesicles without {alpha}-tocopherol. For 1-3 mol % {alpha}-tocopherol, the major radical is AV{sup +} and the minor radical is a neutral free radical of {alpha}-tocopherol (EO) which is formed by photoinduced conversion from the {alpha}-tocopherol cation radical (EH{sup +}) with DODAC vesicles acting as proton scavengers. The total ESR intensity increases with an increase of the alkyl chain length of AV{sup 2+}. The AV{sup +} intensity increases slightly with increasing {alpha}-tocopherol concentration. For over 9 mol % {alpha}-tocopherol, the major radical becomes EO, and at 17 mol % EO alone is observed. This is explained by acceleration of the photoreduction of AV{sup 2+} to AV{sup +} by electrons released from {alpha}-tocopherol and further photoreduction of AV{sup +} to AV, which is not detected by ESR spectroscopy. The photoyield for 23 mol % {alpha}-tocopherol in DODAC vesicles without AV{sup 2+} is about 2-fold more than that in hexane solution. This enhancement of photoyield suggests that DODAC may act as a proton scavenger and compartmentalize {alpha}-tocopherol to minimize back electron reaction. 26 refs., 8 figs.

  5. Flow cytometric analysis of expression of interleukin-2 receptor beta chain (p70-75) on various leukemic cells

    SciTech Connect

    Hoshino, S.; Oshimi, K.; Tsudo, M.; Miyasaka, M.; Teramura, M.; Masuda, M.; Motoji, T.; Mizoguchi, H. )

    1990-08-15

    We analyzed the expression of the interleukin-2 receptor (IL-2R) beta chain (p70-75) on various leukemic cells from 44 patients by flow cytometric analysis using the IL-2R beta chain-specific monoclonal antibody, designated Mik-beta 1. Flow cytometric analysis demonstrated the expression of the IL-2R beta chain on granular lymphocytes (GLs) from all eight patients with granular lymphocyte proliferative disorders (GLPDs), on adult T-cell leukemia (ATL) cells from all three patients with ATL, and on T-cell acute lymphoblastic leukemia (T-ALL) cells from one of three patients with T-ALL. Although GLs from all the GLPD patients expressed the IL-2R beta chain alone and not the IL-2R alpha chain (Tac-antigen: p55), ATL and T-ALL cells expressing the beta chain coexpressed the alpha chain. In two of seven patients with common ALL (cALL) and in both patients with B-cell chronic lymphocytic leukemia, the leukemic cells expressed the alpha chain alone. Neither the alpha chain nor the beta chain was expressed on leukemic cells from the remaining 28 patients, including all 18 patients with acute nonlymphocytic leukemia, five of seven patients with cALL, all three patients with multiple myeloma, and two of three patients with T-ALL. These results indicate that three different forms of IL-2R chain expression exist on leukemic cells: the alpha chain alone; the beta chain alone; and both the alpha and beta chains. To examine whether the results obtained by flow cytometric analysis actually reflect functional aspects of the expressed IL-2Rs, we studied the specific binding of 125I-labeled IL-2 (125I-IL-2) to leukemic cells in 18 of the 44 patients. In addition, we performed 125I-IL-2 crosslinking studies in seven patients. The results of IL-2R expression of both 125I-IL-2 binding assay and crosslinking studies were in agreement with those obtained by flow cytometric analysis.

  6. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  7. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  8. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  9. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  10. Phage P4 alpha protein is multifunctional with origin recognition, helicase and primase activities.

    PubMed Central

    Ziegelin, G; Scherzinger, E; Lurz, R; Lanka, E

    1993-01-01

    alpha Protein of satellite phage P4 of Escherichia coli is multifunctional in P4 replication with three activities. First, the protein (subunit M(r) = 84,900) complexes specifically the P4 origin and the cis replication region required for replication. alpha Protein interacts with all six type I repeats (TGTTCACC) present in the origin. Second, associated with the alpha protein is a DNA helicase activity that is fueled by hydrolysis of a nucleoside 5' triphosphate. All common NTPs except UTP and dTTP can serve as cofactors. Strand separation of partial duplexes containing tailed ends that resemble a replication fork is preferred, although a preformed fork is not absolutely required for the enzyme to invade and unwind duplex DNA. alpha Protein catalyzes unwinding in the 3'-5' direction with respect to the strand it has bound. Finally, the primase activity already demonstrated for alpha protein is due to synthesis of RNA primers. In vitro, alpha protein generates di- to pentaribonucleotides on single-stranded phage fd DNA. The predominant product is the dimer pppApG, on which most of the longer oligoribonucleotides are based. Using DNA oligonucleotides of defined sequence as templates, synthesis of pppApG was also detectable. To date, among prokaryotic and eukaryotic replication systems, gp alpha is the only protein known that combines three activities on one single polypeptide chain. Images PMID:8253092

  11. Role of the alpha-amino group of protein in ubiquitin-mediated protein breakdown.

    PubMed Central

    Hershko, A; Heller, H; Eytan, E; Kaklij, G; Rose, I A

    1984-01-01

    Previous studies suggest that the conjugation of ubiquitin to NH2 groups of proteins is required for protein breakdown. We now show that the selective modification of NH2-terminal alpha-NH2 groups of globin and lysozyme prevents their degradation by the ubiquitin proteolytic system from reticulocytes. The conjugation by ubiquitin of epsilon-NH2 groups of lysine residues, usually seen in multiples, was also inhibited in alpha-NH2-blocked proteins. Naturally occurring N alpha-acetylated proteins are not degraded by the ubiquitin system at a significant rate, while their nonacetylated counterparts from other species are good substrates. This suggests that one function of N alpha-acetylation of cellular proteins is to prevent their degradation by the ubiquitin system. alpha-NH2-blocked proteins can have their activity as substrates for degradation increased by incorporation of alpha-NH2 groups through the introduction of polyalanine side chains. Proteins in which most epsilon-NH2 groups are blocked but the alpha-NH2 group is free are degraded by the ubiquitin system, but at a reduced rate. It is therefore suggested that the exposure of a free NH2 terminus of proteins is required for degradation and probably initiates the formation of ubiquitin conjugates committed for degradation. Images PMID:6095265

  12. Comparison of nonerythroid alpha-spectrin genes reveals strict homology among diverse species.

    PubMed Central

    Leto, T L; Fortugno-Erikson, D; Barton, D; Yang-Feng, T L; Francke, U; Harris, A S; Morrow, J S; Marchesi, V T; Benz, E J

    1988-01-01

    The spectrins are a family of widely distributed filamentous proteins. In association with actin, spectrins form a supporting and organizing scaffold for cell membranes. Using antibodies specific for human brain alpha-spectrin (alpha-fodrin), we have cloned a rat brain alpha-spectrin cDNA from an expression library. Several closely related human clones were also isolated by hybridization. Comparison of sequences of these and other overlapping nonerythroid and erythroid alpha-spectrin genes demonstrated that the nonerythroid genes are strictly conserved across species, while the mammalian erythroid genes have diverged rapidly. Peptide sequences deduced from these cDNAs revealed that the nonerythroid alpha-spectrin chain, like the erythroid spectrin, is composed of multiple 106-amino-acid repeating units, with the characteristic invariant tryptophan as well as other charged and hydrophobic residues in conserved locations. However, the carboxy-terminal sequence varies markedly from this internal repeat pattern and may represent a specialized functional site. The nonerythroid alpha-spectrin gene was mapped to human chromosome 9, in contrast to the erythroid alpha-spectrin gene, which has previously been assigned to a locus on chromosome 1. Images PMID:3336352

  13. Perioperative supply chain management.

    PubMed

    Feistritzer, N R; Keck, B R

    2000-09-01

    Faced with declining revenues and increasing operating expenses, hospitals are evaluating numerous mechanisms designed to reduce costs while simultaneously maintaining quality care. Many facilities have targeted initial cost reduction efforts in the reduction of labor expenses. Once labor expenses have been "right sized," facilities have continued to focus on service delivery improvements by the optimization of the "supply chain" process. This report presents a case study of the efforts of Vanderbilt University Medical Center in the redesign of its supply chain management process in the department of Perioperative Services. Utilizing a multidisciplinary project management structure, 3 work teams were established to complete the redesign process. To date, the project has reduced costs by $2.3 million and enhanced quality patient care by enhancing the delivery of appropriate clinical supplies during the perioperative experience.

  14. Differential expression of laminin isoforms and alpha 6-beta 4 integrin subunits in the developing human and mouse intestine.

    PubMed

    Simon-Assmann, P; Duclos, B; Orian-Rousseau, V; Arnold, C; Mathelin, C; Engvall, E; Kedinger, M

    1994-09-01

    The intestinal tissue is characterized by important morphogenetic movements during development as well as by a continuous dynamic crypt to villus epithelial cell migration leading to differentiation of specialized cells. In this study, we have examined the spatio-temporal distribution of laminin A and M chains as well as of alpha 6 and beta 4 integrin subunits in adult and developing human and mouse intestine by indirect immunofluorescence. Selective expression of the constituent polypeptides of laminin isoforms (A and M chains) was demonstrated. In the mature human intestine, A and M chains were found to be complementary, the M chain being restricted to the base of crypts and the A chain lining the villus basement membrane. In the developing human intestine, M chain expression was delayed as compared to that of A chain; as soon as the M chain was visualized, it exhibited the typical localization in the crypt basement membrane. A somewhat different situation was found in the adult mouse intestine, since both M and A chains were found in the crypts. During mouse intestinal development the delayed expression of the M chain as compared to that of the A chain was also obvious. The absence of M chain expression in mutant dy mouse did not impair intestinal morphogenesis nor cell differentiation. The expression of alpha 6 and beta 4 subunits was not coordinated. In both species the alpha 6 expression preceded that of beta 4. Furthermore, while beta 4 staining in adult mouse intestine was detected at the basal surface of all cells lining the crypt-villus, that of alpha 6 was mainly confined to the crypt cell compartment. An overall similarity of location between alpha 6 integrin subunit and laminin A chain at the epithelial/stromal interface was noted. These data indicate that the spatial and temporal distribution of laminin variants in the developing intestine may be characteristic for each species and that interactions of laminin variants with particular receptors may be

  15. Engineered Ionizable Side Chains.

    PubMed

    Cymes, Gisela D; Grosman, Claudio

    2015-01-01

    One of the great challenges of mechanistic ion-channel biology is to obtain structural information from well-defined functional states. In the case of neurotransmitter-gated ion channels, the open-channel conformation is particularly elusive owing to its transient nature and brief mean lifetime. In this Chapter, we show how the analysis of single-channel currents recorded from mutants engineered to contain single ionizable side chains in the transmembrane region can provide specific information about the open-channel conformation without any interference from the closed or desensitized conformations. The method takes advantage of the fact that the alternate binding and unbinding of protons to and from an ionizable side chain causes the charge of the protein to fluctuate by 1 unit. We show that, in mutant muscle acetylcholine nicotinic receptors (AChRs), this fluctuating charge affects the rate of ion conduction in such a way that individual proton-transfer events can be identified in a most straightforward manner. From the extent to which the single-channel current amplitude is reduced every time a proton binds, we can learn about the proximity of the engineered side chain to the lumen of the pore. And from the kinetics of proton binding and unbinding, we can calculate the side-chain's affinity for protons (pK a), and hence, we can learn about the electrostatic properties of the microenvironment around the introduced ionizable group. The application of this method to systematically mutated AChRs allowed us to identify unambiguously the stripes of the M1, M2 and M3 transmembrane α-helices that face the pore's lumen in the open-channel conformation in the context of a native membrane. PMID:26381938

  16. Callisto Crater Chain Mosaic

    NASA Technical Reports Server (NTRS)

    1997-01-01

    This mosaic of three images shows an area within the Valhalla region on Jupiter's moon, Callisto. North is to the top of the mosaic and the Sun illuminates the surface from the left. The smallest details that can be discerned in this picture are knobs and small impact craters about 160 meters (175 yards) across. The mosaic covers an area approximately 45 kilometers (28 miles) across. It shows part of a prominent crater chain located on the northern part of the Valhalla ring structure.

    Crater chains can form from the impact of material ejected from large impacts (forming secondary chains) or by the impact of a fragmented projectile, perhaps similar to the Shoemaker-Levy 9 cometary impacts into Jupiter in July 1994. It is believed this crater chain was formed by the impact of a fragmented projectile. The images which form this mosaic were obtained by the solid state imaging system aboard NASA's Galileo spacecraft on Nov. 4, 1996 (Universal Time).

    Launched in October 1989, Galileo entered orbit around Jupiter on December 7, 1995. The spacecraft's mission is to conduct detailed studies of the giant planet, its largest moons and the Jovian magnetic environment. The Jet Propulsion Laboratory, Pasadena, CA manages the mission for NASA's Office of Space Science, Washington, DC.

    This image and other images and data received from Galileo are posted on the World Wide Web Galileo mission home page at http://galileo.jpl.nasa.gov. Background information and educational context for the images can be found at http:// www.jpl.nasa.gov/galileo/sepo.

  17. The innovation value chain.

    PubMed

    Hansen, Morten T; Birkinshaw, Julian

    2007-06-01

    The challenges of coming up with fresh ideas and realizing profits from them are different for every company. One firm may excel at finding good ideas but may have weak systems for bringing them to market. Another organization may have a terrific process for funding and rolling out new products and services but a shortage of concepts to develop. In this article, Hansen and Birkinshaw caution executives against using the latest and greatest innovation approaches and tools without understanding the unique deficiencies in their companies' innovation systems. They offer a framework for evaluating innovation performance: the innovation value chain. It comprises the three main phases of innovation (idea generation, conversion, and diffusion) as well as the critical activities performed during those phases (looking for ideas inside your unit; looking for them in other units; looking for them externally; selecting ideas; funding them; and promoting and spreading ideas companywide). Using this framework, managers get an end-to-end view of their innovation efforts. They can pinpoint their weakest links and tailor innovation best practices appropriately to strengthen those links. Companies typically succumb to one of three broad "weakest-link" scenarios. They are idea poor, conversion poor, or diffusion poor. The article looks at the ways smart companies - including Intuit, P&G, Sara Lee, Shell, and Siemens- modify the best innovation practices and apply them to address those organizations' individual needs and flaws. The authors warn that adopting the chain-based view of innovation requires new measures of what can be delivered by each link in the chain. The approach also entails new roles for employees "external scouts" and "internal evangelists," for example. Indeed, in their search for new hires, companies should seek out those candidates who can help address particular weaknesses in the innovation value chain. PMID:17580654

  18. The innovation value chain.

    PubMed

    Hansen, Morten T; Birkinshaw, Julian

    2007-06-01

    The challenges of coming up with fresh ideas and realizing profits from them are different for every company. One firm may excel at finding good ideas but may have weak systems for bringing them to market. Another organization may have a terrific process for funding and rolling out new products and services but a shortage of concepts to develop. In this article, Hansen and Birkinshaw caution executives against using the latest and greatest innovation approaches and tools without understanding the unique deficiencies in their companies' innovation systems. They offer a framework for evaluating innovation performance: the innovation value chain. It comprises the three main phases of innovation (idea generation, conversion, and diffusion) as well as the critical activities performed during those phases (looking for ideas inside your unit; looking for them in other units; looking for them externally; selecting ideas; funding them; and promoting and spreading ideas companywide). Using this framework, managers get an end-to-end view of their innovation efforts. They can pinpoint their weakest links and tailor innovation best practices appropriately to strengthen those links. Companies typically succumb to one of three broad "weakest-link" scenarios. They are idea poor, conversion poor, or diffusion poor. The article looks at the ways smart companies - including Intuit, P&G, Sara Lee, Shell, and Siemens- modify the best innovation practices and apply them to address those organizations' individual needs and flaws. The authors warn that adopting the chain-based view of innovation requires new measures of what can be delivered by each link in the chain. The approach also entails new roles for employees "external scouts" and "internal evangelists," for example. Indeed, in their search for new hires, companies should seek out those candidates who can help address particular weaknesses in the innovation value chain.

  19. Streamlining the supply chain.

    PubMed

    Neumann, Lydon

    2003-07-01

    Effective management of the supply chain requires attention to: Product management--formulary development and maintenance, compliance, clinical involvement, standardization, and demand-matching. Sourcing and contracting--vendor consolidation, GPO portfolio management, price leveling, content management, and direct contracting Purchasing and payment-cycle--automatic placement, web enablement, centralization, evaluated receipts settlement, and invoice matching Inventory and distribution management--"unofficial" and "official" locations, vendor-managed inventory, automatic replenishment, and freight management.

  20. Streamlining the supply chain.

    PubMed

    Neumann, Lydon

    2003-07-01

    Effective management of the supply chain requires attention to: Product management--formulary development and maintenance, compliance, clinical involvement, standardization, and demand-matching. Sourcing and contracting--vendor consolidation, GPO portfolio management, price leveling, content management, and direct contracting Purchasing and payment-cycle--automatic placement, web enablement, centralization, evaluated receipts settlement, and invoice matching Inventory and distribution management--"unofficial" and "official" locations, vendor-managed inventory, automatic replenishment, and freight management. PMID:12866156

  1. Alpha-Ketoglutarate and intestinal function.

    PubMed

    Hou, Yongqing; Wang, Lei; Ding, Binying; Liu, Yulan; Zhu, Huiling; Liu, Jian; Li, Yongtang; Kang, Ping; Yin, Yulong; Wu, Guoyao

    2011-01-01

    Alpha-ketoglutarate (AKG) is an intermediate of the Krebs cycle which bridges amino acid metabolism with glucose oxidation in animals. Of particular interest is the conversion of AKG into glutamate by mitochondrial glutamate dehydrogenase in the gastrointestinal tract where glutamate has multiple physiological functions (including regulation of cell function, neurotransmission, and gastric emptying). Additionally, AKG stimulates the initiation of catabolism of branched-chain amino acids (BCAA) via BCAA transaminase in enterocytes. Oxidation of AKG also provides large amounts of ATP and modulates cellular redox state in the small intestine. Translating the basic research into practice, results of recent studies indicate that dietary supplementation with AKG alleviates oxidative stress and injury in intestinal mucosal cells, while improving intestinal mucosal integrity and absorption of nutrients in endotoxin-challenged pigs. The beneficial effects of AKG are associated with increased activation of the mTOR signaling pathway and net protein synthesis. Thus, AKG is a novel and promising supplement in diets to improve intestinal health in animals and possibly humans. PMID:21196226

  2. Amino acids of the Torpedo marmorata acetylcholine receptor. cap alpha. subunit labeled by a photoaffinity ligand for the acetylcholine binding site

    SciTech Connect

    Dennis, M.; Giraudat, J.; Kotzyba-Hibert, F.; Goeldner, M.; Hirth, C.; Chang, J.Y.; Lazure, C.; Chretien, M.; Changeux, J.P.

    1988-04-05

    The acetylcholine-binding sites on the native, membrane-bound acetylcholine receptor from Torpedo marmorata were covalently labeled with the photoaffinity reagent (/sup 3/H)-p-(dimethylamino)-benzenediazonium fluoroborate (DDF) in the presence of phencyclidine by employing an energy-transfer photolysis procedure. The ..cap alpha..-chains isolated from receptor-rich membranes photolabeled in the absence or presence of carbamoylcholine were cleaved with CNBr and the radiolabeled fragments purified by high-performance liquid chromatography. Amino acid and/or sequence analysis demonstrated that the ..cap alpha..-chain residues Trp-149, Tyr-190, Cys-192, and Cys-193 and an unidentified residue(s) in the segment ..cap alpha.. 31-105 were all labeled by the photoaffinity reagent in an agonist-protectable manner. The labeled amino acids are located within three distinct regions of the large amino-terminal hydrophilic domain of the ..cap alpha..-subunit primary structure and plausibly lie in proximity to one another at the level of the acetylcholine-binding sites in the native receptor. These findings are in accord with models proposed for the transmembrane topology of the ..cap alpha..-chain that assign the amino-terminal segment ..cap alpha.. 1-210 to the synaptic cleft. Furthermore, the results suggest that the four identified (/sup 3/H)DDF-labeled resides, which are conserved in muscle and neuronal ..cap alpha..-chains but not in the other subunits, may be directly involved in agonist binding.

  3. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  4. Effects of surfactants on morphology in synthesis of {alpha}-Mn{sub 2}O{sub 3} nanostructures

    SciTech Connect

    Ramarajan, D.; Sivagurunathan, P.

    2011-03-15

    Cubic and chain-like structure of {alpha}-Mn{sub 2}O{sub 3} with a high surface area was prepared by air oxidation of manganese chloride through sol process by adding hexamine and mercaptosuccinic acid as wetting agent, respectively. The as-synthesized products were characterized with X-ray powder diffraction (XRD), Energy Dispersive X-ray spectroscopy (EDX), transmission electron microscope (TEM), and selected area electron diffraction (SAED). The possible formation mechanism of {alpha}-Mn{sub 2}O{sub 3} cubic and chain-like nanostructures has been proposed and discussed. -- Graphical abstract: Cubic and chain-like nanostructure of {alpha}-Mn{sub 2}O{sub 3} has been synthesized by air oxidation of manganese chloride as precursor, hexamine, and mercaptosuccinic acid as wetting agent, respectively. Display Omitted Research highlights: {yields} Cubic nanostructure of {alpha}-Mn{sub 2}O{sub 3} is obtained using hexamine as surfactant. {yields} Chain-like structure of {alpha}-Mn{sub 2}O{sub 3} is obtained using mercaptosuccinic acid as surfactant. {yields} The linking nature of mercaptosuccinic acid is proved. {yields} Mercaptosuccinic acid accelerates the growth of material.

  5. Antibody-mediated neutralization and binding-reversal studies on alpha-neurotoxins from Micrurus nigrocinctus nigrocinctus (coral snake) venom.

    PubMed

    Alape-Giron, A; Stiles, B G; Gutierrez, J M

    1996-03-01

    An ELISA based, non-radioactive acetylcholine receptor (AchR) binding assay was used to detect the alpha-neurotoxins present in Micrurus nigrocinctus nigrocinctus venom. Sera from horses hyperimmunized against M. nigrocinctus venom contain antibodies which inhibit the binding of M. n. nigrocinctus alpha-neurotoxins to AchR and reverse the binding of toxins already complexed with the receptor. This result supports the importance of using antivenom therapeutically in M. n. nigrocinctus envenomations even after the onset of neurological symptoms. M. nigrocinctus antivenoms cross-reacted in an ELISA with several elapid alpha-neurotoxins and inhibited the binding of Bungarus multicinctus alpha-bungarotoxin and Naja naja oxiana neurotoxin II to AchR in vitro, suggesting the presence of short-chain and long-chain alpha-neurotoxins in M. nigrocinctus venom. In vivo neutralization experiments with M. nigrocinctus antivenom demonstrate that M. nigrocinctus venom contains short-chain alpha-neurotoxin(s) which share common neutralizing epitope(s) with Naja naja oxiana neurotoxin II.

  6. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  7. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  8. Rescue of type I collagen-deficient phenotype by retroviral-vector-mediated transfer of human pro alpha 1(I) collagen gene into Mov-13 cells.

    PubMed Central

    Stacey, A; Mulligan, R; Jaenisch, R

    1987-01-01

    A full-length cDNA clone corresponding to the human pro alpha 1(I) collagen gene was isolated and inserted into a retrovirus vector. Cell lines were obtained which produced recombinant viruses transducing the collagen cDNA (HUC virus). To test whether the transduced cDNA was functional, Mov-13 mouse cells were infected with the virus. These cells do not produce any type I collagen due to an insertional mutation of the pro alpha 1(I) gene which blocks transcription. While normal amounts of pro alpha 2(I) RNA were synthesized, no alpha 2(I) collagen chains were detectable in the mutant Mov-13 cells. Infection with HUC virus, however, resulted in the production of stable type I collagen, which was secreted into the medium. Analysis of pepsin-resistant proteins indicated that interspecies heterotrimers consisting of human alpha 1(I) and mouse alpha 2(I) collagen chains were secreted by the infected Mov-13 cells. Our results show that pro alpha (I) collagen chains from species as distant as human and mouse can associate to form stable type I collagen. The availability of a retrovirus vector transducing a functional pro alpha 1(I) collagen gene combined with the Mov-13 mutant system should enable us to study the effect of specific mutations on the synthesis, assembly, and function of type I collagen, not only in tissue culture but also in the animal. Images PMID:3599181

  9. Tumor necrosis factor-alpha and ceramides in insulin resistance.

    PubMed

    Brindley, D N; Wang, C N; Mei, J; Xu, J; Hanna, A N

    1999-01-01

    The present studies tested the hypothesis that some effects of tumor necrosis factor-alpha (TNF-alpha) are mediated by activation of sphingomyelinases and the production of ceramides. Differentiated 3T3-L1 adipocytes were incubated with short-chain ceramide analogs, (C2- and C6-ceramides: N-acetyl- and N-hexanoyl-sphingosines, respectively), and this treatment increased 2-deoxyglucose uptake in the absence of insulin progressively from 2-24 h. This effect was inhibited by blocking the activations of mitogen-activated protein kinase, phosphatidylinositol 3-kinase (PI 3-kinase), and ribosomal S6 kinase which mediated an increase in GLUT1 concentrations. Long-term increases in PI 3-kinase activity associated with insulin receptor substrate-1 (IRS-1) increased the proportion of GLUT1 and GLUT4 in plasma membranes. These events explain the increases in noninsulin-dependent glucose uptake and incorporation of this glucose into the fatty acid and glycerol moieties of triacylglycerol. The mechanisms by which TNF-alpha and ceramides increase PI 3-kinase activity were investigated further by using rat2 fibroblasts. Incubation for 20 min with TNF-alpha, bacterial sphingomyelinase, or C2-ceramides increased PI 3-kinase activity by about fivefold, and this effect depended upon a stimulation of tyrosine kinase activity and an increase in Ras-GTP. This demonstrates the existence of a novel signaling pathway for TNF-alpha that could contribute to the effects of this cytokine in stimulating basal glucose uptake. By contrast, treating the 3T3-L1 adipocytes for 2-24 h with C2-ceramide diminished insulin-stimulated glucose uptake by decreasing the insulin-induced translocation of GLUT1 and GLUT4 to plasma membranes. This inhibition was observed when there was no increase in basal glucose uptake, and it occurred downstream of PI 3-kinase. Our work provides further mechanisms whereby TNF-alpha and ceramides produce insulin resistance and decrease the effectiveness of insulin in

  10. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  11. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  12. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  13. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  14. Introduction of all-hydrocarbon i,i+3 staples into alpha-helices via ring-closing olefin metathesis.

    PubMed

    Kim, Young-Woo; Kutchukian, Peter S; Verdine, Gregory L

    2010-07-01

    The introduction of all-hydrocarbon i,i+3 staples into alpha-helical peptide scaffolds via ring-closing olefin metathesis (RCM) between two alpha-methyl,alpha-pentenylglycine residues incorporated at i and i+3 positions, which lie on the same face of the helix, has been investigated. The reactions were found to be highly dependent upon the side-chain stereochemistry of the amino acids undergoing RCM. The i,i+3 stapling system established here provides a potentially useful alternative to the well-established i,i+4 stapling system now in widespread use.

  15. Carbohydrate binding properties of banana (Musa acuminata) lectin I. Novel recognition of internal alpha1,3-linked glucosyl residues.

    PubMed

    Mo, H; Winter, H C; Van Damme, E J; Peumans, W J; Misaki, A; Goldstein, I J

    2001-05-01

    Examination of lectins of banana (Musa acuminata) and the closely related plantain (Musa spp.) by the techniques of quantitative precipitation, hapten inhibition of precipitation, and isothermal titration calorimetry showed that they are mannose/glucose binding proteins with a preference for the alpha-anomeric form of these sugars. Both generate precipitin curves with branched chain alpha-mannans (yeast mannans) and alpha-glucans (glycogens, dextrans, and starches), but not with linear alpha-glucans containing only alpha1,4- and alpha1,6-glucosidic bonds (isolichenan and pullulan). The novel observation was made that banana and plantain lectins recognize internal alpha1,3-linked glucosyl residues, which occur in the linear polysaccharides elsinan and nigeran. Concanavalin A and lectins from pea and lentil, also mannose/glucose binding lectins, did not precipitate with any of these linear alpha-glucans. This is, the authors believe, the first report of the recognition of internal alpha1,3-glucosidic bonds by a plant lectin. It is possible that these lectins are present in the pulp of their respective fruit, complexed with starch.

  16. Synthesis and processing of alpha-galactosidase A in human fibroblasts. Evidence for different mutations in Fabry disease.

    PubMed

    Lemansky, P; Bishop, D F; Desnick, R J; Hasilik, A; von Figura, K

    1987-02-15

    The synthesis and processing of the human lysosomal enzyme alpha-galactosidase A was examined in normal and Fabry fibroblasts. In normal cells, alpha-galactosidase A was synthesized as an Mr = 50,500 precursor, which contained phosphate groups in oligosaccharide chains cleavable by endoglucosaminidase H. The precursor was processed via ill-defined intermediates to a mature Mr 46,000 form. Processing was complete within 3-7 days after synthesis. In the presence of NH4Cl and in I-cell fibroblasts, the majority of newly synthesized alpha-galactosidase A was secreted as an Mr = 52,000 form. For comparison, the processing and stability of alpha-galactosidase A were examined in fibroblasts from five unrelated patients with Fabry disease, which is caused by deficient alpha-galactosidase A activity. In one cell line, synthesis of immunologically cross-reacting polypeptides was not detectable. In another, the synthesis, processing, and stability of alpha-galactosidase A was indistinguishable from that in normal fibroblasts. In a third Fabry cell line, the mutation retarded the maturation of alpha-galactosidase A. Finally, in two cell lines, alpha-galactosidase A polypeptides were synthesized that were rapidly degraded following delivery to lysosomes. These results clearly indicate that Fabry disease comprises a heterogeneous group of mutations affecting synthesis, processing, and stability of alpha-galactosidase A. PMID:3029062

  17. Central tolerance regulates B cells reactive with Goodpasture antigen alpha3(IV)NC1 collagen

    PubMed Central

    Zhang, Ying; Su, Susan C.; Hecox, Douglas B.; Brady, Graham F.; Mackin, Katherine M.; Clark, Amy G.; Foster, Mary H.

    2008-01-01

    Patients and rodents with Goodpasture’s syndrome (GPS) develop severe autoimmune crescentic glomerulonephritis, kidney failure, and lung hemorrhage due to binding of pathogenic autoantibodies to the NC1 domain of the alpha3 chain of type IV collagen. Target epitopes are cryptic, normally hidden from circulating antibodies by protein-protein interactions and the highly tissue-restricted expression of the alpha3(IV) collagen chain. Based on this limited antigen exposure, it has been suggested that target epitopes are not available as B cell tolerogens. To determine how pathogenic anti-GPS autoantibody responses are regulated, we generated an immunoglobulin (Ig) transgenic (Tg) mouse model that expresses an Ig that binds alpha3(IV)NC1 collagen epitopes recognized by serum IgG of patients with GPS. Phenotypic analysis reveals B cell depletion and light chain editing in Tg mice. To determine the default tolerance phenotype in the absence of receptor editing and endogenous lymphocyte populations, we crossed Tg mice two generations with mice deficient in recombinase activating gene (Rag). Resulting Tg Rag-deficient mice have central B cell deletion. Thus development of Tg anti-alpha3(IV)NC1 collagen B cells is halted in the bone marrow, at which point the cells are deleted unless rescued by a Rag enzyme-dependent process, such as editing. The central tolerance phenotype implies that tolerizing self antigen is expressed in bone marrow. PMID:18941198

  18. Theoretical and experimental {alpha} decay half-lives of the heaviest odd-Z elements and general predictions

    SciTech Connect

    Zhang, H. F.; Royer, G.

    2007-10-15

    Theoretical {alpha} decay half-lives of the heaviest odd-Z nuclei are calculated using the experimental Q{sub {alpha}} value. The barriers in the quasimolecular shape path are determined within a Generalized Liquid Drop Model (GLDM) and the WKB approximation is used. The results are compared with calculations using the Density-Dependent M3Y (DDM3Y) effective interaction and the Viola-Seaborg-Sobiczewski (VSS) formulas. The calculations provide consistent estimates for the half-lives of the {alpha} decay chains of these superheavy elements. The experimental data stand between the GLDM calculations and VSS ones in the most time. Predictions are provided for the {alpha} decay half-lives of other superheavy nuclei within the GLDM and VSS approaches using the recent extrapolated Q{sub {alpha}} of Audi, Wapstra, and Thibault [Nucl. Phys. A729, 337 (2003)], which may be used for future experimental assignment and identification.

  19. Requirements of supply chain management in differentiating European pork chains.

    PubMed

    Trienekens, Jacques; Wognum, Nel

    2013-11-01

    This paper summarizes results obtained by research into pork chain management in the EU Integrated Project Q-Porkchains. Changing demands for intrinsic and extrinsic quality attributes of pork products impact the way supply chain management should be organized from the farmer down to the consumer. The paper shows the importance of Quality Management Systems for integrating supply chains and enhancing consumer confidence. The paper also presents innovations in information system integration for aligning information exchange in the supply chain and logistics concepts based on innovative measurement technologies at the slaughterhouse stage. In the final section research challenges towards sustainable pork supply chains satisfying current consumer demands are presented. PMID:23611335

  20. Requirements of supply chain management in differentiating European pork chains.

    PubMed

    Trienekens, Jacques; Wognum, Nel

    2013-11-01

    This paper summarizes results obtained by research into pork chain management in the EU Integrated Project Q-Porkchains. Changing demands for intrinsic and extrinsic quality attributes of pork products impact the way supply chain management should be organized from the farmer down to the consumer. The paper shows the importance of Quality Management Systems for integrating supply chains and enhancing consumer confidence. The paper also presents innovations in information system integration for aligning information exchange in the supply chain and logistics concepts based on innovative measurement technologies at the slaughterhouse stage. In the final section research challenges towards sustainable pork supply chains satisfying current consumer demands are presented.

  1. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  2. Localization of the {alpha}7 integrin gene (ITGA7) on human chromosome 12q13: Clustering of integrin and Hox genes implies parallel evolution of these gene families

    SciTech Connect

    Wang, W.; Wu, W.; Kaufman, S.J.

    1995-04-10

    Expression of the {alpha}7 integrin gene (ITGA7) is developmentally regulated during the formation of skeletal muscle. Increased levels of expression and production of isoforms containing different cytoplasmic and extracellular domains accompany myogenesis. To determine whether a single or multiple {alpha}7 gene(s) underlie the structural diversity in this alpha chain that accompanies development, we have examined the rat and human genomes by Southern blotting and in situ hybridization. Our results demonstrate that there is only one {alpha}7 gene in both the rat and the human genomes. In the human, ITGA7 is present on chromosome 12q13. Phylogenetic analysis of the integrin alpha chain sequences suggests that the early integrin genes evolved in two pathways to form the I-integrins and the non-I-integrins. The I-integrin alpha chains contain an additional sequence of approximately 180 amino acids and arose as a result of an early insertion into the non-I-gene. The I-chain subfamily further evolved by duplications within the same chromosome. The non-I-integrin alpha chain genes are localized in clusters on chromosomes 2, 12, and 17, and this closely coincides with the localization of the human homeobox gene clusters. Non-I-integrin alpha chain genes appear to have evolved in parallel and in proximity to the Hox clusters. Thus, the Hox genes that underlie the design of body structure and the Integrin genes that underlie informed cell-cell and cell-matrix interactions appear to have evolved in parallel and coordinate fashions. 52 refs., 5 figs., 2 tabs.

  3. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  4. Domain structure of phage P4 alpha protein deduced by mutational analysis.

    PubMed Central

    Ziegelin, G; Linderoth, N A; Calendar, R; Lanka, E

    1995-01-01

    Bacteriophage P4 DNA replication depends on the product of the alpha gene, which has origin recognition ability, DNA helicase activity, and DNA primase activity. One temperature-sensitive and four amber mutations that eliminate DNA replication in vivo were sequenced and located in the alpha gene. Sequence analysis of the entire gene predicted a domain structure for the alpha polypeptide chain (777 amino acid residues, M(r) 84,900), with the N terminus providing the catalytic activity for the primase and the middle part providing that for the helicase/nucleoside triphosphatase. This model was confirmed experimentally in vivo and in vitro. In addition, the ori DNA recognition ability was found to be associated with the C-terminal third of the alpha polypeptide chain. The type A nucleotide-binding site is required for P4 replication in vivo, as shown for alpha mutations at G-506 and K-507. In the absence of an active DnaG protein, the primase function is also essential for P4 replication. Primase-null and helicase-null mutants retain the two remaining activities functionally in vitro and in vivo. The latter was demonstrated by trans complementation studies, indicating the assembly of active P4 replisomes by a primase-null and a helicase-null mutant. PMID:7635818

  5. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  6. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  7. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  8. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  9. Molecular cloning and nucleotide sequences of the complementary DNAs to chicken skeletal muscle myosin two alkali light chain mRNAs.

    PubMed Central

    Nabeshima, Y; Fujii-Kuriyama, Y; Muramatsu, M; Ogata, K

    1982-01-01

    We report here the molecular cloning and sequence analysis of DNAs complementary to mRNAs for myosin alkali light chain of chicken embryo and adult leg skeletal muscle. pSMA2-1 contained an 818 base-pair insert that includes the entire coding region and 5' and 3' untranslated regions of A2 mRNA. pSMA1-1 contained a 848 base-pair insert that included the 3' untranslated region and almost all of the coding region except for the N-terminal 13 amino acid residues of the A1 light chain. The 741 nucleotide sequences of A1 and A2 mRNAs corresponding to C-terminal 141 amino acid residues and 3' untranslated regions were identical. The 5' terminal nucleotide sequences corresponding to N-terminal 35 amino acid residues of A1 chain were quite different from the sequences corresponding to N-terminal 8 amino acid residues and of the 5' untranslated region of A2 mRNA. These findings are discussed in relation to the structures of the genes for A1 and A2 mRNA. PMID:6128725

  10. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  11. Radiology's value chain.

    PubMed

    Enzmann, Dieter R

    2012-04-01

    A diagnostic radiology value chain is constructed to define its main components, all of which are vulnerable to change, because digitization has caused disaggregation of the chain. Some components afford opportunities to improve productivity, some add value, while some face outsourcing to lower labor cost and to information technology substitutes, raising commoditization risks. Digital image information, because it can be competitive at smaller economies of scale, allows faster, differential rates of technological innovation of components, initiating a centralization-to-decentralization technology trend. Digitization, having triggered disaggregation of radiology's professional service model, may soon usher in an information business model. This means moving from a mind-set of "reading images" to an orientation of creating and organizing information for greater accuracy, faster speed, and lower cost in medical decision making. Information businesses view value chain investments differently than do small professional services. In the former model, producing a better business product will extend image interpretation beyond a radiologist's personal fund of knowledge to encompass expanding external imaging databases. A follow-on expansion with integration of image and molecular information into a report will offer new value in medical decision making. Improved interpretation plus new integration will enrich and diversify radiology's key service products, the report and consultation. A more robust, information-rich report derived from a "systems" and "computational" radiology approach will be facilitated by a transition from a professional service to an information business. Under health care reform, radiology will transition its emphasis from volume to greater value. Radiology's future brightens with the adoption of a philosophy of offering information rather than "reads" for decision making. Staunchly defending the status quo via turf wars is unlikely to constitute a

  12. Determination of toxinotypes of environmental Clostridium perfringens by Polymerase Chain Reaction.

    PubMed

    Florence L, C H; Hakim, S L; Kamaluddin, M A; Thong, K L

    2011-04-01

    Toxinotype of Clostridium perfringens (CP) isolates collected from the Bernam River, Selangor River and Tengi Canal between April 2007 and January 2008 were determined by Polymerase Chain Reaction (PCR) using published primers. All the 147 isolates were toxinotype Type A, harbouring the alpha toxin gene. In addition, 5 of the isolates also had the enterotoxin (CPE) gene.

  13. Long-chain polyunsaturated fatty acids in chronic childhood disorders: panacea, promising, or placebo

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Long-chain polyunsaturated fatty acids (LCPUFA, or LCP) include the essential fatty acids alpha-linolenic acid (ALA, 18:3 n-3) and linoleic acid (LA, 18:2 n-6) as well as a number of metabolites of both, including eicosapentaenoic acid (EPA, 20:5n-3), docosahexaenoic acid (DHA, 22:6n-3), and arachid...

  14. Musical Markov Chains

    NASA Astrophysics Data System (ADS)

    Volchenkov, Dima; Dawin, Jean René

    A system for using dice to compose music randomly is known as the musical dice game. The discrete time MIDI models of 804 pieces of classical music written by 29 composers have been encoded into the transition matrices and studied by Markov chains. Contrary to human languages, entropy dominates over redundancy, in the musical dice games based on the compositions of classical music. The maximum complexity is achieved on the blocks consisting of just a few notes (8 notes, for the musical dice games generated over Bach's compositions). First passage times to notes can be used to resolve tonality and feature a composer.

  15. Monte Carlo without chains

    SciTech Connect

    Chorin, Alexandre J.

    2007-12-12

    A sampling method for spin systems is presented. The spin lattice is written as the union of a nested sequence of sublattices, all but the last with conditionally independent spins, which are sampled in succession using their marginals. The marginals are computed concurrently by a fast algorithm; errors in the evaluation of the marginals are offset by weights. There are no Markov chains and each sample is independent of the previous ones; the cost of a sample is proportional to the number of spins (but the number of samples needed for good statistics may grow with array size). The examples include the Edwards-Anderson spin glass in three dimensions.

  16. {alpha} transitions to coexisting 0{sup +} states in Pb and Po isotopes

    SciTech Connect

    Xu Chang; Ren Zhongzhou

    2007-04-15

    The {alpha}-transitions ({delta}l=0) to ground and first excited 0{sup +} states in neutron deficient Pb and Po isotopes are systematically analyzed by the density-dependent cluster model. The magnitude of nuclear deformation of the coexisting 0{sub 1}{sup +} and 0{sub 2}{sup +} states is extracted directly from the experimental {alpha}-decay energies and half-lives. The phenomenon of shape coexistence around the Z=82 shell closure is clearly demonstrated in our present analysis. The obtained deformation values from Rn {yields} Po {yields} Pb decay chains are generally consistent with both the available experimental and theoretical studies.

  17. Regional distant sequence homology between amylases, alpha-glucosidases and transglucanosylases.

    PubMed

    Svensson, B

    1988-03-28

    Amylases possess short, conserved regions near functional side chains. Sequence comparison extends this relationship to comprise a maltase and a cyclodextrin glucanotransferase. Similarity also exists with intestinal sucrase-isomaltase and fungal glucoamylase near identified essential carboxyl groups. Homology between COOH-terminal regions of glucoamylase and cyclodextrin glucanotranserase may indicate raw-starch binding areas. It is suggested that amylases, alpha-glucosidases, and transglucanosylases acting on 1,4- and 1,6-alpha-glucosidic linkages share key structural features in the active centres.

  18. Coordinated balancing of muscle oxidative metabolism through PGC-1{alpha} increases metabolic flexibility and preserves insulin sensitivity

    SciTech Connect

    Summermatter, Serge; Santos, Gesa

    2011-04-29

    Highlights: {yields} PGC-1{alpha} enhances muscle oxidative capacity. {yields} PGC-1{alpha} promotes concomitantly positive and negative regulators of lipid oxidation. {yields} Regulator abundance enhances metabolic flexibility and balances oxidative metabolism. {yields} Balanced oxidation prevents detrimental acylcarnitine and ROS generation. {yields} Absence of detrimental metabolites preserves insulin sensitivity -- Abstract: The peroxisome proliferator-activated receptor {gamma} coactivator 1{alpha} (PGC-1{alpha}) enhances oxidative metabolism in skeletal muscle. Excessive lipid oxidation and electron transport chain activity can, however, lead to the accumulation of harmful metabolites and impair glucose homeostasis. Here, we investigated the effect of over-expression of PGC-1{alpha} on metabolic control and generation of insulin desensitizing agents in extensor digitorum longus (EDL), a muscle that exhibits low levels of PGC-1{alpha} in the untrained state and minimally relies on oxidative metabolism. We demonstrate that PGC-1{alpha} induces a strictly balanced substrate oxidation in EDL by concomitantly promoting the transcription of activators and inhibitors of lipid oxidation. Moreover, we show that PGC-1{alpha} enhances the potential to uncouple oxidative phosphorylation. Thereby, PGC-1{alpha} boosts elevated, yet tightly regulated oxidative metabolism devoid of side products that are detrimental for glucose homeostasis. Accordingly, PI3K activity, an early phase marker for insulin resistance, is preserved in EDL muscle. Our findings suggest that PGC-1{alpha} coordinately coactivates the simultaneous transcription of gene clusters implicated in the positive and negative regulation of oxidative metabolism and thereby increases metabolic flexibility. Thus, in mice fed a normal chow diet, over-expression of PGC-1{alpha} does not alter insulin sensitivity and the metabolic adaptations elicited by PGC-1{alpha} mimic the beneficial effects of endurance training

  19. Alternative splicing of the guanine nucleotide-binding regulatory protein Go alpha generates four distinct mRNAs.

    PubMed Central

    Murtagh, J J; Moss, J; Vaughan, M

    1994-01-01

    Go alpha a guanine nucleotide-binding (G) protein abundant in brain and other neural tissues, has been implicated in ion channel regulation. Concerted efforts in several laboratories have revealed multiple Go alpha mRNAs and protein isoforms in different contexts. Go alpha is a single copy gene in mammalian species, although the structure, number and tissue localization of Go alpha mRNAs reported by investigators are inconsistent. To define the cell-specific expression of alternatively spliced variants of Go alpha mRNA, we employed several strategies, including Northern hybridizations with sequences-specific oligonucleotides, selective digestions of Go alpha mRNA using RNase H, and adaptations of the polymerase chain reaction. Four distinct alternatively spliced variants were identified, a 5.7-kb Go alpha 2 mRNA and three Go alpha 1 mRNAs with different 3' UTRs. The UTRs of the three Go alpha 1s are composed of different combinations of what have been referred to as UTR-A and UTR-B. The sequences of the spliced segments are well conserved among mammalian species, suggesting a functional role for these alternatively spliced 3' UTRs in post-transcriptional and/or tissue-specific regulation of Go alpha expression. The position of the intron-exon splice boundary at nucleotide 31 following T of the TGA stop codon is conserved in the Gi alpha 2 and Gi alpha 3 genes, consistent with the notion that similar alternative splicing of 3' UTRs occurs in products of these related genes. Images PMID:8139926

  20. Identification of {gamma} rays from {sup 172}Au and {alpha} decays of {sup 172}Au, {sup 168}Ir, and {sup 164}Re

    SciTech Connect

    Hadinia, B.; Cederwall, B.; Andgren, K.; Baeck, T.; Johnson, A.; Khaplanov, A.; Wyss, R.; Page, R. D.; Grahn, T.; Paul, E. S.; Sandzelius, M.; Scholey, C.; Greenlees, P. T.; Jakobsson, U.; Jones, P. M.; Julin, R.; Juutinen, J.; Ketelhut, S.; Leino, M.; Nyman, M.

    2009-12-15

    The very neutron deficient odd-odd nucleus {sup 172}Au was studied in reactions of 342 and 348 MeV {sup 78}Kr beams with an isotopically enriched {sup 96}Ru target. The {alpha} decays previously reported for {sup 172}Au were confirmed and the decay chain extended down to {sup 152}Tm through the discovery of a new {alpha}-decaying state in {sup 164}Re[E{sub {alpha}}=5623(10) keV; t{sub 1/2}=864{sub -110}{sup +150} ms; b{sub {alpha}}=3(1)%]. Fine structure in these {alpha} decays of {sup 172}Au and {sup 168}Ir were identified. A new {alpha}-decaying state was also observed and assigned as the ground state in {sup 172}Au[E{sub {alpha}}=6762(10) keV; t{sub 1/2}=22{sub -5}{sup +6} ms]. This decay chain was also correlated down to {sup 152}Tm through previously reported {alpha} decays. Prompt {gamma} rays from excited states in {sup 172}Au have been identified using the recoil-decay tagging technique. The partial level scheme constructed for {sup 172}Au indicates that it has an irregular structure. Possible configurations of the {alpha}-decaying states in {sup 172}Au are discussed in terms of the systematics of nuclei in this region and total Routhian surface calculations.

  1. Antifungal properties of n-alkanols, alpha, omega-n-alkanediols, and omega-chloro-alpha-alkanols.

    PubMed

    Gershon, H; Shanks, L

    1980-04-01

    Fourteen n-alkanols (C1-C12, C14, and C16), 13 alpha,omega-n-alkanediols (C2-C12, C14, and C16), and 13 omega-chloro-alpha-alkanols (C2-C12, C14, and C16) were tested against Aspergillus niger, Trichoderma viride, and Myrothecium verucaria in Sabouraud dextrose agar at pH 4.0 and 5.6. Toxicity to Candida blbicans, Trichophyton mentagrophytes, and Mucor mucedo was determined in the same medium at pH 5.6 and 7.0 in the absence and presence of 10% beef serum. The fungitoxicity of these alcohols was influenced by chain length and insignificantly by the pH of the medium and the presence of beef serum. The C10-member of each series was most active; the order of activity of the three groups was chloroalkanols greater than alkanols greater than alkanediols. Compared to the fatty acids, the order of fungitoxicity on a weight basis was 2-alkynoic acids greater than 2-alkenoic acids greater than omega-chloralkanols greater than alkanoic acids greater than 2-bromoalkanoic acids greater than 2-fluoroalkanoic acids greater than n-alkoxyacetic acids greater than n-alkanols greater than alpha,omega-n-alkanediols.

  2. Failure of isolated rat tibial periosteal cells to 5 alpha reduce testosterone to 5 alpha-dihydrotestosterone

    SciTech Connect

    Turner, R.T.; Bleiberg, B.; Colvard, D.S.; Keeting, P.E.; Evans, G.; Spelsberg, T.C. )

    1990-07-01

    Periosteal cells were isolated from tibiae of adult male rats after collagenase treatment. Northern blot analysis of total cytoplasmic RNA extracted from the isolated periosteal cells was positive for expression of genes encoding the osteoblast marker proteins osteocalcin (BGP) and pre-pro-alpha 2(I) chain of type 1 precollagen. The isolated periosteal cells were incubated with 1 nM (3H)testosterone (({sup 3}H)T) for up to 240 minutes and the reaction products separated by high-performance liquid chromatography. ({sup 3}H)5 alpha-dihydrotestosterone (({sup 3}H)DHT) was not detected in extracts of periosteal cell incubations. In contrast, ({sup 3}H)DHT was produced in a time-dependent manner by cells from seminal vesicles. These results suggest that testosterone 5 alpha-reductase activity is not expressed by osteoblasts in rat tibial periosteum and that the anabolic effects of androgens in this tissue are not mediated by locally produced DHT.

  3. Predictions on the alpha decay half lives of superheavy nuclei with Z = 113 in the range 255 ≤ A ≤ 314

    NASA Astrophysics Data System (ADS)

    Santhosh, K. P.; Augustine, A.; Nithya, C.; Priyanka, B.

    2016-07-01

    An intense study of the alpha decay properties of the isotopes on superheavy element with Z = 113 has been performed within the Coulomb and proximity potential model for deformed nuclei (CPPMDN) within the wide range 255 ≤ A ≤ 314. The predicted alpha decay half lives of 278113 and 282113 and the alpha half lives of their decay products are in good agreement with the experimental data. 6α chains and 4α chains predicted respectively for 278113 and 282113 are in agreement with the experimental observation. Our study shows that the isotopes in the mass range 278 ≤ A ≤ 286 will survive fission and can be synthesized and detected in the laboratory via alpha decay. In our study, we have predicted 6α chains from 279113, 4α chains from 286113, 3α chains from 280,281,283113, 2α chains from 284113 and 1α chain from 285113. We hope that these predictions will be a guideline for future experimental investigations.

  4. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  5. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  6. New Methods for Targeted Alpha Radiotherapy

    NASA Astrophysics Data System (ADS)

    Robertson, J. David

    2014-03-01

    Targeted radiotherapies based on alpha emitters are a promising alternative to beta emitting radionuclides. Because of their much shorter range, targeted α-radiotherapy (TAT) agents have great potential for application to small, disseminated tumors and micro metastases and treatment of hematological malignancies consisting of individual, circulating neoplastic cells. A promising approach to TAT is the use of the in vivo α-generator radionuclides 223 = 11.4 d) and 225Ac 1/2 = 10.0 d). In addition to their longer half-lives, these two isotopes have the potential of dramatically increasing the therapeutic efficacy of TAT as they each emit four α particles in their decay chain. This principle has recently been exploited in the development of Xofigo®, the first TAT agent approved for clinical use by the U.S. FDA. Xofigo, formulated as 223RaCl2, is used for treatment of metastatic bone cancer in men with castration-resistant prostate cancer. TAT with 223Ra works, however, only in the case of bone cancer because radium, as a chemical analogue of calcium, efficiently targets bone. In order to bring the benefits of TAT with 223Ra or 225Ac to other tumor types, a new delivery method must be devised. Retaining the in vivo α generator radionuclides at the target site through the decay process is one of the major challenges associated with the development of TAT. Because the recoil energy of the daughter radionuclides from the α-emission is ~ 100 keV - a value which is four orders of magnitude greater than the energy of a covalent bond - the daughters will not remain bound to the bioconjugate at the targeting site. Various approaches have been attempted to achieve retention of the α-generator daughter radionuclides at the target site, including incorporation of the in vivo generator into liposomes and fullerenes. Unfortunately, to date single wall liposomes and fullerenes are able to retain less than 10% of the daughter radionuclides. We have recently demonstrated that a

  7. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  8. Inhibition of type 1 and type 2 5alpha-reductase activity by free fatty acids, active ingredients of Permixon.

    PubMed

    Raynaud, Jean Pierre; Cousse, Henri; Martin, Pierre Marie

    2002-10-01

    In different cell systems, the lipido-sterolic extract of Serenoa repens (LSESr, Permixon inhibits both type 1 and type 2 5alpha-reductase activity (5alphaR1 and 5alphaR2). LSESr is mainly constituted of fatty acids (90+/-5%) essentially as free fatty acids (80%). Among these free fatty acids, the main components are oleic and lauric acids which represent 65% and linoleic and myristic acids 15%. To evaluate the inhibitory effect of the different components of LSESr on 5alphaR1 or 5alphaR2 activity, the corresponding type 1 and type 2 human genes have been cloned and expressed in the baculovirus-directed insect cell expression system Sf9. The cells were incubated at pH 5.5 (5alphaR2) and pH 7.4 (5alphaR1) with 1 or 3nM testosterone in presence or absence of various concentrations of LSESr or of its different components. Dihydrotestosterone formation was measured with an automatic system combining HPLC and an on-line radiodetector. The inhibition of 5alphaR1 and 5alphaR2 activity was only observed with free fatty acids: esterified fatty acids, alcohols as well as sterols assayed were inactive. A specificity of the fatty acids in 5alphaR1 or 5alphaR2 inhibition has been found. Long unsaturated chains (oleic and linolenic) were active (IC(50)=4+/-2 and 13+/-3 microg/ml, respectively) on 5alphaR1 but to a much lesser extent (IC(50)>100 and 35+/-21 microg/ml, respectively) on 5alphaR2. Palmitic and stearic acids were inactive on the two isoforms. Lauric acid was active on 5alphaR1 (IC(50)=17+/-3 microg/ml) and 5alphaR2 (IC(50)=19+/-9 microg/ml). The inhibitory activity of myristic acid was evaluated on 5alphaR2 only and found active on this isoform (IC(50)=4+/-2 microg/ml). The dual inhibitory activity of LSESr on 5alpha-reductase type 1 and type 2 can be attributed to its high content in free fatty acids.

  9. Polyketide chain length control by chain length factor.

    PubMed

    Tang, Yi; Tsai, Shiou-Chuan; Khosla, Chaitan

    2003-10-22

    Bacterial aromatic polyketides are pharmacologically important natural products. A critical parameter that dictates product structure is the carbon chain length of the polyketide backbone. Systematic manipulation of polyketide chain length represents a major unmet challenge in natural product biosynthesis. Polyketide chain elongation is catalyzed by a heterodimeric ketosynthase. In contrast to homodimeric ketosynthases found in fatty acid synthases, the active site cysteine is absent from the one subunit of this heterodimer. The precise role of this catalytically silent subunit has been debated over the past decade. We demonstrate here that this subunit is the primary determinant of polyketide chain length, thereby validating its designation as chain length factor. Using structure-based mutagenesis, we identified key residues in the chain length factor that could be manipulated to convert an octaketide synthase into a decaketide synthase and vice versa. These results should lead to novel strategies for the engineered biosynthesis of hitherto unidentified polyketide scaffolds.

  10. Doping of Semiconducting Atomic Chains

    NASA Technical Reports Server (NTRS)

    Toshishige, Yamada; Kutler, Paul (Technical Monitor)

    1997-01-01

    Due to the rapid progress in atom manipulation technology, atomic chain electronics would not be a dream, where foreign atoms are placed on a substrate to form a chain, and its electronic properties are designed by controlling the lattice constant d. It has been shown theoretically that a Si atomic chain is metallic regardless of d and that a Mg atomic chain is semiconducting or insulating with a band gap modified with d. For electronic applications, it is essential to establish a method to dope a semiconducting chain, which is to control the Fermi energy position without altering the original band structure. If we replace some of the chain atoms with dopant atoms randomly, the electrons will see random potential along the chain and will be localized strongly in space (Anderson localization). However, if we replace periodically, although the electrons can spread over the chain, there will generally appear new bands and band gaps reflecting the new periodicity of dopant atoms. This will change the original band structure significantly. In order to overcome this dilemma, we may place a dopant atom beside the chain at every N lattice periods (N > 1). Because of the periodic arrangement of dopant atoms, we can avoid the unwanted Anderson localization. Moreover, since the dopant atoms do not constitute the chain, the overlap interaction between them is minimized, and the band structure modification can be made smallest. Some tight-binding results will be discussed to demonstrate the present idea.

  11. Angular correlation measurements for 4-{alpha} decaying states in {sup 16}O

    SciTech Connect

    Wuosmaa, A.H.; Back, B.B.; Betts, R.R.

    1995-08-01

    Previous measurements of the {sup 12}C({sup 12}C,{sup 8}Be){sup 16}O{sup *}(4 {alpha}) reaction identified discrete levels in {sup 16}O which decay by breakup into 4 {alpha} particles through a number of different decay sequences, including {sup 16}O{sup *} {yields} {sup 8}Be + {sup 8}Be and {alpha} + {sup 12}C (O{sub 2}{sup +}). These states are observed in a range of excitation energies where resonances are observed in inelastic {alpha} + {sup 12}C scattering leading to the {sup 8}Be + {sup 8}Be and {alpha} + {sup 12}C final states. These resonances were associated with 4 {alpha}-particle chain configurations in {sup 16}O. Should the states populated in the {sup 12}C + {sup 12}C reaction possess this same extended structure, it would serve as an important piece of evidence supporting the idea that even more deformed structures are formed in the {sup 24}Mg compound system. In order to more firmly make this association, it is important to determine the spins of the states populated in the {sup 12}C + {sup 12}C reaction.

  12. Topoisomerase II alpha mRNA and tumour cell proliferation in non-Hodgkin's lymphoma.

    PubMed Central

    Lohri, A; Reuter, J; Gudat, F; Herrmann, R

    1997-01-01

    AIMS: To elucidate potential mechanisms of drug resistance, levels of topoisomerase II alpha mRNA, a target for cytostatic drugs, were measured in cryopreserved tumour tissue from 36 patients with non-Hodgkin's lymphoma. To evaluate the potential association between topoisomerase II alpha and cell proliferation, Ki-67 immunostaining was also assessed. METHODS: The study population comprised 13 patients with low grade and 20 with high grade non-Hodgkin's lymphoma. Three patients had recurrent disease. Topoisomerase II alpha mRNA was quantitated by using reverse transcription polymerase chain reaction (RT-PCR) and the PCR product measured by using HPLC. The MIB-1 monoclonal antibody was used for Ki-67 immunostaining. RESULTS: Levels of topoisomerase II alpha mRNA correlated strongly with the Ki-67 labelling index and were higher in high grade than in low grade lymphomas. Patients in complete clinical remission of high grade lymphoma had a higher Ki-67 labelling index and tended to have higher topoisomerase II alpha mRNA levels. CONCLUSIONS: Although topoisomerase II alpha mRNA levels may be indicative of sensitivity to drugs, it is more likely that they reflect the proliferation status of the cell, which in turn involves a large number of additional molecular systems that influence response to treatment. PMID:9059350

  13. Genetic compensation for sarcoglycan loss by integrin alpha7beta1 in muscle.

    PubMed

    Allikian, Michael J; Hack, Andrew A; Mewborn, Stephanie; Mayer, Ulrike; McNally, Elizabeth M

    2004-08-01

    Disruption of the sarcoglycan complex leads to muscle membrane instability and muscular dystrophy in humans and mice. Through the dystrophin glycoprotein complex, sarcoglycan participates in connecting the internal cytoskeleton to the membrane and the extracellular matrix. Integrin alpha7beta1 is also a transmembrane protein of skeletal and cardiac muscle that similarly links the cytoskeleton to the extracellular matrix. Mice lacking integrin alpha7 develop mild muscle degeneration, while sarcoglycan mutant mice display overt muscle degeneration and muscular dystrophy. In sarcoglycan-deficient muscle, integrin alpha7 protein was upregulated at the plasma membrane. To ascertain whether integrin alpha7 upregulation compensates for the loss of the transmembrane sarcoglycan linkage in sarcoglycan-deficient muscle, we generated mice lacking both integrin alpha7 and gamma-sarcoglycan (gxi). These double-mutant gxi mice exhibit profound, rapid muscle degeneration leading to death before one month of age consistent with a weakened cellular attachment to the extracellular matrix. The regenerative capacity of gxi muscle was intact with increased embryonic myosin heavy chain expression, myofiber central nucleation and normal in vivo myoblast differentiation. Therefore, upregulation of integrin alpha7beta1 compensates as a transmembrane muscle cell attachment for sarcoglycan consistent with overlapping roles for sarcoglycan and integrins in mediating cytoskeletal-membrane-extracellular matrix interaction.

  14. Ancient roots for polymorphism at the HLA-DQ. alpha. locus in primates

    SciTech Connect

    Gyllensten, U.B.; Erlich, H.A. )

    1989-12-01

    The genes encoding the human histocompatibility antigens (HLA) exhibit a remarkable degree of polymorphism as revealed by immunologic and molecular analyses. This extensive sequence polymorphism either may have been generated during the lifetime of the human species or could have arisen before speciation and been maintained in the contemporary human population by selection or, possibly, by genetic drift. These two hypotheses were examined using the polymerase chain reaction method to amplify polymorphic sequences from the DQ{alpha} locus, as well as the DX{alpha} locus, an homologous but nonexpressed locus, in a series of primates that diverged at known times. In general, the amino acid sequence of a specific human DQ{alpha} allelic type is more closely related to its chimpanzee or gorilla counterpart than to other human DQ{alpha} alleles. Phylogenetic analysis of the silent nucleotide position changes shows that the similarity of allelic types between species is due to common ancestry rather than convergent evolution. Thus, most of the polymorphism at the DQ{alpha} locus in the human species was already present at least 5 million years ago in the ancestral species that gave rise to the chimpanzee, gorilla, and human lineages. However, one of the DQ{alpha} alleles may have arisen after speciation by recombination between two ancestral alleles.

  15. Proteolytically stable peptides by incorporation of alpha-Tfm amino acids.

    PubMed

    Koksch, B; Sewald, N; Hofmann, H J; Burger, K; Jakubke, H D

    1997-01-01

    A series of model peptides containing alpha-trifluoromethyl-substituted amino acids in five different positions relative to the predominant cleavage site of the serine protease alpha-chymotrypsin was synthesized by solution methods to investigate the influence of alpha-Tfm substitution on the proteolytic stability of peptides. Proteolysis studies demonstrated absolute stability of peptides substituted to the P1 position and still considerable proteolytic stability for peptides substituted at the P2 and P'2 positions compared with the corresponding unsubstituted model peptide. Comparison with peptides containing the fluorine-free disubstituted amino acid alpha-aminoisobutyric acid allowed to separate electronic from steric effects. Furthermore, the absolute configuration of the alpha-Tfm-substituted amino acid was found to exert considerable effects on the proteolytic stability, especially in P'1 substituted peptides. Investigations of this phenomenon using empirical force field calculations revealed that in the (S,R,S)-diasteromer the steric constraints exhibited by the alpha-Tfm group can be outweighed by an advantageous interaction of the flourine atoms with the serine side chain of the enzyme. In contrast, a favourable interaction between substrate and enzyme is impossible for the (S,S,S)-diastereomer. PMID:9230481

  16. A Critical Review of Alpha Radionuclide Therapy-How to Deal with Recoiling Daughters?

    PubMed

    de Kruijff, Robin M; Wolterbeek, Hubert T; Denkova, Antonia G

    2015-01-01

    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  17. A Critical Review of Alpha Radionuclide Therapy—How to Deal with Recoiling Daughters?

    PubMed Central

    de Kruijff, Robin M.; Wolterbeek, Hubert T.; Denkova, Antonia G.

    2015-01-01

    This review presents an overview of the successes and challenges currently faced in alpha radionuclide therapy. Alpha particles have an advantage in killing tumour cells as compared to beta or gamma radiation due to their short penetration depth and high linear energy transfer (LET). Touching briefly on the clinical successes of radionuclides emitting only one alpha particle, the main focus of this article lies on those alpha-emitting radionuclides with multiple alpha-emitting daughters in their decay chain. While having the advantage of longer half-lives, the recoiled daughters of radionuclides like 224Ra (radium), 223Ra, and 225Ac (actinium) can do significant damage to healthy tissue when not retained at the tumour site. Three different approaches to deal with this problem are discussed: encapsulation in a nano-carrier, fast uptake of the alpha emitting radionuclides in tumour cells, and local administration. Each approach has been shown to have its advantages and disadvantages, but when larger activities need to be used clinically, nano-carriers appear to be the most promising solution for reducing toxic effects, provided there is no accumulation in healthy tissue. PMID:26066613

  18. Near Fermi Energy reaction dynamics and clustering in alpha-conjugate systems

    NASA Astrophysics Data System (ADS)

    Cao, Xiguang; Schmidt, Katarzyna; Kim, E.-J.; Hagel, K.; Barbui, M.; Wuenschel, S.; Natowitz, J. B.; Zheng, H.; Blando, N.; Bonasera, A.; Giuliani, G.

    2015-10-01

    Theoretical study predicted that the self-organizing of alpha cluster is favored over deuteron below a critical density with moderate temperature, where the possible Bose-Einstein condensation (BEC) is expected to occur. However the experimental information about the alpha states at low density is scarce. It is natural to pursue experiments with α conjugate beams and advanced detection apparatus to explore the collective dynamics of alpha clustered systems at low density. Systematical experiments were carried out with 40Ca and 28Si beams at 10, 25, 35 MeV/u incident on 28Si, 12C, 40Ca and 180Ta targets, detected with the NIMROD-ISiS 4 Pi detector array. It is found that there is a strong neck-like emission, which consists mainly of alpha-like fragments. The characteristic of the α emission source is explored by shape analysis, multi-particle correlation and quantum fluctuation approaches. How these observables reveal the possible alpha BEC in low density and possible exotic toroidal and linear chain configurations made out of alpha clusters is discussed.

  19. Different effects of the glucosidase inhibitors 1-deoxynojirimycin, N-methyl-1-deoxynojirimycin and castanospermine on the glycosylation of rat alpha 1-proteinase inhibitor and alpha 1-acid glycoprotein.

    PubMed

    Gross, V; Tran-Thi, T A; Schwarz, R T; Elbein, A D; Decker, K; Heinrich, P C

    1986-06-15

    The glucosidase inhibitors 1-deoxynojirimycin, N-methyl-1-deoxynojirimycin and castanospermine were used to inhibit oligosaccharide processing in primary cultures of rat hepatocytes. Their effect on the glycosylation of alpha 1-proteinase inhibitor (alpha 1PI) and alpha 1-acid glycoprotein (alpha 1AGP) was studied. Of the three glucosidase inhibitors examined, 1-deoxynojirimycin inhibited not only oligosaccharide trimming but also glycosylation de novo of newly synthesized proteins, resulting in the formation of alpha 1PI with two and three (normally carrying three) and alpha 1AGP with two to five (normally carrying six) oligosaccharide side chains. In the presence of the glucosidase inhibitors, glucosylated high-mannose-type oligosaccharides accumulated. Whereas most of the endoglucosaminidase-H-sensitive oligosaccharides formed in the presence of 1-deoxynojirimycin contained only one glucose residue, N-methyl-1-deoxynojirimycin and castanospermine led mainly to the formation of oligosaccharides with three glucose residues. None of the three glucosidase inhibitors completely prevented the formation of complex-type oligosaccharides. Thus, in their presence, alpha 1PI and alpha 1AGP with a mixture of both high-mannose and complex-type oligosaccharides were secreted. PMID:2947571

  20. Different effects of the glucosidase inhibitors 1-deoxynojirimycin, N-methyl-1-deoxynojirimycin and castanospermine on the glycosylation of rat alpha 1-proteinase inhibitor and alpha 1-acid glycoprotein.

    PubMed Central

    Gross, V; Tran-Thi, T A; Schwarz, R T; Elbein, A D; Decker, K; Heinrich, P C

    1986-01-01

    The glucosidase inhibitors 1-deoxynojirimycin, N-methyl-1-deoxynojirimycin and castanospermine were used to inhibit oligosaccharide processing in primary cultures of rat hepatocytes. Their effect on the glycosylation of alpha 1-proteinase inhibitor (alpha 1PI) and alpha 1-acid glycoprotein (alpha 1AGP) was studied. Of the three glucosidase inhibitors examined, 1-deoxynojirimycin inhibited not only oligosaccharide trimming but also glycosylation de novo of newly synthesized proteins, resulting in the formation of alpha 1PI with two and three (normally carrying three) and alpha 1AGP with two to five (normally carrying six) oligosaccharide side chains. In the presence of the glucosidase inhibitors, glucosylated high-mannose-type oligosaccharides accumulated. Whereas most of the endoglucosaminidase-H-sensitive oligosaccharides formed in the presence of 1-deoxynojirimycin contained only one glucose residue, N-methyl-1-deoxynojirimycin and castanospermine led mainly to the formation of oligosaccharides with three glucose residues. None of the three glucosidase inhibitors completely prevented the formation of complex-type oligosaccharides. Thus, in their presence, alpha 1PI and alpha 1AGP with a mixture of both high-mannose and complex-type oligosaccharides were secreted. Images Fig. 1. Fig. 2. Fig. 5. PMID:2947571

  1. Polymerase chain reaction

    SciTech Connect

    Arnhelm, N. ); Levenson, C.H. )

    1990-10-01

    This paper discusses the polymerase chain reaction (PCR) an in-vitro method of amplifying DNA sequences. Beginning with DNA of any origin- bacterial, viral, plant, or animal- PCR can increase the amount of a DNA sequence hundreds of millions to billions of times. The procedure can amplify a targeted sequence even when it makes up less than one part in a million of the total initial sample. PCR is an enzymatic process that is carried out in discrete cycles of amplification, each of which can double the amount of target DNA in the sample. Thus, n cycles can produce 2{sup n} times as much target as was present to begin with. This paper discusses how PCR has had an impact on molecular biology, human genetics, infectious and genetic disease diagnosis, forensic science, and evolutionary biology.

  2. NNSA TRITIUM SUPPLY CHAIN

    SciTech Connect

    Wyrick, Steven; Cordaro, Joseph; Founds, Nanette; Chambellan, Curtis

    2013-08-21

    Savannah River Site plays a critical role in the Tritium Production Supply Chain for the National Nuclear Security Administration (NNSA). The entire process includes: • Production of Tritium Producing Burnable Absorber Rods (TPBARs) at the Westinghouse WesDyne Nuclear Fuels Plant in Columbia, South Carolina • Production of unobligated Low Enriched Uranium (LEU) at the United States Enrichment Corporation (USEC) in Portsmouth, Ohio • Irradiation of TPBARs with the LEU at the Tennessee Valley Authority (TVA) Watts Bar Reactor • Extraction of tritium from the irradiated TPBARs at the Tritium Extraction Facility (TEF) at Savannah River Site • Processing the tritium at the Savannah River Site, which includes removal of nonhydrogen species and separation of the hydrogen isotopes of protium, deuterium and tritium.

  3. Design, synthesis and biological evaluation of sugar-derived esters, [alpha]-ketoesters and [alpha]-ketoamides as inhibitors for Mycobacterium tuberculosis antigen 85C

    SciTech Connect

    Sanki, Aditya K.; Boucau, Julie; Umesiri, Francis E.; Ronning, Donald R.; Sucheck, Steven J.

    2010-08-16

    Peptide-based 1,2-dicarbonyl compounds have emerged as potent inhibitors for serine proteases. Herein, we have designed and synthesized D-arabinose and D-trehalose-based esters, {alpha}-ketoesters and {alpha}-ketoamides, and evaluated their inhibitory activity against Mycobacterium tuberculosis (Mtb) antigen 85C (ag85C), an acyltransferase in the serine hydrolase superfamily. In addition the compounds were evaluated for the ability to inhibit the growth of Mycobacterium smegmatis ATCC 14468, a non-pathogenic surrogate for Mtb. Among the synthetic analogs evaluated only the methyl ester1 derived from D-arabinose was found to inhibit the acyltransferase activity of ag85C (IC{sub 50} = 25 mM). Based on this weak inhibitory activity it was not surprising that none of the compounds inhibits the growth of M. smegmatis. In spite of the weak inhibitory activity of 1, X-ray crystallography on crystals of ag85C soaked with 1 suggested the formation of a covalent ester adduct between 1 and the Ser124 side chain hydroxyl moiety found within the catalytic site of ag85C; however, some of the active site electron density appears to result from bound glycerol. The lack of activity associated with the {alpha}-ketoester and {alpha}-ketoamide derivatives of D-trehalose may be the result of intramolecular cyclization of the {alpha}-keto moiety with the nearby C-4/4' hydroxyls leading to the formation of stable bicyclo-ester and amide derivatives.

  4. Cloning and comparative analysis of gene structure in promoter site of alpha-s1 casein gene in Naeinian goat and sheep

    PubMed Central

    Najafi, Mojtaba; Rahimi Mianji, Ghodrat; Ansari Pirsaraie, Zarbakht

    2014-01-01

    The 5′ end or alpha-S1 casein promoter has a significant role in milk protein gene expression. The understanding of the translation process of alpha-S1 casein mutants will provide us an opportunity to make the best selection in livestock providing more proteins in milk. Blood samples were taken from three hundred of Naeinian goats and sheep, and DNA extraction was done using modified salting out method. Polymerase chain reactions (PCR) were carried out using a specific primer pairs for amplification a fragment of 1133 bp from part of 5′-UTR and exon 1 of alpha s1 casein gene. The AluI and HinfI restriction enzyme treatment of all samples provided the same homozygous AA genotype in both species. Subsequently, one sample of each species was selected and cloned, and the final sequences were analyzed by BioEdit, CLC genomic, Mega4 and DNASIS MAX software. Several polymorphisms are recognized between Naeinian goat and sheep that are presented on motif sites. In this research, the interested location, including exon I and a part of 5′, was analyzed, and genetic element comparisons were done between Naeinian goat and sheep. The number and location of probable binding sites can have a crucial role as a result of antagonistic and synergistic effects on gene regulation activities. PMID:25606467

  5. Production and characterization of monoclonal antibodies against α-globin chain-containing human hemoglobins for detecting α-thalassemia disease.

    PubMed

    Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak

    2016-01-01

    Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced. PMID:27050832

  6. Discovery of {sup 109}Xe and {sup 105}Te: Superallowed {alpha} Decay near Doubly Magic {sup 100}Sn

    SciTech Connect

    Liddick, S. N.; Batchelder, J. C.; Grzywacz, R.; Bingham, C. R.; Mazzocchi, C.; Drafta, G.; Tantawy, M. N.; Page, R. D.; Darby, I. G.; Joss, D. T.; Thomson, J.; Rykaczewski, K. P.; Gross, C. J.; Goodin, C.; Hamilton, J. H.; Hwang, J. K.; Li, K.; Hecht, A. A.; Ilyushkin, S.; Korgul, A.

    2006-08-25

    Two new {alpha} emitters {sup 109}Xe and {sup 105}Te were identified through the observation of the {sup 109}Xe{yields}{sup 105}Te{yields}{sup 101}Sn {alpha}-decay chain. The {sup 109}Xe nuclei were produced in the fusion-evaporation reaction {sup 54}Fe({sup 58}Ni,3n){sup 109}Xe and studied using the Recoil Mass Spectrometer at the Holifield Radioactive Ion Beam Facility. Two transitions at E{sub {alpha}}=4062{+-}7 keV and E{sub {alpha}}=3918{+-}9 keV were interpreted as the l=2 and l=0 transitions from the 7/2{sup +} ground state in {sup 109}Xe (T{sub 1/2}=13{+-}2 ms) to the 5/2{sup +} ground state and a 7/2{sup +} excited state, located at 150{+-}13 keV in {sup 105}Te. The observation of the subsequent decay of {sup 105}Te marks the discovery of the lightest known {alpha}-decaying nucleus. The measured transition energy E{sub {alpha}}=4703{+-}5 keV and half-life T{sub 1/2}=620{+-}70 ns were used to determine the reduced {alpha}-decay width {delta}{sup 2}. The ratio {delta}{sub {sup 105}Te}{sup 2}/{delta}{sub {sup 213}Po}{sup 2} of {approx}3 indicates a superallowed character of the {alpha} emission from {sup 105}Te.

  7. The C-terminal region of alpha-crystallin: involvement in protection against heat-induced denaturation

    NASA Technical Reports Server (NTRS)

    Takemoto, L.; Emmons, T.; Horwitz, J.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    Recent studies have demonstrated that the alpha-crystallins can protect other proteins against heat-induced denaturation and aggregation. To determine the possible involvement of the C-terminal region in this activity, the alpha-crystallins were subjected to limited tryptic digestion, and the amount of cleavage from the N-terminal and C-terminal regions of the alpha-A and alpha-B crystallin chains was assessed using antisera specific for these regions. Limited tryptic digestion resulted in cleavage only from the C-terminal region of alpha-A crystallin. This trypsin-treated alpha-A crystallin preparation showed a decreased ability to protect proteins from heat-induced aggregation using an in vitro assay. Together, these results demonstrate that the C-terminal region of alpha-A crystallin is important for its ability to protect against heat-induced aggregation, which is consistent with the hypothesis that post-translational changes that are known to occur at the C-terminal region may have significant effects on the ability of alpha-A crystallin to protect against protein denaturation in vivo.

  8. TNF-alpha/cycloheximide-induced apoptosis in intestinal epithelial cells requires Rac1-regulated reactive oxygen species.

    PubMed

    Jin, Shi; Ray, Ramesh M; Johnson, Leonard R

    2008-04-01

    Previously we have shown that both Rac1 and c-Jun NH(2)-terminal kinase (JNK1/2) are key proapoptotic molecules in tumor necrosis factor (TNF)-alpha/cycloheximide (CHX)-induced apoptosis in intestinal epithelial cells, whereas the role of reactive oxygen species (ROS) in apoptosis is unclear. The present studies tested the hypothesis that Rac1-mediated ROS production is involved in TNF-alpha-induced apoptosis. In this study, we showed that TNF-alpha/CHX-induced ROS production and hydrogen peroxide (H(2)O(2))-induced oxidative stress increased apoptosis. Inhibition of Rac1 by a specific inhibitor NSC23766 prevented TNF-alpha-induced ROS production. The antioxidant, N-acetylcysteine (NAC), or rotenone (Rot), the mitochondrial electron transport chain inhibitor, attenuated mitochondrial ROS production and apoptosis. Rot also prevented JNK1/2 activation during apoptosis. Inhibition of Rac1 by expression of dominant negative Rac1 decreased TNF-alpha-induced mitochondrial ROS production. Moreover, TNF-alpha-induced cytosolic ROS production was inhibited by Rac1 inhibition, diphenyleneiodonium (DPI, an inhibitor of NADPH oxidase), and NAC. In addition, DPI inhibited TNF-alpha-induced apoptosis as judged by morphological changes, DNA fragmentation, and JNK1/2 activation. Mitochondrial membrane potential change is Rac1 or cytosolic ROS dependent. Lastly, all ROS inhibitors inhibited caspase-3 activity. Thus these results indicate that TNF-alpha-induced apoptosis requires Rac1-dependent ROS production in intestinal epithelial cells.

  9. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  10. Advances in single chain technology.

    PubMed

    Gonzalez-Burgos, Marina; Latorre-Sanchez, Alejandro; Pomposo, José A

    2015-10-01

    The recent ability to manipulate and visualize single atoms at atomic level has given rise to modern bottom-up nanotechnology. Similar exquisite degree of control at the individual polymeric chain level for producing functional soft nanoentities is expected to become a reality in the next few years through the full development of so-called "single chain technology". Ultra-small unimolecular soft nano-objects endowed with useful, autonomous and smart functions are the expected, long-term valuable output of single chain technology. This review covers the recent advances in single chain technology for the construction of soft nano-objects via chain compaction, with an emphasis in dynamic, letter-shaped and compositionally unsymmetrical single rings, complex multi-ring systems, single chain nanoparticles, tadpoles, dumbbells and hairpins, as well as the potential end-use applications of individual soft nano-objects endowed with useful functions in catalysis, sensing, drug delivery and other uses. PMID:26505056

  11. Advances in single chain technology.

    PubMed

    Gonzalez-Burgos, Marina; Latorre-Sanchez, Alejandro; Pomposo, José A

    2015-10-01

    The recent ability to manipulate and visualize single atoms at atomic level has given rise to modern bottom-up nanotechnology. Similar exquisite degree of control at the individual polymeric chain level for producing functional soft nanoentities is expected to become a reality in the next few years through the full development of so-called "single chain technology". Ultra-small unimolecular soft nano-objects endowed with useful, autonomous and smart functions are the expected, long-term valuable output of single chain technology. This review covers the recent advances in single chain technology for the construction of soft nano-objects via chain compaction, with an emphasis in dynamic, letter-shaped and compositionally unsymmetrical single rings, complex multi-ring systems, single chain nanoparticles, tadpoles, dumbbells and hairpins, as well as the potential end-use applications of individual soft nano-objects endowed with useful functions in catalysis, sensing, drug delivery and other uses.

  12. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  13. Differential Recognition of CD1d-[alpha]-Galactosyl Ceramide by the V[beta]8.2 and V[beta]7 Semi-invariant NKT T Cell Receptors

    SciTech Connect

    Pellicci, Daniel G.; Patel, Onisha; Kjer-Nielsen, Lars; Pang, Siew Siew; Sullivan, Lucy C.; Kyparissoudis, Konstantinos; Brooks, Andrew G.; Reid, Hugh H.; Gras, Stephanie; Lucet, Isabelle S.; Koh, Ruide; Smyth, Mark J.; Mallevaey, Thierry; Matsuda, Jennifer L.; Gapin, Laurent; McCluskey, James; Godfrey, Dale I.; Rossjohn, Jamie; PMCI-A; Monash; UCHSC; Melbourne

    2009-09-02

    The semi-invariant natural killer T cell receptor (NKT TCR) recognizes CD1d-lipid antigens. Although the TCR{alpha} chain is typically invariant, the {beta} chain expression is more diverse, where three V{beta} chains are commonly expressed in mice. We report the structures of V{alpha}14-V{beta}8.2 and V{alpha}14-V{beta}7 NKT TCRs in complex with CD1d-{alpha}-galactosylceramide ({alpha}-GalCer) and the 2.5 {angstrom} structure of the human NKT TCR-CD1d-{alpha}-GalCer complex. Both V{beta}8.2 and V{beta}7 NKT TCRs and the human NKT TCR ligated CD1d-{alpha}-GalCer in a similar manner, highlighting the evolutionarily conserved interaction. However, differences within the V{beta} domains of the V{beta}8.2 and V{beta}7 NKT TCR-CD1d complexes resulted in altered TCR{beta}-CD1d-mediated contacts and modulated recognition mediated by the invariant {alpha} chain. Mutagenesis studies revealed the differing contributions of V{beta}8.2 and V{beta}7 residues within the CDR2{beta} loop in mediating contacts with CD1d. Collectively we provide a structural basis for the differential NKT TCR V{beta} usage in NKT cells.

  14. Alpha-keto acids are novel siderophores in the genera Proteus, Providencia, and Morganella and are produced by amino acid deaminases.

    PubMed Central

    Drechsel, H; Thieken, A; Reissbrodt, R; Jung, G; Winkelmann, G

    1993-01-01

    Growth promotion and iron transport studies revealed that certain alpha-keto acids generated by amino acid deaminases, by enterobacteria of the Proteus-Providencia-Morganella group (of the tribe Proteeae), show significant siderophore activity. Their iron-binding properties were confirmed by the chrome azurol S assay and UV spectra. These compounds form ligand-to-metal charge transfer bands in the range of 400 to 500 nm. Additional absorption bands of the enolized ligands at 500 to 700 nm are responsible for color formation. Siderophore activity was most pronounced with alpha-keto acids possessing an aromatic or heteroaromatic side chain, like phenylpyruvic acid and indolylpyruvic acid, resulting from deamination of phenylalanine and tryptophan, respectively. In addition, alpha-keto acids possessing longer nonpolar side chains, like alpha-ketoisocaproic acid or alpha-ketoisovaleric acid and even alpha-ketoadipic acid, also showed siderophore activity which was absent or negligible with smaller alpha-keto acids or those possessing polar functional groups, like pyruvic acid, alpha-ketobutyric acid, or alpha-ketoglutaric acid. The fact that deaminase-negative enterobacteria, like Escherichia coli and Salmonella spp., could not utilize alpha-keto acids supports the view that specific iron-carboxylate transport systems have evolved in members of the tribe Proteeae and are designed to recognize ferric complexes of both alpha-hydroxy acids and alpha-keto acids, of which the latter can easily be generated by L-amino acid deaminases in an amino acid-rich medium. Exogenous siderophores, like ferric hydroxamates (ferrichromes) and ferric polycarboxylates (rhizoferrin and citrate), were also utilized by members of the tribe Proteeae. Images PMID:8478334

  15. Chain-Chain Interaction between Surfactant Monolayers and long-chain Alkanes and Alcohols

    NASA Astrophysics Data System (ADS)

    Miranda, Paulo; Pflumio, V.; Saijo, H.; Shen, Y. R.

    1997-03-01

    Infrared-Visible Sum-frequency Vibrational Spectroscopy is used to study various self-assembled surfactant monolayers adsorbed at interfaces between fused quartz and liquid alkanes and alcohols. Information about chain conformation can be deduced from the polarization-dependent spectra. Changing the chain lengths of both alkanes and surfactants, we find that if both are sufficiently long, the amount of trans-gauche defects of the surfactant chains can be significantly reduced, via the chain-chain interaction. This, however, will not happen if the surfactant monolayer has too low a surface density. In the case of long-chain alcohols, the alcohol molecules form a hydrogen-bonding network at the interface. To minimize disruption of this network, the surfactant chains become highly disordered and folded into a compact conformation, to reduce their surface area exposed to the alcohol (hydrophobic effect). However, for a sufficiently long alcohol dissolved in a non-polar solvent, the hydrogen-bonding network is disrupted. The alcohol molecules appear to adsorb at the interface and straighten the surfactant chains via the chain-chain interaction. Work supported by DOE under contract No DE-AC03-76SF00098.

  16. Alpha2A adrenergic receptor activation inhibits epileptiform activity in the rat hippocampal CA3 region.

    PubMed

    Jurgens, Chris W D; Hammad, Hana M; Lichter, Jessica A; Boese, Sarah J; Nelson, Brian W; Goldenstein, Brianna L; Davis, Kylie L; Xu, Ke; Hillman, Kristin L; Porter, James E; Doze, Van A

    2007-06-01

    Norepinephrine has potent antiepileptic properties, the pharmacology of which is unclear. Under conditions in which GABAergic inhibition is blocked, norepinephrine reduces hippocampal cornu ammonis 3 (CA3) epileptiform activity through alpha(2) adrenergic receptor (AR) activation on pyramidal cells. In this study, we investigated which alpha(2)AR subtype(s) mediates this effect. First, alpha(2)AR genomic expression patterns of 25 rat CA3 pyramidal cells were determined using real-time single-cell reverse transcription-polymerase chain reaction, demonstrating that 12 cells expressed alpha(2A)AR transcript; 3 of the 12 cells additionally expressed mRNA for alpha(2C)AR subtype and no cells possessing alpha(2B)AR mRNA. Hippocampal CA3 epileptiform activity was then examined using field potential recordings in brain slices. The selective alphaAR agonist 6-fluoronorepinephrine caused a reduction of CA3 epileptiform activity, as measured by decreased frequency of spontaneous epileptiform bursts. In the presence of betaAR blockade, concentration-response curves for AR agonists suggest that an alpha(2)AR mediates this response, as the rank order of potency was 5-bromo-N-(4,5-dihydro-1H-imidazol-2-yl)-6-quinoxalinamine (UK-14304) >or= epinephrine >6-fluoronorepinephrine > norepinephrine > phenylephrine. Finally, equilibrium dissociation constants (K(b)) of selective alphaAR antagonists were functionally determined to confirm the specific alpha(2)AR subtype inhibiting CA3 epileptiform activity. Apparent K(b) values calculated for atipamezole (1.7 nM), MK-912 (4.8 nM), BRL-44408 (15 nM), yohimbine (63 nM), ARC-239 (540 nM), prazosin (4900 nM), and terazosin (5000 nM) correlated best with affinities previously determined for the alpha(2A)AR subtype (r = 0.99, slope = 1.0). These results suggest that, under conditions of impaired GABAergic inhibition, activation of alpha(2A)ARs is primarily responsible for the antiepileptic actions of norepinephrine in the rat hippocampal CA3

  17. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  18. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  19. Structure of the main oligomannoside chains of the hemagglutinin of the influenza virus A/Leningrad/385/80/ (H3N2)

    SciTech Connect

    Arbatskii, N.P.; Shashkov, A.S.; Zheltova, A.O.; Yurtov, D.V.; Derevitskaya, V.A.; Kochetkov, N.K.

    1986-09-01

    The structure of the four main oligomannoside carbohydrate chains from the hemagglutinin of the influenza virus A/Leningrad/385/80 (H3N2) have been established with the aid of /sup 1/H NMR spectroscopy. On the basis of the results obtained, the hypothesis has been put forward that the splitting out by ..cap alpha..-mannosidase I of four ..cap alpha..-1- ..-->.. 2-bound mannose residues in the transformation of the oligomannoside chain into a complex one is the limiting and selective stage of the processing of the carbohydrate chains in the biosynthesis of glycoproteins.

  20. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  1. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  2. Myosin heavy chain expression in rabbit masseter muscle during postnatal development.

    PubMed Central

    Bredman, J J; Weijs, W A; Korfage, H A; Brugman, P; Moorman, A F

    1992-01-01

    The expression of isoforms of myosin heavy chain (MHC) during postnatal development was studied in the masseter muscle of the rabbit. Evidence is presented that in addition to adult fast and slow myosin, the rabbit masseter contains neonatal and 'cardiac' alpha-MHC. During postnatal growth myosin transitions take place from neonatal and fast (IIA, IIA/IIB--referring to a fibre containing both IIA and IIB MHCs) MHC to adult 'cardiac' alpha-MHC and I/alpha-MHC. Since there is a temporary population of fibres containing IIA/alpha-MHC during the first 4 wk of development with a peak in the 3rd to 4th wk, the transition from IIA-MHC to alpha-MHC may occur in these IIA/alpha-MHC-containing fibres. The appearance of 'cardiac' alpha-MHC coincides with the timing of weaning, suggesting that the changes in MHC content, that probably result in a transition to a lower speed of contraction, have functional significance related to weaning. The finding of neonatal MHC in adult rabbits indicates that the masseter develops at a rate and in a way that is distinct from most other skeletal muscles. A spatiotemporal variation in expression of myosin isozymes within the masseter was observed, with many fibres containing more than one myosin type, indicating developmentally regulated spatial differences in function. Images Fig. 2 Fig. 3 Fig. 4 Fig. 7 PMID:1387129

  3. Collagen chains detected by western blotting using a /sup 125/I-labeled 45K fragment of fibronectin (45K FN)

    SciTech Connect

    Ristagno, R.; Heimer, R.; Fishman, A.P.; Sampson, P.M.

    1987-05-01

    The objective was to improve the sensitivity and specificity of detection of unlabeled collagen chains in biologic fluids. Chains of Types I,II,III,IV and XI (1..cap alpha..2..cap alpha..3..cap alpha..) collagen were separated by SDS PAGE. Their complete transfer to nitrocellulose was obtained by electrophoresis for 16 h at 150 mA with 10 mM Tris, 117 mM glycine, 100 mM cysteine, 0.1% SDS and 10% methanol. The 45K FN was prepared by chymotryptic digestion of fibronectin adsorbed to gelatin-Sepharose, followed by elution with 1.2 M urea, 1 M Tris-NaCl, pH 8.3 and iodination. When exposed to the nitrocellulose transblot at pH 9.5 and 4/sup 0/C, 45K FN did not react with IgG, fibrinogen, myosin, albumin or carbonic anhydrase. These proteins interfere in the assay under conditions of lower pH and higher temperature. The autoradiographs of the transblots were evaluated by densitometry and reflected results also obtained by dot blotting, that chains of collagen Types I,II,III were detectable at 4 ng and those of collagen Type IV at 12 ng. Generally, ..cap alpha..,BETA, and ..gamma.. chains were detectable. The 45K FN reacted equally with ..cap alpha..1(I) and ..cap alpha..2(I), but for Type XI the 1..cap alpha.. chain had considerably more reactivity than 2..cap alpha.. or 3..cap alpha... As the 45K FN was specific for collagens added to plasma, the authors method appears useful for qualitative and quantitative assays of unlabeled collagens in biologic fluids.

  4. Structure and binding kinetics of three different human CD1d-alpha-galactosylceramide-specific T cell receptors.

    PubMed

    Gadola, Stephan D; Koch, Michael; Marles-Wright, Jon; Lissin, Nikolai M; Shepherd, Dawn; Matulis, Gediminas; Harlos, Karl; Villiger, Peter M; Stuart, David I; Jakobsen, Bent K; Cerundolo, Vincenzo; Jones, E Yvonne

    2006-03-20

    Invariant human TCR Valpha24-Jalpha18+/Vbeta11+ NKT cells (iNKT) are restricted by CD1d-alpha-glycosylceramides. We analyzed crystal structures and binding characteristics for an iNKT TCR plus two CD1d-alpha-GalCer-specific Vbeta11+ TCRs that use different TCR Valpha chains. The results were similar to those previously reported for MHC-peptide-specific TCRs, illustrating the versatility of the TCR platform. Docking TCR and CD1d-alpha-GalCer structures provided plausible insights into their interaction. The model supports a diagonal orientation of TCR on CD1d and suggests that complementarity determining region (CDR)3alpha, CDR3beta, and CDR1beta interact with ligands presented by CD1d, whereas CDR2beta binds to the CD1d alpha1 helix. This docking provides an explanation for the dominant usage of Vbeta11 and Vbeta8.2 chains by human and mouse iNKT cells, respectively, for recognition of CD1d-alpha-GalCer.

  5. Regulation of valine and. alpha. -ketoisocaproate metabolism in rat kidney mitochondria

    SciTech Connect

    Miller, R.H.; Harper, A.E. )

    1988-10-01

    Activities of branched-chain amino acid (BCAA) aminotransferase (BCAT) and {alpha}-keto acid dehydrogenase (BCKD) were assayed in mitochondria isolated from kidneys of rats. Rates of transamination of valine and oxidation of keto acids {alpha}-ketoisocaproate (KIC) or {alpha}-ketoisovalerate (KIV) were estimated using radioactive tracers of the appropriate substrate from amounts of {sup 14}C-labeled products formed. Because of the high mitochondrial BCAT activity, an amino acceptor for BCAT, {alpha}-ketoglutarate ({alpha}-KG) or KIC, was added to the assay medium when valine was the substrate. Rates of valine transamination and subsequent oxidation of the KIV formed were determined with 0.5 mM {alpha}-KG as the amino acceptor; these rates were 5- to 50-fold those without added {alpha}-KG. Rates of CO{sub 2} evolution from valine also increased when KIC was present; however, with KIC concentrations above 0.2 mM, rates of CO{sub 2} evolution from valine declined although rates of transamination continued to rise. When 0.05 mM KIC was added to the assay medium, oxidation of KIC was suppressed by inclusion of valine or glutamate in the medium. When valine was present KIC was not oxidized preferentially, presumably because it was also serving as an amino acceptor for BCAT. These results indicate that as the supply of amino acceptor, {alpha}-KG or KIC, is increased in mitochondria not only is the rate of valine transamination stimulated but also the rate of oxidation of the KIV formed from valine. Thus the rate of oxidation of BCAA can be controlled by factors that influence the rate and direction of BCAA transamination and, thereby, the supply of substrate for BCKD.

  6. Protein phylogeny of translation elongation factor EF-1 alpha suggests microsporidians are extremely ancient eukaryotes.

    PubMed

    Kamaishi, T; Hashimoto, T; Nakamura, Y; Nakamura, F; Murata, S; Okada, N; Okamoto, K; Shimizu, M; Hasegawa, M

    1996-02-01

    Partial regions of the mRNA encoding a major part of translation elongation factor 1 alpha (EF-1 alpha) from a mitochondrion-lacking protozoan, Glugea plecoglossi, that belongs to microsporidians, were amplified by polymerase chain reaction (PCR) and their primary structures were analyzed. The deduced amino acid sequence was highly divergent from typical EF-1 alpha's of eukaryotes, although it clearly showed a eukaryotic feature when aligned with homologs of the three primary kingdoms. Maximum likelihood (ML) analyses on the basis of six different stochastic models of amino acid substitutions and a maximum parsimony (MP) analysis consistently suggest that among eukaryotic species being analyzed, G. plecoglossi is likely to represent the earliest offshoot of eukaryotes. Microsporidians might be the extremely ancient eukaryotes which have diverged before an occurrence of mitochondrial symbiosis. PMID:8919877

  7. Chain Dynamics in Magnetorheological Suspensions

    NASA Technical Reports Server (NTRS)

    Gast, A. P.; Furst, E. M.

    1999-01-01

    Magnetorheological (MR) suspensions are composed of colloidal particles which acquire dipole moments when subjected to an external magnetic field. At sufficient field strengths and concentrations, the dipolar particles rapidly aggregate to form long chains. Subsequent lateral cross-linking of the dipolar chains is responsible for a rapid liquid-to-solid-like rheological transition. The unique, magnetically-activated rheological properties of MR suspensions make them ideal for interfacing mechanical systems to electronic controls. Additionally, the ability to experimentally probe colloidal suspensions interacting through tunable anisotropic potentials is of fundamental interest. Our current experimental work has focused on understanding the fluctuations of dipolar chains. It has been proposed by Halsey and Toor (HT) that the strong Landau-Peierls thermal fluctuations of dipolar chains could be responsible for long-range attractions between chains. Such interactions will govern the long-time relaxation of MR suspensions. We have synthesized monodisperse neutrally buoyant MR suspensions by density matching stabilized ferrofluid emulsion droplets with D2O. This allows us to probe the dynamics of the dipolar chains using light scattering without gravitational, interfacial, and polydispersity effects to resolve the short-wavelength dynamics of the dipolar chains. We used diffusing wave spectroscopy to measure these dynamics. The particle displacements at short times that show an independence to the field strength, but at long times exhibit a constrained, sub-diffusive motion that slows as the dipole strength is increased. The experiments are in good qualitative agreement with Brownian dynamics simulations of dipolar chains. Although there have been several important and detailed studies of the structure and interactions in MR suspensions, there has not been conclusive evidence that supports or contradicts the HT model prediction that long-range interactions exist between

  8. Simulation of coherent energy transfer in an alpha-helical peptide by Fermi resonance.

    PubMed Central

    Clarke, D L; Collins, M A

    1992-01-01

    A mechanism by which NH stretching quanta are coherently transported along a chain of hydrogen bonded peptide groups is demonstrated by classical simulation of a section of the alpha-helical peptide poly(L-alanine). Vibrational motion takes place on a complex energy surface constructed from earlier ab initio and empirical surfaces. A speculative hypothesis of the biological role of this mechanism is presented, and the critical parameters governing the dynamics are identified and discussed. Images FIGURE 1 PMID:1547322

  9. Phytanic acid alpha-oxidase deficiency (Refsum disease) presenting in infancy.

    PubMed

    Herbert, M A; Clayton, P T

    1994-01-01

    This report describes a patient with high serum phytanic acid concentration due to phytanic acid alpha-oxidase deficiency (classical Refsum disease). He presented unusually early, hypotonia and developmental delay being apparent by 7 months. A generalized peroxisomal disorder (so-called 'infantile Refsum disease') was excluded by analyses of pristanic acid, very long-chain fatty acids, bile acids and plasmalogen synthesis. The early presentation raises the possibility of in utero exposure to phytanate.

  10. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  11. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  12. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  13. Peroxisomal beta-oxidation of branched chain fatty acids in rat liver. Evidence that carnitine palmitoyltransferase I prevents transport of branched chain fatty acids into mitochondria.

    PubMed

    Singh, H; Beckman, K; Poulos, A

    1994-04-01

    Fatty acid beta-oxidation was investigated in highly purified mitochondrial and peroxisomal preparations from rat liver. Under isotonic conditions, pristanic and homophytanic acid beta-oxidation in purified peroxisomes was severalfold greater compared to the oxidation in purified mitochondria. Branched chain fatty acid beta-oxidation in purified mitochondria was very low, and the oxidation was not stimulated by exogenous L-carnitine or L-malate. In contrast, stearic acid beta-oxidation by purified mitochondria depended upon exogenous L-carnitine, and the oxidation was stimulated by L-malate. Both mitochondrial and peroxisomal beta-oxidation of branched chain fatty acids was strongly inhibited by fatty acid-free bovine serum albumin, whereas stearic acid oxidation was either unaffected or slightly inhibited by bovine serum albumin. The results presented clearly indicate that branched chain fatty acids are mainly degraded in peroxisomes in rat liver. Branched chain fatty acids were efficiently converted to coenzyme A thioesters by purified mitochondria, peroxisomes, and microsomes. Although pristanic and phytanic acids were rapidly converted to pristanoyl-CoA and phytanoyl-CoA, respectively, they were not converted to carnitine esters by mitochondrial outer membranes. The results indicate that acyl-CoA synthetase and carnitine acyltransferase located at the mitochondrial outer membranes regulate entry of branched chain fatty acids into mitochondria. Mitochondrial carnitine acyltransferase I appears to be highly specific for straight chain fatty acids and restricts entry of branched chain fatty acids into mitochondria. Thus, branched chain fatty acids which cannot be transported across the mitochondrial membranes via the carnitine acyltransferase system are directed to peroxisomes for beta-oxidation. The results reported indicate that phytanic acid, the fatty acid which can be initially degraded by alpha-oxidation due to the presence of a beta-methyl group in the

  14. Carbohydrate chains on yeast carboxypeptidase Y are phosphorylated.

    PubMed Central

    Hashimoto, C; Cohen, R E; Zhang, W J; Ballou, C E

    1981-01-01

    Carboxypeptidase Y, a vacuolar enzyme from Saccharomyces cerevisiae, was digested with endo-beta-N-acetyl-D-glucosaminidase H to release the four oligosaccharide chains that are linked to asparagine in the glycoprotein. The oligosaccharides were fractionated into a neutral and acidic component, and the latter proved to phosphorylated. From its gel filtration pattern, the neutral fraction was shown to be a mixture of at least four homologs, the smallest of which had a proton NMR spectrum almost identical to that given by an IgM oligosaccharide with eight mannoses and one N-acetylglucosamine [Cohen, R. E. & Ballou, C. E. (1980) Biochemistry 19, 4345--4358]. The yeast oligosaccharide has one additional mannose unit in an alpha 1 leads to 3 or alpha 1 leads to 6 linkage, whereas the larger homologs appear to have two, three, and four more mannose units. One phosphorylated oligosaccharides with a mannose/phosphate ratio of 12.5 was reduced with NaB3H4 and then subjected to mild acid hydrolysis. This released mannose and mannobiose that were glycosidically linked to the phosphate group, whereas complete acid hydrolysis yielded D-mannose 6-phosphate. The recovered oligosaccharide phosphomonoester, which contained 11 or 12 mannose units, was digested exhaustively with alpha-mannosidase, and the product of this reaction was treated with alkaline phosphatase, which yielded radioactive Man3GlcNAcH2. These results suggest that the mannosidase-resistant phosphorylated oligosaccharide has the structure Man leads to P leads to 6 alpha Man leads to alpha Man leads to 6 beta Man leads to 4GlcNAcH2, in which some of the phosphate groups are substituted with mannobiose instead of mannose. A second phosphorylated oligosaccharide with a mannose/phosphate ratio of 6.5 probably contains two phosphodiester groups, but its structure has not been investigated in detail. Images PMID:7017728

  15. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  16. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  17. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  18. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  19. Building an efficient supply chain.

    PubMed

    Scalise, Dagmara

    2005-08-01

    Realizing at last that supply chain management can produce efficiencies and save costs, hospitals are beginning to adopt practices from other industries, such as the concept of extended supply chains, to improve product flow. They're also investing in enterprise planning resource software, radio frequency identification and other technologies, using quality data to drive standardization and streamlining processes.

  20. Verifying the Hanging Chain Model

    ERIC Educational Resources Information Center

    Karls, Michael A.

    2013-01-01

    The wave equation with variable tension is a classic partial differential equation that can be used to describe the horizontal displacements of a vertical hanging chain with one end fixed and the other end free to move. Using a web camera and TRACKER software to record displacement data from a vibrating hanging chain, we verify a modified version…

  1. Soluble interleukin-15 receptor alpha (IL-15R alpha)-sushi as a selective and potent agonist of IL-15 action through IL-15R beta/gamma. Hyperagonist IL-15 x IL-15R alpha fusion proteins.

    PubMed

    Mortier, Erwan; Quéméner, Agnès; Vusio, Patricia; Lorenzen, Inken; Boublik, Yvan; Grötzinger, Joachim; Plet, Ariane; Jacques, Yannick

    2006-01-20

    Interleukin-15 (IL-15) is crucial for the generation of multiple lymphocyte subsets (natural killer (NK), NK-T cells, and memory CD8 T cells), and transpresentation of IL-15 by monocytes and dendritic cells has been suggested to be the dominant activating process of these lymphocytes. We have previously shown that a natural soluble form of IL-15R alpha chain corresponding to the entire extracellular domain of IL-15R alpha behaves as a high affinity IL-15 antagonist. In sharp contrast with this finding, we demonstrate in this report that a recombinant, soluble sushi domain of IL-15R alpha, which bears most of the binding affinity for IL-15, behaves as a potent IL-15 agonist by enhancing its binding and biological effects (proliferation and protection from apoptosis) through the IL-15R beta/gamma heterodimer, whereas it does not affect IL-15 binding and function of the tripartite IL-15R alpha/beta/gamma membrane receptor. Our results suggest that, if naturally produced, such soluble sushi domains might be involved in the IL-15 transpresentation mechanism. Fusion proteins (RLI and ILR), in which IL-15 and IL-15R alpha-sushi are attached by a flexible linker, are even more potent than the combination of IL-15 plus sIL-15R alpha-sushi. After binding to IL-15R beta/gamma, RLI is internalized and induces a biological response very similar to the IL-15 high affinity response. Such hyper-IL-15 fusion proteins appear to constitute potent adjuvants for the expansion of lymphocyte subsets.

  2. Developing sustainable food supply chains.

    PubMed

    Smith, B Gail

    2008-02-27

    This paper reviews the opportunities available for food businesses to encourage consumers to eat healthier and more nutritious diets, to invest in more sustainable manufacturing and distribution systems and to develop procurement systems based on more sustainable forms of agriculture. The important factors in developing more sustainable supply chains are identified as the type of supply chain involved and the individual business attitude to extending responsibility for product quality into social and environmental performance within their own supply chains. Interpersonal trust and working to standards are both important to build more sustainable local and many conserved food supply chains, but inadequate to transform mainstream agriculture and raw material supplies to the manufactured and commodity food markets. Cooperation among food manufacturers, retailers, NGOs, governmental and farmers' organizations is vital in order to raise standards for some supply chains and to enable farmers to adopt more sustainable agricultural practices. PMID:17766237

  3. Synthesis of 24-nor-5 beta-cholan-23-oic acid derivatives: a convenient and efficient one-carbon degradation of the side chain of natural bile acids.

    PubMed

    Schteingart, C D; Hofmann, A F

    1988-10-01

    An efficient procedure for obtaining nor-bile acids from natural (C24) bile acids is described. Treatment of formylated bile acids with sodium nitrite in a mixture of trifluoroacetic anhydride with trifluoroacetic acid gives, through a "second order" Beckmann rearrangement, 24-nor-23-nitriles. These compounds, on alkaline hydrolysis, afford the corresponding nor-bile acids in high yields. The sequence was successfully applied to the synthesis of 3 alpha-hydroxy-24-nor-5 beta-cholan-23-oic (norlithocholic) acid, 3 alpha,6 alpha- (norhyodeoxycholic), 3 alpha,7 alpha- (norchenodeoxycholic), 3 alpha,7 beta- (norursodeoxycholic), and 3 alpha,12 alpha-dihydroxy-24-nor-5 beta-cholan-23-oic (nordeoxycholic) acids, as well as 3 alpha,7 alpha,12 alpha-trihydroxy-24-nor-5 beta-cholan-23-oic (norcholic) acid. 13C-NMR spectra of their methyl esters are reported. The procedure provides a more rapid alternative to the Barbier-Wieland degradation for shortening by one methylene group the side chain of natural (C24) bile acids.

  4. Arrangement of Kv1 alpha subunits dictates sensitivity to tetraethylammonium.

    PubMed

    Al-Sabi, Ahmed; Shamotienko, Oleg; Dhochartaigh, Sorcha Ni; Muniyappa, Nagesh; Le Berre, Marie; Shaban, Hamdy; Wang, Jiafu; Sack, Jon T; Dolly, J Oliver

    2010-09-01

    Shaker-related Kv1 channels contain four channel-forming alpha subunits. Subfamily member Kv1.1 often occurs oligomerized with Kv1.2 alpha subunits in synaptic membranes, and so information was sought on the influence of their positions within tetramers on the channels' properties. Kv1.1 and 1.2 alpha genes were tandem linked in various arrangements, followed by expression as single-chain proteins in mammalian cells. As some concatenations reported previously seemed not to reliably position Kv1 subunits in their assemblies, the identity of expressed channels was methodically evaluated. Surface protein, isolated by biotinylation of intact transiently transfected HEK-293 cells, gave Kv1.1/1.2 reactivity on immunoblots with electrophoretic mobilities corresponding to full-length concatenated tetramers. There was no evidence of protein degradation, indicating that concatemers were delivered intact to the plasmalemma. Constructs with like genes adjacent (Kv1.1-1.1-1.2-1.2 or Kv1.2-1.2-1.1-1.1) yielded delayed-rectifying, voltage-dependent K(+) currents with activation parameters and inactivation kinetics slightly different from the diagonally positioned genes (Kv1.1-1.2-1.1-1.2 or 1.2-1.1-1.2-1.1). Pore-blocking petidergic toxins, alpha dendrotoxin, agitoxin-1, tityustoxin-Kalpha, and kaliotoxin, were unable to distinguish between the adjacent and diagonal concatamers. Unprecedentedly, external application of the pore-blocker tetraethylammonium (TEA) differentially inhibited the adjacent versus diagonal subunit arrangements, with diagonal constructs having enhanced susceptibility. Concatenation did not directly alter the sensitivities of homomeric Kv1.1 or 1.2 channels to TEA or the toxins. TEA inhibition of currents generated by channels made up from dimers (Kv1.1-1.2 and/or Kv1.2-1.1) was similar to the adjacently arranged constructs. These collective findings indicate that assembly of alpha subunits can be directed by this optimized concatenation, and that subunit

  5. Alpha-tocopherol-doped irradiated UHMWPE for high fatigue resistance and low wear.

    PubMed

    Oral, Ebru; Wannomae, Keith K; Hawkins, Nathaniel; Harris, W H William H; Muratoglu, O K Orhun K

    2004-11-01

    Longevity of total joints has been compromised by wear and fatigue of ultrahigh molecular weight polyethylene (UHMWPE) components. Crosslinking reduces UHMWPE wear, but combined with postirradiation melting, also reduces its fatigue strength, therefore limiting its use in high-stress applications. We hypothesized that a lipophilic antioxidant (alpha-tocopherol, alpha-T) can protect UHMWPE against oxidation eliminating the need for postirradiation melting of crosslinked UHMWPE and improve its fatigue strength. To test these hypotheses, 65- and 100-kGy irradiated, alpha-T-doped and subsequently gamma-sterilized UHMWPE were used. (I) alpha-T-doped irradiated UHMWPEs showed significantly lower oxidation levels (0.48+/-0.25 and 0.44+/-0.06) compared to 100-kGy irradiated UHMWPE (3.74+/-0.16) after 5 weeks of accelerated aging at 80 degrees C in air. (II) Wear rate of alpha-T-doped irradiated UHMWPE (1.9+/-0.5, and 0.9+/-0.1mg/million cycles (MC) for 65- and 100-kGy irradiated UHMWPE, respectively) were comparable to that of 100-kGy irradiated/melted UHMWPE (1.1+/-0.7mg/million cycles). (III) The stress intensity factor at crack inception ( DeltaKi) of 100-kGy irradiated UHMWPE increased significantly upon doping with alpha-T from 0.74 to 0.87MPam(1/2) ( p<0.01 ). The DeltaKi for the 100-kGy irradiated and melted UHMWPE, currently in clinical use, was 0.55MPam(1/2). Doping with alpha-T eliminated the need for postirradiation melting to protect irradiated UHMWPE against long-term oxidation. The fatigue strength was improved by 58% for alpha-T-doped 100-kGy irradiated UHMWPE compared to irradiated and melted UHMWPE. The increase in oxidative stability of alpha-T-doped UHMWPE is attributed to the ability of alpha-T to react with peroxy free radicals on lipid chains and arrest the oxidation reactions. The improved fatigue strength is attributed to the increase in plasticity of UHMWPE due to the lipophilic nature of alpha-T.

  6. Neurofilament light chain

    PubMed Central

    Lu, Ching-Hua; Macdonald-Wallis, Corrie; Gray, Elizabeth; Pearce, Neil; Petzold, Axel; Norgren, Niklas; Giovannoni, Gavin; Fratta, Pietro; Sidle, Katie; Fish, Mark; Orrell, Richard; Howard, Robin; Talbot, Kevin; Greensmith, Linda; Kuhle, Jens

    2015-01-01

    Objective: To test blood and CSF neurofilament light chain (NfL) levels in relation to disease progression and survival in amyotrophic lateral sclerosis (ALS). Methods: Using an electrochemiluminescence immunoassay, NfL levels were measured in samples from 2 cohorts of patients with sporadic ALS and healthy controls, recruited in London (ALS/control, plasma: n = 103/42) and Oxford (ALS/control, serum: n = 64/36; paired CSF: n = 38/20). NfL levels in patients were measured at regular intervals for up to 3 years. Change in ALS Functional Rating Scale–Revised score was used to assess disease progression. Survival was evaluated using Cox regression and Kaplan–Meier analysis. Results: CSF, serum, and plasma NfL discriminated patients with ALS from healthy controls with high sensitivity (97%, 89%, 90%, respectively) and specificity (95%, 75%, 71%, respectively). CSF NfL was highly correlated with serum levels (r = 0.78, p < 0.0001). Blood NfL levels were approximately 4 times as high in patients with ALS compared with controls in both cohorts, and maintained a relatively constant expression during follow-up. Blood NfL levels at recruitment were strong, independent predictors of survival. The highest tertile of blood NfL at baseline had a mortality hazard ratio of 3.91 (95% confidence interval 1.98–7.94, p < 0.001). Conclusion: Blood-derived NfL level is an easily accessible biomarker with prognostic value in ALS. The individually relatively stable levels longitudinally offer potential for NfL as a pharmacodynamic biomarker in future therapeutic trials. Classification of evidence: This report provides Class III evidence that the NfL electrochemiluminescence immunoassay accurately distinguishes patients with sporadic ALS from healthy controls. PMID:25934855

  7. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  8. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  9. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  10. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  11. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  12. Self-consistent calculations of alpha-decay energies

    SciTech Connect

    Tolokonnikov, S. V.; Lutostansky, Yu. S.; Saperstein, E. E.

    2013-06-15

    On the basis of the self-consistent theory of finite Fermi systems, the energies of alphadecay chains were calculated for several new superheavy nuclei discovered recently in experiments of the Dubna-Livermore Collaboration headed by Yu.Ts. Oganessian. The approach in question is implemented on the basis of the generalized method of the density functional proposed by Fayans and his coauthors. The version used here relies on the functional DF3-a proposed recently for describing a wide array of nuclear data, including data on superheavy nuclei. A detailed comparison of the results obtained on this basis with the predictions of different approaches, including the self-consistent Skyrme-Hartree-Fock method, the micro-macro method in the version developed by Sobiczewski and his coauthors, and the phenomenological method of Liran and his coauthors, is performed. The resulting alpha-decay energies are used to calculate respective lifetimes with the aid of the phenomenological Parkhomenko-Sobiczewski formula.

  13. Gold Coated Lanthanide Phosphate Nanoparticles for Targeted Alpha Generator Radiotherapy

    SciTech Connect

    McLaughlin, Mark F; Woodward, Jonathan; Boll, Rose Ann; Wall, Jonathan; Rondinone, Adam Justin; Kennel, Steve J; Mirzadeh, Saed; Robertson, David J.

    2013-01-01

    Targeted radiotherapies maximize cytotoxicty to cancer cells. In vivo generators such as 225Ac, which emits four particles in its decay chain, can significantly amplify the radiation dose delivered to the target site. However, renal dose from unbound 213Bi escaping during the decay process limits the dose of 225Ac that can be administered. Traditional chelating moieties are unable to sequester the radioactive daughters because of the high recoil energy from alpha particle emission. To counter this, we demonstrate that an engineered multilayered nanoparticle-antibody conjugate can both deliver radiation and contain the decay daughters of the in vivo -generator 225Ac while targeting biologically relevant receptors. These multi-shell nanoparticles combine the radiation resistance of crystalline lanthanide phosphate to encapsulate and contain 225Ac and its radioactive decay daughters, the magnetic properties of gadolinium phosphate for easy separation, and established surface chemistry of gold for attachment of nanoparticles to targeting antibodies.

  14. Implication of alpha1-antichymotrypsin polymorphism in familial Alzheimer's disease.

    PubMed

    Nacmias, B; Marcon, G; Tedde, A; Forleo, P; Latorraca, S; Piacentini, S; Amaducci, L; Sorbi, S

    1998-03-13

    A common polymorphism in the alpha1-antichymotrypsin (ACT) gene has been shown to modify the Apolipoprotein E (ApoE) epsilon4-associated Alzheimer's disease (AD) risk identifying the combination of the ACT/AA and ApoE epsilon4/epsilon4 genotypes as a potential susceptibility marker for AD. Using the polymerase chain reaction, we analyzed the segregation of the ACT and ApoE polymorphisms in familial Alzheimer's disease (FAD) patients carrying mutations in Presenilin (PS) and APP genes and in both early onset (EO) and late onset (LO) FAD patients without known mutations. Our data suggest that ACT does not represent an additional risk factor for PS and APP mutated families. However, in LOFAD patients a high frequency of the combined ACT/AA and ApoE epsilon4/epsilon4 genotypes suggest that ACT may interact with ApoE and play a role in LOFAD. PMID:9572591

  15. Expansion of the. alpha. sub 2 -adrenergic receptor family: Cloning and characterization of a human. alpha. sub 2 -adrenergic receptor subtype, the gene for which is located on chromosome 2

    SciTech Connect

    Lomasney, J.W.; Lorenz, W.; Allen, L.F.; King, K.; Caron, M.G.; Lefkowitz, R.J. ); Regan, J.W. ); Yang-Feng, T.L. )

    1990-07-01

    Pharmacologic, biochemical, and genetic analyses have demonstrated the existence of multiple {alpha}{sub 2}-adrenergic receptor ({alpha}{sub 2}AR) subtypes. The authors have cloned a human {alpha}{sub 2}AR by using the polymerase chain reaction with oligonucleotide primers homologous to conserved regions of the previously cloned {alpha}{sub 2}ARs, the genes for which are located on human chromosomes 4 (C4) and 10 (C10). The deduced amino acid sequence encodes a protein of 450 amino acids whose putative topology is similar to that of the family of guanine nucleotide-binding protein-coupled receptors, but whose structure most closely resembles that of the {alpha}{sub 2}ARs. Competition curve analysis of the binding properties of the receptor expressed in COS-7 cells with a variety of adrenergic ligands demonstrates a unique {alpha}{sub 2}AR pharmacology. Hybridization with somatic cell hybrids shows that the gene for this receptor is located on chromosome 2. Northern blot analysis of various rat tissues shows expression in liver and kidney. The unique pharmacology and tissue localization of this receptor suggest that this is an {alpha}{sub 2}AR subtype not previously identified by classical pharmacological or ligand binding approaches.

  16. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  17. Description of two new alpha variants: Hb Canuts [alpha85(F6)Asp-->His (alpha1)] and Hb Ambroise Pare [alpha117(GH5)Phe-->Ile (alpha2)]; two new beta variants: Hb Beaujolais [beta84(EF8)Thr-->Asn] and Hb Monplaisir [beta147 (Tyr-Lys-Leu-Ala-Phe-Phe-Leu-Leu-Ser-Asn-Phe-Tyr-158-COOH)] and one new delta variant: Hb (A2)North Africa [delta59(E3)Lys-->Met].

    PubMed

    Joly, Philippe; Lacan, Philippe; Bererd, Martine; Garcia, Caroline; Zanella-Cleon, Isabelle; Becchi, Michel; Aubry, Martine; Couprie, Nicole; Francina, Alain

    2009-01-01

    We present here five new hemoglobin (Hb) variants which have been identified during routine Hb analysis before their genotypic characterization. Four of these result from a classical missense mutation: Hb Canuts [alpha85(F6)Asp-->His (alpha1)], Hb Ambroise Pare [alpha117(GH5)Phe-->Ile (alpha2)], Hb Beaujolais [beta84(EF8)Thr-->Asn] and HbA(2)-North Africa [delta59(E3)Lys-->Met]. The last one, Hb Monplaisir [beta147 (Tyr-Lys-Leu-Ala-Phe-Phe-Leu-Leu-Ser-Asn-Phe-Tyr-158-COOH)], results from a frameshift mutation at the stop codon of the beta-globin gene which leads to a modified C-terminal sequence in the beta-globin chain. None of these variants seem to have a particular clinical expression in the heterozygous state. The circumstances of the discovery of these five new Hb variants emphasize the fact that an association of techniques is necessary for a complete screening of Hb variants during routine Hb analysis. Globin chain separation by reversed phase liquid chromatography (RP-LC) appears to be the most relevant method.

  18. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  19. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  20. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect