Davis, T M; Parsons, C M; Utterback, P L; Kirstein, D
2015-05-01
Sixteen meat and bone meal (MBM) samples were obtained and selected from various company plants to provide a wide range in pepsin nitrogen digestibility values. Pepsin digestibility was determined using either 0.02 or 0.002% pepsin. Amino acid (AA) digestibility of the 16 MBM samples was then determined using a precision-fed cecectomized rooster assay. The 0.02% pepsin digestibility values were numerically higher than the 0.002% pepsin values. The values varied from 77 to 93% for 0.02% pepsin and from 67 to 91% for 0.002% pepsin. The rooster AA digestibility results showed a wide range of values among MBM samples mostly due to the 4 samples having lowest and highest AA digestibility. A precision-fed broiler chick ileal AA digestibility assay confirmed that there were large differences in AA digestibility among the MBM samples having the lowest and highest rooster digestibility values. Correlation analyses between pepsin and AA digestibility values showed that the correlation values (r) were highly significant (P < 0.0001) for all AA when all 16 MBM samples were included in the analysis. However, when the MBM samples with the 2 lowest and the 2 highest rooster digestibility values were not included in the correlation analyses, the correlation coefficient values (r) were generally very low and not significant (P > 0.05). The results indicated that the pepsin nitrogen digestibility assay is only useful for detecting large differences in AA digestibility among MBM. There also was no advantage for using 0.02 versus 0.002% pepsin. © 2015 Poultry Science Association Inc.
USDA-ARS?s Scientific Manuscript database
The objective of this study was to determine standardized AA digestibility of corn, corn gluten meal (CGM) and three distillers dried grains with solubles (DDGS) using the precision-fed cecectomized rooster assay (PFR), the standardized ileal AA broiler chicken assay (SIAAD), and a newly developed p...
Boucher, S E; Calsamiglia, S; Parsons, C M; Stein, H H; Stern, M D; Erickson, P S; Utterback, P L; Schwab, C G
2009-09-01
The objectives of this experiment were to measure intestinal digestibility of AA in rumen undegradable protein (RUP-AA) in soybean meal (SBM) and expeller SBM (SoyPlus, West Central, Ralston, IA; SP) and to determine if these feeds contain a constant protein fraction that is undegradable in the rumen and indigestible in the small intestine, as assumed in the French Institut National de la Recherche Agronomique (Paris, France) and Scandinavian AAT-PBV (AAT = AA absorbed from small intestine; PBV = protein balance in the rumen) models. Three samples of SBM and 3 samples of SP were obtained from the Feed Analysis Consortium Inc. (Savoy, IL). To obtain the RUP fraction, samples were ruminally incubated in situ for 16 h in 4 lactating cows, and the collected rumen undegraded residues (RUR) were pooled by sample. Subsamples of the intact feeds and RUR were crop intubated to 4 cecectomized roosters, and total excreta were collected for 48 h. Intact feeds, RUR, and excreta were analyzed for AA. Basal endogenous AA loss estimates were obtained from fasted birds and were used to calculate standardized digestibility of AA in the intact feeds and RUP-AA. Indigestibility coefficients of the intact feeds were calculated as (100 - % standardized AA digestibility), and indigestibility of the RUR was calculated as [(100 - % ruminal degradation of AA) x [(100 - % standardized RUP-AA digestibility)]/100]. Results indicated that standardized digestibility of feed-AA was similar to standardized digestibility of RUP-AA for SBM and SP samples and that standardized digestibility of individual AA differed within samples. Standardized feed-AA and RUP-AA digestibility values were lowest for Lys and Cys and highest for Trp and Met. Results also indicated that SBM and SP did not contain a constant protein fraction that was both undegradable in the rumen and indigestible in the small intestine. Indigestibility values of RUR were lower than in intact feeds, suggesting that SBM and SP contain a protein fraction that is indigestible in the intestine but partly degradable in the rumen, digestible in the intestine after ruminal incubation, or both.
Boucher, S E; Calsamiglia, S; Parsons, C M; Stein, H H; Stern, M D; Erickson, P S; Utterback, P L; Schwab, C G
2009-12-01
The objectives of this experiment were to measure intestinal digestibility of AA in the rumen-undegraded protein fraction (RUP-AA) of distillers dried grains with solubles (DDGS) and fish meal (FM) samples and to determine whether these feeds contain a constant protein fraction that is undegradable in the rumen and indigestible in the small intestine, as assumed in the French Institut National de la Recherche Agronomique (Paris, France) and Scandinavian AAT-PBV (AAT = AA absorbed from small intestine; PBV = protein balance in the rumen) models. Five sources of DDGS and 5 sources of FM were obtained from Feed Analysis Consortium, Inc. (Champaign, IL). To obtain the rumen-undegradable protein fraction, samples were ruminally incubated in situ for 16 h in 4 lactating cows, and the collected rumen-undegraded residues (RUR) were pooled by sample. Subsamples of the intact feeds and RUR were crop-intubated to 4 cecectomized roosters, and total excreta were collected for 48 h. Intact feeds, RUR, and excreta were analyzed for AA. Basal endogenous AA loss estimates were obtained from fasted birds and were used to calculate standardized digestibility of RUP-AA and AA in the intact feeds. Indigestibility coefficients of the intact feeds were calculated as (100 - % standardized AA digestibility), and indigestibility of the RUR was calculated as [(100 - % ruminal degradation of AA) x (100 - % standardized RUP-AA digestibility)/100]. Results indicate that standardized digestibility of feed-AA differs from RUP-AA for DDGS samples but not for FM samples, and that standardized digestibility of individual AA differs within samples. For the DDGS samples, standardized feed-AA and RUP-AA digestibility values were most often lowest for His and Lys and highest for Met and Trp. For FM samples, standardized feed-AA and RUP-AA digestibility values were most often lowest for His and highest for Trp. Results also indicate that DDGS and most FM samples do not contain a constant protein fraction that is both undegradable in the rumen and indigestible in the small intestine. Indigestibility values of RUR were lower than in intact feeds, suggesting that the feed ingredients used in this experiment contain a protein fraction that is indigestible in the intestine but partly degradable in the rumen or digestible in the intestine after rumen incubation, or both.
Boucher, S E; Calsamiglia, S; Parsons, C M; Stern, M D; Moreno, M Ruiz; Vázquez-Añón, M; Schwab, C G
2009-08-01
Three soybean meal, 3 SoyPlus (West Central Cooperative, Ralston, IA), 5 distillers dried grains with solubles, and 5 fish meal samples were used to evaluate the modified 3-step in vitro procedure (TSP) and the in vitro immobilized digestive enzyme assay (IDEA; Novus International Inc., St. Louis, MO) for estimating digestibility of AA in rumen-undegraded protein (RUP-AA). In a previous experiment, each sample was ruminally incubated in situ for 16 h, and in vivo digestibility of AA in the intact samples and in the rumen-undegraded residues (RUR) was obtained for all samples using the precision-fed cecectomized rooster assay. For the modified TSP, 5 g of RUR was weighed into polyester bags, which were then heat-sealed and placed into Daisy(II) incubator bottles. Samples were incubated in a pepsin/HCl solution followed by incubation in a pancreatin solution. After this incubation, residues remaining in the bags were analyzed for AA, and digestibility of RUP-AA was calculated based on disappearance from the bags. In vitro RUP-AA digestibility estimates obtained with this procedure were highly correlated to in vivo estimates. Corresponding intact feeds were also analyzed via the pepsin/pancreatin steps of the modified TSP. In vitro estimates of AA digestibility of the feeds were highly correlated to in vivo RUP-AA digestibility, which suggests that the feeds may not need to be ruminally incubated before determining RUP-AA digestibility in vitro. The RUR were also analyzed via the IDEA kits. The IDEA values of the RUR were good predictors of RUP-AA digestibility in soybean meal, SoyPlus, and distillers dried grains with solubles, but the IDEA values were not as good predictors of RUP-AA digestibility in fish meal. However, the IDEA values of intact feed samples were also determined and were highly correlated to in vivo RUP-AA digestibility for all feed types, suggesting that the IDEA value of intact feeds may be a better predictor of RUP-AA digestibility than the IDEA value of the RUR. In conclusion, the modified TSP and IDEA kits are good approaches for estimating RUP-AA digestibility in soybean meal products, distillers dried grains with solubles, and fish meal samples.
Fonseca, A C; Fredin, S M; Ferraretto, L F; Parsons, C M; Utterback, P L; Shaver, R D
2014-01-01
Microbial protein represents the majority of metabolizable protein absorbed by ruminant animals. Enhanced understanding of the AA digestibility of rumen microbes will improve estimates of metabolizable protein. The objective of this experiment was to determine the digestibility of AA in fluid- (FAB) and particle-associated bacteria (PAB) using the precision-fed cecectomized rooster bioassay. Bacteria were isolated from 4 ruminally cannulated lactating Holstein cows by differential centrifugation, including particle suspension in 0.1% Tween-80 for increased removal of PAB from ruminal digesta. Samples of FAB and PAB were fed to 9 cecectomized roosters to determine standardized digestibility of AA. Total AA digestibility was 76.8 and 75.5% for FAB and PAB, respectively, but did not differ. Differences existed in AA digestibilities within bacterial type when compared with the mean essential AA digestibility value. Compared with previous literature estimates of AA digestibility in microbes (mean = 76%; range = 57-87%) and relative to National Research Council estimates of total AA from rumen bacteria (80%), the precision-fed cecectomized rooster assay is an acceptable in vivo model to determine AA digestibility of rumen bacteria. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Comparative amino acid digestibility for broiler chickens and White Pekin ducks.
Kong, C; Adeola, O
2013-09-01
A total of 608 three-week-old male broiler chickens and White Pekin ducks were used in a 5-d trial to compare ileal amino acid (AA) digestibility of soybean meal (SBM) and canola meal (CM) using the regression method. A corn-casein-cornstarch-based diet was mixed to contain 15% CP. Cornstarch was replaced with test ingredient (SBM or CM) to contain 18 or 21% of CP in 4 other diets. A nitrogen-free diet (NFD) was used for standardization of apparent digestibility. Birds received a standard starter diet (23% CP) from d 0 to 14 posthatch and then 6 experimental diets for 5 d. On d 19 posthatch, birds were asphyxiated with CO(2), and digesta from the distal section of ileum was collected. The ileal digestibility of AA from the test ingredients was assessed by multiple linear regression analysis using data on daily apparent ileal digestible AA and total AA intakes. The basal endogenous losses of N and all AA for ducks were significantly higher than those for broilers. For ileal AA digestibility by regression of apparent digestible AA intake against AA intake, there was a higher (P < 0.05) digestibility for Cys and Pro in ducks compared with broilers (P < 0.05). Within species, digestibility was not different between SBM and CM except for Lys of ducks, and Lys and Pro of broilers (P < 0.05). The results of this study showed that ducks have higher basal endogenous AA losses compared with broiler chickens as well as higher ileal Cys and Pro digestibility estimates derived from regression approach, indicating that data obtained from broilers should not be used to formulate diets for ducks.
Zuber, T; Rodehutscord, M
2017-06-01
To optimize the use of corn grain in diets for laying hens, differences in amino acid (AA) digestibility and metabolizable energy among different corn samples should be considered in feed formulation. The present study investigated the variability of AA digestibility and AMEn concentration of 20 corn samples in cecectomized laying hens. Corn grains were characterized based on their physical properties (thousand seed weight, test weight, grain density, and extract viscoelasticity), chemical composition (proximate nutrients, AA, minerals, and inositol phosphates), gross energy concentration, and in vitro solubility of nitrogen to study any relationship with AA digestibility or AMEn. The animal study comprised 4 Latin squares (6 × 6) distributed between 2 subsequent runs. Cecectomized LSL-Classic hens were individually housed in metabolism cages and fed either a basal diet containing 500 g/kg cornstarch or one of 20 corn diets, each replacing the cornstarch with one corn batch, for 8 days. During the last 4 d, feed intake was recorded and excreta were collected quantitatively. A linear regression approach was used to calculate AA digestibility of the corn. The digestibility of all AA differed significantly between the 20 corn batches, including Lys (digestibility range 64 to 85%), Met (86 to 94%), Thr (72 to 89%), and Trp (21 to 88%). The AMEn of the corn batches ranged between 15.7 and 17.1 MJ/kg DM. However, consistent correlations between AA digestibility or AMEn and the physical and chemical characteristics of the grains were not detected. Equations to predict AA digestibility or AMEn based on the grain's physical and chemical characteristics were calculated by multiple linear regressions. The explanatory power (adjusted R2;) of prediction equations was below 0.6 for the majority of AA and AMEn, and, thus, was not sufficiently precise for practical use. Possible explanations for the variation in AA digestibility and AMEn beyond the determined characteristics are discussed. In conclusion, AA digestibility and AMEn of corn grain is high in laying hens, but varies among different corn samples, with physical and chemical characteristics not suitable for explaining these variations. © 2016 Poultry Science Association Inc.
Siegert, Wolfgang; Boguhn, Jeannette; Maurer, Hans Peter; Weiss, Jochen; Zuber, Tobias; Möhring, Jens; Rodehutscord, Markus
2017-01-01
The influence of nitrogen fertilisation and genotype on the amino acid (AA) digestibility of triticale grain was investigated in caecectomised laying hens. Three genotypes, Grenado, EAW6002 and Lasko, were cultivated with and without nitrogen fertilisation at the end of the heading stage. The six triticale variants as well as a basal diet were each used to feed seven laying hens in a 7 × 7 Latin square design. Nitrogen fertilisation influenced the digestibility of Cys, Glu, Phe and Ser in some triticale genotypes and reduced Ala, Ile, Lys, Met and Val digestibility in all genotypes (P < 0.05). Nitrogen fertilisation increased the concentration of all AAs in the grain. Consequently, the concentration of digestible AAs in the grains was increased for most AAs upon nitrogen fertilisation. Overall, Lys had the lowest digestibility, whereas that of Glu and Pro was the highest. For the triticale genotypes, the level of AA digestibility was highest for EAW6002 followed by Lasko and Grenado, with significant differences (P < 0.05) between genotypes for some but not all AAs. The results indicated that the accuracy of the digestible AA supply for hen feeding might benefit from considering fertilisation and genotype-specific digestibility data in feed formulation. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Amino acid digestibility of different rye genotypes in caecectomised laying hens.
Zuber, Tobias; Miedaner, Thomas; Rosenfelder, Pia; Rodehutscord, Markus
2016-12-01
This study investigated the variability of amino acid (AA) digestibility of rye grains in laying hens. Relationships between AA digestibility and physical properties (thousand seed weight, test weight, falling number, and extract viscoelasticity), chemical composition (proximate nutrients, non-starch polysaccharides, AA, minerals, and inositol phosphates), gross energy concentration, and in vitro solubility of nitrogen (N) of the grains were also examined. Twenty rye genotypes were grown under standardised agronomic and environmental conditions as part of a collaborative research project known as "GrainUp". Each genotype was added to a basal diet at 500 g/kg at the expense of maize starch to produce 20 rye diets. The experimental design comprised four Latin Squares (6 × 6) distributed over two runs, resulting in 12 experimental periods. Caecectomised laying hens (LSL-Classic) were individually kept in metabolism cages. Excreta were collected quantitatively for 4 d, and AA digestibility of the rye genotypes was determined using a regression approach. The digestibility of AA was generally low but varied significantly among the 20 rye genotypes, especially for Lys (digestibility range 35-59%), Met (57-75%), Thr (34-54%), and Trp (36-71%). Nevertheless, physical and chemical characteristics as well as the in vitro solubility of N correlated in only a few cases with AA digestibility. Multiple linear regression was used to calculate equations to predict AA digestibility based on the analysed characteristics. However, their explanatory power, as judged by the adjusted R(2), was not sufficiently precise for practical application (below 0.6 for most AA). In conclusion, the AA digestibility of rye grain is generally low and varies significantly between crop genotypes. Equations based on its physical and chemical characteristics are not sufficiently precise to be useful for feed formulation.
Favero, A; Ragland, D; Vieira, S L; Owusu-Asiedu, A; Adeola, O
2014-12-01
Two experiments using soybean meal (SBM) or canola meal (CM) were conducted to investigate whether the choice of digestibility marker influenced the apparent ileal digestibility (AID) or standardized ileal digestibility (SID) of N and AA in diets supplemented with phytase. In each experiment, 18 barrows fitted with T-cannulas at the ileocecal junction were assigned to 3 diets consisting of a N-free diet to determine endogenous losses of N and AA, a semipurified diet (SBM in Exp. 1 or CM in Exp. 2), and the semipurified diet supplemented with phytase at 1,000 phytase units/kg. Three digestibility markers including acid-insoluble ash (AIA), chromic oxide (Cr2O3), and titanium dioxide (TiO2) were added to each diet at 3 g/kg. Each diet was fed for 7 d, consisting of a 5-d adjustment and a 2-d collection of ileal digesta. In both studies, basal ileal endogenous losses determined with Cr2O3 as a digestibility marker were lower (P<0.01) than with those determined with AIA or TiO2 digestibility markers. Using SBM as the protein source in Exp. 1, there was no interaction between phytase and digestibility marker on AID or SID of AA. The AID of N and AA in SBM using AIA as a digestibility marker tended to be lower (P<0.1) compared with Cr2O3 or TiO2 digestibility markers. Phytase supplementation increased (P<0.001) the AID of Ca and P. The use of AIA or Cr2O3 digestibility marker tended to be associated with lower (P<0.1) SID values compared with TiO2. Phytase did not affect the SID of N or any AA in SBM except for Met, for which there was an increase (P<0.05) with phytase supplementation. Using CM as the protein source in Exp. 2, there were significant interactions between digestibility marker and phytase. Phytase supplementation had effects (P<0.01) on AID or SID when Cr2O3 or TiO2 was used as the digestibility marker. With Cr2O3 or TiO2 as the digestibility marker in the CM diets, phytase supplementation increased (P<0.05) the SID of N and all AA (except Trp). There was no SID of N or AA response to phytase supplementation of CM when AIA was used as a digestibility marker. In contrast, there were no clear improvements in AA digestibility from phytase supplementation for SBM. Phytase effects on AID or SID of AA were dependent on the digestibility marker used in diets when CM was used as the protein source but not when SBM was used as the protein source. Therefore, AA digestibility response to phytase supplementation may depend on the protein being evaluated as well as the choice of digestibility marker.
Fessenden, S W; Hackmann, T J; Ross, D A; Foskolos, A; Van Amburgh, M E
2017-09-01
Microbial samples from 4 independent experiments in lactating dairy cattle were obtained and analyzed for nutrient composition, AA digestibility, and AA profile after multiple hydrolysis times ranging from 2 to 168 h. Similar bacterial and protozoal isolation techniques were used for all isolations. Omasal bacteria and protozoa samples were analyzed for AA digestibility using a new in vitro technique. Multiple time point hydrolysis and least squares nonlinear regression were used to determine the AA content of omasal bacteria and protozoa, and equivalency comparisons were made against single time point hydrolysis. Formalin was used in 1 experiment, which negatively affected AA digestibility and likely limited the complete release of AA during acid hydrolysis. The mean AA digestibility was 87.8 and 81.6% for non-formalin-treated bacteria and protozoa, respectively. Preservation of microbe samples in formalin likely decreased recovery of several individual AA. Results from the multiple time point hydrolysis indicated that Ile, Val, and Met hydrolyzed at a slower rate compared with other essential AA. Singe time point hydrolysis was found to be nonequivalent to multiple time point hydrolysis when considering biologically important changes in estimated microbial AA profiles. Several AA, including Met, Ile, and Val, were underpredicted using AA determination after a single 24-h hydrolysis. Models for predicting postruminal supply of AA might need to consider potential bias present in postruminal AA flow literature when AA determinations are performed after single time point hydrolysis and when using formalin as a preservative for microbial samples. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Karlsson, L; Ruiz-Moreno, M; Stern, M D; Martinsson, K
2012-11-01
The objective of this study was to evaluate ruminal degradability and intestinal digestibility of crude protein (CP) and amino acids (AA) in hempseed cake (HC) that were moist heat treated at different temperatures. Samples of cold-pressed HC were autoclaved for 30 min at 110, 120 or 130°C, and a sample of untreated HC was used as the control. Ruminal degradability of CP was estimated, using the in situ Dacron bag technique; intestinal CP digestibility was estimated for the 16 h in situ residue using a three-step in vitro procedure. AA content was determined for the HC samples (heat treated and untreated) of the intact feed, the 16 h in situ residue and the residue after the three-step procedure. There was a linear increase in RUP (p = 0.001) and intestinal digestibility of RUP (p = 0.003) with increasing temperature during heat treatment. The 130°C treatment increased RUP from 259 to 629 g/kg CP, while intestinal digestibility increased from 176 to 730 g/kg RUP, compared to the control. Hence, the intestinal available dietary CP increased more than eight times. Increasing temperatures during heat treatment resulted in linear decreases in ruminal degradability of total AA (p = 0.006) and individual AA (p<0.05) and an increase in intestinal digestibility that could be explained both by a linear and a quadratic model for total AA and most individual AA (p<0.05). The 130°C treatment decreased ruminal degradability of total AA from 837 to 471 g/kg, while intestinal digestibility increased from 267 to 813 g/kg of rumen undegradable AA, compared with the control. There were differences between ruminal AA degradability and between intestinal AA digestibility within all individual HC treatments (p<0.001). It is concluded that moist heat treatment at 130°C did not overprotect the CP of HC and could be used to shift the site of CP and AA digestion from the rumen to the small intestine. This may increase the value of HC as a protein supplement for ruminants.
Karlsson, L.; Ruiz-Moreno, M.; Stern, M. D.; Martinsson, K.
2012-01-01
The objective of this study was to evaluate ruminal degradability and intestinal digestibility of crude protein (CP) and amino acids (AA) in hempseed cake (HC) that were moist heat treated at different temperatures. Samples of cold-pressed HC were autoclaved for 30 min at 110, 120 or 130°C, and a sample of untreated HC was used as the control. Ruminal degradability of CP was estimated, using the in situ Dacron bag technique; intestinal CP digestibility was estimated for the 16 h in situ residue using a three-step in vitro procedure. AA content was determined for the HC samples (heat treated and untreated) of the intact feed, the 16 h in situ residue and the residue after the three-step procedure. There was a linear increase in RUP (p = 0.001) and intestinal digestibility of RUP (p = 0.003) with increasing temperature during heat treatment. The 130°C treatment increased RUP from 259 to 629 g/kg CP, while intestinal digestibility increased from 176 to 730 g/kg RUP, compared to the control. Hence, the intestinal available dietary CP increased more than eight times. Increasing temperatures during heat treatment resulted in linear decreases in ruminal degradability of total AA (p = 0.006) and individual AA (p<0.05) and an increase in intestinal digestibility that could be explained both by a linear and a quadratic model for total AA and most individual AA (p<0.05). The 130°C treatment decreased ruminal degradability of total AA from 837 to 471 g/kg, while intestinal digestibility increased from 267 to 813 g/kg of rumen undegradable AA, compared with the control. There were differences between ruminal AA degradability and between intestinal AA digestibility within all individual HC treatments (p<0.001). It is concluded that moist heat treatment at 130°C did not overprotect the CP of HC and could be used to shift the site of CP and AA digestion from the rumen to the small intestine. This may increase the value of HC as a protein supplement for ruminants. PMID:25049517
Soares, J A; Stein, H H; Singh, V; Shurson, G S; Pettigrew, J E
2012-04-01
Distillers dried grains with solubles (DDGS) has low and variable AA digestibility. The variability is often attributed to damage during the heating process, and it has been suggested that the damage happens to the soluble components of DDGS such as reducing sugars. Combining solubles and grains sometimes produces syrup balls (SB); their digestibility is unknown. The objective of this experiment was to identify potential sources of poor and variable AA digestibility in DDGS. Specifically, our objective was to determine whether the problems are associated with the solubles component or with SB. The ingredients evaluated were DDGS, intact SB, ground SB, liquid condensed solubles (LCS), and pulse dried thin stillage (PDTS) obtained from the same ethanol plant. The LCS is produced by evaporation of thin stillage. Each ingredient was used as the only source of AA in an experimental diet. In a duplicate 6 × 6 Latin square design with 7-d adaptation and collection periods, the 6 treatments consisted of an N-free diet and the 5 test ingredients. Pigs had 5 d of adaptation to each diet, and on d 6 and 7 ileal digesta were collected from an ileal cannula for 8 h each day. Both SB treatments had apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of AA that were similar or greater (P < 0.05) than those of DDGS. The AID and SID values of Lys and a few other AA were similar in LCS (SID Lys: 63.1%) and DDGS (SID Lys: 61.5%), but the digestibility values of most AA in LCS were less than in DDGS (P < 0.05). The low digestibility of AA in LCS was most pronounced for Met (SID: LCS, 41.9% vs. DDGS, 82.8%). The LCS had less (P < 0.05) AID and SID of CP (SID: 67.8%) than intact SB (SID: 85.2%) and ground SB (SID: 85.9%) as well as all AA. The PDTS generally had the least AID and SID and had less (P < 0.05) CP (SID: 55.3%) and several AA, including Lys, compared with LCS. In conclusion, the presence of SB does not decrease AA digestibility of DDGS, and the LCS evaluated has less indispensible AA digestibility than DDGS. The LCS has low digestibility of AA that seems to not be caused by heat damage.
Brake, D W; Titgemeyer, E C; Anderson, D E
2014-09-01
Greater postruminal flows of protein increase small intestinal starch digestion in cattle. Our objective was to determine if small intestinal starch digestion is increased by duodenal supplementation of AA. We fed 5 duodenally and ileally cannulated steers a low-starch soybean hull-based diet in 5 × 5 Latin square designs and provided continuous duodenal infusion of raw cornstarch in combination with AA or casein and measured small intestinal starch digestion. In Exp. 1 treatments were continuous duodenal infusion of 1) no supplement (control), 2) casein (400 g/d), 3) crystalline AA similar in amount and AA composition to the casein (CASAA), 4) crystalline nonessential AA similar to those provided by casein, or 5) crystalline essential AA similar to those provided by casein. In Exp. 2 treatments were continuous duodenal infusion of 1) no supplement (control), 2) casein (400 g/d), 3) Glu (133 g/d), 4) Phe and Trp plus Met (30.4, 6.5, and 17.5 g/d, respectively; PTM), or 5) a combination of Glu and PTM. Duodenal infusion of casein increased (P ≤ 0.05) small intestinal starch digestion. When CASAA was infused, small intestinal starch digestion was similar (P = 0.30) to casein infusion. Infusion of only nonessential AA tended to increase (P = 0.14) small intestinal starch digestion relative to the control, but infusion of essential AA alone did not affect (P = 0.84) small intestinal starch digestion. In addition, infusion of casein or CASAA increased ileal flows of ethanol-soluble starch (small-chain α-glycosides), but nonessential AA alone were not different than the control. Duodenal infusion of Glu increased (P ≤ 0.05) small intestinal starch digestion, whereas PTM did not. Neither Glu nor PTM increased ileal flow of ethanol-soluble starch, but Glu and PTM provided together tended (P = 0.07) to increase ileal flows of small chain α-glycosides. Our data suggest that Glu alone can increase small intestinal starch digestion in cattle similar to casein, but increases in small intestinal starch digestion in response to Glu are not associated with an increase in ileal flows of small chain α-glycosides.
Henning, Susanne M; Zhang, Yanjun; Rontoyanni, Victoria G; Huang, Jianjun; Lee, Ru-Po; Trang, Amy; Nuernberger, Gloria; Heber, David
2014-05-14
The antioxidant activity (AA) of fruits and vegetables has been thoroughly investigated but less is known about the AA of dietary supplements (DS). We therefore assessed the AA of three to five DS each from pomegranate, milk thistle, green tea, grapes, goji, and acai using four widely used standard methods. The secondary objective was to determine the effects of in vitro digestion on their AA. The AA of the DS prior to digestion ranked as follows: pomegranate > resveratrol > green tea > grape seed > milk thistle and very low in goji and acai with significant group variability in AA. The AA after in vitro simulated digestion of the mouth, stomach, and small intestine compared to undigested supplement was decreased for green tea and grape seed but increased for pomegranate, resveratrol, milk thistle, goji, and acai to various extents. Although polyphenols provide the major antioxidant potency of the tested supplements, our observations indicate that digestion may alter antioxidant properties depending in part on the variations in polyphenol content.
Evaluation of Amino Acid and Energy Utilization in Feedstuff for Swine and Poultry Diets
Kong, C.; Adeola, O.
2014-01-01
An accurate feed formulation is essential for optimizing feed efficiency and minimizing feed cost for swine and poultry production. Because energy and amino acid (AA) account for the major cost of swine and poultry diets, a precise determination of the availability of energy and AA in feedstuffs is essential for accurate diet formulations. Therefore, the methodology for determining the availability of energy and AA should be carefully selected. The total collection and index methods are 2 major procedures for estimating the availability of energy and AA in feedstuffs for swine and poultry diets. The total collection method is based on the laborious production of quantitative records of feed intake and output, whereas the index method can avoid the laborious work, but greatly relies on accurate chemical analysis of index compound. The direct method, in which the test feedstuff in a diet is the sole source of the component of interest, is widely used to determine the digestibility of nutritional components in feedstuffs. In some cases, however, it may be necessary to formulate a basal diet and a test diet in which a portion of the basal diet is replaced by the feed ingredient to be tested because of poor palatability and low level of the interested component in the test ingredients. For the digestibility of AA, due to the confounding effect on AA composition of protein in feces by microorganisms in the hind gut, ileal digestibility rather than fecal digestibility has been preferred as the reliable method for estimating AA digestibility. Depending on the contribution of ileal endogenous AA losses in the ileal digestibility calculation, ileal digestibility estimates can be expressed as apparent, standardized, and true ileal digestibility, and are usually determined using the ileal cannulation method for pigs and the slaughter method for poultry. Among these digestibility estimates, the standardized ileal AA digestibility that corrects apparent ileal digestibility for basal endogenous AA losses, provides appropriate information for the formulation of swine and poultry diets. The total quantity of energy in feedstuffs can be partitioned into different components including gross energy (GE), digestible energy (DE), metabolizable energy (ME), and net energy based on the consideration of sequential energy losses during digestion and metabolism from GE in feeds. For swine, the total collection method is suggested for determining DE and ME in feedstuffs whereas for poultry the classical ME assay and the precision-fed method are applicable. Further investigation for the utilization of ME may be conducted by measuring either heat production or energy retention using indirect calorimetry or comparative slaughter method, respectively. This review provides information on the methodology used to determine accurate estimates of AA and energy availability for formulating swine and poultry diets. PMID:25050031
Evaluation of amino Acid and energy utilization in feedstuff for Swine and poultry diets.
Kong, C; Adeola, O
2014-07-01
An accurate feed formulation is essential for optimizing feed efficiency and minimizing feed cost for swine and poultry production. Because energy and amino acid (AA) account for the major cost of swine and poultry diets, a precise determination of the availability of energy and AA in feedstuffs is essential for accurate diet formulations. Therefore, the methodology for determining the availability of energy and AA should be carefully selected. The total collection and index methods are 2 major procedures for estimating the availability of energy and AA in feedstuffs for swine and poultry diets. The total collection method is based on the laborious production of quantitative records of feed intake and output, whereas the index method can avoid the laborious work, but greatly relies on accurate chemical analysis of index compound. The direct method, in which the test feedstuff in a diet is the sole source of the component of interest, is widely used to determine the digestibility of nutritional components in feedstuffs. In some cases, however, it may be necessary to formulate a basal diet and a test diet in which a portion of the basal diet is replaced by the feed ingredient to be tested because of poor palatability and low level of the interested component in the test ingredients. For the digestibility of AA, due to the confounding effect on AA composition of protein in feces by microorganisms in the hind gut, ileal digestibility rather than fecal digestibility has been preferred as the reliable method for estimating AA digestibility. Depending on the contribution of ileal endogenous AA losses in the ileal digestibility calculation, ileal digestibility estimates can be expressed as apparent, standardized, and true ileal digestibility, and are usually determined using the ileal cannulation method for pigs and the slaughter method for poultry. Among these digestibility estimates, the standardized ileal AA digestibility that corrects apparent ileal digestibility for basal endogenous AA losses, provides appropriate information for the formulation of swine and poultry diets. The total quantity of energy in feedstuffs can be partitioned into different components including gross energy (GE), digestible energy (DE), metabolizable energy (ME), and net energy based on the consideration of sequential energy losses during digestion and metabolism from GE in feeds. For swine, the total collection method is suggested for determining DE and ME in feedstuffs whereas for poultry the classical ME assay and the precision-fed method are applicable. Further investigation for the utilization of ME may be conducted by measuring either heat production or energy retention using indirect calorimetry or comparative slaughter method, respectively. This review provides information on the methodology used to determine accurate estimates of AA and energy availability for formulating swine and poultry diets.
2013-01-01
Background Many studies have investigated endogenous loss of proteins and amino acids (AAs) at the ileal level in growing pigs. However, only a few studies have researched this subject in piglets. Knowledge regarding AA ileal digestibility in piglets would be helpful during the formulation of diets for weaning piglets, rather than just using coefficients obtained in growing pigs. Therefore, in this study, we sought to estimate endogenous protein and AA ileal losses in piglets. Furthermore, apparent and true ileal digestibility (AID and TID) of protein and AAs from casein were measured. Results The average flow of protein was 20.8 g/kg of dry matter intake (DMI). Basal protein loss, as estimated by regression, was 16.9 g/kg DMI. Glutamic acid, arginine, and aspartic acid (2.2, 1.4, and 1.2 g/kg DMI, respectively) were the AAs for which greater losses were seen. The AID of protein and AAs increased as the protein level in the diet increased. A higher increment in AID was observed between diets with 80 and160 g CP/kg of feed; this finding was mainly attributable to increases in glycine and arginine (46.1% and 18%, respectively). The TID of protein was 97.8, and the TID of AAs varied from 93.9 for histidine to 100.2 for phenylalanine. Conclusions The basal endogenous protein loss in piglets was 16.9 g/kg DMI. Endogenous protein was rich in glutamic acid, aspartic acid, and arginine, which represented 32.7% of endogenous protein loss in weaning piglets. The TID of casein was high and varied from 93.0 for histidine to 100.2 for phenylalanine. PMID:24053636
Libao-Mercado, A J; Yin, Y; van Eys, J; de Lange, C F M
2006-06-01
Use of dietary AA in growing pigs reflects digestion and use of digested AA for various body functions. Before evaluating dietary effects on use of digestible AA intake for body protein deposition, a digestibility study was conducted to investigate true ileal AA digestibility and endogenous ileal AA losses in growing pigs fed graded levels of wheat shorts (WS) or casein (CS; control). A casein-based basal diet (basal) was formulated to contain 0.27 g of standardized ileal digestible (SID) Lys per MJ of DE, to which extra Lys was added from WS (WS2, +0.10 g of SID Lys per MJ of DE; WS3, +0.20 g of SID Lys per MJ of DE) or casein (CS3, +0.20 g of SID Lys per MJ of DE). A fifth diet was formulated to be similar in CP level and source as CS3 but in which 6% pectin, a source of soluble non-starch polysaccharides (NSP), was included at the expense of cornstarch (CS3 + pectin). Five Yorkshire barrows (17.5 +/- 1.5 kg of BW) were fitted with a T-cannula at the distal ileum and randomly assigned to 1 of the 5 experimental diets in a 5 x 5 Latin Square design. Apparent ileal digestibility (AID), true ileal digestibility (TID), and endogenous ileal protein losses (EPL) were determined using the homoarginine method. Diet CS level did not influence (P > or = 0.10) TID of most essential AA or EPL (10.4 g/kg of DM intake). Including pectin in the diet did not influence TID of AA (P > or = 0.10) but increased EPL (15.6 g/kg of DM intake; P > or = 0.01). Inclusion of WS in the diet reduced TID of most essential AA (P < 0.01). The TID values for most essential AA, however, were the same (P > or = 0.10) for both dietary WS levels, except for Lys and Met, which were further reduced at the greatest dietary WS level. Increased EPL (P < 0.01) was only observed for WS3 (16 g/kg of DMI). We concluded that (1) the effects of dietary protein source on AID of AA can be attributed both to reduced TID of AA and increased EPL, (2) the impact of dietary WS level on TID of AA and EPL does not seem to be linear, (3) soluble NSP from pectin or WS exerts a greater effect on EPL than insoluble NSP, and (4) because of the metabolic cost associated with EPL and the impacts of feed composition on microbial fermentation in the gut lumen, the effects of feed ingredients on the use of ileal digestible AA for protein deposition should be investigated further.
Kerr, K R; Kappen, K L; Garner, L M; Utterback, P L; Parsons, C M; Swanson, K S
2014-10-01
Whole prey diets are commonly used in the zoo and home setting for captive exotic and domestic cats, respectively. Despite their increase in popularity, nutrient digestibility of such diets has been poorly studied. In this study, the precision-fed cecectomized rooster assay was used to determine the protein quality and nitrogen-corrected true ME (TMEn) of 17 whole prey samples (mice [1 to 2 , 10 to 13 , 21 to 25 , 30 to 40 , and 150 to 180 d old], rats [1 to 4, 10 to 13, 21 to 25, 32 to 42, and >60 d old], rabbits [stillborn, 30 to 45 d old, and >65 d old], chicken [1 to 3 d old], and quail [1 to 3, 21 to 40, and >60 d old]) and 2 ground poultry-based products (chicken and duck). Amino acid score (AAS) and protein digestibility corrected AAS (PDCAAS) were calculated using the nutrient profile recommendations for domestic cat food as a reference value (AAFCO, 2012). Average individual indispensable AA (IAA) and total IAA (TIAA) digestibility coefficients were variable anddepended on AA (84 to 94% TIAA, 85 to 95% Arg, 87 to 96% His, 82 to 92% Ile, 84 to 94% Leu, 85 to 93% Lys, 89 to 97% Met, 83 to 94% Phe, 80 to 95% Thr, 84 to 94% Trp, and 80 to 93% Val) and sample. For a majority of the whole prey items, AA concentrations were greater than the Association of American Feed Control Officials ( AAFCO: , 2012) domestic cat nutrient profile recommendations for growth and reproduction and adult maintenance; however, some whole prey had AA concentrations below the AAFCO (2012) recommendations: Met + Cys (1.10% DM) in ground duck (1.06% DM) and taurine (Tau; 0.20% DM) in 30-to-45- and >65-d-old rabbits (0.01 and 0.10% DM, respectively), 150-to-180-d-old mice (0.18% DM), and ground duck (0.15% DM). The TMEn (3.76 to 6.44 kcal/g DM) expressed as the percent of GE (i.e., TMEn/GE) ranged from 66 to 85%, demonstrating how variable the digestibility of these items may be and justifying more research in this area. Both Met and Tau are commonly added to commercial pet foods, so supplements are readily available to address potential deficiencies and improve protein quality. A direct comparison of the ME of whole prey items by in vivo feline and rooster experiments is needed.
Taghizadeh, A; Danesh Mesgaran, M; Valizadeh, R; Shahroodi, F Eftekhar; Stanford, K
2005-05-01
The disappearance of dry matter (DM), crude protein (CP), and amino acids (AA) in steers after rumen incubation and intestinal passage of alfalfa hay, barley hay, corn silage, barley grain, corn grain, wheat bran, meat meal, fish meal, cottonseed meal, and soybean meal were measured in 3 steers using a mobile nylon bag technique. Ruminal degradation of individual AA differed between feedstuffs. For barley hay and corn silage, the ruminal disappearance of total AA was higher and lower than the other feedstuffs, respectively. The intestinal digestibility of total AA in alfalfa hay was lower than the digestion of CP. The intestinal digestibility of Arg and His was higher than that of total AA in alfalfa hay, meat meal, cottonseed meal, soybean meal, barley hay, and wheat bran. In addition, the intestinal digestibility of Lys was higher than that of total AA in alfalfa hay, meat meal, cottonseed meal, soybean meal, barley hay, corn silage, and wheat bran. The intestinal disappearance of CP in most cases was higher than that of DM. The results indicated that feedstuffs with lower ruminal disappearance of DM, CP, total AA, essential AA, and nonessential AA generally had a higher intestinal disappearance, resulting in a relatively constant total tract disappearance. These results could be used to improve the current system of diet formulation in ruminants.
Zuber, T; Maurer, H P; Möhring, J; Nautscher, N; Siegert, W; Rosenfelder, P; Rodehutscord, M
2016-12-01
Triticale, an anthropogenic hybrid grain, is increasing in importance as a feed grain for laying hens. However, our limited knowledge of its nutritional qualities and their impact on hen performance prevents optimization of its use. The present study investigated the digestibility of amino acids ( AA: ) in triticale grain in laying hens, and additionally examined relationships between AA digestibility and chemical and physical characteristics of the grain. Twenty genotypes of triticale were grown under standardized agronomic and environmental conditions and were characterized according to their physical properties (thousand-seed weight, test weight, falling number, extract viscoelasticity), chemical composition (proximate nutrients, non-starch polysaccharides, AA, minerals, inositol phosphates) and gross energy concentration. Additionally, the in vitro solubility of nitrogen was determined. The animal trial comprised 4 Latin Squares (6 × 6) distributed among 2 subsequent runs. Twelve cecectomized LSL-Classic hens were individually housed in metabolism cages and either fed a basal diet containing 500 g/kg cornstarch or one of 20 triticale diets, each replacing the cornstarch with one triticale genotype, for 8 d. During the last 4 d, feed intake was recorded and excreta were collected quantitatively. Amino acid digestibility of the triticale genotypes was calculated by linear regression. The digestibility of all AA differed significantly between the 20 genotypes, including Lys (digestibility range 68 to 80%), Met (77 to 86%), Thr (68 to 78%) and Trp (74 to 83%). However, AA digestibility only correlated with characteristics of the grain in few cases, without a consistent pattern among AA. Equations to predict AA digestibility based on the grain's physical and chemical characteristics were calculated by multiple linear regression. The explanatory power (adjusted R 2 ;) of these prediction equations was below 0.7 for most AA and thus not sufficiently precise to be suitable for practical application. In conclusion, AA digestibility of triticale grain is high overall in laying hens but varies significantly between crop genotypes. This variation could not be well explained by physical and chemical characteristics of the grain. © 2016 Poultry Science Association Inc.
De Boever, J L; Blok, M C; Millet, S; Vanacker, J; De Campeneere, S
2014-11-01
The chemical composition inclusive amino acids (AAs) and the energy and protein value of three wheat, three maize and seven blend (mainly wheat) dried distillers grains and solubles (DDGS) were determined. The net energy for lactation (NEL) was derived from digestion coefficients obtained with sheep. The digestible protein in the intestines (DVE) and the degraded protein balance (OEB) were determined by nylon bag incubations in the rumen and the intestines of cannulated cows. Additional chemical parameters like acid-detergent insoluble CP (ADICP), protein solubility in water, in borate-phosphate buffer and in pepsin-HCl, in vitro digestibility (cellulase, protease, rumen fluid) and colour scores (L*, a*, b*) were evaluated as potential predictors of the energy and protein value. Compared to wheat DDGS (WDDGS), maize DDGS (MDDGS) had a higher NEL-value (8.49 v. 7.38 MJ/kg DM), a higher DVE-content (216 v. 198 g/kg DM) and a lower OEB-value (14 v. 66 g/kg DM). The higher energy value of MDDGS was mainly due to the higher crude fat (CFA) content (145 v. 76 g/kg DM) and also to better digestible cell-walls, whereas the higher protein value was mainly due to the higher percentage of rumen bypass protein (RBP: 69.8 v. 55.6%). The NEL-value of blend DDGS (BDDGS) was in between that of the pure DDGS-types, whereas its DVE-value was similar to MDDGS. Although lower in CP and total AAs, MDDGS provided a similar amount of essential AAs as the other DDGS-types. Lysine content was most reduced in the production of WDDGS and cysteine in MDDGS. Fat content explained 68.6% of the variation in NEL, with hemicellulose and crude ash as extra explaining variables. The best predictor for RBP as well as for OEB was the protein solubility in pepsin-HCl (R 2=77.3% and 83.5%). Intestinal digestibility of RBP could best be predicted by ADF (R 3=73.6%) and the combination of CFA and NDF could explain 60.2% of the variation in the content of absorbable microbial protein. The availability of AAs could accurately be predicted from the rumen bypass and intestinal digestibility of CP.
NASA Astrophysics Data System (ADS)
Chen, Wei; Su, Hongming; Xu, Yang; Jin, Chao
2017-01-01
Acrylamide (AA)-induced toxicity has been associated with accumulation of excessive reactive oxygen species. The present study was therefore undertaken to investigate the protective effect of blackberry digests produced after (BBD) in vitro gastrointestinal (GI) digestion against AA-induced oxidative damage. The results indicated that the BBD (0.5 mg/mL) pretreatment significantly suppressed AA-induced intracellular ROS generation (56.6 ± 2.9% of AA treatment), mitochondrial membrane potential (MMP) decrease (297 ± 18% of AA treatment) and glutathione (GSH) depletion (307 ± 23% of AA treatment), thereby ameliorating cytotoxicity. Furthermore, LC/MS/MS analysis identified eight phenolic compounds with high contents in BBD, including ellagic acid, ellagic acid pentoside, ellagic acid glucuronoside, methyl-ellagic acid pentoside, methyl-ellagic acid glucuronoside, cyanidin glucoside, gallic acid and galloyl esters, as primary active compounds responsible for antioxidant action. Collectively, our study uncovered that the protective effect of blackberry was reserved after gastrointestinal digestion in combating exogenous pollutant-induced oxidative stress.
Domanico, Francesco; Forte, Giovanni; Majorani, Costanza; Senofonte, Oreste; Petrucci, Francesco; Pezzi, Vincenzo; Alimonti, Alessandro
2017-09-01
Mercury is a heavy metal that causes serious health problems in exposed subjects. The most toxic form, i.e., methylmercury (MeHg), is mostly excreted through human hair. Numerous analytical methods are available for total Hg analysis in human hair, including cold vapour atomic fluorescence spectrometry (CV-AFS), inductively coupled plasma mass spectrometry (ICP-MS) and thermal decomposition amalgamation atomic absorption spectrometry (TDA-AAS). The aim of the study was to compare the TDA-AAS with the ICP-MS in the Hg quantification in human hair. After the washing procedure to minimize the external contamination, from each hair sample two aliquots were taken; the first was used for direct analysis of Hg by TDA-AAS and the second was digested for Hg determination by the ICP-MS. Results indicated that the two data sets were fully comparable (median; TDA-AAS, 475ngg -1 ; ICP-MS, 437ngg -1 ) and were not statistically different (Mann-Whitney test; p=0.44). The two techniques presented results with a good coefficient of correlation (r=0.94) despite different operative ranges and method limits. Both techniques satisfied internal performance requirements and the parameters for method validation resulting sensitive, precise and reliable. Finally, the use of the TDA-AAS can be considered instead of the ICP-MS in hair analysis in order to reduce sample manipulation with minor risk of contamination, less time consuming due to the absence of the digestion step and cheaper analyses. Copyright © 2016 Elsevier GmbH. All rights reserved.
Molecular Genetic Analysis of Midgut Serine Proteases in Aedes aegypti Mosquitoes
Isoe, Jun; Rascón, Alberto A.; Kunz, Susan; Miesfeld, Roger L.
2009-01-01
Digestion of blood meal proteins by midgut proteases provides anautogenous mosquitoes with the nutrients required to complete the gonotrophic cycle. Inhibition of protein digestion in the midgut of blood feeding mosquitoes could therefore provide a strategy for population control. Based on recent reports indicating that the mechanism and regulation of protein digestion in blood fed female Aedes aegypti mosquitoes is more complex than previously thought, we used a robust RNAi knockdown method to investigate the role of four highly expressed midgut serine proteases in blood meal metabolism. We show by Western blotting that the early phase trypsin protein (AaET) is maximally expressed at 3 h post blood meal (PBM), and that AaET is not required for the protein expression of three late phase serine proteases, AaLT (late trypsin), AaSPVI (5G1), and AaSPVII. Using the trypsin substrate analog BApNA to analyze in vitro enzyme activity in midgut extracts from single mosquitoes, we found that knockdown of AaSPVI expression caused a 77.6% decrease in late phase trypsin-like activity, whereas, knockdown of AaLT and AaSPVII expression had no significant effect on BApNA activity. In contrast, injection of AaLT, AaSPVI, and AaSPVII dsRNA inhibited degradation of endogenous serum albumin protein using an in vivo protease assay, as well as, significantly decreased egg production in both the first and second gonotrophic cycles (p<0.001). These results demonstrate that AaLT, AaSPVI, and AaSPVII all contribute to blood protein digestion and oocyte maturation, even though AaSPVI is the only abundant midgut late phase serine protease that appears to function as a classic trypsin enzyme. PMID:19883761
Protein quality of insects as potential ingredients for dog and cat foods.
Bosch, Guido; Zhang, Sheng; Oonincx, Dennis G A B; Hendriks, Wouter H
2014-01-01
Insects have been proposed as a high-quality, efficient and sustainable dietary protein source. The present study evaluated the protein quality of a selection of insect species. Insect substrates were housefly pupae, adult house cricket, yellow mealworm larvae, lesser mealworm larvae, Morio worm larvae, black soldier fly larvae and pupae, six spot roach, death's head cockroach and Argentinean cockroach. Reference substrates were poultry meat meal, fish meal and soyabean meal. Substrates were analysed for DM, N, crude fat, ash and amino acid (AA) contents and for in vitro digestibility of organic matter (OM) and N. The nutrient composition, AA scores as well as in vitro OM and N digestibility varied considerably between insect substrates. For the AA score, the first limiting AA for most substrates was the combined requirement for Met and Cys. The pupae of the housefly and black soldier fly were high in protein and had high AA scores but were less digestible than other insect substrates. The protein content and AA score of house crickets were high and similar to that of fish meal; however, in vitro N digestibility was higher. The cockroaches were relatively high in protein but the indispensable AA contents, AA scores and the in vitro digestibility values were relatively low. In addition to the indices of protein quality, other aspects such as efficiency of conversion of organic side streams, feasibility of mass-production, product safety and pet owner perception are important for future dog and cat food application of insects as alternative protein source.
Siegert, W; Ganzer, C; Kluth, H; Rodehutscord, M
2018-02-01
1. Herein, it was investigated whether different particle size distributions of feed ingredients achieved by grinding through a 2- or 3-mm grid would have an effect on precaecal (pc) amino acid (AA) digestibility. Maize and soybean meal were used as the test ingredients. 2. Maize and soybean meal was ground with grid sizes of 2 or 3 mm. Nine diets were prepared. The basal diet contained 500 g/kg of maize starch. The other experimental diets contained maize or soybean meal samples at concentrations of 250 and 500, and 150 and 300 g/kg, respectively, instead of maize starch. Each diet was tested using 6 replicate groups of 10 birds each. The regression approach was applied to calculate the pc AA digestibility of the test ingredients. 3. The reduction of the grid size from 3 to 2 mm reduced the average particle size of both maize and soybean meal, mainly by reducing the proportion of coarse particles. Reducing the grid size significantly (P < 0.050) increased the pc digestibility of all AA in the soybean meal. In maize, reducing the grid size decreased the pc digestibility of all AA numerically, but not significantly (P > 0.050). The mean numerical differences in pc AA digestibility between the grid sizes were 0.045 and 0.055 in maize and soybean meal, respectively. 4. Future studies investigating the pc AA digestibility should specify the particle size distribution and should investigate the test ingredients ground similarly for practical applications.
Rochell, S J; Usry, J L; Parr, T M; Parsons, C M; Dilger, R N
2017-03-01
The objective of this experiment was to evaluate the influence of copper supplementation in diets varying in amino acid (AA) density on growth performance, apparent metabolizable energy (AMEn), apparent ileal nutrient digestibility (AID), and plasma carotenoids in broilers infected with Eimeria acervulina. Ross 308 male broilers (480 total) were housed in battery cages and allotted to 8 experimental treatments in a factorial arrangement of 2 dietary AA densities [1.00% (LAA) or 1.20% (HAA) digestible Lys], 2 supplemental copper concentrations (zero or 116 mg/kg), and 2 E. acervulina infection states (uninfected or infected). Essential AA ratios relative to digestible Lys were similar in both the LAA and HAA diets, and copper was provided by 200 mg/kg of tribasic copper chloride (58% copper). Chicks received experimental diets from 2 to 21 d post hatch and 6 replicate cages of 10 birds per cage were assigned to each treatment. Broilers were inoculated with zero or 6.3 × 105 sporulated E. acervulina oocysts at 15 d and blood and ileal digesta were collected at 21 days. From 2 to 15 d, body weight gain and G:F of broilers were improved (P < 0.05) with increasing AA density, and an AA density × copper interaction was observed (P < 0.05) for feed intake. Eimeria infection reduced (P < 0.05) plasma carotenoids, growth performance, dietary AMEn, and AID of organic matter, nitrogen, and total AA. There were no interactive effects of dietary treatments with E. acervulina infection on broiler growth performance or dietary AMEn. An AA density × copper supplementation interaction was observed (P < 0.05) for AID of total AA, whereby copper supplementation increased AID of total AA for birds fed the LAA diet and decreased AID of total AA for birds fed the HAA diet. In summary, E. acervulina-induced reductions in nutrient digestibility were dependent on dietary copper and AA status, but changes in digestibility had minimal impact on growth performance of broilers during the E. acervulina infection period. © 2016 Poultry Science Association Inc.
Dimri, U; Sharma, M C
2004-03-01
The aim of this study was to evaluate the therapeutic efficacy of commonly used acaricidal drugs in India and also to assess the effect of ascorbic acid as adjunct therapy in 72 growing sheep with sarcoptic mange, aged 5-6 months and weighing 20.4-31.7 kg. Eight replicates of nine animals were formed based on sex, and day 0 body weight. Drugs were applied locally on the affected parts daily and recovery changes in skin lesions were observed at the time of every application. L-ascorbic acid was administered intramuscularly. Skin scrapings were collected daily from each group and examined for the presence of mites. Body weights were measured every 10th day from day 0 to 60. Nutrient digestiblity was evaluated by studying digestibility coefficients for dry matter, crude protein, ether extract, crude fibre, nitrogen free extract, total carbohydrates and nutrient balance (nitrogen, calcium and phosphorus) for a 30-day period. The liver function was evaluated by bromosulphophthalein (BSP) dye retention time. The animals were shorn on day 60 post-treatment (PT). Meat quality assesment was carried out by killing sheep at 60 days PT and estimating pH, water-holding capacity (WHC), tenderness, muscle colour, rib eye area and fat thickness. The lambs treated with oil of Jatropha curcas ascorbic acid had significantly (P < 0.05) greater mean daily body weight gains (63.29 g) than the infected untreated control (41.10 g). This was also higher than the mean daily weight gain in other treated groups. Infected untreated sheep showed significantly (P < 0.01) reduced digestibility coefficients for dry matter, crude protein, crude fibre, ether extract and total carbohydrate, but no significant differences for nitrogen-free extract. Treated sheep had significantly higher positive nitrogen, calcium and phosphorus balances compared with infested untreated sheep. Oil of J. curcas plus ascorbic acid (OJC-AA) treated group was better over all other treated groups with respect to nutrient digestibility. The BSP test revealed significant (P < 0.05) increase in BSP retention time in sheep with sarcoptic mange. Post -treatment, the BSP retention time decreased in all treated groups and the decrease was maximum in OJC-AA treated group. The carcasses of sheep treated with OJC-AA had significantly (P < 0.01) higher water holding capacity, rib eye area and back fat thickness than the untreated infected control group. The muscle pH and tenderness values were significantly lower in OJC-AA treated group post-slaughter than infested untreated control group. Muscle colour of OJC-AA treated group was maximum bright red. The lambs treated with OJC-AA had significantly (P < 0.05) greater clean fleece weight and fleece yield than the untreated infected group. It is concluded that OJC was the better therapy for sarcoptic mange of sheep and ascorbic acid as adjunct therapy is advisable. OJC-AA therapy may be better from the point of view of improving two most important production parameters in sheep, that is, wool yield and meat production.
Mathai, John K; Liu, Yanhong; Stein, Hans H
2017-02-01
An experiment was conducted to compare values for digestible indispensable amino acid scores (DIAAS) for four animal proteins and four plant proteins with values calculated as recommended for protein digestibility-corrected amino acid scores (PDCAAS), but determined in pigs instead of in rats. Values for standardised total tract digestibility (STTD) of crude protein (CP) and standardised ileal digestibility (SID) of amino acids (AA) were calculated for whey protein isolate (WPI), whey protein concentrate (WPC), milk protein concentrate (MPC), skimmed milk powder (SMP), pea protein concentrate (PPC), soya protein isolate (SPI), soya flour and whole-grain wheat. The PDCAAS-like values were calculated using the STTD of CP to estimate AA digestibility and values for DIAAS were calculated from values for SID of AA. Results indicated that values for SID of most indispensable AA in WPI, WPC and MPC were greater (P<0·05) than for SMP, PPC, SPI, soya flour and wheat. With the exception of arginine and tryptophan, the SID of all indispensable AA in SPI was greater (P<0·05) than in soya flour, and with the exception of threonine, the SID of all indispensable AA in wheat was less (P<0·05) than in all other ingredients. If the same scoring pattern for children between 6 and 36 months was used to calculate PDCAAS-like values and DIAAS, PDCAAS-like values were greater (P<0·05) than DIAAS values for SMP, PPC, SPI, soya flour and wheat indicating that PDCAAS-like values estimated in pigs may overestimate the quality of these proteins.
Siegert, Wolfgang; Ganzer, Christian; Kluth, Holger; Rodehutscord, Markus
2018-06-01
A regression approach was applied to determine the influence of feed provisioning prior to digesta sampling on precaecal (pc) amino acid (AA) digestibility in broiler chickens. Soybean meal was used as an example test ingredient. Five feed-provisioning protocols were investigated, four with restricted provision and one with ad libitum provision. When provision was restricted, feed was provided for 30 min after a withdrawal period of 12 h. Digesta were sampled 1, 2, 4 and 6 h after feeding commenced. A diet containing 300 g maize starch/kg was prepared. Half or all the maize starch was replaced with soybean meal in two other diets. Average pc digestibility of all determined AA in the soybean meal was 86% for the 4 and 6-h protocols and 66% and 60% for the 2 and 1-h protocols, respectively. Average pc AA digestibility of soybean meal was 76% for ad libitum feed provision. Feed provisioning also influenced the determined variance. Variance in digestibility ranked in magnitude 1 h > ad libitum > 2 h > 6 h > 4 h for all AA. Owing to the considerable influence of feed-provisioning protocols found in this study, comparisons of pc AA digestibility between studies applying different protocols prior to digesta sampling must be treated with caution. Digestibility experiments aimed at providing estimates for practical feed formulation should use feed-provisioning procedures similar to those used in practice.
Mariz, L D S; Amaral, P M; Valadares Filho, S C; Santos, S A; Detmann, E; Marcondes, M I; Pereira, J M V; Silva Júnior, J M; Prados, L F; Faciola, A P
2018-03-06
The objective of this study was to determine the apparent and true intestinal digestibility of total and individual AA, and to estimate the efficiency of whole-body AA retention from individual and total absorbed AA. Four Nellore animals (241.3 kg initial BW) and four crossbred Angus × Nellore (263.4 kg initial BW) cannulated in rumen and ileum were randomly allocated in two 4 × 4 Latin squares. The experiment lasted four 17 d periods, with 10 d for adaptation to diets and another 7 d for data collection. The diets consisted of increasing CP levels: 100, 120, or 140 g/kg of DM offered ad libitum, and restricted intake diet with 120 g CP/kg DM (experiment 1). In experiment 2, forty-four bulls (22 Nellore and 22 crossbred F1 Angus × Nellore) with 8 months and initial shrunk BW 215.0 ± 15.0 kg (Nellore = 208.0 ± 12.78 kg; Angus × Nellore = 221.9 ± 14.16 kg) were used. Eight of those animals were slaughtered at the beginning of the experiment. The remaining 36 bulls were allocated in a completely randomized design with six replicates, in a 2 (genetic groups) × 3 (CP contents) factorial scheme. The amount of essential AA (EAA) and nonessential AA (NEAA) reaching the small intestine increased linearly (P < 0.05) in response to CP content. The apparent digestibility of EAA was not affected (P > 0.05) by CP content, with exception for histidine (P = 0.07, linear effect), leucine (P = 0.01, linear effect), and methionine (P = 0.05, linear effect). Differences existed among AA when compared the apparent digestibility of NEAA. The apparent digestibility of alanine (P = 0.05), aspartic acid (P = 0.07), glutamic acid (P = 0.02), glycine (P = 0.05), proline (P = 0.02), and serine (P = 0.04) responded quadratically to CP content increase. However, the apparent digestibility of cystine and tyrosine was not affected (P > 0.05) by increasing dietary CP. The true intestinal digestibilities of total, essential, nonessential AA, lysine, and methionine were 75.0%, 77.0%, 74.0%, 77.0%, and 86%, respectively. The true intestinal digestibility of total microbial AA was 80%. The efficiency of utilization of total AA for whole-body protein deposition was 40%. The efficiency of utilization of lysine and methionine was 37% and 58%, respectively. It was concluded that the AA flow to the omasum increases in response to dietary CP content. In addition, there are differences among AA in the efficiency that they are used by beef cattle.
Hulshof, T G; van der Poel, A F B; Hendriks, W H; Bikker, P
2017-07-01
Feed ingredients used in swine diets are often processed to improve nutritional value. However, (over-)processing may result in chemical reactions with amino acids (AAs) that decrease their ileal digestibility. This study aimed to determine effects of (over-)processing of soybean meal (SBM) and rapeseed meal (RSM) on post-absorptive utilization of ileal digestible AAs for retention and on body AA composition of growing pigs. Soybean meal and RSM were processed by secondary toasting in the presence of lignosulfonate to obtain processed soybean meal (pSBM) and processed rapeseed meal (pRSM). Four diets contained SBM, pSBM, RSM or pRSM as sole protein source. Two additional diets contained pSBM or pRSM and were supplemented with crystalline AA to similar standardized ileal digestible (SID) AA level as the SBM or RSM diet. These diets were used to verify that processing affected AA retention by affecting ileal AA digestibility rather than post-absorptive AA utilization. The SID AA levels of the protein sources were determined in a previous study. In total, 59 pigs were used (initial BW of 15.6±0.7 kg) of which five were used to determine initial body composition at the start of the experiment. In total, 54 pigs were fed one of six experimental diets and were slaughtered at a BW of 40 kg. The organ fraction (i.e. empty organs plus blood) and carcass were analyzed separately for N and AA content. Post-absorptive AA utilization was calculated from AA retention and SID AA intake. An interaction between diet type, comprising effects of processing and supplementing crystalline AA, and protein source was observed for CP content in the organ fraction, carcass and empty body and for nutrient retention. Processing reduced CP content and nutrient retention more for SBM than for RSM. Moreover, processing reduced (P<0.001) the lysine content in the organ fraction for both protein sources. Supplementing crystalline AA ameliorated the effect of processing on these variables. Thus, the data indicated that processing affected retention by reducing digestibility. Correcting AA retention for SID AA intake was, therefore, expected to result in similar post-absorptive AA utilization which was observed for the RSM diets. However, post-absorptive AA utilization was lower for the pSBM diet than for the SBM diet which might be related to an imbalanced post-absorptive AA supply. In conclusion, processing negatively affected nutrient retention for both protein sources and post-absorptive utilization of SID AA for retention for SBM. Effects of processing were compensated by supplementing crystalline AA.
Guggenbuhl, P; Waché, Y; Simoes Nunes, C; Fru, F
2012-12-01
Phosphorus of plant-based feedstuffs for monogastric animals is mainly in the form of phytic P, which has a very low bioavailability. The nondigested phytic P may contribute to P pollution. Furthermore, phytic acid may reduce digestibility of other minerals and protein. This study evaluated effects of the microbial 6-phytase RONOZYME HiPhos on apparent ileal digestibility of P, phytic acid, Ca, CP, energy, and AA in six 60-d-old ileorectal anastomosed pigs. In a duplicated 3 × 3 Latin square design, pigs had free access to alternatively a corn (Zea mays)-soybean (Glycine max) meal-barley (Hordeum vulgare)-based diet or this diet supplemented with RONOZYME HiPhos at either 500 units/kg (RH500) or 1000 units/kg (RH1000). Pigs fed diets supplemented with RH500 or RH1000 increased (P < 0.05) digestibility of P, Ca, and Lys. Pigs fed diet RH1000 increased (P < 0.05) digestibility of CP, total AA, indispensable AA, Glu + Gln, His, Gly, Ala, Tyr, Leu, Phe, and Met. Similar to growth trials with increased total tract digestibility of P and Ca, phytase increased apparent ileal digestibility of these indispensable minerals and phytate. The phytase increased digestibility of CP and indispensable AA indicating a better availability of plant-based proteins.
Kaewtapee, C; Mosenthin, R; Nenning, S; Wiltafsky, M; Schäffler, M; Eklund, M; Rosenfelder-Kuon, P
2018-04-01
This study was conducted to determine the chemical composition and standardized ileal digestibility coefficients (SID) of crude protein (CP) and amino acids (AA) of European soya bean and rapeseed products in pigs. Six soya bean and two rapeseed products were used as the sole dietary source of CP and AA, including raw (FFSB) and roasted full-fat soya beans (FFSB R oasted ), soya bean (SBC) and rapeseed cake (RSC), and rapeseed meal (RSM) from Bavaria (Germany), soya bean meal (SBM) from the Danube region (Austria; SBM A ustria ), a commercially available standard SBM (SBM S td ) and an imported genetically modified organism-free SBM (SBM GMO -free ). Eight ileal- cannulated pigs with an initial body weight of 32 ± 2 kg were allotted to a row-column design with eight diets and six periods of seven days each. Trypsin inhibitor activity (TIA) ranged from 1.8 in SBM S td to 24.5 mg/g DM in FFSB. The SID of CP and all AA in FFSB R oasted were greater than in FFSB, but lower when compared to SBC and SBM A ustria (p < .05). The SID of CP and all AA (except glutamic acid) were not different between SBC and SBM A ustria , but the SID of CP and all AA (except methionine) were greater (p < .05) in SBC than in SBM GMO -free . Furthermore, the SID of CP and most AA showed a quadratic response with decreasing TIA, and there exists a quadratic response in SID of CP and all AA with increasing lysine to CP ratio and neutral detergent insoluble nitrogen (p < .05). In conclusion, variation in chemical composition and SID of CP and AA was observed in different European soya bean and rapeseed products as influenced by differences in processing conditions. European SBC and SBM A ustria can be used as alternative to imported SBM GMO -free and SBM S td in diets for growing pigs. © 2017 Blackwell Verlag GmbH.
Ke, Pan; Wu, Zhong-De; Wen, Hua-Song; Ying, Miao-Xiong; Long, Huo-Cheng; Qing, Liu-Guo
2013-01-01
Matrix metalloproteinases (MMPs) degrade various components of the extracellular matrix and functional polymorphisms in encoding genes may contribute to genetic susceptibility to many cancers. Up to now, associations between MMP-7 (-181A>G) and digestive system cancer risk have remained inconclusive. To better understand the role of the MMP-7 (-181A>G) genotype in digestive cancer development, we conducted this comprehensive meta-analysis encompassing 3,518 cases and 4,596 controls. Overall, the MMP-7 (-181A>G) polymorphism was associated with higher digestive system cancer risk on homozygote comparison (GG vs. AA, OR=1.21, 95% CI = 1.12-1.60) and in a dominant model (GG/GA vs. AA, OR=1.16, 95% CI =1.03-1.46). On subgroup analysis, this polymorphism was significantly linked to higher risks for gastric cancer (GG vs. AA, OR=1.22, 95% CI = 1.02- 1.46; GA vs. AA, OR=1.82, 95% CI =1.16-2.87; GG/GA vs. AA, OR=1.13, 95% CI =1.01-1.27; GG vs. GA/AA, OR= 1.25, 95% CI = 1.06-2.39. We also observed increased susceptibility to colorectal cancer and esophageal SCC in both homozygote (OR = 1.13, 95% CI = 1.06-1.26) and heterozygote comparisons (OR = 1.45, 95% CI = 1.11-1.91). In the stratified analysis by controls, significant effects were only observed in population-based studies (GA vs. AA, OR=1.16, 95% CI=1.08-1.50; GA/AA vs. GG, OR=1.10, 95% CI=1.01-1.72). According to the source of ethnicity, a significantly increased risk was found among Asian populations in the homozygote model (GG vs. AA, OR=1.40, 95% CI=1.12-1.69), heterozygote model (GA vs. AA, OR=1.26, 95% CI=1.02-1.51), and dominant model (GG/GA vs. AA, OR=1.18, 95% CI=1.08-1.55). Our findings suggest that the MMP-7 (-181A>G) polymorphism may be a risk factor for digestive system cancer, especially among Asian populations.
Bruce, K J; Karr-Lilienthal, L K; Zinn, K E; Pope, L L; Mahan, D C; Fastinger, N D; Watts, M; Utterback, P L; Parsons, C M; Castaneda, E O; Ellis, M; Fahey, G C
2006-06-01
This experiment was designed to evaluate the effects of selected soybean (SB) processing byproducts (gums, oil, soapstock, weeds/trash) when added back to soybean meal (SBM) during processing on the resulting nutrient composition, protein quality, nutrient digestibility by swine, and true metabolizable energy (TMEn) content and standardized AA digestibility by poultry. To measure ileal DM and nutrient digestibility, pigs were surgically fitted with a T-cannula in the distal ileum. The concentration of TMEn and the standardized AA digestibility by poultry were determined using the precision fed cecectomized rooster assay. Treatments in the swine experiment included SBM with no by-products; SBM with 1% gum; SBM with 3% gum; SBM with 0.5% soapstock; SBM with 1.5% soapstock; SBM with 2% weeds/trash; SBM with a combination of 3% gum, 1.5% soapstock, and 2% weeds/trash; SBM with 5.4% soybean oil; and roasted SB. A 10 x 10 Latin square design was utilized. The experiment was conducted at the University of Illinois, Urbana-Champaign, and at The Ohio State University, Columbus. In the swine experiment, apparent ileal DM, OM, CP, and AA digestibilities were reduced (P < 0.05) when pigs consumed the combination by-product diet compared with the diet containing no by-products. Apparent ileal digestibilities of DM, CP, and total essential, total nonessential, and total AA were lower (P < 0.05) for any diet containing by-products compared with the diet with no by-products. Apparent ileal digestibilities of DM, OM, CP, and AA were lower (P < 0.05) for the roasted SB-compared with the SB oil-containing diet. In the rooster experiment, TMEn values were greater (P < 0.05) for roasted SB compared with SBM with no by-products and increased linearly as the addition of soapstock increased. Individual, total essential, total nonessential, and total AA digestibilities were lower (P < 0.05) for roosters fed roasted SB versus SBM devoid of by-products. Gums, soapstock, and weeds/trash reduce the nutritive value of the resultant meal when they are added back during processing.
Adedokun, S A; Jaynes, P; Payne, R L; Applegate, T J
2015-10-01
Standardized ileal amino acid digestibility (SIAAD) of 5 samples of corn distillers dried grain with solubles (DDGS), 5 samples of bakery by-products (BBP), 3 samples of corn, and 1 sample of wheat middlings (WM) were evaluated in broilers and laying hens. Diets containing each of the 14 feed ingredients were evaluated in 21 day-old broiler chickens. The DDGS and BBP containing diets were fed to 30-week-old laying hens, while corn and wheat middling were evaluated in 50-week-old laying hens. All the diets were semi-purified with each feed ingredient being the only source of amino acid (AA). To obtain SIAAD values, apparent ileal AA digestibility was corrected for basal ileal endogenous AA losses using values generated from broilers and laying hens fed a nitrogen-free diet. Ileal crude protein digestibility for the 5 DDGS samples was higher (P < 0.05) in broilers than in laying hens. Broilers had higher SIAAD for DDGS 2, 3, 4, and 5 while there was no difference for DDGS 1 except for 4 AA where broilers had higher (P < 0.05) SIAAD values. Standardized ileal AA digestibility values for broilers were higher (P < 0.05) for BBP 1 and 4. Ileal CP digestibility for corn 1 was higher (P < 0.05) for broilers compared to laying hens, and SIAAD values for the 16 AA (9 indispensable and 7 dispensable) evaluated in this study were higher (P < 0.05) in broilers. Broilers had higher (P < 0.05) SIAAD values for 4 (histidine, leucine, phenylalanine, and valine) and 6 (histidine, leucine, methionine, phenylalanine, threonine, and valine) indispensable and 3 (cysteine, glutamic acid, and proline) and 4 (cysteine, glutamic acid, proline, and serine) dispensable AA for corn 2 and corn 3, respectively. No difference in SIAAD between broilers and laying hens was observed for WM. Results from this study confirm that high variability in digestibility exists between different samples of DDGS. Differences in SIAAD between broilers and laying hens were observed in some samples of DDGS and BBP. © 2015 Poultry Science Association Inc.
Kataoka, Yohei; Watanabe, Takahiro; Hayashi, Tomoko; Teshima, Reiko; Matsuda, Rieko
2015-01-01
In this study, we developed methods to quantify lead, total arsenic and cadmium contained in various kinds of soft drinks, and we evaluated their performance. The samples were digested by common methods to prepare solutions for measurement by ICP-OES, ICP-MS and graphite furnace atomic absorption spectrometry (GF-AAS). After digestion, internal standard was added to the digestion solutions for measurements by ICP-OES and ICP-MS. For measurement by GF-AAS, additional purification of the digestion solution was conducted by back-extraction of the three metals into nitric acid solution after extraction into an organic solvent with ammonium pyrrolidine dithiocarbamate. Performance of the developed methods were evaluated for eight kinds of soft drinks.
Ammonia pretreatment of corn stover enables facile lignin extraction
Mittal, Ashutosh; Katahira, Rui; Donohoe, Bryon S.; ...
2017-02-09
Thermochemical pretreatment of lignocellulose is often employed to render polysaccharides more digestible by carbohydrate-active enzymes to maximize sugar yields. The fate of lignin during pretreatment, however, is highly dependent on the chemistry employed and must be considered in cases where lignin valorization is targeted alongside sugar conversion—an important feature of future biorefinery development. Here, a two-step process is demonstrated in which anhydrous ammonia (AA) pretreatment is followed by mild NaOH extraction on corn stover to solubilize and fractionate lignin. As known, AA pretreatment simultaneously alters the structure of cellulose with enhanced digestibility while redistributing lignin. The AA-pretreated residue is thenmore » extracted with dilute NaOH at mild conditions to maximize lignin separation, resulting in a digestible carbohydrate-rich solid fraction and a solubilized lignin stream. Lignin removal of more than 65% with over 84% carbohydrate retention is achieved after mild NaOH extraction of AA-pretreated corn stover with 0.1 M NaOH at 25 °C. Two-dimensional nuclear magnetic resonance (2D-NMR) spectroscopy of the AA-pretreated residue shows that ammonolysis of ester bonds occurs to partially liberate hydroxycinnamic acids, and the AA-pretreated/NaOH-extracted residue exhibits a global reduction of all lignin moieties caused by reduced lignin content. A significant reduction (~70%) in the weight-average molecular weight ( M w) of extracted lignin is also achieved. Imaging of AA-pretreated/NaOH extracted residues show extensive delamination and disappearance of coalesced lignin globules from within the secondary cell walls. Glycome profiling analyses demonstrates ultrastructural level cell wall modifications induced by AA pretreatment and NaOH extraction, resulting in enhanced extractability of hemicellulosic glycans, indicating enhanced polysaccharide accessibility. The glucose and xylose yields from enzymatic hydrolysis of AA-pretreated/NaOH-extracted corn stover were higher by ~80% and ~60%, respectively, compared to untreated corn stover at 1% solids loadings. For digestions at 20% solids, a benefit of NaOH extraction is realized in achieving ~150 g/L of total monomeric sugars (glucose, xylose, and arabinose) in the enzymatic hydrolysates from AA-pretreated/NaOH-extracted corn stover. Altogether, this process enables facile lignin extraction in tandem with a leading thermochemical pretreatment approach, demonstrating excellent retention of highly digestible polysaccharides in the solid phase and a highly depolymerized, soluble lignin-rich stream.« less
Ammonia pretreatment of corn stover enables facile lignin extraction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mittal, Ashutosh; Katahira, Rui; Donohoe, Bryon S.
Thermochemical pretreatment of lignocellulose is often employed to render polysaccharides more digestible by carbohydrate-active enzymes to maximize sugar yields. The fate of lignin during pretreatment, however, is highly dependent on the chemistry employed and must be considered in cases where lignin valorization is targeted alongside sugar conversion—an important feature of future biorefinery development. Here, a two-step process is demonstrated in which anhydrous ammonia (AA) pretreatment is followed by mild NaOH extraction on corn stover to solubilize and fractionate lignin. As known, AA pretreatment simultaneously alters the structure of cellulose with enhanced digestibility while redistributing lignin. The AA-pretreated residue is thenmore » extracted with dilute NaOH at mild conditions to maximize lignin separation, resulting in a digestible carbohydrate-rich solid fraction and a solubilized lignin stream. Lignin removal of more than 65% with over 84% carbohydrate retention is achieved after mild NaOH extraction of AA-pretreated corn stover with 0.1 M NaOH at 25 °C. Two-dimensional nuclear magnetic resonance (2D-NMR) spectroscopy of the AA-pretreated residue shows that ammonolysis of ester bonds occurs to partially liberate hydroxycinnamic acids, and the AA-pretreated/NaOH-extracted residue exhibits a global reduction of all lignin moieties caused by reduced lignin content. A significant reduction (~70%) in the weight-average molecular weight ( M w) of extracted lignin is also achieved. Imaging of AA-pretreated/NaOH extracted residues show extensive delamination and disappearance of coalesced lignin globules from within the secondary cell walls. Glycome profiling analyses demonstrates ultrastructural level cell wall modifications induced by AA pretreatment and NaOH extraction, resulting in enhanced extractability of hemicellulosic glycans, indicating enhanced polysaccharide accessibility. The glucose and xylose yields from enzymatic hydrolysis of AA-pretreated/NaOH-extracted corn stover were higher by ~80% and ~60%, respectively, compared to untreated corn stover at 1% solids loadings. For digestions at 20% solids, a benefit of NaOH extraction is realized in achieving ~150 g/L of total monomeric sugars (glucose, xylose, and arabinose) in the enzymatic hydrolysates from AA-pretreated/NaOH-extracted corn stover. Altogether, this process enables facile lignin extraction in tandem with a leading thermochemical pretreatment approach, demonstrating excellent retention of highly digestible polysaccharides in the solid phase and a highly depolymerized, soluble lignin-rich stream.« less
Comparative ileal amino acid digestibility of distillers' grains for growing pigs.
Adeola, Olayiwola; Ragland, Darryl
2016-12-01
The objective of the experiment reported here was to investigate and compare the amino acid (AA) digestibility of distillers' dried grains (DDG), distillers' dried grains with solubles (DDGS), high protein distillers' dried grains (HP-DDG), and high protein distillers' dried grains with solubles (HP-DDGS) in growing pigs. Five semi-purified diets consisting of DDG, DDGS, HP-DDG, HP-DDGS, and nitrogen-free diet (NFD) were fed to pigs fitted with simple T-cannula for 5 observations per diet. Endogenous losses of AA at the terminal ileum of pigs that received the NFD were used to calculate standardized ileal digestibility (SID) of AA from apparent ileal digestibility (AID) of AA. The AID of Lys in DDGS was lower ( P < 0.05) than that in DDG, which was also lower ( P < 0.05) than that in HP-DDG. There were no differences in AID of Met among DDG, DDGS and HP-DDGS, but was greater ( P < 0.05) in HP-DDG than in DDG or DDGS. The AID of Thr in HP-DDG was greater ( P < 0.05) than that in DDGS but not different from that in DDG or HP-DDGS. The branched-chain AA Ile and Leu had greater ( P < 0.05) AID in HP-DDG than in DDG, DDGS or HP-DDGS, and there was no difference among DDG, DDGS, and HP-DDGS. The AID of Trp in DDG and DDGS or HP-DDG and HP-DDGS were not different, but the AID of Trp in HP-DDGS was greater ( P < 0.05) than that of DDGS. The greatest SID of the indispensable AA was in HP-DDG. Except for Arg and Lys in which DDG had greater ( P < 0.05) digestibility, there was no difference between DDG and DDGS in the SID of the indispensable AA. The SID of Lys in DDG was greater ( P < 0.05) than that of DDGS but there was no difference between that of DDG and HP-DDGS. Only His, Ile, and Met had lower ( P < 0.05) SID in HP-DDGS than HP-DDG within the indispensable AA. The SID of Ala, Asp, Cys, Glu, Gly, Ser and Tyr were lower ( P < 0.05) in DDGS than in HP-DDG. There SID of dispensable AA in DDG was not different from that of HP-DDGS. The current study provided apparent and standardized ileal amino acids digestibility values for traditional and high-protein corn distillers' dried grains coproducts for use in formulating swine diets. Amino acid digestibility was generally higher in HP-DDG than in other tested co-products of the dry grind processing of corn for ethanol.
Smiricky, M R; Grieshop, C M; Albin, D M; Wubben, J E; Gabert, V M; Fahey, G C
2002-09-01
Fourteen ileally cannulated pigs (BW = 35 +/- 2 kg) were randomly allotted to a replicated 7 x 7 Latin square design experiment to evaluate the influence of the soybean oligosaccharides (OS), raffinose and stachyose, on ileal nutrient digestibility and fecal consistency. Semipurified diets containing soy protein concentrate (SPC) or soybean meal (SBM) as the sole protein sources were fed. Soy solubles (SS), a by-product of SBM processing containing 3.5% raffinose and 11.5% stachyose, were used to increase dietary raffinose and stachyose concentrations. The seven dietary treatments were SPC, SPC + 9% SS, SBM, SBM + 9% SS, SBM + 18% SS, SBM + 24,000 U alpha-galactosidase enzyme preparation/kg diet, and a low-protein casein (LPC) diet used to calculate true digestibility. Diets, with the exception of the LPC diet, were formulated to contain 17% CP. All diets contained 0.5% chromic oxide as a marker for ileal digestibility determination. The experimental periods were divided into a 5-d diet adaptation followed by 2-d of ileal digesta collection. Diets and digesta were analyzed for DM, N, Cr, amino acids (AA), raffinose, and stachyose. Fecal consistency was determined on d 6 and 7 of each experimental period. The apparent and true ileal AA digestibilities were not different (P < 0.05) for the SPC and SBM control diets. When SS was added to the SPC diet, apparent and true N and AA digestibilities were depressed (P < 0.05) with the exception of Trp and Pro. The apparent and true ileal N and AA digestibilities were not different (P > 0.05) between the SBM control and SBM + 9% SS diets with the exception of Glu. There was a linear decrease (P < 0.05) in apparent and true DM, Val, Gly, and Tyr digestibilities when increasing levels of SS were added to the SBM diet. The addition of alpha-galactosidase did not improve apparent or true ileal N or AA digestibilities except for apparent and true Val and Tyr. Ileal raffinose digestibility was improved (P < 0.05) by addition of a-galactosidase, but was not affected by any other dietary treatment. Ileal stachyose digestibility was not affected (P > 0.58) by treatment. Fecal consistency likewise was not affected (P > 0.36) by dietary treatment. In conclusion, soy OS reduced nutrient digestibilities, but the reductions were small, ranging from approximately 1.1 to 7.4 percentage units. This suggests that other factors may be negatively impacting SBM digestibility.
Validation of an in vitro digestive system for studying macronutrient decomposition in humans.
Kopf-Bolanz, Katrin A; Schwander, Flurina; Gijs, Martin; Vergères, Guy; Portmann, Reto; Egger, Lotti
2012-02-01
The digestive process transforms nutrients and bioactive compounds contained in food to physiologically active compounds. In vitro digestion systems have proven to be powerful tools for understanding and monitoring the complex transformation processes that take place during digestion. Moreover, the investigation of the physiological effects of certain nutrients demands an in vitro digestive process that is close to human physiology. In this study, human digestion was simulated with a 3-step in vitro process that was validated in depth by choosing pasteurized milk as an example of a complex food matrix. The evolution and decomposition of the macronutrients was followed over the entire digestive process to the level of intestinal enterocyte action, using protein and peptide analysis by SDS-PAGE, reversed-phase HPLC, size exclusion HPLC, and liquid chromatography-MS. The mean peptide size after in vitro digestion of pasteurized milk was 5-6 amino acids (AA). Interestingly, mostly essential AA (93.6%) were released during in vitro milk digestion, a significantly different relative distribution compared to the total essential AA concentration of bovine milk (44.5%). All TG were degraded to FFA and monoacylglycerols. Herein, we present a human in vitro digestion model validated for its ability to degrade the macronutrients of dairy products comparable to physiological ranges. It is suited to be used in combination with a human intestinal cell culture system, allowing ex vivo bioavailability measurements and assessment of the bioactive properties of food components.
Zhang, Ranran; Gu, Jie; Wang, Xiaojuan; Qian, Xun; Duan, Manli; Sun, Wei; Zhang, Yajun; Li, Haichao; Li, Yang
2017-02-01
In this study, swine manure containing sulfachloropyridazine sodium (SCPS) and zinc was subjected to mesophilic (37°C) anaerobic digestion (AD). The absolute abundances (AAs) of antibiotic resistance genes (ARGs) were evaluated, as well as intI1 and intI2, and the degradation of SCPS according to variation in the amount of bio-available zinc (bio-Zn). In digester that only contained SCPS, the concentrations of SCPS were lower than that digesters both contain SCPS and Zn. Compared with the control digester, the addition of SCPS increased the AAs of sul1, sul3, drfA1, and drfA7 by 1.3-13.1 times. However, compared with the digester with SCPS but no added Zn, the AAs of sul3, drfA1, and drfA7 were decreased by 21.4-70.3% in the presence of SCPS and Zn, whereas sul1 and sul2 increased 1.3-10.7 times. There were significant positive correlations (P<0.05) between the concentrations of SCPS with several ARGs and bio-Zn. Copyright © 2016. Published by Elsevier Ltd.
Kerr, K R; Beloshapka, A N; Morris, C L; Parsons, C M; Burke, S L; Utterback, P L; Swanson, K S
2013-01-01
Our objective was to evaluate raw meat diets for captive exotic and domestic carnivores containing traditional and alternative raw meat sources, specifically, beef trimmings, bison trimmings, elk muscle meat, and horse trimmings. We aimed to examine diet composition and protein quality; apparent total tract energy and macronutrient digestibility in domestic cats, African wildcats, jaguars, and Malayan tigers; and ME and fecal fermentative end-products in domestic cats. Because of variation in the meat sources, dietary proximate, AA, and long-chain fatty acid composition were variable. Our analyses indicated that all diets had essential fatty acid deficiencies, and the elk diet (i.e., trimmed muscle meat) was deficient in total fat. Standardized AA digestibilities measured using the cecectomized rooster assay were high (>87%). Using the NRC minimum requirements for the growth of kittens, the first limiting AA of all diets was the combined requirement of Met and Cys (AA score: 81 to 95; protein digestibility corrected AA score: 75 to 90). All diets were highly digestible (88 to 89% OM digestibility). There was no effect of diet or felid species on DM (85 to 87%), OM, and GE (90 to 91%) digestibilities. Apparent CP digestibility was greater (P≤0.05) in cats fed elk (97%) compared with those fed bison (96%), and greater (P≤0.05) in wildcats (97%) and domestic cats (97%) compared with tigers (95%). The diet and species interaction (P≤0.05) was observed for apparent fat digestibility. In domestic cats, the fresh fecal pH and proportions of acetate and butyrate were altered (P≤0.05) due to diet. Diet also affected (P≤0.05) fresh fecal concentrations of total branched-chain fatty acids, valerate, and Lactobacillus genus. In conclusion, although the raw meat diets were highly digestible, because of variation in raw meat sources the nutrient composition of the diets was variable. Thus, compositional analysis of raw meat sources is necessary for proper diet formulation. The types of meat commonly used in raw meat diets may be deficient in total fat (trimmed muscle meat) and essential fatty acids (trimmings and muscle meats). Additionally, differences in raw meat source nutrient composition and digestibility affect the beneficial and putrefactive fermentative end-products found in feces.
Deng, P; Utterback, P L; Parsons, C M; Hancock, L; Swanson, K S
2016-08-01
A wide variety of animal protein-based ingredients is commonly used in the pet food products. The raw ingredients and processing procedures used may greatly affect protein quality. Testing the quality of alternative protein sources is necessary and contributes to the sustainability of pet foods. The objective of this study was to test the chemical composition of 8 protein sources intended for use in dog and cat foods (calamari meal, pork peptone, alligator meal, lamb meal, venison meal, chicken meal, and 2 duck meals), and evaluate their true nutrient digestibility and nitrogen-corrected true ME (TMEn) using the precision-fed cecectomized rooster assay. Calamari meal and pork peptone had lower ash (4.4 and 3.6% of DM, respectively) but greater CP (88.1 and 80.5% of DM, respectively) and either greater or similar GE (5.6 and 5.3 kcal/g of DM, respectively) compared with alligator, lamb, venison, chicken, and duck meals (11.8 to 24.5% ash, 58.7 to 65.9% CP, and 4.6 to 5.3 kcal GE/g). Acid-hydrolyzed fat (AHF) was lower in calamari meal (8.7% of DM) compared with the other proteins tested (15.5-22.1% of DM). True nutrient digestibility was variable among the protein sources (52 to 79% of DM, 60 to 83% of OM, 78 to 92% of AHF, and 70 to 89% of GE) with pork peptone having the highest DM, AHF, and GE digestibility and calamari meal having the highest OM digestibility. True indispensable AA digestibility was highest for calamari meal, with all AA having a digestibility greater than 90%. Except for histidine, all indispensable AA had a digestibility over 85% for pork peptone. In contrast, true indispensable AA digestibility was lowest for lamb meal, with histidine having digestibility less than 70% and the other entire indispensable AA having digestibility between 72 and 88%. The TMEn of calamari meal (4.82 kcal/g DM and 86.9% of GE) was greater ( < 0.05) than the other protein sources. The lamb meal had the lowest TMEn value (3.12 kcal/g DM and 66.9% of GE), with others being intermediate (3.46-4.09 kcal/g DM and 71.2-77.9% of GE). This study demonstrates the considerable variability that exists not only in the chemical composition but also in the true nutrient digestibility among protein sources intended for use in dog and cat foods and justifies further in vivo testing of novel protein sources.
Tjernsbekk, M T; Tauson, A-H; Matthiesen, C F; Ahlstrøm, Ø
2016-09-01
The present study evaluated growing mink () as a model for dietary protein quality assessment of protein meals used in extruded dog foods. Three foods with similar CP content but of different protein quality were produced using different protein meals. The protein meals varied with respect to CP digestibility and AA composition and included lamb meal (LBM), poultry meal (PM), and fish meal (FM) with low, intermediate, and high protein quality, respectively. Nitrogen balance, BW gain, protein efficiency ratio (PER), and apparent total tract digestibility (ATTD) were used as measures of protein and AA bioavailability in growing mink. Standardized ileal digestibility (SID) was used to measure protein and AA bioavailability in adult dogs (). The mink study (3 × 3 Latin square design) included 12 kits aged 8 to 11 wk. The dog study included 12 dogs divided in 3 groups allocated to 1 of the experimental diets. The growing mink responded in accordance with the different AA supply between diets, as determined by the first limiting AA. The LBM diet deviated from the other diets with lower ( < 0.001) values for N retention, BW gain, and PER, and the diets differed ( < 0.001) in ATTD of CP and all AA, except for hydroxyproline. Retention of N was 0.66, 1.04, and 1.18 g·kg·d; BW gain was 8.2, 26.8, and 35.3 g/d; PER was 0.38, 1.39, and 1.71; and ATTD of CP was 66.8, 73.8, and 82.1% for the LBM, PM, and FM diets, respectively. In dogs, SID of CP and AA differed ( ≤ 0.017) between diets and was generally lowest for the LBM diet, intermediate for the PM diet, and greatest for the FM diet. For CP, SID was 71.5, 80.2, and 87.0% for the LBM, PM, and FM diets, respectively. The contents of digestible CP and AA (based on SID) covered the minimal requirement for adult dogs set by the NRC for all diets, except for the content of digestible Met + Cys in the LBM diet. Despite this, dietary content of Met + Cys in the LBM diet agreed with the recommended level set by the NRC and the Association of American Feed Control Officials for adult dogs but was below the level recommended by the European Pet Food Industry Federation. It was concluded that growth studies with mink kits can provide valuable information in protein quality assessment of extruded dog foods. Furthermore, the study showed that to ensure nutritional adequacy of dog food and to be able to compare protein quality of dog foods, information on AA composition and digestibility is crucial.
Duan, Yin; Shi, Ji-Nan; Pan, Chi; Chen, Hai-Long; Zhang, Su-Zhan
2014-01-01
Interleukin-17A (IL-17A) is a multifunctional cytokine which plays a crucial role in the initiation and progression of cancer. To date, several studies have investigated associations between IL-17A -197G>A (rs2275913) polymorphism and digestive cancer risk, but the results remain conflicting. We here aimed to confirm the role of this single nucleotide polymorphism (SNP) in susceptibility to digestive cancer through a systemic review and meta-analysis. Ten eligible case-control studies were identified by searching electronic databases, involving 3,087 cases and 3,815 controls. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) were used to estimate the strength of the association. The results of overall analyses indicated that the variant A allele was associated with an increased risk of digestive cancer (AA vs GG: OR=1.51, 95%CI=1.18-1.93; AA vs GG+GA: OR=1.45, 95%CI=1.12-1.87; A vs G: OR=1.21, 95%CI=1.05-1.39). In subgroup analysis stratified by specific cancer type, elevated risk among studies of gastric cancer was found (AA vs GG: OR=1.68, 95%CI=1.24-2.28; AA vs GG+GA: OR=1.62, 95%CI=1.16-2.26; A vs G: OR=1.23, 95%CI=1.04-1.46). According to ethnicity, there was evidence in the Asian populations for an association between this polymorphism and cancer risk (GA vs GG: OR=1.19, 95%CI=1.05-1.36; AA vs GG: OR=1.56, 95%CI=1.15-2.12; AA+GA vs GG: OR=1.28, 95%CI=1.13- 1.44; AA vs GG+GA: OR=1.42, 95%CI=1.01-2.00; A vs G: OR=1.24, 95%CI=1.08-1.44), while in the Caucasian populations an association was found in the recessive model (AA vs GG+GA: OR=1.62, 95%CI=1.17-2.24). In conclusion, the results of this meta-analysis suggest that the IL-17A -197G>A polymorphism contributes to an increased risk of human digestive cancer, both in the Asian and Caucasian populations and especially for gastric cancer.
Rochell, S J; Kuhlers, D L; Dozier, W A
2013-01-01
Two identical trials were conducted to determine the relationship of a novel digestive enzyme assay, Poultry Complete IDEA (PC IDEA), and the pepsin digestibility assay with standardized ileal amino acid digestibility (SIAAD) of 20 animal protein meals (APM) fed to broilers from 25 to 30 d of age. Animal protein meals included 10 meat and bone meals (MBM) consisting of bovine, porcine, or mixed bovine and porcine raw materials (BP), and 10 animal protein blends containing animal proteins from various species. Treatments consisted of 20 semi-purified diets containing 1 APM as the sole source of dietary amino acids (AA), and 1 N-free diet to determine endogenous ileal AA flow. With the exception of the N-free diet, diets were formulated to contain 20% CP. In each trial, 756 Ross × Ross 708 male broilers were housed in battery cages and randomly assigned to 21 dietary treatments on d 25 (12 birds per cage; 3 replicate cages), and ileal digesta were collected on d 30 for determination of SIAAD. Pepsin digestibility and PC IDEA were determined for APM samples from each experimental diet (3 replicates per trial; 6 total replicates). Pepsin digestibility and PC IDEA were both correlated (P < 0.001) with SIAAD for each AA. Multiple linear regression of PC IDEA and pepsin digestibility on SIAAD resulted in the following equations: % Lys SIAAD = [-9.65 + (0.38 × % PC IDEA predicted Lys digestibility) + (0.69 × % pepsin digestibility)], % Met SIAAD = [-35.95 + (0.62 × % PC IDEA predicted Met digestibility) + (0.75 × % pepsin digestibility)], % Thr SIAAD = [-77.5 + (0.39 × % PC IDEA predicted Thr digestibility) + (1.37 × % pepsin digestibility)]. Values of R(2) were 0.46, 0.47, and 0.55 for Lys, Met, and Thr, respectively. The relatively low R(2) values may have been due to the limited range in SIAAD observed for the 20 APM, and additional data on APM varying in SIAAD are needed.
Applying complex models to poultry production in the future--economics and biology.
Talpaz, H; Cohen, M; Fancher, B; Halley, J
2013-09-01
The ability to determine the optimal broiler feed nutrient density that maximizes margin over feeding cost (MOFC) has obvious economic value. To determine optimal feed nutrient density, one must consider ingredient prices, meat values, the product mix being marketed, and the projected biological performance. A series of 8 feeding trials was conducted to estimate biological responses to changes in ME and amino acid (AA) density. Eight different genotypes of sex-separate reared broilers were fed diets varying in ME (2,723-3,386 kcal of ME/kg) and AA (0.89-1.65% digestible lysine with all essential AA acids being indexed to lysine) levels. Broilers were processed to determine carcass component yield at many different BW (1.09-4.70 kg). Trial data generated were used in model constructed to discover the dietary levels of ME and AA that maximize MOFC on a per broiler or per broiler annualized basis (bird × number of cycles/year). The model was designed to estimate the effects of dietary nutrient concentration on broiler live weight, feed conversion, mortality, and carcass component yield. Estimated coefficients from the step-wise regression process are subsequently used to predict the optimal ME and AA concentrations that maximize MOFC. The effects of changing feed or meat prices across a wide spectrum on optimal ME and AA levels can be evaluated via parametric analysis. The model can rapidly compare both biological and economic implications of changing from current practice to the simulated optimal solution. The model can be exploited to enhance decision making under volatile market conditions.
Olojede, O C; Ford, M J; Jacob, J P; Ao, T; Pescatore, A J; Adedokun, S A
2018-06-01
For accurate estimation of nutrient digestibility, an ideal drying and sampling method is required to preserve the quality of the digesta. A standard corn-soybean meal (corn-SBM) broiler starter diet was fed from d 0 to 10 before birds were placed on the experimental diets until d 21. One hundred and sixty-eight male Cobb 500 broiler chicks were used to evaluate the effect of two drying methods (freeze-dryer vs. forced air-oven) and two drying temperatures (40 vs. 55°C) (Exp 1), while ninety-six chicks were used to evaluate the effect of flushing and squeezing as well as marker types (titanium vs. chromium) on apparent ileal DM, N, Ca, P, and AA digestibility (Exp 2). There were seven (Exp 1) or eight (Exp 2) replicate cages per treatment with 6 birds/cage. Digesta from the distal two thirds of the ileum was obtained from birds following euthanasia on d 21 by squeezing (Exp 1) and squeezing or flushing (Exp 2). Samples collected were stored in the freezer at -20°C until they were either freeze-dried (FD) or oven-dried (OD) at 40 or 55°C. There were no interactions between the drying methods and drying temperatures (Exp 1) on apparent ileal DM, N, and AA digestibility. Met had the highest (92.3%) while Cys had the lowest (73.8%) digestibility value. In Exp 2, no interaction between sampling methods and marker types was observed. The effect of sampling methods was not significant except for Arg and Met where squeezing resulted in higher (P < 0.05) digestibility values. Furthermore, apparent ileal His, Ile, Cys, Ser, and Tyr digestibility tended to be higher (P < 0.1) in squeezed digesta compared to the flushed digesta. Results from these studies showed that OD ileal digesta at 40 or 55°C had no negative effect on apparent ileal AA digestibility. Likewise, marker type did not influence apparent ileal AA digestibility values.
What is the true supply of amino acids for a dairy cow?
Lapierre, H; Pacheco, D; Berthiaume, R; Ouellet, D R; Schwab, C G; Dubreuil, P; Holtrop, G; Lobley, G E
2006-03-01
Improving the prediction of milk protein yield relies on knowledge of both protein supply and requirement. Definition of protein/amino acid supply in ruminants is a challenging task, due to feedstuff variety and variability and to the remodeling of nutrient intake by the rumen microflora. The questions arise, therefore, how and where should we measure the real supply of AA in the dairy cow? This review will follow the downstream flow of AA from duodenum to peripheral tissue delivery, with a glance at the efficiency of transfer into milk protein. Duodenal AA flow comprises rumen undegradable feed, microbial protein, and endogenous secretions. Most attention has been directed toward definition of the first two contributions but the latter fraction can represent as much as 20% of duodenal flow. More information is needed on what factors affect its magnitude and overall impact. Once digested, AA are absorbed into the portal vein. The ratio of portal absorption to small intestinal apparent digestion varies among essential AA, from 0.43 (threonine) to 0.76 (phenylalanine), due to the contributions of preduodenal endogenous secretions to the digestive flow, non-reabsorption of endogenous secretions and gut oxidation of AA. Few data are available on these phenomena in dairy cows but the evidence indicates that they alter the profile of AA available for anabolic purposes. Recent comparisons of estimated duodenal flux and measured portal flux have prompted a revisit of the NRC (2001) approach to estimate AA flows at the duodenum. Changes to the model are proposed that yield predictions that better fit the current knowledge of AA metabolism across the gut. After absorption, AA flow first to the liver where substantial and differential net removal occurs, varying from zero for the branched-chain AA to 50% of portal absorption for phenylalanine. This process alters the pattern of net supply to the mammary gland. Overall, intermediary metabolism of AA between the duodenum and the mammary gland biologically explains the decreased efficiency of the transfer of absorbed AA into milk protein as maximal yield is approached. Therefore, variable, rather than fixed, factors for transfer efficiencies must be incorporated into future predictive models.
Hu, Rujiu; Li, Jing; Soomro, Rab Nawaz; Wang, Fei; Feng, Yan; Yang, Xiaojun; Yao, Junhu
2017-01-01
This study was conducted to assess the influence of dietary protein content in poultry when using the 15N-leucine single-injection method to determine endogenous amino acid losses (EAALs) in poultry. Forty-eight cecectomized roosters (2.39 ± 0.23 kg) were randomly allocated to eight dietary treatments containing protein levels of 0, 3%, 6%, 9%, 12%, 15%, 18% and 21%. Each bird was precisely fed an experimental diet of 25 g/kg of body weight. After feeding, all roosters were subcutaneously injected with a 15N-leucine solution at a dose of 20 mg/kg of body weight. Blood was sampled 23 h after the injection, and excreta samples were continuously collected during the course of the 48-h experiment. The ratio of 15N-enrichment of leucine in crude mucin to free leucine in plasma ranged from 0.664 to 0.763 and remained relatively consistent (P > 0.05) across all treatments. The amino acid (AA) profiles of total endogenous AAs, except isoleucine, alanine, aspartic acid, cysteine, proline and serine, were not influenced (P > 0.05) by dietary protein contents. The predominant endogenous AAs in the excreta were glutamic acid, aspartic acid, threonine, serine and proline. The order of the relative proportions of these predominant AAs also remained relatively constant (P > 0.05). The endogenous losses of total AAs determined with the 15N-leucine single-injection method increased curvilinearly with the dietary protein contents. The true digestibility of most AAs and total AAs was independent of their respective dietary protein levels. Collectively, the 15N-leucine single-injection method is appropriate for determining EAALs and the true digestibility of AAs in poultry fed varying levels of protein-containing ingredients.
Hu, Rujiu; Li, Jing; Soomro, Rab Nawaz; Wang, Fei; Feng, Yan; Yang, Xiaojun
2017-01-01
This study was conducted to assess the influence of dietary protein content in poultry when using the 15N-leucine single-injection method to determine endogenous amino acid losses (EAALs) in poultry. Forty-eight cecectomized roosters (2.39 ± 0.23 kg) were randomly allocated to eight dietary treatments containing protein levels of 0, 3%, 6%, 9%, 12%, 15%, 18% and 21%. Each bird was precisely fed an experimental diet of 25 g/kg of body weight. After feeding, all roosters were subcutaneously injected with a 15N-leucine solution at a dose of 20 mg/kg of body weight. Blood was sampled 23 h after the injection, and excreta samples were continuously collected during the course of the 48-h experiment. The ratio of 15N-enrichment of leucine in crude mucin to free leucine in plasma ranged from 0.664 to 0.763 and remained relatively consistent (P > 0.05) across all treatments. The amino acid (AA) profiles of total endogenous AAs, except isoleucine, alanine, aspartic acid, cysteine, proline and serine, were not influenced (P > 0.05) by dietary protein contents. The predominant endogenous AAs in the excreta were glutamic acid, aspartic acid, threonine, serine and proline. The order of the relative proportions of these predominant AAs also remained relatively constant (P > 0.05). The endogenous losses of total AAs determined with the 15N-leucine single-injection method increased curvilinearly with the dietary protein contents. The true digestibility of most AAs and total AAs was independent of their respective dietary protein levels. Collectively, the 15N-leucine single-injection method is appropriate for determining EAALs and the true digestibility of AAs in poultry fed varying levels of protein-containing ingredients. PMID:29166671
Adedokun, S A; Owusu-Asiedu, A; Ragland, D; Plumstead, P; Adeola, O
2015-01-01
Sixteen cannulated pigs were used to evaluate the effect of a new 6-phytase derived from Buttiauxella spp. and expressed in Trichoderma reesei on apparent ileal digestibility (AID) of AA and apparent total tract digestibility (ATTD) of DM, N, Ca, P, Na, Mg, K, Cl, and energy. Pigs were fed 4 diets for 2 periods in a crossover design. Within each period, there were 4 blocks of 4 pigs per block with each diet represented within each block. The average initial BW in periods 1 and 2 were 22 and 30 kg, respectively. Each period lasted 9 d with fecal collection on d 5 and 6 and a 12-h ileal digesta collection on d 7, 8, and 9. Pigs received a daily feed allowance of approximately 4.5% of their BW. The experimental diets were based on corn, soybean meal, wheat middlings, and corn distillers dried grain with solubles. Phytase was added at 0; 500; 1,000; or 2,000 phytase units/kg of diet to a basal diet that contained 205, 15, 5.4, and 10 g of CP, Lys, total P (1.6 g of nonphytate P), and Ca/kg diet, respectively. The addition of phytase improved (P < 0.05) AID of DM, N, Ca, and P. Increasing phytase supplementation linearly and quadratically increased (P < 0.05) AID of P and Ca, respectively, with AID of Ca showing a tendency for a linear increase (P = 0.053). Phytase supplementation of the basal diet improved (P < 0.05) AID of P from 46 to 62%. Phytase supplementation increased (P < 0.05) ATTD of DM, N, Ca, P, Mg, K, and energy. Contrasts showed that phytase supplementation of the basal diet increased (P < 0.05) AID for 8 indispensable AA (Arg, His, Ile, Leu, Lys, Phe, Thr, and Val), 6 dispensable AA (Ala, Asp, Cys, Glu, Ser, and Tyr), as well as for total AA. Furthermore, phytase supplementation to the basal diet showed a tendency (P < 0.10) to increase ileal digestibility of Gly. Ileal digestibility of Met, Trp, and Pro were not affected by phytase supplementation. Increasing the level of phytase supplementation resulted in linear increases (P < 0.05) in AID of 6 indispensable AA (Arg, Ile, Leu, Lys, Phe, and Val) and 1 dispensable AA (Asp) with 4 AA (His, Cys, Glu, and Tyr) showing a tendency for linear increase (P < 0.10) in AID of AA. The results from this study showed that in addition to increasing P and Ca utilization, the new Buttiauxella 6-phytase expressed in Trichoderma reesei enhanced ileal digestibility of N and several AA in growing pigs in a dose-dependent manner.
Gao, Wei; Chen, Aodong; Zhang, Bowen; Kong, Ping; Liu, Chenli; Zhao, Jie
2015-04-01
This study evaluated the in situ ruminal degradability, and subsequent small intestinal digestibility (SID) of dry matter, crude protein (CP), and amino acids (AA) of cottonseed meal (CSM), sunflower seed meal (SFSM) and distillers dried grains with solubles (DDGS) by using the modified three-step in vitro procedure. The ruminal degradability and subsequent SID of AA in rumen-undegradable protein (RUP-AA) varied among three protein supplements. The result show that the effective degradability of DM for SFSM, CSM, and DDGS was 60.8%, 56.4%, and 41.0% and their ruminal fermentable organic matter was 60.0%, 55.9%, and 39.9%, respectively. The ruminal degradable protein (RDP) content in CP for SFSM, CSM, and DDGS was 68.3%, 39.0%, and 32.9%, respectively, at the ruminal solid passage rate of 1.84%/h. The SFSM is a good source of RDP for rumen micro-organisms; however, the SID of RUP of SFSM was lower. The DDGS and CSM are good sources of RUP for lambs to digest in the small intestine to complement ruminal microbial AA of growing lambs. Individual RUP-AA from each protein source was selectively removed by the rumen micro-organisms, especially for Trp, Arg, His, and Lys (p<0.01). The SID of individual RUP-AA was different within specific RUP origin (p<0.01). Limiting amino acid was Leu for RUP of CSM and Lys for both RUP of SFSM and DDGS, respectively. Therefore, different protein supplements with specific limitations should be selected and combined carefully in growing lambs ration to optimize AA balance.
Xue, P C; Ragland, D; Adeola, O
2014-09-01
An experiment was conducted in growing pigs to investigate the additivity of apparent ileal digestibility (AID) or standardized ileal digestibility (SID) of CP and AA in mixed diets containing multiple protein sources. Using the determined AID or SID for CP and AA in corn, soybean meal (SBM), corn distillers' dried grains with solubles (DDGS), or canola meal (CM), the AID or SID for 4 mixed diets based on corn-SBM, corn-SBM-DDGS, corn-SBM-CM, or corn-SBM-DDGS-CM were predicted and compared with determined AID or SID, respectively. Eighteen growing pigs (initial BW = 61.3 ± 5.5 kg) were surgically fitted with T-cannulas and assigned to a duplicated 9 × 4 incomplete Latin square design with 9 diets and 4 periods. The 9 experimental diets consisted of a nitrogen-free diet (NFD) to estimate basal ileal endogenous loss (BEL) of AA, 4 semipurified diets to determine the AID and SID of CP and AA in the 4 ingredients, and 4 mixed diets to test the additivity of AID and SID. Chromic oxide was added as an indigestible marker. Pigs were fed 1 of the 9 diets during each 7-d period, and ileal digesta were collected on d 6 and 7, from 0800 to 1800 h. The analyzed AA levels for the mixed diets were close to the calculated values based on the AA composition of each ingredient. The results revealed that the predicted SID were consistent with determined values, except for Leu, Thr, Asp, Cys, Pro, and Ser in the corn-SBM diet and Met and Cys in the corn-SBM-DDGS diet. The determined AID for total AA and Arg, His, Trp, Gly, and Pro in the corn-SBM diet were greater (P < 0.05) than predicted. For the corn-SBM-DDGS diet, the determined AID were greater (P < 0.05) than predicted AID for CP, total AA, and all AA except for Arg, Leu, and Pro. In the corn-SBM-CM diet, the determined AID were greater (P < 0.05) than predicted AID for Arg, Cys, and Gly. When compared with determined values, predicted AID in the corn-SBM-DDGS-CM diet were lower (P < 0.05) for total AA and Arg, Met, Cys, and Pro. In conclusion, the results substantiate the notion that SID of AA are more accurate than AID for predicting ileal digestibility of AA in mixed diets containing multiple protein sources. In addition, the lack of additivity of AID in mixed diets could be attributed to the intrinsic characteristics of the feed ingredient, especially its AA content.
Ludden, P A; Kerley, M S
1997-09-01
Five cannulated Holstein steers (538 +/- 35 kg) were used in a 4 x 4 Latin square design experiment with extra observations to examine the influence of level of feed intake on postruminal flow and intestinal disappearance of N and amino acids (AA). Treatments consisted of a single diet fed at four levels of energy intake (1.5, 2.0, 2.5, and 3.0 times NEm requirement). The diet was formulated on a DM basis to contain 13.25% CP using cracked corn (56.1%), soybean hulls (18%), cottonseed hulls (15%), soybean oil (4.25%), and corn gluten meal (5.6%). Increasing feed intake linearly increased (P < .0001) the quantity of OM truly digested in the stomach but tended to decrease (P = .11) OM digestion as a percentage of intake. Level of feed intake had no effect (P > .10) on ruminal pH, NH3 N, or peptide concentration or on particulate and fluid passage rates. However, total VFA concentration increased linearly (P < .0001) and the acetate: propionate ratio decreased linearly (P < .0001) as feed intake increased. Flows of microbial and nonmicrobial N at the duodenum linearly increased (P < .002) with increasing intake but did not differ (P > .10) as a percentage of intake. Level of feed intake did not affect (P > .10) microbial efficiency, N disappearance from the small intestine, or total tract N digestibility. With the exception of tryptophan, flows of all individual AA increased linearly (P < .01) with increasing intake. As a percentage of duodenal flow, AA digestion in the small intestine did not differ (P > .10), leading to a linear increase (P < .10) in the net quantity of individual (with the exception of tryptophan) and total AA disappearing from the small intestine as feed intake increased. Likewise, the profile of AA (except tryptophan) disappearing from the small intestine was unaffected (P > .10) by level of feed intake. When compared with predicted requirements for a 227-kg growing beef steer, Arg, Met, His, and Lys were suggested to be the most limiting AA for growth when this diet is fed. We conclude that altering energy intake by restricting intake of a single diet has only minor effects on the profile of digestible AA or other nutrients presented to the animal.
Dadalt, J C; Gallardo, C; Polycarpo, G V; Budiño, F E L; Rogiewicz, A; Berto, D A; Trindade Neto, M A
2016-10-01
Most of amino acid (AA) digestibility values for feed ingredients are obtained using pigs cannulated in the distal ileum. The ileal-cannulated pig model uses pigs older than six weeks due to difficulties related to implanting the T-cannula in distal ileum of younger pigs and complications during the post-surgical recovery. However, to properly formulate the diet of weaned pigs, the nutritive value of feed ingredients should be determined with younger pigs. Thus, 25 weaned pigs were used to determine the apparent total tract digestibility (ATTD) of nutrients, energy, and apparent ileal digestibility (AID) and standardized ileal digestibility (SID) ileal AA digestibility of broken rice (BR), with or without multicarbohydrase (MC) and phytase (Phy) supplementation. Piglets were weaned at 23 d of age and individually housed in digestibility cages until 45 d of age. The trial consisted of 7 d of adaptation to the experimental diets and 3 d of excreta (feces and urine) collection. Ileal digesta was collected at slaughter (about 6 weeks of age). A completely randomized experimental design was used to determine the effects of MC and Phy. Reference diets (RD, 5% casein) was replaced by 30% of BR with or without MC, Phy, or MC+Phy. The RD was used to quantify endogenous AA losses. BR with Phy supplied had increased the ATTD of dry matter (p<0.05) and SID of histidine (p = 0.05), arginine, leucine, lysine, valine, alanine, and proline (p<0.05). BR with MC had been increased digestible energy and protein and SID for histidine (p<0.05). There was no interaction between Phy and MC on the BR nutrient digestibilities. Standardized amino acid digestibilities of BR, without enzymes, were lower than those values reported in the literature. The MC and Phy improved the digestibility of some nutrients and energy of BR in post-weaned piglet diets.
Multivessel system for cold-vapor mercury generation. Determination of mercury in hair and fish.
Boaventura, G R; Barbosa, A C; East, G A
1997-01-01
A multivessel system for the determination of mercury (Hg) by cold-vapor atomic absorption spectrometry (CV-AAS) and inductively coupled plasma atomic emission spectrometry (ICP-AES) was developed. The performance of the proposed device was tested by determining total Hg in quality-control samples of hair and fishes following acid digestion. Application of the apparatus to the determination of Hg by CV-AAS following alkaline digestion was studied as well. The detection limit obtained for CV-AAS was 0.11 ng/mL and for ICP-AES 1.39 ng/mL. The results show that the system is appropriate to be used in techniques involving cold-vapor generation of Hg.
Gao, Wei; Chen, Aodong; Zhang, Bowen; Kong, Ping; Liu, Chenli; Zhao, Jie
2015-01-01
This study evaluated the in situ ruminal degradability, and subsequent small intestinal digestibility (SID) of dry matter, crude protein (CP), and amino acids (AA) of cottonseed meal (CSM), sunflower seed meal (SFSM) and distillers dried grains with solubles (DDGS) by using the modified three-step in vitro procedure. The ruminal degradability and subsequent SID of AA in rumen-undegradable protein (RUP-AA) varied among three protein supplements. The result show that the effective degradability of DM for SFSM, CSM, and DDGS was 60.8%, 56.4%, and 41.0% and their ruminal fermentable organic matter was 60.0%, 55.9%, and 39.9%, respectively. The ruminal degradable protein (RDP) content in CP for SFSM, CSM, and DDGS was 68.3%, 39.0%, and 32.9%, respectively, at the ruminal solid passage rate of 1.84%/h. The SFSM is a good source of RDP for rumen micro-organisms; however, the SID of RUP of SFSM was lower. The DDGS and CSM are good sources of RUP for lambs to digest in the small intestine to complement ruminal microbial AA of growing lambs. Individual RUP-AA from each protein source was selectively removed by the rumen micro-organisms, especially for Trp, Arg, His, and Lys (p<0.01). The SID of individual RUP-AA was different within specific RUP origin (p<0.01). Limiting amino acid was Leu for RUP of CSM and Lys for both RUP of SFSM and DDGS, respectively. Therefore, different protein supplements with specific limitations should be selected and combined carefully in growing lambs ration to optimize AA balance. PMID:25656208
Paz, H A; Klopfenstein, T J; Hostetler, D; Fernando, S C; Castillo-Lopez, E; Kononoff, P J
2014-10-01
A study was conducted to determine the rumen degradation and intestinal digestibility of crude protein (CP) and AA, and AA composition of the rumen-undegradable protein (RUP) from 3 sources of blood meal (BM1, BM2, and BM3), canola meal (CM), low-fat distillers dried grains with solubles (LFDG), soybean meal (SBM), and expeller soybean meal (ESBM). Two Holstein cows fitted with ruminal and proximal duodenal cannulas were used for in situ incubation of 16h and for the mobile bag technique. To correct for bacterial contamination of the RUP, 2 methods were used: purines and DNA as bacterial markers. Ruminal degradations of CP were 85.3, 29.8, 40.7, 75.7, 76.9, 68.8, and 37.0 ± 3.93% for BM1, BM2, BM3, CM, LFDG, SBM, and ESBM, respectively. Ruminal degradation of both total essential AA and nonessential AA followed a similar pattern to that of CP across feedstuffs. Based on the ratio of AA concentration in the RUP to AA concentration in the original feedstuff, ruminal incubation decreased (ratio <1) the concentrations of His, Lys, and Trp, and increased (ratio >1) the concentrations of Ile and Met across feedstuffs. Compared with purines, the use of DNA as bacterial marker resulted in a higher estimate of bacterial CP contamination for CM and lower estimates for LFDG and ESBM. Intestinal digestibility of RUP could not be estimated for BM1, BM3, and SBM due to insufficient recovery of residue. For the remaining feedstuffs, intestinal digestibility of RUP was highest for ESBM, followed by BM2 and LFDG, and lowest for CM: 98.8, 87.9, 89.7, and 72.4 ± 1.40%, respectively. Intestinal absorbable dietary protein was higher for BM2 compared with CM and LFDG, at 61.7, 17.9, and 20.7 ± 2.73% CP, respectively. As prices fluctuate, intestinal absorbable protein or AA may be used as a tool to aid in the selection among feedstuffs with different protein quality. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Ruminal and intestinal degradability of distillers grains plus solubles varies by source.
Kleinschmit, D H; Anderson, J L; Schingoethe, D J; Kalscheur, K F; Hippen, A R
2007-06-01
Currently in the dairy industry, there is a concern about the variability in the nutrient content among sources of distillers grains plus solubles (DG), but little research has evaluated the variability in metabolizable AA among sources. The ruminal degradability of crude protein (CP) in soybean meal (SBM), dried DG from 5 sources (DG1, DG2, DG3, DG4, and DG5), and 1 source of wet DG (WDG) were determined using 2 lactating ruminally cannulated Holstein cows. Feeds were incubated in the rumen for 3, 6, 12, 18, 24, and 36 h. Intestinal CP digestibility via pepsin and pancreatin and AA profiles were measured on residue from 12-h ruminal incubation of feeds. Ruminal undegradable protein (RUP) was less for SBM (46.4%) than for DG. The WDG (53.6%) had less RUP than dried DG. The RUP concentrations of DG3 (59.1%) and DG5 (60.3%) were lower than DG1 (71.7%) and DG4 (67.5%), with DG1 having more than DG2 (63.7%) and DG4. Intestinal digestibility of RUP was greater for SBM (86.7%) than DG. The DG2 (76.8%) and DG3 (74.2%) had greater intestinal digestibility compared with DG1 (59.2%), DG4 (63.0%), and DG5 (68.1%). The intestinal digestibility in WDG (65.8%) was similar to all other DG except for DG1, which was lower. Total digestibility of CP was greater in SBM (93.9%) compared with DG. Among the DG sources, the CP in DG2 (85.3%) and DG3 (84.9%) was more digestible compared with DG1 (70.7%), DG4 (74.9%), and DG5 (80.8%) but not WDG (81.9%). Based on the milk protein score (MPS), which is an estimate of the proportion of milk protein that a protein source can sustain until the first limiting AA is depleted, Met was the first limiting AA in SBM and Lys in DG. The concentrations of essential AA in the RUP were not different among DG sources, but the greater MPS in WDG (0.306) compared with the dried DG (0.240) sources indicated that WDG may have been the more ideal RUP source; but, the MPS of the metabolizable protein indicated that the protein quality of WDG was similar to that in DG2, DG3, and DG5. In conclusion, protein degradability and digestibility differed greatly among DG sources, but these differences were actually not as prominent in the concentrations of metabolizable AA and MPS among these sources.
Pan, L; Zhao, P F; Yang, Z Y; Long, S F; Wang, H L; Tian, Q Y; Xu, Y T; Xu, X; Zhang, Z H; Piao, X S
2016-12-01
Two experiments were conducted to evaluate effects of coated compound proteases (CC protease) on apparent total tract digestibility (ATTD) of nitrogen (N) and energy, and apparent ileal digestibility (AID) of amino acids (AA) and nutrients in diets for pigs. In Exp. 1, 12 crossbred barrows (initial body weight: 20.14±1.71 kg) were housed in individual metabolism crates and allotted into 2 treatments with 6 piglets per treatment according to weight in a randomized complete block design. The 2 diets were corn-soybean meal basal diets with (0.2 g/kg) or without CC protease supplementation. The CC protease supplementation increased (p<0.05) the digestible and metabolizable N and energy values and the digestibility and retention rate of N in the diet. The ATTD of energy and nutrients had been improved (p<0.05) in the diet supplemented with CC protease. In Exp. 2, 12 crossbred barrows (initial body weight: 20.79±1.94 kg), fitted with T-cannulas at the distal ileum, were blocked by body weight into 2 groups with 6 pigs each. The diets were the same as those in Exp. 1. The CC protease increased (p<0.05) the AID of crude protein and some essential AA including arginine, isoleucine and leucine. The AID and ATTD of energy and nutrients had been improved (p<0.05) by supplemental CC protease, but the hindgut digestibility of nutrients was unaffected. Overall, the CC protease improved the ATTD of N and energy and AID of some indispensible AA and nutrients in the corn-soybean meal diet for pigs. Therefore, the CC protease supplement could improve the utilization of protein in the corn-soybean meal diet and thus contribute to lower N excretion to the environment.
Mishra, Arti; Bhalla, Sumir Rai; Rawat, Sameera; Bansal, Vivek; Sehgal, Rakesh; Kumar, Sunil
2007-10-01
In the present study, Aluminium quantification in immunobiologicals has been described using atomic absorption spectroscopy (AAS) technique. The assay was found to be linear in 25-125 microg/ml Aluminium range. The procedure was found to be accurate for different vaccines with recoveries of external additions ranging between 93.26 and 103.41%. The mean Limit of Variation (L.V.) for both intra- and inter-assay precision was calculated to be 1.62 and 2.22%, respectively. Further the procedure was found to be robust in relation to digestion temperature, alteration in acid (HNO(3) and H(2)SO(4)) ratio used for sample digestion and storage of digested vaccine samples up to a period of 15 days. After validation, AAS method was compared for its equivalency with routinely used complexometric titration method. On simultaneously applying on seven different groups of both bacterial and viral vaccines, viz., DPT, DT, TT, Hepatitis-A and B, Antirabies vaccine (cell culture) and tetravalent DPT-Hib, a high degree of positive correlation (+0.85-0.998) among AAS and titration methods was observed. Further AAS method was found to have an edge over complexometric titration method that a group of vaccines, viz., ARV (cell culture, adsorbed) and Hepatitis-A, in which Aluminium estimation is not feasible by pharmacopoeial approved complexometric titration method (possibly due to some interference in the sample matrix), this newly described and validated AAS assay procedure delivered accurate and reproducible results.
Standardized Ileal Amino Acid Digestibility of Commonly Used Feed Ingredients in Growing Broilers
Ullah, Zafar; Ahmed, Gulraiz; Nisa, Mehr un; Sarwar, Muhammad
2016-01-01
This experiment was conducted to determine standardized ileal amino acid digestibility (SIAAD) of commonly used feed ingredients in poultry diets in Pakistan. These feed ingredients included corn, rice broken (RB), rice polishings (RP), wheat bran (WB), sunflower meal (SFM), cottonseed meal (CSM), guar meal (GM), soybean meal (SBM) from India and Argentine and fish meal (FM). The SIAAD of each ingredient was determined in triplicate using 21-days-old broilers. Day-old male broiler chicks (Hubbard× Hubbard) were reared on corn-SBM based diet from 1 to 13 days and thereafter birds were fed experimental diets from day 14 to 21. Each diet was fed to 36 birds kept in six replicate cages, each cage had six birds. In cereals, the SIAAD of corn’s amino acid (AA) (90.1%) was similar (p>0.05) to RB (89.0%). Isoleucine (97.8%) and lysine (96.9%) were highly digestible AA in corn and RB, respectively. Among cereal-by products, WB’s SIAAD (76.9%) was same (p>0.05) as RP (71.9%). Arginine from WB (82.5%) and RP (83.2%) was highly digestible. However, threonine in WB (72.7%) and leucine in RP (69.6%) were the lowest digestible AAs. In plant protein meals, AAs from Argentine-SBM (85.1%) and Indian-SBM (83.4%) had higher (p<0.5) SIAAD than other protein meals. However, SIAAD of SFM (77.1%) and CSM (71.7%) was intermediate while GM (60.3%) exhibited the lowest (p<0.05) SIAAD among all ingredients. Arginine from GM (76.9%), CSM (85.8%), SBM-India (89.5%) and SBM-Argentine (91.5%) was highly digestible from indispensable AAs. In SFM, methionine (91.4%) SIAAD was the greatest. The average SIAAD of FM was 77.6%. Alanine from FM had the highest (84.0%) but cysteine (62.8%) had the lowest SIAAD. In conclusion, cereals i.e. corn and RB had higher (p<0.05) SIAAD of the cereals by-products. The SIAAD of RP and WB was same (p>0.05). The SBM from plant protein meals had higher (p<0.05) SIAAD than other studied feed ingredients. However, the GM had the lowest (p<0.05) SIAAD among protein meals. PMID:26954227
Standardized Ileal Amino Acid Digestibility of Commonly Used Feed Ingredients in Growing Broilers.
Ullah, Zafar; Ahmed, Gulraiz; Nisa, Mehr Un; Sarwar, Muhammad
2016-09-01
This experiment was conducted to determine standardized ileal amino acid digestibility (SIAAD) of commonly used feed ingredients in poultry diets in Pakistan. These feed ingredients included corn, rice broken (RB), rice polishings (RP), wheat bran (WB), sunflower meal (SFM), cottonseed meal (CSM), guar meal (GM), soybean meal (SBM) from India and Argentine and fish meal (FM). The SIAAD of each ingredient was determined in triplicate using 21-days-old broilers. Day-old male broiler chicks (Hubbard× Hubbard) were reared on corn-SBM based diet from 1 to 13 days and thereafter birds were fed experimental diets from day 14 to 21. Each diet was fed to 36 birds kept in six replicate cages, each cage had six birds. In cereals, the SIAAD of corn's amino acid (AA) (90.1%) was similar (p>0.05) to RB (89.0%). Isoleucine (97.8%) and lysine (96.9%) were highly digestible AA in corn and RB, respectively. Among cereal-by products, WB's SIAAD (76.9%) was same (p>0.05) as RP (71.9%). Arginine from WB (82.5%) and RP (83.2%) was highly digestible. However, threonine in WB (72.7%) and leucine in RP (69.6%) were the lowest digestible AAs. In plant protein meals, AAs from Argentine-SBM (85.1%) and Indian-SBM (83.4%) had higher (p<0.5) SIAAD than other protein meals. However, SIAAD of SFM (77.1%) and CSM (71.7%) was intermediate while GM (60.3%) exhibited the lowest (p<0.05) SIAAD among all ingredients. Arginine from GM (76.9%), CSM (85.8%), SBM-India (89.5%) and SBM-Argentine (91.5%) was highly digestible from indispensable AAs. In SFM, methionine (91.4%) SIAAD was the greatest. The average SIAAD of FM was 77.6%. Alanine from FM had the highest (84.0%) but cysteine (62.8%) had the lowest SIAAD. In conclusion, cereals i.e. corn and RB had higher (p<0.05) SIAAD of the cereals by-products. The SIAAD of RP and WB was same (p>0.05). The SBM from plant protein meals had higher (p<0.05) SIAAD than other studied feed ingredients. However, the GM had the lowest (p<0.05) SIAAD among protein meals.
Kaewtapee, Chanwit; Burbach, Katharina; Tomforde, Georgina; Hartinger, Thomas; Camarinha-Silva, Amélia; Heinritz, Sonja; Seifert, Jana; Wiltafsky, Markus; Mosenthin, Rainer; Rosenfelder-Kuon, Pia
2017-01-01
Bacillus spp. seem to be an alternative to antimicrobial growth promoters for improving animals' health and performance. However, there is little information on the effect of Bacillus spp. in combination with different dietary crude protein (CP) levels on the ileal digestibility and microbiota composition. Therefore, the objective of this study was to determine the effect of Bacillus spp. supplementation to low- (LP) and high-protein diets (HP) on ileal CP and amino acid (AA) digestibility and intestinal microbiota composition. Eight ileally cannulated pigs with an initial body weight of 28.5 kg were randomly allocated to a row-column design with 8 pigs and 3 periods of 16 d each. The assay diets were based on wheat-barley-soybean meal with two protein levels: LP (14% CP, as-fed) and HP diet (18% CP, as-fed). The LP and HP diets were supplemented with or without Bacillus spp. at a level of 0.04% (as-fed). The apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of CP and AA was determined. Bacterial community composition from ileal digesta was analyzed by Illumina amplicon sequencing and quantitative real-time PCR. Data were analyzed as a 2 × 2 factorial design using the GLIMMIX procedures of SAS. The supplementation with Bacillus spp. did not affect both AID and SID of CP and AA in growing pigs. Moreover, there was no difference in AID of CP and AA between HP and LP diets, but SID of cystine, glutamic acid, glycine, and proline was lower ( P < 0.05) in pigs fed the HP diets. The HP diets increased abundance of Bifidobacterium spp. and Lactobacillus spp., ( P < 0.05) and by amplicon sequencing the latter was identified as predominant genus in microbiota from HP with Bacillus spp., whereas dietary supplementation of Bacillus spp. increased ( P < 0.05) abundance of Roseburia spp.. The HP diet increased abundance of Lactobacillus spp. and Bifidobacterium spp.. The supplementation of Bacillus spp. resulted in a higher abundance of healthy gut associated bacteria without affecting ileal CP and AA digestibility, whereas LP diet may reduce the flow of undigested protein to the large intestine of pigs.
Amerah, A M; Plumstead, P W; Barnard, L P; Kumar, A
2014-04-01
This study investigated the effect of dietary Ca to available P (AvP) ratio and phytase supplementation on bone ash, ileal phytate degradation, and nutrient digestibility in broilers fed corn-based diets. The experimental design was a 4 × 2 factorial arrangement of treatments evaluating 4 Ca:AvP ratios (1.43, 2.14, 2.86, and 3.57) and 2 levels of phytase (0 and 1,000 phytase units/kg of feed). The 4 Ca:AvP ratios were achieved by formulating all diets to a constant AvP level of 0.28% and varying Ca levels (0.4, 0.6, 0.8, and 1.0%). Each treatment was fed to 6 cages of 8 male Ross 308 broilers from 5 to 21 d. At 21 d, digesta from the terminal ileum was collected and analyzed for energy, phytate, P, Ca, and amino acids (AA) to determine digestibility. Digesta pH was measured in each segment (crop, gizzard, duodenum, and ileum) of the digestive tract. Data were analyzed by 2-way analysis of covariance. There was a significant interaction between dietary Ca:AvP ratio and phytase supplementation for weight gain (WG), feed intake (FI), and feed conversion ratio (FCR). In diets with no phytase, Ca:AvP ratio had a greater effect on WG, FI, and FCR compared with those fed diets without phytase. The orthogonal polynomial contrasts showed that the increase in dietary Ca:AvP ratio significantly decreased WG and FI in a quadratic manner, whereas FCR increased (P < 0.05) linearly with higher dietary Ca:AvP ratio. Increasing dietary Ca:AvP ratio led to a significant quadratic decrease in phytate degradation and significant linear decreases in P digestibility and bone ash. Phytase addition increased (P < 0.05) phytate degradation and improved (P < 0.05) energy, AA, and P digestibility at all levels of Ca:AvP with no interaction (P > 0.05) between the main factors. Digestibility of AA was positively correlated (P < 0.05) with the degree of phytate degradation. Increasing dietary Ca:AvP ratio significantly increased gizzard pH in a linear manner. In conclusion, phytase (1,000 phytase units/kg of feed) improved phytate, and P and AA digestibility at all Ca:AvP ratios evaluated in this study.
Gallardo, Connie; Dadalt, Julio Cezar; Trindade Neto, Messias Alves
2018-06-04
The study was conducted to determine the effects of multicarbohydrase (MC) preparation (700 U α-galactosidase, 2,200 U galactomannanase, 3,000 U xylanase, and 22,000 U β-glucanase per kg of diet) and phytase (Phy, 500 FTU per kg of diet) supplementation on the nutritive value of wheat bran (WB) in broiler chicks. Trial 1 determined retention of nutrients and apparent metabolizable energy corrected by nitrogen (AMEn). One reference diet (RD) protein-free (85% corn based) was fortified to determine the WB nutrient retention coefficient. Trial 2 determined standardized ileal digestibility (SID) of AA, when pancreas and liver were weighed. An additional group of bird was fed with an RD with 5% casein-corn starch diet, fortified with vitamins and minerals to quantify the endogenous fraction and determine SID of AA. For each trial, the test diets were made by mixing RD and WB 7:3 (wt/wt) and fed without or with MC or Phy or combination. Male broilers (Cobb 500), 245 d old, were allocated to five treatments to give seven replicates (seven birds/cage). The birds were fed a commercial diet from day 0 to10 followed by Trial 1 diets from day 11 to 18 and finally Trial 2 diets from day 19 to 21. Excreta samples were collected on days 15-18 and all birds were slaughtered on day 21 for ileal digesta. There was an interaction (P < 0.05) between MC and Phy on retention of DM, N, P, and AMEn. An interaction (P < 0.05) was also observed on SID of Arg, His, Leu, Lys, Phe, Thr, Val, Asp, Cys, Glu, and Ser. Responses of MC plus Phy supplementation were higher (P < 0.05) on overall SID of AA by 6.05% (75.18 to 94.26%), compared with responses for MC (2.35%; 72.04 to 88.97) or Phy (3.46%; 73.27 to 92.13). Liver and pancreas weights were affected (P < 0.05) by the single MC supplementation. The MC and Phy combination may be an effective strategy to improve AA utilization of WB in broiler chickens.
Hilbrands, A M; Johnston, L J; McClelland, K M; Cox, R B; Baidoo, S K; Souza, L W O; Shurson, G C
2013-01-01
Two experiments were conducted to evaluate the effects of feeding continuously a diet containing 40% dried distillers grains with solubles (DDGS) or intermittently diets containing 20 or 40% DDGS on growth performance and carcass quality of pigs. Responses of the pigs to abrupt introduction and removal of dietary DDGS with differing concentrations of standardized ileal digestible (SID) AA were also evaluated. In Exp. 1, crossbred pigs (n=216; initial BW=51.3±3.1 kg) were assigned randomly to 1 of 4 treatments, which included a corn-soybean meal control (CON), a 20% DDGS diet (D20), a switch between D20 and CON (D20-CON), and a switch between a 40% DDGS diet and CON (D40-CON) with 6 pens per treatment. Pigs abruptly introduced and removed from a 20% DDGS diet (D20-CON) exhibited no differences in growth performance or carcass quality compared with CON pigs. However, intermittently feeding a 40% DDGS diet (D40-CON) resulted in lighter HCW (P<0.05) compared with all other treatments. In Exp. 2, crossbred pigs (n=324; initial BW=33.2±3.0 kg) were assigned randomly to 1 of 6 treatments, including a corn-soybean meal control (CON), a 40% low SID AA DDGS diet (LD), a 40% high SID AA DDGS diet (HD), LD and CON diets alternated (LD-CON), HD and CON diets alternated (HD-CON), or HD and LD diets alternated (HD-LD) with 6 pens per treatment. Final BW and ADG were less (P<0.05) for LD and HD-LD pigs compared with CON pigs, but HD pigs tended to have reduced (P<0.10) final BW and ADG. Loin muscle area was smaller for LD and HD-LD pigs compared with CON pigs (P<0.05). Percentage carcass lean was not affected by dietary treatment. Backfat of DDGS-fed pigs was more unsaturated than CON pigs, but AA digestibility of DDGS did not affect this response. Digestibility of AA in DDGS can influence pig performance and carcass quality when fed at high concentrations (40% or more). The use of a high SID AA DDGS source may diminish some of the negative responses observed for growth performance and carcass characteristics when feeding high concentrations of DDGS if accurate values of SID AA are used in diet formulation. Periodic inclusion and removal of 40% DDGS from diets did not adversely affect growth performance or carcass quality regardless of the SID AA digestibility of the DDGS used. These results indicate that it is possible to abruptly incorporate and remove DDGS from grower-finisher swine diets without meaningful detrimental effects on growth performance or carcass quality.
Formulation with ascorbic acid and sucrose modulates catechin bioavailability from green tea
Peters, Catrina M.; Green, Rodney J.; Janle, Elsa M.; Ferruzzi, Mario G.
2009-01-01
In order to investigate the impact of common food ingredients on catechin absorption, green tea (GT) extract (50 mg) was formulated plain, with sucrose (GT+S), with ascorbic acid (GT+AA) and with sucrose and ascorbic acid (GT+S+AA). Bioavailability and bioaccessibility were assessed in Sprague Dawley rats and an in vitro digestion/Caco-2 cell model respectively. Absorption of epigallocatechin (EGC) and epigallocatechin gallate (EGCG) was significantly (P<0.05) enhanced in GT+S+AA formulations (AUC0-6h= 3237.0 and 181.8 pmol*h/L plasma respectively) relative to GT control (AUC0-6h = 1304.1 and 61.0 pmol*h/L plasma respectively). In vitro digestive recovery was higher for EGC and epicatechin (EC) (∼51-53%) relative to EGCG and epicatechin gallate (ECG) (< 20%) and was modestly enhanced in GT+S and GT+S+AA formulations. Accumulation of EGC, EGCG and ECG by Caco-2 cells was significantly (P<0.05) higher from GT+S+AA compared to other formulations while retention of catechins was enhanced in presence of ascorbic acid. These data suggest that formulation with sucrose and ascorbic acid may improve catechin bioavailability by enhancing bioaccessibility and intestinal uptake from tea. PMID:20161530
Perna, Annamaria; Simonetti, Amalia; Gambacorta, Emilio
2016-09-01
The aim of this work was to investigate the effect of casein haplotype (αS1, β, and κ) on antioxidative and angiotensin-converting enzyme (ACE) inhibitory capacities of milk casein from Italian Holstein cows before and following in vitro digestion with gastrointestinal enzymes. The antioxidant capacity was measured using 2,2'-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid and ferric-reducing antioxidant power assays, whereas ACE inhibition was determined by ACE-inhibitory assay. The ACE-inhibitory and antioxidant capacities of milk casein increased during in vitro gastrointestinal digestion. Casein haplotype significantly influenced the antioxidative and ACE-inhibitory capacities of digested casein. In particular, BB-A(2)A(1)-AA casein and BB-A(1)A(1)-AA casein showed the highest ACE-inhibitory capacity, BB-A(2)A(2)-AA casein showed the highest antioxidant capacity, whereas BB-A(2)A(2)-BB casein showed the lowest biological capacity. To date, few studies have been done on the effect of casein haplotype on biological capacity of milk casein, thus the present study sets the basis for a new knowledge that could lead to the production of milk with better nutraceutical properties. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Does Hofstetter's equation predict the real amplitude of accommodation in children?
Hashemi, Hassan; Nabovati, Payam; Khabazkhoob, Mehdi; Yekta, Abbasali; Emamian, Mohammad Hassan; Fotouhi, Akbar
2018-01-01
The aim was to determine the distribution and associated factors of accommodative amplitude (AA) in six- to 12-year-old children and compare the results with those calculated using Hofstetter's formula. In a cross-sectional study in 2015, random sampling was done from urban and rural populations of Shahroud, northern Iran. Participating schoolchildren were examined for manifest, cycloplegic and subjective refraction, as well as uncorrected vision and visual acuity. The AA was measured with Donders' push-up method using a ruler. The near point of convergence (NPC) was also measured. Of the 6,624 selected children, 5,620 participated in the study and after applying the exclusion criteria, the final analyses were done on data from 5,444 schoolchildren. The mean age of the final sample was 9.24 ± 1.71 years (from six to 12 years) and 53.6 per cent (n = 2,919) were boys. Mean measured AA was 14.44 D (95 per cent confidence interval [CI]: 14.33-14.55). In all age groups, the mean measured AA was less than the predicted mean value calculated with the Hofstetter's equation. Mean measured AA was 14.44 D (95 per cent CI: 14.28-14.59) and 14.45 D (95 per cent CI: 14.29-14.6) in boys and girls, respectively (p = 0.926). AA significantly declined with age (coefficient: -0.18, 95 per cent CI: -0.23 to -0.12, p < 0.001). Mean AA in emmetropic, myopic and hyperopic children was 14.31 D, 17.30 D and 14.87 D, respectively. Older age (coefficient = -0.18), living in rural areas (coefficient = -0.48) and NPC (coefficient = 0.47) inversely related with AA and higher AA was associated with a shift of the spherical equivalent refraction toward myopia (coefficient = -0.41). The differences among groups with different types of refractive error and high AA in children with myopia are important findings of this study. The results of the present study suggest that Hofstetter's formula provides inaccurate AA estimates in children and thus, the interpretation of this index requires further population-based studies in different racial and ethnic groups. © 2017 Optometry Australia.
Foltz, Martin; van Buren, Leo; Klaffke, Werner; Duchateau, Guus S M J E
2009-09-01
Selected di- and tripeptides exhibit angiotensin-I converting enzyme (ACE) inhibitory activity in vitro. However, the efficacy in vivo is most likely limited for most peptides due to low bioavailability. The purpose of this study was to identify descriptors of intestinal stability, permeability, and ACE inhibitory activity of dipeptides. A total of 228 dipeptides were synthesized; intestinal stability was obtained by in vitro digestion, intestinal permeability using Caco-2 cells and ACE inhibitory activity by an in vitro assay. Databases were constructed to study the relationship between structure and activity, permeability, and stability. Quantitative structure-activity relationship (QSAR) modeling was performed based on computed models using partial least squares regression based on 400 molecular descriptors. QSAR modeling of dipeptide stability revealed high correlation coefficients (R > 0.65) for models based on Z and X scales. However, amino acid (AA) clustering showed the best results in describing stability of dipeptides. The N-terminal AA residues Asp, Gly, and Pro as well as the C-terminal residues Pro, Ser, Thr, and Asp stabilize dipeptides toward luminal enzymatic peptide hydrolysis. QSAR modeling did not reveal significant correlation models for intestinal permeability. 2D-fingerprint models were identified describing ACE inhibitory activity of dipeptides. The intestinal stability of 12 peptides was predicted. Peptides were synthesized and stability was confirmed in simulated digestion experiments. Based on the results, specific dipeptides can be designed to meet both stability and activity criteria. However, postabsorptive ACE inhibitory activities of dipeptides in vivo are most likely limited due to the very low intestinal permeability of dipeptides.
Preparation And Analysis Of Specimens Of Ablative Materials
NASA Technical Reports Server (NTRS)
Solomon, William C.
1994-01-01
Procedure for chemical analysis of specimens of silicone-based ablative thermal-insulation materials SLA-561 and MA25 involves acid digestion of specimens to prepare them for analysis by inductively-coupled-plasma/atomic-emission spectroscopy (ICP/AES). In comparison with atomic-absorption spectroscopy (AAS), ICP/AES is faster and more accurate than AAS. Results of analyses stored in data base, used to trace variations in concentrations of chemical elements in materials during long-term storage, and used in timely manner in investigations of failures. Acid-digestion portion of procedure applied to other thermal-insulation materials containing room-temperature-vulcanizing silicones and enables instrumental analysis of these materials.
Büsing, K; Berk, A; Müller, S; Kieckhäven, S; Krüger, K; Zeyner, A
2017-10-01
In practice, the content of standardized ileal digestible AA in complex feeds for pigs is calculated on the basis of tabulated values for individual feedstuffs. It comes into question, however, whether this truly reflects an accurate content based upon the estimate made for the individual feedstuffs. The objective of this study was to compare standardized ileal digestibility (SID) of crude protein (CP) and selected AA in complex feeds for grower and finisher pigs either calculated or experimentally determined. Six diets with increasing AA levels were prepared for grower (BW from 30 to 70 kg) and finisher (BW from 70 to 120 kg) feed. Crystalline L-lys, DL-met and L-thr were added to both diets, L-trp and L-val only to the grower feed. SID of both CP and AA was calculated from feed tables and experimentally determined in six adult minipigs (MINILEWE) with ileorectal anastomosis. With increasing AA levels, experimentally determined SID of supplemented AA increased (p < 0.05), but SID of CP (p ≥ 0.05) was not affected. In both grower and finisher feed, calculated and experimentally determined SID of CP, Met, Cys, Trp, Ile and Tyr differed by more than 2% units, but those of Lys and His only in the finisher feed. Yet this effect was not directly consistent. The margin of error following estimation of SID of AA via tabulated values for individual feedstuffs, however, seems to be acceptable for practical use. Journal of Animal Physiology and Animal Nutrition © 2017 Blackwell Verlag GmbH.
[Correlation analysis of G870A CCND1 gene polymorphism with digestive system tumors].
Yang, Shu-Min; Shi, Ya-Lin
2016-11-20
To study the correlation of G870A CCND1 gene polymorphism and digestive system tumors. From August 2010 to August 2014, 164 digestive system cancer patients (including 82 patients with gastric cancer and 82 with colorectal cancer) and 82 healthy subjects (control group) were examined with PCR-restriction fragment length polymorphism (PCR-RFLP). The distribution of CCND1 gene G870A frequency in the 3 groups and its association with tumor staging and grading were analyzed. The frequencies of the GG, GA and AA genotypes in G870A CCND1 gene loci in patients with gastric cancer and colorectal cancer differed significantly from those in the control group (P<0.05). G870A CCND1 gene polymorphism was closely associated with an increased risk of digestive system tumors (P<0.05). The GA and AA genotypes were associated with a significantly higher risk of digestive system cancer risk than the GG genotype (P<0.05), and their frequencies were significantly higher in patients with tumors of higher pathological grade and in those in advanced tumor stages (P<0.05). G870A CCND1 gene polymorphism is associated with the risk of digestive system tumors. The allele A is associated with an increased risk of digestive system tumors and correlated with the tumor differentiation and staging of the tumor.
Oppert, Brenda; Martynov, Alexander G; Elpidina, Elena N
2012-09-01
The yellow mealworm, Tenebrio molitor, is a pest of stored grain products and is sensitive to the Bacillus thuringiensis (Bt) Cry3Aa toxin. As digestive peptidases are a determining factor in Cry toxicity and resistance, we evaluated the expression of peptidase transcripts in the midgut of T. molitor larvae fed either a control or Cry3Aa protoxin diet for 24 h (RNA-Seq), or in larvae exposed to the protoxin for 6, 12, or 24 h (microarrays). Cysteine peptidase transcripts (9) were similar to cathepsins B, L, and K, and their expression did not vary more than 2.5-fold in control and Cry3Aa-treated larvae. Serine peptidase transcripts (48) included trypsin, chymotrypsin and chymotrypsin-like, elastase 1-like, and unclassified serine peptidases, as well as homologs lacking functional amino acids. Highly expressed trypsin and chymotrypsin transcripts were severely repressed, and most serine peptidase transcripts were expressed 2- to 15-fold lower in Cry3Aa-treated larvae. Many serine peptidase and homolog transcripts were found only in control larvae. However, expression of a few serine peptidase transcripts was increased or found only in Cry3Aa-treated larvae. Therefore, Bt intoxication significantly impacted the expression of serine peptidases, potentially important in protoxin processing, while the insect maintained the production of critical digestive cysteine peptidases. Published by Elsevier Inc.
Zhang, Fengrui; Adeola, Olayiwola
2017-12-01
Sound feed formulation is dependent upon precise evaluation of energy and nutrients values in feed ingredients. Hence the methodology to determine the digestibility of energy and nutrients in feedstuffs should be chosen carefully before conducting experiments. The direct and difference procedures are widely used to determine the digestibility of energy and nutrients in feedstuffs. The direct procedure is normally considered when the test feedstuff can be formulated as the sole source of the component of interest in the test diet. However, in some cases where test ingredients can only be formulated to replace a portion of the basal diet to provide the component of interest, the difference procedure can be applied to get equally robust values. Based on components of interest, ileal digesta or feces can be collected, and different sample collection processes can be used. For example, for amino acids (AA), to avoid the interference of fermentation in the hind gut, ileal digesta samples are collected to determine the ileal digestibility and simple T-cannula and index method are commonly used techniques for AA digestibility analysis. For energy, phosphorus, and calcium, normally fecal samples will be collected to determine the total tract digestibility, and therefore the total collection method is recommended to obtain more accurate estimates. Concerns with the use of apparent digestibility values include different estimated values from different inclusion level and non-additivity in mixtures of feed ingredients. These concerns can be overcome by using standardized digestibility, or true digestibility, by correcting endogenous losses of components from apparent digestibility values. In this review, methodologies used to determine energy and nutrients digestibility in pigs are discussed. It is suggested that the methodology should be carefully selected based on the component of interest, feed ingredients, and available experimental facilities.
NASA Astrophysics Data System (ADS)
Song, Zhidong; Wang, Jiying; Qiao, Hongjin; Li, Peiyu; Zhang, Limin; Xia, Bin
2016-09-01
Ontogenetic changes in digestive enzyme activities and the amino acid (AA) profile of starry flounder, Platichthys stellatus, were investigated and limiting amino acids were estimated compared with the essential AA profile between larvae and live food to clarify starry flounder larval nutritional requirements. Larvae were collected at the egg stage and 0, 2, 4, 7, 12, 17, 24 days after hatching (DAH) for analysis. Larvae grew from 1.91 mm at hatching to 12.13 mm at 24 DAH. Trypsin and chymotrypsin activities changed slightly by 4 DAH and then increased significantly 4 DAH. Pepsin activity increased sharply beginning 17 DAH. Lipase activity increased significantly 4 DAH and increased progressively with larval growth. Amylase activity was also detected in newly hatched larvae and increased 7 DAH followed by a gradual decrease. High free amino acid (FAA) content was detected in starry flounder eggs (110.72 mg/g dry weight). Total FAA content dropped to 43.29 mg/g in 4-DAH larvae and then decreased gradually to 13.74 mg/g in 24-DAH larvae. Most FAAs (except lysine and methionine) decreased >50% in 4-DAH larvae compared with those in eggs and then decreased to the lowest values in 24-DAH larvae. Changes in the protein amino acid (PAA) profile were much milder than those observed for FAAs. Most PAAs increased gradually during larval development, except lysine and phenylalanine. The percentages of free threonine, valine, isoleucine, and leucine decreased until the end of the trial, whereas the protein forms of these four AAs followed the opposite trend. A comparison of the essential AA composition of live food (rotifers, Artemia nauplii, and Artemia metanauplii) and larvae suggested that methionine was potentially the first limiting AA. These results may help develop starry flounder larviculture methods by solving the AA imbalance in live food. Moreover, the increased digestive enzyme activities indicate the possibility of introducing artificial compound feed.
Hulshof, T G; van der Poel, A F B; Hendriks, W H; Bikker, P
2016-06-01
An experiment was conducted to determine the effects of processing of soybean meal (SBM) and 00-rapeseed meal (RSM) on N solubilization in chyme, CP digestibility along the small intestine, metabolic load as determined by organ weight, body composition, and growth performance in growing pigs. The SBM and RSM were processed by secondary toasting (at 95°C for 30 min) in the presence of lignosulfonate, resulting in processed SBM (pSBM) and processed RSM (pRSM) as a model for overprocessed protein sources. Fifty-four growing pigs were each fed 1 of the 6 experimental diets. Four of the diets contained SBM, pSBM, RSM, or pRSM as the sole protein source. The remaining 2 experimental diets contained pSBM or pRSM and were supplemented with crystalline AA to the same standardized ileal digestible AA levels as the SBM or RSM diet. Pigs were slaughtered at 40 kg, and organ weights were recorded. The organs plus blood and empty carcass were analyzed for CP content. The small intestine was divided into 3 segments, and chyme samples were taken from the last meter of each segment. Chyme of the SBM, pSBM, RSM, and pRSM diets was centrifuged to separate the soluble and insoluble fractions, and N content was determined in the latter. The amount of insoluble N as a fraction of N in chyme at each small intestinal segment was not affected by processing. Diet type, comprising effects of processing and supplementing crystalline AA, affected ( < 0.05) the G:F and standardized ileal digestibility (SID) of CP. Processing reduced G:F from 0.56 to 0.38 for SBM and 0.49 to 0.40 for RSM, whereas supplementing crystalline AA increased G:F to the level of the SBM and RSM diets. Processing reduced the SID of CP from 87.2% to 69.2% for SBM and 71.0% to 52.2% for RSM. Diet type affected ( < 0.05) the CP content in the empty body, with processing reducing this content from 170 to 144 g/kg empty BW for SBM and 157 to 149 g/kg empty BW for RSM and supplementing crystalline AA restoring this content. Processing reduced ( < 0.05) the weight of several organs, and supplementing crystalline AA restored organ weight. In conclusion, processing increased the amount of N in the chyme, reduced organ weight, body CP content, and G:F. These effects were caused by a reduction in available AA as supplementing crystalline AA restored organ weight, body CP content, and G:F.
Hatz, F; Hardmeier, M; Bousleiman, H; Rüegg, S; Schindler, C; Fuhr, P
2015-02-01
To compare the reliability of a newly developed Matlab® toolbox for the fully automated, pre- and post-processing of resting state EEG (automated analysis, AA) with the reliability of analysis involving visually controlled pre- and post-processing (VA). 34 healthy volunteers (age: median 38.2 (20-49), 82% female) had three consecutive 256-channel resting-state EEG at one year intervals. Results of frequency analysis of AA and VA were compared with Pearson correlation coefficients, and reliability over time was assessed with intraclass correlation coefficients (ICC). Mean correlation coefficient between AA and VA was 0.94±0.07, mean ICC for AA 0.83±0.05 and for VA 0.84±0.07. AA and VA yield very similar results for spectral EEG analysis and are equally reliable. AA is less time-consuming, completely standardized, and independent of raters and their training. Automated processing of EEG facilitates workflow in quantitative EEG analysis. Copyright © 2014 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.
Brestenský, Matej; Nitrayová, Soňa; Patráš, Peter
2017-06-01
The common usage of protein-free diets to estimate unspecific AA losses has been criticised as unphysiological and incorrect. Therefore, in this study different diets were tested for the determination of endogenous losses (EL) of amino acids (AA) and nitrogen (N) assuming a complete absorption in the small intestine. Seven cannulated gilts received a protein-free diet (Diet PF) or diets with 3%, 6% or 10% crude protein (CP) from crystalline AA (Diets CA) or casein (Diets CAS) according to a 7 × 7 Latin square design. After 6 d adaptation to the diet, ileal digesta was collected for 24 h and thereafter analysed for AA, N and the digestibility markers Cr 2 O 3 and acid insoluble ash (AIA). Generally, among all AA, the highest amounts of EL were found for Pro, Glu and Gly, and the smallest for Met. Different levels of CP in Diets CA and CAS had no effect on EL. Significant differences between treatments were observed only for the EL of Glu, Ile, Ser (higher in Diets CA and PF), Pro and Tyr (higher in Diet PF) (p < 0.05). There were no differences in determined EL using Cr 2 O 3 or AIA as digestibility markers.
XPA A23G polymorphism and risk of digestive system cancers: a meta-analysis.
He, Lei; Deng, Tao; Luo, Hesheng
2015-01-01
Several studies have reported an association between the A23G polymorphism (rs 1800975) in the xeroderma pigmentosum group A (XPA) gene and risk of digestive system cancers. However, the results are inconsistent. In this study, we performed a meta-analysis to assess the association between XPA A23G polymorphism and the risk of digestive system cancers. Relevant studies were identified using the PubMed, Web of Science, China National Knowledge Infrastructure, WanFang, and VIP databases up to August 30, 2014. The pooled odds ratio (OR) with a 95% confidence interval (CI) was calculated using the fixed or random effects model. A total of 18 case-control studies from 16 publications with 4,170 patients and 6,929 controls were included. Overall, no significant association was found between XPA A23G polymorphism and the risk of digestive system cancers (dominant model: GA + AA versus GG, OR 0.89, 95% CI 0.74-1.08; recessive model: AA versus GA + GG, OR 0.94, 95% CI 0.74-1.20; GA versus GG, OR 0.89, 95% CI 0.77-1.03; and AA versus GG, OR 0.87, 95% CI 0.64-1.19). When the analysis was stratified by ethnicity, similar results were observed among Asians and Caucasians in all genetic models. In stratified analysis based on tumor type, we also failed to detect any association between XPA A23G polymorphism and the risk of esophageal, gastric, or colorectal cancers. This meta-analysis indicates that the XPA A23G polymorphism is not associated with a risk of digestive system cancers.
USDA-ARS?s Scientific Manuscript database
The yellow mealworm, Tenebrio molitor, is a pest of stored grain products and is sensitive to the coleopteran-specific Cry3Aa toxin from Bacillus thuringiensis (Bt). Larvae digest protein initially with cysteine peptidases in the anterior midgut and further with serine peptidases in middle and poste...
Aldrich, C G; Merchen, N R; Parsons, C M; Hussein, H S; Ingram, S; Clodfelter, J R
1997-11-01
The objectives of these studies were to predict the effects of roasting and extrusion temperatures of whole soybeans (SB) on intestinal protein digestibility in cattle. Intestinal digestibility was assessed with a two-stage in vitro or in situ ruminal incubation/precision-fed cecectomized rooster bioassay. In Exp. 1, whole SB (raw SB or SB roasted to 141, 149, or 157 degrees C exit temperature from a commercial roaster and steeped for 30 min) were incubated in strained ruminal fluid and McDougall's buffer (50:50) at 39 degrees C for 16 h. In Exp. 2, SB (ground raw SB or SB extruded at 116, 138, or 160 degrees C) were placed in polyester bags (20 x 30 cm) and suspended in the ventral rumen of steers for 16 h. Lyophilized residue of the in vitro or in situ incubations and samples of raw SB and most extensively heated SB (roasted SB at 157 degrees C or extruded SB at 160 degrees C) for each respective experiment were crop-intubated to cecectomized roosters. Total excreta were collected for 48 h after intubation and lyophilized, and amino acid (AA) concentrations were determined. In Exp. 1, total AA digestibility was 61.6 and 84.5% for unincubated whole raw SB and 157 degrees C roasted SB, respectively, and 66.2, 88.9, 91.3, and 91.6% for in vitro residues of whole raw SB and SB roasted at 141, 149, and 157 degrees C, respectively. Trypsin inhibitor (TI) activity was 20.09, 1.69, 1.54, and 1.84 mg/g fat-free DM for unincubated whole raw SB and 141, 149, and 157 degrees C roasted SB, respectively, and 30.84, 1.01, .90, and .26 mg/g fat-free DM for in vitro residues of whole raw SB, 141, 149, and 157 degrees C roasted SB, respectively. In Exp. 2, total AA digestibility was 68.5 and 87.7% for unincubated ground raw SB and 160 degrees C extruded SB, respectively, and 81.9, 91.3, 89.7, and 89.4% for in situ residues of ground raw SB and 116, 138, and 160 degrees C extruded SB, respectively. Trypsin inhibitor activity was 17.61, 4.89, 4.08, and 1.56 mg/g fat-free DM for unincubated ground raw SB, 116, 138, and 160 degrees C extruded SB, respectively, and 3.62, .59, .55, and .21 mg/g fat-free DM for incubated ground raw SB, 116, 138, and 160 degrees C extruded SB, respectively. Heat treatment by roasting and extrusion improved AA digestibilities of SB, but there were no differences detected among the roasting or extrusion temperatures. Ruminal fermentation did not eliminate the negative effects of TI activity on intestinal digestibility of AA in whole SB but did reduce TI activity in ground SB.
Shi, C; Gao, S; Gun, S
1997-06-01
The sample is digested with 6% NaOH solution and an amount of 50 microl is used for protein content analysis by the method of Comassie Brilliant Blue G250, the residual is diluted with equal 0.4% Lathanurm-EDTA solution. Its Calcium magensium and potassium content are determined by AAS. With quick-pulsed nebulization technique. When a self-made micro-sampling device is used, 20microl of sample volume is needed and it is only the 1/10 approximately 1/20 of the sample volume required for conventional determination. Sensitivity, precision and rate of recovery agree well with those using regular wet ashing method.
Effects of Aircraft Noise and Sonic Booms on Domestic Animals and Wildlife: A Literature Synthesis
1988-06-01
the digestive response of yearling wethers to the same sound types and intensities used in the two studies above: white noise and music presen’ed...metabolizable energy of the ration and improved the apparent nutrient digestibilities . Sound intensity did not affect apparent digest - ibility coefficients. The...high digestibility coefficients for lambs exposed to intermittent sounds suggests that those types of auditory stimuli influenced the digestive system
Chromic oxide and acid-insoluble ash as markers in digestibility studies with growing pigs and sows.
Brestenský, M; Nitrayová, S; Heger, J; Patráš, P
2017-02-01
The results of three experiments, focused on the determination of endogenous ileal flow (EIF) of amino acids (AA) and nitrogen (N) (Exp. 1), apparent ileal digestibility (AID) of AA and N (Exp. 2), and apparent total tract digestibility (ATTD) of dry matter (DM), organic matter (OM), N, calcium (Ca) and phosphorus (P) (Exps. 2 and 3), were used to compare chromic oxide (Cr 2 O 3 ) and acid-insoluble ash (AIA) as digestibility markers. In Exps. 1 and 2, a total of six gilts fitted with T-cannula in terminal ileum, and in Exp. 3, a total of 24 pregnant sows were used. In Exps. 1 and 2, the pigs were assigned into four dietary treatments according to 4 × 6 crossover design (Exp. 1; diets with 0%, 4%, 8% and 12% of casein; Exp. 2 basal diet with different levels of phytase). In Exp. 3, the sows were assigned to four dietary treatments (basal diet with different levels of phytase) of six sows. In Exps. 1 and 2 ileal digesta and in Exps. 2 and 3 faeces were collected for the determination of EIF, AID and ATTD. Differences in EIF of AA determined by Cr 2 O 3 and AIA ranged (p ˃ 0.05) from -4.62 to 4.54%. The lowest EIF was for methionine and the greatest one for proline, determined by both markers. Apparent ileal digestibility determined by Cr 2 O 3 was slightly greater (p ˃ 0.05) in comparison with AIA. Differences ranged from 1.88% (Arg) to 7.08% (Gly). The greatest AID was for arginine and the lowest one for glycine, determined by both Cr 2 O 3 and AIA. Similarly for ATTD of DM, OM, N, Ca and P, there were no differences in digestibility determined by Cr 2 O 3 and AIA. Both, Cr 2 O 3 and AIA, are suitable and comparable markers for digestibility studies in pigs. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.
NASA Astrophysics Data System (ADS)
Wen, Kaili; Zhou, Aijuan; Zhang, Jiaguang; Liu, Zhihong; Wang, Guoying; Liu, Wenzong; Wang, Aijie; Yue, Xiuping
2017-02-01
Most studies on the production of volatile fatty acids (VFAs) from waste activated sludge (WAS) digestion have focused on operating conditions, pretreatments and characteristic adjustments. Conditioning by extra carbon sources (ECS), normally added in a solid form, has been reported to be an efficient approach. However, this has caused considerable waste of monomeric sugars in the hydrolysate. In this study, the effects of two added forms (pretreated straw (S) and hydrolyzed liquid (L)) of cornstover (CS) on WAS acidification were investigated. To obtain different cellulosic compositions of CS, low-thermal or autoclaved assisted alkaline (TA or AA) pretreatments were conducted. The results showed that AA-L test achieved the highest VFAs value (653 mg COD/g VSS), followed by AA-S (613 mg COD/g VSS). These values were 12% and 28% higher, respectively, than that obtained in the TA-L and TA-S tests. Meanwhile, higher percentages of acetic acid were observed after AA pretreatment (~62% versus ~53% in TA). The added forms of CS played an important role in structuring the innate microbial community in the WAS, as shown by high-throughput sequencing and canonical correspondence analysis. The findings obtained in this work may provide a scientific basis for the potential implementation of co-digesting WAS with ECS simultaneously obtaining energy and high value-added products.
Suganuma, Toshihiko; Fujita, Kiyotaka; Kitahara, Kanefumi
2007-11-01
The highly humid climate of Japan facilitates the growth of various molds. Among these molds, Aspergillus oryzae is the most important and popular in Japan, and has been used as yellow-koji in producing many traditional fermented beverages and foods, such as Japanese sake, and soy sauce. Taka-amylase A (TAA), a major enzyme produced by the mold, is well known worldwide to be a leading enzyme for industrial utilization and academic study, since many extensive studies have been carried out with TAA. In southern Kyushu, the other koji's of citric acid-producing molds have often been used, such as in the production of a traditional distilled liquor of shochu. The koji molds black-koji and white-koji produce two types of alpha-amylase, namely, acid-stable (AA) and common neutral (NA). The latter enzyme is enzymatically and genetically similar to TAA. In this review, we investigate AA from three molds, Aspergillus niger, A. kawachii and A. awamori, and the yeast Cryptococcus sp. regarding the distinguishable properties between AA and NA. (i) The N-terminus amino acid sequences of AA determined by molecular cloning started with the sequence of L-S-A-, whereas those of NA started with A-T-P-. (ii) Most of the full sequences of AA were composed of, besides a core catalytic domain, an extra domain of a hinge region and a carbohydrate binding domain, which could be responsible for raw-starch-digestibility. The AA from A. niger has no exceptionally extra domain, similarly to NA. (iii) Simple methods for distinguishing AA from NA using CNP-alpha-G3 and G5 as substrates were developed by our group. (iv) The number of subsite in AA on the basis of its cleavage pattern of maltooligosaccharides was estimated to be five, which differs from that of TAA, 7-9. AA has many advantages in industrial applications, such as its acid-stability, thermostability, and raw-starch digesting properties.
Nutritional evaluation of Glutenol: a co-product of ethanol production.
Corray, S P; Utterback, P L; Parsons, C M
2018-06-26
The objective of this study was to evaluate the nutritional value of Glutenol, a new coproduct of the ethanol industry. Glutenol was produced by Quality Technology International, Elgin, IL, in a modified wet-milling plant using a hybrid process, NextGenFrac, which fractionates the corn kernel components prior to fermentation without the use of sulfur dioxide. Glutenol was analyzed to contain 52.3% CP, 1.7% Met + Cys, 1.32% Lys, 1.69% Thr, and 2.23% Val on a DM basis. Two precision-fed rooster assays with conventional and cecectomized roosters were conducted to determine TMEn and standardized digestibility of amino acids (AA), respectively. The TMEn of Glutenol was determined to be 3,256 kcal/kg DM. Standardized digestibility values for Lys, Met, Cys, Thr, and Val were 80.1%, 90.4%, 80.1%, 74.1%, 81.1%, and 84.9%, respectively. In addition, a 3-wk broiler chick assay was conducted with increasing levels of dietary Glutenol. Diet 1 was a standard corn/soybean meal diet with 0% Glutenol. Diets 2, 3, and 4 had increasing levels of Glutenol at 4%, 8%, and 12%, respectively. Diets were fed from 3 to 22 d post-hatch and all diets were formulated to be equal in TMEn and digestible AA. Weight gain, feed intake, and gain/feed ratio were measured. No differences in growth performance were observed among dietary treatments. In conclusion, Glutenol can be fed up to at least 12% in the diet of broiler chickens if diets are formulated to be equal in ME and digestible AA.
Cerrate, S; Vignale, S K; Ekmay, R; England, J; Coon, C
2018-04-01
An isotope dose technique was utilized (i) to determine endogenous amino acid (AA) and protein losses and (ii) to propose adjusted values for AA requirements. The endogenous flow rate was calculated from the pool of enrichment in plasma AA, assuming similitude to enrichment of endogenous AA. In experiment 1, chicks were orally administered D4-lysine at 2% of estimated lysine intake from 16 to 24 days to find the isotopic steady state of the atom percent excess (APE) of lysine for plasma and jejunal and ileal digesta. The APE of D4-lysine in plasma, jejunal digesta and ileal digesta reached the isotopic steady state at 5.5, 3.4 and 2.0 days, respectively, by using the broken-line model. It was assumed that the isotopic steady state at 5 days identified for D4-lysine is also representative for the 15N-labeled AA. In experiment 2, chicks were fed diets from 1 to 21 days with increasing levels of fat (6%, 8%, 12%, 13% extract ether), protein (26%, 28.5%, 31% CP) or fiber (14%, 16%, 18% NDF) by adding poultry fat, soybean meal, blended animal protein or barley. Chicks were orally administered 15N-threonine, 15N-cysteine, 15N-methionine, 15N-lysine and 15N-leucine at 2% of estimated daily intake for 5 days from 17 to 21 days of age. Dietary nutrients influenced endogenous losses (EL), where dietary fat stimulated EL of lysine (P=0.06), leucine and protein (P=0.07); dietary protein enhanced EL of leucine and protein; and finally the dietary fiber increased EL of leucine. Dietary nutrients also affected apparent ileal digestibility (AID). Dietary fat increased AID of cysteine but decreased AID of lysine. Dietary protein reduced AID of protein, threonine, lysine and leucine, and similarly dietary fiber decreased AID of protein, threonine, methionine, lysine and leucine. In contrast, dietary fat or protein did not affect real ileal digestibility (RID) of protein and AA except threonine and leucine. The dietary fiber reduced the RID of protein, threonine and leucine. This indicate that variations of some endogenous AA and protein losses due to dietary nutrients almost eliminates the effects of RID, and thus the EL coming from the body should be utilized to adjust the AA requirement instead of changing the true digestible nutrients of ingredients. The present data suggest that 5 days' feeding labeled AA was enough to reach the isotopic steady state and AA requirements should be adjusted when additional dietary protein, fat or fiber is fed.
Montoya, Carlos A; Leterme, Pascal; Victoria, Nestor F; Toro, Orlando; Souffrant, Wolfgang B; Beebe, Stephen; Lallès, Jean-Paul
2008-03-26
A study was conducted to investigate the amino acid (AA) composition and the susceptibility to in vitro proteolysis (pepsin, 120 min and pancreatin, 240 min) of a collection of purified phaseolins ( n = 43) in unheated or heat-treated form. The AA composition of phaseolin varied little across bean varieties. At 360 min of in vitro proteolysis, the degree of hydrolysis varied from 11 to 27% for unheated and from 57 to 96% for heated phaseolins ( P < 0.001). Heat treatment markedly increased the susceptibility of phaseolin to proteolysis ( P < 0.001). The AA scores (AAS) and the protein digestibility corrected for AAS indicated S-containing AA as the limiting AA (39 +/- 3 and 30 +/- 5%, respectively). In conclusion, susceptibility to proteolysis of heat-treated phaseolin rather than its AA composition affects the nutritional value of phaseolin estimated in vitro. Therefore, it should be the criterion of choice in breeding programs aimed at improving the nutritional value of common beans for humans.
USDA-ARS?s Scientific Manuscript database
Dietary canola meal (CM) has been shown to improve N efficiency in dairy cows when compared with soybean meal (SBM). Treating CM may increase amino acid (AA) supply from the rumen undegradable protein fraction and improve absorbable AA in the metabolizable protein. The objective of this study was to...
Baurhoo, N; Baurhoo, B; Zhao, X
2011-12-01
An experiment was conducted to compare a commercial corn-soybean meal diet with a pearl millet diet containing less soybean meal (-27%), alone or in combination with exogenous enzymes, on growth performance, jejunal villus development, ileal CP, and AA digestibility, and cecal microbial populations in broilers. One hundred sixty 1-d-old male Ross 508 broilers (5/cage) were randomly allocated to one of the following dietary treatments: 1) a standard corn-soybean meal control diet (CTL); 2) a pearl millet-soybean meal diet (PM); 3) CTL + exogenous enzymes (CE); and 4) PM + exogenous enzymes (PE) with 8 replicate cages/treatment. The PM and PE diets contained less soybean meal because of greater CP and AA contents of pearl millet. All diets were isonitrogenous and isocaloric. Body weight and feed intake were recorded weekly over 35 d. At d 21 and 35, 8 broilers per treatment were euthanized for sample collection and analyses. Gain-to-feed was greater (P < 0.01) for pearl millet- than corn-based diets. Apparent ileal digestibility (AID) of CP and most AA was similar between corn-based and pearl millet-based diets, and enzyme supplementation improved AID of CP (P < 0.01) and most AA at both d 21 and 35. However, for AID of some AA at d 21, the response to enzyme supplementation was less pronounced in broilers fed pearl millet-based diets than those fed corn-based diets (grain × enzyme, P ≤ 0.05). The villus was longer (P < 0.01) in broilers fed PM and PE than CTL and CE at d 35. Similarly, at d 35, lactobacilli loads were greater (P < 0.01) in broilers fed PM and PE than CTL and CE. It is concluded that, in comparison with corn, broiler diets formulated with pearl millet require less soybean meal and can be used to improve growth performance traits, intestinal lactobacilli populations, and villus development, whereas enzyme supplementation increases AID of CP and AA.
Li, W; Angel, R; Kim, S-W; Jiménez-Moreno, E; Proszkowiec-Weglarz, M; Plumstead, P W
2015-12-01
A total of 1,152 straight-run hatchling Heritage 56M×fast feathering Cobb 500F broiler birds were used to determine Ca, age, and adaptation effects on apparent ileal digestibility of crude protein (AID of CP), amino acids (AID of AA) and phytase efficacy. Twelve treatments with 8 replicates, each were fed from 7 to 9 d (6 birds per replicate), 7 to 21 d (6 birds per replicate) and 19 to 21 d (3 birds per replicate) d of age. Diets were prepared with 3 Ca (0.65, 0.80, and 0.95%) and 2 non-phytate P, (0.20 and 0.40%) concentrations. A 6-phytase was added at 500 or 1,000 FTU/kg to the 0.20% nPP diet at each Ca concentration. The age and adaptation effects were determined by comparing the responses between birds fed from 7 to 9 and 19 to 21 d of age, 19 to 21, and 7 to 21 d of age, respectively. An age effect was observed regardless of Ca, nPP, or phytase concentration, with older birds (19 to 21 d) having greater apparent ileal digestibility (AID) of amino acids (AA) and CP than younger birds (7 to 9 d; P<0.05). Response to adaptation varied depending on Ca, nPP, and phytase concentrations. Constant lower AID of CP and AA was seen in adapted birds (7 to 21 d) compared to unadapted bird (19 to 21 d) when 0.20% nPP diets were fed at 0.95% Ca concentrations (P<0.05). At 0.40% nPP, there was no effect of adaptation on AID of CP and AA at any Ca concentration. Phytase efficacy was significantly lower in younger (7 to 9 d) compared to older birds (19 to 21 d; P<0.05), except at 0.65% Ca. Phytase inclusion increased AID of CP and AA regardless of Ca (P<0.05). In conclusion, the AID of CP and AA can be affected by diet, age, and adaptation. © 2015 Poultry Science Association Inc.
Common tea formulations modulate in vitro digestive recovery of green tea catechins.
Green, Rodney J; Murphy, Angus S; Schulz, Burkhard; Watkins, Bruce A; Ferruzzi, Mario G
2007-09-01
Epidemiological evidence suggests a role for tea catechins in reduction of chronic disease risk. However, stability of catechins under digestive conditions is poorly understood. The objective of this study was to characterize the effect of common food additives on digestive recovery of tea catechins. Green tea water extracts were formulated in beverages providing 4.5, 18, 23, and 3.5 mg per 100 mL epicatechin (EC), epigallocatechin (EGC), epigallocatechin-gallate (EGCG), and epicatechin-gallate (ECG), respectively. Common commercial beverage additives; citric acid (CA), BHT, EDTA, ascorbic acid (AA), milk (bovine, soy, and rice), and citrus juice (orange, grapefruit, lemon, and lime) were formulated into finished tea beverages at incremental dosages. Samples were then subjected to in vitro digestion simulating gastric and small intestinal conditions with pre- and post-digestion catechin profiles assessed by HPLC. Catechin stability in green tea was poor with <20% total catechins remaining post-digestion. EGC and EGCG were most sensitive with less, not double equals 10% recovery. Teas formulated with 50% bovine, soy, and rice milk increased total catechin recovery significantly to 52, 55, and 69% respectively. Including 30 mg AA in 250 mL of tea beverage significantly (p<0.05) increased catechin recovery of EGC, EGCG, EC, and ECG to 74, 54, 82, and 45% respectively. Juice preparation resulted in the highest recovery of any formulation for EGC (81-98%), EGCG (56-76%), EC (86-95%), and ECG (30-55%). These data provide evidence that tea consumption practices and formulation factors likely impact catechin digestive recovery and may result in diverse physiological profiles.
Cervantes-Pahm, S K; Stein, H H
2008-08-01
An experiment was conducted to measure the effect of adding soybean oil to soybean meal (SBM) and soy protein concentrate (SPC) on apparent (AID) and standardized (SID) ileal digestibility of CP and AA by growing pigs. A second objective was to compare AID and SID of AA in a new high-protein variety of full fat soybeans (FFSB) to values obtained in other soybean products. Commercial sources of FFSB (FFSB-CV), SBM, and SPC, and of a new high-protein variety of FFSB (FFSB-HP) were used in the experiment. Four diets were prepared using each soybean product as the sole source of CP and AA in 1 diet. Two additional diets were formulated by adding soybean oil (7.55 and 7.35%, respectively) to the diets containing SBM and SPC. A nitrogen-free diet was also used to measure basal endogenous losses of CP and AA. The 2 sources of FFSB were extruded at 150 degrees C before being used in the experiment. Seven growing barrows (initial BW = 26.2 kg) were prepared with a T-cannula in the distal ileum and allotted to a 7 x 7 Latin square design. Ileal digesta were collected from the pigs on d 6 and 7 of each period. All digesta samples were lyophilized and analyzed for DM, CP, AA, and chromium, and values for AID and SID of CP and AA were calculated. The addition of oil improved (P < 0.05) the SID of most indispensable AA in SBM and SPC. The SID for 6 of the indispensable AA in FFSB-HP were greater (P < 0.05) than in FFSB-CV, and the SID for all indispensable AA except Met was greater (P < 0.05) in FFSB-HP than in SBM. However, the SID for most AA in FFSB-HP was similar to SBM with oil and SPC, but these values were lower (P < 0.05) than in SPC with oil. In conclusion, the addition of oil improved the SID of most AA in SBM and SPC fed to growing pigs, and the SID of AA in FFSB-HP were greater than in SBM and similar to the SID of AA in SBM with oil and in SPC.
Garbarino, John R.
2000-01-01
Analysis of in-bottle digestate by using the inductively coupled plasma?mass spectrometric (ICP?MS) method has been expanded to include arsenic, boron, and vanadium. Whole-water samples are digested by using either the hydrochloric acid in-bottle digestion procedure or the nitric acid in-bottle digestion procedure. When the hydrochloric acid in-bottle digestion procedure is used, chloride must be removed from the digestate by subboiling evaporation before arsenic and vanadium can be accurately determined. Method detection limits for these elements are now 10 to 100 times lower than U.S. Geological Survey (USGS) methods using hydride generation? atomic absorption spectrophotometry (HG? AAS) and inductively coupled plasma? atomic emission spectrometry (ICP?AES), thus providing lower variability at ambient concentrations. The bias and variability of the methods were determined by using results from spike recoveries, standard reference materials, and validation samples. Spike recoveries in reagent-water, surface-water, ground-water, and whole-water recoverable matrices averaged 90 percent for seven replicates; spike recoveries were biased from 25 to 35 percent low for the ground-water matrix because of the abnormally high iron concentration. Results for reference material were within one standard deviation of the most probable value. There was no significant difference between the results from ICP?MS and HG?AAS or ICP?AES methods for the natural whole-water samples that were analyzed.
HIF-1α P582S and A588T polymorphisms and digestive system cancer risk-a meta-analysis.
Yang, Xi; Zhang, Chi; Zhu, Hong-Cheng; Qin, Qin; Zhao, Lian-Jun; Liu, Jia; Xu, Li-Ping; Zhang, Qu; Cai, Jing; Ma, Jian-Xin; Cheng, Hong-Yan; Sun, Xin-Chen
2014-03-01
Hypoxia-inducible factor-1 (HIF-1) influences cancer progression and metastasis through various mechanisms, and HIF-1α polymorphisms are reportedly associated with many cancers; however, the associations of HIF-1α P582S and A588T polymorphisms with the risk of digestive system cancer remain inconclusive. To understand the role of HIF-1α P582S and A588T genotypes in digestive cancer development, we conducted a comprehensive meta-analysis involving 1,517 cases and 3,740 controls. Overall, the P582S polymorphism was not significantly associated with digestive system cancers in all genotypes. By contrast, the A588T polymorphism was significantly associated with digestive system cancers in the dominant model (TT/AT vs. AA: OR = 3.17, 95% CI: 1.21, 8.25; P heterogeneity < 0.001). In subgroup analysis for cancer types, the two polymorphisms were only associated with increased risk of pancreatic cancer (P582S: SS vs. PP: OR = 2.51, 95% CI: 1.31, 4.81; SS vs. OR = 8.73, 95% CI: 1.33, 57.1; A588T: TT vs. AA: OR = 9.30, 95% CI: 1.12, 77.6; P heterogeneity = 0.478; TT vs. OR = 3.14, 95% CI: 1.99, 4.97; P heterogeneity = 0.098; TT/AT vs. AA: OR = 8.65, 95% CI: 1.05, 71.6; P heterogeneity = 0.418). According to the source of ethnicity, the P582S and the A588T polymorphisms are both significantly associated with an increased risk of cancer among Caucasians in the homozygote model (SS vs. PP: OR = 2.41, 95% CI: 1.24, 4.691; P heterogeneity = 0.010; TT vs. AA: OR = 98.6, 95% CI: 4.37, 2,224; P heterogeneity = 0.040) and the recessive model (SS vs. OR = 9.48, 95% CI: 1.12, 80.3; P heterogeneity < 0.001; TT vs. OR = 82.7, 95% CI: 3.79, 1,802; P heterogeneity = 0.041). Our findings suggest that the HIF-1α A588T polymorphism is significantly associated with higher cancer risk and the P582S polymorphism is significantly associated with pancreatic cancer risk. Furthermore, the effect of both polymorphisms on digestive system cancer is more pronounced among Caucasians than that among Asians.
Genheden, Samuel
2017-10-01
We present the estimation of solvation free energies of small solutes in water, n-octanol and hexane using molecular dynamics simulations with two MARTINI models at different resolutions, viz. the coarse-grained (CG) and the hybrid all-atom/coarse-grained (AA/CG) models. From these estimates, we also calculate the water/hexane and water/octanol partition coefficients. More than 150 small, organic molecules were selected from the Minnesota solvation database and parameterized in a semi-automatic fashion. Using either the CG or hybrid AA/CG models, we find considerable deviations between the estimated and experimental solvation free energies in all solvents with mean absolute deviations larger than 10 kJ/mol, although the correlation coefficient is between 0.55 and 0.75 and significant. There is also no difference between the results when using the non-polarizable and polarizable water model, although we identify some improvements when using the polarizable model with the AA/CG solutes. In contrast to the estimated solvation energies, the estimated partition coefficients are generally excellent with both the CG and hybrid AA/CG models, giving mean absolute deviations between 0.67 and 0.90 log units and correlation coefficients larger than 0.85. We analyze the error distribution further and suggest avenues for improvements.
NASA Astrophysics Data System (ADS)
Genheden, Samuel
2017-10-01
We present the estimation of solvation free energies of small solutes in water, n-octanol and hexane using molecular dynamics simulations with two MARTINI models at different resolutions, viz. the coarse-grained (CG) and the hybrid all-atom/coarse-grained (AA/CG) models. From these estimates, we also calculate the water/hexane and water/octanol partition coefficients. More than 150 small, organic molecules were selected from the Minnesota solvation database and parameterized in a semi-automatic fashion. Using either the CG or hybrid AA/CG models, we find considerable deviations between the estimated and experimental solvation free energies in all solvents with mean absolute deviations larger than 10 kJ/mol, although the correlation coefficient is between 0.55 and 0.75 and significant. There is also no difference between the results when using the non-polarizable and polarizable water model, although we identify some improvements when using the polarizable model with the AA/CG solutes. In contrast to the estimated solvation energies, the estimated partition coefficients are generally excellent with both the CG and hybrid AA/CG models, giving mean absolute deviations between 0.67 and 0.90 log units and correlation coefficients larger than 0.85. We analyze the error distribution further and suggest avenues for improvements.
Preexercise aminoacidemia and muscle protein synthesis after resistance exercise.
Burke, Louise M; Hawley, John A; Ross, Megan L; Moore, Daniel R; Phillips, Stuart M; Slater, Gary R; Stellingwerff, Trent; Tipton, Kevin D; Garnham, Andrew P; Coffey, Vernon G
2012-10-01
We have previously shown that the aminoacidemia caused by the consumption of a rapidly digested protein after resistance exercise enhances muscle protein synthesis (MPS) more than the amino acid (AA) profile associated with a slowly digested protein. Here, we investigated whether differential feeding patterns of a whey protein mixture commencing before exercise affect postexercise intracellular signaling and MPS. Twelve resistance-trained males performed leg resistance exercise 45 min after commencing each of three volume-matched nutrition protocols: placebo (PLAC, artificially sweetened water), BOLUS (25 g of whey protein + 5 g of leucine dissolved in artificially sweetened water; 1 × 500 mL), or PULSE (15 × 33-mL aliquots of BOLUS drink every 15 min). The preexercise rise in plasma AA concentration with PULSE was attenuated compared with BOLUS (P < 0.05); this effect was reversed after exercise, with two-fold greater leucine concentrations in PULSE compared with BOLUS (P < 0.05). One-hour postexercise, phosphorylation of p70 S6K(thr389) and rpS6(ser235/6) was increased above baseline with BOLUS and PULSE, but not PLAC (P < 0.05); furthermore, PULSE > BOLUS (P < 0.05). MPS throughout 5 h of recovery was higher with protein ingestion compared with PLAC (0.037 ± 0.007), with no differences between BOLUS or PULSE (0.085 ± 0.013 vs. 0.095 ± 0.010%.h(-1), respectively, P = 0.56). Manipulation of aminoacidemia before resistance exercise via different patterns of intake of protein altered plasma AA profiles and postexercise intracellular signaling. However, there was no difference in the enhancement of the muscle protein synthetic response after exercise. Protein sources producing a slow AA release, when consumed before resistance exercise in sufficient amounts, are as effective as rapidly digested proteins in promoting postexercise MPS.
Hackl, W; Pieper, B; Pieper, R; Korn, U; Zeyner, A
2010-12-01
Inclemency of weather frequently causes critical water contents in cereal grains above 15%. Ensiling in pre-mature condition may be an alternative to other techniques of preservation. Aim of this study was to compare apparent total tract digestibility (D(t) ; barley, wheat, triticale, rye) of proximate nutrients and pre-caecal digestibility (D(pc); barley, wheat) of amino acids (AA), respectively, from cereal grains in ensiled and almost dry condition. Moistly harvested cereal grains (67-73% dry matter) were milled through a 4-mm sieve and ensiled with lactic acid bacteria (LAB, 3 × 10(5) colony forming units/g Lactobacillus plantarum DSMZ 8862 and 8866). To investigate D(t), two trials were conducted with six Mini-Lewe pigs and four German Landrace pigs, respectively. D(pc) of AA was determined using four German Landrace pigs with ileo-rectal anastomosis. D(t) of proximate nutrients did not differ between cereal grains and their silages, except for ether extract, which was more digestible in ensiled than dry wheat, triticale and rye (p < 0.05). Lysine content was lower in ensiled than dry barley and wheat. In barley, ensiling was accompanied by reduced D(pc) of lysine and histidine (p < 0.05). In wheat, ensiling increased D(pc) of lysine, methionine, threonine and leucin (p < 0.05). Ensiling of pre-mature cereal grains with LAB can serve as a reasonable storage alternative. However, as limited data are yet available, further research is required to understand completely the impact of ensiling on nutritional value as indicated, for example, by the lysine content and the D(pc) of certain AA. © 2010 Blackwell Verlag GmbH.
Lymperatou, Anna; Gavala, Hariklia N; Skiadas, Ioannis V
2017-11-01
Swine manure mono-digestion often results to economically non-feasible processes, due to the high dilution and ammonia concentration together with the low degradation rates it presents. The effects of different parameters of Aqueous Ammonia Soaking (AAS) as a pretreatment for improving the digestion of manure fibers when coupled to an ammonia removal step were investigated in this study. Response Surface Methodology was followed and the influence and interactions of the following AAS parameters were studied: NH 3 concentration, duration and solid-to-liquid ratio. The mild conditions found to be optimal (7%w/w NH 3 , 96h, and 0.16kg/L) in combination to a significant increase of the short term CH 4 yield (244% in 17days), make this pretreatment a promising solution for improving swine manure mono-digestion. Furthermore, compositional analysis of the manure fibers revealed significant solubilization of hemicellulose, while no lignin removal or loss of cellulose occurred under optimal conditions. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Atomic Absorption Spectroscopy of Calcium in Foodstuffs in Non-Science-Major Courses
NASA Astrophysics Data System (ADS)
Kostecka, Keith S.
2000-10-01
Non-science-major students at Columbia College-Chicago are introduced to the concept of ppm, prepare AAS standard solutions, digest foodstuffs in nitric acid, conduct AAS analysis for Ca, determine mass percentage of calcium in the sample, and check calcium levels in various food items on the Internet with a critical eye. Students work cooperatively in a setting that allows them to see how wet chemistry and understandable use of instrumental methods can be linked together. Overall response to this activity has been favorable and continues to spawn new projects dealing with the AAS analysis of metals in hair, vitamins, and additional foods.
Measurement of true ileal phosphorus digestibility in meat and bone meal for broiler chickens.
Mutucumarana, R K; Ravindran, V; Ravindran, G; Cowieson, A J
2015-07-01
An experiment was conducted to estimate true ileal phosphorus (P:) digestibility of 3 meat and bone meal samples (MBM-1, MBM-2: , and MBM-3:) for broiler chickens. Four semipurified diets were formulated from each sample to contain graded concentrations of P. The experiment was conducted as a completely randomized design with 6 replicates (6 birds per replicate) per dietary treatment. A total of 432 Ross 308 broilers were assigned at 21 d of age to the 12 test diets. The apparent ileal digestibility coefficient of P was determined by the indicator method, and the linear regression method was used to determine the true P digestibility coefficient. The apparent ileal digestibility coefficient of P in birds fed diets containing MBM-1 and MBM-2 was unaffected by increasing dietary concentrations of P (P > 0.05). The apparent ileal digestibility coefficient of P in birds fed the MBM-3 diets decreased with increasing P concentrations (linear, P < 0.001; quadratic, P < 0. 01). In birds fed the MBM-1 and MBM-2 diets, ileal endogenous P losses were estimated to be 0.049 and 0.142 g/kg DM intake (DMI:), respectively. In birds fed the MBM-3 diets, endogenous P loss was estimated to be negative (-0.370 g/kg DMI). True ileal P digestibility of MBM-1, MBM-2, and MBM-3 was determined to be 0.693, 0.608, and 0.420, respectively. True ileal P digestibility coefficients determined for MBM-1 and MBM-2 were similar (P < 0.05), but were higher (P < 0.05) than that for MBM-3. Total P and true digestible P contents of MBM-1, MBM-2, and MBM-3 were determined to be 37.5 and 26.0; 60.2 and 36.6; and 59.8 and 25.1 g/kg, respectively, on an as-fed basis. © 2015 Poultry Science Association Inc.
Chen, Long Hui; Yang, Ze Min; Chen, Wei Wen; Lin, Jing; Zhang, Min; Yang, Xiao Rong; Zhao, Ling Bo
2015-04-14
Salivary α-amylase (sAA) is responsible for the 'pre-digestion' of starch in the oral cavity and accounts for up to 50 % of salivary protein in human saliva. An accumulating body of literature suggests that sAA is of nutritional importance; however, it is still not clear how sAA is related to individual's nutritional status. Although copy number variations (CNV) of the salivary amylase gene (AMY1) are associated with variation in sAA levels, a significant amount of sAA variation is not explained by AMY1 CNV. To measure sAA responses to gustatory stimulation with citric acid, we used sAA ratio (the ratio of stimulated sAA levels to those of resting sAA) and investigated acute sAA responses to citric acid in children with normal (Normal-BMI, n 22) and low (Low-BMI, n 21) BMI. The AMY1 gene copy number was determined by quantitative PCR. We, for the first time, demonstrated attenuated acute sAA responses (decreased sAA ratio) to gustatory stimulation in Low-BMI (thinness grade 3) children compared with the Normal-BMI children, which suggest that sAA responses to gustatory stimulation may be of nutritional importance. However, child's nutritional status was not directly related to their resting or stimulated sAA levels, and it was not associated with AMY1 gene copy number. Finally, AMY1 CNV might influence, but did not eventually determine, sAA levels in children.
Fate of 14C-acrylamide in roasted and ground coffee during storage.
Baum, Matthias; Böhm, Nadine; Görlitz, Jessica; Lantz, Ingo; Merz, Karl Heinz; Ternité, Rüdiger; Eisenbrand, Gerhard
2008-05-01
Acrylamide (AA) is formed during heating of carbohydrate rich foods in the course of the Maillard reaction. AA has been classified as probably carcinogenic to humans. Storage experiments with roasted coffee have shown that AA levels decrease depending on storage time and temperature. In the present study the fate of AA lost during storage of roasted and ground (R&G) coffee was studied, using 14C-labeled AA as radiotracer. Radiolabel was measured in coffee brew, filter residue, and volatiles. In the brew, total (14)C-label decreased during storage of R&G coffee, while activity in the filter residue built up concomitantly. [2,3-14C]-AA (14C-AA) was the only 14C-related water extractable low molecular compound in the brew detected by radio-HPLC. No formation of volatile 14C-AA-related compounds was detected during storage and coffee brewing. Close to 90% of the radiolabel in the filter residue (spent R&G coffee, spent grounds) remained firmly bound to the matrix, largely resisting extraction by aqueous ammonia, ethyl acetate, chloroform, hexane, and sequential polyenzymatic digest. Furanthiols, which are abundant as aroma components in roasted coffee, have not been found to be involved in the formation of covalent AA adducts and thus do not contribute substantially to the decrease of AA during storage.
Lopez, R; Pulsipher, G D; Guerra-Liera, J E; Soto-Navarro, S A; Balstad, L A; Petersen, M K; Dhuyvetter, D V; Brown, M S; Krehbiel, C R
2016-06-01
Five crossbred beef steers (initial BW = 338.6 ± 7.8 kg) fitted with ruminal and duodenal cannulas were used in a 5 × 5 Latin square design experiment to evaluate the effects of methionine hydroxy analog (MHA) and/or yellow grease (fat) added to a molasses-urea-based supplement on intake and characteristics of digestion. Steers were fed low-quality hay (long-stem lovegrass : 3.3% CP, 76.8% NDF; DM basis) ad libitum and supplemented with 0.91 kg/d (as fed) of 1 of 4 supplements in a 2 × 2 + 1 factorial arrangement of treatments. Supplemental treatments were 1) control (no supplement, NC); 2) molasses-urea liquid supplement (U); 3) U containing (as-fed basis) 1.65% MHA (UM); 4) U containing (as-fed basis) 12% fat (UF); and 5) U containing (as-fed basis) 1.65% MHA and 12% fat (UMF). Total and forage OM intake (kg/d and as % of BW) increased ( < 0.01) with molasses-urea, decreased ( ≤ 0.04) with MHA, and were not affected ( = 0.61) with fat supplementation. Total tract NDF digestibility increased ( = 0.01) with molasses-urea supplementation, and was less ( = 0.01) for fat than for nonfat supplementation. Total and microbial N flowing to the duodenum increased ( = 0.01) with molasses-urea supplementation. Although, total N flowing to duodenum was not affected ( = 0.27), microbial N decreased ( = 0.01), and nonammonia nonmicrobial N (NANMN) increased ( = 0.01) with fat supplementation. Extent of in situ OM and NDF digestibility at 96 h increased ( = 0.01) with molasses-urea supplementation, but were not affected ( ≥ 0.14) by either MHA or fat supplementation. Duodenal flow of total AA, essential AA, and nonessential AA increased ( ≤ 0.02) with molasses-urea supplementation. Total and nonessential serum AA concentration decreased ( < 0.01) with molasses-urea supplementation. Total ruminal VFA concentration increased ( = 0.01) with molasses-urea supplementation, and was not affected ( ≥ 0.14) by MHA or fat supplementation. Fat can be used in molasses-urea liquid supplements for cattle consuming low-quality forage to increase energy intake without negatively affecting forage intake or characteristics of digestion. However, adding MHA did not further improve the response to urea supplementation of cattle consuming low-quality forage. Conversely, the inclusion of MHA on urea supplement decreased forage intake.
Kriseldi, R; Tillman, P B; Jiang, Z; Dozier, W A
2018-05-01
An experiment (2 trials) was conducted to determine the effects of feeding reduced crude protein (CP) diets to Ross × Ross 708 male broilers while maintaining adequate essential amino acid (AA) concentrations on growth performance, nitrogen excretion, and plasma uric acid (UA) concentration during the starter period. In trial 1, 11 dietary treatments were fed from 1 to 18 d of age containing 1.20% digestible Lys. Diet 1 (23.2% CP) was formulated with DL-Met, L-Lys, and L-Thr to contain 1.70 total Gly + Ser to digestible Lys ratio whereas diets 2 (23.4% CP) to 11 were formulated with additional Gly to contain 1.90 total Gly + Ser to digestible Lys ratio. Free AA were added sequentially in the order of limitation (L-Val, L-Ile, L-Arg, L-Trp, L-His, L-Phe, and L-Leu) from diets 3 to 10 to decrease CP content from 22.6 to 18.8%, respectively. In diet 11, L-Gln was added to increase the CP content to 23.4%. Feed conversion of broilers fed diet 2 was lower (P < 0.05) than those consuming diets 6 to 11 from 1 to 17 d of age. Nitrogen excretion (mg/b/d) decreased (P < 0.001) by 14.1% when broilers were fed diet 4 compared with birds fed diet 2 from 15 to 16 d of age. Broilers fed diet 4 had lower (P = 0.011) plasma UA concentration than birds fed diet 2 at 18 d of age. In trial 2, 8 dietary treatments containing 1.25% digestible Lys and 1.70 total Gly + Ser to digestible Lys ratio were fed from 1 to 21 d of age. Diet 1 (24.0% CP) was supplemented with DL-Met, L-Lys, and L-Thr. Free AA (L-Val, Gly, L-Ile, L-Arg, L-Trp, L-His, and L-Phe) were sequentially supplemented in the order of limitation to decrease CP content in diets 2 to 8 from 23.8 to 20.3%. Broilers fed diet 1 had higher (P < 0.05) body weight gain and lower (P < 0.05) feed conversion when compared with diet 7 or 8. Plasma UA concentration of broiler provided diets 4 to 8 was lower (P < 0.05) compared with diet 1 at 21 d of age. Placing a minimum on dietary CP percentage may not be necessary when proper AA ratios are implemented in diet formulation.
Marchetti, Bárbara V; Candotti, Cláudia T; Raupp, Eduardo G; Oliveira, Eduardo B C; Furlanetto, Tássia S; Loss, Jefferson F
The purpose of this study was to assess a radiographic method for spinal curvature evaluation in children, based on spinous processes, and identify its normality limits. The sample consisted of 90 radiographic examinations of the spines of children in the sagittal plane. Thoracic and lumbar curvatures were evaluated using angular (apex angle [AA]) and linear (sagittal arrow [SA]) measurements based on the spinous processes. The same curvatures were also evaluated using the Cobb angle (CA) method, which is considered the gold standard. For concurrent validity (AA vs CA), Pearson's product-moment correlation coefficient, root-mean-square error, Pitman- Morgan test, and Bland-Altman analysis were used. For reproducibility (AA, SA, and CA), the intraclass correlation coefficient, standard error of measurement, and minimal detectable change measurements were used. A significant correlation was found between CA and AA measurements, as was a low root-mean-square error. The mean difference between the measurements was 0° for thoracic and lumbar curvatures, and the mean standard deviations of the differences were ±5.9° and 6.9°, respectively. The intraclass correlation coefficients of AA and SA were similar to or higher than the gold standard (CA). The standard error of measurement and minimal detectable change of the AA were always lower than the CA. This study determined the concurrent validity, as well as intra- and interrater reproducibility, of the radiographic measurements of kyphosis and lordosis in children. Copyright © 2017. Published by Elsevier Inc.
Li, Zhongchao; Wang, Qiuyun; Xie, Fei; Liu, Dewen; Li, Yakui; Lyu, Zhiqian; Lai, Changhua
2017-01-01
Objective The objective of this experiment was to determine apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of crude protein (CP) and amino acid (AA) in 15 sources of soybean meal (SBM) produced from soybeans from different countries and subsequently to establish equations for predicting the AID and SID in SBM based on their chemical composition. Methods Eighteen barrows (57.9±6.1 kg) fitted with a simple T-cannula were allotted into three 6×6 Latin square designs. Each period comprised a 6-d adaption period followed by a 2-d collection of ileal digesta. The 15 test diets included SBM as a sole source of AA in the diet. Another nitrogen-free diet was used to measure basal endogenous losses of CP and AA. Chromic oxide (0.3%) was used as an inert marker in each diet. Results The AID of lysine in SBM from China and USA tended to be greater than in SBM from Brazil (p<0.10). The SID of valine and proline in SBM from China was greater than in SBM from Brazil (p<0.05). The SID of lysine, threonine, cysteine and glycine in SBM from China tended to be greater than in SBM from Brazil (p<0.10). From a stepwise regression analysis, a series of AID and SID prediction equations were generated. The best fit equations for lysine in SBM were: AID lysine = 1.16 sucrose−1.81 raffinose+82.10 (R2 = 0.69, p<0.01) and SID lysine = 1.14 sucrose−1.93 raffinose−0.99 ether extract (EE)+85.26 (R2 = 0.77, p<0.01). Conclusion It was concluded that under the conditions of this experiment, the oligosaccharides (such as sucrose and raffinose) can be used to predict the AID and SID of AA in SBM with reasonable accuracy. PMID:28427255
Rodrigues, J B; Ferreira, L M; Bastos, E; San Roman, F; Viegas, C; Santos, A S
2013-10-01
The influence of dental correction on nociceptive (pressure) test responses, fecal appearance, BCS, and apparent digestibility coefficient for DM was studied in 18 Zamorano-Leonés donkeys, an endangered local breed from the Zamora province in Spain. For this purpose, donkeys were divided into 2 homogeneous control and treatment groups, based on age, BCS, and dental findings. On d 1, 45, 90, and 135, BCS and nociceptive test responses were evaluated in all donkeys. Feed and fecal samples were collected from all donkeys for 3 consecutive days, starting at each of the aforementioned days. Apparent digestibility coefficient for DM was estimated, using ADL as an internal marker. A progressive decrease of positive nociceptive test responses was observed from d 1 up to 90 (P < 0.01) in the treatment group. No difference between groups was observed for BCS. However, BCS at d 90 was greater (P = 0.018) than observed on d 1 or 45, indicating a time influence. Concerning apparent digestibility coefficient for DM, there were differences among collection days in apparent digestibility coefficient for DM (P < 0.05). No differences in fecal appearance were observed between treatments or collection days. This study highlighted the importance of regular dental care for not only Zamorano-Leonés donkeys but also the equid population, in general, to improve their welfare.
Wang, Hong Liang; Shi, Meng; Xu, Xiao; Ma, Xiao Kang; Liu, Ling; Piao, Xiang Shu
2017-07-01
Two experiments were conducted to determine the content of digestible energy (DE) and metabolizable energy (ME) as well as the apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of crude protein (CP) and amino acids (AA) in barley grains obtained from Australia, France or Canada. In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg) were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m) and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg) were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. The relative amounts of gross energy (GE), CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (p<0.05) than those in French barley but did not differ from Australian barley. Differences in the chemical composition, energy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.
Dong, Jing; Dai, Juncheng; Zhang, Mingfeng; Hu, Zhibin; Shen, Hongbing
2010-06-01
Three potentially functional polymorphisms: -765G>C, -1195G>A, and 8473T>C in the cyclooxygenase-2 (COX-2) gene were identified and proposed to be associated with cancer susceptibility. The aim of this meta-analysis was to evaluate the association between these three polymorphisms and the risk of cancer in diverse populations. All case-control studies published up to November 2009 on the association between the three polymorphisms of COX-2 and cancer risk were identified by searching PubMed. The cancer risk associated with the three polymorphisms of the COX-2 gene was estimated for each study by OR together with its 95% confidence interval (CI), respectively. A total of 47 case-control studies were included, and variant genotypes GA/AA of -1195G>A were associated with a significantly increased cancer risk (GA/AA vs GG: odds ratio [OR], 1.29; 95% CI, 1.18-1.41; P(heterogeneity) = 0.113), and this significant association was mainly observed within cancers of the digestive system (e.g. colorectal, gastric, esophageal, oral, biliary tract, gallbladder, and pancreatic) without between-study heterogeneity (GA/AA vs GG: OR, 1.36; 95% CI; 1.23-1.51; P(heterogeneity) = 0.149). Furthermore, a stratification analysis showed that the risk of COX-2-1195G>A associated with cancers in the digestive system was more evident among Asians than Caucasians. However, for COX-2-765G>C and 8473T>C, no convincing association between the two polymorphisms and risk of cancer or cancer type was observed. The effect of three potentially functional polymorphisms (-765G>C, -1195G>A, and 8473T>C) in the COX-2 gene on cancer risk provided evidence that the COX-2-1195G>A polymorphism was significantly associated with increased risk of digestive system cancers, especially among Asian populations.
Guliye, A Y; Wallace, R J
2007-10-01
Anaerobic fungi are important members of the fibrolytic community of the rumen. The aim of this study was to study their requirement for aromatic amino acids (AA) and related phenyl acids (phenylpropionic and phenylacetic acids) for optimal xylan fermentation. Neocallimastix frontalis RE1 and Piromyces communis P were grown in a defined medium containing oat spelts xylan as the sole energy source, plus one of the following N sources: ammonia; ammonia plus a complete mixture of 20 AA commonly found in protein; ammonia plus complete AA mixture minus aromatic AA; ammonia plus phenyl acids; ammonia plus complete AA mixture without aromatic AA plus phenyl acids. Both species grew in all the media, indicating no absolute requirement for AA. The complete AA mixture increased (P<0.05) acetate concentration by 18% and 15%, sugar utilization by 33% and 22% and microbial yield by about 22% and 15% in N. frontalis and P. communis, respectively, in comparison with the treatments that had ammonia as the only N source. Neither the supply of aromatic AA or phenol acids, nor their deletion from the complete AA mixture, affected the fermentation rate, products or yield of either species. AA were not essential for N. frontalis and P. communis, but their growth on xylan was stimulated. The effects could not be explained in terms of aromatic AA alone. Ruminant diets should contain sufficient protein to sustain optimal fibre digestion by ruminal fungi. Aromatic AA or phenyl acids alone cannot replace the complete AA mixture.
Relating residue in raccoon feces to food consumed
Greenwood, R.J.
1979-01-01
Feeding tests were conducted with captive raccoons (Procyon lotor) to permit more meaningful interpretation of food habit data obtained from fecal analysis. Ten diverse types of natural foods were offered in 20 tests. Digestibility coefficients were calculated that ranged from 3.6 for dry sunflowers, where considerable residue was recovered, to infinity for earthworms and boned meat where no residue was recovered. The influence of differences in both food and animal behavior on digestibility coefficients was significant (ANOVA, F<0.001). The use of digestibility coefficients to adjust quantitative estimates of fecal residue or to predict biomass consumed is of questionable value with raccoons due to variability in foods consumed and behavior of individual animals.
Puntigam, R; Schedle, K; Schwarz, C; Wanzenböck, E; Eipper, J; Lechner, E-M; Yin, L; Gierus, M
2018-07-01
The present study investigated the effect of hydrothermic maize processing and supplementation of amino acids (AA) in two experiments. In total, 60 barrows and 384 broilers were fed four diets including either unprocessed (T1), or hydrothermically processed maize, that is short- (T2), or long-term conditioned (LC) (T3), and subsequently expanded maize of the same batch. Assuming a higher metabolizable energy (ME) content after processing, the fourth diet (T4) contains maize processed as treatment T3, but AA were supplemented to maintain the ideal protein value. Performance, digestibility and product quality in both species were assessed. Results show that in pigs receiving T4 the average daily feed intake was lower compared with the other treatments, whereas no difference was observed in broilers. The T3 improved the feed conversion rate compared with T1 (P<0.10) for both species. In contrast, average daily gain (ADG) (1277 g/day for T2 and 1267 g/day for T3 v. 971 g/day for T1) was only altered in pigs. The hydrothermic maize processing increased the apparent total tract digestibility (ATTD) of dry matter, starch and ether extract after acid hydrolysis. This may be a consequence of higher ATTD of gross energy in the finishing phase for both animal species, suggesting a higher ME content in diets with processed maize. The higher ME content of diets with processed maize is supported also by measurements of product quality. Supplementation of AA in T4 enhanced the loin depth in pigs as well as the amount of breast meat in broilers. Further effects of processing maize on meat quality were the reduced yellowness and antioxidative capacity (P<0.10) for broilers, likely due to the heat damage of xanthophylls and tocopherols. Processing also increased springiness and chewiness (P<0.10) of the broilers breast meat, whereas the loin meat of pigs showed a decreased lightness and yellowness (P<0.10) in meat when hydrothermic processed maize was used (for T2, T3 and T4). LC processed maize (T3) showed the lowest springiness in pork, however the supplementation of AA in T4 did not show differences between the treatments. Shown results demonstrated positive effects of hydrothermic processing of maize on animal performance and digestibility in both species. However, effects on carcass characteristics and product quality differed. The negative effects on product quality could be partly compensated with the AA supplementation, whereas a change in meat colour and reduced antioxidative capacity was observed in all groups fed hydrothermic maize processing.
Effects of freezing, freeze drying and convective drying on in vitro gastric digestion of apples.
Dalmau, Maria Esperanza; Bornhorst, Gail M; Eim, Valeria; Rosselló, Carmen; Simal, Susana
2017-01-15
The influence of processing (freezing at -196°C in liquid N2, FN sample; freeze-drying at -50°C and 30Pa, FD sample; and convective drying at 60°C and 2m/s, CD sample) on apple (var. Granny Smith) behavior during in vitro gastric digestion was investigated. Dried apples (FD and CD samples) were rehydrated prior to digestion. Changes in carbohydrate composition, moisture, soluble solids, acidity, total polyphenol content (TPC), and antioxidant activity (AA) of apple samples were measured at different times during digestion. Processing resulted in disruption of the cellular structure during digestion, as observed by scanning electron microscopy, light microscopy, and changes in carbohydrate composition. Moisture content increased (6-11% dmo), while soluble solids (55-78% dmo), acidity (44-72% dmo), total polyphenol content (30-61% dmo), and antioxidant activity (41-87%) decreased in all samples after digestion. Mathematical models (Weibull and exponential models) were used to better evaluate the influence of processing on apple behavior during gastric digestion. Copyright © 2016 Elsevier Ltd. All rights reserved.
Objectively measured sedentary time and academic achievement in schoolchildren.
Lopes, Luís; Santos, Rute; Mota, Jorge; Pereira, Beatriz; Lopes, Vítor
2017-03-01
This study aimed to evaluate the relationship between objectively measured total sedentary time and academic achievement (AA) in Portuguese children. The sample comprised of 213 children (51.6% girls) aged 9.46 ± 0.43 years, from the north of Portugal. Sedentary time was measured with accelerometry, and AA was assessed using the Portuguese Language and Mathematics National Exams results. Multilevel linear regression models were fitted to assess regression coefficients predicting AA. The results showed that objectively measured total sedentary time was not associated with AA, after adjusting for potential confounders.
Improved Peptide and Protein Torsional Energetics with the OPLSAA Force Field.
Robertson, Michael J; Tirado-Rives, Julian; Jorgensen, William L
2015-07-14
The development and validation of new peptide dihedral parameters are reported for the OPLS-AA force field. High accuracy quantum chemical methods were used to scan φ, ψ, χ1, and χ2 potential energy surfaces for blocked dipeptides. New Fourier coefficients for the dihedral angle terms of the OPLS-AA force field were fit to these surfaces, utilizing a Boltzmann-weighted error function and systematically examining the effects of weighting temperature. To prevent overfitting to the available data, a minimal number of new residue-specific and peptide-specific torsion terms were developed. Extensive experimental solution-phase and quantum chemical gas-phase benchmarks were used to assess the quality of the new parameters, named OPLS-AA/M, demonstrating significant improvement over previous OPLS-AA force fields. A Boltzmann weighting temperature of 2000 K was determined to be optimal for fitting the new Fourier coefficients for dihedral angle parameters. Conclusions are drawn from the results for best practices for developing new torsion parameters for protein force fields.
Chen, Xiaojuan; Chen, Zhihua; Wang, Xun; Huo, Chan; Hu, Zhiquan; Xiao, Bo; Hu, Mian
2016-07-01
The present study focused on the application of anaerobic digestion model no. 1 (ADM1) to simulate biogas production from Hydrilla verticillata. Model simulation was carried out by implementing ADM1 in AQUASIM 2.0 software. Sensitivity analysis was used to select the most sensitive parameters for estimation using the absolute-relative sensitivity function. Among all the kinetic parameters, disintegration constant (kdis), hydrolysis constant of protein (khyd_pr), Monod maximum specific substrate uptake rate (km_aa, km_ac, km_h2) and half-saturation constants (Ks_aa, Ks_ac) affect biogas production significantly, which were optimized by fitting of the model equations to the data obtained from batch experiments. The ADM1 model after parameter estimation was able to well predict the experimental results of daily biogas production and biogas composition. The simulation results of evolution of organic acids, bacteria concentrations and inhibition effects also helped to get insight into the reaction mechanisms. Copyright © 2016. Published by Elsevier Ltd.
Zhang, Ranran; Wang, Xiaojuan; Gu, Jie; Zhang, Yajun
2017-11-01
This study determined the accumulated biogas, methane content, and absolute abundances (AAs) of 14 common antibiotic resistance genes (ARGs) and two integrons during the anaerobic digestion of swine manure for 52days with different amounts of added zinc. The accumulated biogas increased by 51.2% and 56.0% with 125mgL -1 (L) and 1250mgL -1 (H) zinc, respectively, compared with the control with no added zinc (CK), but there was no significant difference between L and H. Compared with CK, excluding tetW and tetC, all the other ARGs detected in this study increased in the L and H reactors. However, the low concentration of zinc (L reactor) caused greater increases in the AAs of ARGs in the AD products. Redundancy analysis showed that NO 3 -N and bio-zinc significantly explained the changes in genes, where they accounted for 60.9% and 20.3% of the total variation in the environmental factors, respectively. Copyright © 2017. Published by Elsevier Ltd.
Amino acid composition of rumen bacteria and protozoa in cattle.
Sok, M; Ouellet, D R; Firkins, J L; Pellerin, D; Lapierre, H
2017-07-01
Because microbial crude protein (MCP) constitutes more than 50% of the protein digested in cattle, its AA composition is needed to adequately estimate AA supply. Our objective was to update the AA contributions of the rumen microbial AA flowing to the duodenum using only studies from cattle, differentiating between fluid-associated bacteria (FAB), particle-associated bacteria (PAB), and protozoa, based on published literature (53, 16, and 18 treatment means were used for each type of microorganism, respectively). In addition, Cys and Met reported concentrations were retained only when an adequate protection of the sulfur groups was performed before the acid hydrolysis. The total AA (or true protein) fraction represented 82.4% of CP in bacteria. For 10 AA, including 4 essential AA, the AA composition differed between protozoa and bacteria. The most noticeable differences were a 45% lower Lys concentration and 40% higher Ala concentration in bacteria than in protozoa. Differences between FAB and PAB were less pronounced than differences between bacteria and protozoa. Assuming 33% FAB, 50% PAB, and 17% of protozoa in MCP duodenal flow, the updated concentrations of AA would decrease supply estimates of Met, Thr, and Val originating from MCP and increase those of Lys and Phe by 5 to 10% compared with those calculated using the FAB composition reported previously. Therefore, inclusion of the contribution of PAB and protozoa to the duodenal MCP flow is needed to adequately estimate AA supply from microbial origin when a factorial method is used to estimate duodenal AA flow. Furthermore, acknowledging the fact that hydrolysis of 1 kg of true microbial protein yields 1.16 kg of free AA substantially increases the estimates of AA supply from MCP. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Anumula, K R; Du, P
1999-11-15
Application of the most sensitive fluorescent label 2-aminobenzoic acid (anthranilic acid, AA) for characterization of carbohydrates from the glycoproteins ( approximately 15 pmol) separated by polyacrylamide gel electrophoresis is described. AA label is used for the determination of both monosaccharide composition and oligosaccharide map. For the monosaccharide determination, bands containing the glycoprotein of interest are excised from the polyvinylidene fluoride (PVDF) membrane blots, hydrolyzed in 20% trifluoroacetic acid, derivatized, and analyzed by C-18 reversed-phase high-performance liquid chromatography. For the oligosaccharide mapping, bands were digested with peptide N-glycosidase F (PNGase F) in order to release the N-linked oligosaccharides, derivatized, and analyzed by normal-phase anion-exchange chromatography. For convenience, the PNGase F digestion was performed in 1:100 diluted ammonium hydroxide overnight. The oligosaccharide yield from ammonium hydroxide-PNGase F digestion was better or equal to all the other reported procedures, and the presumed "oligosaccharide-amine" product formed in the reaction mixture did not interfere with labeling of the oligosaccharides under the conditions used for derivatization. Sequencing of oligosaccharides can be performed using the same mapping method following treatment with an array of glycosidases. In addition, the mapping method is useful for determining the relative and simultaneous distribution of sialic acid and fucose. Copyright 1999 Academic Press.
Nutritive value of extruded or multi-enzyme supplemented cold-pressed soybean cake for pigs.
Woyengo, T A; Patterson, R; Levesque, C L
2016-12-01
The objectives were to determine the standardized ileal digestibility (SID) of AA and NE value of cold-pressed soybean cake (CP-SBC), and the effect of extrusion or adding multi-enzyme to CP-SBC diet for growing pigs. Eight ileal-cannulated pigs (initial BW = 79.7 ± 3.97 kg) were fed 4 diets in a replicated 4 × 4 Latin square design to give 8 replicates per diet. Diets included a cornstarch-based diet with CP-SBC, extruded CP-SBC, and SBC plus multi-enzyme (1,200 U of xylanase, 150 U of glucanase, 500 U of cellulase, 60 U of mannanase, 700 U of invertase, 5,000 U of protease, and 12,000 U of amylase/kilogram of diet; Superzyme-CS, 0.5 g/kg); and a N-free diet. The CP-SBC was the sole source of protein in the CP-SBC-containing diets. The ratio of cornstarch to sugar and soybean oil in CP-SBC-containing diets was identical to the N-free diet to allow calculation of energy digestibility of CP-SBC by the difference method. The evaluated CP-SBC had been produced by heating the soybean seed at 105°C for 60 min followed by pressing of the heated soybean seeds at less than 42°C (barrel temperature). On a DM basis, CP-SBC and extruded CP-SBC contained 47.8 and 47.1% CP, 15.6 and 10.5% ADF, 7.23 and 8.85% ether extract, 3.11 and 3.08% Lys, and 2.25 and 3.70 trypsin inhibitor units per mg, respectively. Extrusion increased ( < 0.001) the SID of AA for the CP-SBC by an average of 12%. Also, extrusion increased ( < 0.001) the NE value of the CP-SBC from 2,743 to 2,853 kcal/kg of DM. Supplementation of CP-SBC diet with the multi-enzyme increased ( < 0.05) the SID of Arg and Pro, and tended to increase ( < 0.1) the SID of Ile and Tyr. However, the multi-enzyme supplementation did not affect the NE value of CP-SBC. In conclusion, the CP-SBC evaluated in the present study could be an alternative source of AA and energy in swine diets, and its nutritive value can be increased by extrusion following cold-pressing. The multi-enzyme used in this study improved the digestibility of some AA, but had limited effect on energy digestibility and hence NE value of the CP-SBC.
Eklund, M; Sauer, N; Schöne, F; Messerschmidt, U; Rosenfelder, P; Htoo, J K; Mosenthin, R
2015-06-01
Five rapeseed meals (RSM) were produced from a single batch of rapeseed in a large-scale pilot plant under standardized conditions. The objective was to evaluate the effect of residence time in the desolventizer/toaster (DT) on chemical composition and standardized ileal digestibility (SID) of AA in RSM. Four RSM, with 48, 64, 76, and 93 min residence time and using unsaturated steam in the DT, referred to as RSM48, RSM64, RSM76, and RSM93, respectively, and 1 low-glucosinolate RSM, which was subjected to sequential treatment with unsaturated steam, saturated steam, and dry heat in the DT, referred to as low-GSL RSM, were assayed. Six barrows (average initial BW = 22 ± 1 kg) were surgically fitted with a T-cannula at the distal ileum. Pigs were allotted to a 5 × 6 row × column design with 5 diets and 5 periods. The 5 RSM were included in a cornstarch-casein-based basal diet. In addition, basal ileal endogenous losses and SID of AA originating from casein were determined at the conclusion of the experiment in 2 additional periods by means of the regression method and using 3 graded levels of casein. The SID of AA in the 5 RSM was determined in difference to SID of AA originating from casein. The glucosinolates (GSL) were efficiently reduced, whereas NDF, ADF, ADL, and NDIN contents increased and reactive Lys (rLys) and Lys:CP ratio decreased as the residence time in the DT was increased from 48 to 93 min. The SID of most AA in RSM linearly decreased (P < 0.05) as the residence time in the DT increased from 48 to 93 min. Moreover, there was a linear decrease (P < 0.05) in SID of AA with increasing NDF, ADF, ADL, and NDIN contents in these RSM, whereas SID of AA linearly decreased (P < 0.05) with decreasing levels of GSL and rLys and a decreasing Lys:CP ratio. The decrease (P < 0.05) in SID of AA amounted from 3 up to 6 (percentage units) for most AA, except for SID of Cys and Lys, which decreased by 10 and 11%-units (P < 0.05), respectively, as the residence time in the DT was increased from 48 to 93 min. The SID in low-GSL RSM was for CP and most AA similar to RSM93 but lower ( < 0.05) compared to RSM48. It can be concluded that time and energy-intensive heat treatment results in lower contents of SID AA in RSM together with a reduction in GSL levels. The feed industry would most likely benefit from a rapid and accurate prediction of SID of AA, for example, based on content of NDIN, GSL, rLys or on Lys:CP ratio, in different batches of RSM used for feed manufacturing.
Guardia, Sarah; Lessire, Michel; Corniaux, Alain; Métayer-Coustard, Sonia; Mercerand, Frédéric; Tesseraud, Sophie; Bouvarel, Isabelle; Berri, Cécile
2014-07-01
The poultry meat industry is faced with various quality issues related to variations in the ultimate pH of breast meat. The aim of this study was to evaluate the possibility to control breast ultimate pH by distributing finishing diets varying in amino acid (AA) and energy content for a short period before slaughter. Experimental diets were distributed to PM3 broilers on the last 3 d before slaughter (36 d of age). They consisted of a control (C) diet (3,150 kcal/kg; 200 g/kg of CP; 10.0 g/kg of true digestible Lys) with adequate amounts of AA other than Lys, 6 diets isocaloric to the control diet including 3 Lys-deficient (8.0 g/kg) diets with an adequate (Lys-/AA), low (Lys-/AA-), or high (Lys-/AA+) amount of other essential AA calculated in relation to Lys, and 3 Lys-rich (12.0 g/kg) diets with an adequate (Lys+/AA), low (Lys+/AA-), or high (Lys+/AA+) amount of other essential AA calculated in relation to Lys, and 2 diets isoproteic to C with a high (3,300 kcal/kg, E+) or low (3,000 kcal/kg, E-) energy content. Broiler feed consumption and growth performance were slightly affected by AA and energy content during the finishing period. Feed intake (33-36 d) was lower with the Lys+/AA+ and E+, and FCR between 24 and 36 d was higher with the Lys-/AA- and E- than with the C diet. Body weight at d 36 was lower in Lys-/AA-, Lys+/AA+, and E+ than in C, whereas the breast meat yield and abdominal fatness were not affected by diet. Lower pH values were observed in broilers fed Lys-deficient diets containing a high amount of other AA (Lys-/AA+) than in broilers fed diets containing low (AA-) or adequate (AA) amounts of other AA. This study shows that it is possible to alter the pH of breast meat by changing AA profile over a short period before slaughter, with limited impact on broiler growth and carcass composition. © 2014 Poultry Science Association Inc.
Wang, Q; Yang, X; Leonard, S; Archbold, T; Sullivan, J A; Duncan, A M; Ma, W D L; Bizimungu, B; Murphy, A; Htoo, J K; Fan, M Z
2012-12-01
Whereas dietary fibers are well recognized for nutritional management of human health issues, fiber is also known to be one of the dietary factors potentially affecting digestive use of dietary proteins. As a staple food, potato (Solanum tuberosum) may be a significant dietary fiber source. The objective of this study was to examine effects of dietary supplementation of six potato cultivar-genotype samples that differ in soluble fiber content and two conventional fiber components (i.e., cellulose and guar gum) on the apparent ileal AA digestibility in pigs fed a high-fat basal diet. The basal diet was formulated as a zero-fiber negative control (NC) to contain 41.5% poultry meal, 4% casein, 15% animal fat-oil blend, 2.8% sucrose, 31% corn (Zea mays) starch, 0.50% salt, and 0.40% trace mineral-vitamin supplement with fat contributing to 47% of the dietary GE. The two fiber diets were formulated by respectively diluting the basal diet with 10% guar gum and 10% cellulose at the expense of corn starch. Six other test diets were formulated by including 8.5% guar gum and further diluting the basal diet with 25.1% one of the six cultivar-genotype samples of dehydrated potato tuber powder to contain about 10% total dietary fiber at the expense of corn starch. Eighty-one 25-kg barrows were fitted with a simple T-cannula at the distal ileum and fed the diets according to a completely randomized block design with each block lasting 28 d. Compared with the NC, the ileal digestibility of Ala, Gly, and Pro were decreased (P < 0.05) by 10% guar gum whereas the digestibility of Gly was reduced (P < 0.05) by 10% cellulose. The ileal digestibility of several AA was decreased (P < 0.05) by the test potatoes plus 8.5% guar gum compared with the NC. Our results suggest that dietary inclusion of fiber at 10% from guar gum and cellulose and contributed by potatoes may adversely affect digestive use of dietary protein.
Sommerfeld, V; Schollenberger, M; Kühn, I
2018-01-01
Abstract This study aimed to distinguish between the single and interactive effects of phosphorus (P), calcium (Ca), and phytase on products of phytate degradation, including the disappearance of myo-inositol (MI), P, Ca, and amino acids (AA) in different segments of the digestive tract in broiler chickens. Additionally, all dephosphorylation steps from myo-inositol 1,2,3,4,5,6-hexakis (dihydrogen phosphate) (InsP6) to MI were investigated in the digesta of the terminal ileum. Unsexed Ross 308 broiler chickens were allocated to 56 pens with 19 birds per pen, and assigned to one of 8 dietary treatments. The dietary treatments included diets without (P−, 4.1 g/kg DM) or with (P+, 6.9 g/kg DM) monosodium phosphate supplementation, without (Ca−, 6.2 g/kg DM) or with (Ca+, 10.3 g/kg DM) additional fine limestone supplementation, and without or with 1,500 FTU phytase/kg feed in a factorial design. Adding Ca or P had no effect on InsP6 disappearance in the crop when phytase was added. InsP6 disappearance up to the terminal ileum (P−Ca− 56%) was decreased in P+Ca− (40%), and even more so in P+Ca+ (21%), when no phytase was added. Adding phytase removed all effects of P and Ca (77 to 87%); however, P+Ca+ increased the concentrations of lower InsP esters and reduced free MI in the ileum, even in the presence of phytase. These results indicate that mineral supplements, especially P and Ca combined, reduce the efficacy of endogenous microbial or epithelial phosphatases. Supplementation with phytase increased, while supplementation with Ca decreased the concentration of MI in all segments of the digestive tract and in blood plasma, demonstrating the ability of broilers to fully degrade phytate and absorb released MI. While AA disappearance was not affected by P or Ca, or an interaction among P, Ca, and phytase, it increased with the addition of phytase by 2 to 6%. This demonstrates the potential of the phytase used to increase AA digestibility, likely independent of P and Ca supply. PMID:29325118
Silage or fresh by-product of peach palm as roughage in the feeding of lambs.
dos Santos Cabral, Ícaro; Azevêdo, José Augusto Gomes; de Almeida, Flávio Moreira; Pereira, Luiz Gustavo Ribeiro; de Araújo, Gherman Garcia Leal; Nogueira, Abdon Santos; Souza, Lígia Lins; de Oliveira, Gisele Andrade; de Oliveira Filho, Carlos Alberto Alves
2015-03-01
The objective of this study was to evaluate intake and apparent digestibility of agro-industrial by-product of peach palm in diets for lambs. Twenty castrated, crossbred Santa Ines lambs, with average age of 150 days and body weight of 22.4 ± 3.4 kg, were distributed in a completely randomized design with four experimental diets composed of the following: fresh by-product of peach palm enriched with urea + ammonia sulfate (FU); fresh peach palm by-product + concentrate (FP); silage of peach palm by-product + concentrate (SP); and silage of peach palm by-product enriched with 15% of cornmeal + concentrate (SPC). Intake was recorded daily, and the digestibility coefficients were estimated with the internal marker indigestible acid detergent fiber (iADF). Diet FU resulted in the lowest intake and digestibility of the nutrients evaluated. Animals receiving diet FP showed higher intakes of dry matter (DM), organic matter (OM), crude protein (CP), neutral detergent fiber (NDF), total digestible nutrients (TDN), and digestible energy (DE) in relation to animals fed diets SP and SPC. Diets SP and SPC showed higher coefficients of digestibility of DM, OM, CP, and NDF than diet FP. Diet SP reduced the intakes of DM, OM, ether extract (EE), non-fibrous carbohydrate (NFC), TDN, and DE and the digestibility coefficients of DM, OM, and NFC as compared with diet SPC. Feedlot lambs fed a diet with fresh peach palm by-product + concentrate (diet FP) have higher nutrient intake.
Ebner, Jacqueline H; Labatut, Rodrigo A; Lodge, Jeffrey S; Williamson, Anahita A; Trabold, Thomas A
2016-06-01
Anaerobic digestion of commercial food waste is a promising alternative to landfilling commercial food waste. This study characterized 11 types of commercial food wastes and 12 co-digestion blends. Bio-methane potential, biodegradable fraction, and apparent first-order hydrolysis rate coefficients were reported based upon biochemical methane potential (BMP) assays. Food waste bio-methane potentials ranged from 165 to 496 mL CH4/g VS. Substrates high in lipids or readily degradable carbohydrates showed the highest methane production. Average bio-methane potential observed for co-digested substrates was -5% to +20% that of the bio-methane potential of the individual substrates weighted by VS content. Apparent hydrolysis rate coefficients ranged from 0.19d(-1) to 0.65d(-1). Co-digested substrates showed an accelerated apparent hydrolysis rate relative to the weighted average of individual substrate rates. These results provide a database of key bio-digestion parameters to advance modeling and utilization of commercial food waste in anaerobic digestion. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dry Sliding Tribological Studies of AA6061-B4C-Gr Hybrid Composites
NASA Astrophysics Data System (ADS)
Monikandan, V. V.; Joseph, M. A.; Rajendrakumar, P. K.
2016-10-01
The dry sliding behavior of stir-cast AA6061-10 wt.% B4C composites containing 2.5, 5 and 7.5 wt.% graphite particles was studied as a function of applied load, sliding speed and sliding distance on a pin-on-disk tribotester. The wear rate and friction coefficient increased with increase in applied load and sliding distance. The increase in graphite addition reduced the increase in wear rate and friction coefficient in the sliding speed range 2-2.5 m/s. Scanning electron microscopy of the worn pin revealed a graphite tribolayer, and transmission electron microscopy revealed overlapping deformation bands under 30 N applied load. Upon increasing the applied load to 40 N, welded region with fine crystalline structure was formed due to dynamic recrystallization of AA6061 alloy matrix.
An update on the correlation between the cosmic radiation intensity and the geomagnetic AA index
NASA Technical Reports Server (NTRS)
Shea, M. A.; Smart, D. F.
1985-01-01
A statistical study between the cosmic ray intensity, as observed by a neutron monitor, and of the geomagnetic aa index, as representative of perturbations in the plasma and interplanetary magnetic field in the heliosphere, has been updated to specifically exclude time periods around the reversal of the solar magnetic field. The results of this study show a strong negative correlation for the period 1960 through 1968 with a correlation coefficient of approximately -0.86. However, there is essentially no correlation between the cosmic ray intensity and the aa index for the period 1972-1979 (i.e. correlation coefficient less than 0.16). These results would appear to support the theory of preferential particle propagation into the heliosphere vis the ecliptic during the period 1960-1968 and via the solar polar regions during 1972-1979.
Brandao, V L N; Dai, X; Paula, E M; Silva, L G; Marcondes, M I; Shenkoru, T; Poulson, S R; Faciola, A P
2018-06-01
Camelina is a drought- and salt-tolerant oil seed, which in total ether extract (EE) contains up to 74% polyunsaturated fatty acids. The objective of this study was to assess the effects of replacing calcium salts of palm oil (Megalac, Church & Dwight Co. Inc., Princeton, NJ) with camelina seed (CS) on ruminal fermentation, digestion, and flows of fatty acids (FA) and AA in a dual-flow continuous culture system when supplemented at 5 or 8% dietary EE. Diets were randomly assigned to 8 fermentors in a 2 × 2 factorial arrangement of treatments in a replicated 4 × 4 Latin square design, with four 10-d experimental periods consisting of 7 d for diet adaptation and 3 d for sample collection. Treatments were (1) calcium salts of palm oil supplementation at 5% EE (MEG5); (2) calcium salts of palm oil supplementation at 8% EE (MEG8); (3) 7.7% CS supplementation at 5% EE (CS5); and (4) 17.7% CS supplementation at 8% EE (CS8). Diets contained 55% orchardgrass hay, and fermentors were fed 72 g of dry matter/d. On d 8, 9, and 10 of each period, digesta effluent samples were taken for ruminal NH 3 , volatile fatty acids, nitrogen metabolism analysis, and long-chain FA and AA flows. Statistical analysis was performed using the MIXED procedure (SAS Institute Inc., Cary, NC). We detected an interaction between FA source and dietary EE level for acetate, where MEG8 had the greatest molar proportion of acetate. Molar proportions of propionate were greater and total volatile fatty acids were lower on CS diets. Supplementation of CS decreased overall ruminal nutrient true digestibility, but dietary EE level did not affect it. Diets containing CS had greater biohydrogenation of 18:2 and 18:3; however, biohydrogenation of 18:1 was greater in MEG diets. Additionally, CS diets had greater ruminal concentrations of trans-10/11 18:1 and cis-9,trans-11 conjugated linoleic acid. Dietary EE level at 8% negatively affected flows of NH 3 -N (g/d), nonammonia N, and bacterial N as well as the overall AA outflow. However, treatments had minor effects on individual ruminal AA digestibility. The shift from acetate to propionate observed on diets containing CS may be advantageous from an energetic standpoint. Moreover, CS diets had greater ruminal outflow of trans-10/11 18:1 and cis-9,trans-11 conjugated linoleic acid than MEG diets, suggesting a better FA profile available for postruminal absorption. However, dietary EE at 8% was deleterious to overall N metabolism and AA outflow, indicating that CS can be fed at 5% EE without compromising N metabolism. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
A 100-Year Review: Protein and amino acid nutrition in dairy cows.
Schwab, Charles G; Broderick, Glen A
2017-12-01
Considerable progress has been made in understanding the protein and amino acid (AA) nutrition of dairy cows. The chemistry of feed crude protein (CP) appears to be well understood, as is the mechanism of ruminal protein degradation by rumen bacteria and protozoa. It has been shown that ammonia released from AA degradation in the rumen is used for bacterial protein formation and that urea can be a useful N supplement when lower protein diets are fed. It is now well documented that adequate rumen ammonia levels must be maintained for maximal synthesis of microbial protein and that a deficiency of rumen-degradable protein can decrease microbial protein synthesis, fiber digestibility, and feed intake. Rumen-synthesized microbial protein accounts for most of the CP flowing to the small intestine and is considered a high-quality protein for dairy cows because of apparent high digestibility and good AA composition. Much attention has been given to evaluating different methods to quantify ruminal protein degradation and escape and for measuring ruminal outflows of microbial protein and rumen-undegraded feed protein. The methods and accompanying results are used to determine the nutritional value of protein supplements and to develop nutritional models and evaluate their predictive ability. Lysine, methionine, and histidine have been identified most often as the most-limiting amino acids, with rumen-protected forms of lysine and methionine available for ration supplementation. Guidelines for protein feeding have evolved from simple feeding standards for dietary CP to more complex nutrition models that are designed to predict supplies and requirements for rumen ammonia and peptides and intestinally absorbable AA. The industry awaits more robust and mechanistic models for predicting supplies and requirements of rumen-available N and absorbed AA. Such models will be useful in allowing for feeding lower protein diets and increased efficiency of microbial protein synthesis. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Rodriguez-Ramiro, Ildefonso; Perfecto, Antonio; Fairweather-Tait, Susan J.
2017-01-01
Iron deficiency is a major public health concern and nutritional approaches are required to reduce its prevalence. The aim of this study was to examine the iron bioavailability of a novel home fortificant, the “Lucky Iron Fish™” (LIF) (www.luckyironfish.com/shop, Guelph, Canada) and the impact of dietary factors and a food matrix on iron uptake from LIF in Caco-2 cells. LIF released a substantial quantity of iron (about 1.2 mM) at pH 2 but this iron was only slightly soluble at pH 7 and not taken up by cells. The addition of ascorbic acid (AA) maintained the solubility of iron released from LIF (LIF-iron) at pH 7 and facilitated iron uptake by the cells in a concentration-dependent manner. In vitro digestion of LIF-iron in the presence of peas increased iron uptake 10-fold. However, the addition of tannic acid to the digestion reduced the cellular iron uptake 7.5-fold. Additionally, LIF-iron induced an overproduction of reactive oxygen species (ROS), similar to ferrous sulfate, but this effect was counteracted by the addition of AA. Overall, our data illustrate the major influence of dietary factors on iron solubility and bioavailability from LIF, and demonstrate that the addition of AA enhances iron uptake and reduces ROS in the intestinal lumen. PMID:28895913
Gunawardena, C K; Zijlstra, R T; Beltranena, E
2010-02-01
Most pulse (nonoilseed legume) seed flours can be fractionated rapidly and economically by air classification into protein and starch concentrates. The nutritional value of air-classified field pea and faba bean concentrates requires characterization to assess the feeding opportunity for pigs. Thus, the objectives were to characterize the apparent total tract digestibility (ATTD) of DM, OM, energy, starch, CP, fat, and ash; apparent ileal digestibility of CP and starch; standardized ileal digestibility (SID) of AA; and the SID AA, DE, and NE content of air-classified zero-tannin faba bean and field pea protein and starch concentrates in grower pigs. Pulse protein and starch concentrates were compared with soy protein concentrate and corn starch, respectively, as corresponding standards. The corn starch diet served as an N-free diet to correct for basal endogenous AA losses. In a Youden square design, 8 ileal-cannulated barrows (24.9 +/- 2.3 kg of BW) were fed 6 diets over 7 periods at 3 times the maintenance DE requirement. Periods encompassed a 5-d diet acclimation, 3-d feces collection, and 3-d ileal digesta collection. The ATTD of GE was 2% greater (P < 0.05) for faba bean than soy and was intermediate for field pea protein (95.6, 93.7, and 94.9%, respectively). The ATTD of GE was 3.6% greater (P < 0.05) for corn and field pea than faba bean starch (96.2, 95.1, and 92.3%, respectively). The DE content of faba bean was 5.0% greater (P < 0.05) than for field pea or soy protein (4.47, 4.23, and 4.26 Mcal/kg, respectively). The DE content of faba bean and field pea was 1.7% greater (P < 0.05) than for corn starch (3.72, 3.77, and 3.68 Mcal/kg, respectively). The NE content was 5% greater (P < 0.05) for faba bean than field pea and soy protein (3.08, 2.94, and 2.92 Mcal/kg, respectively). The NE content for field pea starch was 2.0% greater (P < 0.05) than for corn starch and faba bean starch (2.68, 2.63, and 2.61 Mcal/kg, respectively). Protein concentrates had a 14 and 11% greater (P < 0.05) DE and NE content, respectively, than starch concentrates. The SID of Lys was 6.0% greater (P < 0.05) for faba bean and field pea protein than soy protein (95.5, 92.6, and 88.7%, respectively). The SID of Lys was 6.0% greater (P < 0.05) for faba bean than field pea starch. Nutrient digestibility and digestible nutrient profiles indicated that air-classified fractions of zero-tannin faba bean and field pea constitute concentrated sources of AA and energy for pigs with high nutritional demands.
Measurement of true ileal digestibility of phosphorus in some feed ingredients for broiler chickens.
Mutucumarana, R K; Ravindran, V; Ravindran, G; Cowieson, A J
2014-12-01
An experiment was conducted to estimate the true ileal digestibility of P in wheat, sorghum, soybean meal, and corn distiller's dried grains with solubles (DDGS) in broiler chickens. Four semipurified diets were formulated from each ingredient (wheat and sorghum: 236.5, 473, 709.5, and 946 g/kg; soybean meal and corn DDGS: 135, 270, 405, and 540 g/kg) to contain graded concentrations of nonphytate P. The experiment was conducted as a randomized complete block design with 4 weight blocks of 16 cages each (5 birds per cage). A total of 320 21-d-old broilers (Ross 308) were assigned to the 16 test diets with 4 replicates per diet. Apparent ileal digestibility coefficients of P were determined by the indicator method and the linear regression method was used to determine the true P digestibility coefficients. The results showed that the apparent ileal P digestibility coefficients of wheat-based diets were not influenced (P>0.05) by increasing dietary P concentrations, whereas those of diets based on sorghum, soybean meal, and corn DDGS differed (P<0.05) at different P concentrations. Apparent ileal P digestibility in broilers fed diets with soybean meal and corn DDGS linearly (P<0.001) increased with increasing P concentrations. True ileal P digestibility coefficients of wheat, sorghum, soybean meal, and corn DDGS were determined to be 0.464, 0.331, 0.798, and 0.727, respectively. Ileal endogenous P losses in birds fed diets with wheat, soybean meal, and corn DDGS were estimated to be 0.080, 0.609, and 0.418 g/kg DMI, respectively. In birds fed sorghum-based diets, endogenous P losses were estimated to be negative (-0.087 g/kg DMI). True digestible P contents of wheat, sorghum, soybean meal, and corn DDGS were determined to be 1.49, 0.78, 5.16, and 5.94 g/kg, respectively. The corresponding nonphytate P contents in wheat, sorghum, soybean meal, and corn DDGS were 1.11, 0.55, 2.15, and 4.36 g/kg, respectively. These differences between digestible P and nonphytate P contents may be suggestive, at least in part, of overestimation of P digestibility under the calcium-deficient conditions used in the regression method.
Luo, Min; Zhang, Xin; Sun, Wen Juan; Jiao, Ning; Li, De Fa; Yin, Jing Dong
2016-01-01
Dietary protein restriction is not only beneficial to health and longevity in humans, but also protects against air pollution and minimizes feeding cost in livestock production. However, its impact on amino acid (AA) absorption and metabolism is not quite understood. Therefore, the study aimed to explore the effect of protein restriction on nitrogen balance, circulating AA pool size, and AA absorption using a pig model. In Exp.1, 72 gilts weighting 29.9 ± 1.5 kg were allocated to 1 of the 3 diets containing 14, 16, or 18% CP for a 28-d trial. Growth (n = 24), nitrogen balance (n = 6), and the expression of small intestinal AA and peptide transporters (n = 6) were evaluated. In Exp.2, 12 barrows weighting 22.7 ± 1.3 kg were surgically fitted with catheters in the portal and jejunal veins as well as the carotid artery and assigned to a diet containing 14 or 18% CP. A series of blood samples were collected before and after feeding for determining the pool size of circulating AA and AA absorption in the portal vein, respectively. Protein restriction did not sacrifice body weight gain and protein retention, since nitrogen digestibility was increased as dietary protein content reduced. However, the pool size of circulating AA except for lysine and threonine, and most AA flux through the portal vein were reduced in pigs fed the low protein diet. Meanwhile, the expression of peptide transporter 1 (PepT-1) was stimulated, but the expression of the neutral and cationic AA transporter systems was depressed. These results evidenced that protein restriction with essential AA-balanced diets, decreased AA absorption and reduced circulating AA pool size. Increased expression of small intestinal peptide transporter PepT-1 could not compensate for the depressed expression of jejunal AA transporters for AA absorption. PMID:27611307
Mathews, Susan A; Oliver, William T; Phillips, Oulayvanh T; Odle, Jack; Diersen-Schade, Deborah A; Harrell, Robert J
2002-10-01
Addition of arachidonic acid (AA) and docosahexaenoic acid (DHA) to infant formula promotes visual and neural development. This study was designed to determine whether the source of dietary long-chain polyunsaturated fatty acids (LCPUFA) affected overall animal health and safety. Piglets consumed ad libitum from 1 to 16 d of age a skim milk-based formula with different fat sources added to provide 50% of the metabolizable energy. Treatment groups were as follows: control (CNTL; no added LCPUFA), egg phospholipid (PL), algal/fungal triglyceride (TG) oils, TG plus PL (soy lecithin source) added to match phospholipid treatment (TG + PL) and essential fatty acid deficient (EFAD). Formulas with LCPUFA provided 0.6 and 0.3 g/100 g total fatty acids as AA and DHA, respectively. CNTL piglets had 40% longer ileal villi than PL piglets (P < 0.03), but the TG group was not different from the CNTL group. Gross liver histology did not differ among any of the formula-fed groups (P > 0.1). Apparent dry matter digestibility was 10% greater in CNTL, TG and TG + PL groups compared with PL piglets (P < 0.002). No differences in alanine aminotransferase were detected among treatments, but aspartate aminotransferase was elevated (P < 0.03) in PL piglets compared with TG + PL piglets. Total plasma AA concentration was greater in the TG group compared with CNTL piglets (P < 0.05). Total plasma DHA concentrations were greater in TG piglets compared with PL (P < 0.06) or CNTL (P < 0.02) piglets. These data demonstrate that the algal/fungal TG sources of DHA and AA may be a more appropriate supplement for infant formulas than the egg PL source based on piglet plasma fatty acid profiles and apparent dry matter digestibilities.
Carbon dioxide emissions from agricultural soils amended with livestock-derived organic materials
NASA Astrophysics Data System (ADS)
Pezzolla, D.; Said-Pullicino, D.; Gigliotti, G.
2009-04-01
Carbon dioxide gas xchange between terrestrial ecosystems and the atmosphere, as well as the carbon sink strength of various arable land ecosystems, is of primary interest for global change research. Measures for increasing soil C inputs include the preferential use of livestock-derived organic materials (e.g. animal manure and slurries, digestate from biogas production plants and compost). The application of such materials to agricultural soils returns essential nutrients for plant growth and organic matter to maintain long-term fertility. Whether or not such practices ultimately result in sustained C sequestration at the ecosystem level will depend on their mineralization rates. This work presents preliminary results from a laboratory incubation trial to evaluate carbon dioxide fluxes from two agricultural soils (a calcareous silt loam and a silty clay loam) amended with agricultural doses of (i) pig slurry (PSL), (ii) the digestate from the anaerobic fermentation of pig slurries (AAS) and (ii) a compost from the aerobic stabilisation of the digestate (LDC). These subsequent steps of slurry stabilisation resulted in a decrease in the content of labile organic matter which was reflected in a reduction in maximum carbon dioxide emission rates from amended soils. Measurements have shown that peak emissions from soils occur immediately after application of these organic materials (within 5 days) and decrease in the order PSL > AAS > LDC. Moreover, mean cumulative emissions over the first 40 days showed that a higher percentage (about 44%) of the C added with PSL was mineralised respect to C added with AAS (39%) and LDC (25%). Although it was hypothesised that apart from the quantity and stability of the added organic materials, even soil characteristics could influence C mineralisation rates, no significant differences were observed between emission fluxes for similarly treated soils. Mean cumulative emission fluxes after 40 days from treatment were of 114, 103 and 84 g C m-2 for PSL, AAS and LDC respectively. Carbon dioxide emission rates were corroborated with results obtained from the quantification of water-extractable organic C (WEOC) and soil microbial biomass-C (Cmic). The former represents the more labile fraction of soil organic matter and its concentration in the freshly amended soils followed the order LDC > AAS ≈ PSL. However, whereas WEOC concentrations decrease rapidly for PSL and LDC amended soils, AAS treated soils showed a steady increase during the first 20 days of incubation followed by a decrease thereafter. This was attributed to the release of soluble organic matter from the anaerobically stabilised digestate in the presence of an aerobic soil microbial community. Irrespective of the type of amendment, Cmic values increased with time with respect to the unamended controls, reaching highest values after 20 days from amendment and decreasing thereafter. Even after 40 days of incubation, Cmic values in all amended soils did not return to the background values obtained with unamended controls. These results suggest that the application of stabilised livestock-derived organic materials to soils may play an important role in reducing C emissions associated with agricultural practices and increase soil C stocks, apart from other indirect beneficial effects such as the recovery of energy from combustion of biogas from anaerobic fermentation of these waste materials.
Dabeka, R W; McKenzie, A D; Albert, R H
1985-01-01
Twenty-six collaborators participated in a study to evaluate an atomic absorption spectrophotometric (AAS) method for the determination of tin in canned foods. The 5 foods evaluated were meat, pineapple juice, tomato paste, evaporated milk, and green beans, each spiked at 2 levels. The concentration range of tin in the samples was 10-450 micrograms/g, and each level was sent as a blind duplicate. Statistical treatment of results revealed no laboratory outliers and 6 individual or replicate-total outliers, accounting for 3.3% of the data. Repeatability (within-laboratory) coefficient of variation (CVo) ranged from 2.2 to 48%, depending on the tin level and food evaluated. For samples containing greater than or equal to 80 micrograms/g of tin, repeatability CV averaged 5.6% including outliers and 3.7% after their rejection. Overall among-laboratories coefficient of variation (CVx) varied from 3.3 to 58%; at levels greater than or equal to 80 micrograms/g, it averaged 7.3% with outliers and 5.3% after their rejection. Recovery of tin, based on spiking levels, ranged from 100.0 to 112.8% and averaged 105.4%. Detection limit range is 2-10 micrograms/g, and lower quantitation limit is 40 micrograms/g. This method has been adopted official first action.
[Performance comparison of material tests for cadmium and lead in food contact plastics].
Mutsuga, Motoh; Abe, Tomoyuki; Abe, Yutaka; Ishii, Rie; Itoh, Yuko; Ohno, Hiroyuki; Ohno, Yuichiro; Ozaki, Asako; Kakihara, Yoshiteru; Kaneko, Reiko; Kawamura, Yoko; Shibata, Hiroshi; Sekido, Haruko; Sonobe, Hironori; Takasaka, Noriko; Tajima, Yoshiyasu; Tanaka, Aoi; Nomura, Chie; Hikida, Akinori; Matsuyama, Sigetomo; Murakami, Ryo; Yamaguchi, Miku; Wada, Takenari; Watanabe, Kazunari; Akiyama, Hiroshi
2014-01-01
Based on the Japanese Food Sanitation Law, the performances of official and alternative material test methods for cadmium (Cd) and lead (Pb) in food contact plastics were compared. Nineteen laboratories participated to an interlaboratory study, and quantified Cd and Pb in three PVC pellets. in the official method, a sample is digested with H2SO4, taken up in HCl, and evaporated to dryness on a water bath, then measured by atomic absorption spectrometry (AAS) or inductively coupled plasma-optical emission spectrometry (ICP-OES). Statistical treatment revealed that the trueness, repeatability (RSDr) and reproducibility (RSDr) were 86-95%, 3.1-9.4% and 8.6-22.1%, respectively. The values of the performance parameters fulfilled the requirements , and the performances met the test specifications. The combination of evaporation to dryness on a hot plate and measurement by AAS or ICP-OES is applicable as an alternative method. However, the trueness and RSDr were inferior to those of the official method. The performance parameters obtained by using the microwave digestion method (MW method) to prepare test solution were better than those of the official method. Thus, the MW method is available as an alternative method. Induced coupled plasma-mass spectrometry (ICP-MS) is also available as an alternative method. However, it is necessary to ensure complete digestion of the sample.
Aguilera, A; Reis de Souza, T C; Mariscal-Landín, G; Escobar, K; Montaño, S; Bernal, M G
2015-08-01
Apparent ileal digestibility (AID) of diets containing sesame expeller (SE) and soya bean meal (SBM) was determined using 15 piglets (Genetiporc(®)), weaned at 17 ± 0.4 days with average body weight of 6.4 ± 0.7 kg (Fertilis 20 × G Performance, Genetiporc(®), PIC México, Querétaro, México). Piglets were randomly assigned to three treatments: (i) a reference diet with casein as the sole protein source; (ii) a mixed diet of casein-SE; and (iii) a mixed diet of casein-SBM. The chemical composition of SE and SBM was determined, and AID and standardized ileal digestibility (SID) of crude protein (CP) and amino acids (AAs) were determined for each protein source. SE contained greater quantities of ether extract, neutral detergent fibre, phytic acid, methionine and arginine than SBM. Lysine and proline contents and trypsin inhibitor activity were higher in SBM than in SE. The AID and SID of CP and AA (except for lysine and proline) were similar in SE and SBM. The AID of lysine and proline was higher in SBM than in SE (p < 0.05), and the SID of proline was higher in SE than in SBM (p < 0.05). These findings indicate that SE is an appropriate alternative protein source for early weaned pigs. Journal of Animal Physiology and Animal Nutrition © 2014 Blackwell Verlag GmbH.
Bosch, Jos A; Veerman, Enno C I; de Geus, Eco J; Proctor, Gordon B
2011-05-01
Recent years have seen a growing interest in salivary α-amylase (sAA) as a non-invasive marker for sympathetic nervous system (SNS) activity. Saliva offers many advantages as a biomarker fluid and sAA is one of its most plentiful components. sAA is a digestive enzyme that breaks down starch, which provides a simple means of quantification by measuring its enzymatic activity. This commentary will address a number of common misconceptions and methodological issues that surround the use of sAA as a marker of SNS activity and limit its utility in biobehavioral research. The usefulness of sAA as an SNS marker is undermined by the fact that the parasympathetic nerves also play a significant role in sAA release. Local parasympathetic nerves regulate sAA activity via: (1) α-amylase release from glands that are solely or mainly parasympathetically innervated; (2) via synergistic sympathetic-parasympathetic effects on protein secretion (known as 'augmented secretion'); and (3) via effects on salivary flow rate. Regarding methodology, we discuss why it is problematic: (1) to ignore the contribution of salivary flow rate; (2) to use absorbent materials for saliva collection, and; (3) to stimulate saliva secretion by chewing. While these methodological problems can be addressed by using standardized and timed collection of unstimulated saliva, the physiological regulation of sAA secretion presents less resolvable issues. We conclude that at present there is insufficient support for the use and interpretation of sAA activity as a valid and reliable measure of SNS activity. Copyright © 2011 Elsevier Ltd. All rights reserved.
The role of atomic absorption spectrometry in geochemical exploration
Viets, J.G.; O'Leary, R. M.
1992-01-01
In this paper we briefly describe the principles of atomic absorption spectrometry (AAS) and the basic hardware components necessary to make measurements of analyte concentrations. Then we discuss a variety of methods that have been developed for the introduction of analyte atoms into the light path of the spectrophotometer. This section deals with sample digestion, elimination of interferences, and optimum production of ground-state atoms, all critical considerations when choosing an AAS method. Other critical considerations are cost, speed, simplicity, precision, and applicability of the method to the wide range of materials sampled in geochemical exploration. We cannot attempt to review all of the AAS methods developed for geological materials but instead will restrict our discussion to some of those appropriate for geochemical exploration. Our background and familiarity are reflected in the methods we discuss, and we have no doubt overlooked many good methods. Our discussion should therefore be considered a starting point in finding the right method for the problem, rather than the end of the search. Finally, we discuss the future of AAS relative to other instrumental techniques and the promising new directions for AAS in geochemical exploration. ?? 1992.
Zhang, Xiaoya; Liu, Xutong; Jia, Hongmin; He, Pingli; Mao, Xiangbing; Qiao, Shiyan; Zeng, Xiangfang
2018-03-28
The objective of this study was to investigate whether valine (Val) supplementation in a reduced protein (RP) diet regulates growth performance associated with the changes in plasma amino acids (AAs) profile, metabolism, endocrine, and neural system in piglets. Piglets or piglets with a catheter in the precaval vein were randomly assigned to two treatments, including two RP diets with standardized ileal digestible (SID) Val:Lysine (Lys) ratio of 0.45 and 0.65, respectively. The results indicated that piglets in the higher Val:Lys ratio treatment had higher average daily feed intake (ADFI) ( P < 0.001), average daily gain (ADG) ( P = 0.001), feed conversion ratio (FCR) ( P = 0.004), lower plasma urea nitrogen ( P = 0.032), expression of gastric cholecystokinin (CCK), and hypothalamic pro-opiomelanocortin (POMC). Plasma AAs profiles including postprandial plasma essential AAs (EAAs) profile and in serum, muscle, and liver involved in metabolism of AAs and fatty acids were significantly different between two treatments. In conclusion, Val influenced growth performance associated with metabolism of AAs and fatty acids and both endocrine and neural system in piglets.
Yang, Yong; Wang, Zhongjiang; Wang, Rui; Sui, Xiaonan; Qi, Baokun; Han, Feifei; Li, Yang; Jiang, Lianzhou
2016-01-01
In the present study, in vitro digestibility and structure of soybean protein isolates (SPIs) prepared from five soybean varieties were investigated in simulated gastric fluid (SGF), using FT-IR microspectroscopy and SDS-PAGE. The result indicated that β-conformations were prone to be hydrolyzed by pepsin preferentially and transformed to unordered structure during in vitro digestion, followed by the digestion of α-helix and unordered structure. A negative linear correlation coefficient was found between the β-conformation contents of five SPIs and their in vitro digestibility values. The intensities of the protein bands corresponding to 7S and 11S fractions were decreased and many peptide bands appeared at 11~15 kDa during enzymatic hydrolysis. β-conglycinin was poorly hydrolyzed with pepsin, especially the β-7S subunit. On the other hand, basic polypeptides of glycinin degraded slower than acidic polypeptides and represented a large proportion of the residual protein after digestion. 11S-A3 of all SPIs disappeared after 1 h digestion. Moreover, a significant negative linear correlation coefficient (r = −0.89) was found between the β-7S contents of five SPIs and their in vitro digestibility values. These results are useful for further studies of the functional properties and bioactive properties of these varieties and laid theoretical foundations for the development of the specific functional soy protein isolate. PMID:27298825
Truong, Ha H; Chrystal, Peter V; Moss, Amy F; Selle, Peter H; Liu, Sonia Yun
2017-12-01
A foundation diet, an intermediate blend and a summit diet were formulated with different levels of soyabean meal, casein and crystalline amino acids to compare 'slow' and 'rapid' protein diets. The diets were offered to male Ross 308 chicks from 7 to 28 d post-hatch and assessed parameters included growth performance, nutrient utilisation, apparent digestibility coefficients and disappearance rates of starch and protein (N) in four small intestinal segments. Digestibility coefficients and disappearance rates of sixteen amino acids in three small intestinal segments and amino acid concentrations in plasma from portal and systemic circulations from the foundation and summit diets were determined. The dietary transition significantly accelerated protein (N) disappearance rates in the distal jejunum and ileum. The transition from foundation to summit diets significantly increased starch digestibility coefficients in the ileum and disappearance rates in all four small intestinal segments. These starch responses were associated with significant enhancements in nutrient utilisation. The dietary transition linearly increased digestibility coefficients and disappearance rates of amino acids in the majority of cases. The summit diet increased plasma concentrations of five amino acids but decreased those of four amino acids relative to the foundation diet to significant extents. Plasma concentrations of free amino acids were higher in the portal than systemic circulations. Rapid protein disappearance rates advantaged poultry performance and influenced post-enteral availability of amino acids. If the underlying mechanisms are to be identified, further research into the impact of protein digestive dynamics on broiler performance is required but appears justified.
In vitro digestibility and physicochemical properties of milled rice.
Dhital, Sushil; Dabit, Laura; Zhang, Bin; Flanagan, Bernadine; Shrestha, Ashok K
2015-04-01
Rice is a staple diet as well as a major ingredient in many processed foods. The physicochemical and supra-molecular structure of eight rice varieties with amylose content from 9% to 19% were studied to elucidate the factors responsible for variation in enzymatic digestibility of raw and cooked rice. Parboiled rice had a digestion rate coefficient almost 4.5 times higher than the least digestible Low GI rice. The rate coefficient was found to be independent of helical structure and long range molecular order, possibly attributed to the effect of rice flour architecture. Strong swelling and pasting behaviour and lower gelatinisation temperature were linked with apparently higher in vitro digestibility but the relationship was statistically insignificant. It is concluded that the enzymatic susceptibility of rice flours are independent of supra-molecular structure and are most likely controlled by external factors not limited to particle size, presence of intact cell wall and other non-starch polymers. Copyright © 2014 Elsevier Ltd. All rights reserved.
Chamorro, S; Viveros, A; Centeno, C; Romero, C; Arija, I; Brenes, A
2013-04-01
Polyphenols are chemically and biologically active compounds. Grape seed extracts (GSEs) have been widely used as a human food supplement for health promotion and disease prevention. However, there is little information regarding its application in animal feeds. An experiment was conducted to investigate the effect of inclusion of GSE at 0.025, 0.25, 2.5 and 5.0 g/kg in a wheat soya bean control diet on growth performance, protein and amino acid (AA) digestibility and plasma lipid and mineral concentrations in broiler chickens at 21 days of age. Performance was not affected by dietary treatment except in the case of birds fed the diet with the highest GSE concentration, which showed a worsening of weight gain and feed conversion. Apparent ileal digestibility (AID) of protein was significantly reduced in the birds fed the highest concentration of GSE, which also had a reduction on the AID of arginine, histidine, phenylalanine, cystine, glutamic acid and proline compared with those fed control diet. The inclusion of graded concentration of GSE in the chicken diets caused a significant linear decrease in the concentrations of plasma copper, iron and zinc. Plasma cholesterol, triglycerides and lipoproteins (high-density lipoprotein, low-density lipoprotein and very-low-density lipoprotein) concentrations were not affected by dietary GSE. In conclusion, this study demonstrated that incorporation of GSE in chicken diets up to 2.5 g/kg had no adverse effect on growth performance or protein and AA digestibility. Feed conversion was reduced and growth rate was retarded, when chickens were fed 5 g/kg of GSE. This study also indicated that grape polyphenols reduce the free plasma minerals.
The effects of vertical motion on the performance of current meters
Thibodeaux, K.G.; Futrell, J. C.
1987-01-01
A series of tests to determine the correction coefficients for Price type AA and Price type OAA current meters, when subjected to vertical motion in a towing tank, have been conducted. During these tests, the meters were subjected to vertical travel that ranged from 1.0 to 4.0 ft and vertical rates of travel that ranged from 0.33 to 1.20 ft/sec while being towed through the water at speeds ranging from 0 to 8 ft/sec. The tests show that type AA and type OAA current meters are affected adversely by the rate of vertical motion and the distance of vertical travel. In addition, the tests indicate that when current meters are moved vertically, correction coefficients must be applied to the observed meter velocities to correct for the registration errors that are induced by the vertical motion. The type OAA current meter under-registers and the type AA current meter over-registers in observed meter velocity. These coefficients for the type OAA current meter range from 0.99 to 1.49 and for the type AA current meter range from 0.33 to 1.07. When making current meter measurements from a boat or a cableway, errors in observed current meter velocity will occur when the bobbing of a boat or cableway places the current meter into vertical motion. These errors will be significant when flowing water is < 2 ft/sec and the rate of vertical motion is > 0.3 ft/sec. (Author 's abstract)
Comparison of soil pollution concentrations determined using AAS and portable XRF techniques.
Radu, Tanja; Diamond, Dermot
2009-11-15
Past mining activities in the area of Silvermines, Ireland, have resulted in heavily polluted soils. The possibility of spreading pollution to the surrounding areas through dust blow-offs poses a potential threat for the local communities. Conventional environmental soil and dust analysis techniques are very slow and laborious and consequently there is a need for fast and accurate analytical methods, which can provide real-time in situ pollution mapping. Laboratory-based aqua regia acid digestion of the soil samples collected in the area followed by the atomic absorption spectrophotometry (AAS) analysis confirmed very high pollution, especially by Pb, As, Cu, and Zn. In parallel, samples were analyzed using portable X-ray fluorescence radioisotope and miniature tube powered (XRF) NITON instruments and their performance was compared. Overall, the portable XRF instrument gave excellent correlation with the laboratory-based reference AAS method.
Cyclooxygenase and lipoxygenase-like activity in Drosophila melanogaster.
Pagés, M; Roselló, J; Casas, J; Gelpí, E; Gualde, N; Rigaud, M
1986-11-01
To determine the possible activity of cyclooxygenase and lipoxygenase like enzymes in Drosophila melanogaster, we have investigated whether fly homogenates can biosynthesize prostaglandins and HETEs. Incubation of fly extracts with AA yields a mixture of 15- 12- 9- and 8-HETE as detected by selected ion monitoring GC-MS. Also the combination of HPLC-RIA using a PGE antibody shows the presence of endogenous PGE2 immunoreactivity in the extracts (405 pg/g in males and 165 pg/g in females). We have also detected the presence of lipoxygenase like immunoreactivity in the reproductive male system by using immunocytochemical techniques in whole body sections of the fly as well as reactivity in the digestive system of both males and females. Finally, we have not been able to detect endogenous AA in the fly by GC-MS methods. However, estimates by GC-MS of the total body fatty acids indicate substantial amounts of potential AA precursors.
Adedokun, S A; Pescatore, A J; Ford, M J; Jacob, J P; Helmbrecht, A
2017-09-01
The effect of dietary electrolyte balance (DEB), energy source (ES), and length of feeding of nitrogen-free diet (NFD) on ileal endogenous amino acid (EAA) loss in mg/kg dry matter intake (DMI) was evaluated in broiler chickens. In Experiment 1, 720 chickens consisting of 15 replicate cages with 6 chickens/replicate were used. Treatments were arranged in a 2 × 2 × 2 factorial and consisted of 4 NFD with 2 levels (low or high) of DEB and 2 ES [corn starch (CS) or dextrose (DX)], and 2 sampling time-points (diets were fed for either 72 h (d 16 to 19) or 120 h (d 16 to 21). Experiment 2 used 360 chickens in a 2 × 2 factorial arrangement of treatments with 2 levels (low or high) of DEB and 2 ES (CS or DX). Diets were fed for 72 h (d 18 to 21). All birds had access to feed and water on an ad libitum basis. Data were analyzed using the GLM procedure of SAS appropriate for a completely randomized design for a factorial arrangement of treatments. For Experiment 1, there were interactions (P < 0.05) between the 3 main factors for nitrogen and all the AA except Trp. Broilers that were fed DX-based NFD with high DEB for 72 h had the highest (P < 0.05) EAA losses. In Experiment 2, there was no interaction between DEB and ES except for His and Lys. When ileal EAA losses from birds fed the low DEB, CS-based NFD were used to standardize apparent ileal digestibility values from a previous study, there was no effect of length of feeding on standardized ileal AA digestibility values. In conclusion, DX-based NFD with high DEB increased endogenous AA loses. Despite differences in ileal EAA losses from CS-based NFD, standardized ileal AA digestibility values were not influenced by the length of feeding of NFD. Based on the results from these studies, NFD could be fed for 72 h without influencing SIAAD values. © 2017 Poultry Science Association Inc.
Liu, Y; Song, M; Maison, T; Stein, H H
2014-10-01
Two experiments were conducted to determine DE and ME and the apparent ileal digestibility (AID) and the standardized ileal digestibility (SID) of CP and AA in 4 sources of canola meal (high-protein [CM-HP], high-temperature-processed [CM-HT], low-temperature-processed [CM-LT], and conventional [CM-CV] canola meal) and in conventional soybean meal (SBM) fed to growing pigs. In Exp. 1, 48 growing barrows (initial BW: 39.7 ± 1.58 kg) were individually housed in metabolism cages and randomly assigned to 6 treatments in a randomized complete block design with 2 blocks of 24 pigs and 8 replicate pigs per treatment. The 6 diets included a corn-based basal diet and 5 diets that were formulated by mixing corn and 1 of the sources of canola meal (39.0% inclusion) or SBM (28.5% inclusion). Feces and urine were collected for 5 d following a 5-d adaptation period. The DE and ME in each source of canola meal and in SBM were calculated using the difference procedure. The DE and ME in the 4 sources of canola meal were less (P < 0.05) than in corn and SBM (DE: 2,854, 2,680, 2,892, and 2,883 vs. 3,324 and 3,784 kcal/kg, respectively; ME: 2,540, 2,251, 2,681, and 2,637 vs. 3,213 and 3,523 kcal/kg, respectively). No differences in the concentrations of DE and ME were observed among the 4 sources of canola meal. In Exp. 2, 12 growing barrows (initial BW: 34.0 ± 1.41 kg) that had a T-cannula installed in the distal ileum were randomly allotted to a repeated 6 × 6 Latin square design with 6 diets and 6 periods in each square. Five diets that contained 35% SBM or 45% of 1 of the 4 sources of canola meal as the sole source of CP and AA were formulated, and a N-free diet was also used. Each period lasted 7 d and ileal digesta were collected on d 6 and 7 of each period. The AID and SID of CP and all AA in SBM were greater (P < 0.05) than in the 4 sources of canola meal. Compared with CM-CV, CM-HP had greater (P < 0.05) AID of Ile, Lys, Asp, Cys, and Pro and greater (P < 0.05) SID of Lys and Cys. However, no differences between CM-HT and CM-LT were observed. In conclusion, regardless of the concentration of CP and the processing used, canola meal provides less DE and ME to pigs than corn and SBM, and the SID of AA in canola meal is less than in SBM. The processing temperature used in this experiment did not affect DE and ME or SID of AA in canola meal. The SID of Lys and Cys was greater in CM-HP than in CM-CV.
NASA Astrophysics Data System (ADS)
Nugraha, W. C.; Elishian, C.; Ketrin, R.
2017-03-01
Fish containing arsenic compound is one of the important indicators of arsenic contamination in water monitoring. The high level of arsenic in fish is due to absorption through food chain and accumulated in their habitat. Hydride generation (HG) coupled with atomic absorption spectrometric (AAS) detection is one of the most popular techniques employed for arsenic determination in a variety of matrices including fish. This study aimed to develop a method for the determination of total arsenic in fish by HG-AAS. The method for sample preparation from American of Analytical Chemistry (AOAC) Method 999.10-2005 was adopted for acid digestion using microwave digestion system and AOAC Method 986.15 - 2005 for dry ashing. The method was developed and validated using Certified Reference Material DORM 3 Fish Protein for trace metals for ensuring the accuracy and the traceability of the results. The sources of uncertainty of the method were also evaluated. By using the method, it was found that the total arsenic concentration in the fish was 45.6 ± 1.22 mg.Kg-1 with a coverage factor of equal to 2 at 95% of confidence level. Evaluation of uncertainty was highly influenced by the calibration curve. This result was also traceable to International Standard System through analysis of Certified Reference Material DORM 3 with 97.5% of recovery. In summary, it showed that method of preparation and HG-AAS technique for total arsenic determination in fish were valid and reliable.
Toward the Clonotype Analysis of Alopecia Areata-Specific, Intralesional Human CD8+ T Lymphocytes.
Bertolini, Marta; Uchida, Youhei; Paus, Ralf
2015-11-01
Alopecia areata (AA) is an organ-restricted autoimmune disease that mainly affects the hair follicle (HF). Several findings support a key primary effector role of CD8+ T cells in the disease pathogenesis. Autoreactive CD8+ T cells are not only present in the characteristic peribulbar inflammatory cell infiltrate of lesional AA HFs but are also found to be infiltrating in lesional HF epithelium where they are thought to recognize major histocompatibility complex class I-presented (auto-)antigens. However, the latter still remain unidentified. Therefore, one key aim in AA research is to identify the clonotypes of autoaggressive, intralesional CD8+ T cells. Therapeutically, this is important (a) so that these lymphocytes can be selectively eliminated or inhibited, (b) to identify the-as yet elusive-key (auto-)antigens in AA, and/or (c) to induce peripheral tolerance against the latter. Therefore, we have recently embarked on a National Alopecia Areata Foundation-supported project that attempts to isolate disease-specific, intralesional CD8+ T cells from AA skin in order to determine their TCR clonotype, using two complementary strategies. The first method is based on the enzymatic skin digestion from lesional AA skin, followed by either MACS technology and single-cell picking or FACS cell sorting, while the second method on laser microdissection. The identification of disease-specific TCRs can serve as a basis for specific AA immunotherapy along the lines sketched above and may possibly also provide prognostic biomarkers. If successful, this research strategy promises to permit, at long last, the causal therapy of AA.
Reliability and Accuracy of Static Parameters Obtained From Ink and Pressure Platform Footprints.
Zuil-Escobar, Juan Carlos; Martínez-Cepa, Carmen Belén; Martín-Urrialde, Jose Antonio; Gómez-Conesa, Antonia
2016-09-01
The purpose of this study was to evaluate the accuracy and the intrarater reliability of arch angle (AA), Staheli Index (SI), and Chippaux-Smirak Index (CSI) obtained from ink and pressure platform footprints. We obtained AA, SI, and CSI measurements from ink pedigraph footprints and pressure platform footprints in 40 healthy participants (aged 25.65 ± 5.187 years). Intrarater reliability was calculated for all parameters obtained using the 2 methods. Standard error of measurement and minimal detectable change were also calculated. A repeated-measure analysis of variance was used to identify differences between ink and pressure platform footprints. Intraclass correlation coefficient and Bland and Altman plots were used to assess similar parameters obtained using different methods. Intrarater reliability was >0.9 for all parameters and was slightly higher for the ink footprints. No statistical difference was reported in repeated-measure analysis of variance for any of the parameters. Intraclass correlation coefficient values from AA, SI, and CSI that were obtained using ink footprints and pressure platform footprints were excellent, ranging from 0.797 to 0.829. However, pressure platform overestimated AA and underestimated SI and CSI. Our study revealed that AA, SI, and CSI were similar regardless of whether the ink or pressure platform method was used. In addition, the parameters indicated high intrarater reliability and were reproducible. Copyright © 2016. Published by Elsevier Inc.
Canan, Bhaskara; do Nascimento, Wallace Silva; da Silva, Naisandra Bezerra; Chellappa, Sathyabama
2012-01-01
This study investigated the morphohistology of the digestive tract and the mean intestinal coefficient of the damsel fish Stegastes fuscus captured from the tidal pools of Northeastern Brazil. The wall of the digestive tract of S. fuscus is composed of the tunica mucosa, tunica muscularis, and tunica serosa. The esophagus is short with sphincter and thick distensible wall with longitudinally folded mucosa. Mucous glands are predominant, and the muscular layer of the esophagus presented striated fibers all along its extension. The transition region close to the stomach shows plain and striated muscular fibers. Between the stomach and intestine, there are three pyloric caeca. The intestine is long and thin with four folds around the stomach. The anterior intestine presents folds similar to those of pyloric caeca. The estimated mean intestinal coefficient and characteristics of the digestive system of S. fuscus present morphological adequacy for both herbivorous and omnivorous feeding habits. PMID:22547996
Nutritional value of winter foods for whooping cranes
Nelson, J.T.; Slack, R.D.; Gee, G.F.
1996-01-01
We measured metabolizable energy and digestibility of Whooping Crane (Grus americana) winter foods (blue crab [Callinectes sapidus]), common Rangia clam (Rangia cuneata), wolfberry fruit (Lycium carolinianurn [wolfberry]), and live oak acorn (Ouercus virginiana [acorn])] with feeding trials to captive-reared Whooping Cranes. Apparent metabolizable energy coefficients (expressed as %) were for crab (34.1), Rangia clam (75.0), wolfberry (44.8), and acorn (43.2). Digestion coefficients for protein were lower for plant foods (48.9 and 53.4) than for animal foods (69.4 and 75.2). Digestion coefficients for total lipid differed among foods: highest and lowest lipid digestibility was for acorn (87.2) and wolfberry (60.0), respectively. We also determined total energy and percent protein and lipid of the four foods and stout razor clam (Tagelus plebeius); gross energy was 2-5x higher for acorn and wolfberry on a dry-weight basis than for blue crab and stout razor clam. Crude protein was 2-3x higher for blue crab than for wolfberry and stout razor clam. Wolfberry ranked the highest of five foods for metabolic energy and total lipid nutrient availability per kg of food ingested, and blue crab ranked highest for crude protein availability.
Ripken, Dina; van Avesaat, Mark; Troost, Freddy J; Masclee, Ad A; Witkamp, Renger F; Hendriks, Henk F
2017-02-01
Activation of the ileal brake by casein induces satiety signals and reduces energy intake. However, adverse effects of intraileal casein administration have not been studied before. These adverse effects may include impaired amino acid digestion, absorption and immune activation. To investigate the effects of intraileal infusion of native casein on plasma amino acid appearance, immune activation and gastrointestinal (GI) symptoms. A randomized single-blind cross over study was performed in 13 healthy subjects (6 male; mean age 26 ± 2.9 years; mean body mass index 22.8 ± 0.4 kg/m -2 ), who were intubated with a naso-ileal feeding catheter. Thirty minutes after intake of a standardized breakfast, participants received an ileal infusion, containing either control (C) consisting of saline, a low-dose (17.2 kcal) casein (LP) or a high-dose (51.7 kcal) of casein (HP) over a period of 90 min. Blood samples were collected for analysis of amino acids (AAs), C-reactive protein (CRP), pro-inflammatory cytokines and oxylipins at regular intervals. Furthermore, GI symptom questionnaires were collected before, during and after ileal infusion. None of the subjects reported any GI symptoms before, during or after ileal infusion of C, LP and HP. Plasma concentrations of all AAs analyzed were significantly increased after infusion of HP as compared to C (p < 0.001), and most AAs were increased after infusion of LP (p < 0.001). In total, 12.49 ± 1.73 and 3.18 ± 0.87 g AAs were found in plasma after intraileal infusion of HP and LP, corresponding to 93 ± 13% (HP) and 72 ± 20% (LP) of AAs infused as casein, respectively. Ileal casein infusion did not affect plasma concentrations of CRP, IL-6, IL-8, IL-1β and TNF-α. Infusion of HP resulted in a decreased concentration of 11,12-dihydroxyeicosatrienoic acid whereas none of the other oxylipins analyzed were affected. A single intraileal infusion of native casein results in a concentration and time dependent increase of AAs in plasma, suggesting an effective digestion and absorption of AAs present in casein. Also, ileal infusion did not result in immune activation nor in GI symptoms. CLINICALTRIALS.GOV: NCT01509469. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Labarca, Gonzalo; Dreyse, Jorge; Salas, Constanza; Contreras, Andrea; Nazar, Gonzalo; Gaete, Maria I; Jorquera, Jorge
2018-04-07
Home sleep apnea testing (HSAT) is a diagnostic measure for obstructive sleep apnea hypopnea syndrome (OSAHS) in moderate/high risk patients. Some HSAT companies contain automatic analysis (AA). However, guidelines recommend manual analysis (MA) despite the weak evidence for this recommendation. Evaluate the concordance between AA and MA of HSAT to make either a diagnosis and severity classification. We evaluated AA and MA of HSAT between 2015 and 2016. The study was a blind analysis reviewed by two physicians using currents recommendations. The differences between AA and MA were compared with single variable T analysis, inter-scorer agreement for diagnosis was evaluated with Cohen Kappa coefficient, correlation was examined using Tau-b Kendall, and Bland-Altman plot was constructed to analyze differences between AA and MA. One hundred and ninety-eight patients were included. In our study, the mean age was 50 ± 15 years, 83% male, BMI 30 ± 5 and neck circumference 41 ± 4 cm. Eighty-two percent of subjects showed an apnea-hypopnea index (AHI) > 5 ev/h. Thirty-five percent of patients with OSAHS were mild (AHI: 5-15 ev/h), 34% moderate and 31% severe (>30 ev/h). The kappa coefficient between physicians was 1.0 (high), between AA and MA was 0.58 (moderate) for the diagnosis of OSAHS and 0.33 (weak) for severity with 0.70 Tau-b. The AA underestimates the IAH -8 ev/h, (95% CI -9 to -7 ev/h, p < 0.001) and delivers a misclassification of severity by 47%. AA underestimates the rate of respiratory events and alters the classification of the severity of the disease and may modify the therapeutic approach. Copyright © 2018 Elsevier B.V. All rights reserved.
2011-01-01
Batch anaerobic digestion experiments using dairy manure as feedstocks were performed at moderate (25°C), mesophilic (37°C), and thermophilic (52.5°C) temperatures to understand E. coli, an indicator organism for pathogens, inactivation in dairy manure. Incubation periods at 25, 37, and 52.5°C, were 61, 41, and 28 days respectively. Results were used to develop models for predicting E. coli inactivation and survival in anaerobic digestion. For modeling we used the decay of E. coli at each temperature to calculate the first-order inactivation rate coefficients, and these rates were used to formulate the time - temperature - E. coli survival relationships. We found the inactivation rate coefficient at 52.5°C was 17 and 15 times larger than the inactivation rate coefficients at 25 and 37°C, respectively. Decimal reduction times (D10; time to achieve one log removal) at 25, 37, and 52.5°C, were 9 -10, 7 - 8 days, and < 1 day, respectively. The Arrhenius correlation between inactivation rate coefficients and temperatures over the range 25 -52.5°C was developed to understand the impacts of temperature on E. coli inactivation rate. Using this correlation, the time - temperature - E. coli survival relationships were derived. Besides E. coli inactivation, impacts of temperature on biogas production, methane content, pH change, ORP, and solid reduction were also studied. At higher temperatures, biogas production and methane content was greater than that at low temperatures. While at thermophilic temperature pH was increased, at mesophilic and moderate temperatures pH were reduced over the incubation period. These results can be used to understand pathogen inactivation during anaerobic digestion of dairy manure, and impacts of temperatures on performance of anaerobic digesters treating dairy manure. PMID:21906374
Tjernsbekk, M T; Tauson, A-H; Kraugerud, O F; Ahlstrøm, Ø
2017-10-01
Protein quality was evaluated for mechanically separated chicken meat (MSC) and salmon protein hydrolysate (SPH), and for extruded dog foods where MSC or SPH partially replaced poultry meal (PM). Apparent total tract digestibility (ATTD) of crude protein (CP) and amino acids (AA) in the protein ingredients and extruded foods was determined with mink (Neovison vison). The extruded dog foods included a control diet with protein from PM and grain, and two diets where MSC or SPH provided 25% of the dietary CP. Nutrient composition of the protein ingredients varied, dry matter (DM) was 944.0, 358.0 and 597.4 g/kg, CP was 670.7, 421.2 and 868.9 g/kg DM, crude fat was 141.4, 547.8 and 18.5 g/kg DM and ash was 126.4, 32.1 and 107.0 g/kg DM for PM, MSC and SPH respectively. The content of essential AA (g/100 g CP) was more than 10.0 percentage units lower in SPH than in PM and MSC. The ATTD of CP differed (p < 0.001) between protein ingredients and was 80.9%, 88.2% and 91.3% for PM, MSC and SPH respectively. The ATTD of total AA was lowest (p < 0.001) for PM, and similar (p > 0.05) for MSC and SPH. In the extruded diets, the expected higher ATTD of CP and AA from replacement of PM with MSC or SPH was not observed. The ATTD of CP was determined to be 80.3%, 81.3% and 79.0% for the PM, MSC and SPH extruded foods respectively. Furthermore, the ATTD of several AA was numerically highest for the PM diet. Possibly, extrusion affected ATTD of the diets differently due to different properties and previous processing of the three protein ingredients. Journal of Animal Physiology and Animal Nutrition © 2017 Blackwell Verlag GmbH.
Modeling temperature variations in a pilot plant thermophilic anaerobic digester.
Valle-Guadarrama, Salvador; Espinosa-Solares, Teodoro; López-Cruz, Irineo L; Domaschko, Max
2011-05-01
A model that predicts temperature changes in a pilot plant thermophilic anaerobic digester was developed based on fundamental thermodynamic laws. The methodology utilized two simulation strategies. In the first, model equations were solved through a searching routine based on a minimal square optimization criterion, from which the overall heat transfer coefficient values, for both biodigester and heat exchanger, were determined. In the second, the simulation was performed with variable values of these overall coefficients. The prediction with both strategies allowed reproducing experimental data within 5% of the temperature span permitted in the equipment by the system control, which validated the model. The temperature variation was affected by the heterogeneity of the feeding and extraction processes, by the heterogeneity of the digestate recirculation through the heating system and by the lack of a perfect mixing inside the biodigester tank. The use of variable overall heat transfer coefficients improved the temperature change prediction and reduced the effect of a non-ideal performance of the pilot plant modeled.
Kheravii, S K; Swick, R A; Choct, M; Wu, S-B
2018-04-01
Improving diet digestibility is important to the broiler industry. Therefore, this study focused on optimizing the physical structure of feed ingredients and addition of dietary fiber as strategies to improve nutrient digestibility in low and high sodium diets. A total of 672 day-old Ross 308 male broilers was allocated to 48 pens using a 2 × 2 × 2 factorial arrangement of treatments with 2 particle sizes of corn (coarse 3,576 μm or fine 1,113 μm geometric mean diameter), 2 levels of sugarcane bagasse (SB) (0 or 2%), and 2 levels of Na (0.16 or 0.4%). Protein digestibility coefficient was measured using pooled distal ileal digesta of 3 birds per pen on d 24. Meanwhile, starch and gross energy digestibility coefficients were measured using pooled duodenal, distal jejunal, and distal ileal digesta of 3 birds per pen on d 24. Coarsely ground corn (CC) resulted in improved ileal protein digestibility (P < 0.05). Addition of 2% SB increased starch digestibility in the duodenum (P < 0.05), distal jejunum (P < 0.001), and distal ileum (P < 0.001), and increased protein digestibility in distal ileum (P < 0.01). A significant particle size × SB × Na interaction was observed for ileal energy digestibility (P < 0.05). The SB increased ileal energy digestibility only in birds fed the diet with finely ground corn (FC) and 0.16% Na. These findings demonstrate that SB and CC are able to improve nutrient digestibility. It can be recommended for the poultry industry to use SB and coarsely ground corn in feed to improve the utilization of nutrients.
White, Robin R; McGill, Tyler; Garnett, Rebecca; Patterson, Robert J; Hanigan, Mark D
2017-04-01
The objective of this work was to evaluate the precision and accuracy of the milk yield predictions made by the PREP10 model in comparison to those from the National Research Council (NRC) Nutrient Requirements of Dairy Cattle. The PREP10 model is a ration-balancing system that allows protein use efficiency to vary with production level. The model also has advanced AA supply and requirement calculations that enable estimation of AA-allowable milk (Milk AA ) based on 10 essential AA. A literature data set of 374 treatment means was collected and used to quantitatively evaluate the estimates of protein-allowable milk (Milk MP ) and energy-allowable milk yields from the NRC and PREP10 models. The PREP10 Milk AA prediction was also evaluated, as were both models' estimates of milk based on the most-limiting nutrient or the mean of the estimated milk yields. For most milk estimates compared, the PREP10 model had reduced root mean squared prediction error (RMSPE), improved concordance correlation coefficient, and reduced mean and slope bias in comparison to the NRC model. In particular, utilizing the variable protein use efficiency for milk production notably improved the estimate of Milk MP when compared with NRC. The PREP10 Milk MP estimate had an RMSPE of 18.2% (NRC = 25.7%), concordance correlation coefficient of 0.82% (NRC = 0.64), slope bias of -0.14 kg/kg of predicted milk (NRC = -0.34 kg/kg), and mean bias of -0.63 kg (NRC = -2.85 kg). The PREP10 estimate of Milk AA had slightly elevated RMSPE and mean and slope bias when compared with Milk MP . The PREP10 estimate of Milk AA was not advantageous when compared with Milk MP , likely because AA use efficiency for milk was constant whereas MP use was variable. Future work evaluating variable AA use efficiencies for milk production is likely to improve accuracy and precision of models of allowable milk. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Neville, David C A; Coquard, Virginie; Priestman, David A; te Vruchte, Danielle J M; Sillence, Daniel J; Dwek, Raymond A; Platt, Frances M; Butters, Terry D
2004-08-15
Interest in cellular glycosphingolipid (GSL) function has necessitated the development of a rapid and sensitive method to both analyze and characterize the full complement of structures present in various cells and tissues. An optimized method to characterize oligosaccharides released from glycosphingolipids following ceramide glycanase digestion has been developed. The procedure uses the fluorescent compound anthranilic acid (2-aminobenzoic acid; 2-AA) to label oligosaccharides prior to analysis using normal-phase high-performance liquid chromatography. The labeling procedure is rapid, selective, and easy to perform and is based on the published method of Anumula and Dhume [Glycobiology 8 (1998) 685], originally used to analyze N-linked oligosaccharides. It is less time consuming than a previously published 2-aminobenzamide labeling method [Anal. Biochem. 298 (2001) 207] for analyzing GSL-derived oligosaccharides, as the fluorescent labeling is performed on the enzyme reaction mixture. The purification of 2-AA-labeled products has been improved to ensure recovery of oligosaccharides containing one to four monosaccharide units, which was not previously possible using the Anumula and Dhume post-derivatization purification procedure. This new approach may also be used to analyze both N- and O-linked oligosaccharides.
Pavlik, Valory N; Chan, Wenyaw; Hyman, David J; Feldman, Penny; Ogedegbe, Gbenga; Schwartz, Joseph E; McDonald, Margaret; Einhorn, Paula; Tobin, Jonathan N
2015-01-01
African-Americans (AAs) have a high prevalence of hypertension and their blood pressure (BP) control on treatment still lags behind other groups. In 2004, NHLBI funded five projects that aimed to evaluate clinically feasible interventions to effect changes in medical care delivery leading to an increased proportion of AA patients with controlled BP. Three of the groups performed a pooled analysis of trial results to determine: 1) the magnitude of the combined intervention effect; and 2) how the pooled results could inform the methodology for future health-system level BP interventions. Using a cluster randomized design, the trials enrolled AAs with uncontrolled hypertension to test interventions targeting a combination of patient and clinician behaviors. The 12-month Systolic BP (SBP) and Diastolic BP (DBP) effects of intervention or control cluster assignment were assessed using mixed effects longitudinal regression modeling. 2,015 patients representing 352 clusters participated across the three trials. Pooled BP slopes followed a quadratic pattern, with an initial decline, followed by a rise toward baseline, and did not differ significantly between intervention and control clusters: SBP linear coefficient = -2.60±0.21 mmHg per month, p<0.001; quadratic coefficient = 0.167± 0.02 mmHg/month, p<0.001; group by time interaction group by time group x linear time coefficient=0.145 ± 0.293, p=0.622; group x quadratic time coefficient= -0.017 ± 0.026, p=0.525). RESULTS were similar for DBP. The individual sites did not have significant intervention effects when analyzed separately. Investigators planning behavioral trials to improve BP control in health systems serving AAs should plan for small effect sizes and employ a "run-in" period in which BP can be expected to improve in both experimental and control clusters.
African Ancestry Gradient Is Associated with Lower Systemic F2-Isoprostane Levels
Annor, Francis; Okosun, Ike; Gower, Barbara A.
2017-01-01
Context. Low levels of systemic F2-isoprostanes (F2-IsoP) increase the risk of diabetes and weight gain and were found in African Americans. Low F2-IsoPs could reflect an unfavorable metabolic characteristic, namely, slow mitochondrial metabolism in individuals with African ancestry. Objective. To examine differences in plasma F2-IsoPs in three groups with a priori different proportion of African ancestry: non-Hispanic Whites (NHWs), US-born African Americans (AAs), and West African immigrants (WAI). Design. Cross-sectional study. Setting. Georgia residents recruited from church communities. Participants. 218 males and females 25–74 years of age, who are self-identified as NHW (n = 83), AA (n = 56), or WAI (n = 79). Main Outcome Measure(s). Plasma F2-IsoPs quantified by gas chromatography-mass spectrometry. Results. After adjustment for age, gender, obesity, and other comorbidities, WAI had lower levels of plasma F2-IsoP than AA (beta-coefficient = −9.8, p < 0.001) and AA had lower levels than NHW (beta-coefficient = −30.3, p < 0.001). Similarly, among healthy nonobese participants, F2-IsoP levels were lowest among WAI, followed by AA, and the highest levels were among NHW. Conclusion. Plasma F2-IsoPs are inversely associated with African ancestry gradient. Additional studies are required to test whether optimization of systemic F2-IsoP levels can serve as means to improve race-specific lifestyle and pharmacological intervention targeted to obesity prevention and treatment. PMID:28250893
African Ancestry Gradient Is Associated with Lower Systemic F2-Isoprostane Levels.
Annor, Francis; Goodman, Michael; Thyagarajan, Bharat; Okosun, Ike; Doumatey, Ayo; Gower, Barbara A; Il'yasova, Dora
2017-01-01
Context . Low levels of systemic F 2 -isoprostanes (F 2 -IsoP) increase the risk of diabetes and weight gain and were found in African Americans. Low F 2 -IsoPs could reflect an unfavorable metabolic characteristic, namely, slow mitochondrial metabolism in individuals with African ancestry. Objective . To examine differences in plasma F 2 -IsoPs in three groups with a priori different proportion of African ancestry: non-Hispanic Whites (NHWs), US-born African Americans (AAs), and West African immigrants (WAI). Design . Cross-sectional study. Setting . Georgia residents recruited from church communities. Participants . 218 males and females 25-74 years of age, who are self-identified as NHW ( n = 83), AA ( n = 56), or WAI ( n = 79). Main Outcome Measure(s) . Plasma F 2 -IsoPs quantified by gas chromatography-mass spectrometry. Results . After adjustment for age, gender, obesity, and other comorbidities, WAI had lower levels of plasma F 2 -IsoP than AA (beta-coefficient = -9.8, p < 0.001) and AA had lower levels than NHW (beta-coefficient = -30.3, p < 0.001). Similarly, among healthy nonobese participants, F 2 -IsoP levels were lowest among WAI, followed by AA, and the highest levels were among NHW. Conclusion . Plasma F 2 -IsoPs are inversely associated with African ancestry gradient. Additional studies are required to test whether optimization of systemic F 2 -IsoP levels can serve as means to improve race-specific lifestyle and pharmacological intervention targeted to obesity prevention and treatment.
Kinetic modelling of anaerobic hydrolysis of solid wastes, including disintegration processes
DOE Office of Scientific and Technical Information (OSTI.GOV)
García-Gen, Santiago; Sousbie, Philippe; Rangaraj, Ganesh
2015-01-15
Highlights: • Fractionation of solid wastes into readily and slowly biodegradable fractions. • Kinetic coefficients estimation from mono-digestion batch assays. • Validation of kinetic coefficients with a co-digestion continuous experiment. • Simulation of batch and continuous experiments with an ADM1-based model. - Abstract: A methodology to estimate disintegration and hydrolysis kinetic parameters of solid wastes and validate an ADM1-based anaerobic co-digestion model is presented. Kinetic parameters of the model were calibrated from batch reactor experiments treating individually fruit and vegetable wastes (among other residues) following a new protocol for batch tests. In addition, decoupled disintegration kinetics for readily and slowlymore » biodegradable fractions of solid wastes was considered. Calibrated parameters from batch assays of individual substrates were used to validate the model for a semi-continuous co-digestion operation treating simultaneously 5 fruit and vegetable wastes. The semi-continuous experiment was carried out in a lab-scale CSTR reactor for 15 weeks at organic loading rate ranging between 2.0 and 4.7 g VS/L d. The model (built in Matlab/Simulink) fit to a large extent the experimental results in both batch and semi-continuous mode and served as a powerful tool to simulate the digestion or co-digestion of solid wastes.« less
Sommerfeld, V; Künzel, S; Schollenberger, M; Kühn, I
2018-01-01
Abstract The objective of this study was to investigate the effects of supplementation with free myo-inositol (MI) or graded levels of phytase on inositol phosphate (InsP) degradation, concentrations of MI in the digestive tract and blood, bone mineralization, and prececal digestibility of amino acids (AA). Ross 308 broiler hatchlings were allocated to 40 pens with 11 birds each and assigned to one of 5 treatments. The birds were fed a starter diet until d 11 and a grower diet from d 11 to d 22. All diets were based on wheat, soybean meal, and corn. Birds were fed a control diet, calculated to contain adequate levels of all nutrients without (C) or with MI supplementation (C+MI), or one of 3 experimental diets that differed in phytase level (modified E. coli-derived 6-phytase; Phy500, Phy1500, or Phy3000 FTU/kg), with P and Ca levels adapted to the recommendations of the phytase supplier for a phytase level of 500 FTU/kg. The gain:feed ratio (G:F) was increased by MI or phytase in the starter+grower phase by 0.02 g/g. Prececal P and Ca digestibility, P and Ca concentration in blood serum, and tibia ash weight did not differ among treatments (P > 0.05). MI supplementation led to the highest MI concentration in the crop, ileum, and blood plasma across treatments. Phytase supplementation increased MI concentrations in the crop and ileum digesta in a dose-dependent manner and in plasma without any dose effect (P > 0.05). Prececal digestibility of some AA was increased by phytase. These outcomes indicate that MI might have been a relevant cause for the increase in G:F. Therefore, it is likely that the release of MI after complete dephosphorylation of phytate is one of the beneficial effects of phytase, along with the release of P and improvement in digestibility of other nutrients. Simultaneously, MI seems to have no diminishing effects on InsP degradation. PMID:29300969
A Comprehensive Approach to Assess Feathermeal as an Alternative Protein Source in Aquafeed.
Jasour, Mohammad Sedigh; Wagner, Liane; Sundekilde, Ulrik K; Larsen, Bodil K; Greco, Ines; Orlien, Vibeke; Olsen, Karsten; Rasmussen, Hanne T; Hjermitslev, Niels H; Hammershøj, Marianne; Dalsgaard, Anne J T; Dalsgaard, Trine K
2017-12-06
The effect of partially replacing fishmeal in aquafeed with feathermeal (FTH) at three levels (0%: FTH0, 8%: FTH8, 24%: FTH24) and two extrusion temperatures (100 and 130 °C) was evaluated in rainbow trout (Oncorhynchus mykiss) with respect to growth performance, metabolism response, and oxidative status of the feed proteins. Multivariate data analyses revealed that FTH24 correlated positively with high levels of oxidation products, amino acids (AA) racemization, glucogenic AAs level in liver, feed intake (FI), specific growth rate (SGR), and feed conversion ratio (FCR); and low AAs digestibility. Both FI and SGR were significantly increased when 8 and 24% feathermeal was included in the feed extruded at 100 °C, while there was a negative effect on FCR in fish fed FTH24. In conclusion, higher oxidation levels in FTH24 may give rise to metabolic alterations while lower levels of FTH may be considered as fishmeal substitute in aquafeed for rainbow trout.
Carrasco, R; Arrizon, A A; Plascencia, A; Torrentera, N G; Zinn, R A
2013-04-01
Two experiments were conducted to examine the effect of level of dried distillers grains plus solubles (DDGS) supplementation (0, 10, 20, and 30%; DM basis), replacing steam-flaked (SF) corn in finishing diets, on characteristics of digestion (Exp. 1) and growth performance (Exp. 2) in calf-fed Holstein steers. In Exp.1, 4 cannulated Holstein steers (349 ± 12 kg) were used to evaluate treatment effects on characteristics of digestion. Ruminal NDF digestion tended to increase (quadratic effect, P = 0.09) and ruminal OM digestion decreased (linear effect, P = 0.01) with DDGS substitution. There were no treatment effects on duodenal flow of microbial N (MN). Substitution with DDGS increased (linear effect, P < 0.01) N flow to the small intestine. The undegradable intake protein (UIP) value of DDGS was 35%. Postruminal digestion of OM (linear effect, P = 0.04) and fatty acids (linear effect, P = 0.03) and total tract digestion of OM and GE decreased (linear effect, P < 0.03) with increasing level of DDGS substitution. Substitution with DDGS did not affect (P = 0.80) ruminal pH but increased (linear effect, P = 0.01) acetate:propionate molar ratio. In Exp.2, 144 Holsteins steer (112 ± 6 kg) were used in a 305-d trial to evaluate treatment effects on growth performance and carcass characteristics. During the initial 126 d, DDGS substitution increased ADG (linear effect, P = 0.03), G:F (quadratic effect, P = 0.03), and dietary NE (quadratic effect, P = 0.02), maximal for both at 20% DDGS inclusion rate. Based on estimated indispensable AA supply to the small intestine as a percentage of requirements during the initial 126-d period, histidine was first limiting followed by methionine. During the final 179-d period and overall (305-d feeding period), treatment effects on ADG and G:F were small (P ≥ 0.22). Compared with the other treatments, HCW was greater (3.4; P = 0.03) at the 20% level of DDGS substitution. The NE value for DDGS in SF corn-based diets for the calf-fed Holstein are consistent with current tabular standards. Extra-caloric value of DDGS as a metabolizable AA source is apparent during the initial growing phase. The UIP value of DDGS used in this study (35%) was considerably less than current tabular estimates (52%; NRC, 2000).
USDA-ARS?s Scientific Manuscript database
Treated canola meal (TCM) was produced as an attempt to increase the rumen undegradable protein (RUP) fraction of canola meal (CM) with the goal of enhancing amino acid (AA) availability for absorption in the small intestine of dairy cows. The objective of this study was to measure nutrient and micr...
Rémond, Didier; Bernard, Laurence; Chauveau, Béatrice; Nozière, Pierre; Poncet, Claude
2003-05-01
Digestion and portal net flux of nutrients were studied in sheep fed twice daily with fresh orchard-grass. Digestive flows were measured in six fistulated sheep using the double-marker technique. Three sheep were fitted with catheters and blood-flow probes, allowing nutrient net flux measurements across the portal-drained viscera (PDV), the mesenteric-drained viscera (MDV) and the rumen. Total tract apparent digestion of N was similar to portal net appearance of N, calculated as the sum of free amino acids (FAA), peptide amino acids (PAA), NH3, and urea net fluxes. PAA accounted for 25 % of non-protein amino acid net release across the PDV. With the exception of glycine and glutamate, the small intestine was the main contributor to this PAA net release. The essential amino acid (EAA) apparent disappearance between the duodenum and the ileum was lower than the net appearance of EAA (FAA + PAA) across the MDV. The value of PDV:MDV flux of free EAA was, on average, 78 %. The rumen accounted for 30 % of the net uptake of EAA by the PDV tissues not drained by the mesenteric vein. Rumen net release of acetate, propionate, butyrate, 3-hydroxybutyrate, and lactate accounted for 70, 55, 46, 77 and 52 %, respectively, of their portal net releases. Conversely, the small intestine was a net consumer of arterial acetate and 3-hydroxybutyrate. Dynamic study of nutrient net fluxes across the PDV showed that throughout a feeding cycle, the liver faced a constant flux of amino acids (AA), whereas volatile fatty acid and NH3 net fluxes varied in response to the meal. The present study specified, in forage-fed sheep, the partitioning of nutrient net fluxes across the PDV and the role of peptides in portal net release of AA.
Oliveira, C A A; Azevedo, J F; Martins, J A; Barreto, M P; Silva, V P; Julliand, V; Almeida, F Q
2015-01-01
This study was performed to evaluate the impact of dietary protein levels on nutrient digestibility and water and nitrogen balances in conditioning eventing horses. Twenty-four Brazilian Sport Horses, male and female (8.0 to 15.0 yr; 488 ± 32 kg BW), were used in a randomized design with 4 levels of CP diets: 7.5%, 9.0%, 11.0%, and 13.0%. A digestion assay was performed with partial feces collection over 4 d, followed by 1 d of total urine collection. Data were submitted to regression analysis and adjusted to linear and quadratic models (P < 0.05). No differences were observed in the intake of DM, OM, EE, ADF, and NDF as a function of dietary protein levels. Dry matter intake average was 1.7% of BW. CP and N intake showed a linear increase as a function of increasing protein level in diets. A quadratic response (P < 0.05) was observed on the CP and NDF digestibility coefficients, with the maximum estimated level of digestibility at 11.6% and 11.4% CP in the diet, respectively. There was a linear effect on ADF digestibility coefficients, digestible DM and protein intake, and CP/DE ratio according to dietary protein levels. There was no impact of dietary protein levels on daily water intake, total water intake, or fecal water excretion. Urinary excretion values showed a linear increase in response to increased dietary protein levels, but no impact was observed on water balance, with an average of 8.4 L/d. Nitrogen intake (NI), N absorption (NA), and urinary N increased linearly as a function of increasing dietary protein levels. There was no impact of dietary protein levels on N retention (NR), with an average of 7.5 g N/d. Nitrogen retention as a percentage of NI or NA showed no significant changes in the function of dietary protein levels. There was an impact of dietary protein levels on the digestibility coefficient of CP, NDF, ADF, and digestible protein intake on conditioning eventing horses. The 11.6% CP level in the diet provided an intake of 2.25 g CP/kg BW and 0.37 g N/kg BW, and this intake was the most appropriate for the conditioning of intensely exercised horses, considering the responses related to NI, NA, and the estimated NR to NA ratio. The NDF and ADF responses indicated that dietary fiber was more digested with an increased amount of N in the digestive tract.
Correlation between ocular parameters and amplitude of accommodation
Abraham, Lekha Mary; Kuriakose, Thomas; Sivanandam, Viswanathan; Venkatesan, Nithya; Thomas, Ravi; Muliyil, Jayaprakash
2010-01-01
Aim: To study the relationship between ocular parameters and amplitude of accommodation (AA) in the peri-presbyopic age group (35–50 years). Materials and Methods: Three hundred and sixteen right eyes of consecutive patients in the age group 35–50 years, who attended our outpatient clinic, were studied. Emmetropes, hypermetropes and myopes with best-corrected visual acuity of 20/20, J1 in both eyes were included. The AA was calculated by measuring the near point of accommodation. The axial length (AL), central anterior chamber depth (CACD) and lens thickness (LT) were also measured. Results: There was moderate correlation (Pearson’s correlation coefficient r = 0.56) between AL and AA as well as between CACD and AA (r = 0.53) in myopes in the age group 35–39 years. In the other age groups and the groups taken as a whole, there was no correlation. In hypermetropes and emmetropes, there was no correlation between AA and the above ocular parameters. No significant correlation existed between LT and AA across different age groups and refractive errors. Conclusion: There was no significant correlation between AA and ocular parameters like anterior chamber depth, AL and LT. PMID:20952831
Gutierrez, N A; Serão, N V L; Patience, J F
2016-04-01
The use of corn coproducts increases the concentration of fiber and, often, the use of supplemental lipids in swine diets, which may affect energy and nutrient digestibility. An experiment was conducted to determine the effects of reduced-oil distillers' dried grains with solubles (DDGS) and soybean oil (SBO) on dietary AA, acid hydrolyzed ether extract (AEE), and NDF digestibility in corn-based diets fed to growing pigs. Eighteen growing pigs (33.8 ± 2.2 kg BW) were surgically fitted with a T-cannula in the distal ileum and allocated to 1 of 6 dietary treatment groups in a 3-period incomplete Latin square design, with 9 observations per treatment. Six dietary treatments were obtained by adding 0, 20, and 40% DDGS to corn-casein diets formulated with 2 and 6% SBO. Ileal digesta and fecal samples were collected and the apparent ileal digestibility (AID) and apparent total tract digestibility (ATTD) of AEE and NDF and the AID of AA were determined. Apparent values were corrected for endogenous losses of lipids, and true ileal (TID) and true total tract digestibility (TTTD) values of lipids were calculated. Results showed that the AID of Lys decreased ( < 0.001) with the inclusion of DDGS but was not affected ( = 0.63) by the inclusion of SBO. An interaction between DDGS and SBO on the AID ( = 0.002) and ATTD ( = 0.009) of NDF was observed, where the AID and ATTD of NDF decreased with DDGS at 6% SBO but no effect was observed at 2% SBO. The AID of NDF increased with SBO at 0% DDGS, but no effect was observed at 20 or 40% DDGS. An interaction between DDGS and SBO on the AID ( = 0.011) and ATTD ( = 0.008) of AEE was observed, where the AID and ATTD of AEE increased with SBO. The AID and ATTD of AEE increased with DDGS at 2% SBO, but no effect was observed at 6% SBO. Correction by ileal and fecal endogenous loss of AEE (9.5 and 13.6 g/kg of DMI, respectively) showed that increasing dietary AEE had no effect on the TID and TTD of AEE ( > 0.05). In conclusion, the AID of Lys decreased with DDGS and was not affected by lipids from SBO. The greatest AID and ATTD of NDF was observed in diets with a high AEE and low NDF content. Low values of apparent digestibility of AEE in lower-lipid diets are possibly the result of endogenous losses of lipids, because the true digestibility of AEE was not affected by the dietary increase of AEE.
Gutierrez, N A; Kerr, B J; Patience, J F
2013-11-01
Extensive use of corn coproducts in swine diets increases the concentration of dietary fiber, raising concerns on energy and nutrient digestibility and, ultimately, pig performance. A digestion trial was conducted to determine the effect of increasing levels of insoluble-low fermentable fiber from corn in the diet, using corn bran with solubles (CBS) from the corn-ethanol distillation industry, on digestibility of energy, fiber, and AA, and hindgut fermentation of fiber in diets fed to growing pigs. Fifteen growing pigs (BW=28.7 kg) arranged in a 3-period incomplete block design and fitted with a T-cannula in the distal ileum were provided 5 diets (n=9) containing either a corn-casein basal or the basal diet with 10, 20, 30, or 40% CBS. Fecal and ileal digesta samples were collected. Two subsequent 28-d growth trials determined the effects of increasing dietary fiber from CBS in 2 sets of 7 diets formulated either with declining (growing phase: 2,387 to 2,133 kcal NE/kg; finishing phase: 2,499 to 2,209 kcal NE/kg) or constant dietary NE (growing phase≈2,390 kcal NE/kg; finishing phase≈2,500 kcal NE/kg) on growth performance and apparent total tract digestibility (ATTD) of energy in 70 growing (BW=48.9 kg; n=10 per diet) and 70 finishing (BW=102.0 kg; n=10) pigs. Results indicated that increasing fiber from corn lowered (P<0.01) the apparent ileal digestibility of all indispensable amino acids except Arg, GE, DM, and CP but not NDF or total dietary fiber (TDF). Increased fiber from corn also reduced ATTD of GE, DM, CP, NDF, and TDF (P<0.01). Increasing fiber with declining diet NE lowered BW, ADG, and G:F (P<0.05) in growing and in finishing pigs. When NE was held constant, as fiber increased, BW and ADG were unaffected in growing and finishing pigs, and G:F was unaffected in finishing pigs but improved in growing pigs (P<0.05) with increasing dietary fiber. In both growing and finishing pigs, ADFI was unaffected by the increased fiber from corn, regardless of the NE content of diets. In conclusion, the dietary level of insoluble-low fermentable dietary fiber from corn origin decreased the digestibility of dietary AA, and the ability of the growing pig to ferment corn dietary fiber. In spite of the reduction in digestibility of energy and nutrients with insoluble-low fermentable fiber level from corn, growth performance was not impaired when the energy supply is adequately balanced in the diet using the NE system.
Magura, Stephen; Cleland, Charles M; Tonigan, J Scott
2013-05-01
The objective of the study is to determine whether Alcoholics Anonymous (AA) participation leads to reduced drinking and problems related to drinking within Project MATCH (Matching Alcoholism Treatments to Client Heterogeneity), an existing national alcoholism treatment data set. The method used is structural equation modeling of panel data with cross-lagged partial regression coefficients. The main advantage of this technique for the analysis of AA outcomes is that potential reciprocal causation between AA participation and drinking behavior can be explicitly modeled through the specification of finite causal lags. For the outpatient subsample (n = 952), the results strongly support the hypothesis that AA attendance leads to increases in alcohol abstinence and reduces drinking/ problems, whereas a causal effect in the reverse direction is unsupported. For the aftercare subsample (n = 774), the results are not as clear but also suggest that AA attendance leads to better outcomes. Although randomized controlled trials are the surest means of establishing causal relations between interventions and outcomes, such trials are rare in AA research for practical reasons. The current study successfully exploited the multiple data waves in Project MATCH to examine evidence of causality between AA participation and drinking outcomes. The study obtained unique statistical results supporting the effectiveness of AA primarily in the context of primary outpatient treatment for alcoholism.
Liu, Sonia Y; Cowieson, Aaron J; Selle, Peter H
2016-06-01
The objective of this study was to examine the influence of meat-and-bone meal (MBM) and phytase inclusion on growth performance, bone mineralisation and apparent digestibility coefficients of nutrients in broiler chickens offered wheat-based diets. The feeding study comprised 7 dietary treatments: positive control (PC, 9.0% Ca and 4.5% available phosphorous [AvP] in starter, 7.0% Ca and 3.5% AvP in finisher); negative control (NC, 7.2% Ca and 3.0% AvP in starter, 5.2% Ca and 2.0% AvP in finisher) diets incorporating a 3 × 2 factorial array of 3 MBM inclusions (0, 60, 120 g/kg) and 2 levels of phytase supplementation (0 and 1,000 FYT/kg). Each treatment was allocated to 6 replicated pens with 30 birds per pen in an environmentally-controlled deep litter facility. A total of 1,260 one-day-old male Ross 308 chicks were offered starter diets from 1 to 14 days post-hatch and finisher diets from 15 to 36 days post-hatch. There were significant ( P < 0.05) interactions between MBM inclusions and phytase supplementation on weight gain and feed intake in starter diets. Phytase significantly increased weight gain in diets without MBM and did not influence weight gain in diets with 60 and 120 g/kg MBM. Collectively, increasing MBM inclusion significantly reduced weight gain in starter diets ( P < 0.0001). There were dietary interactions ( P < 0.01) on toe ash where phytase significantly improved toe ash in diet without MBM and did not influence toe ash in the other two groups of negative control diets. There were no dietary treatment interactions on apparent ileal digestibility coefficients of starch and protein except that diets without MBM had significantly ( P < 0.01) lower ileal starch digestibility and diets with 120 g/kg MBM had significantly ( P < 0.0001) lower ileal protein digestibility. No dietary influence on ileal fat digestibility was observed. There were dietary interactions on ileal digestibilities of isoleucine, valine and glycine. Phytase significantly increased glycine digestibility in diets with 60 and 120 g/kg MBM but not in diets without MBM. Including 120 g/kg MBM significantly ( P < 0.01) depressed apparent digestibility coefficients of 13 ex 16 amino acids in the distal ileum. This study demonstrated the negative impacts of MBM on amino acid digestibility and growth performance. Also, responses to phytase were more pronounced in diets without MBM, which may have been due to their relatively lower available P and higher phytate concentrations in comparison to diets containing MBM.
Evaluation of pelleted aspen foliage as a ruminant feedstuff
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bas, F.J.; Ehle, F.R.; Goodrich, R.D.
1985-01-01
Growth and digestion trials were made to determine the nutritive value of pelleted aspen (Populus tremuloides) foliage as a dietary ingredient for sheep. Lambs offered diets without or with 25, 50 and 75% aspen leaves, with lucerne as the other dietary ingredient, ate less and gained less weight as the proportion of aspen leaves in the diet increased (P less than 0.05). Digestibility coefficients for DM, organic matter, crude protein, gross energy, neutral detergent fibre, acid detergent fibre, hemicellulose and cellulose decreased linearly (P less than 0.01) as the percentage of aspen foliage eaten increased. Calculated digestibility of individual aspenmore » leaf components gave values as low as 16.6 and 13% for crude protein and cellulose, respectively. Coefficients of determination for the linear regressions indicated no associative effects between lucerne and aspen leaves. Due to the depressed value for crude protein digestibility, the amount of acid detergent fibre-insoluble nitrogen was estimated. Over 50% of the total N in aspen foliage was bound to the acid detergent fibre fraction, reflecting the presence of heat-damaged protein, tannin-protein complexes that are unavailable for digestion or both. After adjustment for unavailable N, the crude protein digestibility of aspen foliage was 61.5%. Balances of 10 minerals were estimated during the digestion trial. Negative mineral balances for the 75% aspen leaf diet suggest that the lambs were in a nutrient deficient condition when fed on this diet. 29 references.« less
Characterization of the interfacial heat transfer coefficient for hot stamping processes
NASA Astrophysics Data System (ADS)
Luan, Xi; Liu, Xiaochuan; Fang, Haomiao; Ji, Kang; El Fakir, Omer; Wang, LiLiang
2016-08-01
In hot stamping processes, the interfacial heat transfer coefficient (IHTC) between the forming tools and hot blank is an essential parameter which determines the quenching rate of the process and hence the resulting material microstructure. The present work focuses on the characterization of the IHTC between an aluminium alloy 7075-T6 blank and two different die materials, cast iron (G3500) and H13 die steel, at various contact pressures. It was found that the IHTC between AA7075 and cast iron had values 78.6% higher than that obtained between AA7075 and H13 die steel. Die materials and contact pressures had pronounced effects on the IHTC, suggesting that the IHTC can be used to guide the selection of stamping tool materials and the precise control of processing parameters.
Brunelle, S.; Bertucci, F.; Chetaille, B.; Lelong, B.; Piana, G.; Sarran, A.
2013-01-01
Introduction Aggressive angiomyxoma (AA) is a rare benign soft tissue tumour usually affecting the pelvis and perineum of young women. Magnetic resonance imaging (MRI) is crucial in the management of AA patients for its diagnostic contribution and for the preoperative assessment of the actual tumour extension. Given the current development of less aggressive therapeutics associated with a higher risk of recurrence, close follow-up with MRI is fundamental after treatment. In this context, diffusion-weighted (DW) imaging has already shown high efficacy in the detection of early small relapses in prostate or rectal cancer. Case Report We report here a case of pelvic AA in a 51-year-old woman examined with dynamic contrast enhancement and DW-MRI, including apparent diffusion coefficient mapping and calculation. Conclusion To our knowledge, this is the first description of DW-MRI in AA reported in the literature. Here, knowledge about imaging features of AA will be reviewed and expanded. PMID:23904848
Brunelle, S; Bertucci, F; Chetaille, B; Lelong, B; Piana, G; Sarran, A
2013-05-01
Aggressive angiomyxoma (AA) is a rare benign soft tissue tumour usually affecting the pelvis and perineum of young women. Magnetic resonance imaging (MRI) is crucial in the management of AA patients for its diagnostic contribution and for the preoperative assessment of the actual tumour extension. Given the current development of less aggressive therapeutics associated with a higher risk of recurrence, close follow-up with MRI is fundamental after treatment. In this context, diffusion-weighted (DW) imaging has already shown high efficacy in the detection of early small relapses in prostate or rectal cancer. We report here a case of pelvic AA in a 51-year-old woman examined with dynamic contrast enhancement and DW-MRI, including apparent diffusion coefficient mapping and calculation. To our knowledge, this is the first description of DW-MRI in AA reported in the literature. Here, knowledge about imaging features of AA will be reviewed and expanded.
Espinosa, C D; Stein, H H
2018-05-04
Two experiments were conducted to determine the standardized ileal digestibility (SID) of CP and AA, apparent total tract digestibility (ATTD) of GE, and DE and ME in conventional distillers dried grains with solubles (DDGS-CV) and in a novel source of high-protein distillers dried grains with solubles (DDGS-HP) produced by Lincolnway Energy (Nevada, IA). In Exp. 1, 18 barrows (initial BW: 72.47 ± 9.16 kg) that had a T-cannula installed in the distal ileum were allotted to a completely randomized design with 3 diets and 6 replicate pigs per diet. A nitrogen-free diet and 2 diets that contained cornstarch and DDGS-CV or DDGS-HPLincolnway as the sole source of CP and AA were formulated. Diets were fed to pigs for 7 d, and ileal digesta were collected on days 6 and 7 of each period. The SID for Leu, Lys, Met, Phe, and Glu was greater (P < 0.05) in DDGS-HPLincolnway than in DDGS-CV, and the SID of Ile, Val, and total indispensable AA, as well as the SID of Tyr, tended to be greater (P < 0.10) in DDGS-HPLincolnway than in DDGS-CV. No difference between DDGS-CV and DDGS-HPLincolnway was observed for the SID of CP and all other AA. In Exp. 2, 24 barrows (initial BW: 52.80 ± 2.55 kg) were housed individually in metabolism crates and randomly allotted to 1 of 3 diets. A corn-based basal diet (97.25% corn) and 2 diets that contained corn and DDGS-CV or corn and DDGS-HPLincolnway were formulated. Each diet was fed to 8 pigs. Feces and urine were collected using the marker to marker approach with 7-d adaptation and 5-d collection periods. The DE and ME in DDGS-CV and DDGS-HPLincolnway were calculated using the difference procedure. The DE and ME in DDGS-HPLincolnway on an as-fed basis were greater (P < 0.05) than in corn and DDGS-CV, but the ATTD of GE in DDGS-HPLincolnway and DDGS-CV was less (P < 0.01) than in corn. In conclusion, the SID of some AA and the DE and ME in DDGS-HPLincolnway were greater than in DDGS-CV.
Safwat, A. M.; Sarmiento-Franco, L.; Santos-Ricalde, R. H.; Nieves, D.; Sandoval-Castro, C. A.
2015-01-01
This study aimed to evaluate the nutrient digestibility of growing rabbits fed diets with different levels of either Leucaena leucocephala (LLM) or Moringa oleifera (MOLM) leaf meals and also to compare total collection and TiO2 marker methods for estimating digestibility. A total of 30 California growing rabbits (1.81±0.19 kg live weight on average) were randomly distributed into five experimental groups of six rabbits each and were housed in individual cages. The groups were control, 30% LLM, 40% LLM, 30% MOLM, and 40% MOLM. All groups received pelleted diets for two weeks; diets also contained 4 g/kg titanium dioxide as dietary marker. Daily feed intake was recorded during the whole experimental period and total feces were collected daily and weighed individually during four days. The results showed that there were no difference (p>0.05) in feed, dry matter (DM), organic matter (OM), crude protein (CP), digestible energy, and crude fiber (CF) intake between the control group and the other experimental groups. The apparent digestibility values of DM, OM, CP, CF, acid detergent fiber, and gross energy were the highest for control group (p = 0.001), meanwhile MOLM diets had generally higher nutrient digestibility coefficients than LLM diets. Increasing the inclusion level of leaf meal in the diet from 30% to 40% improved the digestibility of CF from 45.02% to 51.69% for LLM and from 48.11% to 55.89% for MOLM. Similar results for apparent nutrient digestibility coefficients were obtained when either total collection or indigestible marker method was used. In conclusion, the digestibility of MOLM containing diets were better than LLM diets, furthermore TiO2 as an external marker could be used as a simple, practical and reliable method to estimate nutrients digestibility in rabbit diets. PMID:26104524
Safwat, A M; Sarmiento-Franco, L; Santos-Ricalde, R H; Nieves, D; Sandoval-Castro, C A
2015-08-01
This study aimed to evaluate the nutrient digestibility of growing rabbits fed diets with different levels of either Leucaena leucocephala (LLM) or Moringa oleifera (MOLM) leaf meals and also to compare total collection and TiO2 marker methods for estimating digestibility. A total of 30 California growing rabbits (1.81±0.19 kg live weight on average) were randomly distributed into five experimental groups of six rabbits each and were housed in individual cages. The groups were control, 30% LLM, 40% LLM, 30% MOLM, and 40% MOLM. All groups received pelleted diets for two weeks; diets also contained 4 g/kg titanium dioxide as dietary marker. Daily feed intake was recorded during the whole experimental period and total feces were collected daily and weighed individually during four days. The results showed that there were no difference (p>0.05) in feed, dry matter (DM), organic matter (OM), crude protein (CP), digestible energy, and crude fiber (CF) intake between the control group and the other experimental groups. The apparent digestibility values of DM, OM, CP, CF, acid detergent fiber, and gross energy were the highest for control group (p = 0.001), meanwhile MOLM diets had generally higher nutrient digestibility coefficients than LLM diets. Increasing the inclusion level of leaf meal in the diet from 30% to 40% improved the digestibility of CF from 45.02% to 51.69% for LLM and from 48.11% to 55.89% for MOLM. Similar results for apparent nutrient digestibility coefficients were obtained when either total collection or indigestible marker method was used. In conclusion, the digestibility of MOLM containing diets were better than LLM diets, furthermore TiO2 as an external marker could be used as a simple, practical and reliable method to estimate nutrients digestibility in rabbit diets.
Petrat-Melin, B; Andersen, P; Rasmussen, J T; Poulsen, N A; Larsen, L B; Young, J F
2015-01-01
Genetic polymorphisms of bovine milk proteins affect the protein profile of the milk and, hence, certain technological properties, such as casein (CN) number and cheese yield. However, reports show that such polymorphisms may also affect the health-related properties of milk. Therefore, to gain insight into their digestion pattern and bioactive potential, β-CN was purified from bovine milk originating from cows homozygous for the variants A(1), A(2), B, and I by a combination of cold storage, ultracentrifugation, and acid precipitation. The purity of the isolated β-CN was determined by HPLC, variants were verified by mass spectrometry, and molar extinction coefficients at λ=280nm were determined. β-Casein from each of the variants was subjected to in vitro digestion using pepsin and pancreatic enzymes. Antioxidant and angiotensin-converting enzyme (ACE) inhibitory capacities of the hydrolysates were assessed at 3 stages of digestion and related to that of the undigested samples. Neither molar extinction coefficients nor overall digestibility varied significantly between these 4 variants; however, clear differences in digestion pattern were indicated by gel electrophoresis. In particular, after 60min of pepsin followed by 5min of pancreatic enzyme digestion, one ≈4kDa peptide with the N-terminal sequence (106)H-K-E-M-P-F-P-K- was absent from β-CN variant B. This is likely a result of the (122)Ser to (122)Arg substitution in variant B introducing a novel trypsin cleavage site, leading to the changed digestion pattern. All investigated β-CN variants exhibited a significant increase in antioxidant capacity upon digestion, as measured by the Trolox-equivalent antioxidant capacity assay. After 60min of pepsin + 120min of pancreatic enzyme digestion, the accumulated increase in antioxidant capacity was ≈1.7-fold for the 4 β-CN variants. The ACE inhibitory capacity was also significantly increased by digestion, with the B variant reaching the highest inhibitory capacity at the end of digestion (60min of pepsin + 120min of pancreatic enzymes), possibly because of the observed alternative digestion pattern. These results demonstrate that genetic polymorphisms affect the digestion pattern and bioactivity of milk proteins. Moreover, their capacity for radical scavenging and ACE inhibition is affected by digestion. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choi, Kwang-Soon; Lee, Chang Heon; Ahn, Hong-Joo
2013-07-01
Based on the regulation of the activity concentration of Cs-137, Co-58, Co-60, Fe-55, Ni-59, Ni-63, Sr-90, Nb-94, and Tc-99, and the total alpha from the radioactive waste acceptance criteria, the measurement of the activity concentration of these nuclides in low and intermediate levels of radioactive waste such as in paper, cotton, vinyl and plastic samples was investigated. A dry ashing method was applied to obtain a concentration effect of the samples. Owing to the temperature dependence of the volatility for cesium, the temperature of 300 to 650 deg. C was examined. It was found that 450 deg. C is themore » optimum dry ashing temperature. After dry ashing, the produced ash was dissolved with HNO{sub 3}, HCl, and HF by a high-performance microwave digestion system. The ash sample, for the most part, was completely dissolved with 10 mL of HNO{sub 3}, 4 mL of HCl, and 0.25 mL of HF by a high-performance microwave digestion system using a nova high temperature rotor at 250 deg. C for 90 min until reaching 0.2 g. To confirm the reliability of cesium loss after the performance of the dry ashing procedure, a cesium standard solution for AAS and a Cs-137 standard solution for gamma spectrometry were added to a paper towel or a planchet of stainless steel, respectively. Cesium was measured by AAS, ICP-MS, and gamma spectrometry. The volatility of cesium did not occur until 450 deg. C ashing. (authors)« less
Eppinger, Robert G.; Giles, Stuart A.; Lee, Gregory K.; Smith, Steven M.
2015-01-01
The geochemical sample media collected by the BGS and BRGM under the PRISM-I contract included rock, sediment, regolith, and soil samples. Details on sample collection procedures are in unpublished reports available from PRISM. These samples were analyzed under PRISM-I contract by ALS Chemex Laboratories using various combinations of modern methods including fire-assay inductively coupled plasma-atomic emission spectrometry (ICPAES) and ICP-mass spectrometry (ICP-MS) for Au; multi-acid digestion, atomic absorption spectroscopy (AAS) for Ag and As; 47-element, four-acid digestion, ICP-MS; 27-element, fouracid digestion, ICP-AES; special four-acid ICP-MS techniques for Pt and B; fire assay followed by ICP-AES for platinum-group elements; whole-rock analyses by wavelength dispersive X-ray fluorescence (XRF); special techniques for loss-on-ignition, inorganic C, and total S; and special ore-grade AAS techniques for Ag, Au, Cu, Ni, Pb, and Zn. Around 30,000 samples were analyzed by at least one technique. However, it is stressed here that: (1) there was no common sample medium collected at all sites, likely due to the vast geological and geomorphologic differences across the country, (2) the sample site distribution is very irregular, likely due in part to access constraints and sand dune cover, and (3) there was no common across-the-board trace element analytical package used for all samples. These three aspects fundamentally affect the ability to produce country-wide geochemical maps of Mauritania. Gold (Au), silver (Ag), and arsenic (As) were the three elements that were most commonly analyzed.
Li, Y S; Tran, H; Bundy, J W; Burkey, T E; Kerr, B J; Nielsen, M K; Miller, P S
2016-06-01
Two experiments were conducted to investigate the effects of collection method and diet type on digestibility coefficients. In Exp. 1, 24 barrows were fed either a corn-soybean meal (CSBM) diet or CSBM with 20% dried distillers' grains with solubles (CSBM-DDGS). In Exp. 2, the effects of basal diet and collection method on determination of dried distillers' grains with solubles (DDGS) digestibility were studied using 24 barrows. The 4 diets used in Exp. 2 were: a CSBM (basal 1) , a barley-canola meal (BCM; basal 2), 80% basal 1 with 20% DDGS (CSBM-DDGS), and 80% basal 2 with 20% DDGS (BCM-DDGS). In both experiments, feces were collected using a time-based collection method (DY) or a "marker-to-marker" collection method (MM). Diets contained 0.5% of titanium dioxide (TiO) for estimating digestibility using the index marker approach (IM). The apparent total tract digestibility (ATTD) of DM and GE were lower ( < 0.05) in the CSBM-DDGS diet than in the CSBM diet in Exp. 1 but were not different in Exp. 2. All the estimates of BCM-based diets were consistently lower ( < 0.05) than those of CSBM-based diets. In Exp. 1, digestibility coefficients determined by the DY and MM were not different from each other, whereas those estimates were lower ( < 0.05) using the IM than those using the total collection approach (TC; DY and MM). In Exp. 2, interactions ( < 0.05) were observed between diet type and method for dietary digestibility coefficients. Digestibility and energy values estimated by the DY and MM were not different in pigs fed CSBM-based diets and the BCM-DDGS diet, whereas those estimates were greater ( < 0.05) using the DY than those using the MM in pigs fed the BCM. There were no interactions between basal diet and method for estimating DDGS digestibility. The ATTD of DM and GE of DDGS using the MM were greater ( < 0.05) than those using the IM, and ATTD of N tended to be greater ( < 0.10) using the MM than that using the IM. All estimates using the DY were not different from those using the MM or the IM, except that DE of DDGS was greater ( < 0.05) using the DY than when using the IM. Digestibility estimates of DDGS were not affected by basal diets. The mean DE and ME (as-fed basis) of DDGS were 3,994 and 3,688 kcal/kg, respectively, when estimated using the basal 1 diet and were 3,919 and 3,547 kcal/kg, respectively, when estimated using the basal 2 diet. In conclusion, both collection methods can be used to estimate energy and nutrient digestibility of diets and DDGS when using CSBM-based diets.
[Specific problems posed by carbohydrate utilization in the rainbow trout].
Bergot, F
1979-01-01
Carbohydrate incorporation in trout diets arises problems both at digestive and metabolic levels. Digestive utilization of carbohydrate closely depends on their molecular weight. In addition, in the case of complex carbohydrates (starches), different factors such as the level of incorporation, the amount consumed and the physical state of starch influence the digestibility. The measurement of digestibility in itself is confronted with methodological difficulties. The way the feces are collected can affect the digestion coefficient. Dietary carbohydrates actually serve as a source of energy. Nevertheless, above a certain level in the diet, intolerance phenomena may appear. The question that arises now is to establish the optimal part that carbohydrates can take in the metabolizable energy of a given diet.
Woyengo, T A; Patterson, R; Slominski, B A; Beltranena, E; Zijlstra, R T
2016-10-01
The objectives were to determine the standardized ileal digestibility (SID) of amino acids (AA) and AMEn value of cold-pressed camelina cake (CPCC) and the effect of adding multi-enzyme to a corn-CPCC diet for broilers. The 600 male broiler chicks were divided into 40 groups and fed 5 diets in a completely randomized design (8 groups per diet) from d 15 to d 21 of age. A corn basal diet and the basal diet with 30% of it replaced by CPCC were used in a 2 × 2 factorial arrangement with or without multi-enzyme (2,800 U of cellulase, 1,800 U of pectinase, 400 U of mannanase, 50 U of galactanase, 1,000 U of xylanase, 600 U of glucanase, 2,500 U of amylase, and 200 U of protease/kilogram of diet; Superzyme OM, 1 g/kg). The fifth diet was N-free. The corn basal diet was fed to determine nutrient digestibility and retention for CPCC by substitution. The N-free diet was fed to estimate basal endogenous AA losses for determining SID of AA. Diets contained TiO2 as indigestible marker. On a DM basis, CPCC contained 39.8% CP, 38.3% neutral detergent fiber, 12.7% ether extract, 1.89% Lys, 0.70% Met, 1.56% Thr, and 0.45% Trp. The SID of Lys, Met, Thr, and Trp for CPCC were 76.5, 85.5, 72.8, and 84.1%, respectively. The AMEn value for CPCC was 1,671 kcal/kg of DM. Multi-enzyme supplementation increased (P < 0.05) the SID of Met and Thr and the AMEn value of the corn-CPCC-based diet by 1.4, 1.3, and 3.0%, respectively. The multi-enzyme increased (P = 0.026) the AMEn value of CPCC from 1,671 to 1,941 kcal/kg of DM. In conclusion, the CPCC evaluated in the present study can be included in poultry diets as a source of energy and AA. Multi-enzyme supplementation increased the AMEn value of CPCC for broilers. © 2016 Poultry Science Association Inc.
Hulshof, T G; Bikker, P; van der Poel, A F B; Hendriks, W H
2016-03-01
An experiment was conducted to determine protein quality in processed protein sources using the content of AA, -methylisourea (OMIU)-reactive Lys, Maillard reaction products (MRP), and cross-link products; the standardized ileal digestibility (SID) of CP and AA; and growth performance in growing pigs as criteria. Differences in protein quality were created by secondary toasting (at 95°C for 30 min) of soybean meal (SBM) and rapeseed meal (RSM) in the presence of lignosulfonate resulting in processed SBM (pSBM) and processed RSM (pRSM). The processing treatment was used as a model for overprocessed protein sources. Ten growing pigs were each fed 1 of the 4 diets containing SBM, pSBM, RSM, or pRSM in each of 3 periods. Ileal chyme was collected at the end of each period and analyzed for CP, AA, and OMIU-reactive Lys. Diets were analyzed for furosine and carboxymethyllysine (CML) as an indicator for MRP and lysinoalanine (LAL), which is a cross-link product. The SBM and RSM diets contained furosine, CML, and LAL, indicating that the Maillard reaction and cross-linking had taken place in SBM and RSM, presumably during the oil extraction/desolventizing process. The amounts of furosine, CML, and LAL were elevated in pSBM and pRSM due to further processing. Processing resulted in a reduction in total and OMIU-reactive Lys contents and a decrease in G:F from 0.52 to 0.42 for SBM and 0.46 to 0.39 for RSM ( = 0.006), SID of CP from 83.9 to 71.6% for SBM and 74.9 to 64.6% for RSM ( < 0.001), and SID of AA ( < 0.001), with the largest effects for total and OMIU-reactive Lys. The effects of processing could be substantial and should be taken into account when using processed protein sources in diets for growing pigs. The extent of protein damage may be assessed by additional analyses of MRP and cross-link products.
The purpose of this SOP is to describe the acid digestion of soil, house dust, air filter, and surface or dermal wipe samples for analysis using inductively coupled plasma atomic emissions spectrometry (ICP-AES) and/or graphite furnace atomic absorption spectrometry (GFAAS) or fl...
USDA-ARS?s Scientific Manuscript database
Two experiments were conducted to investigate the effects of collection method and diet type on digestibility coefficients. In Exp. 1, 24 barrows were fed either a corn-soybean meal diet (CSBM) or CSBM with 20% dried distillers grains with solubles (DDGS). In Exp. 2, the effects of basal diet and co...
Yáñez, J L; Landero, J L; Owusu-Asiedu, A; Cervantes, M; Zijlstra, R T
2013-02-01
Traditional supplemental dietary phytase loses activity during steam pelleting. The thermal tolerance and bioefficacy of a phytase product with a thermoprotective coating [coated phytase (C-phytase)] was compared in mash and pelleted diets to a traditional, uncoated phytase (U-phytase) added to a negative control (NC) diet, formulated with reduced dietary Ca and P, and compared with a corn-soybean meal based positive control (POC) diet. Growth performance, nutrient digestibility, and third metacarpal bone characteristics were response variables. Weaned pigs (n = 56; 8.20 ± 0.5 kg initial BW; 28 d of age) were individually housed and randomly allotted to 1 of 7 diets for 21 d. The diets were 1) POC mash, 2) NC mash, 3) NC pelleted at 90°C, 4) NC mash + 500 U/kg U-phytase, 5) NC mash + 500 U/kg C-phytase, 6) NC + 500 U/kg C-phytase pelleted at 80°C, and 7) NC + 500 U/kg C-phytase pelleted at 90°C. The POC and NC diets were formulated to be isoenergetic and isolysinic. The content of Ca and available P was 1.01 and 0.40% and 0.83 and 0.22% in the POC and NC diets, respectively. Pig BW and feed intake were measured on d 7, 14, and 21, and feces were collected for 2 d. On d 21, pigs were killed and ileal digesta and the third metacarpal bone collected. Pigs fed POC had greater (P < 0.05) ADG, G:F, P digestibility, and bone mineralization but lower (P < 0.01) energy digestibility than pigs fed NC. Pelleting the NC diet did not improve performance, nutrient digestibility, or P use. Adding the U-phytase to NC mash diet increased (P < 0.05) ADG, G:F, apparent ileal digestibility (AID) of CP and Ile, Leu, Phe, Thr, Val, and Ser, and apparent total tract digestibility (ATTD) of P compared with pigs fed NC. Pigs fed C-phytase in NC mash diets had increased (P < 0.05) G:F and an AID of CP and AA and ATTD of P compared with pigs fed NC but not different than pigs fed U-phytase NC mash diets. Pigs fed pelleted NC diet with C-phytase had a greater (P < 0.05) ATTD of P and energy than pigs fed mash NC diet with C-phytase but had similar growth performance, AID of CP and AA, and bone mineralization to pigs fed U-phytase. In conclusion, release and bioefficacy of phytase after pelleting was not affected by the thermal protective coating.
NASA Astrophysics Data System (ADS)
Lenzen, Matthias; Merklein, Marion
2017-10-01
In the automotive sector, a major challenge is the deep-drawing of modern lightweight sheet metals with limited formability. Thus, conventional material models lack in accuracy due to the complex material behavior. A current field of research takes into account the evolution of the Lankford coefficient. Today, changes in anisotropy under increasing degree of deformation are not considered. Only a consolidated average value of the Lankford coefficient is included in conventional material models. This leads to an increasing error in prediction of the flow behavior and therefore to an inaccurate prognosis of the forming behavior. To increase the accuracy of the prediction quality, the strain dependent Lankford coefficient should be respected, because the R-value has a direct effect on the contour of the associated flow rule. Further, the investigated materials show a more or less extinct rate dependency of the yield stress. For this reason, the rate dependency of the Lankford coefficient during uniaxial tension is focused within this contribution. To quantify the influence of strain rate on the Lankford coefficient, tensile tests are performed for three commonly used materials, the aluminum alloy AA6016-T4, the advanced high strength steel DP800 and the deep drawing steel DC06 at three different strain rates. The strain measurement is carried out by an optical strain measurement system. An evolution of the Lankford coefficient was observed for all investigated materials. Also, an influence of the deformation velocity on the anisotropy could be detected.
Tank 40 Final SB7b Chemical Characterization Results
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bannochie, C. J.
2012-11-06
A sample of Sludge Batch 7b (SB7b) was taken from Tank 40 in order to obtain radionuclide inventory analyses necessary for compliance with the Waste Acceptance Product Specifications (WAPS). The SB7b WAPS sample was also analyzed for chemical composition including noble metals and fissile constituents. At the Savannah River National Laboratory (SRNL) the 3-L Tank 40 SB7b sample was transferred from the shipping container into a 4-L high density polyethylene bottle and solids were allowed to settle over the weekend. Supernate was then siphoned off and circulated through the shipping container to complete the transfer of the sample. Following thoroughmore » mixing of the 3-L sample, a 558 g sub-sample was removed. This sub-sample was then utilized for all subsequent analytical samples. Eight separate aliquots of the slurry were digested, four with HNO{sub 3}/HCl (aqua regia) in sealed Teflon vessels and four with NaOH/Na{sub 2}O{sub 2} (alkali or peroxide fusion) using Zr crucibles. Two Analytical Reference Glass ? 1 (ARG-1) standards were digested along with a blank for each preparation. Each aqua regia digestion and blank was diluted to 1:100 mL with deionized water and submitted to Analytical Development (AD) for inductively coupled plasma ? atomic emission spectroscopy (ICP-AES) analysis, inductively coupled plasma ? mass spectrometry (ICP-MS) analysis, atomic absorption spectroscopy (AA) for As and Se, and cold vapor atomic absorption spectroscopy (CV-AA) for Hg. Equivalent dilutions of the alkali fusion digestions and blank were submitted to AD for ICP-AES analysis. Tank 40 SB7b supernate was collected from a mixed slurry sample in the SRNL Shielded Cells and submitted to AD for ICP-AES, ion chromatography (IC), total base/free OH{sup -}/other base, total inorganic carbon/total organic carbon (TIC/TOC) analyses, and Cs-137 gamma scan. Weighted dilutions of slurry were submitted for IC, TIC/TOC, and total base/free OH-/other base analyses. Activities for U-233, U-235, and Pu-239 were determined from the ICP-MS data for the aqua regia digestions of the Tank 40 WAPS slurry using the specific activity of each isotope. The Pu-241 value was determined from a Pu-238/-241 method.« less
Mujahid, A; Asif, M; ul Haq, I; Abdullah, M; Gilani, A H
2003-09-01
Nutrient digestibility of broiler feeds containing different levels of variously processed rice bran stored for varying periods was determined. A total of 444 Hubbard male chicks were used to conduct four trials. Each trial was carried out on 111 chicks to determine digestibility of 36 different feeds. Chicks of 5 wk age were fed feeds containing raw, roasted, and extruded rice bran treated with antioxidant, Bianox Dry (0, 125, 250 g/ton), stored for a periods of 0, 4, 8, and 12 mo and used at levels of 0, 10, 20, and 30% in feeds. Digestibility coefficients for fat and fiber of feeds were determined. Increasing storage periods of rice bran significantly reduced the fat digestibility of feed, whereas no difference in fiber digestibility was observed. Processing of rice bran by extrusion cooking significantly increased digestibility of fat even used at higher levels in broiler feeds. Interaction of storage, processing, and levels was significant for fat digestibility. Treatments of rice bran by different levels of antioxidant had no effect on digestibility of fat and fiber when incorporated in broiler feed.
Zamanzadeh, Mirzaman; Parker, Wayne J
2018-01-01
The hydrolysis of mixed primary and secondary sludges in two-stage anaerobic digestion was evaluated and compared with conventional single-stage digestion, using various temperature-phased configurations of M1-M2, M1-T3, T1-T2, and T1-M3. A dual hydrolysis model best described the hydrolysis in all tests. This model was also able to consistently estimate the readily and slowly fractions of particulate chemical oxygen demand (COD) of raw sludge used in the tests. The hydrolysis kinetic coefficients (Khyd_s and Khyd_r) estimated for the mesophilic digesters were significantly greater in the short hydraulic retention time (HRT) M1 digester than those of the extended HRT digesters. Conversely, at thermophilic temperatures only Khyd_r was greater in short HRT T1 digester when compared to the extended HRT digesters. The increased Khyd_r and reduced Khyd_s values due to staging effect were explained with surface reaction models and endogenous decay. The temperature dependency of Khyd_s and Khyd_r was also explored in the staged digesters.
1980-07-01
span, ft (m) CD Drag coefficient, D/qS I CD Drag coefficient at zero lift CL Lift coefficient, L/qS CL Lift curve elope, aCL/aa I CL Maximum lift...recording on magnetic tape utilizing a Beckman 210 high-speed acquistion system. The wing-fuselage model was mounted in the test section such that...6, 7, and 8 show the tip sails have little impact on the zero or low-lift drag, but these j sails definitely influence the induced drag that is deve
USDA-ARS?s Scientific Manuscript database
The objective of this study was to determine amino acid digestibility of 4 feedstuffs [soybean meal (SBM), canola meal, fish meal, and meat and bone meal (MBM)] using the precision-fed cecectomized rooster assay (PFR), the standardized ileal assay (SIAAD), and a newly developed precision-fed ileal b...
Marinangeli, Christopher P F; House, James D
2017-01-01
Abstract Regulatory frameworks for protein content claims in Canada and the United States are underpinned by the protein efficiency ratio and protein digestibility-corrected amino acid score (PDCAAS), respectively, which are used to assess the protein quality of a given food. The digestible indispensable amino acid score (DIAAS) is a novel approach to measuring the protein quality of foods and is supported by the Food and Agriculture Organization of the United Nations. Methodological concerns about the PDCAAS are addressed by the DIAAS through introduction of the use of ileal amino acid digestibility coefficients and untruncated protein scores. However, before the DIAAS is widely adopted within regulatory frameworks, a comprehensive assessment is required. Accordingly, this review addresses the potential impact of the DIAAS on regulation, communication, and public health, as well as knowledge gaps, analytical challenges, and cost of implementation. A pragmatic approach to addressing protein quality is advocated by suggesting the use of conservative coefficients of digestibility that are derived from in vitro methods. Before adopting the DIAAS as a framework for supporting protein content claims, updated food-related regulations and policies should also be evaluated through a lens that anticipates the impact on consumer-facing nutrition communication, the adoption of dietary patterns that are nutritionally adequate, and a food value chain that fosters a spirit of food and nutritional innovation. PMID:28969364
The purpose of this SOP is to describe the acid digestion of soil, house dust, air filter, and surface or dermal wipe samples for analysis using inductively coupled plasma atomic emissions spectrometry (ICP-AES) and/or graphite furnace atomic absorption spectrometry (GFAAS) or fl...
Nasr, S M; Ateya, A I; Sadek, K M; Radwan, H A
The GH and MSTN gene polymorphisms and their association with body weight were declared in a population of 100 Friesian bull calves. For DNA extraction, collection of blood samples was carried out from the studied animals. The PCR for GH and MSTN genes yielded fragments of 329 and 1346 bp, respectively. The PCR-HpaII digestion of 329 bp of GH gene revealed three genotypes: AA genotype possess undigested fragment (329 bp), AB genotype has three fragments (329, 224 and 105 bp) and BB genotype has two fragments (224 and 105 bp). The GH genotypes incidence and alleles frequency were calculated. For the 100 Friesian bull calves, genotypic frequencies for the AA, AB and BB genotypes were 0.1, 0.78 and 0.12, respectively and the allele frequencies for A and B allele frequencies were 0.49 and 0.51. Statistical analysis revealed that there was a significant effect of GH genotypes on body weight. The AB genotype possessed higher body weight than the other 2 genotypes. Regarding MSTN gene, PCR-DraI digestion of 1346 bp fragment was monomorphic; where it yielded four fragments (505, 427, 321 and 93 bp) in all animals under study. The outcome of this study is that it highlights the effectiveness of GH/HpaII locus as candidate marker for body weight in cattle rather than MSTN/DraI.
Li, Guoliang; Cui, Yanyan; You, Jinmao; Zhao, Xianen; Sun, Zhiwei; Xia, Lian; Suo, Yourui; Wang, Xiao
2011-04-01
Analysis of trace amino acids (AA) in physiological fluids has received more attention, because the analysis of these compounds could provide fundamental and important information for medical, biological, and clinical researches. More accurate method for the determination of those compounds is highly desirable and valuable. In the present study, we developed a selective and sensitive method for trace AA determination in biological samples using 2-[2-(7H-dibenzo [a,g]carbazol-7-yl)-ethoxy] ethyl chloroformate (DBCEC) as labeling reagent by HPLC-FLD-MS/MS. Response surface methodology (RSM) was first employed to optimize the derivatization reaction between DBCEC and AA. Compared with traditional single-factor design, RSM was capable of lessening laborious, time and reagents consumption. The complete derivatization can be achieved within 6.3 min at room temperature. In conjunction with a gradient elution, a baseline resolution of 20 AA containing acidic, neutral, and basic AA was achieved on a reversed-phase Hypersil BDS C(18) column. This method showed excellent reproducibility and correlation coefficient, and offered the exciting detection limits of 0.19-1.17 fmol/μL. The developed method was successfully applied to determinate AA in human serum. The sensitive and prognostic index of serum AA for liver diseases has also been discussed.
A computational study of low-head direct chill slab casting of aluminum alloy AA2024
NASA Astrophysics Data System (ADS)
Hasan, Mainul; Begum, Latifa
2016-04-01
The steady state casting of an industrial-sized AA2024 slab has been modeled for a vertical low-head direct chill caster. The previously verified 3-D CFD code is used to investigate the solidification phenomena of the said long-range alloy by varying the pouring temperature, casting speed and the metal-mold contact heat transfer coefficient from 654 to 702 °C, 60-180 mm/min, and 1.0-4.0 kW/(m2 K), respectively. The important predicted results are presented and thoroughly discussed.
Lee, Eunyoung; Cumberbatch, Jewel; Wang, Meng; Zhang, Qiong
2017-03-01
Anaerobic co-digestion has a potential to improve biogas production, but limited kinetic information is available for co-digestion. This study introduced regression-based models to estimate the kinetic parameters for the co-digestion of microalgae and Waste Activated Sludge (WAS). The models were developed using the ratios of co-substrates and the kinetic parameters for the single substrate as indicators. The models were applied to the modified first-order kinetics and Monod model to determine the rate of hydrolysis and methanogenesis for the co-digestion. The results showed that the model using a hyperbola function was better for the estimation of the first-order kinetic coefficients, while the model using inverse tangent function closely estimated the Monod kinetic parameters. The models can be used for estimating kinetic parameters for not only microalgae-WAS co-digestion but also other substrates' co-digestion such as microalgae-swine manure and WAS-aquatic plants. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kraft, G; Ortigues-Marty, I; Durand, D; Rémond, D; Jardé, T; Bequette, B; Savary-Auzeloux, I
2011-04-01
We investigated the effect of relative changes in dietary nitrogen (N) and energy supply and the subsequent variations in net portal appearance (NPA) of nitrogenous and energy nutrients on the net amino acid (AA) uptake by the liver and net N supply to the peripheral tissues. Six lambs were catheterised across the splanchnic tissues and received, in a replicated Latin square, one of three dietary treatments. The diets were formulated to either match the requirements of N and energy (C), or supply only 0.8 of the N requirement (LN) or 0.8 of the energy requirement (LE). Net fluxes of AA and urea-N were measured across the portal-drained viscera, and estimation of arterial hepatic flow allowed the estimation of hepatic fluxes. Catheters were implanted into the portal and hepatic veins as well as in the abdominal aorta for the measurement of AA fluxes. Animals fed the LN diet showed more efficient N retention (0.59 of digested N) than did the C and LE diet (0.50 and 0.33, respectively; P < 0.001). The NPA of total AA-N for the LN diet was only 0.60 of the value measured for the control (C) diet (P < 0.01). Despite this, the total estimated AA-N net splanchnic fluxes were not significantly different across the three diets (3.3, 1.9 and 2.6 g total AA-N/day for C, LN and LE, respectively, P = 0.52). Thus, different metabolic regulations must have taken place across the liver between the three experimental diets. A combination of decreased net uptake of total AA-N by the liver of animals in the LN diet (0.61 of the C diet; P = 0.002) and reduced urinary urea-N production (0.52 of the C diet; P = 0.001) spared AA from catabolism in the LN diet relative to the other two diets. For the LE diet, the urinary urea-N output was 1.3 times the value of the C diet (P = 0.01). This may relate to an increased catabolism of AA by the muscle and/or, to a lesser extent, to an increased utilisation of AA for gluconeogenesis in the liver. These effects may explain the reduced whole body protein retention observed with the LE diet.
Maathuis, Annet; Havenaar, Robert; He, Tao; Bellmann, Susann
2017-01-01
ABSTRACT Objective: The aim of this study was to determine the kinetics of true ileal protein digestion and digestible indispensable amino acid score (DIAAS) of a goat milk-based infant formula (GIF), a cow milk-based infant formula (CIF), and human milk (HM). Methods: The GIF, CIF, and HM were investigated in an in vitro gastrointestinal model simulating infant conditions. Digested compounds were dialyzed from the intestinal compartment as bioaccessible fraction. Dialysate was collected in 15 to 60-minute periods for 4 hours. True ileal protein digestibility and DIAAS were determined as bioaccessible nitrogen (N) and amino acids. Results: N bioaccessibility from the GIF showed similar kinetics to that of HM. The CIF showed a delay in N bioaccessibility versus the GIF and HM. In the 1st hour of digestion, N bioaccessibility was 19.9% ± 3.5% and 23.3% ± 1.3% for the GIF and HM, respectively, and 11.2% ± 0.6% for CIF (P < 0.05 vs HM). In the 3rd hour of digestion, the N bioaccessibility was higher (P < 0.05) for the CIF (28.9% ± 1.2%) than for the GIF (22.5% ± 1.6%) and HM (20.6% ± 1.0%). After 4 hours, the true ileal protein digestibility of the GIF, CIF, and HM was 78.3% ± 3.7%, 73.4% ± 2.7%, and 77.9% ± 4.1%, respectively. The DIAAS for the GIF, CIF, and HM for 0- to 6-month-old infants was 83%, 75%, and 77% for aromatic AA. Conclusion: The protein quality is not different between the GIF, CIF, and HM, but the kinetics of protein digestion of the GIF is more comparable to that of HM than that of the CIF. PMID:28968291
Maathuis, Annet; Havenaar, Robert; He, Tao; Bellmann, Susann
2017-12-01
The aim of this study was to determine the kinetics of true ileal protein digestion and digestible indispensable amino acid score (DIAAS) of a goat milk-based infant formula (GIF), a cow milk-based infant formula (CIF), and human milk (HM). The GIF, CIF, and HM were investigated in an in vitro gastrointestinal model simulating infant conditions. Digested compounds were dialyzed from the intestinal compartment as bioaccessible fraction. Dialysate was collected in 15 to 60-minute periods for 4 hours. True ileal protein digestibility and DIAAS were determined as bioaccessible nitrogen (N) and amino acids. N bioaccessibility from the GIF showed similar kinetics to that of HM. The CIF showed a delay in N bioaccessibility versus the GIF and HM. In the 1st hour of digestion, N bioaccessibility was 19.9% ± 3.5% and 23.3% ± 1.3% for the GIF and HM, respectively, and 11.2% ± 0.6% for CIF (P < 0.05 vs HM). In the 3rd hour of digestion, the N bioaccessibility was higher (P < 0.05) for the CIF (28.9% ± 1.2%) than for the GIF (22.5% ± 1.6%) and HM (20.6% ± 1.0%). After 4 hours, the true ileal protein digestibility of the GIF, CIF, and HM was 78.3% ± 3.7%, 73.4% ± 2.7%, and 77.9% ± 4.1%, respectively. The DIAAS for the GIF, CIF, and HM for 0- to 6-month-old infants was 83%, 75%, and 77% for aromatic AA. The protein quality is not different between the GIF, CIF, and HM, but the kinetics of protein digestion of the GIF is more comparable to that of HM than that of the CIF.
Álvarez-Rodríguez, J; Mir, L; Seradj, A R; Morazán, H; Balcells, J; Babot, D
2017-10-01
Twelve lactating sows were used to evaluate the effects of reducing dietary crude protein (CP) (14% vs. 12%) and increasing neutral detergent fibre (NDF) levels (18% vs. 22%) on litter performance, total tract apparent digestibility and manure composition in a 4 × 4 latin square arrangement during a 36-day lactation period. Diets were isoenergetic (2.9 Mcal ME/kg) and had similar total lysine content (0.9%). In addition, a second aim was to compare a reference external marker method (Cr 2 O 3 ) with an internal feed marker [acid-insoluble ash (AIA)] for the calculation of apparent total tract digestibility of nutrients in lactating sows. The reduction of dietary CP level in lactating sows had no effect on either live-weight or backfat thickness or apparent total tract digestibility of nutrients. However, the piglets' average daily gain (ADG) was reduced in low dietary CP diets, which suggests that sows reduced milk production due to an underestimation of certain essential amino acid requirements (e.g. valine). The increase of dietary NDF level did not affect sow and litter performance. Nevertheless, the total tract apparent digestibility of organic matter, CP and carbohydrates was reduced, and ether extract digestion was increased in high NDF compared to normal NDF diets equally balanced for ME and lysine content. The coefficients of total tract apparent digestibility of nutrients in lactating sows were greater when using AIA compared to Cr 2 O 3 marker, regardless of dietary CP or NDF level, but their coefficients of variation were lower in the former than in the latter. In lactating sows, a trade-off between litter performance and nutrient digestion is established when reducing dietary CP or increasing NDF levels while maintaining similar lysine content through synthetic amino acids and balancing metabolizable energy through dietary fat sources. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.
Gandarillas, Mónica; Hodgkinson, Suzanne Marie; Riveros, José Luis; Bas, Fernando
2015-09-01
Morbid obesity is a worldwide health concern that compromises life quality and health status of obese human subjects. Bariatric surgery for treating morbid obesity remains as one of the best alternatives to promote excess weight loss and to reduce co-morbidities. We have not found studies reporting nutrients and energy balance considering digestibility trials in humans following surgery. The purpose of this study was to determine protein, lipid, fiber, energy, calcium, and phosphorous digestibility in a swine model that underwent ileal transposition (IT), sleeve gastrectomy with ileal transposition (SGIT), Roux-en-Y gastric bypass (RYGBP), and with sham operated animals (SHAM). Thirty-two pigs were randomly assigned to four laparoscopic procedures: IT (n = 8), RYGBP (n = 8), SGIT (n = 8), and Sham-operated pigs (n = 8). From day 0 postsurgery to 130, pigs were weighed monthly to determine live weight and weight gain was calculated for each month postsurgery until day 130. Food intake in a metabolic weight basis was calculated by measuring ad libitum food intake at day 130. Swine were fitted into metabolic crates to determine digestibility coefficients of dry matter, protein, fat, fiber, ash, energy, calcium, and phosphorous from day 130. A one-way ANOVA and Student-Newman-Keuls were used to detect differences in weight, food intake, and digestibility coefficients. Digestibility values for dry matter, fiber, phosphorus, and energy showed no differences among groups (P > 0.05). However, significant differences (P ≤ 0.05) were encountered among groups for fat, protein, ash, and calcium digestibilities. The RYGBP procedure, when applied to the pig model, significantly reduced calcium, fat, and ash digestibility, which did not occur with SGIT or IT procedure, when compared with Sham-operated animals. © 2015 by the Society for Experimental Biology and Medicine.
USDA-ARS?s Scientific Manuscript database
Apparent digestibility coefficients (ADCs) of nutrients (crude protein, amino acids, crude lipid, fatty acids, and minerals) were determined for fish meals derived from menhaden, Asian carp (combination of silver and bighead carps), and common carp in feeds for hybrid striped bass and rainbow trout....
USDA-ARS?s Scientific Manuscript database
Use of indigestible markers such as Cr2O3, Fe2O3, and TiO2 are commonly used in animal studies to evaluate rate of passage and nutrient digestibility. Yet nothing is known relative to their potential impact on fecal microbial ecology and subsequent VFA generation. Two experiments utilizing a total o...
Villa-Lojo, M C; Alonso-Rodríguez, E; López-Mahía, P; Muniategui-Lorenzo, S; Prada-Rodríguez, D
2002-06-10
A high performance liquid chromatography-microwave digestion-hydride generation-atomic absorption spectrometry (HPLC-MW-HG-AAS) coupled method is described for As(III), As(V), monomethylarsonic acid (MMA), dimethylarsinic acid (DMA), arsenobetaine (AsB) and arsenocholine (AsC) determination. A Hamilton PRP-X100 anion-exchange column is used for carrying out the arsenic species separation. As mobile phase 17 mM phosphate buffer (pH 6.0) is used for As(III), As(V), MMA and DMA separation, and ultrapure water (pH 6.0) for AsB and AsC separation. Prior to injection into the HPLC system AsB and AsC are isolated from the other arsenic species using a Waters Accell Plus QMA cartridge. A microwave digestion with K(2)S(2)O(8) as oxidizing agent is used for enhancing the efficiency of conversion of AsB and AsC into arsenate. Detection limits achieved were between 0.3 and 1.1 ng for all species. The method was applied to arsenic speciation in fish samples.
[The direct AAS determination of micro elements in hair and nail by base-digestion].
Ju, Hong-fang
2002-08-01
The study of micro elements is more and more extensively, and people can gain some informations by the level of micro elements in tissue. This paper tempts to dissolve hair or nail in 2 mol.L-1 NaOH and determinate nine micro elements including calcium, zinc, iron, manganese, nickel, cadmium, copper, lead and bismuth in them by base-digestion with FAAS and GFAAS. It shows that the measured value of these elements is coincident with reference articles reported, except bismuth. The elements' percent recoveries are 90.0%-110.8%. The result also shows that the level of zinc and copper in hair are higher than in nail, and the level of bismuth, cadmium and iron in hair are lower than in nail, but the level of micro elements in hair and in nail are not correlative.
NASA Astrophysics Data System (ADS)
Akter, Sharmin; Tanabe, Tomoki; Maejima, Satoshi; Kawauchi, Satoko; Sato, Shunichi; Hinoki, Akinari; Aosasa, Suefumi; Yamamoto, Junji; Nishidate, Izumi
2016-04-01
To quantify the changes in optical properties of in vivo rat liver tissue, we applied diffuse reflectance spectroscopy (DRS) system using single-reflectance fiber probe during ischemia and reperfusion evoked by hepatic portal occlusion (hepatic artery, portal vein and bile duct). Changes in the reduced scattering coefficient μ s', the absorption coefficient μ a, the tissue oxygen saturation StO2, and the oxidation of heme aa3 in cytochrome c oxidase (C cO) OHaa3 of in vivo rat liver (n = 6) were evaluated. Heme aa3 in C cO were significantly reduced (P < 0.05) during ischemia, which indicates a sign of mitochondrial energy failure induced by oxygen insufficiency of liver tissue. We found that OHaa3 obtained from the proposed method was unchanged immediately after the onset of ischemia and started gradually decreasing at 2 min after the onset of ischemia. Difference in the time course between OHaa3 and the conventional ratio metric analysis with μ a(605)/ μ a(620) reported in literature demonstrates that the proposed method is effective in reduction of optical cross talk between hemoglobin and heme aa3. Our results suggest that DRS technique is applicable and useful for assessing in vivo tissue viability and hemodynamics in liver intraoperatively.
Scholljegerdes, E J; Weston, T R; Ludden, P A; Hess, B W
2005-09-01
Twelve Angus crossbred cattle (eight heifers and four steers; average initial BW = 594 +/- 44.4 kg) fitted with ruminal and duodenal cannulas and fed restricted amounts of forage plus a ruminally undegradable protein (RUP) supplement were used in a triplicated 4 x 4 Latin square design experiment to determine intestinal supply of essential AA. Cattle were fed four different levels of chopped (2.54 cm) bromegrass hay (11.4% CP, 57% NDF; OM basis): 30, 55, 80, or 105% of the forage intake required for maintenance. Cattle fed below maintenance were given specified quantities of a RUP supplement (6.8% porcine blood meal, 24.5% hydrolyzed feather meal, and 68.7% menhaden fish meal; DM basis) designed to provide duodenal essential AA flow equal to that of cattle fed forage at 105% of maintenance. Experimental periods lasted 21 d (17 d of adaptation and 4 d of sampling). Total OM intake and duodenal OM flow increased linearly (P < 0.001) as cattle consumed more forage; however, OM truly digested in the rumen (% of intake) did not change (P = 0.43) as intake increased. True ruminal N degradation (% of intake) tended (P = 0.07) to increase linearly, and true ruminal N degradation (g/d) decreased quadratically (P = 0.02) as intake increased from 30 to 105%. Duodenal N flow was equal (P = 0.33) across intake levels, even though microbial N flow increased linearly (P < 0.001) as forage OM intake increased. Total and individual essential AA intake decreased (cubic; P < 0.001) as forage intake increased because the supply of nonammonia, nonmicrobial N flow from RUP was decreased (linear; P < 0.001) by design. Total duodenal flow of essential AA did not differ (P = 0.39) across these levels of forage intake. Although the profile of essential AA reaching the duodenum differed (P < or = 0.02) for all 10 essential AA, the range of each essential AA as a proportion of total essential AA was low (11.1 to 11.2% of total essential AA for phenylalanine to 12.3 to 14.3% of total essential AA for lysine). Duodenal essential AA flow did not differ (P = 0.10 to 0.65) with forage intake level for eight of the 10 essential AA. Duodenal flow of arginine decreased linearly (P = 0.01), whereas duodenal flow of tryptophan increased linearly (P = 0.002) as forage intake increased from 30 to 105% of maintenance. Balancing intestinal essential AA supply in beef cattle can be accomplished by varying intake of a RUP supplement.
Russell, Thomas R; Demeler, Borries; Tu, Shiao-Chun
2004-02-17
The homodimeric NADH:flavin oxidoreductase from Aminobacter aminovorans is an NADH-specific flavin reductase herein designated FRD(Aa). FRD(Aa) was characterized with respect to purification yields, thermal stability, isoelectric point, molar absorption coefficient, and effects of phosphate buffer strength and pH on activity. Evidence from this work favors the classification of FRD(Aa) as a flavin cofactor-utilizing class I flavin reductase. The isolated native FRD(Aa) contained about 0.5 bound riboflavin-5'-phosphate (FMN) per enzyme monomer, but one bound flavin cofactor per monomer was obtainable in the presence of excess FMN or riboflavin. In addition, FRD(Aa) holoenzyme also utilized FMN, riboflavin, or FAD as a substrate. Steady-state kinetic results of substrate titrations, dead-end inhibition by AMP and lumichrome, and product inhibition by NAD(+) indicated an ordered sequential mechanism with NADH as the first binding substrate and reduced FMN as the first leaving product. This is contrary to the ping-pong mechanism shown by other class I flavin reductases. The FMN bound to the native FRD(Aa) can be fully reduced by NADH and subsequently reoxidized by oxygen. No NADH binding was detected using 90 microM FRD(Aa) apoenzyme and 300 microM NADH. All results favor the interpretation that the bound FMN was a cofactor rather than a substrate. It is highly unusual that a flavin reductase using a sequential mechanism would require a flavin cofactor to facilitate redox exchange between NADH and a flavin substrate. FRD(Aa) exhibited a monomer-dimer equilibrium with a K(d) of 2.7 microM. Similarities and differences between FRD(Aa) and certain flavin reductases are discussed.
NASA Astrophysics Data System (ADS)
Seeger, Tassia S.; Machado, Eduarda Q.; Flores, Erico M. M.; Mello, Paola A.; Duarte, Fabio A.
2018-03-01
In this study, Na and K were determined in desalted crude oil by direct sampling graphite furnace atomic absorption spectrometry (DS-GF AAS), with the use of a Zeeman-effect background correction system with variable magnetic field. The analysis was performed in low and high sensitivity conditions. Sodium determination was performed in two low-sensitivity conditions: 1) main absorption line (589.0 nm), gas stop flow during the atomization step and 3-field dynamic mode (0.6-0.8 T); and 2) secondary absorption line (330.3 nm), gas stop flow during the atomization and 2-field mode (0.8 T). In K determination, some parameters, such as high-sensitivity mode, main absorption line (766.5 nm), gas stop flow during the atomization and 2-field mode (0.8 T), were used. Suitability of chemical modifiers, such as Pd and W-Ir was also evaluated. The heating program for Na and K was based on the pyrolysis and atomization curves. Calibration was performed by aqueous standards. Accuracy was evaluated by the analysis of Green Petroleum Coke (SRM NIST 2718) and Trace Elements in Fuel Oil (SRM NIST 1634c). Recovery tests were also performed and results were compared with those obtained by GF AAS after crude oil digestion by microwave-assisted digestion. The characteristic mass of Na was 17.1 pg and 0.46 ng in conditions 1 and 2, respectively, while the one of K was 1.4 pg. Limits of detection and quantification by DS-GF AAS were 30 and 40 ng g-1 for Na and 3.2 and 4.2 ng g-1 for K, respectively. Sodium and K were determined in three crude oil samples with API density ranging from 20.9 to 28.0. Sodium and K concentration ranged from 1.5 to 73 μg g-1 and from 23 to 522 ng g-1, respectively.
Kawauchi, Iris M; Sakomura, Nilva K; Pontieri, Cristiana F F; Rebelato, Aline; Putarov, Thaila C; Malheiros, Euclides B; Gomes, Márcia de O S; Castrillo, Carlos; Carciofi, Aulus C
2014-01-01
Animal by-product meals have large variability in crude protein (CP) content and digestibility. In vivo digestibility procedures are precise but laborious, and in vitro methods could be an alternative to evaluate and classify these ingredients. The present study reports prediction equations to estimate the CP digestibility of meat and bone meal (MBM) and poultry by-product meal (PM) using the protein solubility in pepsin method (PSP). Total tract CP digestibility of eight MBM and eight PM samples was determined in dogs by the substitution method. A basal diet was formulated for dog maintenance, and sixteen diets were produced by mixing 70 % of the basal diet and 30 % of each tested meal. Six dogs per diet were used to determine ingredient digestibility. In addition, PSP of the MBM and PM samples was determined using three pepsin concentrations: 0·02, 0·002 and 0·0002 %. The CP content of MBM and PM ranged from 39 to 46 % and 57 to 69 %, respectively, and their mean CP digestibility by dogs was 76 (2·4) and 85 (2·6) %, respectively. The pepsin concentration with higher Pearson correlation coefficients with the in vivo results were 0·0002 % for MBM (r 0·380; P = 0·008) and 0·02 % for PM (r 0·482; P = 0·005). The relationship between the in vivo and in vitro results was better explained by the following equations: CP digestibility of MBM = 61·7 + 0·2644 × PSP at 0·0002 % (P = 0·008; R (2) 0·126); and CP digestibility of PM = 54·1 + 0·3833 × PSP at 0·02 % (P = 0·005; R (2) 0·216). Although significant, the coefficients of determination were low, indicating that the models were weak and need to be used with caution.
Hsieh, Pei-Wen; Al-Suwayeh, Saleh A; Fang, Chia-Lang; Lin, Chwan-Fwu; Chen, Chun-Che; Fang, Jia-You
2012-06-01
A co-drug of hydroquinone (HQ) and azelaic acid (AA), bis(4-hydroxyphenyl)nonanedioate (BHN), was synthesized and investigated as a topical prodrug with the aim of improving the dermal delivery of the parent drugs. Physicochemical parameters were ascertained, and the enzymatic hydrolysis was examined. Skin permeation of HQ, AA, and BHN was studied by determining the skin deposition and flux across nude mouse skin under equivalent doses with the same thermodynamic activity. The partition coefficient (log P) of the co-drug increased by up to 5.0 with HQ and AA conjugation, which had respective log P values of 0.5 and 1.4. In the skin absorption experiment, BHN in ethanol/pH 7 buffer resulted in a 2-fold enhancement of skin deposition compared to both HQ and AA. With permeation using polyethylene glycol 400/pH 7 buffer as the vehicle, the co-drug, respectively, exhibited 8.1- and 1.4-fold enhancements of skin uptake compared to HQ and AA alone. The transdermal flux from BHN was negligible compared to those with HQ and AA treatments. The results of a preliminary safety evaluation showed no signs of stratum corneum disruption or erythema by BHN application within 24h. The co-drug approach provides a viable option for the treatment of skin hyperpigmentation of HQ and AA. Copyright © 2012 Elsevier B.V. All rights reserved.
Digestive parameters in young turkeys fed yucca saponin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dziuk, H.E.; Duke, G.E.; Buck, R.J.
1985-06-01
Yucca saponin fed in a concentration of 63 ppm to turkey poults at 6 to 14 weeks of age did not significantly improve weight gains, feed conversion, or digestive coefficients. Compared with nonstressed control groups, saponin-fed poults did not have significantly greater average weight gains or feed intakes when stressed by crowding (3 poults per cage) or by adding ammonia to the atmosphere (30 to 35 ppm).
Utilization of protein in red clover and alfalfa silages by lactating dairy cows and growing lambs.
Broderick, Glen A
2018-02-01
Feeding trials were conducted with lactating cows and growing lambs to quantify effects of replacing dietary alfalfa silage (AS) with red clover silage (RCS) on nutrient utilization. The lactation trial had a 2 × 4 arrangement of treatments: AS or RCS fed with no supplement, rumen-protected Met (RPM), rumen-protected Lys (RPL), or RPM plus RPL. Grass silage was fed at 13% of dry matter (DM) with AS to equalize dietary neutral detergent fiber (NDF) and crude protein contents. All diets contained (DM basis) 5% corn silage and 16% crude protein. Thirty-two multiparous (4 ruminally cannulated) plus 16 primiparous Holstein cows were blocked by parity and days in milk and fed diets as total mixed rations in an incomplete 8 × 8 Latin square trial with four 28-d periods. Production data (over the last 14 d of each period) and digestibility and excretion data (at the end of each period) were analyzed using the MIXED procedure of SAS (SAS Institute Inc., Cary, NC). Although DM intake was 1.2 kg/d greater on AS than RCS, milk yield and body weight gain were not different. However, yields of fat and energy-corrected milk as well as milk content of fat, true protein, and solids-not-fat were greater on AS. Relative to AS, feeding RCS increased milk and energy-corrected milk yield per unit of DM intake, milk lactose content, and apparent N efficiency and reduced milk urea. Relative to AS, apparent digestibility of DM, organic matter, NDF, and acid detergent fiber were greater on RCS, whereas apparent and estimated true N digestibility were lower. Urinary N excretion and ruminal concentrations of ammonia, total AA, and branched-chain volatile fatty acids were reduced on RCS, indicating reduced ruminal protein degradation. Supplementation of RPM increased intake, milk true protein, and solids-not-fat content and tended to increase milk fat content. There were no silage × RPM interactions, suggesting that RPM was equally limiting on both AS and RCS. Supplementation of RPL did not influence any production trait; however, a significant silage × RPL interaction was detected for intake: RPL reduced intake of AS diets but increased intake of RCS diets. Duplicated metabolism trials were conducted with lambs confined to metabolism crates and fed only silage. After adaptation, collections of silage refusals and excreta were made during ad libitum feeding followed by feeding DM restricted to 2% of body weight. Intake of DM was not different when silages were fed ad libitum. Apparent digestibility of DM, organic matter, NDF, and hemicellulose was greater in lambs fed RCS on both ad libitum and restricted intake; however, acid detergent fiber digestibility was only greater at restricted intake. Apparent and estimated true N digestibility was substantially lower, and N retention was reduced, on RCS. Results confirmed greater DM and fiber digestibility in ruminants and N efficiency in cows fed RCS. Specific loss of Lys bioavailability on RCS was not observed. Based on milk composition, Met was the first-limiting AA on both silages; however, Met was not limiting based on production and nutrient efficiency. Depressed true N digestibility suggested impaired intestinal digestibility of rumen-undegraded protein from RCS. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Zou, Wei; Sissons, Mike; Gidley, Michael J; Gilbert, Robert G; Warren, Frederick J
2015-12-01
The aim of the present study is to characterise the influence of gluten structure on the kinetics of starch hydrolysis in pasta. Spaghetti and powdered pasta were prepared from three different cultivars of durum semolina, and starch was also purified from each cultivar. Digestion kinetic parameters were obtained through logarithm-of-slope analysis, allowing identification of sequential digestion steps. Purified starch and semolina were digested following a single first-order rate constant, while pasta and powdered pasta followed two sequential first-order rate constants. Rate coefficients were altered by pepsin hydrolysis. Confocal microscopy revealed that, following cooking, starch granules were completely swollen for starch, semolina and pasta powder samples. In pasta, they were completely swollen in the external regions, partially swollen in the intermediate region and almost intact in the pasta strand centre. Gluten entrapment accounts for sequential kinetic steps in starch digestion of pasta; the compact microstructure of pasta also reduces digestion rates. Copyright © 2015 Elsevier Ltd. All rights reserved.
Xin, Xiao-Dong; He, Jun-Guo; Qiu, Wei; Tang, Jian; Liu, Tian-Tian
2015-01-01
Waste activated sludge from a lab-scale sequencing batch reactor was used to investigate the potential relation of microbial community with lysozyme digestion process for sludge solubilization. The results showed the microbial community shifted conspicuously as sludge suffered lysozyme digestion. Soluble protein and polysaccharide kept an increasing trend in solution followed with succession of microbial community. The rise of lysozyme dosage augmented the dissimilarity among communities in various digested sludge. A negative relationship presented between community diversity and lysozyme digestion process under various lysozyme/TS from 0 to 240min (correlation coefficient R(2) exceeded 0.9). Pareto-Lorenz curves demonstrated that microbial community tended to be even with sludge disintegration process by lysozyme. Finally, with diversity (H) decrease and community distribution getting even, the SCOD/TCOD increased steadily in solution which suggested the sludge with high community diversity and uneven population distribution might have tremendous potential for improving their biodegradability by lysozyme digestion. Copyright © 2014 Elsevier Ltd. All rights reserved.
Anaerobic digestion of dairy cattle manure autoheated by aerobic pretreatment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Achkari-Begdouri, A.
1989-01-01
A novel way to heat anaerobic digesters was investigated. Dairy cattle manure was autoheated by an aerobic pretreatment process and then fed to the anaerobic digester. Important physical properties of the dairy cattle manure were determined. These included bulk density, specific heat, thermal conductivity and the rheological properties; consistency coefficient, behavior index and apparent viscosity. These parameters were used to calculate the overall heat transfer coefficients, and to estimate the heat losses from the aerobic reactor to the outside environment. The total energy balance of the aerobic treatment system was then established. An optimization study of the main parameters influencingmore » the autoheating process showed that the total solids, the air flow rate and the stirring speed for operation of the aerobic pretreatment should be approximately 7%, 70 L/H and 1,400 rpm respectively. Temperatures as high as 65C were reached in 40 hours of aerobic treatment. At the above recommended levels of total solids, the air flow rate and the stirring speed, there was little difference in the energy requirements for heating the influent by aeration and heating the influent by a conventional heating system. In addition to the temperature increase, the aerobic pretreatment assisted in balancing the anaerobic digestion process and increased the methanogenesis of the dairy cattle manure. Despite the 8% decomposition of organic matter that occurred during the aerobic pretreatment process, methane production of the digester started with the aerobically heated manure was significantly higher (at least 20% higher) than of the digester started with conventionally heated manure. The aerobic system successfully autoheated the dairy cattle manure with an energy cost equal to that of conventionally heated influent.« less
Verlangieri, A J; Fay, M J; Bannon, A W
1991-01-01
The Osteogenic Disorder Shionogi (ODS) rat, Clea Inc., Tokyo, Japan lacks the ability to synthesize L-ascorbic acid (AA). As with man, monkey and the guinea pig, this rat lacks L-gulonolactone oxidase necessary for the synthesis of AA from glucose. This study shows this animal to be an alternative to the guinea pig in AA studies. The anti-scorbutic potency of Ester C (EC), a calcium ascorbate and calcium threonate mixture, was compared with an AA dose of equal ascorbate activity equivalents (AAE) for anti-scorbutic activity in the ODS rat. The minimal anti-scorbutic dose of EC was determined to be 0.44 mg/kg/day (AAE), while an AA dose of 0.51 mg/kg/day (AAE) was not anti-scorbutic in a 24 day study. At 24 days EC rats gained 125% of initial body weight (BW) and the AA rats only 45% BW. Scorbutic signs at 24 days were scored on a 0 (min) to 3 (max) scale. The EC/AA ratio scores were: hemorrhage 0/1.4, behavior change 0/2.0, piloerection 0/2.2, mobility 0.4/2.2, dysbasia 0.6/2.8 and ataxia 0.4/1.0. Pearson's correlation coefficient for BW versus AAE was r = .34 for the AA group and r = .90 for the EC group. The morbidity index for EC was 0/5 and for the AA group 2/5. The AAE dose of AA which was 16% higher/day than the EC AAE dose was not anti-scorbutic, while the EC dose was anti-scorbutic. EC rats had 3.5X greater weight gain, a sensitive indicator of scurvy, than the AA rats. EC rats had 3-4 times less, if any, scorbutic signs than AA rats. The results clearly show that, based on ascorbate activity equivalents, EC has more available ascorbate activity/potency than AA. The mechanism of this increased potency is believed to be due to the facilitated transport of AAE into the cell by the threonate (a normal in vivo metabolite of AA) present in the EC product. In addition, previous studies have shown EC (AAE) to be higher in plasma and excreted less rapidly than the AAE derived from AA administered orally.
Tank 40 Final Sludge Batch 8 Chemical Characterization Results
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bannochie, Christopher J.
2013-09-19
A sample of Sludge Batch 8 (SB8) was pulled from Tank 40 in order to obtain radionuclide inventory analyses necessary for compliance with the Waste Acceptance Product Specifications (WAPS). The SB8 WAPS sample was also analyzed for chemical composition, including noble metals, and fissile constituents, and these results are reported here. These analyses along with the WAPS radionuclide analyses will help define the composition of the sludge in Tank 40 that is currently being fed to the Defense Waste Processing Facility (DWPF) as SB8. At SRNL, the 3-L Tank 40 SB8 sample was transferred from the shipping container into amore » 4-L high density polyethylene bottle and solids were allowed to settle. Supernate was then siphoned off and circulated through the shipping container to complete the transfer of the sample. Following thorough mixing of the 3-L sample, a 553 g sub-sample was removed. This sub-sample was then utilized for all subsequent slurry sample preparations. Eight separate aliquots of the slurry were digested, four with HNO{sub 3}/HCl (aqua regia) in sealed Teflon(r) vessels and four with NaOH/Na{sub 2}O{sub 2} (alkali or peroxide fusion) using Zr crucibles. Two Analytical Reference Glass - 1 (ARG-1) standards were digested along with a blank for each preparation. Each aqua regia digestion and blank was diluted to 1:100 mL with deionized water and submitted to Analytical Development (AD) for inductively coupled plasma - atomic emission spectroscopy (ICP-AES) analysis, inductively coupled plasma - mass spectrometry (ICP-MS) analysis, atomic absorption spectroscopy (AA) for As and Se, and cold vapor atomic absorption spectroscopy (CV-AA) for Hg. Equivalent dilutions of the alkali fusion digestions and blank were submitted to AD for ICP-AES analysis. Tank 40 SB8 supernate was collected from a mixed slurry sample in the SRNL Shielded Cells and submitted to AD for ICP-AES, ion chromatography (IC), total base/free OH-/other base, total inorganic carbon/total organic carbon (TIC/TOC) analyses. Weighted dilutions of slurry were submitted for IC, TIC/TOC, and total base/free OH-/other base analyses. Activities for U-233, U-235, and Pu-239 were determined from the ICP-MS data for the aqua regia digestions of the Tank 40 WAPS slurry using the specific activity of each isotope. The Pu-241 value was determined from a Pu-238/-241 method developed by SRNL AD and previously described.« less
Tank 40 final sludge batch 9 chemical and fissile radionuclide characterization results
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bannochie, C. J.; Kubilius, W. P.; Pareizs, J. M.
A sample of Sludge Batch (SB) 9 was pulled from Tank 40 in order to obtain radionuclide inventory analyses necessary for compliance with the Waste Acceptance Product Specifications (WAPS)i. The SB9 WAPS sample was also analyzed for chemical composition, including noble metals, and fissile constituents, and these results are reported here. These analyses along with the WAPS radionuclide analyses will help define the composition of the sludge in Tank 40 that is fed to the Defense Waste Processing Facility (DWPF) as SB9. At the Savannah River National Laboratory (SRNL), the 3-L Tank 40 SB9 sample was transferred from the shippingmore » container into a 4-L high density polyethylene bottle and solids were allowed to settle. Supernate was then siphoned off and circulated through the shipping container to complete the transfer of the sample. Following thorough mixing of the 3-L sample, a 547 g sub-sample was removed. This sub-sample was then utilized for all subsequent slurry sample preparations. Eight separate aliquots of the slurry were digested, four with HNO3/HCl (aqua regiaii) in sealed Teflon® vessels and four with NaOH/Na2O2 (alkali or peroxide fusioniii) using Zr crucibles. Three Analytical Reference Glass – 1iv (ARG-1) standards were digested along with a blank for each preparation. Each aqua regia digestion and blank was diluted to 1:100 with deionized water and submitted to Analytical Development (AD) for inductively coupled plasma – atomic emission spectroscopy (ICP-AES) analysis, inductively coupled plasma – mass spectrometry (ICP-MS) analysis, atomic absorption spectroscopy (AA) for As and Se, and cold vapor atomic absorption spectroscopy (CV-AA) for Hg. Equivalent dilutions of the alkali fusion digestions and blank were submitted to AD for ICP-AES analysis. Tank 40 SB9 supernate was collected from a mixed slurry sample in the SRNL Shielded Cells and submitted to AD for ICP-AES, ion chromatography (IC), total base/free OH-/other base, total inorganic carbon/total organic carbon (TIC/TOC) analyses. Weighted dilutions of slurry were submitted for IC, TIC/TOC, and total base/free OH-/other base analyses. Activities for U-233, U-235, and Pu-239 were determined from the ICP-MS data for the aqua regia digestions of the SB9 WAPS slurry using the specific activity of each isotope. The Pu-241 value was determined from a Pu-238/-241 method developed by SRNL AD and previously described.v« less
Wood digestion in Pselactus spadix Herbst--a weevil attacking marine timber structures.
Oevering, Pascal; Pitman, Andrew J; Pandey, Krishna K
2003-04-01
Pselactus spadix tunnels timber structures in the marine environment. Recent studies reported a cosmopolitan distribution for this weevil, which is frequently found in harbour and port areas. P. spadix feeds on timber (hardwood and softwood) in immature and adult life stages, but its digestion of wood components had not been investigated. Using dry weight analyses of tunnel walls and frass produced, P. spadix adults consumed Scots pine with soft rot decay at a rate of 1.59 +/- 0.37 mg d-1 and the digestibility of this substrate was 57.96 +/- 5.89 (i.e. for 100 mg consumed SR-pine, 58 mg was digested). Using gravimetric analysis to quantify structural wood components in tunnel walls and frass, P. spadix adults were found to digest cellulose, lignin and hemicellulose with digestibility coefficients of 82.2, 41.2 and 14.5 respectively. Fourier Transform Infrared (FTIR) spectroscopy analyses of tunnel walls and frass of adults and larvae from soft rotted pine also indicated digestion of all structural components, with larvae digesting cellulose and lignin more efficiently than adults. When FTIR was employed to analyse adult tunnel walls and frass from undecayed pine, cellulose and hemicellulose were digested, but no evidence of lignin digestion was found. This study shows that adults digest lignin when soft rot is present and suggests a symbiotic function of wood degrading microorganisms.
Son, Jee Young; Ko, Sung Min; Choi, Jin Woo; Song, Meong Gun; Hwang, Hweung Kon; Lee, Sook Jin; Kang, Joon-Won
2011-12-01
We aimed to evaluate the diagnostic performance of dual-source computed tomography coronary angiography (DSCT-CA) in the measurement of the ascending aorta (AA) diameter and compare the AA diameter in patients with severe bicuspid aortic valve (BAV) and tricuspid aortic valve (TAV) stenosis. Eighty-eight consecutive patients (50 men, mean age 60.3 ± 13 year) with severe aortic stenosis (AS) underwent DSCT-CA before aortic valve surgery. Seventy-four of the 88 patients underwent cardiovascular magnetic resonance (CMR). The internal diameter of AA was measured from early-systole with DSCT-CA and CMR by 2 radiologists independently at 4 levels (aortic annulus, sinuses of Valsalva, sinotubular junction, and tubular portion at the right pulmonary artery). The patients were divided in to 2 groups (BAV [n = 53]; TAV [n = 35]) according to operative findings. Patients with BAV were significantly younger than those with TAV (P = 0.0035). Inter-observer agreement of AA diameters at 4 levels with DSCT-CA and CMR was excellent (intraclass correlation coefficient = 0.89-0.97). Also, the DSCT-CA and CMR measurements of the AA diameter strongly correlated (r = 0.871-0.976). Mean diameter of the AA by DSCT-CA was significantly larger in patients with BAV (34.4 ± 8.2 mm) as compared to those with TAV (30.6 ± 5.5 mm). The diameters at the sinuses of Valsalva, sinotubular junction, and tubular portion were significantly larger in BAV than in TAV. Twenty-two of 53 (41.5%) patients with BAV and 2 of 35 (5.7%) patients with TAV had AA dilatation > 45 mm. DSCT-CA allows accurate assessment of the AA diameters in patients with severe AS. Patients with severe BAV stenosis had larger AA diameters and higher prevalence of AA dilatation > 45 mm as compared to those with severe TAV stenosis.
Evaluation of thrombelastographic platelet-mapping in healthy cats.
Blois, Shauna L; Banerjee, Amrita; Wood, R Darren
2012-06-01
Thrombelastography (TEG) permits analysis of clot formation but it is not specific for platelet activity. TEG PlateletMapping (TEG-PM) is a modification of TEG that uses adenosine diphosphate (ADP) and arachidonic acid (AA) as platelet agonists to define the contribution of platelets to clot formation. The objectives of this study were to determine values for TEG-PM in healthy cats and the interassay variation of TEG-PM. TEG-PM analysis was performed on blood specimens collected from 12 healthy cats and was repeated using a second blood specimen collected 2 hours later. Maximum amplitudes generated by thrombin (MA(thrombin)), fibrin (MA(fibrin)), ADP-stimulated platelet activity (MA(ADP)), and AA-stimulated platelet activity (MA(AA)) were recorded. Mean ± SD for MA(thrombin) was 51.1 ± 8.5 mm, for MA(fibrin) was 32.3 ± 17.7 mm, for MA(ADP) was 32.3 ± 15.0 mm, and for MA(AA) was 24.5 ± 12.2 mm. Mean MA(ADP) and MA(fibrin) were not significantly different, whereas mean MA(AA) was significantly lower than mean MA(fibrin). Results from the first and second specimens were not significantly different. Correlation between the first and second specimens was moderate for MA(thrombin), MA(fibrin), and MA(ADP), but was poor for MA(AA). A high degree of variability (coefficient of variation 47.7-60.0%) was observed for MA(fibrin), MA(ADP), and MA(AA). As MA(ADP) and MA(AA) (AA) were the same as or lower than MA(fibrin), a valid baseline to determine platelet-stimulated clot formation could not be established. Considerable interassay variation and wide intervals for MA(fibrin), MA(ADP), and MA(AA) values in this study indicate that TEG-PM should be used cautiously in feline patients. Several preanalytical factors should be examined in further detail. © 2012 American Society for Veterinary Clinical Pathology.
Anumula, Kalyan Rao
2008-02-01
A novel method for the analysis of Ser/Thr-linked sugar chains was made possible by the virtue of unique anthranilic acid (AA, 2-aminobenzoic acid [2AA]) chemistry for labeling carbohydrates in aqueous salt solutions (K. R. Anumula, Anal. Biochem. 350 (2006) 1-23). The protocol for profiling of Ser/Thr carbohydrates by hydrazinolysis was made simple by eliminating intermediary isolation steps involved in a sample preparation such as desalting and various chromatographic purification schemes. A 6-h hydrazinolysis was carried out at 60 degrees C for O-linked oligosaccharides and at 95 degrees C for total oligosaccharides (N-linked with some O-linked). Following evaporation of hydrazine (<10 min), the oligosaccharides were N-acetylated and derivatized with AA in the same reaction mixture containing salts. Presumably, the glycosyl-hydrazines/hydrazones present in the mixture did not interfere with AA labeling. Because AA is the most fluorescent and highly reactive tag for labeling carbohydrates, the procedures described are suitable for the analysis of a limited amount of samples ( approximately 5 microg) by the current high-resolution high-performance liquid chromatography (HPLC) methods. HPLC conditions developed for the separation of O-linked sugar chains based on size on an amide column were satisfactory for quantitative profiling and characterization. Common O-linked sugar chains found in fetuin, equine chorionic gonadotropin, and glycophorin can be analyzed in less than 50 min. In addition, these fast profiling methods were comparable to profiling by PNGase F (peptide N-glycosidase from Flavobacterium meningosepticum) digestion in terms of time, effort, and simplicity and also were highly reproducible for routine testing. The procedures for the release of sugar chains by hydrazinolysis at the microgram level, labeling with fluorescent tag AA, and profiling by HPLC should be useful in characterization of carbohydrates found in glycoproteins.
Physiopathology and Management of Gluten-Induced Celiac Disease.
Kumar, Jitendra; Kumar, Manoj; Pandey, Rajesh; Chauhan, Nar Singh
2017-02-01
Proline- and glutamine-rich gluten proteins are one of the major constituents of cereal dietary proteins, which are largely resistant to complete cleavage by the human gastrointestinal (GI) digestive enzymes. Partial digestion of gluten generates approximately 35 amino acids (aa) immunomodulatory peptides which activate T-cell-mediated immune system, followed by immunological inflammation of mucosa leading to the onset of celiac disease (CD). CD is an autoimmune disease associated with HLA-DQ2/DQ8 polymorphism and dysbiosis of gut microbiota. CD is either diagnosed using duodenal mucosal biopsis or serological testing for transglutaminase 2 (TG2) specific antibodies (IgA and IgG). Current therapy for CD management is gluten-free diet, while other therapies like glutenase, probiotics, immunomodulation, jamming of HLA-DQ2, inhibition of TG2, and gluten tolerance aided by gluten tolerizing vaccines are being developed. © 2017 Institute of Food Technologists®.
Masey-O'Neill, H V; Singh, M; Cowieson, A J
2014-01-01
1. A previous experiment reported that caecal temperature was negatively correlated with d 49 feed conversion ratio (FCR). This increased temperature in the caeca may indicate a prebiotic effect. An experiment was designed to investigate whether caecal temperature was affected in diets based on maize and whether other portions of the tract were affected. 2. A total of 25 Ross 308-d-old male broilers were allocated to each of 8 replicate pens per treatment. Treatments followed a 2 × 3 factorial design: two diets based on wheat or maize and three levels of enzyme addition, 0, 16 000 or 32 000 BXU/kg. Growth performance was assessed between d 1 and 49. Digestibility measurements were taken at d 28 and 49. On d 49, the excised small and large intestine of each bird was thermally imaged, weighed and volatile fatty acids (VFA) measured. 3. On d 28 and d 49, birds on the maize diets had higher feed intake and weight gain than those offered wheat diets. Additionally, on d 28, birds that received the maize diet had lower FCR than those offered the wheat diet. Enzyme improved FCR at d 49, independently of cereal. On d 28, enzyme improved the coefficient of apparent ileal DM digestibility and the coefficient of apparent ileal nitrogen digestibility. Enzyme only improved apparent ileal digestible energy in wheat-based diets (interactive term). On d 49, all digestibility parameters were improved by enzyme. Enzyme increased gizzard weight in maize-fed birds and the caeca of those fed wheat were heavier. The higher enzyme dose decreased duodenal temperature. In summary of VFA data, wheat-based diets produced more total VFAs and the total amount also increased with enzyme. 4. It appears from this study that there is equal potential in both wheat and maize diets for xylanase to improve performance of broilers probably through different mechanisms.
Cowieson, A J; Masey O'Neill, H V
2013-06-01
1. Five dietary treatments were used in a 49 d broiler trial to assess the effect of xylanase on performance, nutrient digestibility and thermal profiles of the caeca and head. Treatments included an industry-standard control diet and four further diets where xylanase was introduced with or without a metabolisable energy density dilution either from day one or the introduction was delayed until d 28. 2. The addition of xylanase with no associated energy dilution from day one resulted in the most consistent beneficial effects on performance, with significant improvements in weight gain compared with the industry-standard to d 28 and at d 49. Addition of xylanase from d 28 (with no energy dilution) was the second most successful strategy and resulted in a significant improvement in feed conversion ratio (FCR) from d 29 to 49 and overall. 3. Addition of xylanase improved ileal digestible energy values at d 28 by around 0.35 MJ/kg and ileal nitrogen digestibility coefficients by around 3%. On d 49 xylanase improved ileal digestible energy values by around 0.9 MJ/kg and ileal nitrogen digestibility coefficients by around 4.6%. 4. Thermal imaging of the head and caeca of three birds per replicate on d 49 revealed a significant increase in caecal surface temperature following xylanase addition with no effect on head temperature profile. These increases were particularly large (around 1.4ºC, or 3.9%) when xylanase was added from day one with no corresponding energy dilution in feed formulation. 5. It can be concluded that supplemental xylanase is effective in improving performance and nutrient digestibility in broilers given wheat-based diets. The correlation between the magnitude of this effect and the increased temperature in the caeca presents additional evidence that the hind-gut microflora may play an important, if yet unquantified, role in the outworking of these mechanisms.
Hernandez-Patlan, D; Solis-Cruz, B; Méndez-Albores, A; Latorre, J D; Hernandez-Velasco, X; Tellez, G; López-Arellano, R
2018-02-01
To compare the conventional plating method vs a fluorometric method using PrestoBlue ® as a dye by determining the antimicrobial activity of two organic acids and curcumin (CUR) against Salmonella Enteritidis in an avian in vitro digestion model that simulates the crop, proventriculus and intestine. A concentration of 10 8 CFU per ml of S. Enteritidis was exposed to groups with different rates of ascorbic acid (AA), boric acid (BA) and CUR. Significant differences were observed when the means of the treatments were compared with the controls in the compartments that simulate the crop and intestine (P < 0·05). Ascorbic acid alone and high rates of AA in the mixtures were the most efficient treatments in the crop compartment. However, in the intestinal compartment BA alone and at different rates in the mixture BA-CUR (1 : 1) were the best treatments to decrease the concentration of S. Enteritidis. The results of this study suggest that there could be an antagonistic bactericidal effect between AA and CUR and AA and BA as well as a synergistic bactericidal effect between BA and CUR. These findings may contribute to the development of a formulation with microencapsulated compounds to liberate them in different compartments to combat S. Enteritidis infections in broiler chickens. © 2017 The Society for Applied Microbiology.
Yin, Dongxue; Liu, Wei; Zhai, Ningning; Feng, Yongzhong; Yang, Gaihe; Wang, Xiaojiao; Han, Xinhui
2015-01-01
This study investigated the effect of sunlight-dark conditions on volatile fatty acids (VFAs), total ammonium nitrogen (TAN), total alkalinity (TA) and pH during pig manure (PM) digestion and then the subsequent influence on biogas yield of PM. PM1 and PM2 were performed in a transparent reactor and a non-transparent reactor, respectively. Two sets of experiments were conducted with a temperature of 35.0±2.0 °C and a total solid concentration of 8.0% to the digestion material. The dynamic change of the four parameters in response to sunlight-dark conditions resulted in variations of the physiological properties in the digester and affected the cumulative biogas production (CBP). PM1 obtained higher CBP (15020.0 mL) with a more stable pH and a lower TAN concentration (1414.5 mg/L) compared to PM2 (2675.0 mL and 1670.0 mg/L, respectively). The direct path coefficients and indirect path coefficients between the four parameters and CBP were also analyzed. PMID:25970266
Yin, Dongxue; Liu, Wei; Zhai, Ningning; Feng, Yongzhong; Yang, Gaihe; Wang, Xiaojiao; Han, Xinhui
2015-01-01
This study investigated the effect of sunlight-dark conditions on volatile fatty acids (VFAs), total ammonium nitrogen (TAN), total alkalinity (TA) and pH during pig manure (PM) digestion and then the subsequent influence on biogas yield of PM. PM1 and PM2 were performed in a transparent reactor and a non-transparent reactor, respectively. Two sets of experiments were conducted with a temperature of 35.0±2.0 °C and a total solid concentration of 8.0% to the digestion material. The dynamic change of the four parameters in response to sunlight-dark conditions resulted in variations of the physiological properties in the digester and affected the cumulative biogas production (CBP). PM1 obtained higher CBP (15020.0 mL) with a more stable pH and a lower TAN concentration (1414.5 mg/L) compared to PM2 (2675.0 mL and 1670.0 mg/L, respectively). The direct path coefficients and indirect path coefficients between the four parameters and CBP were also analyzed.
Accommodative amplitude using the minus lens at different near distances
Momeni-Moghaddam, Hamed; Ng, Jason S; Cesana, Bruno Mario; Yekta, Abbas Ali; Sedaghat, Mohammad Reza
2017-01-01
Purpose: The purpose of this study was to compare the mean findings and the repeatability of the minus lens (ML) amplitude of accommodation (AA) at 33 cm and 40 cm. Materials and Methods: AA was measured from the dominant eye of 120 fully corrected subjects using the ML procedure when viewing the target at both 33 and 40 cm. Each measurement was repeated between 24 and 48 hours after the first trial. Results: Mean AA when tested at 33 cm and 40 cm was 10.20 diopter (D) (standard deviation [SD] =1.24) and 8.85 D (SD = 1.23), respectively (P < 0.001). The limits of agreement of the measured amplitude calculated with taking into account of the replicates at 33 and 40 cm were − 0.19 (95% confidence interval [CI]: −0.34 to −0.04) and 2.53 (95% CI: 2.38 to 2.68), respectively. The repeatability of testing at the two distances 33 and 40 cm was ± 1.24 and ± 0.99, respectively. In addition, the retest reliability of measured amplitude using the intraclass correlation coefficient was 0.87 (95% CI: 0.789–0.920) at 33 cm and 0.91 (95% CI: 0.872–0.945) at 40 cm. Conclusion: There is no agreement in the obtained amplitude at the two measurement distances. Testing the ML AA at 40 cm may be superior given that a lower repeatability coefficient was observed. However, it is unclear whether the larger amplitude measured at 33 cm reflects a larger increase in accommodation (greater proximity effect) or a decrease in the ability to perceive the first slight sustained blur. PMID:28440251
Rinne, M; Kuoppala, K; Ahvenjärvi, S; Vanhatalo, A
2015-12-01
The effects of rapeseed and soya bean expeller (SBE) supplementation on digestion and milk production responses in dairy cows were investigated in an incomplete Latin square design using five cows and four 3-week periods. The experimental diets consisted of five concentrate treatments fed at a rate of 9 kg/day: a mixture of barley and oats, which was replaced with rapeseed or SBE at two levels (CP concentration (g/kg dry matter (DM)) of 130 for the control concentrate and 180 and 230 for the two protein supplemented levels). A mixture of grass and red clover silage (1:1) was fed ad libitum and it had a CP concentration of 157 g/kg DM. Supply of nutrients to the lower tract was measured using the omasal canal sampling technique, and total digestion from total faecal collection. Protein supplementation increased omasal canal amino acid (AA) flows and plasma concentrations of AA, and was also reflected as increased milk production. However, N use efficiency (NUE) decreased with increased protein supplementation. Rapeseed expeller (RSE) tended to increase silage DM intake and elicited higher milk production responses compared with SBE and also resulted in a higher NUE. The differences between the protein supplements in nitrogen metabolism were relatively small, for example, there were no differences in the efficiency of microbial protein synthesis or omasal canal flows of nitrogenous components between them, but plasma methionine concentration was lower for soya bean-fed cows at the high CP level in particular. The lower milk protein production responses to SBE than to RSE supplementation were at least partly caused by increased silage DM and by the lower methionine supply, which may further have been amplified by the use of red clover in the basal diet. Although feed intake, diet digestion, AA supply and milk production were all consistently improved by protein supplementation, there was a simultaneous decrease in NUE. In the current study, the milk protein production increased only 9% and energy-corrected milk production by 7% when high level of protein supplementation (on average 2.9 kg DM/day) was compared with the control diet without protein supplementation showing that dairy production could be sustained at a high level even without external protein supplements, at least in the short term. The economic and environmental aspects need to be carefully evaluated when decisions about protein supplementation for dairy cows are taken.
2017-01-01
We have calculated the excess free energy of mixing of 1053 binary mixtures with the OPLS-AA force field using two different methods: thermodynamic integration (TI) of molecular dynamics simulations and the Pair Configuration to Molecular Activity Coefficient (PAC-MAC) method. PAC-MAC is a force field based quasi-chemical method for predicting miscibility properties of various binary mixtures. The TI calculations yield a root mean squared error (RMSE) compared to experimental data of 0.132 kBT (0.37 kJ/mol). PAC-MAC shows a RMSE of 0.151 kBT with a calculation speed being potentially 1.0 × 104 times greater than TI. OPLS-AA force field parameters are optimized using PAC-MAC based on vapor–liquid equilibrium data, instead of enthalpies of vaporization or densities. The RMSE of PAC-MAC is reduced to 0.099 kBT by optimizing 50 force field parameters. The resulting OPLS-PM force field has a comparable accuracy as the OPLS-AA force field in the calculation of mixing free energies using TI. PMID:28418655
Endo, Yuichiro; Miyachi, Yoshiki; Arakawa, Akiko
2012-01-01
Alopecia areata (AA) is a common hair loss disorder that frequently follows a chronic course. Although AA is apparently associated with disturbance of quality of life (QoL), no disease-specific instrument to measure the QoL has been developed. This study was conducted to develop a disease-specific self-administered instrument to measure AA patients' QoL (AAQ). A two-step cross-sectional study was conducted. Items were generated from qualitative interviews with five patients with AA (two men and three women, age 28±6.4 years). Then, a preliminary questionnaire was produced and delivered to the patients (n=122). The AAQ was examined in terms of statistical performance. The AAQ included 7 items in the following three subscales: 'restriction of activity', 'concealment' and 'adaptation'. The reliability of internal consistency was fair with Cronbach's alpha coefficients of 0.59-81 for each subscale. Confirmatory factor analysis and correlation analysis demonstrated that the AAQ had good construct validity. Interestingly, the AAQ was only correlated with subjective severity scores as rated by the patients, but not with objective disease severity assessed by investigators.
Zhang, Hua; Kurgan, Lukasz
2014-12-01
Knowledge of protein flexibility is vital for deciphering the corresponding functional mechanisms. This knowledge would help, for instance, in improving computational drug design and refinement in homology-based modeling. We propose a new predictor of the residue flexibility, which is expressed by B-factors, from protein chains that use local (in the chain) predicted (or native) relative solvent accessibility (RSA) and custom-derived amino acid (AA) alphabets. Our predictor is implemented as a two-stage linear regression model that uses RSA-based space in a local sequence window in the first stage and a reduced AA pair-based space in the second stage as the inputs. This method is easy to comprehend explicit linear form in both stages. Particle swarm optimization was used to find an optimal reduced AA alphabet to simplify the input space and improve the prediction performance. The average correlation coefficients between the native and predicted B-factors measured on a large benchmark dataset are improved from 0.65 to 0.67 when using the native RSA values and from 0.55 to 0.57 when using the predicted RSA values. Blind tests that were performed on two independent datasets show consistent improvements in the average correlation coefficients by a modest value of 0.02 for both native and predicted RSA-based predictions.
Interdiffusion and reaction between pure magnesium and aluminum alloy 6061
Kammerer, C. C.; Fu, Mian; Zhou, Le; ...
2015-06-01
Using solid-to-solid couples investigation, this study characterized the reaction products evolved and quantified the diffusion kinetics when pure Mg bonded to AA6061 is subjected to thermal treatment at 300°C for 720 hours, 350°C for 360 hours, and 400°C for 240 hours. Characterization techniques include optical microscopy, scanning electron microscopy with X-ray energy dispersive spectroscopy, and transmission electron microscopy. Parabolic growth constants were determined for γ-Mg 17Al 12, β-Mg 2Al 3, and the elusive ε-phase. Similarly, the average effective interdiffusion coefficients of major constituents were calculated for Mg (ss), γ-Mg 17Al 12, β-Mg 2Al 3, and AA6061. The activation energies andmore » pre-exponential factors for both parabolic growth constant and average effective interdiffusion coefficients were computed using the Arrhenius relationship. The activation energy for growth of γ-Mg 17Al 12 was significantly higher than that for β-Mg 2Al 3 while the activation energy for interdiffusion of γ-Mg 17Al 12 was only slightly higher than that for β-Mg 2Al 3. As a result, comparisons are made between the results of this study and those of diffusion studies between pure Mg and pure Al to examine the influence of alloying additions in AA6061.« less
Gonçalves, Renata L. S.; Machado, Ana Carolina L.; Paiva-Silva, Gabriela O.; Sorgine, Marcos H. F.; Momoli, Marisa M.; Oliveira, Jose Henrique M.; Vannier-Santos, Marcos A.; Galina, Antonio; Oliveira, Pedro L.; Oliveira, Marcus F.
2009-01-01
Background Hematophagy poses a challenge to blood-feeding organisms since products of blood digestion can exert cellular deleterious effects. Mitochondria perform multiple roles in cell biology acting as the site of aerobic energy-transducing pathways, and also an important source of reactive oxygen species (ROS), modulating redox metabolism. Therefore, regulation of mitochondrial function should be relevant for hematophagous arthropods. Here, we investigated the effects of blood-feeding on flight muscle (FM) mitochondria from the mosquito Aedes aegypti, a vector of dengue and yellow fever. Methodology/Principal Findings Blood-feeding caused a reversible reduction in mitochondrial oxygen consumption, an event that was parallel to blood digestion. These changes were most intense at 24 h after blood meal (ABM), the peak of blood digestion, when oxygen consumption was inhibited by 68%. Cytochromes c and a+a 3 levels and cytochrome c oxidase activity of the electron transport chain were all reduced at 24 h ABM. Ultrastructural and molecular analyses of FM revealed that mitochondria fuse upon blood meal, a condition related to reduced ROS generation. Consistently, BF induced a reversible decrease in mitochondrial H2O2 formation during blood digestion, reaching their lowest values at 24 h ABM where a reduction of 51% was observed. Conclusion Blood-feeding triggers functional and structural changes in hematophagous insect mitochondria, which may represent an important adaptation to blood feeding. PMID:19924237
Zhang, Yanyan; Pignatello, Joseph J; Tao, Shu; Xing, Baoshan
2015-03-17
Polycyclic aromatic hydrocarbons (PAHs) associated with soot or black carbon can enter the human digestive tract by unintentional ingestion of soil or other particles. This study investigated the bioaccessibility of 11 PAHs in a composite fuel soot sample using an in vitro digestive model that included silicone sheet as an absorptive sink during the small intestinal digestion stage. The sheet was meant to simulate the passive transfer of PAHs in lumen fluid across the small intestinal epithelium, which was postulated to promote desorption of labile PAHs from the soot by steepening the soot-fluid concentration gradient. We show that the presence of silicone sheet during a 4 h default digestion time significantly increased the apparent bioaccessible fraction (Bapp, %), defined as the sum in the sheet and digestive fluid relative to the total PAH determined. The ability to increase Bapp for most PAHs leveled off above a sheet-to-soot ratio of 2.0 g per 50 mg, indicating that the sheet is an effective absorptive sink and promotes desorption in the mentioned way. Enhancement of Bapp by the sheet correlated positively with the octanol-water partition coefficient (Kow), even though the partition coefficient of PAH between sheet and digestive fluid (which contains bile acid micelles) correlated negatively with Kow. It was hypothesized that PAHs initially in the soot exist in labile and nonlabile states. The fraction of labile PAH still sorbed to the soot residue after digestion, and the maximum possible (limiting) bioaccessibility (Blim) could be estimated by varying the sheet-to-soot ratio. We show conclusively that the increase in bioccessibility due to the presence of the sheet is accounted for by a corresponding decrease in fraction of labile PAH still sorbed to the soot. The Blim ranged from 30.8 to 62.4%, independent of molecular size. The nonlabile fraction of individual PAHs (69.2-37.6% in this case) is therefore large and needs to be taken into account in risk assessment.
Oso, Abimbola Oladele; Idowu, Olusegun Mark Obawale; Jegede, Adebayo Vincent; Olayemi, Wasiu A; Lala, Olubukola A; Bamgbose, Adeyemi Mustapha
2012-10-01
The effect of dietary inclusion of fermented pigeon pea meal (FPPM) on growth response, apparent nutrient digestibility, haematological indices and serum biochemistry of cockerel chicks was studied using 240-day-old cockerel chicks allotted to four dietary treatments consisting of 60 birds each. Four experimental diets were formulated to include FPPM at 0, 50, 100 and 150 g/kg inclusion levels, respectively. Each of the diets was fed to 60 birds replicated six times with ten birds per replicate. The feeding trial lasted for 56 days. Results indicated that final live weight (linear (L). quadratic (Q): P < 0.05), weight gain (L.Q: P < 0.01), feed intake (Q.: P < 0.05) and coefficient of total tract apparent crude protein digestibility (P < 0.05) were reduced with increasing dietary inclusion of FPPM. Similar improved feed-to-gain ratios were obtained for chicks fed the control and those fed a diet containing 50 g/kg FPPM. Coefficient of total tract apparent ether extract and ash digestibility were not affected (P > 0.05) by the inclusion of FPPM. Haemoglobin and serum uric acid concentrations were also reduced (P < 0.05) with increasing dietary inclusion of FPPM. Chicks fed with 150 g/kg FPPM had the least (P < 0.05) packed cell volume, red blood cell and neutrophil count. It was concluded that dietary inclusion of up to 50 g/kg FPPM could be used in the ration for cockerel chicks without imposing any threat on the growth response, nutrient digestibility and blood constituents.
Faraji, Mohammad; Hamdamali, Mohammadrezza; Aryanasab, Fezzeh; Shabanian, Meisam
2018-07-13
In this research, an ultrasonic-assisted extraction followed by 2-naphthalenthiol derivatization and dispersive liquid-liquid microextraction of acrylamide (AA) was developed as simple and sensitive sample preparation method for AA in bread and biscuit samples using high performance liquid chromatography. Influence of derivatization and microextraction parameters were evaluated and optimized. Results showed that the derivatization of AA leads to improve its hydrophobicity and chromatographic behavior. Under optimum conditions of derivatization and microextraction, the method yielded a linear calibration curve ranging from 10 to 1000 μg L -1 with a determination coefficient (R 2 ) of 0.9987. Limit of detection (LOD) and limit of quantification (LOQ) were 3.0 and 9.0 μg L -1 , respectively. Intra-day (n = 6) and inter-day (n = 3) precisions based on relative standard deviation percent (RSD%) for extraction and determination of AA at 50 and 500 μg L -1 levels were less than 9.0%. Finally, the performance of proposed method was investigated for determination of AA in some bread and biscuit samples, and satisfactory results were obtained (relative recovery ≥ 90%). Copyright © 2018. Published by Elsevier B.V.
White, R R; Roman-Garcia, Y; Firkins, J L; VandeHaar, M J; Armentano, L E; Weiss, W P; McGill, T; Garnett, R; Hanigan, M D
2017-05-01
Evaluation of ration balancing systems such as the National Research Council (NRC) Nutrient Requirements series is important for improving predictions of animal nutrient requirements and advancing feeding strategies. This work used a literature data set (n = 550) to evaluate predictions of total-tract digested neutral detergent fiber (NDF), fatty acid (FA), crude protein (CP), and nonfiber carbohydrate (NFC) estimated by the NRC (2001) dairy model. Mean biases suggested that the NRC (2001) lactating cow model overestimated true FA and CP digestibility by 26 and 7%, respectively, and under-predicted NDF digestibility by 16%. All NRC (2001) estimates had notable mean and slope biases and large root mean squared prediction error (RMSPE), and concordance (CCC) ranged from poor to good. Predicting NDF digestibility with independent equations for legumes, corn silage, other forages, and nonforage feeds improved CCC (0.85 vs. 0.76) compared with the re-derived NRC (2001) equation form (NRC equation with parameter estimates re-derived against this data set). Separate FA digestion coefficients were derived for different fat supplements (animal fats, oils, and other fat types) and for the basal diet. This equation returned improved (from 0.76 to 0.94) CCC compared with the re-derived NRC (2001) equation form. Unique CP digestibility equations were derived for forages, animal protein feeds, plant protein feeds, and other feeds, which improved CCC compared with the re-derived NRC (2001) equation form (0.74 to 0.85). New NFC digestibility coefficients were derived for grain-specific starch digestibilities, with residual organic matter assumed to be 98% digestible. A Monte Carlo cross-validation was performed to evaluate repeatability of model fit. In this procedure, data were randomly subsetted 500 times into derivation (60%) and evaluation (40%) data sets, and equations were derived using the derivation data and then evaluated against the independent evaluation data. Models derived with random study effects demonstrated poor repeatability of fit in independent evaluation. Similar equations derived without random study effects showed improved fit against independent data and little evidence of biased parameter estimates associated with failure to include study effects. The equations derived in this analysis provide interesting insight into how NDF, starch, FA, and CP digestibilities are affected by intake, feed type, and diet composition. The Authors. Published by the Federation of Animal Science Societies and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
AA Attendance and Abstinence for Dually Diagnosed Patients: A Meta-Analytic Review.
Scott Tonigan, J; Pearson, Matthew R; Magill, Molly; Hagler, Kylee J
2018-05-29
There is consensus that best clinical practice for dual diagnosis (DD) is integrated mental health and substance use treatment augmented with Alcoholics Anonymous (AA) attendance. This is the first quantitative review of the direction and magnitude of the association between AA attendance and alcohol abstinence for DD patients. A systematic literature search (1993-2017) identified 22 studies yielding 24 effect sizes that met our inclusion criteria (8,075 patients). Inverse-variance weighting of correlation coefficients (r) was used to aggregate sample-level findings and study aims were addressed using random and mixed effect models. Sensitivity and publication bias analyses were conducted to assess the likelihood of bias in the overall estimate of AA-related benefit. AA exposure and abstinence for DD patients were significantly and positively associated (r w =.249; 95% CI.203-.293; Tau=.097). There was also significant heterogeneity in the distribution of effect sizes, (Q(23)=90.714, p<.001), and high between-sample variance (I 2 =74.646). Subgroup analyses indicated that the magnitude of AA-related benefit did not differ between 6 (k=7) and 12 (k=12) month follow-up, (Q=.068, p<.794), type of treatment received (inpatient k=9; intensive outpatient, outpatient, community k=15; Q=2.057, p<.152), and whether a majority of patients in a sample had (k=11) or did not have (k=13) major depression (Q=.563, p<.453). Sensitivity analyses indicated that the overall meta-analytic estimate of AA benefit was not adversely or substantively impacted by pooling RCT and observational samples (Q=.763, p<.382), pooling count, binary, and ordinal-based AA (Q=.023, p<.879) and outcome data (Q=1.906, p<.167), and reversing direction of correlations extracted from studies (Q=.006, p<.937). No support was found for publication bias. Clinical referral of dual diagnosis (DD) patients to Alcoholics Anonymous (AA) is common and, in many cases, DD patients who attend AA will report higher rates of alcohol abstinence relative to DD patients who do not attend AA. This article is protected by copyright. All rights reserved.
Dei, H K; Rose, S P; Mackenzie, A M
2006-10-01
1. The objective of this experiment was to determine and compare the apparent lipid digestibility coefficient and apparent metabolisable energy (AME) value of shea nut (Vitellaria paradoxa, Gaertn.) fat in broiler chickens with that of soybean oil and cocoa fat. 2. One hundred and sixty 13-d-old male broiler chicks were used in a randomised complete block design. The fats were added at 30, 60 and 90 g/kg to a basal diet. A tenth dietary treatment was the basal feed with no added fats or oils. The birds were fed on the diets for 8 d and all droppings were collected for the final 4 d. 3. The mean coefficient of apparent lipid digestibility for shea fat (0.58) was similar to that of cocoa fat (0.54) but lower than that of soybean oil (0.95). There was evidence of a lipid x concentration interaction with the 90 g/kg shea fat diet having low lipid digestibility (0.43). 4. There was an interaction between the effects of dietary lipid concentration and test lipid on AME but, at dietary levels of 60 g/kg and below, the AME of shea fat (22.0 MJ/kg DM) and cocoa fat (26.4 MJ/kg DM) was significantly lower than that of soybean oil (39.8 MJ/kg DM).
NASA Astrophysics Data System (ADS)
Rachmawati, Diana; Samidjan, Istiyanto; Elfitasari, Tita
2018-02-01
The purpose of this study was to determine the effect of adding the phytase enzyme in the artificial feed on digestibility of feed, feed conversion ratio and growth of gift tilapia saline fish (Oreochromis niloticus) nursery stadia I. The fish samples in this study used gift tilapia saline fish (O. niloticus) with an average weight of 0,62 ± 0,008 g/fish and the stocking density of 1 fish1 L. Experimental method used in this study was completely randomized design with 4 treatments and 3 repetitions. The treatments were by adding phytase enzyme in artificial feed with the different level of doses those were A (0 FTU kg1 feed), B (500 FTU kg1 feed), C (1000 FTU kg1 feed) and D (1500 FTU kg1 feed). The results show that the addition of phytase enzyme was significantly (P<0.01) affected on apparent digestibility coefficient of protein (ADCP), apparent digestibility coefficient of Phospor (ADCF), feed conversion ratio (FCR), protein efficiency ratio (PER), and relative growth rate (RGR), on the other hand it insignificantly (P>0.05) affected on Survival Rate (SR) of gift tilapia saline fish. The optimum doses of phytase enzyme on RGR, FCR, PER, ADCP and ADCF of gift tilapia saline fish ranged from 1060 to 1100 FTU kg-1 feed.
Onukwugha, Eberechukwu; Osteen, Phillip; Jayasekera, Jinani; Mullins, C Daniel; Mair, Christine A; Hussain, Arif
2014-11-01
Factors contributing to the lower likelihood of urologist follow-up among African American (AA) men diagnosed with prostate cancer may not be strictly related to patient factors. The authors investigated the relationship between crime, poverty, and poor housing, among others, and postdiagnosis urologist visits among AA and white men. The authors used linked cancer registry and Medicare claims data from 1999 through 2007 for men diagnosed with American Joint Committee on Cancer stage I to III prostate cancer. The USA Counties and County Business Patterns data sets provided county-level data. Variance components models reported the percentage of variation attributed to county of residence. Postdiagnosis urologist visits for AA and white men were investigated using logistic and modified Poisson regression models. A total of 65,635 patients were identified; 87% of whom were non-Hispanic white and 9.3% of whom were non-Hispanic AA. Approximately 16% of men diagnosed with stage I to III prostate cancer did not visit a urologist within 1 year after diagnosis (22% of AA men and 15% of white men). County of residence accounted for 10% of the variation in the visit outcome (13% for AA men and 10% for white men). AA men were more likely to live in counties ranked highest in terms of poverty, occupied housing units with no telephone, and crime. AA men were less likely to see a urologist (odds ratio, 0.65 [95% confidence interval, 0.6-0.71]; rate ratio, 0.94 [95% confidence interval, 0.92-0.95]). The sign and magnitude of the coefficients for the county-level measures differed across race-specific regression models of urologist visits. Among older men diagnosed with stage I to III prostate cancer, the social environment appears to contribute to some of the disparities in postdiagnosis urologist visits between AA and white men. © 2014 American Cancer Society.
Pokój, T; Bułkowska, K; Gusiatin, Z M; Klimiuk, E; Jankowski, K J
2015-08-01
This study presents the results of long-term semi-continuous experiments on anaerobic digestion at an HRT of 45d with ten silages: 2 annual and 4 perennial crops, and 4 mixtures of annual with perennial crops. The composition of substrates and digestates was determined with Van Soest's fractionation method. Removal of non-fiber materials ranged from 49.4% (Miscanthus sacchariflorus) to 89.3% (Zea mays alone and mixed with M. sacchariflorus), that of fiber materials like lignin ranged from 0.005% (Z. mays alone and mixed with grasses at VS ratio of 90:10%) to 46.5% (Sida hermaphrodita). The lowest stability of anaerobic digestion, as confirmed by normalized data concentrations of volatile fatty acids, was reported for both miscanthuses and sugar sorghum. The methane yield coefficients for non-fiber and fiber materials were 0.3666 and 0.2556L/g, respectively. All digestate residues had high fertilizing value, especially those from mixtures of crops. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Itodo, I.N.; Awulu, J.O.
1999-12-01
The effects of total solids concentrations of poultry, cattle and piggery waste slurries on biogas yield was investigated. Twelve laboratory-size anaerobic batch digesters with 25 L volume were constructed and used for the experiments. Three replicates of 5%, 10%, 15%, and 20% TS concentrations of poultry, cattle, and piggery waste slurries were anaerobically digested for a 30-day detention period and gas yield was measured by the method of water displacement. Temperature variation within the digesters was measured with a maximum and minimum thermometer. Anaerobic digestion of the slurries was undertaken in the mesophilic temperature range (20--40 C). The carbon:nitrogen ratiomore » of each of the slurries digested was determined. The carbon content was determined using the wackley-Black method, and nitrogen content was determined by the regular kjeldhal method. The pH was measured weekly during the period of digestion from a digital pH meter. Gas quality (% methane fraction) was also measured weekly from an analyzer. Coefficient of variation was computed to ascertain the status of the digestion process. Analysis of variance was used to determine the significant difference in gas yield at p < 0.05. Duncan's New Multiple Range Test at p < 0.05 was used to analyze the difference in gas yield among the various TS concentrations of the slurries investigated. The results indicate that biogas yield is of the order: 5% TS > 10% TS > 15% TS > 20% TS. This result shows that gas yield increases with decreasing TS concentration of the slurries. The ANOVA showed that the gas yield from the various TS % was significantly different (p < 0.05). DNMRT showed that there was significant difference in gas yield from the slurries and wastetypes investigated. Poultry waste slurries had the greatest gas yield (L CH4/kg TS) as the gas yield from the waste types was of the order: Poultry > Piggery > Cattle. The pH of the slurries was of the range 5.5 to 6.8 (weakly acidic). The C:N of the slurries varied between 6:1 and 9:1. The Coefficient of Variation (CV) for 10 consecutive days of digestion was less than 10% indicating a steady state in all the digesters.« less
Bergot, F
1981-01-01
A semi-purified diet containing 22 p. 100 of a wood cellulose extract without lignin but still containing 22 p. 100 of hemicelluloses was distributed for one month to rainbow trout and common carp reared at 17 and 20 degrees C, respectively. The digestibility of the main dietary constituents was determined by an indirect method using chrome oxide as an inert tracer. The feces were recovered by a continuous automatic collector which rapidly removed them from the water, minimizing alteration by leaching. The cellulose content was estimated by the Weende (crude fiber) and the Van Soest (neutral detergent fiber and acid detergent fiber) methods. The digestibility coefficients obtained for trout as well as for carp indicate that cellulose and hemicelluloses were not digested. In both species, volatile fatty acid concentration in the different segments of the digestive tract was low (less than 10 mM/l). These results lead us to suggest that trout and carp cannot degrade purified cellulose.
Halmemies-Beauchet-Filleau, A; Vanhatalo, A; Toivonen, V; Heikkilä, T; Lee, M R F; Shingfield, K J
2014-01-01
Diets based on red clover silage (RCS) typically increase the concentration of polyunsaturated fatty acids (PUFA) in ruminant meat and milk and lower the efficiency of N utilization compared with grass silages (GS). Four multiparous Finnish Ayrshire cows (108 d postpartum) fitted with rumen cannulas were used in a 4 × 4 Latin square design with 21-d periods to evaluate the effect of incremental replacement of GS with RCS on milk production, nutrient digestion, whole-body N metabolism, and milk fatty acid composition. Treatments comprised total mixed rations offered ad libitum, containing 600 g of forage/kg of diet dry matter (DM), with RCS replacing GS in ratios of 0:100, 33:67, 67:33, and 100:0 on a DM basis. Intake of DM and milk yield tended to be higher when RCS and GS were offered as a mixture than when fed alone. Forage species had no influence on the concentration or secretion of total milk fat, whereas replacing GS with RCS tended to decrease milk protein concentration and yield. Substitution of GS with RCS decreased linearly whole-tract apparent organic matter, fiber, and N digestion. Forage species had no effect on total nonammonia N at the omasum, whereas the flow of most AA at the omasum was higher for diets based on a mixture of forages. Replacing GS with RCS progressively lowered protein degradation in the rumen, increased linearly ruminal escape of dietary protein, and decreased linearly microbial protein synthesis. Incremental inclusion of RCS in the diet tended to lower whole-body N balance, increased linearly the proportion of dietary N excreted in feces and urine, and decreased linearly the utilization of dietary N for milk protein synthesis. Furthermore, replacing GS with RCS decreased linearly milk fat 4:0 to 8:0, 14:0, and 16:0 concentrations and increased linearly 18:2n-6 and 18:3n-3 concentrations, in the absence of changes in cis-9 18:1, cis-9, trans-11 18:2, or total trans fatty acid concentration. Inclusion of RCS in the diet progressively increased the apparent transfer of 18-carbon PUFA from the diet into milk, but had no effect on the amount of 18:2n-6 or 18:3n-3 at the omasum recovered in milk. In conclusion, forage species modified ruminal N metabolism, the flow of AA at the omasum, and whole-body N partitioning. A lower efficiency of N utilization for milk protein synthesis with RCS relative to GS was associated with decreased availability of AA for absorption, with some evidence of an imbalance in the supply of AA relative to requirements. Higher enrichment of PUFA in milk for diets based on RCS was related to an increased supply for absorption, with no indication that forage species substantially altered PUFA bioavailability. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Samoilov, A.V.
The author extends the model of the flux-flow thermomagnetic transport coefficients of superconductors [A.V. Samoilov, A.A. Yurgens, and N.V. Zavaritsky] to the pinning region. Using a method due to Vinokur, Geshkenbein, Feigel'man, and Blatter, it is shown that if the vortex dynamics in disorder-dominated, N/[rho][sub xx] and S/[rho][sub xx] (where N is the Nernst coefficient, S is the thermopower, and [rho][sub xx] is the longitudinal resistivity) do not depend on the pinning strength. The theoretical consideration is illustrated by experimental results on the high-temperature superconductors.
NASA Astrophysics Data System (ADS)
Nunes, Dayana Lopes; dos Santos, Eliane Pereira; Barin, Juliano Smanioto; Mortari, Sergio Roberto; Dressler, Valderi Luiz; de Moraes Flores, Érico Marlon
2005-06-01
In this study, a systematic investigation was performed concerning the interference of nitrogen oxides on the determination of selenium and mercury by hydride generation atomic absorption spectrometry (HG AAS) and cold vapor atomic absorption spectrometry (CV AAS). The effect of nitrate, nitrite and NO 2 dissolved in the condensed phase was evaluated. No effect of NO 3- on Se and Hg determination was observed up to 100 mg of sodium nitrate added to the reaction vessel. The Se signal was reduced by about 80% upon the addition of 6.8 mg NO 2-. For Hg, no interference of nitrite was observed up to 20 mg of NO 2-. A complete suppression of the Se signal was observed when gaseous NO 2 was introduced into analytical solutions. For Hg, a signal decrease between 8 and 13% occurred. For Se, bubbling argon or heating the solution was not able to recover the original absorbance values, whereas Hg signals were recovered with these procedures. When gaseous NO 2 was passed directly into the atomizer, Se signals decreased similarly to when NO 2 was bubbled in analytical solutions. The addition of urea, hydroxylamine hydrochloride and sulfamic acid (SA) was investigated to reduce the NO 2 effect in sample digests containing residual NO 2, but only SA was effective in reducing the interference. Based on the results, it is possible to propose the use of SA to prevent interferences in Se and Hg determinations by HG AAS and CV AAS, respectively.
Chemical and Physical Predictors of the Nutritive Value of Wheat in Broiler Diets
Ball, M. E. E.; Owens, B.; McCracken, K. J.
2013-01-01
The aim of this study was to establish relationships between chemical and physical parameters of wheat with performance and digestibilities of feed components in broiler chickens fed on wheat-based diets. Ninety-four wheat samples were selected for inclusion in four bird trials. Birds were housed in individual wire metabolism cages from 7 to 28 d and offered water and feed ad libitum. Dry matter intake (DMI), liveweight gain (LWG) and gain:feed were measured weekly. A balance collection was carried out from 14 to 21 d for determination of apparent metabolizable energy (AME), ME:gain, dry matter retention, oil and neutral detergent fibre (NDF) digestibility. At 28 d the birds were humanely killed, the contents of the jejunum removed for determination of in vivo viscosity and the contents of the ileum removed for determination of ileal dry matter, starch and protein digestibility. When wheat parameters were correlated with bird performance data, it was found that specific weight was not significantly (p>0.05) related to bird performance. Bird DMI, LWG and gain:feed were best correlated (p<0.05) with the rate of starch digestion, although the coefficients of correlation (r) were still low (0.246 to 0.523). A negative relationship (p<0.01) between AME and total (r = −0.432) and soluble (r = −0.304) non starch polysaccharide (NSP) was observed in this study. Thousand grain weight (TG) was positively correlated with DMI (r = 0.299), LWG (r = 0.343) and gain:feed (r = 0.371). When establishing multiple regression relationships, correlation coefficients greater than 0.8 were achieved for DMI, LWG, gain:feed and ileal crude protein digestibility. However, the economics involved in determining the parameters involved in the regressions make the process impractical. PMID:25049711
Cherdthong, Anusorn; Pornjantuek, Boonserm; Wachirapakorn, Chalong
2016-10-01
This experiment was conducted to investigate the effects of various levels of cassava bioethanol waste (CBW) on nutrient intake, digestibility, rumen fermentation, and blood metabolites in growing goats. Twelve crossbred, male (Thai Native × Anglo Nubian) growing goats with initial body weight (BW) of 20±3 kg were randomly assigned according to a completely randomized design (CRD). The dietary treatments were total mixed ration (TMR) containing various levels of CBW at 0, 10, and 20 % dry matter (DM). CBW contained crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), and acid detergent lignin (ADL) at 11, 69, 47, and 23 % DM, respectively. The TMR diets were offered ad libitum and contained CP at 15 % DM. Inclusion of CBW at 10 % DM in TMR did not alter feed intake (g DM and g/kg BW(0.75)) and CP intake when compared to the control fed group (0 % CBW). Total OM intake was lower in the 20 % CBW group than in the others (P < 0.01). The digestibility coefficients of DM, OM, CP, and NDF were not changed for the TMR including 10 % CBW compared to the control group (P > 0.05) whereas when 20 % CBW was incorporated to diet, intermediate digestibility coefficients were decreased. Average ruminal pH values ranged from 6-7. Rumen NH3-N and PUN concentration at 0, 3, and 6 h post-feeding were not significantly different among treatments (P > 0.05). Thus, inclusion of 10 % CBW in TMR diets does not adversely affect nutrient intake, digestibility, rumen fermentation, and blood metabolite in fattening goats, and CBW may be effectively used as an alternative roughage source in the diets of goats.
A mechanistic model of small intestinal starch digestion and glucose uptake in the cow.
Mills, J A N; France, J; Ellis, J L; Crompton, L A; Bannink, A; Hanigan, M D; Dijkstra, J
2017-06-01
The high contribution of postruminal starch digestion (up to 50%) to total-tract starch digestion on energy-dense, starch-rich diets demands that limitations to small intestinal starch digestion be identified. A mechanistic model of the small intestine was described and evaluated with regard to its ability to simulate observations from abomasal carbohydrate infusions in the dairy cow. The 7 state variables represent starch, oligosaccharide, glucose, and pancreatic amylase in the intestinal lumen, oligosaccharide and glucose in the unstirred water layer at the intestinal wall, and intracellular glucose of the enterocyte. Enzymatic hydrolysis of starch was modeled as a 2-stage process involving the activity of pancreatic amylase in the lumen and of oligosaccharidase at the brush border of the enterocyte confined within the unstirred water layer. The Na + -dependent glucose transport into the enterocyte was represented along with a facilitative glucose transporter 2 transport system on the basolateral membrane. The small intestine is subdivided into 3 main sections, representing the duodenum, jejunum, and ileum for parameterization. Further subsections are defined between which continual digesta flow is represented. The model predicted nonstructural carbohydrate disappearance in the small intestine for cattle unadapted to duodenal infusion with a coefficient of determination of 0.92 and a root mean square prediction error of 25.4%. Simulation of glucose disappearance for mature Holstein heifers adapted to various levels of duodenal glucose infusion yielded a coefficient of determination of 0.81 and a root mean square prediction error of 38.6%. Analysis of model behavior identified limitations to the efficiency of small intestinal starch digestion with high levels of duodenal starch flow. Limitations to individual processes, particularly starch digestion in the proximal section of the intestine, can create asynchrony between starch hydrolysis and glucose uptake capacity. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Gutierrez, N A; Serão, N V L; Kerr, B J; Zijlstra, R T; Patience, J F
2014-10-01
An experiment was conducted to determine a best fitting dietary fiber (DF) component to estimate the effect of DF concentration on the digestibility of energy, DF, and AA and energy value of 9 corn coproducts: corn bran (37.0% total nonstarch polysaccharides [NSP]); corn bran with solubles (17.1% NSP); cooked corn distillers dried grains with solubles (DDGS; 20.4% NSP); reduced oil DDGS (25.0% NSP); uncooked DDGS (22.0% NSP); high protein distillers dried grains (21.9% NSP); dehulled, degermed corn (1.1% NSP); corn germ meal (44.4% NSP); and corn gluten meal (4.9% NSP). A total of 20 growing pigs (initial BW: 25.9 ± 2.5 kg) were fitted with a T-cannula in the distal ileum and allotted to 10 dietary treatment groups in a 4-period incomplete block design with 8 observations per treatment. Treatments included a corn-soybean meal-based basal diet and 9 diets obtained by mixing 70% of the basal diet with 30% of the test ingredient. In tested ingredients, 11 DF components were determined: 1) ADF, 2) NDF, 3) total dietary fiber, 4) hemicellulose, 5) total NSP, 6) NSP arabinose, 7) NSP xylose, 8) NSP mannose, 9) NSP glucose, 10) NSP galactose, and 11) arabinoxylan. The apparent ileal digestibility (AID) and apparent total tract digestibility (ATTD) of GE, DM, and NDF and the AID of AA of ingredients were measured. A single best fitting DF component was assessed and ranked for each trait, showing that arabinoxylan concentration best explained variance in AID of GE (R(2) = 0.65; cubic, P < 0.01) and DM (R(2) = 0.67; cubic, P < 0.01). The NSP xylose residue best explained variance in ATTD of GE (R(2) = 0.80; cubic, P < 0.01), DM (R(2) = 0.78; cubic, P < 0.01), and NDF (R(2) = 0.63; cubic, P < 0.01); AID of Met (R(2) = 0.40; cubic, P = 0.02), Met + Cys (R(2) = 0.44; cubic, P = 0.04), and Trp (R(2) = 0.11; cubic, P = 0.04); and DE (R(2) = 0.66; linear, P = 0.02) and ME (R(2) = 0.71; cubic, P = 0.01) values. The AID of Lys was not predictable (P > 0.05) from the DF concentration. In conclusion, the arabinoxylan and NSP xylose residue were the DF components that best explained variation due to DF concentration and, with the exception of AID of Lys, can be used to predict the digestibility of energy and DF and the DE and ME values in corn coproducts.
Taylor, Marcus K
2013-01-01
Evidence links dehydroepiandrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEAS) to crucial military health issues, including operational stress, resilience, and traumatic brain injury. This study evaluated the anabolic, neuroprotective, and neuroexcitatory properties of DHEA(S) in healthy military men. A salivary sample was obtained from 42 men and assayed for DHEA(S), testosterone, nerve growth factor (NGF; which supports nerve cell proliferation), and salivary alpha amylase (sAA; a proxy of sympathetic nervous system function). Separate regression analyses were conducted with DHEA and DHEAS as independent variables, and testosterone, NGF, and sAA as dependent variables, respectively. The models explained 23.4% of variance in testosterone (p < 0.01), 17.2% of variance in NGF (p < 0.01), and 7.4% of variance in sAA (p = 0.09). Standardized beta coefficients revealed that DHEA independently influenced testosterone (beta = 0.40, p < 0.01), whereas DHEAS independently influenced NGF (beta = 0.48, p < 0.01) and sAA (beta = 0.36, p < 0.05). DHEA demonstrated anabolic properties, whereas DHEAS demonstrated neuroprotective and neuroexcitatory properties in military men. This area of study has broad implications for stress inoculation, traumatic brain injury rehabilitation, and regenerative medicine in military personnel.
Azam, Faizul; Madi, Arwa M.; Ali, Hamed I.
2012-01-01
Monoamine oxidase B (MAO-B) inhibitory potential of adenosine A2A receptor (AA2AR) antagonists has raised the possibility of designing dual-target–directed drugs that may provide enhanced symptomatic relief and that may also slow the progression of Parkinson's disease (PD) by protecting against further neurodegeneration. To explain the dual inhibition of MAO-B and AA2AR at the molecular level, molecular docking technique was employed. Lamarckian genetic algorithm methodology was used for flexible ligand docking studies. A good correlation (R2= 0.524 and 0.627 for MAO-B and AA2AR, respectively) was established between docking predicted and experimental Ki values, which confirms that the molecular docking approach is reliable to study the mechanism of dual interaction of caffeinyl analogs with MAO-B and AA2AR. Parameters for Lipinski's “Rule-of-Five” were also calculated to estimate the pharmacokinetic properties of dual-target–directed drugs where both MAO-B inhibition and AA2AR antagonism exhibited a positive correlation with calculated LogP having a correlation coefficient R2 of 0.535 and 0.607, respectively. These results provide some beneficial clues in structural modification for designing new inhibitors as dual-target–directed drugs with desired pharmacokinetic properties for the treatment of PD. PMID:23112538
de Oliveira, Amanda Priscila; Bernardo, Cássia Rubia; Camargo, Ana Vitória da Silveira; Ronchi, Luiz Sérgio; Borim, Aldenis Albaneze; de Mattos, Cinara Cássia Brandão; de Campos Júnior, Eumildo; Castiglioni, Lílian; Netinho, João Gomes; Cavasini, Carlos Eugênio; Bestetti, Reinaldo Bulgarelli; de Mattos, Luiz Carlos
2015-01-01
The clinical manifestations of chronic Chagas disease include the cardiac form of the disease and the digestive form. Not all the factors that act in the variable clinical course of this disease are known. This study investigated whether the CCR5Δ32 (rs333) and CCR5 59029 A/G (promoter region--rs1799987) polymorphisms of the CCR5 gene are associated with different clinical forms of chronic Chagas disease and with the severity of left ventricular systolic dysfunction in patients with chronic Chagas heart disease (CCHD). The antibodies anti-T. cruzi were identified by ELISA. PCR and PCR-RFLP were used to identify the CCR5Δ32 and CCR5 59029 A/G polymorphisms. The chi-square test was used to compare variables between groups. There was a higher frequency of the AA genotype in patients with CCHD compared with patients with the digestive form of the disease and the control group. The results also showed a high frequency of the AG genotype in patients with the digestive form of the disease compared to the other groups. The results of this study show that the CCR5Δ32 polymorphism does not seem to influence the different clinical manifestations of Chagas disease but there is involvement of the CCR5 59029 A/G polymorphism in susceptibility to the different forms of chronic Chagas disease. Besides, these polymorphisms do not influence left ventricular systolic dysfunction in patients with CCHD.
Zhang, Yuyao; Li, Huan
2017-09-18
During anaerobic digestion, low-organic-content sludge sometimes is used as feedstock, resulting in deteriorated digestion performance. The operational experience of conventional anaerobic digestion cannot be applied to this situation. To investigate the feature of low-organic-content sludge digestion and explain its intrinsic mechanism, batch experiments were conducted using designed feedstock having volatile solids (VS) contents that were 30-64% of total solids (TS). The results showed that the accumulative biogas yield declined proportionally from 173.7 to 64.8 ml/g VS added and organic removal rate decreased from 34.8 to 11.8% with decreasing VS/TS in the substrate. The oligotrophic environment resulting from low-organic-content substrates led to decreased microbial activity and a switch from butyric fermentation to propionic fermentation. A first-order model described the biogas production from the batch experiments very well, and the degradation coefficient decreased from 0.159 to 0.069 day -1 , exhibiting a positive relation with organic content in substrate. The results observed here corroborated with data from published literature on anaerobic digestion of low-organic-content sludge and showed that it may not be feasible to recover energy from sludge with an organic content lower than 50% through mono digestion.
Scholey, D; Burton, E; Morgan, N; Sanni, C; Madsen, C K; Dionisio, G; Brinch-Pedersen, H
2017-09-01
Around 70% of total seed phosphorus is represented by phytate which must be hydrolysed to be bioavailable in non-ruminant diets. The limited endogenous phytase activity in non-ruminant animals make it common practice to add an exogenous phytase source to most poultry and pig feeds. The mature grain phytase activity (MGPA) of cereal seeds provides a route for the seeds themselves to contribute to phytate digestion, but MGPA varies considerably between species and most varieties in current use make negligible contributions. Currently, all phytases used for feed supplementation and transgenic improvement of MGPA are derived from microbial enzymes belonging to the group of histidine acid phosphatases (HAP). Cereals contain HAP phytases, but the bulk of MGPA can be attributed to phytases belonging to a completely different group of phosphatases, the purple acid phosphatases (PAPhy). In recent years, increased MGPAs were achieved in cisgenic barley holding extra copies of barley PAPhy and in the wheat HIGHPHY mutant, where MGPA was increased to ~6200 FTU/kg. In the present study, the effect of replacing 33%, 66% and 100% of a standard wheat with HIGHPHY wheat was compared with a control diet with and without 500 FTU of supplemental phytase. Diets were compared by evaluating broiler performance, ileal Ca and P digestibility and tibia development, using nine replicate pens of four birds per diet over 3 weeks from hatch. There were no differences between treatments in any tibia or bird performance parameters, indicating the control diet did not contain sufficiently low levels of phosphorus to distinguish effect of phytase addition. However, in a comparison of the two wheats, the ileal Ca and P digestibility coefficients for the 100% HIGHPHY wheat diets are 22.9% and 35.6% higher, respectively, than for the control diet, indicating the wheat PAPhy is functional in the broiler digestive tract. Furthermore, 33% HIGHPHY replacement of conventional wheat, significantly improved Ca and P digestibility over the diet-supplemented exogenous phytase, probably due to the higher phytase activity in the HIGHPHY diet (1804 v. 1150 FTU). Full replacement by HIGHPHY gave 14.6% and 22.8% higher ileal digestibility coefficients for Ca and P, respectively, than for feed supplemented with exogenous HAP phytase at 500 FTU. This indicates that in planta wheat PAPhys has promising potential for improving P and mineral digestibility in animal feed.
Lopes, F; Cook, D E; Combs, D K
2015-09-01
An in vivo study was performed to test an in vitro procedure and model that predicts total-tract neutral detergent fiber (NDF) digestibility for lactating dairy cattle. Corn silage (CS) and alfalfa silage (AS) were used as forages for this study. These forages had similar NDF composition, but fiber in the CS contained less indigestible NDF compared with AS (35.5 and 47.8% of indigestible NDF, respectively). The in vitro method estimated rate of digestion of alfalfa potentially digestible NDF to be approximately 2 times faster than CS fiber (6.11 and 3.21%/h, respectively). Four diets were formulated containing different proportions of CS to AS: 100CS:0AS, 67CS:33AS, 33CS:67AS, and 0CS:100AS, as percentage of diet DM basis. The objective was to construct diets that contained approximately similar levels of NDF but with different pool sizes and rates of digestion of potentially digestible NDF. Diets were fed to 8 ruminally cannulated, multiparous, lactating dairy cows in a replicated 4×4 Latin square with 21-d periods. Total-tract fiber digestibility and fiber digestion kinetic parameters observed in vivo were compared with the values predicted by the in vitro assay and model. Total-tract NDF digestibility coefficients were similar (41.8 and 40.6% of total NDF) for the in vitro and in vivo methods, respectively. As the proportion of dietary alfalfa increased, the digestibility of NDF increased. The rate of digestion of potentially digestible NDF predicted from the in vitro assay was also similar to what was observed in vivo. Results suggest that the in vitro total-tract NDF digestibility model could be used to predict rate of fiber digestion and NDF digestibility for lactating dairy cattle. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Lee, C; Hristov, A N; Cassidy, T W; Heyler, K S; Lapierre, H; Varga, G A; de Veth, M J; Patton, R A; Parys, C
2012-10-01
The objective of this experiment was to evaluate the effect of supplementing a metabolizable protein (MP)-deficient diet with rumen-protected (RP) Lys, Met, and specifically His on dairy cow performance. The experiment was conducted for 12 wk with 48 Holstein cows. Following a 2-wk covariate period, cows were blocked by DIM and milk yield and randomly assigned to 1 of 4 diets, based on corn silage and alfalfa haylage: control, MP-adequate diet (ADMP; MP balance: +9 g/d); MP-deficient diet (DMP; MP balance: -317 g/d); DMP supplemented with RPLys (AminoShure-L, Balchem Corp., New Hampton, NY) and RPMet (Mepron; Evonik Industries AG, Hanau, Germany; DMPLM); and DMPLM supplemented with an experimental RPHis preparation (DMPLMH). The analyzed crude protein content of the ADMP and DMP diets was 15.7 and 13.5 to 13.6%, respectively. The apparent total-tract digestibility of all measured nutrients, plasma urea-N, and urinary N excretion were decreased by the DMP diets compared with ADMP. Milk N secretion as a proportion of N intake was greater for the DMP diets compared with ADMP. Compared with ADMP, dry matter intake (DMI) tended to be lower for DMP, but was similar for DMPLM and DMPLMH (24.5, 23.0, 23.7, and 24.3 kg/d, respectively). Milk yield was decreased by DMP (35.2 kg/d), but was similar to ADMP (38.8 kg/d) for DMPLM and DMPLMH (36.9 and 38.5kg/d, respectively), paralleling the trend in DMI. The National Research Council 2001model underpredicted milk yield of the DMP cows by an average (±SE) of 10.3 ± 0.75 kg/d. Milk fat and true protein content did not differ among treatments, but milk protein yield was increased by DMPLM and DMPLMH compared with DMP and was not different from ADMP. Plasma essential amino acids (AA), Lys, and His were lower for DMP compared with ADMP. Supplementation of the DMP diets with RP AA increased plasma Lys, Met, and His. In conclusion, MP deficiency, approximately 15% below the National Research Council requirements from 2001, decreased DMI and milk yield in dairy cows. Supplementation of the MP-deficient diet with RPLys and RPMet diminished the difference in DMI and milk yield compared with ADMP and additional supplementation with RPHis eliminated it. As total-tract fiber digestibility was decreased with the DMP diets, but DMI tended to increase with RP AA supplementation, we propose that, similar to monogastric species, AA play a role in DMI regulation in dairy cows. Our data implicate His as a limiting AA in high-producing dairy cows fed corn silage- and alfalfa haylage-based diets, deficient in MP. The MP-deficient diets clearly increased milk N efficiency and decreased dramatically urinary N losses. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Nitrayová, S; Brestensky, M; Patrás, P; Heger, J
2012-12-01
Chemical composition and nutrient and energy digestibilities were determined in 4 samples of dried distillers grains with solubles (DDGS) and 1 sample of wet distillers grains (WDG) from 4 ethanol fuel manufacturers. The cereal sources used for ethanol production were wheat (Triticum aestivum; 1 sample), wheat + barley (Hordeum vulgare; 2 samples), and maize (Zea mays; 2 samples). The nutrient contents (expressed as % of DM) were variable, ranging from 30.5 to 39.5 CP, 4.4 to 12.3 fat, 7.5 to 12.9 crude fiber, 2.7 to 7.8 ash, and 0.4 to 0.9 total P. The concentration of Lys ranged from 2.05 to 5.20 g/kg DM. The diets were fed to 6 gilts (39.9 ± 1.9 kg BW) fitted with ileal T-cannulas using a 5 × 6 Youden square. Each experimental period comprised a 5-d adaptation followed by a 2-d collection of urine and feces and 1-d (24 h) collection of ileal digesta. Using acid-insoluble ash as a marker, apparent ileal digestibility (AID) and apparent total tract digestibility (ATTD) of nutrients and energy and AID of AA were calculated. The ATTD of N ranged from 55.7 to 83.7%. The N retention expressed as percentage of N intake ranged from 10.2 to 32.0. Except for wheat-based DDGS, the AID of N was 66.8%. The ATTD and AID values of NDF were 52.8 and 24.4%, respectively. The concentration of total P in WDG was half of values in DDGS, which likely caused its very low ATTD (1.4%). The ATTD and AID of energy ranged from 58.8 to 73.9% and from 40.6 to 54.1%, respectively. The AID of AA was greatest (P < 0.001) in WDG (71.8%) and lowest (P < 0.001) in DDGS from wheat (44.8%). In conclusion, nutrient variability among DDGS samples varies greatly, and source of origin is an important determinant of quality.
Charwat-Resl, S; Niessner, A; Mueller, M; Bartko, P E; Giurgea, G A; Zehetmayer, S; Willfort-Ehringer, A; Koppensteiner, R; Schlager, O
2016-10-01
Purpose: Vascular ultrasound (US) allows the analysis of vascular strain by speckle-tracking. This study sought to assess the extent to which vas cular strain varies between different segments of the arterial tree. Furthermore, this study aimed to investigate the reproducibility of vascular strain determination as well as of the components that contribute to the variance of vascular strain measurements in different vascular beds. Materials and Methods: Speckle-tracking was used to determine the vascular strain of the abdominal aorta (AA), the common carotid artery (CCA), the common femoral (CFA) and the popliteal artery (PA) of healthy adults. Intra- and interday reproducibility and the components of variance of vascular strain of the respective arteries were determined. Results: A total of 589 US clips obtained in 10 healthy adults (7 males, 28.3 ± 3.2 years) were analyzable. Vascular strain was 7.2 ± 3.0 % in the AA, 5.7 ± 2.1 % in the CCA, 2.1 ± 1.1 % in the CFA and 1.9 ± 1.1 % in the PA. The intraday coefficients of variation of vascular strain were 6.2 % (AA), 3.9 % (CCA), 3.3 % (CFA) and 6.1 % (PA), and the interday coefficients of variation were 5.9 % (AA), 8.4 % (CCA), 10 % (CFA) and 4.6 % (PA). The variance of vascular strain mainly depended on the investigated vessel and subject. Individual DUS clips, the day of examination and the (right/left) body side (in paired arteries) had no impact on the variance of vascular strain. Conclusion: Vascular strain substantially varies between different sites of the arterial tree. Speckle-tracking by DUS allows the reliable determination of vascular strain at different arterial sites. © Georg Thieme Verlag KG Stuttgart · New York.
Zhou, X; Beltranena, E; Zijlstra, R T
2017-06-01
Digestibility of remaining oil in canola press-cake (CPC) may be lower than that of extracted, liquid canola oil (CO) because oil may be partly entrapped in the CPC matrix. To determine true digestibility of fat in ingredients, endogenous fat losses should be estimated. Dietary fat may interact with digestion of other dietary components. To test these hypotheses, 10 ileal-cannulated pigs (initial BW, 25.4 kg) were fed 10 diets for 8 periods in a 10 × 8 Youden square. A basal diet was formulated based on wheat, barley, and canola meal. The 4 CPC and 4 CO test diets were prepared by replacing identical portion of basal diet with 10%, 20%, 30%, or 40% CPC, or 1.5%, 3.0%, 4.5%, or 6.0% CO, respectively, to match the fat content of CPC diet with CO diet at each fat level. An N-free diet based on corn starch was prepared to measure basal endogenous losses of AA. Apparent total tract digestibility (ATTD) and apparent ileal digestibility (AID) of acid-hydrolyzed ether extract (AEE) were calculated for each diet. True ileal digestibility (TID) and true total tract (TTTD) digestibility of AEE in CPC and CO, and total endogenous losses of AEE were estimated by regressing apparent digestible AEE (g/kg of DMI) against dietary AEE intake (g/kg of DM) at the total tract and distal ileum, respectively. The mean AID and ATTD of AEE in CPC diets were 78.9% and 61.5%, which were lower ( < 0.01) than 81.9% and 63.4% in CO diets. Apparent ileal and total tract digestible AEE content in CPC and CO diets increased linearly ( < 0.01) with increasing AEE intake. Endogenous losses of AEE were greater ( < 0.05) for the total tract than for the ileum (23.4 vs. 9.4 g/kg of DMI). Dietary fat source did not affect ( > 0.05) total tract or ileal endogenous losses of AEE. The TID and TTTD of AEE in CPC were 92.3% and 94.5%, respectively, lower ( < 0.01) than 96.5% and 100% in CO. Increasing dietary inclusion of CO linearly increased ( < 0.001) standardized ileal digestibility (SID) of CP, Lys, Met, Thr, and Trp, and quadratically increased ( < 0.001) the AID and ATTD of energy in the basal part of the test diets. In conclusion, CPC had lower TID and TTTD of AEE than CO. Dietary fat source did not affect endogenous losses of AEE. The lower digestibility of AEE in CPC than in CO indicates that fat digestibility of CPC should be considered to predict its nutritional value accurately. Dietary inclusion of CO may increase digestibility of CP and energy originating from the balance of the diet.
Jasek, A; Latham, R E; Mañón, A; Llamas-Moya, S; Adhikari, R; Poureslami, R; Lee, J T
2018-06-08
Exogenous enzymatic supplementation of poultry feeds, including α-galactosidase and xylanase, has been shown to increase metabolically available energy, although little information has been published on the impact on amino acid digestibility. An experiment was conducted to investigate a multicarbohydrase containing α-galactosidase and xylanase on amino acid digestibility, ileal digestible energy (IDE), and CP in male broiler chicks. The experiment was a 2 × 2 (diet × enzyme) factorial arrangement with 15 replicates of 8 male broilers per replicate raised for 21 d in a battery setting. The 2 dietary treatments included a positive control (PC) and a negative control (NC) diet formulated to contain 2.5% less calculated AME and digestible amino acids. Each of these diets was fed with and without enzyme. Broilers were fed a starter diet from 0-14 d (crumble) and a grower from 14-21 d (pellet). Birds were sampled on day 21 to determine ileal amino acid digestibility, IDE, and CP digestibility. Titanium dioxide (TiO2) was used as an indigestible marker for the determination of digestibility coefficients. Total ileal amino acid digestibility was increased (P = 0.008) by 3.80% with the inclusion of enzyme. Methionine and lysine digestibility was improved (P < 0.05) with the inclusion of enzyme by 3.37% and 2.61%, respectively. Enzyme inclusion increased (P = 0.001) cysteine digestibility by 9.3%. Diet-influenced ileal amino acid digestibility with tryptophan, threonine, isoleucine, and valine digestibility being increased (P < 0.05) in the PC when compared to the NC. IDE was decreased (P = 0.037) in broilers fed the NC diet by 100 kcal/kg feed when compared to broilers fed the PC diet. Enzyme inclusion increased (P = 0.047) IDE value by 90 kcal/kg. Crude protein digestibility was not influenced by diet; however, similar improvements in CP digestibility with enzyme inclusion were observed as with energy. These data support the benefits of a multicarbohydrase containing α-galactosidase and xylanase inclusion to improve nutrient and ileal amino acid digestibility across multiple dietary nutrient profiles.
Ragnarsson, S; Jansson, A
2011-06-01
The aim of the present study was to compare digestibility and metabolic response in Icelandic and Standardbred horses fed two grass haylages harvested at different stages of maturity. Six horses of each breed were used in a 24-day change-over design. A total collection of faeces was made on days 15-17 and 22-24. Blood samples were collected on day 24 of each period and analysed for total plasma protein (TPP), plasma urea, non-esterified fatty acids, cortisol and insulin concentration. There were no differences in digestibility coefficients of crude protein, neutral detergent fibre or energy between breeds but organic matter digestibility was higher in the Standardbred horses. On both haylages, the Icelandic horses gained weight whereas the Standardbred horses lost weight. The Icelandic horses had higher TPP, plasma insulin and lower plasma urea concentrations. Our results indicate that the Icelandic horse may be more prone to maintain positive energy balance in relation to the Standardbred horse, but there were no indication of a better digestive capacity in the Icelandic horses. © 2010 Blackwell Verlag GmbH.
Williams, Richelle M; Welch, Cailee E; Parsons, John T; McLeod, Tamara C Valovich
2015-03-01
Sport-related concussion can affect athletes' sport participation and academic success. With the recent emphasis on cognitive rest, student-athletes may benefit from academic accommodations (AA) in the classroom; however, athletic trainers' (ATs') perceived familiarity with, and use of, AA is unknown. To assess secondary school ATs' perceived familiarity with, attitudes and beliefs about, and incorporation of AA for student-athletes after sport-related concussion. A secondary purpose was to determine whether employment status altered familiarity and use of AA. Cross-sectional study. Online survey. Of 3286 possible respondents, 851 secondary school ATs accessed the survey (response rate = 25.9%; 308 men [36.2%], 376 women [44.2%], 167 respondents [19.6%] with sex information missing; age = 37.3 ± 10.1 years). Participants were solicited via e-mail to complete the Beliefs, Attitudes and Knowledge Following Pediatric Athlete Concussion among Athletic Trainers employed in the secondary school setting (BAKPAC-AT) survey. The BAKPAC-AT assessed ATs' perceived familiarity, perceptions, and roles regarding 504 plans, Individualized Education Programs (IEPs), and returning student-athletes to the classroom. Independent variables were employment status (full time versus part time), employment model (direct versus outreach), years certified, and years of experience in the secondary school setting. The dependent variables were participants' responses to the AA questions. Spearman rank-correlation coefficients were used to assess relationships and Mann-Whitney U and χ(2) tests (P < .05) were used to identify differences. Respondents reported that approximately 41% of the student-athletes whose sport-related concussions they managed received AA. Respondents employed directly by the school were more familiar with 504 plans (P < .001) and IEPs (P < .001) and had a greater belief that ATs should have a role in AA. Both the number of years certified and the years of experience at the secondary school were significantly correlated with perceived familiarity regarding 504 plans and IEPs. The ATs employed directly by secondary schools and those with more experience as secondary school ATs were more familiar with AA. Understanding AA is important for all ATs because cognitive rest and "return to learn" are becoming more widely recommended in concussion management.
Edmonds, Rohan
2015-01-01
The purpose of this study was to a) determine the heart rate variability (HRV) and saliva markers of immunity (salivary immunoglobulin A; sIgA) and stress (salivary alpha-amylase; sAA) responses to chronic training in elite swimmers with a disability; and b) identify the relationships between HRV, sIgA, sAA and training volume. Eight members of a high performance Paralympic swimming program were monitored for their weekly resting HRV, sIgA and sAA levels in the 14 weeks leading up to a major international competition. The 14 week training program included aerobic, anaerobic, power and speed, and taper training phases, while also incorporating two swimming step tests and two swimming competitions. Specific time (root mean square of the successive differences; RMSSD) and frequency (high frequency normalized units [HFnu]) domain measures, along with non-linear indices (standard deviation of instantaneous RR variability; SD1 and short term fractal scaling exponent; α1) of HRV were used for all analyses with effects examined using magnitude-based inferences. Relationships between HRV and saliva markers were identified by Spearman rank rho (ρ) correlation coefficients. Compared with week 1, SD1 was very likely lower (96/4/0, ES = -2.21), while sAA was very likely elevated (100/0/0, ES = 2.32) at the beginning of week 7 for all athletes. The training program did not alter HRV or saliva whereas competition did. There were also no apparent differences observed for HRV, sIgA and sAA between each of the training phases during the 14 week swimming program. Correlations were observed between sAA and SD1 (ρ = -0.212, p<0.05), along with sAA and mean HR (ρ = 0.309, p<0.05). These results show that high level national competition influences depresses HRV (SD1) and increases saliva biomarkers of stress (sAA). It appears that a well-managed and periodised swimming program can maintain these indices within normal baseline levels. The study also highlighted the parasympathetic nervous system influence on sAA. PMID:26043224
Edmonds, Rohan; Burkett, Brendan; Leicht, Anthony; McKean, Mark
2015-01-01
The purpose of this study was to a) determine the heart rate variability (HRV) and saliva markers of immunity (salivary immunoglobulin A; sIgA) and stress (salivary alpha-amylase; sAA) responses to chronic training in elite swimmers with a disability; and b) identify the relationships between HRV, sIgA, sAA and training volume. Eight members of a high performance Paralympic swimming program were monitored for their weekly resting HRV, sIgA and sAA levels in the 14 weeks leading up to a major international competition. The 14 week training program included aerobic, anaerobic, power and speed, and taper training phases, while also incorporating two swimming step tests and two swimming competitions. Specific time (root mean square of the successive differences; RMSSD) and frequency (high frequency normalized units [HFnu]) domain measures, along with non-linear indices (standard deviation of instantaneous RR variability; SD1 and short term fractal scaling exponent; α1) of HRV were used for all analyses with effects examined using magnitude-based inferences. Relationships between HRV and saliva markers were identified by Spearman rank rho (ρ) correlation coefficients. Compared with week 1, SD1 was very likely lower (96/4/0, ES = -2.21), while sAA was very likely elevated (100/0/0, ES = 2.32) at the beginning of week 7 for all athletes. The training program did not alter HRV or saliva whereas competition did. There were also no apparent differences observed for HRV, sIgA and sAA between each of the training phases during the 14 week swimming program. Correlations were observed between sAA and SD1 (ρ = -0.212, p<0.05), along with sAA and mean HR (ρ = 0.309, p<0.05). These results show that high level national competition influences depresses HRV (SD1) and increases saliva biomarkers of stress (sAA). It appears that a well-managed and periodised swimming program can maintain these indices within normal baseline levels. The study also highlighted the parasympathetic nervous system influence on sAA.
Mansilla, W D; Htoo, J K; de Lange, C F M
2017-10-01
Amino acid usage for protein retention, and, consequently, the AA profile of retained protein, is the main factor for determining AA requirements in growing animals. The objective of the present study was to determine the effect of supplementing ammonia N on whole-body N retention and the AA profile of retained protein in growing pigs fed a diet deficient in nonessential AA (NEAA) N. In total, 48 barrows with a mean initial BW of 13.6 kg (SD 0.7) were used. At the beginning of the study, 8 pigs were euthanized for determination of initial protein mass. The remaining animals were individually housed and fed 1 of 5 dietary treatments. A common basal diet (95% of experimental diets) was formulated to meet the requirements for all essential AA (EAA) but to be deficient in NEAA N (CP = 8.01%). The basal diet was supplemented (5%) with cornstarch (negative control) or 2 N sources (ammonia or NEAA) at 2 levels each to supply 1.35 or 2.70% extra CP. The final standardized ileal digestible (SID) NEAA content in the high-NEAA-supplemented diet (positive control) was based on the NEAA profile of whole-body protein of 20-kg pigs, and it was expected to reduce the endogenous synthesis of NEAA. Pigs were fed at 3.0 times maintenance energy requirements for ME in 3 equal meals daily. At the end of a 3-wk period, pigs were euthanized and the carcass and visceral organs were weighed, frozen, and ground for determination of protein mass. From pigs in the initial, negative control, high-ammonia, and high-NEAA groups, AA contents in the carcass and pooled visceral organs were analyzed to determine the total and deposited protein AA profile, dietary EAA efficiencies, and minimal de novo synthesis of NEAA. Carcass weight and whole-body N retention linearly increased ( < 0.05) with N supplementation. The AA profile of protein and deposited protein in the carcass was not different ( > 0.10) between N sources, but Cys content increased ( < 0.05) with NEAA compared with ammonia in visceral organ protein and deposited protein. The dietary SID EAA efficiency for increasing EAA deposition in whole-body protein increased ( < 0.05) with N supplementation, but it was not different ( > 0.10) between N sources. The de novo synthesis of NEAA increased ( < 0.05) for ammonia compared with NEAA supplementation. In conclusion, adding ammonia as a N source to diets deficient in NEAA N increases whole-body N retention without affecting the carcass AA profile.
Brito, A F; Tremblay, G F; Bertrand, A; Castonguay, Y; Bélanger, G; Michaud, R; Lafrenière, C; Martineau, R; Berthiaume, R
2014-11-01
The objective of this study was to investigate the effects of feeding alfalfa baleage with different concentrations of nonstructural carbohydrates (NSC) supplemented with a common corn-based concentrate on performance, ruminal fermentation profile, N utilization, and omasal flow of nutrients in dairy cows during early lactation. Ten multiparous (8 ruminally cannulated) and 8 primiparous Holstein cows were randomly assigned to treatments (high- or low-NSC diet) in a crossover design. The difference in NSC concentration between the 2 alfalfa baleages fed from d14 to 21 averaged 14 g of NSC/kg of dry matter (DM). Forages and concentrate were offered in separate meals with forages fed once and concentrate offered 3 times daily. Except for the molar proportion of valerate, which was lowest in cows fed the high-NSC diet, no other changes in ruminal fermentation were observed. Omasal flows of most nitrogenous fractions, including bacterial nonammonia N and AA, were not affected by treatments. Apparent ruminal digestibilities of neutral and acid detergent fiber and N were lowest, whereas that of total ethanol-soluble carbohydrates was highest when feeding the high-NSC diet. Postruminal digestibilities of DM, organic matter, fiber, and N were highest in cows fed the high-NSC diet, resulting in no difference in total-tract digestibilities. Total-tract digestibility of total ethanol-soluble carbohydrates was highest in cows fed the high-NSC diet, but that of starch did not differ across treatments. Although milk yield and total DM intake did not differ between treatments, yields of milk fat and 4% fat-corrected milk decreased significantly in cows fed the high-NSC diet. Milk concentration of urea N was lowest, and that of ruminal NH3-N highest, in cows fed the high-NSC diet. Plasma urea N concentration tended to be decreased in cows fed the high-NSC diet, but concentrations of AA were not affected by treatments, with the exception of Asp and Cys, both of which were lowest in cows fed the low-NSC diet. Feeding diets with contrasting NSC concentrations did not improve milk production, N utilization, or bacterial protein synthesis, possibly because intakes of NSC and DM were similar between treatments. Overall, results from the current study should be interpreted cautiously because of the lack of difference in dietary NSC intake between treatments and reduced N and fiber intakes when feeding the high-NSC diet. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Insights into the Structure of the Vip3Aa Insecticidal Protein by Protease Digestion Analysis
Bel, Yolanda; Banyuls, Núria; Chakroun, Maissa; Escriche, Baltasar; Ferré, Juan
2017-01-01
Vip3 proteins are secretable proteins from Bacillus thuringiensis whose mode of action is still poorly understood. In this study, the activation process for Vip3 proteins was closely examined in order to better understand the Vip3Aa protein stability and to shed light on its structure. The Vip3Aa protoxin (of 89 kDa) was treated with trypsin at concentrations from 1:100 to 120:100 (trypsin:Vip3A, w:w). If the action of trypsin was not properly neutralized, the results of SDS-PAGE analysis (as well as those with Agrotis ipsilon midgut juice) equivocally indicated that the protoxin could be completely processed. However, when the proteolytic reaction was efficiently stopped, it was revealed that the protoxin was only cleaved at a primary cleavage site, regardless of the amount of trypsin used. The 66 kDa and the 19 kDa peptides generated by the proteases co-eluted after gel filtration chromatography, indicating that they remain together after cleavage. The 66 kDa fragment was found to be extremely resistant to proteases. The trypsin treatment of the protoxin in the presence of SDS revealed the presence of secondary cleavage sites at S-509, and presumably at T-466 and V-372, rendering C-terminal fragments of approximately 29, 32, and 42 kDa, respectively. The fact that the predicted secondary structure of the Vip3Aa protein shows a cluster of beta sheets in the C-terminal region of the protein might be the reason behind the higher stability to proteases compared to the rest of the protein, which is mainly composed of alpha helices. PMID:28387713
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, O.; Masters, C.; Lewis, M.B.
1994-09-01
In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less
Urriola, P E; Stein, H H
2010-04-01
The objective of this experiment was to measure the effect of distillers dried grains with solubles (DDGS) on the digestibility of AA, energy, and fiber, on the fermentation of fiber, and on the first appearance of digesta at the end of the ileum, in the cecum, and in the feces of growing pigs fed a corn-soybean meal-based diet. Sixteen pigs (initial BW = 38.0 +/- 1.6 kg) were prepared with a T-cannula in the distal ileum and a T-cannula in the cecum and allotted to 2 treatments. In period 1, all pigs were fed a corn-soybean meal diet. In periods 2, 3, and 4, pigs were fed the control diet or a diet containing corn, soybean meal, and 30% DDGS. First appearance of digesta at the end of the ileum, in the cecum, and over the entire intestinal tract was measured at the end of period 4. The apparent ileal digestibility (AID) and the apparent total tract digestibility (ATTD) of nutrients were measured, and the concentration of VFA was analyzed in ileal, cecal, and fecal samples. The AID of Lys (74.1%) in the DDGS diet was less (P < 0.05) than in the control diet (78.6%), but the AID of most other AA and GE, NDF, and total dietary fiber (TDF) were not different between the 2 diets. The ATTD of GE (81.0%), NDF (57.2%), TDF (55.5%), and DM (81.7%) were less (P < 0.05) in the DDGS diet than in the control diet (86.0, 69.3, 66.0, and 87.2%, respectively). The concentration of VFA in ileal, cecal, and fecal samples was not different between pigs fed the 2 diets. The pH of ileal and cecal digesta from pigs fed the DDGS diet (6.3 and 5.5) was greater (P < 0.01) than from pigs fed the control diet (5.8 and 5.3). The ATTD of DM, GE, ADF, NDF, and TDF did not change with collection period, but the AID of ADF, NDF, and TDF increased (P < 0.05) from period 2 to period 4. The concentration of all VFA, except isobutyrate, was greater (P < 0.05) in cecal samples from period 4 compared with period 2, and the concentration of all VFA except propionate and isovalerate were greater (P < 0.05) in fecal samples collected in period 4 compared with those collected in period 2. The first appearance of digesta at the end of the ileum, in the cecum, and in the feces was not affected by DDGS. In conclusion, pigs fed the diet containing DDGS had less digestibility of Lys, GE, ADF, NDF, and TDF than pigs fed the control diet. The digestibility of DM and GE was not influenced by collection period, but the concentration of VFA in cecal digesta and feces increased with the length of time pigs received the diets.
SORPTION OF ORGANICS ON WASTEWATER SOLIDS: CORRELATION WITH FUNDAMENTAL PROPERTIES.
Sorption of toxic organic compounds on primary, mixed-liquor, and digested solids from municipal wastewater treatment plants has been correlated with octanol/water partition coefficients arid with modified Randic indexes. he correlations developed are useful for assessing the rol...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weston, D.P.; Mayer, L.M.
1995-12-31
A method using polychaete digestive fluids as a more biologically realistic extractant has recent been proposed as a means to quantify this bioavailable fraction. This work was intended to evaluate this approach with polynuclear aromatic hydrocarbons (PAH), and, in particular, to relate in vitro measures of PAH solubilization by digestive fluids to bioavailability as perceived by the whole animal. In tests with a variety of PAH-contaminated sediments, there were dramatic differences among the sediments in the amounts of PAH extracted by digestive fluids. About 50% of a PAH spike was extracted from a low organic carbon sediment during digestive fluidmore » extraction, while only 20% was extracted from a high organic carbon sediment. The relationships between these differences in PAH solubilization and true bioavailability were evaluated in polychaete bioaccumulation tests measuring PAH uptake rate coefficients and steady state body burdens. The work has also shown that desorption of PAH from ingested sediments in the whole animal approximated the quantities extracted in the in vitro tests. Moreover, desorption of PAH from ingested sediments was found to be greatest in that portion of the polychaete gut with the highest enzymatic activity and from which the digestive fluids had been collected. The digestive fluid extraction approach provides a new tool to examine digestive uptake of contaminants by manipulations that would be impossible in vivo, and may help to quantify a bioavailable contaminant fraction.« less
NASA Astrophysics Data System (ADS)
M. C. Sagis, Leonard
2001-03-01
In this paper, we develop a theory for the calculation of the surface diffusion coefficient for an arbitrarily curved fluid-fluid interface. The theory is valid for systems in hydrodynamic equilibrium, with zero mass-averaged velocities in the bulk and interfacial regions. We restrict our attention to systems with isotropic bulk phases, and an interfacial region that is isotropic in the plane parallel to the dividing surface. The dividing surface is assumed to be a simple interface, without memory effects or yield stresses. We derive an expression for the surface diffusion coefficient in terms of two parameters of the interfacial region: the coefficient for plane-parallel diffusion D (AB)aa(ξ) , and the driving force d(B)I||(ξ) . This driving force is the parallel component of the driving force for diffusion in the interfacial region. We derive an expression for this driving force using the entropy balance.
Murugesan, Ganapathi R; Romero, Luis F; Persia, Michael E
2014-01-01
Two experiments were conducted to determine the effects of protease and phytase (PP) and a Bacillus sp. direct-fed microbial (DFM) on dietary energy and nutrient utilization in broiler chickens. In the first experiment, Ross 308 broiler chicks were fed diets supplemented with PP and DFM in a 2×2 factorial arrangement. The 4 diets (control (CON), CON + PP, CON + DFM, and CON + PP + DFM) were fed from 15-21 days of age. In Experiment 1, significant interaction (P≤0.01) between PP and DFM on the apparent ileal digestibility coefficient for starch, crude protein, and amino acid indicated that both additives increased the digestibility. Both additives increased the nitrogen retention coefficient with a significant interaction (P≤0.01). Although no interaction was observed, significant main effects (P≤0.01) for nitrogen-corrected apparent ME (AMEn) for PP or DFM indicated an additive response. In a follow-up experiment, Ross 308 broiler chicks were fed the same experimental diets from 1-21 days of age. Activities of ileal brush border maltase, sucrase, and L-alanine aminopeptidase were increased (P≤0.01) by PP addition, while a trend (P = 0.07) for increased sucrase activity was observed in chickens fed DFM, in Experiment 2. The proportion of cecal butyrate was increased (P≤0.01) by DFM addition. Increased nutrient utilization and nitrogen retention appear to involve separate but complementary mechanisms for PP and DFM, however AMEn responses appear to have separate and additive mechanisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Almeida, Valmor F; Ye, Xianggui; Cui, Shengting
2013-01-01
A comprehensive molecular dynamics simulation study of n-alkanes using the Optimized Potential for Liquid Simulation-All Atoms (OPLS-AA) force field at ambient condition has been performed. Our results indicate that while simulations with the OPLS-AA force field accurately predict the liquid state mass density for n-alkanes with carbon number equal or less than 10, for n-alkanes with carbon number equal or exceeding 12, the OPLS-AA force field with the standard scaling factor for the 1-4 intramolecular Van der Waals and electrostatic interaction gives rise to a quasi-crystalline structure. We found that accurate predictions of the liquid state properties are obtained bymore » successively reducing the aforementioned scaling factor for each increase of the carbon number beyond n-dodecane. To better un-derstand the effects of reducing the scaling factor, we analyzed the variation of the torsion potential pro-file with the scaling factor, and the corresponding impact on the gauche-trans conformer distribution, heat of vaporization, melting point, and self-diffusion coefficient for n-dodecane. This relatively simple procedure thus allows for more accurate predictions of the thermo-physical properties of longer n-alkanes.« less
Bułkowska, K; Pokój, T; Klimiuk, E; Gusiatin, Z M
2012-12-01
Digestion of crop silage (Zea mays L. and Miscanthus sacchariflorus) with 0%, 7.5%, 12.5% and 25% pig manure as co-substrate was performed in continuous stirred-tank reactors, for a constant hydraulic retention time of 45 d and organic load rate of 2.1 g L(-1)d(-1). A matrix of correlations between biogas/methane production and parameters of anaerobic digestion was created in order to estimate process stability. The values of the correlation coefficients indicated that the most stable anaerobic digestion was achieved using 7.5% and 12.5% pig manure. In contrast, the positive correlation between ammonium and volatile fatty acids (r=0.8698, p<0.001) at 25% pig manure showed process instability. Compared to crop silage alone, pig manure favored the production of biogas and methane; the highest production rates were obtained with 12.5% pig manure. Copyright © 2012 Elsevier Ltd. All rights reserved.
Li, Hailong; Xiong, Lian; Chen, Xuefang; Wang, Can; Qi, Gaoxiang; Huang, Chao; Luo, Mutan; Chen, Xinde
2017-03-01
This study aims to propose a biorefinery pretreatment technology for the bioconversion of sugarcane bagasse (SB) into biofuels and N-fertilizers. Performance of diluted acid (DA), aqueous ammonia (AA), oxidate ammonolysis (OA) and the combined DA with AA or OA were compared in SB pretreatment by enzymatic hydrolysis, structural characterization and acetone-butanol-ethanol (ABE) fermentation. Results indicated that DA-OA pretreatment improves the digestibility of SB by sufficiently hydrolyzing hemicellulose into fermentable monosaccharides and oxidating lignin into soluble N-fertilizer with high nitrogen content (11.25%) and low C/N ratio (3.39). The enzymatic hydrolysates from DA-OA pretreated SB mainly composed of glucose was more suitable for the production of ABE solvents than the enzymatic hydrolysates from OA pretreated SB containing high ratio of xylose. The fermentation of enzymatic hydrolysates from DA-OA pretreated SB produced 12.12g/L ABE in 120h. These results suggested that SB could be utilized efficient, economic, and environmental by DA-OA pretreatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
de Oliveira, Amanda Priscila; Bernardo, Cássia Rubia; Camargo, Ana Vitória da Silveira; Ronchi, Luiz Sérgio; Borim, Aldenis Albaneze; Brandão de Mattos, Cinara Cássia; de Campos Júnior, Eumildo; Castiglioni, Lílian; Netinho, João Gomes; Cavasini, Carlos Eugênio; Bestetti, Reinaldo Bulgarelli; de Mattos, Luiz Carlos
2015-01-01
The clinical manifestations of chronic Chagas disease include the cardiac form of the disease and the digestive form. Not all the factors that act in the variable clinical course of this disease are known. This study investigated whether the CCR5Δ32 (rs333) and CCR5 59029 A/G (promoter region—rs1799987) polymorphisms of the CCR5 gene are associated with different clinical forms of chronic Chagas disease and with the severity of left ventricular systolic dysfunction in patients with chronic Chagas heart disease (CCHD). The antibodies anti-T. cruzi were identified by ELISA. PCR and PCR-RFLP were used to identify the CCR5Δ32 and CCR5 59029 A/G polymorphisms. The chi-square test was used to compare variables between groups. There was a higher frequency of the AA genotype in patients with CCHD compared with patients with the digestive form of the disease and the control group. The results also showed a high frequency of the AG genotype in patients with the digestive form of the disease compared to the other groups. The results of this study show that the CCR5Δ32 polymorphism does not seem to influence the different clinical manifestations of Chagas disease but there is involvement of the CCR5 59029 A/G polymorphism in susceptibility to the different forms of chronic Chagas disease. Besides, these polymorphisms do not influence left ventricular systolic dysfunction in patients with CCHD. PMID:26599761
Luzardo-Ocampo, I; Campos-Vega, R; Gaytán-Martínez, M; Preciado-Ortiz, R; Mendoza, S; Loarca-Piña, G
2017-10-01
Corn (Zea mays L.) and common beans (Phaseolus vulgaris L.) are alternative suitable ingredients for snacks, because of their content of bioactive compounds such as phenolic compounds (PC) and oligosaccharides (OS). However, there is no information about the transformation of these compounds associated with food matrix during gastrointestinal digestion. Therefore, the objective of this work was to simulate the whole digestion process (mouth to colon) to estimate bioaccessibility and small intestine permeability of free PC and OS, and the antioxidant capacity of free PC. Digested nixtamalized corn-cooked common bean chips exhibited significant different quantities of free PC and OS, and higher antioxidant activity compared to methanolic extract. The free PC showed high values of apparent permeability coefficients (0.023-0.729×10 -3 ), related with their absorption in the small intestine. Both free PC and OS were retained in the non-digestible fraction of chips (10.24-64.4%) and were able to reach the colon. Our results suggest the digestion potential to increase chip bioactive compounds and antioxidant activity. Additional studies are required to evaluate their in vivo effects. Copyright © 2017. Published by Elsevier Ltd.
VizieR Online Data Catalog: Spatial deconvolution code (Quintero Noda+, 2015)
NASA Astrophysics Data System (ADS)
Quintero Noda, C.; Asensio Ramos, A.; Orozco Suarez, D.; Ruiz Cobo, B.
2015-05-01
This deconvolution method follows the scheme presented in Ruiz Cobo & Asensio Ramos (2013A&A...549L...4R) The Stokes parameters are projected onto a few spectral eigenvectors and the ensuing maps of coefficients are deconvolved using a standard Lucy-Richardson algorithm. This introduces a stabilization because the PCA filtering reduces the amount of noise. (1 data file).
Calculation and validation of heat transfer coefficient for warm forming operations
NASA Astrophysics Data System (ADS)
Omer, Kaab; Butcher, Clifford; Worswick, Michael
2017-10-01
In an effort to reduce the weight of their products, the automotive industry is exploring various hot forming and warm forming technologies. One critical aspect in these technologies is understanding and quantifying the heat transfer between the blank and the tooling. The purpose of the current study is twofold. First, an experimental procedure to obtain the heat transfer coefficient (HTC) as a function of pressure for the purposes of a metal forming simulation is devised. The experimental approach was used in conjunction with finite element models to obtain HTC values as a function of die pressure. The materials that were characterized were AA5182-O and AA7075-T6. Both the heating operation and warm forming deep draw were modelled using the LS-DYNA commercial finite element code. Temperature-time measurements were obtained from both applications. The results of the finite element model showed that the experimentally derived HTC values were able to predict the temperature-time history to within a 2% of the measured response. It is intended that the HTC values presented herein can be used in warm forming models in order to accurately capture the heat transfer characteristics of the operation.
Ukwuani, Anayo T; Tao, Wendong
2016-12-01
To prevent acetoclastic methanogens from ammonia inhibition in anaerobic digestion of protein-rich substrates, ammonia needs to be removed or recovered from digestate. This paper presents an innovative ammonia recovery process that couples vacuum thermal stripping with acid absorption. Ammonia is stripped out of digestate boiling at a temperature below the normal boiling point due to vacuum. Stripped ammonia is absorbed to a sulfuric acid solution, forming ammonium sulfate crystals as a marketable product. Three common types of digestate were found to have boiling point temperature-vacuum curves similar to water. Seven combinations of boiling temperature and vacuum (50 °C 16.6 kPa, 58 °C 20.0 kPa, 65 °C 25.1 kPa, 70 °C 33.6 kPa, 80 °C 54.0 kPa, 90 °C 74.2 kPa, and 100 °C 101.3 kPa) were tested for batch stripping of ammonia in dairy manure digestate. 93.3-99.9% of ammonia was stripped in 3 h. The Lewis-Whitman model fitted ammonia stripping process well. Ammonia mass transfer coefficient was significantly higher at boiling temperature 65-100 °C and vacuum pressure 25.1-101.3 kPa than 50-58 °C and 16.6-20.0 kPa. The low ammonia saturation concentrations (0-24 mg N/L) suggested a large driving force to strip ammonia. The optimum boiling point temperature - vacuum pressure for ammonia recovery in a recirculation line of a mesophilic digester was 65 °C and 25.1 kPa, at which the ammonia mass transfer coefficient was as high as 37.3 mm/h. Installation of a demister and liquid trap could avoid negative effects of higher stripping temperature and stronger vacuum on formation of ammonium sulfate crystals. Pilot tests demonstrated that high-purity ammonium sulfate crystals could be produced by controlling sulfuric acid content and maintaining acid solution saturated with ammonium sulfate. Although volatile organic compounds such as cyclohexene were found in the final acid solutions, no volatile organic compounds were found in the recovered crystals. Copyright © 2016 Elsevier Ltd. All rights reserved.
The friction coefficient evolution of a MoS2/WC multi-layer coating system during sliding wear
NASA Astrophysics Data System (ADS)
Chan, T. Y.; Hu, Y.; Gharbi, Mohammad M.; Politis, D. J.; Wang, L.
2016-08-01
This paper discusses the evolution of friction coefficient for the multi-layered Molybdenum Disulphide (MoS2) and WC coated substrate during sliding against Aluminium AA 6082 material. A soft MoS2 coating was prepared over a hard WC coated G3500 cast iron tool substrate and underwent friction test using a pin-on-disc tribometer. The lifetime of the coating was reduced with increasing load while the Aluminium debris accumulated on the WC hard coating surfaces, accelerated the breakdown of the coatings. The lifetime of the coating was represented by the friction coefficient and the sliding distance before MoS2 coating breakdown and was found to be affected by the load applied and the wear mechanism.
Fawole, Olaniyi Amos; Opara, Umezuruike Linus
2016-09-13
Co-products obtained from pomegranate juice processing contain high levels of polyphenols with potential high added values. From value-addition viewpoint, the aim of this study was to evaluate the stability of polyphenolic concentrations in pomegranate fruit co-products in different solvent extracts and assess the effect on the total antioxidant capacity using the FRAP, DPPH˙ and ABTS(+) assays during simulated in vitro digestion. Pomegranate juice, marc and peel were extracted in water, 50 % ethanol (50%EtOH) and absolute ethanol (100%EtOH) and analysed for total phenolic concentration (TPC), total flavonoids concentration (TFC) and total antioxidant capacity in DPPH˙, ABTS(+) and FRAP assays before and after in vitro digestion. Total phenolic concentration (TPC) and total flavonoid concentration (TFC) were in the order of peel > marc > juice throughout the in vitro digestion irrespective of the extraction solvents used. However, 50 % ethanol extracted 1.1 to 12-fold more polyphenols than water and ethanol solvents depending on co-products. TPC and TFC increased significantly in gastric digests. In contrast, after the duodenal phase of in vitro digestion, polyphenolic concentrations decreased significantly (p < 0.05) compared to those obtained in gastric digests. Undigested samples and gastric digests showed strong and positive relationships between polyphenols and the antioxidant activities measured in DPPH, ABTS(+) and FRAP assays, with correlation coefficients (r (2)) ranging between 0.930-0.990. In addition, the relationships between polyphenols (TPC and TFC) and radical cation scavenging activity in ABTS(+) were moderately positive in duodenal digests. Findings from this study showed that concentration of pomegranate polyphenols and the antioxidant capacity during in vitro gastro-intestinal digestion may not reflect the pre-digested phenolic concentration. Thus, this study highlights the need to provide biologically relevant information on antioxidants by providing data reflecting their stability and activity after in vitro digestion.
Colombo, Michelle L; McNeil, Swami; Iwai, Nicholas; Chang, Albert; Shen, Mei
2016-01-01
We present here the detection of dopamine (DA) at nanopipet electrodes with radii of hundreds of nanometers ranging from 160 nm to 480 nm. Dibenzo-18-crown-6 (DB18C6) was employed as an ionophore to facilitate DA transfer, resulting in a half-wave transfer potential, E 1/2, DA , of -0.322 (±0.020) V vs. E 1/2, TBA . Well-defined steady-state sigmoidal cyclic voltammograms were observed for the transfer of DA. High resolution scanning electron microscopy was used to measure the size and taper angle of the nanopipet electrodes. The detection is linear with concentration of DA ranging from 0.25 mM to 2 mM; calculated diffusion coefficient at nanopipet electrodes with above mentioned sizes is 4.87 (±0.28) × 10 -10 m 2 /s. The effect of the common interferent ascorbic acid on DA detection with nanopipet electrodes was evaluated, where DA detection still shows linear behavior with well-defined sigmoidal CVs with E 1/2, DA being -0.328 (±0.029) V vs. E 1/2, TBA . The diffusion coefficient for DA transfer in MgCl 2 with the presence of 2 mM AA was measured to be 1.93 (±0.59) × 10 -10 m 2 /s on nanoelectrodes with radii from 161 nm to 263 nm, but the physiological concentration of 0.1 mM AA had no effect on DA's diffusion coefficient.
USDA-ARS?s Scientific Manuscript database
A digestibility trial with channel catfish Ictalurus punctatus was conducted to determine apparent availability coefficients (AACs) of phosphorus for selected common feedstuffs: soybean meal, cottonseed meal, wheat middlings, corn gluten feed (CGF), and corn distillers dried grains with solubles (DD...
Farrah, S R; Bitton, G
1983-01-01
The fate of indicator bacteria, a bacterial pathogen, and total aerobic bacteria during aerobic and anaerobic digestion of wastewater sludge under laboratory conditions was determined. Correlation coefficients were calculated between physical and chemical parameters (temperature, dissolved oxygen, pH, total solids, and volatile solids) and either the daily change in bacterial numbers or the percentage of bacteria in the supernatant. The major factor influencing survival of Salmonella typhimurium and indicator bacteria during aerobic digestion was the temperature of sludge digestion. At 28 degrees C with greater than 4 mg of dissolved oxygen per liter, the daily change in numbers of these bacteria was approximately -1.0 log10/ml. At 6 degrees C, the daily change was less than -0.3 log10/ml. Most of the bacteria were associated with the sludge flocs during aerobic digestion of sludge at 28 degrees C with greater than 2.4 mg of dissolved oxygen per liter. Lowering the temperature or the amount of dissolved oxygen decreased the fraction of bacteria associated with the flocs and increased the fraction found in the supernatant. PMID:6401978
Bjerg-Nielsen, Michael; Ward, Alastair James; Møller, Henrik Bjarne; Ottosen, Lars Ditlev Mørck
2018-02-01
This paper analyses time (30 and 60 min) and temperature (120-190 °C) effects of intermediate thermal hydrolysis (ITHP) in a two-step anaerobic digestion of waste activated sludge (WAS) with and without wheat straw as a co-substrate. Effects were analyzed by measuring biochemical methane potential for 60 days and assessing associated kinetic and chemical data. Compared to non-treatment, ITHP increased the secondary step methane yield from 52 to 222 L CH 4 kg VS -1 and from 147 to 224 L CH 4 kg VS -1 for pre-digested WAS and pre-co-digested WAS respectively at an optimum of 170 °C and 30 min. The hydrolysis coefficients (k hyd ) increased by up to 127% following treatment. Increasing ITHP time from 30 to 60 min showed ambiguous results regarding methane yields, whilst temperature had a clear and proportional effect on the concentrations of acetic acid. The energy balances were found to be poor and dewatering to increase total solids above the values tested here is necessary for this process to be energetically feasible. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Paidar, Moslem; Asgari, Ali; Ojo, Olatunji Oladimeji; Saberi, Abbas
2018-03-01
Grain growth inhibition at the heat-affected zone, improved weld strength and superior tribological properties of welds are desirable attributes of modern manufacturing. With the focused on these attributes, tungsten carbide (WC) nanoparticles were employed as reinforcements for the friction stir welding of 5-mm-thick AA5182 aluminum alloy by varying tool traverse speeds. The microstructure, microhardness, ultimate tensile strength, fracture and wear behavior of the resultant WC-reinforced welds were investigated, while unreinforced AA5182 welds were employed as controls for the study. The result shows that the addition of WC nanoparticles causes substantial grain refinement within the weld nugget. A decrease in traverse speed caused additional particle fragmentation, improved hardness value and enhanced weld strength in the reinforced welds. Improved wear rate and friction coefficient of welds were attained at a reduced traverse speed of 100 mm/min in the WC-reinforced welds. This improvement is attributed to the effects of reduced grain size/grain fragmentation and homogeneous dispersion of WC nanoparticles within the WC-reinforced weld nugget.
NRL (Naval Research Laboratory) Plasma Formulary. Revised.
1983-01-01
EQUATIONS Name Rationalized inks Gaussian Faday’s law V xE -- !-s VxE--l1p .aD -l3D 4i" Ampere’slta xH-VxH -- +J VxH -- .- +- J at C at C Poison’s eqution...energy density Froude Fr t V (gL ) 1/2 (Inertial forces/gravitational or VINL buoyancy forces) t/2 Gay- Lussac Ga I/PA T (Relative volume change...112 Alfvin speed a Newton’s- law heat coefficient, k x " aA T aix Volumetric expansion coefficient, dV/ V - )dT r Bulk modulus (units m/it 2 ) AR, A
Jiang, H Q; Gong, L M; Ma, Y X; He, Y H; Li, D F; Zhai, H X
2006-08-01
1. The objective of this study was to evaluate whether the oligosaccharide stachyose enhances gastrointestinal tract health by fermentation and proliferation of desirable bacteria species and thus affects growth performance and nutrient digestibility in broilers. 2. A total of 432 1-d-old male Arbor Acres (AA) broilers were randomly allocated to one of 6 treatments, with 12 replicate pens per treatment and 6 birds per pen. Chicks were fed a maize-hamlet protein 300 (HP300) basal diet with 0, 4.0, 8.0, 12.0 or 16.0 g/kg stachyose. A sixth diet contained no HP300 but soybean meal (SBM) and provided 8.7 g/kg stachyose and 3.1 g/kg raffinose. The duration of the study was 42 d. 3. Stachyose contents above 12.0 g/kg depressed group body weights, average daily gain and feed/gain but not feed intake during the whole experimental period. Broiler growth decreased linearly and quadratically with increasing stachyose content. No differences were detected between diets supplemented with 12.0 g/kg stachyose and SBM. 4. Nutrient digestibility tended to decrease but not significantly with increasing stachyose. 5. Stachyose content had no significant positive effects on caecal pH, microflora population and the resulting short-chain fatty acid (SCFA) metabolites during the 42 d experiment, with only butyrate differing significantly in the initial period.
Cai, Yafan; Wang, Jungang; Zhao, Yubin; Zhao, Xiaoling; Zheng, Zehui; Wen, Boting; Cui, Zongjun; Wang, Xiaofen
2018-09-01
Trace elements were commonly used as additives to facilitate anaerobic digestion. However, their addition is often blind because of the complexity of reaction conditions, which has impeded their widespread application. Therefore, this study was conducted to evaluate deficiencies in trace elements during anaerobic digestion by establishing relationships between changes in trace element bioavailability (the degree to which elements are available for interaction with biological systems) and digestion performance. To accomplish this, two batch experiments were conducted. In the first, sequential extraction was used to detect changes in trace element fractions and then to evaluate trace element bioavailability in the whole digestion cycle. In the second batch experiment, trace elements (Co, Fe, Cu, Zn, Mn, Mo and Se) were added to the reaction system at three concentrations (low, medium and high) and their effects were monitored. The results showed that sequential extraction was a suitable method for assessment of the bioavailability of trace elements (appropriate coefficient of variation and recovery rate). The results revealed that Se had the highest (44.2%-70.9%) bioavailability, while Fe had the lowest (1.7%-3.0%). A lack of trace elements was not directly related to their absolute bioavailability, but was instead associated with changes in their bioavailability throughout the digestion cycle. Trace elements were insufficient when their bioavailability was steady or increased over the digestion cycle. These results indicate that changes in trace element bioavailability during the digestion cycle can be used to predict their deficiency. Copyright © 2018 Elsevier Ltd. All rights reserved.
Costas, Benjamín; Aragão, Cláudia; Dias, Jorge; Afonso, António; Conceição, Luís E C
2013-10-01
Amino acids (AA) regulate key metabolic pathways, including some immune responses. Therefore, this study aimed to assess whether an increased availability of dietary AA can mitigate the expected increase in plasma cortisol and metabolites levels due to high stocking density and its subsequent immunosuppression. Senegalese sole (Solea senegalensis) were maintained at low stocking density (LSD; 3.5 kg m(-2)) or high stocking density (HSD; 12 kg m(-2)) for 18 days. Additionally, both treatments were fed a control or a high protein (HP) diet (LSD, LSD HP, HSD and HSD HP). The HP diet slightly increased the levels of digestible indispensable AA, together with tyrosine and cysteine. HSD was effective in inducing a chronic stress response after 18 days of treatment since fish held at HSD presented higher plasma cortisol, glucose and lactate levels. Moreover, this increase in stress indicators translated in a decrease in plasma lysozyme, alternative complement pathway (ACP) and peroxidase activities, suggesting some degree of immunosuppression. Interestingly, while plasma glucose and lactate levels in HSD HP specimens decreased to similar values than LSD fish, plasma lysozyme, ACP and peroxidase activities increased, with even higher values than LSD groups for ACP activity. It is suggested that the HP diet may be used as functional feed since it may represent a metabolic advantage during stressful events and may counteract immunosuppression in sole.
Attia, Y A; Hassan, R A; Tag El-Din, A E; Abou-Shehema, B M
2011-12-01
Four hundred and twenty, 21-day-old slow-growing chicks were divided randomly into seven treatments, each containing five replicates. Each replicate was kept in a 1 × 1-m floor pen. One treatment was kept under thermo-neutral conditions in a semi-open house and fed a corn-soybean meal diet (positive control). The other six groups were kept under chronic heat stress (CHS) at 38 °C and 60% RH for 4 h from 12:00 to 16:00 pm for three successive days per week. Chicks in CHS treatments were fed a corn-soybean meal diet without (negative control) or with increasing metabolizable energy (ME) level by oil supplementation alone, or also with increasing some essential amino acids (EAA) such as methionine (Met), methionine and lysine (Met+Lys) or methionine, lysine and arginine (Met+Lys+Arg) or supplemented with 250 mg of ascorbic acid (AA)/kg. CHS impaired (p < 0.05) growth performance, increased plasma triglycerides and total serum Ca while decreasing (p < 0.05) plasma glucose and total serum protein. Meanwhile 250 mg AA/kg diet or an increasing ME without or with some EAA partially alleviated (p < 0.0001) the negative effect of CHS on growth while increasing (p < 0.05) feed intake and improving (p < 0.05) feed:gain ratio (F:G) and crude protein (CP) digestibility (p < 0.05). AA or increasing ME with or without EAA increased (p < 0.05) percentage dressing, liver and giblets to those of the positive control. AA or increasing ME with or without EAA partially alleviated the negative effect of CHS on blood pH, packed cell volume (PCV), haemoglobin (Hgb), total serum protein and total Ca, plasma glucose and triglyceride, rectal temperature and respiration rate. Increasing ME level improved chickens' tolerance to CHS without a significant difference from those supplemented with AA. However, increasing Met, Lys and Arg concentration did not improve performance over that recorded with increasing ME level alone. Under CHS, 250 mg AA/kg diet or increasing ME level by addition of 3% vegetable oil could be an useful approach to improve productive and physiological traits of slow-growing chicks, which may be applicable also to fast-growing one. © 2010 Blackwell Verlag GmbH.
Milis, Ch; Liamadis, D
2008-02-01
Two in vivo digestion trials were conducted to evaluate the effects of diet's crude protein (CP) level, N degradability, and non-forage fibre source (NFFS) on nutrient digestibility and energy value of sheep rations. In each trial, rams were fed four isocaloric and isofibrous rations, differing in main protein and/or NFFS source. At the first trial, mean CP/metabolizable energy (ME) ratio of the diets was 17 g/MJ ME and at the second trial, 13 g/MJ ME. At both trials, the first ration contained cotton seed cake (CSC) and wheat bran (WB), the second CSC and corn gluten feed (CGF), the third corn gluten meal (CGM) and WB and the fourth CGM and CGF. Data of both trials were analysed in common as 2 x 2 x 2 factorial experimental design. Low N degradability (CGM) had positive effect on CP, neutral detergent fibre (NDF) and acid detergent fibre (ADF) digestibility of the ration. Those results suggest that an increase in rumen undegradable protein (RUP) content does not negatively affect nutrient digestibility of sheep rations. Corn gluten feed significantly elevated crude fibre (CF) digestibility, in comparison with WB. Rations having high CP/ME ratio had higher digestibility of CP in comparison with those having low CP/ME ratio; the opposite was true for ether extract, CF, NDF and ADF digestibilities. CP level x N degradability interaction negatively affected energy value of the rations that had high CP level and high N degradability. Former suggest that when CP content is high then N degradability should be low otherwise ration's ME is negatively affected. CP digestibility and coefficient q of the rations containing WB and having high N degradability (N degradability x NFFS interaction) were the lowest suggesting that the combination of CSC and WB negatively affected CP digestibility and energy value of the ration. This could be explained by a reduced microbial CP synthesis, or lower RUP digestibility or both.
[Migrations in Latin American countries. Characteristics of the pediatric population].
Vásquez-De Kartzow, Rodrigo; Castillo-Durán, Carlos; Lera M, Lydia
2015-01-01
Migration is a growing phenomenon among Latin American countries (LAC) as well as others; however, scarce information is available studying its impact on paediatric groups and its association with socioeconomic variables. To study the association among socioeconomic variables and the immigration rate of paediatric population in LAC. Official rates of migration of LAC were obtained from: International Organization for Migration, Pan American Health Organization, and United Nations Development Programme. Demographic and socioeconomic information was also obtained for: gross domestic product (GDP), human development index (HDI), Gini coefficient of inequality (GC), alphabetization rate for adults (AA), net migration rate (NMR), and immigration of children<15 years (IM15). Description, linear correlations and analysis of differences between groups of countries were assessed. The NMR was positive for Costa Rica, Panama, Venezuela, Chile and Argentina. No association among NMR and GDP, HDI, GC, AA was found. A correlation of IM15 was found with: GC (r=0.668, P=.01), with GDP (r=-0.720; P=.01), AA (r=-0.755; P=.01) and with HDI (r=-0.799; P=.01). Rate of IM15 was lower in LA countries with advanced/medium development (GDP>median) vs those with low development (Fisher, P<.0001). There is a direct inverse association between GDP per capita, HDI, AA and GC and the proportion of each country IN15. We did not observe an association between NMR and HDI, AA, and GC. The health impact of these migrations should be analysed. Copyright © 2015. Publicado por Elsevier España, S.L.U.
Kim, Dong Young; Kim, Young Soo; Kim, Tae Hyun; Oh, Kyeong Keun
2016-01-01
Fractionation of EFB was conducted in two consecutive steps using a batch reaction system: hemicellulose hydrolysis using acetic acid (AA; 3.0-7.0 wt.%) at 170-190°C for 10-20 min in the first stage, and lignin solubilization using ammonium hydroxide (5-20 wt.%) at 140-220°C for 5-25 min in the second stage. The two-stage process effectively fractionated empty fruit bunches (EFB) in terms of hemicellulose hydrolysis (53.6%) and lignin removal (59.5%). After the two-stage treatment, the fractionated solid contained 65.3% glucan. Among three investigated process parameters, reaction temperature and ammonia concentration had greater impact on the delignification reaction in the second stage than reaction time. The two-stage fractionation processing improved the enzymatic digestibility to 72.9% with 15 FPU of cellulase/g of glucan supplemented with 70 pNPG of β-glycosidase (Novozyme 188)/g-glucan, which was significantly enhanced from the equivalent digestibility of 28.3% for untreated EFB and 45.7% for AAH-fractionated solid. Copyright © 2015 Elsevier Ltd. All rights reserved.
Murugesan, Ganapathi R.; Romero, Luis F.; Persia, Michael E.
2014-01-01
Two experiments were conducted to determine the effects of protease and phytase (PP) and a Bacillus sp. direct-fed microbial (DFM) on dietary energy and nutrient utilization in broiler chickens. In the first experiment, Ross 308 broiler chicks were fed diets supplemented with PP and DFM in a 2×2 factorial arrangement. The 4 diets (control (CON), CON + PP, CON + DFM, and CON + PP + DFM) were fed from 15–21 days of age. In Experiment 1, significant interaction (P≤0.01) between PP and DFM on the apparent ileal digestibility coefficient for starch, crude protein, and amino acid indicated that both additives increased the digestibility. Both additives increased the nitrogen retention coefficient with a significant interaction (P≤0.01). Although no interaction was observed, significant main effects (P≤0.01) for nitrogen-corrected apparent ME (AMEn) for PP or DFM indicated an additive response. In a follow-up experiment, Ross 308 broiler chicks were fed the same experimental diets from 1–21 days of age. Activities of ileal brush border maltase, sucrase, and L-alanine aminopeptidase were increased (P≤0.01) by PP addition, while a trend (P = 0.07) for increased sucrase activity was observed in chickens fed DFM, in Experiment 2. The proportion of cecal butyrate was increased (P≤0.01) by DFM addition. Increased nutrient utilization and nitrogen retention appear to involve separate but complementary mechanisms for PP and DFM, however AMEn responses appear to have separate and additive mechanisms. PMID:25013936
Kaplan, R J; Greenwood, C E
1998-05-01
The digestibility and absorption of dietary triacylglycerols are dependent on a number of factors including their fatty acid profile. Data demonstrating poor bioavailability of dietary stearic acid would suggest that hydrogenated oil sources would have lower digestibility coefficients compared with their native oils. To test this hypothesis, postweanling rats were fed one of four diets, formulated to contain 40% of energy as fat (assuming complete bioavailability), for 14 d. The diets only differed by fat type, containing soybean oil (SBO), fully hydrogenated soybean oil (HSB), medium-chain triglyceride oil (MCT), or hydrogenated coconut oil (HCO). Rats fed HSB consumed more food during the last 6 d (155.2 +/- 2.7 g) than those in each of the other groups (MCT: 118.9 +/- 2. 2 g; HCO: 124.7 +/- 3.2 g; SBO: 123.8 +/- 2.3 g), yet, they did not gain more weight. Two-day fecal excretion was almost three times greater in HSB-fed rats than in rats fed any other diet (P < 0.0001) because HSB was very poorly available. The digestibility coefficients (a measure of bioavailability) of the four fats were: HSB (30.9 +/- 1.3%) < HCO (94.5 +/- 0.4%) < SBO (97.0 +/- 0.4%) < MCT (98.7 +/- 0.2%) (P < 0.0007). All rats compensated for the incomplete availability of the fats, as apparent absorbable energy consumed did not differ among diet groups. The present data suggest that HSB only contributes 11.6 kJ/g (most fats contribute approximately 37.7 kJ/g) and that not only manufactured fat substitutes, such as olestra, but also more conventional fats are incompletely available to the body. Foods that currently contain HSB may contribute much less utilizable fat and energy than presently realized.
Field Assessment of Acoustic-Doppler Based Discharge Measurements
Mueller, D.S.; ,
2002-01-01
The use of equipment based on the Doppler principle for measuring water velocity and computing discharge is common within the U.S. Geological Survey (USGS). The instruments and software have changed appreciably during the last 5 years; therefore, the USGS has begun a field validation of the instruments currently (2002) available for making discharge measurements from a moving boat in streams of various sizes. Instruments manufactured by SonTek/YSI2 and RD Instruments, Inc. were used to collect discharge data at five different sites. One or more traditional discharge measurements were made by the use of a Price AA current meter and standard USGS procedures with the acoustic instruments at each site during data collection. The discharges measured with the acoustic instruments were compared with the discharges measured with Price AA meters and the current USGS stage-discharge rating for each site. The mean discharges measured by each acoustic instrument were within 5 percent of the Price AA-based measurement and (or) discharge from the stage-discharge rating. Additional analysis of the data collected indicates that the coefficient of variation of the discharge measurements consistently was less for the RD Instruments, Inc. Rio Grandes than it was for the SonTek/YSI RiverSurveyors. The bottom-tracking referenced measurement had a lower coefficient of variation than the differentially corrected global positioning system referenced measurements. It was observed that the higher frequency RiverSurveyors measured a moving bed more often than the lower frequency Rio Grandes. The detection of a moving bed caused RiverSurveyors to be consistently biased low when referenced to bottom tracking. Differentially corrected global positioning system data may be used to remove the bias observed in the bottom-tracking referenced measurements.
A systematic study of multiple minerals precipitation modelling in wastewater treatment.
Kazadi Mbamba, Christian; Tait, Stephan; Flores-Alsina, Xavier; Batstone, Damien J
2015-11-15
Mineral solids precipitation is important in wastewater treatment. However approaches to minerals precipitation modelling are varied, often empirical, and mostly focused on single precipitate classes. A common approach, applicable to multi-species precipitates, is needed to integrate into existing wastewater treatment models. The present study systematically tested a semi-mechanistic modelling approach, using various experimental platforms with multiple minerals precipitation. Experiments included dynamic titration with addition of sodium hydroxide to synthetic wastewater, and aeration to progressively increase pH and induce precipitation in real piggery digestate and sewage sludge digestate. The model approach consisted of an equilibrium part for aqueous phase reactions and a kinetic part for minerals precipitation. The model was fitted to dissolved calcium, magnesium, total inorganic carbon and phosphate. Results indicated that precipitation was dominated by the mineral struvite, forming together with varied and minor amounts of calcium phosphate and calcium carbonate. The model approach was noted to have the advantage of requiring a minimal number of fitted parameters, so the model was readily identifiable. Kinetic rate coefficients, which were statistically fitted, were generally in the range 0.35-11.6 h(-1) with confidence intervals of 10-80% relative. Confidence regions for the kinetic rate coefficients were often asymmetric with model-data residuals increasing more gradually with larger coefficient values. This suggests that a large kinetic coefficient could be used when actual measured data is lacking for a particular precipitate-matrix combination. Correlation between the kinetic rate coefficients of different minerals was low, indicating that parameter values for individual minerals could be independently fitted (keeping all other model parameters constant). Implementation was therefore relatively flexible, and would be readily expandable to include other minerals. Copyright © 2015 Elsevier Ltd. All rights reserved.
Mei, Juan; Zhao, Ji
2018-06-14
Presynaptic neurotoxins and postsynaptic neurotoxins are two important neurotoxins isolated from venoms of venomous animals and have been proven to be potential effective in neurosciences and pharmacology. With the number of toxin sequences appeared in the public databases, there was a need for developing a computational method for fast and accurate identification and classification of the novel presynaptic neurotoxins and postsynaptic neurotoxins in the large databases. In this study, the Multinomial Naive Bayes Classifier (MNBC) had been developed to discriminate the presynaptic neurotoxins and postsynaptic neurotoxins based on the different kinds of features. The Minimum Redundancy Maximum Relevance (MRMR) feature selection method was used for ranking 400 pseudo amino acid (PseAA) compositions and 50 top ranked PseAA compositions were selected for improving the prediction results. The motif features, 400 PseAA compositions and 50 PseAA compositions were combined together, and selected as the input parameters of MNBC. The best correlation coefficient (CC) value of 0.8213 was obtained when the prediction quality was evaluated by the jackknife test. It was anticipated that the algorithm presented in this study may become a useful tool for identification of presynaptic neurotoxin and postsynaptic neurotoxin sequences and may provide some useful help for in-depth investigation into the biological mechanism of presynaptic neurotoxins and postsynaptic neurotoxins. Copyright © 2018 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Bressan, José Divo; Liewald, Mathias; Drotleff, Klaus
2017-10-01
Forming limit strain curves of conventional aluminium alloy AA6014 sheets after loading with non-linear strain paths are presented and compared with D-Bressan macroscopic model of sheet metal rupture by critical shear stress criterion. AA6014 exhibits good formability at room temperature and, thus, is mainly employed in car body external parts by manufacturing at room temperature. According to Weber et al., experimental bi-linear strain paths were carried out in specimens with 1mm thickness by pre-stretching in uniaxial and biaxial directions up to 5%, 10% and 20% strain levels before performing Nakajima testing experiments to obtain the forming limit strain curves, FLCs. In addition, FLCs of AA6014 were predicted by employing D-Bressan critical shear stress criterion for bi-linear strain path and comparisons with the experimental FLCs were analyzed and discussed. In order to obtain the material coefficients of plastic anisotropy, strain and strain rate hardening behavior and calibrate the D-Bressan model, tensile tests, two different strain rate on specimens cut at 0°, 45° and 90° to the rolling direction and also bulge test were carried out at room temperature. The correlation of experimental bi-linear strain path FLCs is reasonably good with the predicted limit strains from D-Bressan model, assuming equivalent pre-strain calculated by Hill 1979 yield criterion.
Buyukozturk, Fulden; Di Maio, Selena; Budil, David E.; Carrier, Rebecca L.
2014-01-01
Purpose To mechanistically study and model the effect of lipids, either from food or self-emulsifying drug delivery systems (SEDDS), on drug transport in the intestinal lumen. Methods Simultaneous lipid digestion, dissolution/release, and drug partitioning were experimentally studied and modeled for two dosing scenarios: solid drug with a food-associated lipid (soybean oil) and drug solubilized in a model SEDDS (soybean oil and Tween 80 at 1:1 ratio). Rate constants for digestion, permeability of emulsion droplets, and partition coefficients in micellar and oil phases were measured, and used to numerically solve the developed model. Results Strong influence of lipid digestion on drug release from SEDDS and solid drug dissolution into food-associated lipid emulsion were observed and predicted by the developed model. 90 minutes after introduction of SEDDS, there was 9% and 70% drug release in the absence and presence of digestion, respectively. However, overall drug dissolution in the presence of food-associated lipids occurred over a longer period than without digestion. Conclusion A systems-based mechanistic model incorporating simultaneous dynamic processes occurring upon dosing of drug with lipids enabled prediction of aqueous drug concentration profile. This model, once incorporated with a pharmacokinetic model considering processes of drug absorption and drug lymphatic transport in the presence of lipids, could be highly useful for quantitative prediction of impact of lipids on bioavailability of drugs. PMID:24234918
Cheng, Jiehong; Kong, Feng; Zhu, Jun; Wu, Xiao
2015-01-01
A novel process of combining mesophilic (<35°C) anaerobic digestion with the thermophilic (55°C) aerobic digestion process (AN-TAD) was designed to stabilize sludge and economize aeration energy. Effects of stabilization and sludge properties for AN-TAD process were evaluated by batch experiments during a 25 d digestion period. The sludges digested by AN-TAD process achieved the requirements for Class-A sludge standard. The sludge at total solid (TS) 5.4% had the highest value of decay coefficient K(d(55)) at 0.1851 d(-1) among the three TS contents according to the first-order kinetics equation. Oxidation reduction potential at below 0 mV remained for sludges at TSs of 6.5%, 5.4%, and 4.6% for at least 15 d because of initial hydrolytic-acidification. Concentrations of nitrogen and phosphorus in sludges at TSs of 6.5%, 5.4%, and 4.6% gradually increased up to the highest values in the supernatant during the initial 13 d, causing low utilized value in land application as a fertilizer. Prolonging the retention time for more than 15 d was considered because soluble phosphorus precipitated in the solid phase. High content of soluble organic matters of the soluble chemical oxygen demand, protein, and polysaccharide in the supernatant caused deterioration in sludge dewaterability rates.
Zhang, Dian; Strawn, Mary; Novak, John T; Wang, Zhi-Wu
2018-07-01
The highly volatile methanethiol (MT) with an extremely low odor threshold and distinctive putrid smell is often identified as a major odorous compound generated under anaerobic conditions. As an intermediate compound in the course of anaerobic digestion, the extent of MT emission is closely related to the time of anaerobic reaction. In this study, lab-scale anaerobic digesters were operated at solids retention time (SRTs) of 15, 20, 25, 30, 40 and 50 days to investigate the effect of SRT on MT emission. The experimental results demonstrated a bell-shaped curve of MT emission versus SRT with a peak around 20 days SRT. In order to understand this SRT effect, a kinetic model was developed to describe MT production and utilization dynamics in the course of anaerobic digestion and calibrated with the experimental results collected from this study. The model outcome revealed that the high protein content in the feed sludge together with the large maintenance coefficient of MT fermenters are responsible for the peak MT emission emergence in the range of typical SRT used for anaerobic digestion. A further analysis of the kinetic model shows that it can be extensively simplified with reasonable approximation to a form that anaerobic digestion practitioners could easily use to predict the MT and SRT relationship. Copyright © 2018 Elsevier Ltd. All rights reserved.
13C-Labeled-Starch Breath Test in Congenital Sucrase-isomaltase Deficiency.
Robayo-Torres, Claudia C; Diaz-Sotomayor, Marisela; Hamaker, Bruce R; Baker, Susan S; Chumpitazi, Bruno P; Opekun, Antone R; Nichols, Buford L
2018-06-01
Human starch digestion is a multienzyme process involving 6 different enzymes: salivary and pancreatic α-amylase; sucrase and isomaltase (from sucrose-isomaltase [SI]), and maltase and glucoamylase (from maltase-glucoamylase [MGAM]). Together these enzymes cleave starch to smaller molecules ultimately resulting in the absorbable monosaccharide glucose. Approximately 80% of all mucosal maltase activity is accounted for by SI and the reminder by MGAM. Clinical studies suggest that starch may be poorly digested in those with congenital sucrase-isomaltase deficiency (CSID). Poor starch digestion occurs in individuals with CSID and can be documented using a noninvasive C-breath test (BT). C-Labled starch was used as a test BT substrate in children with CSID. Sucrase deficiency was previously documented in study subjects by both duodenal biopsy enzyme assays and C-sucrose BT. Breath CO2 was quantitated at intervals before and after serial C-substrate loads (glucose followed 75 minutes later by starch). Variations in metabolism were normalized against C-glucose BT (coefficient of glucose absorption). Control subjects consisted of healthy family members and a group of children with functional abdominal pain with biopsy-proven sucrase sufficiency. Children with CSID had a significant reduction of C-starch digestion mirroring that of their duodenal sucrase and maltase activity and C-sucrase BT. In children with CSID, starch digestion may be impaired. In children with CSID, starch digestion correlates well with measures of sucrase activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Z.
1994-12-31
Hydride generation (HG) is a good sample introduction technique for the determination of As and Se, and has been widely used in atomic spectrometry. Several instrumental developments have been made in the hydride-generation system, however, sample digestion (pretreatment) is still the critical step in the FIG determination of As and Se in solid and semi-solid samples. The general digestion procedure with mineral acids is not suitable for complete decomposition of refractory organic compounds of As and Se present in some organic-rich materials, and then does not allow for the measurement of both As and Se in most environmental and biologicalmore » samples by HG. In this work, some well-designed experiments on the wet digestion in open system have been done with a temperature controlled sand bath. The oxidation performances of some mixtures of mineral acids and salts in different combinations have been investigated and evaluated with environmental and biological samples. With the use of HNO{sub 3}/HClO{sub 4} mixing with either the high-boiling-point acids (H{sub 2}SO{sub 4}, H{sub 3}PO{sub 4}) or some mineral salts(Mg(NO{sub 3}){sub 2}, MgSO{sub 4}, Na{sub 2}SO{sub 4}, NaH{sub 2}PO{sub 4}), the complete mineralization of organoarsenic and organoselenium compounds in the samples can be readily achieved while a dewatered step is in the employ of the digestion program. An improved wet digestion procedure with HNO{sub 3}/HClO{sub 4}/H{sub 3}PO{sub 4}(or Mg(NO{sub 3}){sub 2}, or MgSO{sub 4}) was investigated and optimized for the determination of both As and Se in sediment, soil, coal, fish and plant materials by HG-AAS. This method has been evaluated by the analyses of CRMs, including PACS-1, BCSS-1, MESS-11 DORM-1. DOLT-1. NIST-1632b, BCR-40 and BCR-181 for both As and Se, and good agreements with the certified values were obtained.« less
Dennis, T S; Hu, W; Suarez-Mena, F X; Hill, T M; Quigley, J D; Schlotterbeck, R L
2017-08-01
Fecal starch (FS) has been used as a tool to evaluate starch and diet digestibility in lactating dairy cows and feedlot steers. Some on-farm advisors also use FS to evaluate calf starter digestibility in preweaned dairy calves. Our objective was to evaluate the influence of starter intake (SI), starch and organic matter digestibility, milk replacer (MR) feeding rate, and age on FS concentrations in preweaned dairy calves. Male Holstein calves (43 ± 2.9 kg of body weight; n = 35) from a single farm were fed different amounts of MR ranging from 0.44 to 1.10 kg of dry matter (DM) daily (27% crude protein, 17% fat) and weaned by 7 wk of age. Starter ingredient composition was 37% whole corn, 20% whole oats, 35% protein pellet, and 3% molasses and contained 43 ± 1.9% starch. Fecal grab samples were taken at 3 (n = 20), 6 (n = 20), and 8 wk (n = 35) of age. Twelve fecal samples per calf were taken via rectal palpation over a 5-d period each week, frozen daily, combined on an equal wet-weight basis, and subsampled for analysis. Chromic oxide was used as an external digestibility marker at 3 and 6 wk (included in MR), whereas acid-insoluble ash was used as an internal marker at 8 wk. Milk replacer and starter intakes (offered and refused) were recorded daily during collection periods. Multiple and linear regression of organic matter digestibility (% of DM), total-tract starch digestibility (TTSD; % of DM), MR intake (kg/d), SI (kg/d), and age (week) versus FS (% of fecal DM) were determined using PROC REG of SAS (version 9.2, SAS Institute Inc., Cary, NC). Prior to weaning, SI, age, and MR rate explained 89% of the variation in TTSD, where TTSD = [19.7 × SI (±4.25)] + [3.8 × age (±0.79)] - [24.8 × MR (±3.19)] + 56.2 (±3.39). At 3 wk of age, TTSD increased (coefficient of determination = 0.53) and SI decreased (coefficient of determination = 0.20) with increasing FS. At 6 wk of age, TTSD and SI were unrelated to FS. In 8-wk-old calves (with 2 trials), SI, MR rate, FS, and trial explained 92% of the variation in TTSD, where TTSD = -[2.6 × SI (±0.67)] - [2.4 × MR (±0.56)] - [0.6 × FS (±0.04)] + [1.1 × trial (±0.33)] + 100.4 (±1.02). Postweaning, TTSD decreased linearly as FS increased (coefficient of determination = 0.86), whereas FS and SI were unrelated, a relationship in contrast to the previously observed result in calves still consuming milk replacer. In the current study, FS was not a good estimate of TTSD or dry feed intake in the preweaned calf, but has potential for evaluating TTSD in calves after weaning. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Borucki Castro, S I; Lapierre, H; Phillip, L E; Jardon, P W; Berthiaume, R
2008-02-01
Lysine (Lys) availability in three different soya-bean meal (SBM) products was determined using the following techniques: whole body (WB) net flux of Lys, digestible Lys (duodenal flow × intestinal digestibility) and the plasma Lys response curve method of Rulquin and Kowalczyk (2003). Four multiparous Holstein cows (173 days in milk) were equipped with ruminal and duodenal cannulas and used in a 4 × 4 Latin square experiment with 14-day periods. The animals were fed either solvent-extracted SBM (SE), expeller-processed SBM (EP) or lignosulphonate-treated SBM (LS) at 23% of the diet dry matter (DM). The fourth treatment (SE70) consisted of a continuous infusion of Lys (70 g/day) into the omasum of cows fed the SE diet. Chromium(III) oxide was included as a digesta marker in order to determine the duodenal flow of amino acids (AA). On day 12 of each experimental period, six blood samples were collected to determine plasma Lys concentrations. Immediately after that, a pulse dose of L-[2-15N] Lys was administered in the jugular vein. Jugular blood samples were then collected at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 13, 16, 19, 25 and 31 min after the injection to determine 15N Lys enrichment. On each of days 13 and 14, eight digesta samples were collected and pooled by period. Amongst the diets of SBM (SE, EP, LS), no differences were observed for duodenal Lys flow or digestible Lys. Duodenal flow of microbial N with SE was numerically higher, compared with EP and LS, indicating enhanced duodenal supply of microbial Lys for this diet, and this may have compensated for the additional Lys derived from undegradable protein in rumen-protected SBM products (EP and LS). The use of the plasma response curve method as well as the measurement of WB Lys flux also revealed no differences in Lys availability among the SBM products. The WB flux method resulted in 100% post-ruminal recovery of the Lys infused with diet SE70 compared with the control diet SE, which indicates that the method is reliable for determining Lys availability. The Lys flux approach not only allows for the estimation of intestinally available essential AA but also it avoids the use of cannulated animals.
Lee, Kathy Wai Yu; Porter, Christopher J H; Boyd, Ben J
2013-09-01
There is increasing attention in the literature towards understanding the behaviour of lipid-based drug formulations under digestion conditions using in vitro and in vivo methods. This necessitates a convenient method for quantitation of lipids and lipid digestion products. In this study, a simple and accessible method for the separation and quantitative determination of typical formulation and digested lipids using high performance liquid chromatography coupled to refractive index detection (HPLC-RI) is described. Long and medium chain lipids were separated and quantified in a biological matrix (gastrointestinal content) without derivatisation using HPLC-RI on C18 and C8 columns, respectively. The intra- and inter-assay accuracy was between 92% and 106%, and the assays were precise to within a coefficient of variation of less than 10% over the range of 0.1-2 mg/mL for both long and medium chain lipids. This method is also shown to be suitable for quantifying the lipolysis products collected from the gastrointestinal tract in the course of in vivo lipid digestion studies.
Nousiainen, J; Rinne, M; Huhtanen, P
2009-10-01
A meta-analysis based on published experiments with lactating dairy cows was conducted to study the effects of dietary forage and concentrate factors on apparent total diet digestibility. A data set was collected that included a total of 497 dietary treatment means from 92 studies. The diets were based on grass silage or on legume or whole-crop cereal silages partly or completely substituted for grass silage. The silages were supplemented with concentrates given at a flat rate within a dietary comparison. For the statistical evaluation, the data were divided into 5 subsets to quantify silage (digestibility, 42 diets in 17 studies; fermentation characteristics, 108 diets in 39 studies) and concentrate (amount of supplementation, 142 diets in 59 studies; concentration of crude protein, 215 diets in 82 studies; carbohydrate composition, 66 diets in 23 studies) factors on total diet digestibility. The diet digestibility of dairy cows was determined by total fecal collection or by using acid-insoluble ash as an internal marker. Diet organic matter digestibility (OMD) at a maintenance level of feeding (OMD(m)) was estimated using sheep in vivo or corresponding in vitro digestibility values for the forage and reported ingredient and chemical composition values, with tabulated digestibility coefficients for the concentrate components of the diet. A mixed model regression analysis was used to detect the responses of different dietary factors on apparent total diet digestibility. Improved silage OMD(m) resulting from earlier harvest was translated into improved production-level OMD in cows (OMD(p)). The effects of silage fermentation characteristics on OMD(p) were quantitatively small, although sometimes significant. Concentrate supplementation improved total diet OMD(m), but this was not realized in lactating dairy cows because of linearly decreased neutral detergent fiber (NDF) digestibility as concentrate intake increased. Increasing the concentrate crude protein amount quadratically improved OMD(p) in cows, with the response being mostly due to improved NDF digestibility. Replacement of starchy concentrates with fibrous by-products slightly decreased OMD(p) but tended to improve NDF digestibility. The true digestibility of cell solubles (OM - NDF) estimated by the Lucas test both from all data and from the data subsets was not significantly different from 1.00, suggesting that responses in OMD(p) of dairy cows are mediated through changes in the concentration and digestibility of NDF.
The degree-related clustering coefficient and its application to link prediction
NASA Astrophysics Data System (ADS)
Liu, Yangyang; Zhao, Chengli; Wang, Xiaojie; Huang, Qiangjuan; Zhang, Xue; Yi, Dongyun
2016-07-01
Link prediction plays a significant role in explaining the evolution of networks. However it is still a challenging problem that has been addressed only with topological information in recent years. Based on the belief that network nodes with a great number of common neighbors are more likely to be connected, many similarity indices have achieved considerable accuracy and efficiency. Motivated by the natural assumption that the effect of missing links on the estimation of a node's clustering ability could be related to node degree, in this paper, we propose a degree-related clustering coefficient index to quantify the clustering ability of nodes. Unlike the classical clustering coefficient, our new coefficient is highly robust when the observed bias of links is considered. Furthermore, we propose a degree-related clustering ability path (DCP) index, which applies the proposed coefficient to the link prediction problem. Experiments on 12 real-world networks show that our proposed method is highly accurate and robust compared with four common-neighbor-based similarity indices (Common Neighbors(CN), Adamic-Adar(AA), Resource Allocation(RA), and Preferential Attachment(PA)), and the recently introduced clustering ability (CA) index.
Anaerobic digestion of glycerol derived from biodiesel manufacturing.
Siles López, José Angel; Martín Santos, María de Los Angeles; Chica Pérez, Arturo Francisco; Martín Martín, Antonio
2009-12-01
The anaerobic digestion of glycerol derived from biodiesel manufacturing, in which COD was found to be 1010 g/kg, was studied in batch laboratory-scale reactors at mesophilic temperature using granular and non-granular sludge. Due to the high KOH concentration of this by-product, H(3)PO(4) was added to recover this alkaline catalyst as agricultural fertilizer (potassium phosphates). Although it would not be economically viable, a volume of glycerol was distilled and utilised as reference substrate. The anaerobic revalorisation of glycerol using granular sludge achieved a biodegradability of around 100%, while the methane yield coefficient was 0.306 m(3) CH(4)/kg acidified glycerol. Anaerobic digestion could be a good option for revalorising this available, impure and low priced by-product derived from the surplus of biodiesel companies. The organic loading rate studied was 0.21-0.38 g COD/g VSS d, although an inhibition phenomenon was observed at the highest load.
Anwar, M N; Ravindran, V; Morel, P C H; Ravindran, G; Cowieson, A J
2016-10-01
The purpose of this study was to determine the effect of limestone particle size and calcium (Ca) to non-phytate phosphorus (P) ratio on the true ileal Ca digestibility of limestone for broiler chickens. A limestone sample was passed through a set of sieves and separated into fine (<0.5 mm) and coarse (1-2 mm) particles. The analysed Ca concentration of both particle sizes was similar (420 g/kg). Six experimental diets were developed using each particle size with Ca:non-phytate P ratios of 1.5:1, 2.0:1 and 2.5:1, with ratios being adjusted by manipulating the dietary Ca concentrations. A Ca-free diet was also developed to determine the basal ileal endogenous Ca losses. Titanium dioxide (3 g/kg) was incorporated in all diets as an indigestible marker. Each experimental diet was randomly allotted to 6 replicate cages (8 birds per cage) and fed from d 21 to 24 post hatch. Apparent ileal digestibility of Ca was calculated using the indicator method and corrected for basal endogenous losses to determine the true Ca digestibility. The basal ileal endogenous Ca losses were determined to be 127 mg/kg of dry matter intake. Increasing Ca:non-phytate P ratios reduced the true Ca digestibility of limestone. The true Ca digestibility coefficients of limestone with Ca:non-phytate P ratios of 1.5, 2.0 and 2.5 were 0.65, 0.57 and 0.49, respectively. Particle size of limestone had a marked effect on the Ca digestibility, with the digestibility being higher in coarse particles (0.71 vs. 0.43).
Russell, J R; Sexten, W J; Kerley, M S
2016-06-01
A beef feedlot study was conducted to determine the effects of increasing soybean hull (SH) inclusion and enzyme addition on diet digestibility and animal performance. The hypothesis was SH inclusion and enzyme addition would increase fiber digestibility with no negative effect on animal performance. Eight treatments (TRT) were arranged in a 4 × 2 factorial using four diets and two enzyme (ENZ) inclusion rates. The diets were composed primarily of whole shell corn (WSC) with 0%, 7%, 14%, or 28% SH replacing corn. The ENZ was a commercial proprietary mix of , and (Cattlemace, R&D Life Sciences, Menomonie, WI) included in the diets at 0% (S0, S7, S14, S28) or 0.045% DM basis (S0e, S7e, S14e, S28e). Eighty steers (287 ± 31 kg, SD) were stratified by weight and blocked into pens with 1 heavy and 1 light pen per TRT (2 pen/TRT, 5 steers/pen). Steers were fed for 70 d with titanium dioxide included in the diets for the final 15 d. Fecal samples were collected on d 70 to determine diet digestibility. Diets were balanced for AA and RDP requirement based on available ME. Individual DMI was measured using a GrowSafe system. Diet, ENZ, and diet × ENZ effects were analyzed using the MIXED procedure of SAS. Initial BW was applied as a covariate for final BW (FBW), and DMI was included as a covariate for all digestibility measures. The diet × ENZ interaction had no effect on FBW, ADG, DMI, or any digestibility measure ( ≥ 0.11). Steers fed ENZ tended to have greater FBW ( = 0.09) and had numerically greater ADG than steers not fed ENZ. Diet influenced DMI ( < 0.01), as steers fed S7 diets had the greatest DMI ( ≤ 0.3), steers fed S0 diets had the least DMI ( ≤ 0.002), and DMI of steers fed S14 and S28 diets did not differ ( = 0.5). There was a diet × ENZ interaction for G:F ( = 0.02) in which S0, S0e, S14e, and S28e did not differ ( ≥ 0.3) and were greatest ( ≤ 0.05). There was no effect of diet or ENZ on DM, OM, or CP digestibility ( ≥ 0.2). Diet had an effect on NDF and ADF digestibility ( ≤ 0.04) which decreased as SH inclusion increased. The addition of ENZ tended to decrease NDF digestibility ( = 0.08) but had no effect on ADF digestibility ( = 0.8). Fiber digestibility in WSC diets did not improve with SH inclusion or ENZ addition but steers fed diets with 14% to 28% of WSC replaced by SH and the addition of 0.045% ENZ converted feed at the same rate as steers fed WSC diets with no SH.
Moeller, A; Ambrose, R F; Que Hee, S S
2001-01-01
Four catfish fillet homogenate treatments before multielemental metal analysis by simultaneous inductively coupled plasma/atomic emission spectroscopy were compared in triplicate. These treatments were: nitric acid wet-ashing by Parr bomb digestion; nitric acid wet-ashing by microwave digestion; tetramethylammonium hydroxide/nitric acid wet digestion; and dry-ashing. The tetramethylammonium hydroxide/nitric acid method was imprecise (coefficients of variation > 20%). The dry-ashing method was fast and sensitive but had low recoveries of 50% for spiked Pb and Al and was not as precise as the Parr bomb or microwave treatments. The Parr bomb method was the most precise method but was less sensitive than the microwave method which had nearly the same precision. The microwave method was then adapted to homogenates of small whole fish < or = 3 cm in length. The whole fish homogenate required more vigorous digestion conditions, and addition of more acid after the evaporative step because of the presence of less oxidizable and acid-soluble components than fillet. The whole fish homogenate was also more heterogeneous than catfish fillet. A quality assurance protocol to demonstrate homogenate uniformity is essential. The use of a non-specialized microwave oven system allowed precise results for fillet and whole fish homogenates.
Kinetic study of anaerobic digestion of fruit-processing wastewater in immobilized-cell bioreactors.
Borja, R; Banks, C J
1994-08-01
The kinetics of the anaerobic digestion of a fruit-processing wastewater [chemical oxygen demand (COD) = 5.1 g/l] were investigated. Laboratory experiments were carried out in bioreactors containing supports of different chemical composition and features, namely bentonite and zeolite (aluminum silicates), sepiolite and saponite (magnesium silicates) and polyurethane foam, to which the microorganisms responsible for the process adhered. The influence of the support medium on the kinetics was compared with a control digester with suspended biomass. Assuming the overall anaerobic digestion process conforms to first-order kinetics, the specific rate constant, K0, was determined for each of the experimental reactors. The average values obtained were: 0.080 h-1 (bentonite); 0.103 h-1 (zeolite); 0.180 h-1 (sepiolite); 0.198 h-1 (saponite); 0.131 h-1 (polyurethane); and 0.037 h-1 (control). The results indicate that the support used to immobilize the micro-organisms had a marked influence on the digestion process; the results were significant at the 95% confidence level. Methanogenic activity increased linearly with COD, with the saponite and sepiolite supports showing the highest values. The yield coefficient of methane was 270 ml of methane (under standard temperature and pressure conditions)/g of COD. The average elimination of COD was 89.5%.
De Santis, Serena; Masci, Giancarlo; Casciotta, Francesco; Caminiti, Ruggero; Scarpellini, Eleonora; Campetella, Marco; Gontrani, Lorenzo
2015-08-28
In the present work we report the synthesis and physico-chemical characterization in terms of the viscosity and density of a wide series of cholinium-amino acid based room temperature ionic liquids ([Ch][AA] RTILs). 18 different amino acids were used to obtain 14 room temperature ILs. Among the most common AAs, only valine did not form an RTIL but it is a liquid above 80 °C. With respect to the methods reported in the literature we propose a synthesis based on potentiometric titration which has several advantages such as shorter preparation time, stoichiometry within ±1%, very high yields (close to 100%), high reproducibility, and no use of organic solvents, thus being more environmentally friendly. We tried to prepare dianionic ILs with some AAs with two potentially ionisable groups but in all cases the salts were solids at room temperature. All the ILs were characterized by (1)H NMR to confirm the stoichiometry. Physico-chemical properties such as density, viscosity, refractive index and conductivity were measured as a function of temperature and correlated with empirical equations. The values were compared with the data already reported in the literature for some [Ch][AA] ILs. The thermal expansion coefficient αp and the molar volume Vm were also calculated from the experimental density values. Due to the high number of AAs explored and their structural heterogeneity we have been able to find some interesting correlations between the data obtained and the structural features of the AAs in terms of the alkyl chain length, hydrogen bonding ability, stacking and cyclization. Some parameters were also found to be in good agreement with those reported for other ILs. We think that these data can give an important contribution to the understanding of the structure-property relationship of ILs because they focused on the structural effect of the anions, while most data in the literature are focussed on the cations.
García-Martín, Ana; Lázaro-Rivera, Carla; Fernández-Golfín, Covadonga; Salido-Tahoces, Luisa; Moya-Mur, Jose-Luis; Jiménez-Nacher, Jose-Julio; Casas-Rojo, Eduardo; Aquila, Iolanda; González-Gómez, Ariana; Hernández-Antolín, Rosana; Zamorano, José Luis
2016-07-01
A specialized three-dimensional transoesophageal echocardiography (3D-TOE) reconstruction tool has recently been introduced; the system automatically configures a geometric model of the aortic root from the images obtained by 3D-TOE and performs quantitative analysis of these structures. The aim of this study was to compare the measurements of the aortic annulus (AA) obtained by the new model to that obtained by 3D-TOE and multidetector computed tomography (MDCT) in candidates to transcatheter aortic valve implantation (TAVI) and to assess the reproducibility of this new method. We included 31 patients who underwent TAVI. The AA diameters and area were evaluated by the manual 3D-TOE method and by the automatic software. We showed an excellent correlation between the measurements obtained by both methods: intra-class correlation coefficient (ICC): 0.731 (0.508-0.862), r: 0.742 for AA diameter and ICC: 0.723 (0.662-0.923), r: 0.723 for the AA area, with no significant differences regardless of the method used. The interobserver variability was superior for the automatic measurements than for the manual ones. In a subgroup of 10 patients, we also found an excellent correlation between the automatic measurements and those obtained by MDCT, ICC: 0.941 (0.761-0.985), r: 0.901 for AA diameter and ICC: 0.853 (0.409-0.964), r: 0.744 for the AA area. The new automatic 3D-TOE software allows modelling and quantifying the aortic root from 3D-TOE data with high reproducibility. There is good correlation between the automated measurements and other 3D validated techniques. Our results support its use in clinical practice as an alternative to MDCT previous to TAVI. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2015. For permissions please email: journals.permissions@oup.com.
Windham, B. Gwen; Wilkening, Steven R.; Lirette, Seth T.; Kullo, Iftikhar J.; Turner, Stephen T.; Griswold, Michael E.; Mosley, Thomas H.
2016-01-01
OBJECTIVES To examine associations of inflammation with physical function and potential mediation by white matter hyperintensities (WMH) in African-Americans (AA) and European-Americans (EA). DESIGN Cross-sectional analysis using linear and logistic models with Generalized Estimating Equations to account for familial clustering, reporting results as regression coefficients (β) and odds ratios (OR) adjusted for education, alcohol, exercise, BMI, hypertension, diabetes, heart disease, cognition, ankle brachial index, race-site and supported interactions. SETTING Genetic Epidemiology Network of Arteriopathy-Genetics of Microangiopathic Brain Injury Study cohort. PARTICIPANTS AA and EA sibships, ≥2 siblings with hypertension before age 60 (n=1960; 65% female, 51% AA, age 26–91y, 50% obese, 72% hypertensive). MEASUREMENTS Inflammation C-reactive protein (CRP), interleukin-6 (IL6), soluble tumor necrosis factor receptors [sTNFR] 1 and 2; magnetic resonance imaged WMH volumes (cm3). Walking speed (cm/second) over 25 feet and mobility difficulty (any self-reported difficulty walking ½ mile). RESULTS In separate models, inflammatory markers were associated with walking speed (sTNFR1: β=−2.74, p<.001; sTNFR2: −1.23, p=.03; CRP β=−1.95, p=.001; IL6 β=−1.24, p=.03) and mobility difficulty (sTNFR1: OR=1.36, p=.001; sTNFR2:OR=1.25, p=.005; CRP OR=1.22, p=.005; IL6 OR=1.18, p=.02); WMH was associated marginally only with sTNFR1 in AA (β=0.07, p=0.06). WMH were associated with walking speed in AA (AA: (β=−3.17, p=0.017; EA: β=−2.23, p=0.17) but not with mobility difficulty (OR=1.10, p=.54). Adjusting for WMH did not change associations. CONCLUSION In young-to-old persons with prevalent cardiovascular risk factors, multiple inflammatory biomarkers were associated with slower walking speed independent of microvascular disease in the brain. There was little evidence for mediation by brain WMH. Inflammation may contribute to physical function impairments through pathways other than brain microvascular disease, particularly in AA. PMID:27310030
Shimizu, Masaya; Muramatsu, Yuki; Tada, Eiko; Kurosawa, Takeshi; Yamaura, Erika; Nakamura, Hiroyuki; Fujino, Hiromichi; Houjyo, Yuuya; Miyasaka, Yuri; Koide, Yuuki; Nishida, Atsushi; Murayama, Toshihiko
2009-03-01
Sphingolipid metabolites including ceramide, sphingosine, and their phosphorylated products [sphingosine-1-phosphate (S1P) and ceramide-1-phosphate] regulate cell functions including arachidonic acid (AA) metabolism and cell death. The development of analogs of S1P may be useful for regulating these mediator-induced cellular responses. We synthesized new analogs of S1P and examined their effects on the release of AA and cell death in L929 mouse fibrosarcoma cells. Among the analogs tested, several compounds including DMB-mC11S [dimethyl (2S,3R)-2-tert-butoxycarbonylamino-3-hydroxy-3-(3'-undecyl)phenylpropyl phosphate] and DMB-mC9S [dimethyl (2S,3R)-2-tert-butoxycarbonylamino-3-hydroxy-3-(3'-nonyl)phenylpropyl phosphate] released AA within 1 h and caused cell death 6 h after treatment. The release of AA was observed in C12 cells [a L929 variant lacking a type alpha cytosolic phospholipase A(2) (cPLA(2)alpha)] and L929-cPLAalpha-siRNA cells (L929 cells treated with small interference RNA for cPLA(2)alpha). Treatment with pharmacological inhibitors of secretory and Ca(2+)-independent PLA(2)s decreased the DMB-mC11S-induced release of AA. The effect of the S1P analogs tested on the release of AA was comparable to that on cell death in L929 cells, and a high correlation coefficient was observed. Two analogs lacking a butoxycarbonyl moiety [DMAc-mC11S (dimethyl (2S,3R)-2-acetamino-3-hydroxy-3-(3'-undecyl)phenylpropyl phosphate] and DMAm-mC11S [dimethyl (2S,3R)-2-amino-3-hydroxy-3-(3'-undecyl)phenylpropyl phosphate)] had inhibitory effects on the release of AA and cell toxicity induced by DMB-mC11S. Synthetic phosphorylated lipid analogs may be useful for studying PLA(2) activity and its toxicity in cells. [Supplementary Fig. 1: available only at http://dx.doi.org/10.1254/jphs.08284FP].
Determination of Pd, Pt and Rh in vehicles escape fumes by GF-AAS and ICP-OES.
Goncalves, Antonio; Domínguez, José R; Alvarado, José
2008-04-15
Automotive exhaust gases from vehicles using catalytic converters were filtered through cellulose filter papers to collect suspended particles expulsed along with the engine's escape fumes. A specially designed sample collector was used for supporting the filter papers during collection. The collector was manufactured from a new car's exhaust pipe. A cellulose circular paper filter, 11 cm diameter, was attached to one end of the pipe and kept centered by pressing it against the borders of the pipe by means of a perforated aluminum cap, slightly wider than the pipe, used to cover this end of the collector. Filter papers loaded with the solid particles were acid-digested using a modified domestic microwave oven to bring the solid material into solution. The resulting solutions were analyzed for Pt by graphite furnace atomic absorption spectrometry (GF-AAS) and for Pd and Rh by inductively coupled plasma (ICP-OES). Results indicate that concentration of these analytes in the particulate is higher for new vehicles, having new catalytic converters, than for old ones. Maximum Pd, Pt and Rh in the samples analyzed were found to be 5.36, 12.60 and 1.03 microg g(-1), respectively.
Associations of Inflammation to Cognitive Function in African Americans and European Americans
Windham, B. Gwen; Simpson, Brittany N.; Lirette, Seth; Bridges, John; Bielak, Lawrence; Peyser, Patricia A.; Kullo, Iftikhar; Turner, Stephen; Griswold, Michael E.; Mosley, Thomas H.
2014-01-01
OBJECTIVES Elucidating associations of specific inflammatory biomarkers with cognitive function in African Americans (AA) and European Americans (EA) with prevalent vascular risk factors could identify vascular-mediated effects on cognitive impairment. DESIGN Cross-sectional analysis using Generalized Estimating Equations to account for familial clustering; standardized β-coefficients, adjusted for age, sex, and education are reported. SETTING A community cohort study in Jackson, MS and Rochester, MN. PARTICIPANTS Genetic Epidemiology Network of Arteriopathy (GENOA)-Genetics of Microangiopathic Brain Injury (GMBI) Study. MEASUREMENTS We examined associations between inflammation [high-sensitivity C-reactive protein (CRP), interleukin (IL)-6, soluble tumor necrosis factor receptors 1 and 2 (sTNFR1, sTNFR2)] and cognitive function measures [global (G), processing speed (PS), language (L), memory (M), and executive function (EF)] in AA and EA (N=1965; age 26–95y, 64% women, 52% AA, 75% hypertensive). RESULTS In AA, higher sTNFR2 was associated with poorer cognition across all domains (G: −0.11, p=.009; PS: −0.11, p<.001; L: −0.08, p=.002; M: −0.09, p=.008; EF: −0.07, p=.032); sTNFR1 was associated with poorer PS (−0.08, p<.001) and with EF (−0.08, p=.008); higher CRP was associated with lower PS (−0.04, p=.024), and higher IL6 was associated with poorer EF (−0.07, p=.019). In EA, only higher sTNFR1 was associated with poorer PS (−0.05, p=.007). We did not find support for associations between cognition and sTNFR2, CRP or IL6 in EA. CONCLUSION In a population with heightened vascular risk, adverse associations between inflammation and cognitive function were especially apparent in AA, primarily involving markers of TNFα activity. PMID:25516026
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
USDA-ARS?s Scientific Manuscript database
The determination of nutrient digestibility’s in specific ingredients and diets for fish has been an area of active research for decades. The Apparent Digestibility Coefficients (ADC), the percentage of nutrients in an ingredient that are available to the fish, is information needed by researchers,...
Digestive capacities, inbreeding and growth capacities in juvenile Arctic charr Salvelinus alpinus.
Ditlecadet, D; Blier, P U; Le François, N R; Dufresne, F
2009-12-01
Genetic variation in growth performance was estimated in 26 families from two commercial strains of Arctic charr Salvelinus alpinus. Physiological determinants of growth and metabolic capacities were also assessed through enzymatic assays. A relatedness coefficient was attributed to each family using parental genotypes at seven microsatellite loci. After 15 months of growth, faster growing families had significantly lower relatedness coefficients than slower growing families, suggesting their value as indicators of growth potential. Individual fish that exhibited higher trypsin activity also displayed higher growth rate, suggesting that superior protein digestion capacities can be highly advantageous at early stages. Capacities to use amino acids as expressed by glutamate dehydrogenase (GDH) activities were lower in the liver of fast-growing fish (13-20%), whereas white muscle of fast-growing fish showed higher activities than that of slow-growing fish for amino acid metabolism and aerobic capacity [22-32% increase for citrate synthase (CS), aspartate aminotransferase (AAT) and GDH]. The generally higher glycolytic capacities (PK and LDH) in white muscle of fast-growing fish indicated higher burst swimming capacities and hence better access to food.
NASA Astrophysics Data System (ADS)
Kumar, P.; Singh, A.
2018-04-01
The present study deals with evaluation of low cycle fatigue (LCF) behavior of aluminum alloy 5754 (AA 5754) at different strain rates. This alloy has magnesium (Mg) as main alloying element (Al-Mg alloy) which makes this alloy suitable for Marines and Cryogenics applications. The testing procedure and specimen preparation are guided by ASTM E606 standard. The tests are performed at 0.5% strain amplitude with three different strain rates i.e. 0.5×10-3 sec-1, 1×10-3 sec-1 and 2×10-3 sec-1 thus the frequency of tests vary accordingly. The experimental results show that there is significant decrease in the fatigue life with the increase in strain rate. LCF behavior of AA 5754 is also simulated at different strain rates by finite element method. Chaboche kinematic hardening cyclic plasticity model is used for simulating the hardening behavior of the material. Axisymmetric finite element model is created to reduce the computational cost of the simulation. The material coefficients used for “Chaboche Model” are determined by experimentally obtained stabilized hysteresis loop. The results obtained from finite element simulation are compared with those obtained through LCF experiments.
Yujiao, Wu; Guoyan, Wang; Wenyan, Zhao; Hongfen, Zhang; Huanwang, Jing; Anjia, Chen
2014-05-01
In this paper, a simple, effective and green capillary electrophoresis separation and detection method was developed for the quantification of underivatized amino acids (dl-phenylalanine; dl-tryptophan) using β-Cyclodextrin and chiral ionic liquid ([TBA] [l-ASP]) as selectors. Separation parameters such as buffer concentrations, pH, β-CD and chiral ionic liquid concentrations and separation voltage were investigated for the enantioseparation in order to achieve the maximum possible resolution. A good separation was achieved in a background electrolyte composed of 15 mm sodium tetraborate, 5 mm β-CD and 4 mm chiral ionic liquid at pH 9.5, and an applied voltage of 10 kV. Under optimum conditions, linearity was achieved within concentration ranges from 0.08 to 10 µg/mL for the analytes with correlation coefficients from 0.9956 to 0.9998, and the analytes were separated in less than 6 min with efficiencies up to 970,000 plates/m. The proposed method was successfully applied to the determination of amino acid enantiomers in compound amino acids injections, such as 18AA-I, 18AA-II and 3AA.
Tebbe, A W; Faulkner, M J; Weiss, W P
2017-08-01
Many nutrition models rely on summative equations to estimate feed and diet energy concentrations. These models partition feed into nutrient fractions and multiply the fractions by their estimated true digestibility, and the digestible mass provided by each fraction is then summed and converted to an energy value. Nonfiber carbohydrate (NFC) is used in many models. Although it behaves as a nutritionally uniform fraction, it is a heterogeneous mixture of components. To reduce the heterogeneity, we partitioned NFC into starch and residual organic matter (ROM), which is calculated as 100 - CP - LCFA - ash - starch - NDF, where crude protein (CP), long-chain fatty acids (LCFA), ash, starch, and neutral detergent fiber (NDF) are a percentage of DM. However, the true digestibility of ROM is unknown, and because NDF is contaminated with both ash and CP, those components are subtracted twice. The effect of ash and CP contamination of NDF on in vivo digestibility of NDF and ROM was evaluated using data from 2 total-collection digestibility experiments using lactating dairy cows. Digestibility of NDF was greater when it was corrected for ash and CP than without correction. Conversely, ROM apparent digestibility decreased when NDF was corrected for contamination. Although correcting for contamination statistically increased NDF digestibility, the effect was small; the average increase was 3.4%. The decrease in ROM digestibility was 7.4%. True digestibility of ROM is needed to incorporate ROM into summative equations. Data from multiple digestibility experiments (38 diets) using dairy cows were collated, and ROM concentrations were regressed on concentration of digestible ROM (ROM was calculated without adjusting for ash and CP contamination). The estimated true digestibility coefficient of ROM was 0.96 (SE = 0.021), and metabolic fecal ROM was 3.43 g/100 g of dry matter intake (SE = 0.30). Using a smaller data set (7 diets), estimated true digestibility of ROM when calculated using NDF corrected for ash and CP contamination was 0.87 (SE = 0.025), and metabolic fecal ROM was 3.76 g/100 g (SE = 0.60). Regardless of NDF method, ROM exhibited nutritional uniformity. The ROM fraction also had lower errors associated with the estimated true digestibility and its metabolic fecal fraction than did NFC. Therefore, ROM may result in more accurate estimates of available energy if integrated into models. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Cizdziel, James V.; Tolbert, Candice; Brown, Garry
2010-02-01
A Direct Mercury Analyzer (DMA) based on sample combustion, concentration of mercury by amalgamation with gold, and cold vapor atomic absorption spectrometry (CVAAS) was coupled to a mercury-specific cold vapor atomic fluorescence spectrometer (CVAFS). The purpose was to evaluate combustion-AFS, a technique which is not commercially available, for low-level analysis of mercury in environmental and biological samples. The experimental setup allowed for comparison of dual measurements of mercury (AAS followed by AFS) for a single combustion event. The AFS instrument control program was modified to properly time capture of mercury from the DMA, avoiding deleterious combustion products from reaching its gold traps. Calibration was carried out using both aqueous solutions and solid reference materials. The absolute detection limits for mercury were 0.002 ng for AFS and 0.016 ng for AAS. Recoveries for reference materials ranged from 89% to 111%, and the precision was generally found to be <10% relative standard deviation (RSD). The two methods produced similar results for samples of hair, finger nails, coal, soil, leaves and food stuffs. However, for samples with mercury near the AAS detection limit (e.g., filter paper spotted with whole blood and segments of tree rings) the signal was still quantifiable with AFS, demonstrating the lower detection limit and greater sensitivity of AFS. This study shows that combustion-AFS is feasible for the direct analysis of low levels of mercury in solid samples that would otherwise require time-consuming and contamination-prone digestion.
NASA Astrophysics Data System (ADS)
Zamfir, Oana-Liliana; Ionicǎ, Mihai; Caragea, Genica; Radu, Simona; Vlǎdescu, Marian
2016-12-01
Cobalt is a chemical element with symbol Co and atomic number 27 and atomic weight 58.93. 59 Co is the only stable cobalt isotope and the only isotope to exist naturally on Earth. Cobalt is the active center of coenzymes called cobalamin or cyanocobalamin the most common example of which is vitamin B12. Vitamin B12 deficiency can potentially cause severe and irreversible damage, especially to the brain and nervous system in the form of fatigue, depression and poor memory or even mania and psychosis. In order to study the degree of deficiency of the population with Co or the correctness of treatment with vitamin B12, a modern optoelectronic method for the determination of metals and metalloids from biological samples has been developed, Graphite Furnace - Atomic Absorption Spectrometer (GF- AAS) method is recommended. The technique is based on the fact that free atoms will absorb light at wavelengths characteristic of the element of interest. Free atoms of the chemical element can be produced from samples by the application of high temperatures. The system GF-AAS Varian used as biological samples, blood or urine that followed the digest of the organic matrix. For the investigations was used a high - performance GF-AAS with D2 - background correction system and a transversely heated graphite atomizer. As result of the use of the method are presented the concentration of Co in the blood or urine of a group of patient in Bucharest. The method is sensitive, reproducible relatively easy to apply, with a moderately costs.
Jones, Sandra R.; Garbarino, John R.
1999-01-01
Graphite furnace-atomic absorption spectrometry (GF-AAS) is a sensitive, precise, and accurate technique that can be used to determine arsenic and selenium in samples of water and sediment. The GF-AAS method has been developed to replace the hydride generation-atomic absorption spectrometry (HG-AAS) methods because the method detection limits are similar, bias and variability are comparable, and interferences are minimal. Advantages of the GF-AAS method include shorter sample preparation time, increased sample throughput from simultaneous multielement analysis, reduced amount of chemical waste, reduced sample volume requirements, increased linear concentration range, and the use of a more accurate digestion procedure. The linear concentration range for arsenic and selenium is 1 to 50 micrograms per liter in solution; the current method detection limit for arsenic in solution is 0.9 microgram per liter; the method detection limit for selenium in solution is 1 microgram per liter. This report describes results that were obtained using stop-flow and low-flow conditions during atomization. The bias and variability of the simultaneous determination of arsenic and selenium by GF-AAS under both conditions are supported with results from standard reference materials--water and sediment, real water samples, and spike recovery measurements. Arsenic and selenium results for all Standard Reference Water Samples analyzed were within one standard deviation of the most probable values. Long-term spike recoveries at 6.25, 25.0, 37.5 micrograms per liter in reagent-, ground-, and surface-water samples for arsenic averaged 103 plus or minus 2 percent using low-flow conditions and 104 plus or minus 4 percent using stop-flow conditions. Corresponding recoveries for selenium were 98 plus or minus 13 percent using low-flow conditions and 87 plus or minus 24 percent using stop-flow conditions. Spike recoveries at 25 micrograms per liter in 120 water samples ranged from 97 to 99 percent for arsenic and from 82 to 93 percent for selenium, depending on the flow conditions used. Statistical analysis of dissolved and whole-water recoverable analytical results for the same set of water samples indicated that there is no significant difference between the GF-AAS and HG-AAS methods. Interferences related to various chemical constituents were also identified. Although sulfate and chloride in association with various cations might interfere with the determination of arsenic and selenium by GF-AAS, the use of a magnesium nitrate/palladium matrix modifier and low-flow argon during atomization helped to minimize such interferences. When using stabilized temperature platform furnace conditions where stop flow is used during atomization, the addition of hydrogen (5 percent volume/volume) to the argon minimized chemical interferences. Nevertheless, stop flow during atomization was found to be less effective than low flow in reducing interference effects.
Effects of feeding and stocking density on digestion of cultured Atlantic salmon Salmo salar L.
NASA Astrophysics Data System (ADS)
Sun, Guoxiang; Zheng, Jimeng; Liu, Baoliang; Liu, Ying
2014-11-01
The combined effects of feeding rate (0.8%, 1.0%, and 1.2% initial body weight/day), feeding frequency (two, three, and four times/day) and stocking density (10, 15, and 20 kg/m3) in recirculating aquaculture systems (RAS) on growth performance, digestion and waste generation of Atlantic salmon ( Salmo salar L.) were investigated in an 8-week orthogonal experiment (L9(3)3) with a constant daily water renewal at 7.50% of total volume. No mortality occurred during the experimental period. Feed conversion ratio (FCR) varied from 0.90 to 1.13 and specific growth rate (SGR) ranged from 0.48% to 0.69%/day. SGR, thermal growth coefficient (TGC) and FCR were not significantly ( P>0.05) affected by the three factors, while net protein utilization (NPU) was significantly ( P<0.05) affected. Apparent digestibility coefficients (ADC) of dry matter in the present study were in the range 66.12%-73.55%. ADC in protein, lipid and energy were statistically different among all treatments and in the range of 90.07%-93.67%, 81.54%-89.15%, and 67.55%-71.87%, respectively. The proportion of mean total ammonia nitrogen excreted ranged from 1.37% to 1.64% of feed nitrogen at steady state, and the concentration of nitrogenous and phosphorus compounds were differently correlated to the three factors. The results will provide valuable reference data for culture management decisions in the Atlantic salmon farming industry.
Omasal sampling technique for assessing fermentative digestion in the forestomach of dairy cows.
Huhtanen, P; Brotz, P G; Satter, L D
1997-05-01
A procedure allowing digesta sampling from the omasum via a ruminal cannula without repeated entry into the omasum was developed. The sampling system consisted of a device inserted into the omasum via the ruminal cannula, a tube connecting the device to the ruminal cannula, and a single compressor/vacuum pump. Eight cows given ad libitum access to a total mixed diet were used in a crossover design to evaluate the effects of the sampling system on digestive activity, animal performance, and animal behavior. Results indicated that the omasal sampling system has minimal effect on normal digestive and productive functions of high-producing dairy cows. Dry matter intake was reduced (24.0 vs 21.8 kg/d; P < .02) and seemed related more to the sampling procedures than to the device in the omasum. Observations of animal behavior indicated that cows with the sampling device were similar to control cows, although rumination and total chewing times were reduced slightly. The composition of digesta samples was biased toward an over-abundance of the liquid phase, but using a double-marker system to calculate digesta flow resulted in fairly small coefficients of variation for measurements of ruminal digestion variables. This technique may prove useful for partitioning digestion between the fermentative portion of the forestomach and the lower gastrointestinal tract. The omasal sampling procedure requires less surgical intervention than the traditional methods using abomasal or duodenal cannulas as sampling sites to study forestomach digestion and avoids potentially confounding endogenous secretions of the abomasum.
Wu, Sarah Xiao; Chen, Lide; Zhu, Jun; Walquist, McKenzie; Christian, David
2018-04-30
Insufficient denitrification in biological treatment is often a result of the lack of a carbon source. In this study, use of the volatile fatty acids (VFAs) generated via pre-digestion as a carbon source to improve denitrification in sequencing batch reactor (SBR) treatment of liquid swine manure was investigated. The pre-digestion of swine manure was realized by storing the manure in a sealed container in room temperature and samples were taken periodically from the container to determine the VFA levels. The results showed that after 14 days of pre-digestion, the VFA level in the digested liquid was increased by 200%. A polynomial relationship for the VFA level in the digested manure with the digestion time was observed with a correlation coefficient being 0.9748. Two identical SBRs were built and operated on 8-h cycles in parallel, with one fed with pre-digested and the other raw swine manure. There were five phases included in each cycle, i.e., anaerobic (90 min), anoxic (150 min), anoxic/anaerobic (90 min), anoxic/aerobic (120 min), and settle/decant (30 min), and the feeding was split to 600 mL/200 mL and performed at the beginning of and 240 min into the cycle. The SBR fed on pre-digested swine manure achieved successful denitrification with only 0.35 mg/L nitrate left in the effluent, compared to 15.9 mg/L found in the effluent of the other SBR. Nitrite was not detected in the effluent from both SBRs. The results also indicated that there was no negative impact of feeding SBRs with the pre-digested liquid swine manure for treatment on the removal of other constituents such as total solids (TS), volatile solids (VS), suspended solids (SS), volatile suspended solids (VSS), and soluble chemical oxygen demand (COD). Therefore, anaerobic digestion as a pretreatment can be an effective way to condition liquid swine manure for SBR treatment to achieve sufficient nitrate removal.
Lee, Joonyeob; Koo, Taewoan; Han, Gyuseong; Shin, Seung Gu; Hwang, Seokhwan
2015-12-01
Anaerobic digestion of cattle offal was investigated in batch reactors at 35 °C to determine the feasibility of using cattle offal as a feedstock. The organic content [i.e., volatile solids (VS)] of the cattle offal was mainly composed of protein (33.9%) and lipids (46.1%). Hydrolysis along with acidogenesis was monitored to investigate the substrate degradation and generation of intermediate products (e.g., volatile fatty acids, ammonia). Acetate (2.03 g/L), propionate (0.60 g/L), n-butyrate (0.39 g/L), and iso-valerate (0.37 g/L) were major acidogenesis products (91% of total volatile fatty acid concentration). Overall protein and lipid degradation were 82.9 and 81.8%, respectively. Protein degraded first, and four times faster (0.28 day(-1)) than lipid (0.07 day(-1)). Methane yields were 0.52 L CH4/g VSadded and 0.65 L CH4/g VSremoved, indicating that anaerobic digestion of the offal was feasible. A quantitative QPCR assay was conducted to understand the microbial dynamics. The variation patt erns in the gene concentrations successfully indicated the population dynamics of proteolytic and lipolytic acidogens. A fourth-order Runge-Kutta approximation was used to determine the kinetics of the acidogens. The molecular biotechnology approach was appropriate for the evaluation of the acidogenic biokinetics. The maximum growth rate, μ m, halfsaturation coefficients, K s, microbial yield coefficient, Y, cell mass decay rate coefficient, k d, of the proteolytic acidogens were 9.9 day(-1), 37.8 g protein/L, 1.1 × 10(10) copies/g protein, and 3.8 × 10(-1), respectively. Those for the lipolytic acidogens were 1.2 × 10(-1) day(-1), 8.3 g lipid/L, 1.5 × 10(9) copies/g lipid, and 9.9 × 10(-3) day(-1), respectively.
NASA Astrophysics Data System (ADS)
Fang, T.; Verma, V.; Bates, J. T.; Abrams, J.; Klein, M.; Strickland, M. J.; Sarnat, S. E.; Chang, H. H.; Mulholland, J. A.; Tolbert, P. E.; Russell, A. G.; Weber, R. J.
2015-11-01
The ability of certain components of particulate matter to induce oxidative stress through catalytic generation of reactive oxygen species (ROS) in vivo may be one mechanism accounting for observed linkages between ambient aerosols and adverse health outcomes. A variety of assays have been used to measure this so-called aerosol oxidative potential. We developed a semi-automated system to quantify oxidative potential of filter aqueous extracts utilizing the dithiothreitol (DTT) assay and have recently developed a similar semi-automated system using the ascorbic acid (AA) assay. Approximately 500 PM2.5 filter samples collected in contrasting locations in the southeastern US were analyzed using both assays. We found that water-soluble DTT activity on a per air volume basis was more spatially uniform than water-soluble AA activity. DTT activity was higher in winter than in summer/fall, whereas AA activity was higher in summer/fall compared to winter, with highest levels near highly trafficked highways. DTT activity was correlated with organic and metal species, whereas AA activity was correlated with water-soluble metals (especially water-soluble Cu, r=0.70-0.91 at most sites). Source apportionment models, Positive Matrix Factorization (PMF) and a Chemical Mass Balance Method with ensemble-averaged source impact profiles (CMB-E), suggest a strong contribution from secondary processes (e.g., organic aerosol oxidation or metal mobilization by formation of an aqueous particle with secondary acids) and traffic emissions to both DTT and AA activities in urban Atlanta. Biomass burning was a large source for DTT activity, but insignificant for AA. DTT activity was well correlated with PM2.5 mass (r=0.49-0.86 across sites/seasons), while AA activity did not co-vary strongly with mass. A linear model was developed to estimate DTT and AA activities for the central Atlanta Jefferson Street site, based on the CMB-E sources that are statistically significant with positive coefficients. The model was used to estimate oxidative potential at this site over the period 1998-2009. Time-series epidemiological analyses were conducted to assess daily emergency department (ED) visits data for the five-county Atlanta metropolitan area based on the estimated 10 year backcast oxidative potential. Results suggest that estimated DTT activity was associated with ED visits for both asthma/wheeze and congestive heart failure, while AA activity was not linked to any health outcomes. The findings point to the importance of both organic components and transition metals from biomass burning and mobile sources to adverse health outcomes in this region.
Zhao, Bo; Kokoza, Vladimir A.; Saha, Tusar T.; Wang, Stephanie; Roy, Sourav; Raikhel, Alexander S.
2015-01-01
Pathogen transmission by mosquitoes is tightly linked to blood feeding which, in turn, is required for egg development. Studies of these processes would greatly benefit from genetic methods, such as the binary Gal4/UAS system. The latter has been well established for model organisms, but its availability is limited for mosquitoes. The objective of this study was to develop the blood-meal-activated, gut-specific Gal4/UAS system for the yellow-fever mosquito Aedes aegypti and utilize it to investigate the regulation of gut-specific gene expression. A 1.1-kb, 5' upstream region of the carboxypeptidase A (CP) gene was used to genetically engineer the CP-Gal4 driver mosquito line. The CP-Gal4 specifically activated the Enhanced Green Fluorescent Protein (EGFP) reporter only after blood feeding in the gut of the CP-Gal4>UAS-EGFP female Ae. aegypti. We used this system to study the regulation of CP gene expression. In vitro treatments with either amino acids (AAs) or insulin stimulated expression of the CP-Gal4>UAS-EGFP transgene; no effect was observed with 20-hydroxyecdysone (20E) treatments. The transgene activation by AAs and insulin was blocked by rapamycin, the inhibitor of the Target-of-Rapamycin kinase (TOR). RNA interference (RNAi) silence of the insulin receptor (IR) reduced the expression of the CP-Gal4>UAS-EGFP transgene. Thus, in vitro and in vivo experiments have revealed that insulin and TOR pathways control expression of the digestive enzyme CP. In contrast, 20E, the major regulator of post-blood-meal vitellogenic events in female mosquitoes, has no role in regulating the expression of this gene. This novel CP-Gal4/UAS system permits functional testing of midgut-specific genes that are involved in blood digestion and interaction with pathogens in Ae. aegypti mosquitoes. PMID:25152428
Rational design of aerobic digestion systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rich, L.G.
1987-06-01
Deficiencies are identified in state-of-the-art procedures used in the design of systems for the aerobic digestion of waste-activated sludge solids. A procedure for the design of such systems on a rational basis is presented. Such a procedure not only includes a well-defined stabilization objective, but takes into account the stabilization that occurs in the activated sludge process. Related methods are discussed by which coefficients used in the design procedure can be evaluated. A design example is given. Further research and performance data derived from systems designed by the procedure are needed to better evaluate the parameters used and to testmore » the assumptions made in applying the procedure.« less
Rational design of aerobic digestion systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rich, L.G.
1987-06-01
Deficiencies are identified in state-of-the-art procedures used in the design of systems for the aerobic digestion of waste-activated sludge solids. A procedure for the design of such systems on a rational basis is presented. Such a procedure not only includes a well-defined stabilization objective, but takes into account the stabilization that occurs in the activated sludge process. Related methods are discussed by which coefficients used in the design procedure can be evaluated. A design example is given. Further research and performance data derived from systems designed by the procedure are needed to better evaluate the parameters used and to testmore » the assumptions made in applying the procedure. (Refs. 28).« less
Carder, E G; Weiss, W P
2017-06-01
The first few weeks after parturition is marked by low, but increasing feed intake and sharply increasing milk production by dairy cows. Because of low intake, the nutrient density of the diet may need to be higher during this period to support increasing milk yields. We hypothesized that feeding higher levels of metabolizable protein (MP) or a protein supplement with rumen-protected lysine and methionine during the immediate postpartum period would increase yields of milk and milk components. Fifty-six Holstein cows (21 primiparous and 35 multiparous) starting at 3 d in milk were used in a randomized block design. In phase 1 (3 through 23 d in milk), cows were fed 1 of 3 diets that differed in supply of MP and AA profile. At 23 d in milk, all cows were moved to a common freestall pen and fed the control diet used in phase 1 for an additional 63 d (phase 2). Diets were formulated using the National Research Council model and were control [16.5% crude protein (CP), 10.9% rumen-degradable protein (RDP), and 5.6% rumen-undegradable protein (RUP)], high MP (HMP; 18.5% CP, 11.6% RDP, 6.9% RUP), and AA (MPAA; 17.5% CP, 10.5% RDP, 7.0% RUP 29.7). The MPAA diet included a proprietary spray-dried blood meal product (Perdue Agribusiness, Salisbury, MD) and contained a model-estimated 7.2 and 2.6% of digestible lysine and methionine (% of MP). The HMP and control diets contained 6.3 and 6.7% digestible lysine and both had 1.8% digestible methionine. In phase 1, diet did not affect milk yield (33.6, 34.7, and 33.2 kg for control, HMP, and MPAA, respectively), dry matter intake (17.8, 18.0, and 18.5 kg/d for control, HMP, and MPAA), or milk protein yield (1.07 kg/d). Feeding additional protein (HMP or MPAA) increased both the concentration and yield of milk fat, and milk protein concentration was greater (3.30 vs. 3.17%) for MPAA compared with the HMP diet. Energy-corrected milk was greater (38.4 and 38.6 vs. 35.3 kg/d, respectively) for MPAA and HP than for the control. Cows fed MPAA had the greatest plasma concentrations of Met and the lowest concentrations of isoleucine, but lysine was not affected by treatment. Feeding additional MP (HMP or MPAA) reduced the concentrations of 3-methylhistidine in plasma, indicating reduced muscle breakdown. Diet effects on milk composition continued after cows were changed to a common diet in that cows fed MPAA the first 3 wk of lactation had greater concentration of milk protein for the entire experiment than cows fed HMP, and cows fed additional MP (HMP and MPAA) during phase 1 had greater concentrations of milk fat for the entire experiment. Increasing dietary protein and AA supply in early lactation had short-term effects on yield of energy-corrected milk and long-term effects on milk composition. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Töyräs, J.; Rieppo, J.; Nieminen, M. T.; Helminen, H. J.; Jurvelin, J. S.
1999-11-01
Ultrasound may provide a quantitative technique for the characterization of cartilage changes typical of early osteoarthrosis. In this study, specific changes in bovine articular cartilage were induced using collagenase and chondroitinase ABC, enzymes that selectively degrade collagen fibril network and digest proteoglycans, respectively. Changes in cartilage structure and properties were quantified using high frequency ultrasound, microscopic analyses and mechanical indentation tests. The ultrasound reflection coefficient of the physiological saline-cartilage interface (R1) decreased significantly (-96.4%, p<0.01) in the collagenase digested cartilage compared to controls. Also a significantly lower ultrasound velocity (-6.2%, p<0.01) was revealed after collagenase digestion. After chondroitinase ABC digestion, a new acoustic interface at the depth of the enzyme penetration front was detected. Cartilage thickness, as determined with ultrasound, showed a high, linear correlation (R = 0.943, n = 60, average difference 0.073 mm (4.0%)) with the thickness measured by the needle-probe method. Both enzymes induced a significant decrease in the Young's modulus of cartilage (p<0.01). Our results indicate that high frequency ultrasound provides a sensitive technique for the analysis of cartilage structure and properties. Possibly ultrasound may be utilized in vivo as a quantitative probe during arthroscopy.
Vieira, Elsa F; das Neves, José; Vitorino, Rui; Dias da Silva, Diana; Carmo, Helena; Ferreira, Isabel M P L V O
2016-10-05
Brewer's spent yeast (BSY) autolysates may have potential applications as food ingredients or nutraceuticals due to their antioxidant and ACE-inhibitory activities. The impact of simulated gastrointestinal (GI) digestion, the interaction with intracellular sources of oxidative stress, the intestinal cell permeability of BSY peptides, and the antioxidant and ACE-inhibitory activities of BSY permeates were assayed. Gastrointestinal digestion of BSY autolysates enhanced antioxidant and ACE-inhibitory activities as measured in vitro. No cytotoxic effects were observed on Caco-2 cells after exposure to the digested BSY autolysates within a concentration range of 0.5 to 3.0 mg of peptides/mL. A protective role to induced oxidative stress was observed. The transepithelial transport assays indicate high apparent permeability coefficient (P app ) values for BSY peptides across Caco-2/HT29-MTX cell monolayer (14.5-26.1 × 10 -6 cm/s) and for Caco-2 cell monolayer model (12.4-20.8 × 10 -6 cm/s), while the antioxidant and ACE-inhibitory activities found in flux material from the basolateral side suggest transepithelial absorption of bioactive compounds.
Sales, J; Janssens, G P J
2003-09-01
The influence of length of excreta collection period (1, 3, 6, 10, 14 d) and prefeeding protocol (7 d either individual feeding in collection cages or group feeding in housing cages) on AMEn, nitrogen retention (NR), and apparent DM, organic matter and ether extract digestibility of corn and peas were evaluated in domestic pigeons (Columba livia domestica). In addition, the use of internal markers [acid-insoluble ash (AIA) and acid detergent lignin (ADL)] to determine AMEn, NR, and apparent digestibility was compared with the method of measuring total feed input and excreta output. A quadratic (y = a + bx + cx2) trend in the CV for AMEn, NR, and apparent digestibility coefficients found over collection periods with corn presented evidence that excreta collection for a period of 3 d will produce a CV of 5% less than the minimum CV. Although no trend could be detected in CV for peas, a 3-d excreta collection period resulted in relatively low variation. Both AIA and ADL, when used as internal markers, resulted in AMEn, NR, and digestibility values below (P < 0.05) those obtained with total collection with corn. However, values between markers were comparable (P > 0.05) for all components evaluated. The ADL was unsuccessful as marker with peas. Group prefeeding of pigeons in housing cages resulted in lower feed intake, excreta output, NR, and apparent digestibility than when birds were adapted individually to collection cages. This study presents evidence that the method of measuring total feed intake and excreta output for a period of 3 d, with individual adaptation of birds to collection cages, resulted in the most reliable values for AMEn, NR, and apparent digestibility of DM, organic matter and ether extract of feed ingredients in pigeons.
Solid Loss of Carrots During Simulated Gastric Digestion.
Kong, Fanbin; Singh, R Paul
2011-03-01
The knowledge of solid loss kinetics of foods during digestion is crucial for understanding the factors that constrain the release of nutrients from the food matrix and their fate of digestion. The objective of this study was to investigate the solid loss of carrots during simulated gastric digestion as affected by pH, temperature, viscosity of gastric fluids, mechanical force present in stomach, and cooking. Cylindrical carrot samples were tested by static soaking method and using a model stomach system. The weight retention, moisture, and loss of dry mass were determined. The results indicated that acid hydrolysis is critical for an efficient mass transfer and carrot digestion. Internal resistance rather than external resistance is dominant in the transfer of soluble solids from carrot to gastric fluid. Increase in viscosity of gastric fluid by adding 0.5% gum (w/w) significantly increased the external resistance and decreased mass transfer rate of carrots in static soaking. When mechanical force was not present, 61% of the solids in the raw carrot samples were released into gastric fluid after 4 h of static soaking in simulated gastric juice. Mechanical force significantly increased solid loss by causing surface erosion. Boiling increased the disintegration of carrot during digestion that may favor the loss of solids meanwhile reducing the amount of solids available for loss in gastric juice. Weibull function was successfully used to describe the solid loss of carrot during simulated digestion. The effective diffusion coefficients of solids were calculated using the Fick's second law of diffusion for an infinite cylinder, which are between 0.75 × 10(-11) and 8.72 × 10(-11) m(2)/s, depending on the pH of the gastric fluid.
NASA Astrophysics Data System (ADS)
Bernabucci, U.; Lacetera, N.; Danieli, P. P.; Bani, P.; Nardone, A.; Ronchi, B.
2009-09-01
Effects of different periods of exposure to hot environments on rumen function, diet digestibility and digesta passage rate were studied in four adult not-pregnant Sardinian ewes housed in a climatic chamber. The ewes were kept in individual metabolic cages. The trial lasted 83 days; 17 days were spent under thermal comfort conditions (TC) [temperature-humidity index (THI) = 65.0 ± 2.0], followed by 49 days under elevated THI (ETHI: THI = 82.0 ± 2.5) and 17 days under thermal comfort (TC; THI = 65.0 ± 1.0). Five digestibility and passage rate trials were carried out during the 83 days. Trials 1 and 5 were carried out under TC; trials 2, 3 and 4 were carried out under ETHI. Values of rectal temperatures (39.7 ± 0.3°C) and respiratory rate (118.4 ± 31.8 breaths/min) indicated that sheep under ETHI were heat-stressed. Heat stress caused an increase ( P < 0.01) in water intake, and reductions ( P < 0.05) in dry matter intake, rumen pH, rumen cellulolytic and amylolytic bacteria count, rumen osmolarity, organic matter, dry matter, neutral detergent fibre, acid detergent fibre and non-structural carbohydrates digestibility coefficients, and a reduction of digesta passage rates. Under ETHI, diet digestibility and passage rate of digesta were reduced in a time-dependent fashion. Variation of diet digestibility under ETHI was not related to passage rate of digesta and feed intake. Reduction of cellulolytic and amylolytic bacteria and the adaptive response to hot environment seem to be related to alteration of digestibility observed in ewes chronically exposed to hot environment.
Precipitation scavenging of aerosol particles at a rural site in the Czech Republic
NASA Astrophysics Data System (ADS)
Zikova, Nadezda; Zdimal, Vladimir
2017-04-01
Wet deposition is an important removal mechanism of atmospheric aerosol (AA) in the troposphere, transferring AA to the Earth surface in an aqueous form (Seinfeld and Pandis, 1998). Deposition consists of in-cloud (ICS) and below-cloud (BCS) scavenging, both processes depending on the size, chemical composition and concentration of the AA particles (e.g. Laakso et al., 2003; Ladino et al., 2011). Due to the complexity of the processes and high instrumentation and time demands, a complete understanding is still a challenge, although both phenomena have been extensively studied recently (e.g. Andronache et al. 2006; Chate et al. 2011; Collett et al. 2008). In this work, the influence of ICS and BCS, described by the obscurities (mist, fog and shallow fog) and precipitation (drizzle, rain, snow, rain with snow), on submicron atmospheric aerosol particle number size distributions (PNSD) was studied using 5 years of measurements at the rural background station Košetice. The typical PNSD during individual meteorological phenomena were compared, and the change in the concentrations before and after the beginning of the phenomenon, the scavenging coefficient lambda_s, and the rate of change of the AA concentrations with time were computed. It was found that both obscurities and precipitation have a strong influence on the AA concentrations, both on the total number concentrations and on the particle number size distributions. The scavenging not only lowers the total AA concentrations, it even changes the number of modes on the PNSDs. The PNSD main mode is shifted to the larger particles, and the concentrations of particles smaller than 50 nm in diameter are considerably lower. In nucleation mode, however, wet scavenging does not seem to be the main process influencing the AA concentrations, although its considerable effect on the concentration was proved. During obscurities, there is a typical PNSD to which the PNSD converge at any mist/fog/shallow fog event. The concentrations of AA particles smaller than 80 nm are lower than they are during periods without any phenomenon recorded. Also during liquid precipitation, PNSD are lower when compared to non-event periods, suggesting an effective AA deposition. Precipitation containing frozen hydrometeors behaves differently from liquid precipitation. Concentrations of AA particles larger than 200 nm during precipitation containing solid particles do not differ from non-event cases, suggesting insignificant scavenging. The results of the observed size dependent changes in AA concentrations and PNSD could be used to assess the expected changes in atmosphere during transport and scavenging of AA not only during experimental campaigns, but during modelling as well. This project has received funding from the European Union's Horizon 2020 research and innovation programme under grant agreement No. 654109. Andronache at al. 2006. Atmos. Chem. Phys. 6, 4739-54. Chate at al. 2011. Atmos. Res. 99(3-4), 528-536. Collett at al. 2008. Atmos. Res. 87(3-4), 232-241. Laakso et al. 2003. Atmos. Environ. 37(25), 3605-3613. Ladino at al. 2011. J. Atmos. Sci. 68(9), 1853-1864. Seinfeld and Pandis. 2012. Atmospheric Chemistry and Physics: From Air Pollution to Climate Change, Wiley.
Deglaire, Amélie; De Oliveira, Samira C; Jardin, Julien; Briard-Bion, Valérie; Emily, Mathieu; Ménard, Olivia; Bourlieu, Claire; Dupont, Didier
2016-07-01
Holder pasteurization (62.5°C, 30 min) ensures sanitary quality of donor's human milk but also denatures beneficial proteins. Understanding whether this further impacts the kinetics of peptide release during gastrointestinal digestion of human milk was the aim of the present paper. Mature raw (RHM) or pasteurized (PHM) human milk were digested (RHM, n = 2; PHM, n = 3) by an in vitro dynamic system (term stage). Label-free quantitative peptidomics was performed on milk and digesta (ten time points). Ascending hierarchical clustering was conducted on "Pasteurization × Digestion time" interaction coefficients. Preproteolysis occurred in human milk (159 unique peptides; RHM: 91, PHM: 151), mostly on β-casein (88% of the endogenous peptides). The predicted cleavage number increased with pasteurization, potentially through plasmin activation (plasmin cleavages: RHM, 53; PHM, 76). During digestion, eight clusters resumed 1054 peptides from RHM and PHM, originating for 49% of them from β-casein. For seven clusters (57% of peptides), the kinetics of peptide release differed between RHM and PHM. The parent protein was significantly linked to the clustering (p-value = 1.4 E-09), with β-casein and lactoferrin associated to clusters in an opposite manner. Pasteurization impacted selectively gastric and intestinal kinetics of peptide release in term newborns, which may have further nutritional consequences. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oomen, A.G.; Sips, A.J.A.M.; Groten, J.P.
2000-01-15
Children can take up contaminated soil via hand-to-mouth behavior. The contaminants can be mobilized from the soil by digestive juices and thus become available for intestinal absorption. In the present study components of an in vitro digestion model were varied to study their effect on the mobilization of several PCBs and lindane from surrogate soil (OECD-medium). Approximately 35% of the PCBs and 57% of lindane were bioaccessible after a default digestion. Since the mobilization was independent of the spiking level, a partitioning-based model could describe the distribution of the test compounds. Fitting the data to the model yielded a ratiomore » of partitioning coefficients that indicated that approximately 60% of the PCBs were sorbed to the OECD-medium, 25% to bile salt micelles, and 15% to proteins. The respective values for lindane were 40%, 23%, and 32%. The relatively large fraction of the mobilized compounds that was sorbed to bile salt micelles indicates that micelles play a central role in making hydrophobic compounds bioaccessible. The distribution model is suitable for explaining the results reported in several literature studies and can be used to extrapolate the physiological parameters for the worst case situation and trends in the bioaccessible fraction.« less
Impact of feeding level on digestibility of a haylage-only diet in Icelandic horses.
Ragnarsson, S; Lindberg, J E
2010-10-01
Eight mature Icelandic geldings were used in an experiment arranged as a change-over design to evaluate the effect of feeding level on the digestibility of a high-energy haylage-only diet. The horses were fed a low feeding level 10.7 g dry matter (DM)/kg body weight (BW) (maintenance) and a high feeding level 18.1 g DM/kg BW (1.5 × maintenance) during two 23 days experimental periods. Total collection of faeces was performed for 6 days at the end of each period to determine the coefficient of total tract apparent digestibility (CTTAD). The CTTAD for DM, organic matter, neutral detergent fibre (NDF), acid detergent fibre and energy was higher in horses fed at the low level of feed intake, while feeding level did not affect the CTTAD of crude protein. The largest difference in CTTAD between feeding levels was found for NDF. The content (/kg DM) of digestible energy in the haylage was 11.3 MJ at the low level of feed intake and 10.6 MJ at the high level of feed intake. It can be concluded that feeding level has a large impact on the digestibility and energy value of early cut haylage in Icelandic horses. © 2009 The Authors. Journal of Animal Physiology and Animal Nutrition © 2009 Blackwell Verlag GmbH.
Yu, Xie; Hai-Yan, Liao; Shu-Jie, Chen; Ling-Yu, Shi; Li-Yan, Ou; Ping-Ying, Teng; Dan, Xia; Qi-Wei, Chen; Sinan, Zheng; Xiao-Hong, Zhou
2016-07-12
To clone and identify the heat shock factors (HSFs) of Schistosoma japonicum and analyze its molecular structure and alternative splicing pattern. The New Zealand rabbits were infected with the cercariae of Schistosoma japonicum and were killed and dissected 42 days post-infection, and the adult worms of S. japonicum and the livers of the rabbits were harvested. Then, the total RNA was extracted by using Trizol reagent. The Sj-hsf open reading frame (ORF) and the alternative splicing fragments were amplified by RT-PCR from the female, male and egg samples, then cloned and verified by enzyme digestion and sequencing. DNAMAN 8.0, InterPro, Mega 6 combined with the Internet databases were utilized to clarify the gene structure, functional domains, alternative splicing pattern, and the homology and phylogenetic tree of HSFs. Sj-hsf ORF and the alternative splicing fragments were amplified from the female, male and egg samples of S. japonicum by RT-PCR. After cloning, the positive recombinant plasmids pB Sj HSFf-F, pB Sj HSFf-M, pB Sj HSFf-E containing Sj-hsf ORF, pB Sj HSFs-F, pB Sj HSFs-M, pB Sj HSFs-E with Sj-hsf alternative splicing fragments were identified by enzyme digestion and sequencing. Three alternative splicing Sj-hsf isoforms were observed through sequence analysis: Sj-hsf -isoform1 (2 050 bp), Sj-hsf -isoform2 (2 086 bp) and Sj - hsf -isoform3 (2 111 bp); the GenBank accession numbers were KU954546, KX119143 and KX119144, respectively. All the three isoforms located in the same Contig SJC_S000780 of S. japonicum genome and all expressed at female, male and egg stages, but Sj-hsf -isoform1 with a high-level expression. Sj -HSF-isoform1 (671 aa) and Sj -HSF-isoform2 (683 aa) had DBD (DNA binding domain), HR-A/B and HR-C domains, while Sj -HSF-isoform3 (282 aa) stopped in advance without HR-C domain. Phylogenetic tree analysis of HSFs illustrated that Sj - HSFs belonged to HSF1 family, with a close phylogenetic relationship to Sm -HSFs. There are three alternative splicing isoforms of Sj -HSF existing in the female, male and egg stages of S. japonicum , but Sj -HSF-isoform1 expresses in a high-level. This study lays the foundation for further study on molecular mechanisms of Sj- HSFs in regulating the heat shock response system.
Francesch, M; Geraert, P A
2009-09-01
One experiment was conducted to investigate the benefits of a multi-enzyme complex, containing carbohydrases (from Penicillium funiculosum) and phytase (bacterial 6-phytase) activities, on the performance and bone mineralization of broiler chickens fed corn-soybean meal diets. A total of 2,268 male broilers were allocated to 9 treatments, replicated 6 times, in a randomized complete block design from 1 to 43 d. A positive control (PC) diet formulated to be adequate in nutrients and 4 reduced nutrient diets (NC1 to NC4), with gradual decrease on AME, CP, and digestible amino acids (CP-dAA) and available P (avP) and Ca contents, with or without enzyme supplementation, were tested. The nutrient reductions applied were NC1 (-65 kcal/kg, -1.5% CP-dAA) and NC2 (-85 kcal/kg, -3.0% CP-dAA) both with -0.15 percent point avP and -0.12 percent point Ca and NC3 (-65 kcal/kg, -1.5% CP-dAA) and NC4 (-85 kcal/kg, -3.0% CP-dAA) both with -0.20 percent point avP and -0.16 percent point Ca. Supplementation of the NC diets with the enzyme complex increased ADFI (P<0.001), ADG (P<0.001), and reduced feed:gain (P<0.01). The magnitude of the enzyme effect in increasing feed intake and weight gain was greater for the diets with greatest reductions in avP and Ca. Enzyme supplementation increased (P<0.001) feed intake of birds fed on NC diets close to the level of feed consumption of the PC. Enzyme supplementation to NC diets resulted in all cases in lower (P<0.05) feed:gain than the PC. Enzyme supplementation to NC1 and NC3 diets restored bone mineralization to that of the PC, whereas ash and Ca with NC2 and NC4 diets and P with NC4 diet remained lower (P<0.05). These results suggest that the dietary supplementation with a multi-enzyme complex containing nonstarch polysaccharide enzymes and phytase is efficient in reducing the P, energy, protein, and amino acid specifications of corn-soybean meal diets.
NASA Astrophysics Data System (ADS)
Obeidat, Abdalla; Abu-Ghazleh, Hind
2018-06-01
Two intermolecular potential models of methanol (TraPPE-UA and OPLS-AA) have been used in order to examine their validity in reproducing the selected structural, dynamical, and thermodynamic properties in the unary and binary systems. These two models are combined with two water models (SPC/E and TIP4P). The temperature dependence of density, surface tension, diffusion and structural properties for the unary system has been computed over specific range of temperatures (200-300K). The very good performance of the TraPPE-UA potential model in predicting surface tension, diffusion, structure, and density of the unary system led us to examine its accuracy and performance in its aqueous solution. In the binary system the same properties were examined, using different mole fractions of methanol. The TraPPE-UA model combined with TIP4P-water shows a very good agreement with the experimental results for density and surface tension properties; whereas the OPLS-AA combined with SPCE-water shows a very agreement with experimental results regarding the diffusion coefficients. Two different approaches have been used in calculating the diffusion coefficient in the mixture, namely the Einstein equation (EE) and Green-Kubo (GK) method. Our results show the advantageous of applying GK over EE in reproducing the experimental results and in saving computer time.
Saez, Patricio; Borquez, Aliro; Dantagnan, Patricio; Hernández, Adrián
2015-01-01
A digestibility trial was conducted to assess the effect of dehulling, steam-cooking and microwave-irradiation on the apparent digestibility of nutrients in white lupin (Lupinus albus) seed meal when fed to rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar). Six ingredients, whole lupin seed meal (LSM), dehulled LSM, dehulled LSM steam-cooked for 15 or 45 min (SC15 and SC45, respectively) and LSM microwave-irradiated at 375 or 750 W (MW375 and MW750, respectively), were evaluated for digestibility of dry matter, crude protein (CP), lipids, nitrogen-free extractives (NFE) and gross energy (GE). The diet-substitution approach was used (70% reference diet + 30% test ingredient). Faeces from each tank were collected using a settlement column. Dehulled LSM showed higher levels of proximate components (except for NFE and crude fibre), GE and phosphorus in comparison to whole LSM. Furthermore, SC15, SC45, MW375 and MW750 showed slight variations of chemical composition in comparison to dehulled LSM. Results from the digestibility trial indicated that dehulled LSM, SC15, SC45 and MW375 are suitable processing methods for the improvement of nutrients' apparent digestibility coefficient (ADC) in whole LSM. MW750 showed a lower ADC of nutrients (except for CP and lipids for rainbow trout) in comparison with MW350 for rainbow trout and Atlantic salmon, suggesting a heat damage of the ingredient when microwave-irradiation exceeded 350 W.
TNF-α-308 polymorphism and risk of digestive system cancers: a meta-analysis.
Guo, Xu-Feng; Wang, Jun; Yu, Shi-Jie; Song, Jia; Ji, Meng-Yao; Cao, Zhuo; Zhang, Ji-Xiang; Wang, Jing; Dong, Wei-Guo
2013-12-28
To evaluate the association between the tumour necrosis factor alpha-308 (TNF-α-308) gene polymorphism and the risk of digestive system cancers. All eligible case-control studies published up to December 2012 were identified by searching PubMed, Web of Science, Embase and China National Knowledge Internet without language restrictions. The risk of digestive system cancers associated with the TNF-α-308 polymorphism was estimated for each study using odds ratio (OR) together with its 95%CI, respectively. Cochrane Collaboration RevMan 5.1 was used to perform the analysis. A χ²-test-based Q statistic test and an I² test were performed to assess the between-study heterogeneity. When the Q test was significant (P < 0.05) or I² > 50%, the random effects model was used, otherwise the fixed effects model was used. Fifty-eight studies from fifty-five publications with a total of 9986 cancer patients and 15511 healthy controls were included. Overall, a significant association was found between the TNF-α-308 polymorphism and the risk of digestive system cancers [dominant model: OR = 1.23, 95%CI: 1.09-1.39, (G/A) vs (G/G): OR = 1.15, 95%CI: 1.02-1.28, (A/A) vs (G/G): OR = 1.44, 95%CI: 1.19-1.73, recessive model: OR = 1.38, 95%CI: 1.15-1.66]. Furthermore, when the analysis was stratified by ethnicity, similar results were observed in both the Asian and Caucasian populations, except for the dominant model and heterozygote comparisons in the Asian population [dominant model: OR = 1.24, 95%CI: 0.99-1.56, (G/A) vs (G/G): OR = 1.09, 95%CI: 0.96-1.24]. When the cancer type subgroups were examined, similar results were detected in gastric and hepatocellular carcinomas; however, no significant association was observed among other digestive system cancers. The TNF-α-308 gene polymorphism may be significantly associated with the risk of gastric and hepatocellular carcinomas, but not colorectal, pancreatic, or oesophageal cancer, in the Asian population.
Mackenzie, Colin F; Pasley, Jason; Garofalo, Evan; Shackelford, Stacy; Chen, Hegang; Longinaker, Nyaradzo; Granite, Guinevere; Pugh, Kristy; Hagegeorge, George; Tisherman, Samuel A
2017-07-01
Unbiased evaluation of trauma core competency procedures is necessary to determine if residency and predeployment training courses are useful. We tested whether a previously validated individual procedure score (IPS) for individual procedure vascular exposure and fasciotomy (FAS) performance skills could discriminate training status by comparing IPS of evaluators colocated with surgeons to blind video evaluations. Performance of axillary artery (AA), brachial artery (BA), and femoral artery (FA) vascular exposures and lower extremity FAS on fresh cadavers by 40 PGY-2 to PGY-6 residents was video-recorded from head-mounted cameras. Two colocated trained evaluators assessed IPS before and after training. One surgeon in each pretraining tertile of IPS for each procedure was randomly identified for blind video review. The same 12 surgeons were video-recorded repeating the procedures less than 4 weeks after training. Five evaluators independently reviewed all 96 randomly arranged deidentified videos. Inter-rater reliability/consistency, intraclass correlation coefficients were compared by colocated versus video review of IPS, and errors. Study methodology and bias were judged by Medical Education Research Study Quality Instrument and the Quality Assessment of Diagnostic Accuracy Studies criteria. There were no differences (p ≥ 0.5) in IPS for AA, FA, FAS, whether evaluators were colocated or reviewed video recordings. Evaluator consistency was 0.29 (BA) - 0.77 (FA). Video and colocated evaluators were in total agreement (p = 1.0) for error recognition. Intraclass correlation coefficient was 0.73 to 0.92, dependent on procedure. Correlations video versus colocated evaluations were 0.5 to 0.9. Except for BA, blinded video evaluators discriminated (p < 0.002) whether procedures were performed before training versus after training. Study methodology by Medical Education Research Study Quality Instrument criteria scored 15.5/19, Quality Assessment of Diagnostic Accuracy Studies 2 showed low bias risk. Video evaluations of AA, FA, and FAS procedures with IPS are unbiased, valid, and have potential for formative assessments of competency. Prognostic study, level II.
Kumar, Rakesh; Gupta, I. D.; Verma, Archana; Verma, Nishant; Vineeth, M. R.
2015-01-01
Aim: The present study was undertaken to identify novel single nucleotide polymorphism (SNP) in Exon 3 of HSP90AA1 gene and to analyze their association with respiration rate (RR) and rectal temperature (RT) in Sahiwal cows. Materials and Methods: The present study was carried out in Sahiwal cows (n=100) with the objectives to identify novel SNP in exon 3 of HSP90AA1 gene and to explore the association with heat tolerance traits. CLUSTAL-W multiple sequence analysis was used to identify novel SNPs in exon 3 of HSP90AA1 gene in Sahiwal cows. Gene and genotype frequencies of different genotypes were estimated by standard procedure POPGENE version 1.32 (University of Alberta, Canada). The significant effect of SNP variants on physiological parameters, e.g. RR and RT were analyzed using the General Linear model procedure of SAS Version 9.2. Results: The polymerase chain reaction product with the amplicon size of 450 bp was successfully amplified, covering exon 3 region of HSP90AA1 gene in Sahiwal cows. On the basis of comparative sequence analysis of Sahiwal samples (n=100), transitional mutations were detected at locus A1209G as compared to Bos taurus (NCBI GenBank AC_000178.1). After chromatogram analysis, three genotypes AA, AG, and GG with respective frequencies of 0.23, 0.50, and 0.27 ascertained. RR and RT were recorded once during probable extreme hours in winter, spring, and summer seasons. It was revealed that significant difference (p<0.01) among genetic variants of HSP90AA1 gene with heat tolerance trait was found in Sahiwal cattle. The homozygotic animals with AA genotype had lower heat tolerance coefficient (HTC) (1.78±0.04a), as compared to both AG and GG genotypes (1.85±0.03b and 1.91±0.02c), respectively. The gene and genotype frequencies for the locus A1209G were ascertained. Conclusions: Novel SNP was found at the A1209G position showed all possible three genotypes (homozygous and heterozygous). Temperature humidity index has a highly significant association with RR, RT, and HTC in all the seasons. Perusal of results across different seasons showed the significant (p<0.01) difference in RR, RT, and HTC among winter, spring, and summer seasons. Genetic association with heat tolerance traits reveals their importance as a potential genetic marker for heat tolerance traits in Sahiwal cows. PMID:27047179
Yang, Zhong; Li, Kang; Zhang, Maomao; Xin, Donglin; Zhang, Junhua
2016-01-01
During conversion of bamboo into biofuels and chemicals, it is necessary to efficiently predict the chemical composition and digestibility of biomass. However, traditional methods for determination of lignocellulosic biomass composition are expensive and time consuming. In this work, a novel and fast method for quantitative and qualitative analysis of chemical composition and enzymatic digestibilities of juvenile bamboo and mature bamboo fractions (bamboo green, bamboo timber, bamboo yellow, bamboo node, and bamboo branch) using visible-near infrared spectra was evaluated. The developed partial least squares models yielded coefficients of determination in calibration of 0.88, 0.94, and 0.96, for cellulose, xylan, and lignin of bamboo fractions in raw spectra, respectively. After visible-near infrared spectra being pretreated, the corresponding coefficients of determination in calibration yielded by the developed partial least squares models are 0.994, 0.990, and 0.996, respectively. The score plots of principal component analysis of mature bamboo, juvenile bamboo, and different fractions of mature bamboo were obviously distinguished in raw spectra. Based on partial least squares discriminant analysis, the classification accuracies of mature bamboo, juvenile bamboo, and different fractions of bamboo (bamboo green, bamboo timber, bamboo yellow, and bamboo branch) all reached 100 %. In addition, high accuracies of evaluation of the enzymatic digestibilities of bamboo fractions after pretreatment with aqueous ammonia were also observed. The results showed the potential of visible-near infrared spectroscopy in combination with multivariate analysis in efficiently analyzing the chemical composition and hydrolysabilities of lignocellulosic biomass, such as bamboo fractions.
Meta-Analysis of Mass Balances Examining Chemical Fate during Wastewater Treatment
2008-01-01
Mass balances are an instructive means for investigating the fate of chemicals during wastewater treatment. In addition to the aqueous-phase removal efficiency (Φ), they can inform on chemical partitioning, transformation, and persistence, as well as on the chemical loading to streams and soils receiving, respectively, treated effluent and digested sewage sludge (biosolids). Release rates computed on a per-capita basis can serve to extrapolate findings to a larger scale. This review examines over a dozen mass balances conducted for various organic wastewater contaminants, including prescription drugs, estrogens, fragrances, antimicrobials, and surfactants of differing sorption potential (hydrophobicity), here expressed as the 1-octanol−water partition coefficient (KOW) and the organic carbon normalized sorption coefficient (KOC). Major challenges to mass balances are the collection of representative samples and accurate quantification of chemicals in sludge. A meta-analysis of peer-reviewed data identified sorption potential as the principal determinant governing chemical persistence in biosolids. Occurrence data for organic wastewater compounds detected in digested sludge followed a simple nonlinear model that required only KOW or KOC as the input and yielded a correlation coefficient of 0.9 in both instances. The model predicted persistence in biosolids for the majority (>50%) of the input load of organic wastewater compounds featuring a log10KOW value of greater than 5.2 (log10KOC > 4.4). In contrast, hydrophobicity had no or only limited value for estimating, respectively, Φ and the overall persistence of a chemical during conventional wastewater treatment. PMID:18800497
Windham, B Gwen; Wilkening, Steven R; Lirette, Seth T; Kullo, Iftikhar J; Turner, Stephen T; Griswold, Michael E; Mosley, Thomas H
2016-07-01
To examine associations between inflammation and physical function and potential mediation by white matter hyperintensities (WMHs) in African Americans (AAs) and European Americans (EAs). Cross-sectional analysis using linear and logistic models with generalized estimating equations to account for family clustering, reporting results as regression coefficients (β) and odds ratios (ORs) adjusted for education, alcohol, exercise, body mass index, hypertension, diabetes mellitus, heart disease, cognition, ankle-brachial index, race (site), and supported interactions. Genetic Epidemiology Network of Arteriopathy-Genetics of Microangiopathic Brain Injury Study cohort. AA and EA sibships with two or more siblings with hypertension before age 60 (N = 1,960; 65% female, 51% AA, aged 26-91, 50% obese, 72% hypertensive). Inflammation (C-reactive protein (CRP), interleukin-6 (IL6), soluble tumor necrosis factor receptors (sTNFRs) 1 and 2, WMH volume (cm(3) ) according to magnetic resonance imaging), walking speed (cm/s) over 25 feet, and mobility difficulty (any self-reported difficulty walking half a mile). In separate models, inflammatory markers were associated with walking speed (sTNFR1: β = -2.74, P < .001; sTNFR2: β = -1.23, P = .03; CRP: β = -1.95, P = .001; IL6: β = -1.24, P = .03) and mobility difficulty (sTNFR1: OR = 1.36, P = .001; sTNFR2: OR = 1.25, P = .005; CRP: OR = 1.22, P = .005; IL6: OR = 1.18, P = .02); the association between WMH volume and sTNFR1 in AA (β = 0.07, P = .06) did not reach typical statistical thresholds. WMH volume was associated with walking speed in AA (β = -3.17, P = .02) but not with mobility difficulty (OR = 1.10, P = .54). Adjusting for WMH did not change associations. In young, middle-aged, and older adults with prevalent cardiovascular risk factors, multiple inflammatory biomarkers were associated with slower walking speed independent of microvascular disease in the brain. There was little evidence of mediation by brain WMH volume. Inflammation may contribute to physical function impairments through pathways other than brain microvascular disease, particularly in AAs. © 2016, Copyright the Authors Journal compilation © 2016, The American Geriatrics Society.
Stella, Stefano; Italia, Leonardo; Geremia, Giulia; Rosa, Isabella; Ancona, Francesco; Marini, Claudia; Capogrosso, Cristina; Giglio, Manuela; Montorfano, Matteo; Latib, Azeem; Margonato, Alberto; Colombo, Antonio; Agricola, Eustachio
2018-02-06
A 3D transoesophageal echocardiography (3D-TOE) reconstruction tool has recently been introduced. The system automatically configures a geometric model of the aortic root and performs quantitative analysis of these structures. We compared the measurements of the aortic annulus (AA) obtained by semi-automated 3D-TOE quantitative software and manual analysis vs. multislice computed tomography (MSCT) ones. One hundred and seventy-five patients (mean age 81.3 ± 6.3 years, 77 men) who underwent both MSCT and 3D-TOE for annulus assessment before transcatheter aortic valve implantation were analysed. Hypothetical prosthetic valve sizing was evaluated using the 3D manual, semi-automated measurements using manufacturer-recommended CT-based sizing algorithm as gold standard. Good correlation between 3D-TOE methods vs. MSCT measurements was found, but the semi-automated analysis demonstrated slightly better correlations for AA major diameter (r = 0.89), perimeter (r = 0.89), and area (r = 0.85) (all P < 0.0001) than manual one. Both 3D methods underestimated the MSCT measurements, but semi-automated measurements showed narrower limits of agreement and lesser bias than manual measurements for most of AA parameters. On average, 3D-TOE semi-automated major diameter, area, and perimeter underestimated the respective MSCT measurements by 7.4%, 3.5%, and 4.4%, respectively, whereas minor diameter was overestimated by 0.3%. Moderate agreement for valve sizing for both 3D-TOE techniques was found: Kappa agreement 0.5 for both semi-automated and manual analysis. Interobserver and intraobserver agreements for the AA measurements were excellent for both techniques (intraclass correlation coefficients for all parameters >0.80). The 3D-TOE semi-automated analysis of AA is feasible and reliable and can be used in clinical practice as an alternative to MSCT for AA assessment. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author(s) 2018. For permissions, please email: journals.permissions@oup.com.
Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.
Carvalho-de-Souza, Joao L; Bezanilla, Francisco
2018-02-05
Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018 Carvalho-de-Souza and Bezanilla.
Sealy-Jefferson, Shawnita; Messer, Lynne; Slaughter-Acey, Jaime; Misra, Dawn P.
2016-01-01
Background The inter-relationships between objective (census-based) and subjective (resident reported) measures of the residential environment is understudied in African American (AA) populations. Methods Using data from the Life Influences on Fetal Environments Study (2009–2011) (n=1,387) of AA women, we quantified the area-level variation in subjective reports of residential healthy food availability, walkability, safety and disorder that can be accounted for with an objective neighborhood disadvantage index (NDI). Two-level generalized linear models estimated associations between objective and subjective measures of the residential environment, accounting for individual-level covariates. Results In unconditional models, intraclass correlation coefficients for block-group variance in subjective reports ranged from 11% (healthy food availability) to 30% (safety). Models accounting for the NDI (versus both NDI and individual level covariates) accounted for more variance in healthy food availability (23% versus 8%) and social disorder (40% versus 38%). The NDI and individual level variables accounted for 39% and 51% of the area-level variation in walkability and safety. Associations between subjective and objective measures of the residential environment were significant and in the expected direction. Conclusions Future studies on neighborhood effects on health, especially among AAs, should include a wide range of residential environment measures, including subjective, objective and spatial contextual variables. PMID:28160971
Sealy-Jefferson, Shawnita; Messer, Lynne; Slaughter-Acey, Jaime; Misra, Dawn P
2017-03-01
The inter-relationships between objective (census based) and subjective (resident reported) measures of the residential environment is understudied in African American (AA) populations. Using data from the Life Influences on Fetal Environments Study (2009-2011; n = 1387) of AA women, we quantified the area-level variation in subjective reports of residential healthy food availability, walkability, safety, and disorder that can be accounted for with an objective neighborhood disadvantage index (NDI). Two-level generalized linear models estimated associations between objective and subjective measures of the residential environment, accounting for individual-level covariates. In unconditional models, intraclass correlation coefficients for block-group variance in subjective reports ranged from 11% (healthy food availability) to 30% (safety). Models accounting for the NDI (vs. both NDI and individual-level covariates) accounted for more variance in healthy food availability (23% vs. 8%) and social disorder (40% vs. 38%). The NDI and individual-level variables accounted for 39% and 51% of the area-level variation in walkability and safety, respectively. Associations between subjective and objective measures of the residential environment were significant and in the expected direction. Future studies on neighborhood effects on health, especially among AAs, should include a wide range of residential environment measures, including subjective, objective, and spatial contextual variables. Copyright © 2016 Elsevier Inc. All rights reserved.
Hilario, Eric C; Stern, Alan; Wang, Charlie H; Vargas, Yenny W; Morgan, Charles J; Swartz, Trevor E; Patapoff, Thomas W
2017-01-01
Concentration determination is an important method of protein characterization required in the development of protein therapeutics. There are many known methods for determining the concentration of a protein solution, but the easiest to implement in a manufacturing setting is absorption spectroscopy in the ultraviolet region. For typical proteins composed of the standard amino acids, absorption at wavelengths near 280 nm is due to the three amino acid chromophores tryptophan, tyrosine, and phenylalanine in addition to a contribution from disulfide bonds. According to the Beer-Lambert law, absorbance is proportional to concentration and path length, with the proportionality constant being the extinction coefficient. Typically the extinction coefficient of proteins is experimentally determined by measuring a solution absorbance then experimentally determining the concentration, a measurement with some inherent variability depending on the method used. In this study, extinction coefficients were calculated based on the measured absorbance of model compounds of the four amino acid chromophores. These calculated values for an unfolded protein were then compared with an experimental concentration determination based on enzymatic digestion of proteins. The experimentally determined extinction coefficient for the native proteins was consistently found to be 1.05 times the calculated value for the unfolded proteins for a wide range of proteins with good accuracy and precision under well-controlled experimental conditions. The value of 1.05 times the calculated value was termed the predicted extinction coefficient. Statistical analysis shows that the differences between predicted and experimentally determined coefficients are scattered randomly, indicating no systematic bias between the values among the proteins measured. The predicted extinction coefficient was found to be accurate and not subject to the inherent variability of experimental methods. We propose the use of a predicted extinction coefficient for determining the protein concentration of therapeutic proteins starting from early development through the lifecycle of the product. LAY ABSTRACT: Knowing the concentration of a protein in a pharmaceutical solution is important to the drug's development and posology. There are many ways to determine the concentration, but the easiest one to use in a testing lab employs absorption spectroscopy. Absorbance of ultraviolet light by a protein solution is proportional to its concentration and path length; the proportionality constant is the extinction coefficient. The extinction coefficient of a protein therapeutic is usually determined experimentally during early product development and has some inherent method variability. In this study, extinction coefficients of several proteins were calculated based on the measured absorbance of model compounds. These calculated values for an unfolded protein were then compared with experimental concentration determinations based on enzymatic digestion of the proteins. The experimentally determined extinction coefficient for the native protein was 1.05 times the calculated value for the unfolded protein with good accuracy and precision under controlled experimental conditions, so the value of 1.05 times the calculated coefficient was called the predicted extinction coefficient. Comparison of predicted and measured extinction coefficients indicated that the predicted value was very close to the experimentally determined values for the proteins. The predicted extinction coefficient was accurate and removed the variability inherent in experimental methods. © PDA, Inc. 2017.
Peik-See, Teo; Pandikumar, Alagarsamy; Nay-Ming, Huang; Hong-Ngee, Lim; Sulaiman, Yusran
2014-01-01
The fabrication of an electrochemical sensor based on an iron oxide/graphene modified glassy carbon electrode (Fe3O4/rGO/GCE) and its simultaneous detection of dopamine (DA) and ascorbic acid (AA) is described here. The Fe3O4/rGO nanocomposite was synthesized via a simple, one step in-situ wet chemical method and characterized by different techniques. The presence of Fe3O4 nanoparticles on the surface of rGO sheets was confirmed by FESEM and TEM images. The electrochemical behavior of Fe3O4/rGO/GCE towards electrocatalytic oxidation of DA was investigated by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) analysis. The electrochemical studies revealed that the Fe3O4/rGO/GCE dramatically increased the current response against the DA, due to the synergistic effect emerged between Fe3O4 and rGO. This implies that Fe3O4/rGO/GCE could exhibit excellent electrocatalytic activity and remarkable electron transfer kinetics towards the oxidation of DA. Moreover, the modified sensor electrode portrayed sensitivity and selectivity for simultaneous determination of AA and DA. The observed DPVs response linearly depends on AA and DA concentration in the range of 1–9 mM and 0.5–100 μM, with correlation coefficients of 0.995 and 0.996, respectively. The detection limit of (S/N = 3) was found to be 0.42 and 0.12 μM for AA and DA, respectively. PMID:25195850
Peik-See, Teo; Pandikumar, Alagarsamy; Nay-Ming, Huang; Hong-Ngee, Lim; Sulaiman, Yusran
2014-08-19
The fabrication of an electrochemical sensor based on an iron oxide/graphene modified glassy carbon electrode (Fe3O4/rGO/GCE) and its simultaneous detection of dopamine (DA) and ascorbic acid (AA) is described here. The Fe3O4/rGO nanocomposite was synthesized via a simple, one step in-situ wet chemical method and characterized by different techniques. The presence of Fe3O4 nanoparticles on the surface of rGO sheets was confirmed by FESEM and TEM images. The electrochemical behavior of Fe3O4/rGO/GCE towards electrocatalytic oxidation of DA was investigated by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) analysis. The electrochemical studies revealed that the Fe3O4/rGO/GCE dramatically increased the current response against the DA, due to the synergistic effect emerged between Fe3O4 and rGO. This implies that Fe3O4/rGO/GCE could exhibit excellent electrocatalytic activity and remarkable electron transfer kinetics towards the oxidation of DA. Moreover, the modified sensor electrode portrayed sensitivity and selectivity for simultaneous determination of AA and DA. The observed DPVs response linearly depends on AA and DA concentration in the range of 1-9 mM and 0.5-100 µM, with correlation coefficients of 0.995 and 0.996, respectively. The detection limit of (S/N = 3) was found to be 0.42 and 0.12 µM for AA and DA, respectively.
Pereira, Éderson R; de Almeida, Tarcísio S; Borges, Daniel L G; Carasek, Eduardo; Welz, Bernhard; Feldmann, Jörg; Campo Menoyo, Javier Del
2016-04-01
High-resolution continuum source graphite furnace atomic absorption spectrometry (HR-CS GF AAS) has been applied for the development of a method for the determination of total As in fish oil samples using direct analysis. The method does not use any sample pretreatment, besides dilution with 1-propanole, in order to decrease the oil viscosity. The stability and sensitivity of As were evaluated using ruthenium and iridium as permanent chemical modifiers and palladium added in solution over the sample. The best results were obtained with ruthenium as the permanent modifier and palladium in solution added to samples and standard solutions. Under these conditions, aqueous standard solutions could be used for calibration for the fish oil samples diluted with 1-propanole. The pyrolysis and atomization temperatures were 1400 °C and 2300 °C, respectively, and the limit of detection and characteristic mass were 30 pg and 43 pg, respectively. Accuracy and precision of the method have been evaluated using microwave-assisted acid digestion of the samples with subsequent determination by HR-CS GF AAS and ICP-MS; the results were in agreement (95% confidence level) with those of the proposed method. Copyright © 2015 Elsevier B.V. All rights reserved.
Atmospheric aerosols: Their Optical Properties and Effects (supplement)
NASA Technical Reports Server (NTRS)
1976-01-01
A digest of technical papers is presented. Topics include aerosol size distribution from spectral attenuation with scattering measurements; comparison of extinction and backscattering coefficients for measured and analytic stratospheric aerosol size distributions; using hybrid methods to solve problems in radiative transfer and in multiple scattering; blue moon phenomena; absorption refractive index of aerosols in the Denver pollution cloud; a two dimensional stratospheric model of the dispersion of aerosols from the Fuego volcanic eruption; the variation of the aerosol volume to light scattering coefficient; spectrophone in situ measurements of the absorption of visible light by aerosols; a reassessment of the Krakatoa volcanic turbidity, and multiple scattering in the sky radiance.
Determination of total mercury in biological and geological samples
Crock, James G.
2005-01-01
The analytical chemist is faced with several challenges when determining mercury in biological and geological materials. These challenges include widespread mercury contamination, both in the laboratory and the environment, possible losses of mercury during sample preparation and digestion, the wide range of mercury values commonly observed, ranging from the low nanogram per gram or per liter for background areas to hundreds of milligrams per kilogram in contaminated or ore-bearing areas, great matrix diversity, and sample heterogeneity1. These factors can be naturally occurring or anthropogenic, but must be addressed to provide a precise and accurate analysis. Although there are many instrumental methods available for the successful determination of mercury, no one technique will address all problems or all samples all of the time. The approach for the determination of mercury used at the U.S. Geological Survey, Crustal Imaging and Characterization Team, Denver Laboratories, utilizes a suite of complementary instrumental methods when approaching a study requiring mercury analyses. Typically, a study could require the analysis of waters, leachates or selective digestions of solids, vegetation, and biological materials such as tissue, bone, or shell, soils, rocks, sediments, coals, sludges, and(or) ashes. No one digestion or sample preparation method will be suitable for all of these matrices. The digestions typically employed at our laboratories include: (i) a closed-vessel microwave method using nitric acid and hydrogen peroxide, followed by digestion/dilution with a nitric acid/sodium dichromate solution, (ii) a robotic open test-tube digestion with nitric acid and sodium dichromate, (iii) a sealed Teflon? vessel with nitric acid and sodium dichromate, (iv) a sealed glass bottle with nitric acid and sodium dichromate, or (v) open test tube digestion with nitric and sulfuric acids and vanadium pentoxide. The common factor in all these digestions is that they are very oxidative to ensure the conversion of all mercury forms into Hg (II). Each method of digestion has its advantages and limitations. The method of detection used in our laboratories involves a combination of an in-house, custom, classic continuous-flow cold-vapor atomic absorption spectrometry (CVAAS), a commercially available, automated, flow-injection and a continuous flow cold-vapor atomic fluorescence spectrometry (CV-AFS) systems, and a relatively new, automated and integrated approach where solid or liquid samples are thermally decomposed under an oxygen atmosphere (a nitrogen atmosphere is used for coals) and the released mercury vapor trapped onto a gold gauze and then thermally released into an AAS system. Other less frequently used instrumental methods available for the determination of mercury include inductively coupled plasma ? optical emission spectrometry (ICP-OES), inductively couple plasma ? mass spectrometry (ICP-MS) (both solution nebulization and laser ablation), and instrumental neutron activation analysis (INAA). Results from two case studies involving the determination of mercury in the challenging matrices of biological materials will be presented. These will include fillet, liver and stomach-content samples from grayling for a baseline/background study in Alaska, and samples of meat tissue and shell material from Tanner crabs from Glacier Bay, Alaska. These studies show that the method of digestion is more important than a very sensitive detection limit for mercury.
Rotordynamic Forces Developed by Labyrinth Seals
1984-11-01
the prediction of leakage and the rotordynamic coefficients of Eq. (1) for labyrinth seals . A copy of reference DI) is attached. In comparison to... Leakage of Steam Through Labyrinth Glands," Trans. ASME, Vol. 57, 1935, pp. 115-122. 16. John, E. A. Jamea, Gas Dynamios, Wylie, 1979. -19- • ]{ o -Cr...Quadratic-Upstream Di iferemcing in Uigh Reynolds Number Illiptic a. Xgli. A.. ’"the Leakage of Steam Through Labyrinth flows," of P ohAa. ab o.. l 9
NASA Technical Reports Server (NTRS)
Wilson, Robert M.
2014-01-01
Examined are sunspot cycle- (SC-) length averages of the annual January-December values of the Global Land-Ocean Temperature Index (
Solon, Kimberly; Flores-Alsina, Xavier; Gernaey, Krist V; Jeppsson, Ulf
2015-01-01
This paper examines the importance of influent fractionation, kinetic, stoichiometric and mass transfer parameter uncertainties when modeling biogas production in wastewater treatment plants. The anaerobic digestion model no. 1 implemented in the plant-wide context provided by the benchmark simulation model no. 2 is used to quantify the generation of CH₄, H₂and CO₂. A comprehensive global sensitivity analysis based on (i) standardized regression coefficients (SRC) and (ii) Morris' screening's (MS's) elementary effects reveals the set of parameters that influence the biogas production uncertainty the most. This analysis is repeated for (i) different temperature regimes and (ii) different solids retention times (SRTs) in the anaerobic digester. Results show that both SRC and MS are good measures of sensitivity unless the anaerobic digester is operating at low SRT and mesophilic conditions. In the latter situation, and due to the intrinsic nonlinearities of the system, SRC fails in decomposing the variance of the model predictions (R² < 0.7) making MS a more reliable method. At high SRT, influent fractionations are the most influential parameters for predictions of CH₄and CO₂emissions. Nevertheless, when the anaerobic digester volume is decreased (for the same load), the role of acetate degraders gains more importance under mesophilic conditions, while lipids and fatty acid metabolism is more influential under thermophilic conditions. The paper ends with a critical discussion of the results and their implications during model calibration and validation exercises.
Stick-slip friction and wear of articular joints
Lee, Dong Woog; Banquy, Xavier; Israelachvili, Jacob N.
2013-01-01
Stick-slip friction was observed in articular cartilage under certain loading and sliding conditions and systematically studied. Using the Surface Forces Apparatus, we show that stick-slip friction can induce permanent morphological changes (a change in the roughness indicative of wear/damage) in cartilage surfaces, even under mild loading and sliding conditions. The different load and speed regimes can be represented by friction maps—separating regimes of smooth and stick-slip sliding; damage generally occurs within the stick-slip regimes. Prolonged exposure of cartilage surfaces to stick-slip sliding resulted in a significant increase of surface roughness, indicative of severe morphological changes of the cartilage superficial zone. To further investigate the factors that are conducive to stick-slip and wear, we selectively digested essential components of cartilage: type II collagen, hyaluronic acid (HA), and glycosaminoglycans (GAGs). Compared with the normal cartilage, HA and GAG digestions modified the stick-slip behavior and increased surface roughness (wear) during sliding, whereas collagen digestion decreased the surface roughness. Importantly, friction forces increased up to 2, 10, and 5 times after HA, GAGs, and collagen digestion, respectively. Also, each digestion altered the friction map in different ways. Our results show that (i) wear is not directly related to the friction coefficient but (ii) more directly related to stick-slip sliding, even when present at small amplitudes, and that (iii) the different molecular components of joints work synergistically to prevent wear. Our results also suggest potential noninvasive diagnostic tools for sensing stick-slip in joints. PMID:23359687
Froetschel, M A; Amos, H E; Evans, J J; Croom, W J; Hagler, W M
1989-03-01
Slaframine (SF), a parasympathomimetic salivary stimulant, was administered i.m. (10, 15 or 20 micrograms SF/kg BW) to ruminally and abomasally fistulated steers at 12-h intervals for 18-d periods in a latin square-designed experiment. Steers were fed semicontinuously (12 times daily) a 40:60 roughage:concentrate diet at twice their net energy requirement for maintenance. Ruminal digestion coefficients for DM, ADF and starch were 10 to 16% lower and linearly related in an inverse manner to the level of SF administered (P less than .05). Postruminal digestion of DM, ADF and starch increased as much as 46.7, 9.5 and 44.0%, respectively, in a fashion linearly related (P less than .05) to the level of SF administered. Total tract digestion of DM and ADF were not affected by SF; however, total tract starch digestion was increased as much as 5% and was related linearly (P less than .05) to SF treatment. With SF administration, as much as 13% more bacterial protein exited the rumen, resulting in a 16.5% linear improvement (P less than .1) in the efficiency of ruminal bacterial protein production per 100 g of OM fermented. Ruminal concentrations of VFA, ammonia and pH were not affected by SF. These results demonstrate a positive relationship between salivation and ruminal bacterial protein synthesis and suggest that feed utilization by ruminants may be improved by pharmacological stimulation of salivary secretions.
Razavi, Morteza; Leigh Anderson, N; Pope, Matthew E; Yip, Richard; Pearson, Terry W
2016-09-25
Efficient robotic workflows for trypsin digestion of human plasma and subsequent antibody-mediated peptide enrichment (the SISCAPA method) were developed with the goal of improving assay precision and throughput for multiplexed protein biomarker quantification. First, an 'addition only' tryptic digestion protocol was simplified from classical methods, eliminating the need for sample cleanup, while improving reproducibility, scalability and cost. Second, methods were developed to allow multiplexed enrichment and quantification of peptide surrogates of protein biomarkers representing a very broad range of concentrations and widely different molecular masses in human plasma. The total workflow coefficients of variation (including the 3 sequential steps of digestion, SISCAPA peptide enrichment and mass spectrometric analysis) for 5 proteotypic peptides measured in 6 replicates of each of 6 different samples repeated over 6 days averaged 3.4% within-run and 4.3% across all runs. An experiment to identify sources of variation in the workflow demonstrated that MRM measurement and tryptic digestion steps each had average CVs of ∼2.7%. Because of the high purity of the peptide analytes enriched by antibody capture, the liquid chromatography step is minimized and in some cases eliminated altogether, enabling throughput levels consistent with requirements of large biomarker and clinical studies. Copyright © 2016 Elsevier B.V. All rights reserved.
Cao, X J; Wang, W M; Song, F
2011-08-01
With 3 figures and 1 table Topmouth culter (Culter alburnus), a freshwater carnivorous fish of the Cyprinidae, is one of the most popular fish species in aquatic market in China. The anatomy and histology features of fish intestine are very useful for understanding digestive physiology, diagnosing some intestinal diseases and formulating suitable feeds. Thus, here we first characterize topmouth culter intestine via light microscope, transmission electron microscope and scan electron microscope. The 'Z' shaped intestine can be divided into three parts (e.g. the anterior intestine, middle intestine and posterior intestine), with an intestinal coefficient of 0.68. The anterior intestine possessed the longest mucosa folds and thickest muscularis among the three intestinal parts, and microvilli were very well-developed whilst many mitochondria, endoplasmic reticulums and lysosomes were found in which. This indicated the anterior intestine was a main region for digestion and absorption of food in the topmouth culter. While the vacuoles observed in the posterior intestine may be closely related to the intracellular digestion. Neutral and acid mucus were strongly present throughout the intestine. This detailed descriptive paper will be very helpful for studies of topmouth culter related to its digestive physiology, intestinal disease control and feed nutrient. © 2011 Blackwell Verlag GmbH.
Evaluation of in situ valine production by Bacillus subtilis in young pigs.
Nørgaard, J V; Canibe, N; Soumeh, E A; Jensen, B B; Nielsen, B; Derkx, P; Cantor, M D; Blaabjerg, K; Poulsen, H D
2016-11-01
Mutants of Bacillus subtilis can be developed to overproduce Val in vitro. It was hypothesized that addition of Bacillus subtilis mutants to pig diets can be a strategy to supply the animal with Val. The objective was to investigate the effect of Bacillus subtilis mutants on growth performance and blood amino acid (AA) concentrations when fed to piglets. Experiment 1 included 18 pigs (15.0±1.1 kg) fed one of three diets containing either 0.63 or 0.69 standardized ileal digestible (SID) Val : Lys, or 0.63 SID Val : Lys supplemented with a Bacillus subtilis mutant (mutant 1). Blood samples were obtained 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding and analyzed for AAs. In Experiment 2, 80 piglets (9.1±1.1 kg) were fed one of four diets containing 0.63 or 0.67 SID Val : Lys, or 0.63 SID Val : Lys supplemented with another Bacillus subtilis mutant (mutant 2) or its parent wild type. Average daily feed intake, daily weight gain and feed conversion ratio were measured on days 7, 14 and 21. On day 17, blood samples were taken and analyzed for AAs. On days 24 to 26, six pigs from each dietary treatment were fitted with a permanent jugular vein catheter, and blood samples were taken for AA analysis 0.5 h before feeding and at 1, 2, 3, 4, 5 and 6 h after feeding. In experiment 1, Bacillus subtilis mutant 1 tended (P<0.10) to increase the plasma levels of Val at 2 and 3 h post-feeding, but this was not confirmed in Experiment 2. In Experiment 2, Bacillus subtilis mutant 2 and the wild type did not result in a growth performance different from the negative and positive controls. In conclusion, results obtained with the mutant strains of Bacillus subtilis were not better than results obtained with the wild-type strain, and for both strains, the results were not different than the negative control.
Maherani, Behnoush; Arab-Tehrany, Elmira; Kheirolomoom, Azadeh; Geny, David; Linder, Michel
2013-11-01
The design of the drug delivery depends upon different parameters. One of the most noticeable factors in design of the drug delivery is drug-release profile which determines the site of action, the concentration of the drug at the time of administration, the period of time that the drug must remain at a therapeutic concentration. To get a better understanding of drug release, large unilamellar liposomes containing calcein were prepared using 1,2-dioleoyl-sn-glycero-3-phosphocholine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine and 1,2-palmitoyl-sn-glycero-3-phosphocholine, and a mixture of them; calcein was chosen as a model of hydrophilic drug. The calcein permeability across liposomal membrane (with different compositions) was evaluated on the basis of the first-order kinetic by spectrofluorometer. Also, the effects of liposome composition/fluidity as well as the incubation temperature/pH were investigated. Furthermore, we simulated the digestion condition in the gastrointestinal tract in humans, to mimic human gastro-duodenal digestion to monitor calcein release during the course of the digestion process. In vitro digestion model ''pH stat'' was used to systematically examine the influence of pH/enzyme on phospholipid liposomes digestion under simulated gastro-duodenal digestion. The results revealed that calcein permeates across liposomal membrane without membrane disruption. The release rate of calcein from the liposomes depends on the number and fluidity of bilayers and its mechanical/physical properties such as permeability, bending elasticity. Chemo-structural properties of drugs like as partition coefficient (Log P), H-bonding, polar surface area (PSA) are also determinative parameter in release behavior. Finally, stimulated emission depletion (STED) microscopy was used to study calcein translocation through liposomal bilayers. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, M.; Ma, L.Q.
1998-11-01
It is critical to compare existing sample digestion methods for evaluating soil contamination and remediation. USEPA Methods 3050, 3051, 3051a, and 3052 were used to digest standard reference materials and representative Florida surface soils. Fifteen trace metals (Ag, As, Ba, Be, Cd, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Sb, Se, and Za), and six macro elements (Al, Ca, Fe, K, Mg, and P) were analyzed. Precise analysis was achieved for all elements except for Cd, Mo, Se, and Sb in NIST SRMs 2704 and 2709 by USEPA Methods 3050 and 3051, and for all elements except for As, Mo,more » Sb, and Se in NIST SRM 2711 by USEPA Method 3052. No significant differences were observed for the three NIST SRMs between the microwave-assisted USEPA Methods 3051 and 3051A and the conventional USEPA Method 3050 Methods 3051 and 3051a and the conventional USEPA Method 3050 except for Hg, Sb, and Se. USEPA Method 3051a provided comparable values for NIST SRMs certified using USEPA Method 3050. However, for method correlation coefficients and elemental recoveries in 40 Florida surface soils, USEPA Method 3051a was an overall better alternative for Method 3050 than was Method 3051. Among the four digestion methods, the microwave-assisted USEPA Method 3052 achieved satisfactory recoveries for all elements except As and Mg using NIST SRM 2711. This total-total digestion method provided greater recoveries for 12 elements Ag, Be, Cr, Fe, K, Mn, Mo, Ni, Pb, Sb, Se, and Zn, but lower recoveries for Mg in Florida soils than did the total-recoverable digestion methods.« less
Lech, Gregory P.; Reigh, Robert C.
2012-01-01
Costs of compounded diets containing fish meal as a primary protein source can be expected to rise as fish meal prices increase in response to static supply and growing demand. Alternatives to fish meal are needed to reduce production costs in many aquaculture enterprises. Some plant proteins are potential replacements for fish meal because of their amino acid composition, lower cost and wide availability. In this study, we measured utilization of soybean meal (SBM) and soy protein concentrate (SPC) by Florida pompano fed compounded diets, to determine the efficacy of these products as fish meal replacements. We also calculated apparent digestibility coefficients (ADCs) for canola meal (CM), corn gluten meal (CGM), and distillers dried grains with solubles (DDGS), following typical methods for digestibility trials. Juvenile Florida pompano were fed fish-meal-free diets containing graded levels of SBM and SPC, and weight gain was compared to a control diet that contained SBM, SPC, and fish meal. Fish fed diets that contained 25–30 percent SBM in combination with 43–39 percent SPC had weight gain equivalent to fish fed the control diet with fish meal, while weight gain of fish fed other soy combinations was significantly less than that of the control group. Apparent crude protein digestibility of CGM was significantly higher than that of DDGS but not significantly different from CM. Apparent energy digestibility of DDGS was significantly lower than CGM but significantly higher than CM. Findings suggested that composition of the reference diet used in a digestibility trial affects the values of calculated ADCs, in addition to the chemical and physical attributes of the test ingredient. PMID:22536344
van Gastelen, S; Visker, M H P W; Edwards, J E; Antunes-Fernandes, E C; Hettinga, K A; Alferink, S J J; Hendriks, W H; Bovenhuis, H; Smidt, H; Dijkstra, J
2017-11-01
Complex interactions between rumen microbiota, cow genetics, and diet composition may exist. Therefore, the effect of linseed oil, DGAT1 K232A polymorphism (DGAT1), and the interaction between linseed oil and DGAT1 on CH 4 and H 2 emission, energy and N metabolism, lactation performance, ruminal fermentation, and rumen bacterial and archaeal composition was investigated. Twenty-four lactating Holstein-Friesian cows (i.e., 12 with DGAT1 KK genotype and 12 with DGAT1 AA genotype) were fed 2 diets in a crossover design: a control diet and a linseed oil diet (LSO) with a difference of 22 g/kg of dry matter (DM) in fat content between the 2 diets. Both diets consisted of 40% corn silage, 30% grass silage, and 30% concentrates (DM basis). Apparent digestibility, lactation performance, N and energy balance, and CH 4 emission were measured in climate respiration chambers, and rumen fluid samples were collected using the oral stomach tube technique. No linseed oil by DGAT1 interactions were observed for digestibility, milk production and composition, energy and N balance, CH 4 and H 2 emissions, and rumen volatile fatty acid concentrations. The DGAT1 KK genotype was associated with a lower proportion of polyunsaturated fatty acids in milk fat, and with a higher milk fat and protein content, and proportion of saturated fatty acids in milk fat compared with the DGAT1 AA genotype, whereas the fat- and protein-corrected milk yield was unaffected by DGAT1. Also, DGAT1 did not affect nutrient digestibility, CH 4 or H 2 emission, ruminal fermentation or ruminal archaeal and bacterial concentrations. Rumen bacterial and archaeal composition was also unaffected in terms of the whole community, whereas at the genus level the relative abundances of some bacterial genera were found to be affected by DGAT1. The DGAT1 KK genotype was associated with a lower metabolizability (i.e., ratio of metabolizable to gross energy intake), and with a tendency for a lower milk N efficiency compared with the DGAT1 AA genotype. The LSO diet tended to decrease CH 4 production (g/d) by 8%, and significantly decreased CH 4 yield (g/kg of DM intake) by 6% and CH 4 intensity (g/kg of fat- and protein-corrected milk) by 11%, but did not affect H 2 emission. The LSO diet also decreased ruminal acetate molar proportion, the acetate to propionate ratio, and the archaea to bacteria ratio, whereas ruminal propionate molar proportion and milk N efficiency increased. Ruminal bacterial and archaeal composition tended to be affected by diet in terms of the whole community, with several bacterial genera found to be significantly affected by diet. These results indicate that DGAT1 does not affect enteric CH 4 emission and production pathways, but that it does affect traits other than lactation characteristics, including metabolizability, N efficiency, and the relative abundance of Bifidobacterium. Additionally, linseed oil reduces CH 4 emission independent of DGAT1 and affects the rumen microbiota and its fermentative activity. The Authors. Published by the Federation of Animal Science Societies and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heinzig, M.; DeYong, G.D.; Anglin, R.J.
1993-12-01
The MetalTrace method, which consists of an anion-exchange separation coupled with a spectrophotometric quantification, was used to determine lead and cadmium in sulfuric acid-hydrogen peroxide digests of soils and sludges and hydrobromic acid extracts of soils. Cadmium only was determined in sulfuric acid-hydrogen peroxide digests of fertilizers because no standards were available with certified lead contents. The selectivity provided by the anion-exchange separation allowed the use of a spectrophotometric indicator with an extremely high extinction coefficient so that detection limits in the low parts per million range could be attained. The results obtained using this method compared favorably with thosemore » obtained using much more expensive methods requiring more specialized training and equipment.« less
Response of growing goslings to dietary supplementation with methionine and betaine.
Yang, Z; Wang, Z Y; Yang, H M; Zhao, F Z; Kong, L L
2016-12-01
An experiment with a 2 × 3 factorial design with two concentrations of dietary betaine (0 and 600 mg/kg) and three dietary concentrations of methionine (0, 600 and 1200 mg/kg) was conducted using goslings to estimate growth, nutrient utilisation and digestibility of amino acids from 21 to 70 d of age. Three hundred geese were randomised at 18 d of age into 6 groups with 5 replicates per treatment and 10 geese per replicate. Increasing dietary concentrations of methionine gave a linear increase in body weight and average daily gain. The coefficient of crude fat retention increased as dietary methionine increased and there was a significant non-linear response to increasing dietary methionine. Similarly, increasing supplemental methionine gave linear increases in the digestibility of methionine and cysteine. The results of this study indicated that optimal dietary supplementation of methionine could increase growth performance and methionine and cysteine utilisation in growing goslings. Betaine supplementation had no apparent sparing effect on methionine needs for growth performance, but did improve the apparent cysteine digestibility.
Improving methane production from anaerobic digestion of Pennisetum Hybrid by alkaline pretreatment.
Kang, Xihui; Sun, Yongming; Li, Lianhua; Kong, Xiaoying; Yuan, Zhenhong
2018-05-01
Alkaline pretreatment with NaOH was used to improve methane yield from Pennisetum Hybrid. The pretreatments were carried out with different NaOH solutions (2-8% w/w) at three temperatures (35, 55 and 121 °C) for different periods of time (24, 24 and 1 h). All treated and untreated Pennisetum Hybrid were digested under mesophilic conditions (37 °C) to biogas, significant effects of the pretreatments on the yield of methane were observed. Results showed the modified Gompertz equation was reliable (determination coefficients (R 2 ) greater than 0.96) to describe the kinetic behavior of anaerobic digestion of Pennisetum Hybrid. The best result, obtained by the treatment at 35 °C 2% NaOH for 24 h, resulted in the methane yield of 301.7 mL/g VS, corresponding to 21.0% improvement in the methane yield. Compositional, SEM, XRD and FTIR analysis confirmed that lignin removal, structural modification and cellulose crystalline variation were responsible for the improvement. Copyright © 2018 Elsevier Ltd. All rights reserved.
Choct, M; Hughes, R J; Trimble, R P; Angkanaporn, K; Annison, G
1995-03-01
The effect of a commercial glycanase product (Avizyme TX) on the performance of 4-wk-old broiler chickens fed wheats with low and normal apparent metabolizable energy values was studied. Controls were fed a corn-based diet. Supplementation with the enzyme product significantly (P < 0.01) increased the apparent metabolizable energy of the low metabolizable energy wheat from 12.02 to 14.94 MJ/kg dry matter. The apparent metabolizable energy value of the normal wheat was increased from 14.52 to 14.83 MJ/kg dry matter; this was, however, not significant. Birds fed the low metabolizable energy wheat diet had significantly (P < 0.01) higher digesta viscosity and lower small intestinal starch and protein digestibilities than birds fed the normal wheat diet. Chickens fed the low metabolizable energy wheat tended to grow less than those fed the normal wheat diet. When the low metabolizable energy wheat+enzyme diet was fed, digesta viscosity was significantly (P < 0.01) lower (20.28 vs. 10.36 mPa.s), and small intestinal digestibility coefficient of starch was significantly (P < 0.01) greater (0.584 vs. 0.861) relative to values in birds fed the low metabolizable energy wheat diet alone. Although the protein digestibility coefficient also increased from 0.689 to 0.745, the difference was not significant. Weight gain and feed efficiency of birds fed the low metabolizable energy wheat+enzyme equaled those of controls. The enzyme product significantly (P < 0.01) increased the solubilization of non-starch polysaccharides within the gastrointestinal tract of birds fed both types of wheat diets.(ABSTRACT TRUNCATED AT 250 WORDS)
Toxicokinetics, disposition and metabolism of fluoxetine in crabs.
Robert, Alexandrine; Schultz, Irvin R; Hucher, Nicolas; Monsinjon, Tiphaine; Knigge, Thomas
2017-11-01
The disposition and metabolism of fluoxetine in the European shore crab and the Dungeness crab were assessed. Crabs received intracardiac doses of either 0.13 μg/kg or 0.5 mg/kg fluoxetine, respectively. In addition, fluoxetine was administered to Metacarcinus cancer by oral gavage at 7.8 mg/kg. The distribution of fluoxetine was quantified in haemolymph and digestive gland for both crabs, as well as brain, muscle, and testis of Carcinus maenas, over 12 days. The metabolite norfluoxetine, was also measured in C. maenas. Fluoxetine was mainly found in lipid rich tissues. Distribution coefficients increased for digestive gland until three days after fluoxetine administration and then decreased until the end of the observations. The highest distribution coefficients were obtained for brain. Norfluoxetine displayed continuously high levels in digestive gland and brain. The strong decrease in fluoxetine and the concomitant increase in norfluoxetine demonstrates that decapod crustaceans metabolise fluoxetine into the more biologically active norfluoxetine. Fluoxetine levels in the haemolymph of M. cancer declined within 20 h, but showed a second peak 25 h later, suggesting remobilisation from tissues sequestering the compound. The steady state volume distribution and the total body clearance of fluoxetine were high, consistent with high diffusion of fluoxetine into the peripheral tissues and biotransformation as an important elimination pathway. Oral administration of fluoxetine prolonged its half-life in M. cancer, but bioavailability was low. These results confirm the high distribution into nervous tissue, extensive biotransformation into the highly active norfluoxetine and a half-life similar to that observed in vertebrates. Copyright © 2017 Elsevier Ltd. All rights reserved.
Arvaniti, Olga S; Andersen, Henrik R; Thomaidis, Nikolaos S; Stasinakis, Athanasios S
2014-09-01
The distribution coefficient (Kd) and the organic carbon distribution coefficient (KOC) were determined for four Perfluorinated Compounds (PFCs) to three different types of sludge taken from a conventional Sewage Treatment Plant (STP). Batch experiments were performed in six different environmental relevant concentrations (200ngL(-1)to 5μgL(-1)) containing 1gL(-1) sludge. Kd values ranged from 330 to 6015, 329 to 17432 and 162 to 11770Lkg(-1) for primary, secondary and digested sludge, respectively. The effects of solution's pH, ionic strength and cation types on PFCs sorption were also evaluated. Sorption capacities of PFCs significantly decreased with increased pH values from 6 to 8. Furthermore, the divalent cation (Ca(2+)) enhanced PFCs sorption to a higher degree in comparison with the monovalent cation (Na(+)) at the same ionic strength. The obtained Kd values were applied to estimate the sorbed fractions of each PFC in different stages of a typical STP and to calculate their removal through treated wastewater and sludge. In primary settling tank, the predicted sorbed fractions ranged from 3% for Perfluorooctanoic Acid (PFOA) to 55% for Perfluoroundecanoic acid (PFUdA), while in activated sludge tank and anaerobic digester sorption was more than 50% for all target compounds. Almost 86% of initial PFOA load is expected to be detected in treated wastewater; while Perfluorodecanoic acid (PFDA), PFUdA and Perfluorooctanesulfonate (PFOS) can be significantly removed (>49%) via sorption to primary and excess secondary sludge. In anaerobic digester, the major part (>76%) of target PFCs is expected to be sorbed to sludge, while almost 3% of initial PFOA load will be detected in sludge leachates. Copyright © 2014 Elsevier Ltd. All rights reserved.
Decomposing Racial/Ethnic Disparities in Influenza Vaccination among the Elderly
Yoo, Byung-Kwang; Hasebe, Takuya; Szilagyi, Peter G.
2015-01-01
While persistent racial/ethnic disparities in influenza vaccination have been reported among the elderly, characteristics contributing to disparities are poorly understood. This study aimed to assess characteristics associated with racial/ethnic disparities in influenza vaccination using a nonlinear Oaxaca-Blinder decomposition method. We performed cross-sectional multivariable logistic regression analyses for which the dependent variable was self-reported receipt of influenza vaccine during the 2010–2011 season among community dwelling non-Hispanic African-American (AA), non-Hispanic White (W), English-speaking Hispanic (EH) and Spanish-speaking Hispanic (SH) elderly, enrolled in the 2011 Medicare Current Beneficiary Survey (MCBS) (un-weighted/weighted N= 6,095/19.2million). Using the nonlinear Oaxaca-Blinder decomposition method, we assessed the relative contribution of seventeen covariates—including socio-demographic characteristics, health status, insurance, access, preference regarding healthcare, and geographic regions —to disparities in influenza vaccination. Unadjusted racial/ethnic disparities in influenza vaccination were 14.1 percentage points (pp) (W-AA disparity, p<.001), 25.7 pp (W-SH disparity, p<.001) and 0.6 pp (W-EH disparity, p>.8). The Oaxaca-Blinder decomposition method estimated that the unadjusted W-AA and W-SH disparities in vaccination could be reduced by only 45% even if AA and SH groups become equivalent to Whites in all covariates in multivariable regression models. The remaining 55% of disparities were attributed to (a) racial/ethnic differences in the estimated coefficients (e.g., odds ratios) in the regression models and (b) characteristics not included in the regression models. Our analysis found that only about 45% of racial/ethnic disparities in influenza vaccination among the elderly could be reduced by equalizing recognized characteristics among racial/ethnic groups. Future studies are needed to identify additional modifiable characteristics causing disparities in influenza vaccination. PMID:25900133
Jung, Keum Ji; Jang, Yangsoo; Oh, Dong Joo; Oh, Byung-Hee; Lee, Sang Hoon; Park, Seong-Wook; Seung, Ki-Bae; Kim, Hong-Kyu; Yun, Young Duk; Choi, Sung Hee; Sung, Jidong; Lee, Tae-Yong; Kim, Sung Hi; Koh, Sang Baek; Kim, Moon Chan; Chang Kim, Hyeon; Kimm, Heejin; Nam, Chungmo; Park, Sungha; Jee, Sun Ha
2015-09-01
To evaluate the performance of the American College of Cardiology/American Heart Association (ACC/AHA) 2013 Pooled Cohort Equations in the Korean Heart Study (KHS) population and to develop a Korean Risk Prediction Model (KRPM) for atherosclerotic cardiovascular disease (ASCVD) events. The KHS cohort included 200,010 Korean adults aged 40-79 years who were free from ASCVD at baseline. Discrimination, calibration, and recalibration of the ACC/AHA Equations in predicting 10-year ASCVD risk in the KHS cohort were evaluated. The KRPM was derived using Cox model coefficients, mean risk factor values, and mean incidences from the KHS cohort. In the discriminatory analysis, the ACC/AHA Equations' White and African-American (AA) models moderately distinguished cases from non-cases, and were similar to the KRPM: For men, the area under the receiver operating characteristic curve (AUROCs) were 0.727 (White model), 0.725 (AA model), and 0.741 (KRPM); for women, the corresponding AUROCs were 0.738, 0.739, and 0.745. Absolute 10-year ASCVD risk for men in the KHS cohort was overestimated by 56.5% (White model) and 74.1% (AA model), while the risk for women was underestimated by 27.9% (White model) and overestimated by 29.1% (AA model). Recalibration of the ACC/AHA Equations did not affect discriminatory ability but improved calibration substantially, especially in men in the White model. Of the three ASCVD risk prediction models, the KRPM showed best calibration. The ACC/AHA Equations should not be directly applied for ASCVD risk prediction in a Korean population. The KRPM showed best predictive ability for ASCVD risk. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Dalton, D. A.; Worthington, D. L.; Sherek, P. A.; Pedrazas, N. A.; Quevedo, H. J.; Bernstein, A. C.; Rambo, P.; Schwarz, J.; Edens, A.; Geissel, M.; Smith, I. C.; Taleff, E. M.; Ditmire, T.
2011-11-01
Experiments investigating fracture and resistance to plastic deformation at fast strain rates (>106 s-1) were performed via laser ablation on thin sheets of aluminum and aluminum alloys. Single crystal high purity aluminum (Al-HP) and a single crystal 1100 series aluminum alloy (AA1100) were prepared to investigate the role of impurity particles. Specimens of aluminum alloy +3 wt. % Mg (Al+3Mg) at three different grain sizes were also studied to determine the effect of grain size. In the present experiments, high purity aluminum (Al-HP) exhibited the highest spall strength over 1100 series aluminum alloy (AA1100) and Al+3Mg. Fracture characterization and particle analysis revealed that fracture was initiated in the presence of particles associated with impurity content in the AA1100 and at both grain boundaries and particles in Al+3Mg. The Al+3Mg specimens exhibited the greatest resistance to plastic deformation likely resulting from the presence of magnesium atoms. The Al-HP and AA1100, both lacking a strengthening element such as Mg, were found to have the same Hugoniot elastic limit (HEL) stress. Within the single crystal specimens, orientation effects on spall strength and HEL stress appear to be negligible. Although the fracture character shows a trend with grain size, no clear dependence of spall strength and HEL stress on grain size was measured for the Al+3Mg. Hydrodynamic simulations show how various strength and fracture models are insufficient to predict material behavior at fast strain rates, and a revised set of Tuler-Butcher coefficients for spall are proposed.
Grimminger, F; Wahn, H; Mayer, K; Kiss, L; Walmrath, D; Seeger, W
1997-02-01
Escherichia coli hemolysin (HlyA) is a proteinaceous pore-forming exotoxin that is implicated as a significant pathogenicity factor in extraintestinal E. coli infections including sepsis. In perfused rabbit lungs, subcytolytic concentrations of the toxin evoke thromboxane-mediated vasoconstriction and prostanoid-independent protracted vascular permeability increase (11). In the present study, the influence of submicromolar concentrations of free arachidonic acid (AA) and eicosapentaenoic acid (EPA) on the HlyA-induced leakage response was investigated. HlyA at concentration from 0.02 to 0.06 hemolytic units/ml provoked a dose-dependent, severalfold increase in the capillary filtration coefficient (Kfc), accompanied by the release of leukotriene(LT)B4, LTC4, and LTE4 into the recirculating buffer fluid. Simultaneous application of 100 nmol/L AA markedly augmented the HlyA-elicited leakage response, concomitant with an amplification of LTB4 release and a change in the kinetics of cysteinyl-LT generation. In contrast, 50 to 200 nmol/L EPA suppressed in a dose-dependent manner the HlyA-induced increase in Kfc values. This was accompanied by a blockage of 4-series LT generation and a dose-dependent appearance of LTB5, LTC5, and LTE5. In addition, EPA fully antagonized the AA-induced amplification of the HlyA-provoked Kfc increase, again accompanied by a shift from 4-series to 5-series LT generation. We conclude that the vascular leakage provoked by HlyA in rabbit lungs is differentially influenced by free AA versus free EPA, related to the generation of 4- versus 5-series leukotrienes. The composition of lipid emulsions used for parenteral nutrition may thus influence inflammatory capillary leakage.
She, Y; Sparks, J C; Stein, H H
2018-04-24
An experiment was conducted to test the hypothesis that inclusion of increasing concentrations of an Escherichia coli (E. coli) phytase to a corn-soybean meal (SBM) diet results in improved digestibility of DM, GE, CP, NDF, ADF, macro minerals, micro minerals, and AA. Twenty four growing barrows (initial BW: 37.0 ± 1.4 kg) were equipped with a T-cannula in the distal ileum and placed individually in metabolism crates, and allotted to a 2-period switch-back design with 6 diets and 4 replicate pigs per diet in each period. The positive control diet was a corn-SBM diet that contained limestone and dicalcium phosphate to meet the requirement for standardized total tract digestible (STTD) P and Ca (0.31% STTD P and 0.70% Ca). A negative control diet that was similar to the positive control diet with the exception that no dicalcium phosphate was used and formulated to contain 0.16% STTD P and 0.43% Ca. Four additional diets were formulated by adding 500, 1,000, 2,000, or 4,000 units of microbial phytase (FTU) to the negative control diet. Each period lasted 14 d. Fecal and urine samples were collected from the feed provided from d 6 to 11 of each period following 5 d of adaptation to the diets. Ileal digesta were collected for 8 h on d 13 and 14. Results indicated that addition of the E. coli phytase to the negative control diet tended to quadratically improve the apparent ileal digestibility (AID) of Phe (P = 0.086) and Asp (P = 0.054), and linearly increased (P < 0.05) the apparent total tract digestibility (ATTD) of ADF, K, and Fe. Microbial phytase also quadratically increased (P < 0.05) the ATTD of NDF and Mg, and linearly and quadratically increased (P < 0.05) the ATTD and retention of Ca and P. However, no effects of the phytase on ATTD of GE or the concentration of DE were observed. In conclusion, the increased absorption of several minerals including Ca, P, K, Mg, and Fe that was observed as increasing concentrations of an E. coli phytase were added to a corn-SBM meal diet indicates that the dietary provision of these minerals may be reduced if phytase is fed.
Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.; ...
2017-04-19
The nuclear modification factormore » $${R_{\\mathrm{AA}}} $$ and the azimuthal anisotropy coefficient $${v_{2}} $$ of prompt and nonprompt (i.e. those from decays of b hadrons) $$\\mathrm{J}/\\psi$$ mesons, measured from PbPb and pp collisions at $$\\sqrt{s_{\\mathrm{NN}}} = $$ 2.76 TeV at the LHC, are reported. The results are presented in several event centrality intervals and several kinematic regions, for transverse momenta $$p_{\\mathrm{T}} > $$ 6.5 GeV/$c$ and rapidity $$| {y} | < $$ 2.4, extending down to $$p_{\\mathrm{T}}= $$ 3 GeV/$c$ in the 1.6 $$ < |{y}| < $$ 2.4 range. The $${v_{2}} $$ of prompt $$\\mathrm{J}/\\psi$$ is found to be nonzero and constant over the full kinematic range studied, while the measured $${v_{2}} $$ of nonprompt $$\\mathrm{J}/\\psi$$ is consistent with zero. The $${R_{\\mathrm{AA}}} $$of prompt $$\\mathrm{J}/\\psi$$ exhibits a suppression that increases with centrality but does not vary as a function of either $y$ or $$p_{\\mathrm{T}}$$ in the fiducial range. The nonprompt $$\\mathrm{J}/\\psi {R_{\\mathrm{AA}}} $$ shows a suppression which becomes stronger as rapidity or $$ p_{\\mathrm{T}}$$ increase. Furthermore, the $${v_{2}} $$ and nuclear suppression of open and hidden charm, and of open charm and beauty, are compared.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khachatryan, V.; Sirunyan, A. M.; Tumasyan, A.
The nuclear modification factormore » $${R_{\\mathrm{AA}}} $$ and the azimuthal anisotropy coefficient $${v_{2}} $$ of prompt and nonprompt (i.e. those from decays of b hadrons) $$\\mathrm{J}/\\psi$$ mesons, measured from PbPb and pp collisions at $$\\sqrt{s_{\\mathrm{NN}}} = $$ 2.76 TeV at the LHC, are reported. The results are presented in several event centrality intervals and several kinematic regions, for transverse momenta $$p_{\\mathrm{T}} > $$ 6.5 GeV/$c$ and rapidity $$| {y} | < $$ 2.4, extending down to $$p_{\\mathrm{T}}= $$ 3 GeV/$c$ in the 1.6 $$ < |{y}| < $$ 2.4 range. The $${v_{2}} $$ of prompt $$\\mathrm{J}/\\psi$$ is found to be nonzero and constant over the full kinematic range studied, while the measured $${v_{2}} $$ of nonprompt $$\\mathrm{J}/\\psi$$ is consistent with zero. The $${R_{\\mathrm{AA}}} $$of prompt $$\\mathrm{J}/\\psi$$ exhibits a suppression that increases with centrality but does not vary as a function of either $y$ or $$p_{\\mathrm{T}}$$ in the fiducial range. The nonprompt $$\\mathrm{J}/\\psi {R_{\\mathrm{AA}}} $$ shows a suppression which becomes stronger as rapidity or $$ p_{\\mathrm{T}}$$ increase. Furthermore, the $${v_{2}} $$ and nuclear suppression of open and hidden charm, and of open charm and beauty, are compared.« less
Mathai, J K; Htoo, J K; Thomson, J E; Touchette, K J; Stein, H H
2016-10-01
Four experiments were conducted to determine effects of fiber on the ideal Thr:Lys ratio for 25- to 50-kg gilts. In Exp. 1, the objective was to determine the requirement for standardized ileal digestible Lys for gilts from 25 to 50 kg BW. Seventy gilts (24.54 ± 3.28 kg BW) were used in a growth assay with 2 pigs per pen, 5 diets, and 7 replicate pens per diet. The 5 diets were based on corn and soybean meal and contained between 0.80 and 1.32% SID Lys. Results indicated that 1.09% SID Lys was needed to optimize ADG and G:F. In Exp. 2, the objective was to determine the standardized ileal digestibility of AA in corn, soybean meal, field peas, fish meal, and soybean hulls. Six ileal-cannulated gilts (26.5 ± 0.74 kg BW) were allotted to a 6 × 6 Latin square design with 6 diets and 6 periods. Values for standardized ileal digestibility of AA were calculated for all ingredients. In Exp. 3, the objective was to determine the effect of fiber on the ideal SID Thr:Lys ratio for gilts from 25 to 50 kg BW. A total of 192 gilts (26.29 ± 4.64 kg BW) were used in a growth assay with 2 pigs per pen and 8 replicate pens per treatment. Six low-fiber diets and 6 high-fiber diets were formulated using the same batches of ingredients as in Exp. 2. Within each level of fiber, diets with SID Thr:Lys ratios ranging from 45:100 to 90:100 were formulated using the SID values calculated in Exp. 2. In both types of diets, ADG and G:F linearly and quadratically ( < 0.05) increased as the Thr:Lys ratio increased. Regression analysis estimated the ideal SID Thr:Lys ratio at 0.66 and 0.63 for ADG and G:F, respectively, for pigs fed low-fiber diets and at 0.71 and 0.63, respectively, for pigs fed high-fiber diets. In Exp. 4, the objective was to determine the N balance in pigs fed low-fiber or high-fiber diets that were formulated to have SID Thr:Lys ratios of 45:100 or 60:100. The 4 diets were formulated using the same batches of ingredients as in Exp. 2, and the SID values determined in Exp. 2 were used in diet formulations. Thirty-six gilts (29.0 ± 0.74 kg BW) were individually housed in metabolism crates with 9 replicate pigs per diet. Retention of N (% of intake) was greater (P < 0.05) for pigs fed the low-fiber diets compared with pigs fed the high-fiber diets regardless of the Thr:Lys ratio. Results of these experiments indicate that increased fiber levels in diets fed to growing gilts increase the requirement for Thr and that diets with higher fiber levels should be formulated to a greater SID Thr:Lys ratio.
75 FR 38537 - Alaska Native Claims Selection
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-02
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11960, AA-12011, AA-12010, AA-11963, AA-11974, AA-11999, AA-12019, AA-12000, AA-12001, AA-12002, AA-11975, AA-11998, AA-11997, AA-11976, AA-11966, AA-11965, AA-12009, AA-12007, AA-12008, AA-11955, AA-11953, AA-11954, AA-12006, AA-11945, AA...
75 FR 51098 - Alaska Native Claims Selection
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-18
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11956, AA-11991, AA-11992, AA-11983, AA-11990, AA-11962, AA-11946, AA-11947, AA-11964, AA-11951, AA-11989, AA-11952, AA-11959, AA-11988, AA-11948, AA-11949, AA-11980, AA-11985, AA-11950, AA-11986, AA-11981, AA-11982, AA-12004, AA-12005; LLAK...
The Shock and Vibration Digest. Volume 17. Number 5
1985-05-01
Prediction of these frequencies from acoustic source models remains open. Measurements have shown that the sound power radiated by a saw is proportional to...which appears to be metallurgically oriented, the chapter discusses experimental techniques, models of acoustic emission, and effects of mate...coefficient facili- tates calculation of A-weighted sound pres- sure levels in rooms. Thus, for modeling the acoustic field only one set of calcula
The Shock and Vibration Digest. Volume 16, Number 11
1984-11-01
wave [19], a secular equation for Rayleigh waves on ing, seismic risk, and related problems are discussed. the surface of an anisotropic half-space...waves in an !so- tive equation of an elastic-plastic rack medium was....... tropic linear elastic half-space with plane material used; the coefficient...pair of semi-linear hyperbolic partial differential -- " Conditions under which the equations of motion equations governing slow variations in amplitude
Greenaway, P; Raghaven, S
1998-01-01
Two species of herbivorous land crabs from Christmas Island, Cardisoma hirtipes and Gecarcoidea natalis, overlap in both diet and distribution. This study compared the dietary preferences and digestive capabilities of these two species on a diet of leaf litter to establish the digestive strategies each adopts and the likely degree of competition for food. C. hirtipes preferred green to yellow or brown leaves of Ficus macrophylla in short-term food-choice experiments. Brown leaves were least favoured. G. natalis showed no preference for the different leaf types and in the field ate chiefly brown and decomposing leaf litter. When fed green leaves, C. hirtipes had a low food intake (4.5+/-0.36 g kg-1 d-1) and a short retention time for food, and the readily digestible components of the diet constituted greater than 84% of the dry matter assimilated. When fed brown leaves, the intake was increased 3.3 times, but retention time remained short, and assimilation coefficients for all nutrients were low. The readily digestible fraction of the diet made the chief contribution to dry matter assimilation (69%), and hemicellulose (19%) and cellulose (21%) were also significantly used. This pattern of food intake and assimilation contrasts with that for G. natalis, which had a low intake of brown leaves and a longer retention time associated with higher nutrient assimilation, particularly of complex polysaccharides. It is suggested that through their feeding preferences and habits, these two sympatric species use opposite ends of the leaf litter quality spectrum on Christmas Island.
Burch, Tucker R.; Sadowsky, Michael J.; LaPara, Timothy M.
2012-01-01
Numerous initiatives have been undertaken to circumvent the problem of antibiotic resistance, including the development of new antibiotics, the use of narrow spectrum antibiotics, and the reduction of inappropriate antibiotic use. We propose an alternative but complimentary approach to reduce antibiotic resistant bacteria (ARB) by implementing more stringent technologies for treating municipal wastewater, which is known to contain large quantities of ARB and antibiotic resistance genes (ARGs). In this study, we investigated the ability of conventional aerobic digestion to reduce the quantity of ARGs in untreated wastewater solids. A bench-scale aerobic digester was fed untreated wastewater solids collected from a full-scale municipal wastewater treatment facility. The reactor was operated under semi-continuous flow conditions for more than 200 days at a residence time of approximately 40 days. During this time, the quantities of tet(A), tet(W), and erm(B) decreased by more than 90%. In contrast, intI1 did not decrease, and tet(X) increased in quantity by 5-fold. Following operation in semi-continuous flow mode, the aerobic digester was converted to batch mode to determine the first-order decay coefficients, with half-lives ranging from as short as 2.8 days for tet(W) to as long as 6.3 days for intI1. These results demonstrated that aerobic digestion can be used to reduce the quantity of ARGs in untreated wastewater solids, but that rates can vary substantially depending on the reactor design (i.e., batch vs. continuous-flow) and the specific ARG. PMID:23407455
Loyra-Tzab, Enrique; Sarmiento-Franco, Luis Armando; Sandoval-Castro, Carlos Alfredo; Santos-Ricalde, Ronald Herve
2013-07-01
The nutrient digestibility, nitrogen balance and in vivo metabolizable energy supply of Mucuna pruriens whole pods fed to growing Pelibuey lambs was investigated. Eight Pelibuey sheep housed in metabolic crates were fed increasing levels of Mucuna pruriens pods: 0 (control), 100 (Mucuna100), 200 (Mucuna200) and 300 (Mucuna300) g/kg dry matter. A quadratic (p<0.002) effect was observed for dry matter (DM), neutral detergent fibre (aNDF), nitrogen (N) and gross energy (GE) intakes with higher intakes in the Mucuna100 and Mucuna200 treatments. Increasing M. pruriens in the diets had no effect (p>0.05) on DM and GE apparent digestibility (p<0.05). A linear reduction in N digestibility and N retention was observed with increasing mucuna pod level. This effect was accompanied by a quadratic effect (p<0.05) on fecal-N and N-balance which were higher in the Mucuna100 and Mucuna200 treatments. Urine-N excretion, GE retention and dietary estimated nutrient supply (metabolizable protein and metabolizable energy) were not affected (p>0.05). DM, N and GE apparent digestibility coefficient of M. pruriens whole pods obtained through multiple regression equations were 0.692, 0.457, 0.654 respectively. In vivo DE and ME content of mucuna whole pod were estimated in 11.0 and 9.7 MJ/kg DM. It was concluded that whole pods from M. pruriens did not affect nutrient utilization when included in an mixed diet up to 200 g/kg DM. This is the first in vivo estimation of mucuna whole pod ME value for ruminants.
Burch, Tucker R; Sadowsky, Michael J; Lapara, Timothy M
2013-01-01
Numerous initiatives have been undertaken to circumvent the problem of antibiotic resistance, including the development of new antibiotics, the use of narrow spectrum antibiotics, and the reduction of inappropriate antibiotic use. We propose an alternative but complimentary approach to reduce antibiotic resistant bacteria (ARB) by implementing more stringent technologies for treating municipal wastewater, which is known to contain large quantities of ARB and antibiotic resistance genes (ARGs). In this study, we investigated the ability of conventional aerobic digestion to reduce the quantity of ARGs in untreated wastewater solids. A bench-scale aerobic digester was fed untreated wastewater solids collected from a full-scale municipal wastewater treatment facility. The reactor was operated under semi-continuous flow conditions for more than 200 days at a residence time of approximately 40 days. During this time, the quantities of tet(A), tet(W), and erm(B) decreased by more than 90%. In contrast, intI1 did not decrease, and tet(X) increased in quantity by 5-fold. Following operation in semi-continuous flow mode, the aerobic digester was converted to batch mode to determine the first-order decay coefficients, with half-lives ranging from as short as 2.8 days for tet(W) to as long as 6.3 days for intI1. These results demonstrated that aerobic digestion can be used to reduce the quantity of ARGs in untreated wastewater solids, but that rates can vary substantially depending on the reactor design (i.e., batch vs. continuous-flow) and the specific ARG.
Why are they missing? : Bioinformatics characterization of missing human proteins.
Elguoshy, Amr; Magdeldin, Sameh; Xu, Bo; Hirao, Yoshitoshi; Zhang, Ying; Kinoshita, Naohiko; Takisawa, Yusuke; Nameta, Masaaki; Yamamoto, Keiko; El-Refy, Ali; El-Fiky, Fawzy; Yamamoto, Tadashi
2016-10-21
NeXtProt is a web-based protein knowledge platform that supports research on human proteins. NeXtProt (release 2015-04-28) lists 20,060 proteins, among them, 3373 canonical proteins (16.8%) lack credible experimental evidence at protein level (PE2:PE5). Therefore, they are considered as "missing proteins". A comprehensive bioinformatic workflow has been proposed to analyze these "missing" proteins. The aims of current study were to analyze physicochemical properties, existence and distribution of the tryptic cleavage sites, and to pinpoint the signature peptides of the missing proteins. Our findings showed that 23.7% of missing proteins were hydrophobic proteins possessing transmembrane domains (TMD). Also, forty missing entries generate tryptic peptides were either out of mass detection range (>30aa) or mapped to different proteins (<9aa). Additionally, 21% of missing entries didn't generate any unique tryptic peptides. In silico endopeptidase combination strategy increased the possibility of missing proteins identification. Coherently, using both mature protein database and signal peptidome database could be a promising option to identify some missing proteins by targeting their unique N-terminal tryptic peptide from mature protein database and or C-terminus tryptic peptide from signal peptidome database. In conclusion, Identification of missing protein requires additional consideration during sample preparation, extraction, digestion and data analysis to increase its incidence of identification. Copyright © 2016. Published by Elsevier B.V.
Kane, J.S.; Evans, J.R.; Jackson, J.C.
1989-01-01
Accurate and precise determinations of tin in geological materials are needed for fundamental studies of tin geochemistry, and for tin prospecting purposes. Achieving the required accuracy is difficult because of the different matrices in which Sn can occur (i.e. sulfides, silicates and cassiterite), and because of the variability of literature values for Sn concentrations in geochemical reference materials. We have evaluated three methods for the analysis of samples for Sn concentration: graphite furnace atomic absorption spectrometry (HGA-AAS) following iodide extraction, inductively coupled plasma atomic emission spectrometry (ICP-OES), and energy-dispersive X-ray fluorescence (EDXRF) spectrometry. Two of these methods (HGA-AAS and ICP-OES) required sample decomposition either by acid digestion or fusion, while the third (EDXRF) was performed directly on the powdered sample. Analytical details of all three methods, their potential errors, and the steps necessary to correct these errors were investigated. Results showed that similar accuracy was achieved from all methods for unmineralized samples, which contain no known Sn-bearing phase. For mineralized samples, which contain Sn-bearing minerals, either cassiterite or stannous sulfides, only EDXRF and fusion ICP-OES methods provided acceptable accuracy. This summary of our study provides information which helps to assure correct interpretation of data bases for underlying geochemical processes, regardless of method of data collection and its inherent limitations. ?? 1989.
Unique Genomic Alterations in Prostate Cancers in African American Men
2015-12-01
with MNX1 mRNA in AA PCa by Pearson Product Moment. Correlation coefficient and p-value are shown. 13 Subtask 6: Validation of key gene...1 SF 298……………………………………………………………………………..……2 Table of Contents…………………………………………………………..…….... 3 Introduction ...
Anwar, M N; Ravindran, V; Morel, P C H; Ravindran, G; Cowieson, A J
2016-01-01
The objective of the study that is presented herein was to determine the true ileal calcium (Ca) digestibility in meat and bone meal (MBM) for broiler chickens using the direct method. Four MBM samples (coded as MBM-1, MBM-2, MBM-3 and MBM-4) were obtained and analyzed for nutrient composition, particle size distribution and bone to soft tissue ratio. The Ca concentrations of MBM-1, MBM-2, MBM-3 and MBM-4 were determined to be 71, 118, 114 and 81 g/kg, respectively. The corresponding geometric mean particle diameters and bone to soft tissue ratios were 0.866, 0.622, 0.875 and 0.781 mm, and 1:1.49, 1:0.98, 1:0.92 and 1:1.35, respectively. Five experimental diets, including four diets with similar Ca concentration (8.3 g/kg) from each MBM and a Ca and phosphorus-free diet, were developed. Meat and bone meal served as the sole source of Ca in the MBM diets. Titanium dioxide (3 g/kg) was incorporated in all diets as an indigestible marker. Each experimental diet was randomly allotted to six replicate cages (eight birds per cage) and offered from d 28 to 31 post-hatch. Apparent ileal Ca digestibility was calculated by the indicator method and corrected for ileal endogenous Ca losses to determine the true ileal Ca digestibility. Ileal endogenous Ca losses were determined to be 88 mg/kg dry matter intake. True ileal Ca digestibility coefficients of MBM-1, MBM-2, MBM-3 and MBM-4 were determined to be 0.560, 0.446, 0.517 and 0.413, respectively. True Ca digestibility of MBM-1 was higher (P < 0.05) than MBM-2 and MBM-4 but similar (P > 0.05) to that of MBM-3. True Ca digestibility of MBM-2 was similar (P > 0.05) to MBM-3 and MBM-4, while that of MBM-3 was higher (P < 0.05) than MBM-4. These results demonstrated that the direct method can be used for the determination of true Ca digestibility in feed ingredients and that Ca in MBM is not highly available as often assumed. The variability in true Ca digestibility of MBM samples could not be attributed to Ca content, percentage bones or particle size. © 2015 Poultry Science Association Inc.
Greiling, Alexander Michael; Schwarz, Christiane; Gierus, Martin; Rodehutscord, Markus
2018-06-01
The objectives of this study were to investigate the digestibility of pumpkin seed cake (PSC) for the rainbow trout, Oncorhynchus mykiss (Walbaum, 1792), and effects on performance and product quality traits of four different fish species when PSC partially replaced fishmeal in extruded diets. A digestibility trial was carried out to determine apparent digestibility coefficients (ADC) for crude protein (CP), ether extract (EE) and gross energy (GE) of PSC fed to rainbow trout. In subsequent growth trials, effects on performance and morphological traits and fillet colour values of four different fish species [rainbow trout; brook trout, Salvelinus fontinalis (Mitchill, 1814); African sharptooth catfish, Clarias gariepinus (Burchell, 1822); and wels catfish, Silurus glanis (Linnaeus, 1758)] were evaluated when 60% of fishmeal protein of a reference diet was replaced by PSC protein (based on digestible CP). Nutrient ADC of PSC were high (CP: 89%, EE: 88% and GE: 84%). No significant effects on growth and only minor effects on fillet colour were detected in the trials. However, replacing fishmeal with PSC at the chosen level affected morphological traits and feed conversion in all four species to different extents. Replacement effects of PSC should be tested at lower levels of inclusion before conclusions are drawn on its suitability in fish diets.
Kumar, Abhinav; Gangadharan, Bevin; Cobbold, Jeremy; Thursz, Mark; Zitzmann, Nicole
2017-09-21
LC-MS and immunoassay can detect protein biomarkers. Immunoassays are more commonly used but can potentially be outperformed by LC-MS. These techniques have limitations including the necessity to generate separate calibration curves for each biomarker. We present a rapid mass spectrometry-based assay utilising a universal calibration curve. For the first time we analyse clinical samples using the HeavyPeptide IGNIS kit which establishes a 6-point calibration curve and determines the biomarker concentration in a single LC-MS acquisition. IGNIS was tested using apolipoprotein F (APO-F), a potential biomarker for non-alcoholic fatty liver disease (NAFLD). Human serum and IGNIS prime peptides were digested and the IGNIS assay was used to quantify APO-F in clinical samples. Digestion of IGNIS prime peptides was optimised using trypsin and SMART Digest™. IGNIS was 9 times faster than the conventional LC-MS method for determining the concentration of APO-F in serum. APO-F decreased across NAFLD stages. Inter/intra-day variation and stability post sample preparation for one of the peptides was ≤13% coefficient of variation (CV). SMART Digest™ enabled complete digestion in 30 minutes compared to 24 hours using in-solution trypsin digestion. We have optimised the IGNIS kit to quantify APO-F as a NAFLD biomarker in serum using a single LC-MS acquisition.
Martín, J; Camacho-Muñoz, D; Santos, J L; Aparicio, I; Alonso, E
2012-11-15
The occurrence of sixteen pharmaceutically active compounds in influent and effluent wastewater and in primary, secondary and digested sludge in one-year period has been evaluated. Solid-water partition coefficients (Kd) were calculated to evaluate the efficiency of removal of these compounds from wastewater by sorption onto sludge. The ecotoxicological risk to aquatic and terrestrial ecosystems, due to wastewater discharges to the receiving streams and to the application of digested sludge as fertilizer onto soils, was also evaluated. Twelve of the pharmaceuticals were detected in wastewater at mean concentrations from 0.1 to 32 μg/L. All the compounds found in wastewater were also found in sewage sludge, except diclofenac, at mean concentrations from 8.1 to 2206 μg/kg dm. Ibuprofen, salicylic acid, gemfibrozil and caffeine were the compounds at the highest concentrations. LogKd values were between 1.17 (naproxen) and 3.48 (carbamazepine). The highest ecotoxicological risk in effluent wastewater and digested sludge is due to ibuprofen (risk quotient (RQ): 3.2 and 4.4, respectively), 17α-ethinylestradiol (RQ: 12 and 22, respectively) and 17β-estradiol (RQ: 12 and 359, respectively). Ecotoxicological risk after wastewater discharge and sludge disposal is limited to the presence of 17β-estradiol in digested-sludge amended soil (RQ: 2.7). Copyright © 2012 Elsevier B.V. All rights reserved.
75 FR 26784 - Alaska Native Claims Selection
Federal Register 2010, 2011, 2012, 2013, 2014
2010-05-12
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11973, AA-11993, AA-11968, AA-11972, AA-12018, AA-12013, AA-12014, AA-12015, AA-12016, AA-12017, AA-11984, AA-11994, AA-11995, AA-11996, AA-12003, AA-12012, AA-11967, AA-12020, AA-12021; LLAK-962000- L14100000-HY0000-P] Alaska Native Claims...
Colomina, Jose M; Cavallé-Busquets, Pere; Fernàndez-Roig, Sílvia; Solé-Navais, Pol; Fernandez-Ballart, Joan D; Ballesteros, Mónica; Ueland, Per M; Meyer, Klaus; Murphy, Michelle M
2016-10-09
The effect of the betaine: homocysteine methyltransferase BHMT c.716G>A (G: guanosine; A: adenosine) single nucleotide polymorphism (SNP) on the BHMT pathway is unknown during pregnancy. We hypothesised that it impairs betaine to dimethylglycine conversion and that folate status modifies its effect. We studied 612 women from the Reus Tarragona Birth Cohort from ≤12 gestational weeks (GW) throughout pregnancy. The frequency of the variant BHMT c.716A allele was 30.8% (95% confidence interval (CI): 28.3, 33.5). In participants with normal-high plasma folate status (>13.4 nmol/L), least square geometric mean [95% CI] plasma dimethylglycine (pDMG, µmol/L) was lower in the GA (2.35 [2.23, 2.47]) versus GG (2.58 [2.46, 2.70]) genotype at ≤12 GW ( p < 0.05) and in the GA (2.08 [1.97, 2.19]) and AA (1.94 [1.75, 2.16]) versus GG (2.29 [2.18, 2.40]) genotypes at 15 GW ( p < 0.05). No differences in pDMG between genotypes were observed in participants with possible folate deficiency (≤13.4 nmol/L) ( p for interactions at ≤12 GW: 0.023 and 15 GW: 0.038). PDMG was lower in participants with the AA versus GG genotype at 34 GW (2.01 [1.79, 2.25] versus 2.44 [2.16, 2.76] and at labour, 2.51 [2.39, 2.64] versus 3.00 [2.84, 3.18], ( p < 0.01)). Possible deficiency compared to normal-high folate status was associated with higher pDMG in multiple linear regression analysis (β coefficients [SEM] ranging from 0.07 [0.04], p < 0.05 to 0.20 [0.04], p < 0.001 in models from early and mid-late pregnancy) and the AA compared to GG genotype was associated with lower pDMG (β coefficients [SEM] ranging from -0.11 [0.06], p = 0.055 to -0.23 [0.06], p < 0.001). During pregnancy, the BHMT pathway is affected by folate status and by the variant BHMT c.716A allele.
An insight into the sialotranscriptome of the seed-feeding bug, Oncopeltus fasciatus.
Francischetti, Ivo M B; Lopes, Angela H; Dias, Felipe A; Pham, Van M; Ribeiro, José M C
2007-09-01
The salivary transcriptome of the seed-feeding hemipteran, Oncopeltus fasciatus (milkweed bug), is described following assembly of 1025 expressed sequence tags (ESTs) into 305 clusters of related sequences. Inspection of these sequences reveals abundance of low complexity, putative secreted products rich in the amino acids (aa) glycine, serine or threonine, which might function as silk or mucins and assist food canal lubrication and sealing of the feeding site around the mouthparts. Several protease inhibitors were found, including abundant expression of cystatin transcripts that may inhibit cysteine proteases common in seeds that might injure the insect or induce plant apoptosis. Serine proteases and lipases are described that might assist digestion and liquefaction of seed proteins and oils. Finally, several novel putative proteins are described with no known function that might affect plant physiology or act as antimicrobials.
Nakadi, Flávio V; Prodanov, Caroline; Boschetti, Wiliam; Vale, Maria Goreti R; Welz, Bernhard; de Andrade, Jailson B
2018-03-01
Thermochemical processes can convert the biomass into fuels, such as bio-oil. The biomass submitted to pyrolysis process, such as fibers, are generally rich in silicon, an element that can lead to damages in an engine when there is high concentration in a fuel. High-resolution continuum source atomic absorption spectrometry (HR-CS AAS) is an interesting alternative for Si determination in the products and byproducts of the pyrolysis process because, besides the flame (F) and graphite furnace (GF) atomizers, it has enhanced the application of direct analysis of solid samples (SS) within GF. This study aimed the development of methods to determine Si in biomass samples, their products and byproducts using HR-CS AAS. A high-resolution continuum source atomic absorption spectrometer contrAA 700 equipped with F and GF atomizers was used throughout the study. HR-CS F AAS (λ = 251.611nm, 1 detection pixel, N 2 O/C 2 H 2 flame) was used to evaluate Si content in biomass and ash, after a microwave-assisted acid digestion with HNO 3 and HF. HR-CS GF AAS (T pyr = 1400°C, T atom = 2650°C) has evaluated Si in pyrolysis water and bio-oil at 251.611nm, and in peach pit biomass and ash at 221.174nm using SS, both wavelengths with 1 detection pixel. Rhodium (300μg) was applied as permanent modifier and 10μgPd + 6μg Mg were pipetted onto the standards/samples at each analysis. Three different biomass samples were studied: palm tree fiber, coconut fiber and peach pit, and three certified reference materials (CRM) were used to verify the accuracy of the methods. The figures of merit were LOD 0.09-20mgkg -1 , and LOQ 0.3-20mgkg -1 , considering all the methods. There were no significant differences between the CRM certified values and the determined ones, using a Student t-test with a confidence interval of 95% (n = 5). Si concentration ranged from 0.11-0.92% mm -1 , 1.1-1.7mgkg -1 , 3.3-13mgkg -1 , and 0.41-1.4%mm -1 , in biomass, bio-oil, pyrolysis water and ash, respectively. Si remained mostly in the ash, leading to a mass fraction of up to 103%, even when the Si loss is not considered. Silicon concentration in bio-oil was below 1.7mgkg -1 , which is suitable for its application as a fuel. The developed methods using HR-CS AAS are suitable for Si determination in biomass, bio-oil, pyrolysis water, and ash. The application of bio-oil as an alternative fuel would be possible evaluating its Si content due to its low levels. The mass balance for Si has proved to be an important tool in order to evaluate the correct disposal of pyrolysis process byproducts. Copyright © 2017 Elsevier B.V. All rights reserved.
Schmidely, P; Glasser, F; Doreau, M; Sauvant, D
2008-05-01
A database built from 95 experiments with 303 treatments was used to quantify the ruminal biohydrogenation (BH) of fatty acids (FA), efficiency of microbial protein synthesis (EMPS), duodenal flow and intestinal absorption of total FA and of FA with 12 to 18 C units, in response to variations in dietary FA content, source or technological treatment of fat supplement. Flows of FA were expressed relative to dry matter intake (DMI) to compile data from bovine and ovine species. BH tended to increase curvilinearly with FA intake, whereas dietary FA did not affect EMPS. A linear relationship between FA intake and duodenal flow of total FA was obtained, with a coefficient of 0.75 ± 0.06 g duodenal FA/kg DMI for each g FA intake/kg DMI. Between experiments, positive balances of total FA (intake - duodenum) were related to low EMPS. Relationships between duodenal flows of FA with 12 to 18 C units and their respective intakes were linear, with a coefficient that increased with the number of C units. Duodenal flow of bacterial FA was linearly related to FA intake (coefficient 0.33 ± 0.13), whereas contribution of bacterial lipid to duodenal flow decreased as FA intake increased. For each FA with 12 to 16 C units, prediction of FA absorption from its respective duodenal flow was linear. For total FA and FA with 18 C units, apparent absorption levelled off at high duodenal flows. All these relationships were discussed according to current knowledge on microbial metabolism in the rumen and on the intestinal digestibility of FA in the intestine.
NASA Astrophysics Data System (ADS)
Grein, C. H.; John, Sajeev
1989-01-01
The optical absorption coefficient for subgap electronic transitions in crystalline and disordered semiconductors is calculated by first-principles means with use of a variational principle based on the Feynman path-integral representation of the transition amplitude. This incorporates the synergetic interplay of static disorder and the nonadiabatic quantum dynamics of the coupled electron-phonon system. Over photon-energy ranges of experimental interest, this method predicts accurate linear exponential Urbach behavior of the absorption coefficient. At finite temperatures the nonlinear electron-phonon interaction gives rise to multiple phonon emission and absorption sidebands which accompany the optically induced electronic transition. These sidebands dominate the absorption in the Urbach regime and account for the temperature dependence of the Urbach slope and energy gap. The physical picture which emerges is that the phonons absorbed from the heat bath are then reemitted into a dynamical polaronlike potential well which localizes the electron. At zero temperature we recover the usual polaron theory. At high temperatures the calculated tail is qualitatively similar to that of a static Gaussian random potential. This leads to a linear relationship between the Urbach slope and the downshift of the extrapolated continuum band edge as well as a temperature-independent Urbach focus. At very low temperatures, deviations from these rules are predicted arising from the true quantum dynamics of the lattice. Excellent agreement is found with experimental data on c-Si, a-Si:H, a-As2Se3, and a-As2S3. Results are compared with a simple physical argument based on the most-probable-potential-well method.
Identification of phosphorylation sites in the nucleocapsid protein (N protein) of SARS-coronavirus
NASA Astrophysics Data System (ADS)
Lin, Liang; Shao, Jianmin; Sun, Maomao; Liu, Jinxiu; Xu, Gongjin; Zhang, Xumin; Xu, Ningzhi; Wang, Rong; Liu, Siqi
2007-12-01
After decoding the genome of SARS-coronavirus (SARS-CoV), next challenge is to understand how this virus causes the illness at molecular bases. Of the viral structural proteins, the N protein plays a pivot role in assembly process of viral particles as well as viral replication and transcription. The SARS-CoV N proteins expressed in the eukaryotes, such as yeast and HEK293 cells, appeared in the multiple spots on two-dimensional electrophoresis (2DE), whereas the proteins expressed in E. coli showed a single 2DE spotE These 2DE spots were further examined by Western blot and MALDI-TOF/TOF MS, and identified as the N proteins with differently apparent pI values and similar molecular mass of 50 kDa. In the light of the observations and other evidences, a hypothesis was postulated that the SARS-CoV N protein could be phosphorylated in eukaryotes. To locate the plausible regions of phosphorylation in the N protein, two truncated N proteins were generated in E. coli and treated with PKC[alpha]. The two truncated N proteins after incubation of PKC[alpha] exhibited the differently electrophoretic behaviors on 2DE, suggesting that the region of 1-256 aa in the N protein was the possible target for PKC[alpha] phosphorylation. Moreover, the SARS-CoV N protein expressed in yeast were partially digested with trypsin and carefully analyzed by MALDI-TOF/TOF MS. In contrast to the completely tryptic digestion, these partially digested fragments generated two new peptide mass signals with neutral loss, and MS/MS analysis revealed two phosphorylated peptides located at the "dense serine" island in the N protein with amino acid sequences, GFYAEGSRGGSQASSRSSSR and GNSGNSTPGSSRGNSPARMASGGGK. With the PKC[alpha] phosphorylation treatment and the partially tryptic digestion, the N protein expressed in E. coli released the same peptides as observed in yeast cells. Thus, this investigation provided the preliminary data to determine the phosphorylation sites in the SARS-CoV N protein, and partially clarified the argument regarding the phosphorylation possibility of the N protein during the infection process of SARS-CoV to human host.
[Determination of 27 elements in Maca nationality's medicine by microwave digestion ICP-MS].
Yu, Gui-fang; Zhong, Hai-jie; Hu, Jun-hua; Wang, Jing; Huang, Wen-zhe; Wang, Zhen-zhong; Xiao, Wei
2015-12-01
An analysis method has been established to test 27 elements (Li, Be, B, Mg, Al, Sc, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, As, Sr, Mo, Cd, Sn, Sb, Ba, La, Hg, Pb, Bi) in Maca nationality's medicine with microwave digestion-ICP-MS. Sample solutions were analyzed by ICP-MS after microwave digestion, and the contents of elements were calculated according to their calibration curves, and internal standard method was adopted to reduce matrix effect and other interference effects. The experimental results showed that the linear relations of all the elements were very good; the correlation coefficient (r) was 0.9994-1.0000 (Hg was 0.9982) ; the limits of detection were 0.003-2.662 microg x L(-1); the relative standard deviations for all elements of reproducibility were lower than 5% (except the individual elements); the recovery rate were 78.5%-123.7% with RSD lower than 5% ( except the individual elements). The analytical results of standard material showed acceptable agreement with the certified values. This method was applicable to determinate the contents of multi-elements in Maca which had a high sensitivity, good specificity and good repeatability, and provide basis for the quality control of Maca.
Dickerson, Jane A.; Dovichi, Norman J.
2011-01-01
We perform two-dimensional capillary electrophoresis on fluorescently labeled proteins and peptides. Capillary sieving electrophoresis was performed in the first dimension and micellar electrokinetic capillary chromatography was performed in the second. A cellular homogenate was labeled with the fluorogenic reagent FQ and separated using the system. This homogenate generated a pair of ridges; the first had essentially constant migration time in the CSE dimension, while the second had essentially constant migration time in the MEKC dimension. In addition a few spots were scattered through the electropherogram. The same homogenate was digested using trypsin, and then labeled and subjected to the two dimensional separation. In this case, the two ridges observed from the original two-dimensional separation disappeared, and were replaced by a set of spots that fell along the diagonal. Those spots were identified using a local-maximum algorithm and each was fit using a two-dimensional Gaussian surface by an unsupervised nonlinear least squares regression algorithm. The migration times of the tryptic digest components were highly correlated (r = 0.862). When the slowest migrating components were eliminated from the analysis, the correlation coefficient improved to r = 0.956. PMID:20564272
Parera, N; Lázaro, R P; Serrano, M P; Valencia, D G; Mateos, G G
2010-02-01
An experiment was conducted to compare different dietary vegetable sources of starch and protein on the coefficient of apparent total tract digestibility (CATTD) of energy and nutrients and performance of piglets from 29 to 60 d of age. The experiment was completely randomized with 6 treatments arranged factorially with 3 sources of starch (cooked-flaked corn, cooked-flaked rice, and pea starch) and 2 sources of protein [soy protein concentrate (SPC) and pea protein concentrate (PPC)]. The pea starch and the PPC used were obtained by dehulling and grinding pea seeds to a mean particle size of 30 microm. Each treatment was replicated 6 times (6 pigs per pen). For the entire experiment, piglets fed cooked rice had greater ADG than piglets fed pea starch with piglets fed cooked corn being intermediate (471, 403, and 430 g/d, respectively; P < 0.05). Protein source did not have any effect on piglet performance. The CATTD of DM, OM, and GE were greater (P < 0.05) for diets based on cooked rice than diets based on cooked corn with diets based on pea starch being intermediate. Crude protein digestibility was not affected by source of starch but was greater for the diets based on SPC than for diets based on PPC (0.836 vs. 0.821; P < 0.01). Protein source did not affect the digestibility of any of the other dietary components. It is concluded that cooked rice is an energy source of choice in diets for young pigs. The inclusion of PPC in the diet reduced protein digestibility but had no effects on energy digestibility or piglet performance. Therefore, the finely ground starch and protein fractions of peas can be used in substitution of cooked corn or SPC, respectively, in diets for young pigs.
Ngoc, T T B; Len, N T; Lindberg, J E
2013-05-01
The impact of fibre level and fibre source on digestibility, gastrointestinal tract (GIT) development, total tract mean retention time (MRT) and growth performance was studied in indigenous Mong Cai (MC) and exotic Landrace × Yorkshire (LY) pigs. The diets were based on maize, rice bran, soyabean meal, fish meal and soyabean oil, and cassava residue (CR) or brewer's grain (BG) as fibrous ingredient sources in the high-fibre diets (HF) and were fed ad libitum. A low-fibre diet (LF), containing around 200 g NDF/kg dry matter (DM), was formulated without CR and BG as feed ingredients. The HF diets (HF-CR and HF-BG) were formulated to contain around 270 g NDF/kg DM. The experiment was arranged as a 2 × 3 factorial completely randomized design with six replications, and lasted 27 days. Increased dietary fibre level resulted in a reduction (P < 0.05) in average daily gain, digestibility of organic matter (OM), CP and gross energy (GE) at the ileum and in the total tract, and in MRT, and an increase (P < 0.05) in the feed conversion ratio and in the weight of the GIT (except for small intestine and caecum). The coefficients of total tract digestibility of fibre fractions were higher in HF diets than in the LF diet, with highest values for diet HF-CR, which had a high proportion of soluble non-starch polysaccharides. MC pigs had longer MRT of digesta than LY pigs (P < 0.05), resulting in higher digestibility at the ileum and in the total tract. Across diets and breeds, the total tract apparent digestibility of OM, CP and GE was positively related (R 2 = 0.80 to 0.84) to the MRT of solids, whereas the MRT was negatively related to the DM intake (R 2 = 0.60).
Guevara, M A; Bauer, L L; Garleb, K A; Fahey, G C; de Godoy, M R C
2015-05-01
The objectives were to quantify gastrointestinal tolerance, total tract nutrient digestibility, and serum lipid profiles of dogs as affected by α-cyclodextrin (ACD) supplementation and to validate the accuracy of fat analyses techniques using novel ACD-fat complexes. The ACD was hydrolyzed and free sugars and hydrolyzed monosaccharides were quantified using high performance liquid chromatography. Known amount of fats were complexed with ACD, and fat content of complexes were determined using the ether extraction and acid-hydrolyzed fat methods. Nine mixed-breed hounds were used in a crossover design with 3 periods of 10 d each, including 6 d for diet adaptation and 4 d for fecal collection. Dogs were fed twice daily a diet with poultry byproduct meal and brewer's rice as the main ingredients, and chromic oxide (0.2%) was included as a digestion marker. Dogs were supplemented with either 0, 3, or 6 g of ACD diluted in 15 mL of water twice per day for a total of 0, 6, and 12 g ACD per day. The ACD had a very low free sugar concentration and, once hydrolyzed, released only glucose, as expected. Average daily food intake, fecal output (DM basis), and fecal scores were not significantly different among treatments. Body weight and condition score and serum triglycerides and cholesterol concentrations remained unaltered throughout the duration of the experiment. Dry matter, OM, and fat digestibility coefficients were lower (P < 0.05) for both treatment groups compared to the control. The acid-hydrolyzed fat method was valid to measure fat that was bound to ACD. Intake of ACD lowered fat digestibility somewhat but not to the extent previously reported, without affecting serum lipid concentrations or outcomes related to tolerance. Therefore, ACD supplementation resulted in a small decrease in fat digestibility, but ACD supplementation might have potential in modifying serum lipid profiles.
Effects of different lipid sources on intake, digestibility and purine derivatives in hair lambs.
Pereira, E S; Pereira, M W F; Arruda, P C L; Cabral, L S; Oliveira, R L; Mizubuti, I Y; Pinto, A P; Campos, A C N; Gadelha, C R F; Carneiro, M S S
2016-08-01
An experiment was conducted to evaluate the effects of different lipid sources on the nutrient intake, digestibility and purine derivative excretion of lambs. Thirty-five 60-day-old, male, non-castrated Santa Ines lambs with an initial average body weight (BW) of 13.00 ± 1.80 kg were used in a randomized complete block design with seven blocks and five treatments. The experimental treatments consisted of a control diet without supplemental lipids and four test diets with different lipid supplements, selected according to the degree of ruminal protection from hydrogenation: supplementation, being supplementation with whole cottonseed (WC), supplementation with cashew nut meal (CNM), supplementation with both cottonseed and cashew nut meal (WC-CNM) and supplementation with calcium salts of long-chain fatty acids (Ca-LCFA). The lambs were slaughtered after reaching 28 kg average BW for each treatment. The ether extract intake (EEI) was higher (p < 0.01) for the lipid supplemented compared to control diet lambs. Supplementation with WC decreased the digestibility of dry matter (DM), organic matter (OM), neutral detergent fibre (NDF) and total carbohydrate (TC) (p < 0.01), whereas supplementation with CNM, WC-CNM and Ca-LCFA reduced non-fibrous carbohydrate (NFC) digestibility (p < 0.01). The ether extract (EE) digestibility coefficient was higher with CNM, followed by Ca-LCFA and WC, when compared to WC-CNM and control diets. Nitrogen balance (NB) was not influenced (p > 0.05) by the different lipid sources. A lower purine derivative (PD) excretion and thus lower microbial protein supply (MPS) was observed for animals supplemented with Ca-LCFA (p < 0.01) compared to the WC-CNM and control diets. In conclusion, WC, CNM and WC-CNM supplementation did not have negative effects on MPS, although negative effects have been observed on nutrient digestibility. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.
Linear models for calculating digestibile energy for sheep diets.
Fonnesbeck, P V; Christiansen, M L; Harris, L E
1981-05-01
Equations for estimating the digestible energy (DE) content of sheep diets were generated from the chemical contents and a factorial description of diets fed to lambs in digestion trials. The diet factors were two forages (alfalfa and grass hay), harvested at three stages of maturity (late vegetative, early bloom and full bloom), fed in two ingredient combinations (all hay or a 50:50 hay and corn grain mixture) and prepared by two forage texture processes (coarsely chopped or finely chopped and pelleted). The 2 x 3 x 2 x 2 factorial arrangement produced 24 diet treatments. These were replicated twice, for a total of 48 lamb digestion trials. In model 1 regression equations, DE was calculated directly from chemical composition of the diet. In model 2, regression equations predicted the percentage of digested nutrient from the chemical contents of the diet and then DE of the diet was calculated as the sum of the gross energy of the digested organic components. Expanded forms of model 1 and model 2 were also developed that included diet factors as qualitative indicator variables to adjust the regression constant and regression coefficients for the diet description. The expanded forms of the equations accounted for significantly more variation in DE than did the simple models and more accurately estimated DE of the diet. Information provided by the diet description proved as useful as chemical analyses for the prediction of digestibility of nutrients. The statistics indicate that, with model 1, neutral detergent fiber and plant cell wall analyses provided as much information for the estimation of DE as did model 2 with the combined information from crude protein, available carbohydrate, total lipid, cellulose and hemicellulose. Regression equations are presented for estimating DE with the most currently analyzed organic components, including linear and curvilinear variables and diet factors that significantly reduce the standard error of the estimate. To estimate De of a diet, the user utilizes the equation that uses the chemical analysis information and diet description most effectively.
Zmozinski, Ariane V; de Jesus, Alexandre; Vale, Maria G R; Silva, Márcia M
2010-12-15
Lubricating oils are used to decrease wear and friction of movable parts of engines and turbines, being in that way essential for the performance and the increase of that equipment lifespan. The presence of some metals shows the addition of specific additives such as detergents, dispersals and antioxidants that improve the performance of these lubricants. In this work, a method for determination of calcium, magnesium and zinc in lubricating oil by flame atomic absorption spectrometry (F AAS) was developed. The samples were diluted with a small quantity of aviation kerosene (AVK), n-propanol and water to form a three-component solution before its introduction in the F AAS. Aqueous inorganic standards diluted in the same way have been used for calibration. To assess the accuracy of the new method, it was compared with ABNT NBR 14066 standard method, which consists in diluting the sample with AVK and in quantification by F AAS. Two other validating methods have also been used: the acid digestion and the certified reference material NIST (SRM 1084a). The proposed method provides the following advantages in relation to the standard method: significant reduction of the use of AVK, higher stability of the analytes in the medium and application of aqueous inorganic standards for calibration. The limits of detection for calcium, magnesium and zinc were 1.3 μg g(-1), 0.052 μg g(-1) and 0.41 μg g(-1), respectively. Concentrations of calcium, magnesium and zinc in six different samples obtained by the developed method did not differ significantly from the results obtained by the reference methods at the 95% confidence level (Student's t-test and ANOVA). Therefore, the proposed method becomes an efficient alternative for determination of metals in lubricating oil. Copyright © 2010 Elsevier B.V. All rights reserved.
Loyra-Tzab, Enrique; Sarmiento-Franco, Luis Armando; Sandoval-Castro, Carlos Alfredo; Santos-Ricalde, Ronald Herve
2013-01-01
The nutrient digestibility, nitrogen balance and in vivo metabolizable energy supply of Mucuna pruriens whole pods fed to growing Pelibuey lambs was investigated. Eight Pelibuey sheep housed in metabolic crates were fed increasing levels of Mucuna pruriens pods: 0 (control), 100 (Mucuna100), 200 (Mucuna200) and 300 (Mucuna300) g/kg dry matter. A quadratic (p<0.002) effect was observed for dry matter (DM), neutral detergent fibre (aNDF), nitrogen (N) and gross energy (GE) intakes with higher intakes in the Mucuna100 and Mucuna200 treatments. Increasing M. pruriens in the diets had no effect (p>0.05) on DM and GE apparent digestibility (p<0.05). A linear reduction in N digestibility and N retention was observed with increasing mucuna pod level. This effect was accompanied by a quadratic effect (p<0.05) on fecal-N and N-balance which were higher in the Mucuna100 and Mucuna200 treatments. Urine-N excretion, GE retention and dietary estimated nutrient supply (metabolizable protein and metabolizable energy) were not affected (p>0.05). DM, N and GE apparent digestibility coefficient of M. pruriens whole pods obtained through multiple regression equations were 0.692, 0.457, 0.654 respectively. In vivo DE and ME content of mucuna whole pod were estimated in 11.0 and 9.7 MJ/kg DM. It was concluded that whole pods from M. pruriens did not affect nutrient utilization when included in an mixed diet up to 200 g/kg DM. This is the first in vivo estimation of mucuna whole pod ME value for ruminants. PMID:25049876
75 FR 65644 - Alaska Native Claims Selection
Federal Register 2010, 2011, 2012, 2013, 2014
2010-10-26
... DEPARTMENT OF THE INTERIOR Bureau of Land Management [AA-11937, AA-11938, AA-11939, AA-11940, AA-11944, AA-11943, AA-11941, AA-11936, AA-11933, AA-11928, AA-11929, AA-11931, AA-11932; LLAK- 962000-L14100000-HY0000-P] Alaska Native Claims Selection AGENCY: Bureau of Land Management, Interior. ACTION...
Hepatitis E virus capsid protein assembles in 4M urea in the presence of salts.
Yang, Chunyan; Pan, Huirong; Wei, Minxi; Zhang, Xiao; Wang, Nan; Gu, Ying; Du, Hailian; Zhang, Jun; Li, Shaowei; Xia, Ningshao
2013-03-01
The hepatitis E virus (HEV) capsid protein has been demonstrated to be able to assemble into particles in vitro. However, this process and the mechanism of protein-protein interactions during particle assembly remain unclear. In this study, we investigated the assembly mechanism of HEV structural protein subunits, the capsid protein p239 (aa368-606), using analytical ultracentrifugation. It was the first to observe that the p239 can form particles in 4M urea as a result of supplementation with salt, including ammonium sulfate [(NH₄)₂SO₄], sodium sulfate (Na₂SO₄), sodium chloride (NaCl), and ammonium chloride (NH₄Cl). Interestingly, it is the ionic strength that determines the efficiency of promoting particle assembly. The assembly rate was affected by temperature and salt concentration. When (NH₄)₂SO₄ was used, assembling intermediates of p239 with sedimentation coefficient values of approximately 5 S, which were mostly dodecamers, were identified for the first time. A highly conserved 28-aa region (aa368-395) of p239 was found to be critical for particle assembly, and the hydrophobic residues Leu³⁷², Leu³⁷⁵, and Leu³⁹⁵ of p239 was found to be critical for particle assembly, which was revealed by site-directed mutagenesis. This study provides new insights into the assembly mechanism of native HEV, and contributes a valuable basis for further investigations of protein assembly by hydrophobic interactions under denaturing conditions. Copyright © 2012 The Protein Society.
Bilateral Asymmetry in the Human Pelvis.
Kurki, Helen K
2017-04-01
Asymmetry of the human axial skeleton has received much less attention that of the limb skeleton. Pelvic morphology is subject to multiple selective factors, including bipedal locomotion and obstetrics, among others, as well as environmental factors such as biomechanical loading. How these various factors influence or restrict asymmetry of the pelvis is unknown and few studies have investigated levels and patterns of pelvic asymmetry. This study examines percentage directional (%DA) and absolute (%AA) asymmetry in 14 bilaterally paired dimensions of the pelvic canal, non-canal pelvis, and femur in female (n = 111) and male (n = 126) skeletons from nine geographically dispersed skeletal samples. Directional asymmetries were uniformly low for all measures and lacked any consistent patterning across the variables, while %AA was highest in the pelvic canal, particularly the posterior aspects. Few sex differences and no population differences were found for %DA and %AA; however the latter was correlated with coefficients of variation across the 14 variables in both sexes. While sample mean %DA were low, standard deviations of the canal variables were high and the majority of individuals in both sexes displayed %DA values >±0.5, suggesting asymmetry is common, if not directionally consistent. Biomechanical loading of the pelvic girdle may influence asymmetry of both the canal and non-canal aspects of the pelvis; however it is unlikely that these asymmetries negatively affect obstetric function, given the prevalence for %DA found in this study. Anat Rec, 300:653-665, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
VizieR Online Data Catalog: Methods for CIP and CIO localisation (Capitaine+, 2006)
NASA Astrophysics Data System (ADS)
Capitaine, N.; Wallace, P. T.
2006-04-01
Various implementations are described, their theoretical bases compared and the relationships between the expressions for the relevant parameters are provided. Semi-analytical and numerical comparisons have been made, based on the P03 precession and the IAU 2000A nutation, with slight modifications to the latter to make it consistent with P03. Methods based on the recent P03 precession model can be found in Capitaine et al. (2003A&A...412..567C, 2005A&A...432..355C). Tables 5-11 contain the coefficients in microarcseconds (uas) of the series developments (i.e. Fourier and Poisson terms) as functions of (terrestrial) time t (expressed in centuries since J2000.0) for the quantities s (Eq. (53)), s+XY/2 (Eq. (58)), s+XY/2+D (Eq. (60)), EO+Dpsi*cos(epsilonA) (where EO is given by Eq. (69)), x{CIO}, y{CIO}, z{CIO} (Eq. (70)), respectively, retaining all terms larger than 0.1 uas. The general formula is: S=Sum{on i}[Sum{j=0,5}[(S{j}i)*tj*sin(ARG)+(C{j}i*cos(ARG)]*tj
Baird, Mark E
2003-10-01
The size, shape, and absorption coefficient of a microalgal cell determines, to a first order approximation, the rate at which light is absorbed by the cell. The rate of absorption determines the maximum amount of energy available for photosynthesis, and can be used to calculate the attenuation of light through the water column, including the effect of packaging pigments within discrete particles. In this paper, numerical approximations are made of the mean absorption cross-section of randomly oriented cells, aA. The shapes investigated are spheroids, rectangular prisms with a square base, cylinders, cones and double cones with aspect ratios of 0.25, 0.5, 1, 2, and 4. The results of the numerical simulations are fitted to a modified sigmoid curve, and take advantage of three analytical solutions. The results are presented in a non-dimensionalised format and are independent of size. A simple approximation using a rectangular hyperbolic curve is also given, and an approach for obtaining the upper and lower bounds of aA for more complex shapes is outlined.
Nowrouzi, Mohsen; Mansouri, Borhan; Nabizadeh, Sahar; Pourkhabbaz, Alireza
2014-02-01
This study determined the concentration of heavy metals (Al, Cr, Cu, and Zn) in water and sediments at nine sites in the Hara biosphere reserve of southern Iran during the summer and winter 2010. Determination of Al, Cr, Cu, and Zn in water was carried out by graphite furnace atomic absorption spectrometer (Shimadzu, AA 610s) and in sediment by flame atomic absorption spectrometer (Perkin Elmer, AA3030). Results showed that the heavy metal concentrations in the water samples decreased in the sequence of Zn > Al > Cu > Cr, while in sediment samples were Cr > Zn > Cu > Al. Data analysis indicated that with the exception of Al, there was a Pearson's correlation coefficient between pH and Cu, Zn, and Cr at α = 0.01, 0.05, and 0.001 in sediment (in winter), respectively. There were also significant differences between heavy metals of Cr, Cu, and Zn during the two seasons (p < 0.001) in the water and sediment.
Optimization of the Alkaline Pretreatment of Rice Straw for Enhanced Methane Yield
Song, Zilin; Yang, Gaihe; Han, Xinhui; Feng, Yongzhong; Ren, Guangxin
2013-01-01
The lime pretreatment process for rice straw was optimized to enhance the biodegradation performance and increase biogas yield. The optimization was implemented using response surface methodology (RSM) and Box-Behnken experimental design. The effects of biodegradation, as well as the interactive effects of Ca(OH)2 concentration, pretreatment time, and inoculum amount on biogas improvement, were investigated. Rice straw compounds, such as lignin, cellulose, and hemicellulose, were significantly degraded with increasing Ca(OH)2 concentration. The optimal conditions for the use of pretreated rice straw in anaerobic digestion were 9.81% Ca(OH)2 (w/w TS), 5.89 d treatment time, and 45.12% inoculum content, which resulted in a methane yield of 225.3 mL/g VS. A determination coefficient (R 2) of 96% was obtained, indicating that the model used to predict the anabolic digestion process shows a favorable fit with the experimental parameters. PMID:23509824
Ivanová, Lucia; Fáberová, Milota; Mackuľak, Tomáš; Grabic, Roman; Bodík, Igor
2017-05-01
Antibiotics and antidepressants are among the most successful drugs used for human therapy. Their concentration in influent on WWTP is relative high and there can be removed by biodegradation or sorption. The aim of this study was to define the amounts of sorbed pharmaceuticals on digested sludge from WWTP Bratislava - Petržalka. The amounts of sorbed pharmaceuticals were calculated from knowing partition coefficients for selected pharmaceuticals and from analytically measured pharmaceutical´s concentrations in sludge liquor. From this calculation were estimated the one-year sorbed amount of pharmaceutical onto sludge from wastewater treatment plant Petržalka (26,066g/y for ciprofloxacin, 756g/y for azithromycin, 647g/y for clarithromycin, 445g/y for venlafaxine and 148g/y for citalopram). Copyright © 2017 Elsevier Inc. All rights reserved.
Jensen, Morten Bang; Møller, Jacob; Scheutz, Charlotte
2017-08-01
The fate of total solids, volatile solids, total organic carbon, fossil carbon, biogenic carbon and 17 substances (As, Ca, CaCO 3 , Cd, Cl, Cr, Cu, H, Hg, K, Mg, N, Ni, O, P, Pb, S, Zn) in a combined dry anaerobic digestion and post-composting facility were assessed. Mass balances showed good results with low uncertainties for non-volatile substances, while balances for nitrogen, carbon, volatile solids and total organic carbon showed larger but reasonable uncertainties, due to volatilisation and emissions into the air. Material and substance flow analyses were performed in order to obtain transfer coefficients for a combined dry anaerobic digestion and post-composting facility. All metals passed through the facility and ended up in compost or residues, but all concentrations of metals in the compost complied with legislation. About 23% of the carbon content of the organic waste was transferred to the biogas, 24% to the compost, 13% to residues and 40% into the atmosphere. For nitrogen, 69% was transferred to the compost, 10% volatilised to the biofilter, 11% directly into the atmosphere and 10% to residues. Finally, a full life cycle inventory was conducted for the combined dry anaerobic digestion and post-composting facility, including waste received, fuel consumption, energy use, gaseous emissions, products, energy production and chemical composition of the compost produced. Copyright © 2017. Published by Elsevier Ltd.
The nutritive value of condensed wheat distillers solubles for cattle.
De Boever, J L; Blok, M C; Millet, S; Vanacker, J; De Campeneere, S
2016-12-01
The chemical composition and the energy and protein value of five batches of condensed distillers solubles (CDS) originating from wheat were determined. The net energy for lactation (NEL) was derived from digestion coefficients obtained with sheep. The true protein digested in the small intestine (DVE) and the rumen degradable protein balance (OEB) were based on the rumen degradation rate (kd D ), the rumen undegradable fraction (U) and intestinal digestibility of undegraded protein (%DVBE) predicted by regression equations derived from a data set of 28 protein feeds with kd D , U and %DVBE determined in situ. The CDS is a by-product with a high, but very variable CP content (238 to 495 g/kg DM). The CP contained on average 81% amino acids, with glutamine as main component (on average 21.8% of CP) and a relatively good lysine proportion (3.0%). Further, CDS contains quite a lot of crude fat (mean±SD: 71±14 g/kg DM), glycerol (95±52 g/kg DM) and sugars (123±24 g/kg DM) resulting in a high organic matter digestibility (88.6±3.0%) and high NEL content (8.3±0.4 MJ/kg DM). The protein value showed a large variation, with DVE ranging from 122 to 244 g/kg DM and OEB from 50 to 204 g/kg DM. Wheat CDS is a rich source of minerals and trace elements with exception of calcium.
Jetana, T; Suthikrai, W; Usawang, S; Vongpipatana, C; Sophon, S; Liang, J B
2009-04-01
Four, male, growing Thai swamp buffaloes (197 +/- 5.3 kg and all 1 year old) were used to evaluate the effects of concentrate added to pineapple waste silage in differing ratios, to form a complete diet, studying in vivo digestion, the rate of passage, microbial protein synthesis and blood metabolites. Animals were fed ad libitum with 4 diets, using four combinations of pineapple waste silage (P) and concentrate (C), in the proportions (on a dry matter basis) of 0.8:0.2 (P80:C20), 0.6:0.4 (P60:C40), 0.4:0.6 (P40:C60) and 0.2:0.8 (P20:C80). The results showed that the intakes of dry matter (DM), organic matter (OM), nitrogen (N), the N-balance, urinary purine derivatives (PD) excretion, the ratios of allantoin to creatinine (CR), PD to CR, the plasma urea-N (PUN) and insulin increased in the animals, but the intake of neutral detergent fiber (NDF), the coefficient of whole tract, apparent digestibility of NDF, the transit time (TT) and the mean retention time (TMRT) decreased, when the proportion of concentrate in the diet increased. This study indicated that the proportion of P40:C60 in the diet produced the best efficiency of urinary PD excretion (mmol) per digestible OM intake (kg DOMI).
The Shock and Vibration Digest. Volume 12, Number 8,
1980-08-01
half tme coefficient of 0.315 in the above lamina. Sequential delamination began when a strip equation because two surfaces are formed). of width D in...a striker plate. Each specimen study of the two-dimensional ( plane -strain) response was subjected to two separate impact loadings: an of an elastic...laminated plate; they used a finite ele- in- plane impact and a so-called shear-bending impact. ment/normal mode technique. The physical behavior The
2009-09-03
coefficients are set to a value of 0.3. The stick/slip critical shear stress level is defined using a modified Coulomb friction law. Within this law, there...Modified Johnson Cook Model Equivalent Plastic Strain a P M,htgnert S d lei Y 1 2 3 4 5 6 7 420 440 460 480 500 520 540 560 Original Johnson Cook Model...Lett., 2005, 59, 3315–3318. 7 Thomas, W. M. and Nicholas, E. D. Friction stir welding for the transportation industries. Mater. Des ., 1997, 18, 269
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maniwa, Yutaka; Fujiwara, Ryuji; Kira, Hiroshi
X-ray diffraction study of multiwalled carbon nanotube (MWNT) grown by arc discharge in hydrogen atmosphere is presented. It is found that the thermal-expansion coefficient along the radial direction of MWNT is widely distributed in a range from 1.6 x 10{sup -5} K{sup -1} to 2.6 x 10{sup -5} K{sup -1}, indicating the existence of both of Russian doll MWNT and highly defective MWNT. Russian doll MWNT is suggested to have the outer diameter less than {approx}100 Aa. Thicker MWNT's are typically highly defective, and may have the jelly roll (scroll) or defective polygonal structure consisting of flat graphite domains.
Huang, Q.; Su, Y. B.; Li, D. F.; Liu, L.; Huang, C. F.; Zhu, Z. P.; Lai, C. H.
2015-01-01
The objective of this study was to determine the effects of graded inclusions of wheat bran (0%, 9.65%, 48.25% wheat bran) and two growth stages (from 32.5 to 47.2 kg and 59.4 to 78.7 kg, respectively) on the apparent ileal digestibility (AID), apparent total tract digestibility (ATTD) and hindgut fermentation of nutrients and energy in growing pigs. Six light pigs (initial body weight [BW] 32.5±2.1 kg) and six heavy pigs (initial BW 59.4±3.2 kg) were surgically prepared with a T-cannula in the distal ileum. A difference method was used to calculate the nutrient and energy digestibility of wheat bran by means of comparison with a basal diet consisting of corn-soybean meal (0% wheat bran). Two additional diets were formulated by replacing 9.65% and 48.25% wheat bran by the basal diet, respectively. Each group of pigs was allotted to a 6×3 Youden square design, and pigs were fed to three experimental diets during three 11-d periods. Hindgut fermentation values were calculated as the differences between ATTD and AID values. For the wheat bran diets, the AID and ATTD of dry matter (DM), ash, organic matter (OM), carbohydrates (CHO), gross energy (GE), and digestible energy (DE) decreased with increasing inclusion levels of wheat bran (p<0.05). While only AID of CHO and ATTD of DM, ash, OM, CHO, GE, and DE content differed (p<0.05) when considering the BW effect. For the wheat bran ingredient, there was a wider variation effect (p<0.01) on the nutrient and energy digestibility of wheat bran in 9.65% inclusion level due to the coefficient of variation (CV) of the nutrient and energy digestibility being higher at 9.65% compared to 48.25% inclusion level of wheat bran. Digestible energy content of wheat bran at 48.25% inclusion level (4.8 and 6.7 MJ/kg of DM, respectively) fermented by hindgut was significantly higher (p<0.05) than that in 9.65% wheat bran inclusion level (2.56 and 2.12 MJ/kg of DM, respectively), which was also affected (p<0.05) by two growth stages. This increase in hindgut fermentation caused the difference in ileal DE (p<0.05) to disappear at total tract level. All in all, increasing wheat bran levels in diets negatively influences the digestibility of some nutrients in pigs, while it positively affects the DE fermentation in the hindgut. PMID:25925062
NASA Astrophysics Data System (ADS)
Liu, Genyou; Duan, Pengshuo; Hao, Xiaoguang; Hu, Xiaogang
2015-04-01
The previous studies indicated that the most of the interannual variations in Length-Of-Day (LOD) could be explained by the joint effects of ENSO (EI Nino-Southern Oscillations) and QBO (Quasi-Biennial Oscillation) phenomenon in the atmosphere. Due to the limit of the used methods, those results cannot give the 'time-frequency' coherence spectrum between ENSO and LOD, and cannot indicate in which specific periods the weak coherence occurred and difficult to give the reliable reason. This paper uses Daubechies wavelet with 10 order vanishing moment to analyze the LOD monthly time series from 1962 to 2011. Based on cross-wavelet and wavelet coherence methods, the analysis of the time-frequency correlations between ENSO and LOD series (1962-2011) on the 1.3~10.7 year scales is given. We have extracted and reconstructed the LOD signals on 1.3~10.7year scales. The result shows that there is obvious weak coherence on both biennial and 5~8 year scales after 1982 relative to before 1982. According to the previous works, the biennial weak coherence is due to QBO, but the weak coherence on 5~8 year scales cannot be interpreted by the effects of ENSO and QBO. In this study, the Geomagnetic field signals (can be characterized as Aa index) are introduced, we have further extracted and reconstructed the LOD, ENSO and Aa signals in 5-8.0 year band using wavelet packet analysis. Through analyzing the standardized series of the three signals, we found a linear time-frequency formula among the original observation series: LOD(t,f) =αENSO(t,f) +βAa(t,f). This study indicates that the LOD signals on 5.3~8.0 year scales can be expressed in term of linear combination of ENSO and Aa signals. Especially after 1982, the contributions of ENSO and Aa to LOD respectively reach about 0.95ms and 1.0ms.The results also imply that there is an obvious Geomagnetic field signal in interannual variations of LOD. Furthermore, after considering the geomagnetic field signal correction, the Pearson correlation coefficient between LOD and ENSO will increase from 0.51 to 0.98. Consequently, we can conclude that the weak coherence after 1982 on 5.3-8.0 year scales between LOD and ENSO is mainly due to the disturbance of Aa signal, and the observed LOD series is the result of the interaction between ENSO and geomagnetic field signals.
Das, Krushna Chandra; Haque, Nazrul; Baruah, K K; Rajkhowa, C; Mondal, M
2011-01-01
A study was conducted to compare the nutrient utilization, growth, and rumen enzyme profile of mithun (Bos frontalis) and Tho-tho cattle (Bos indicus) reared in the same feeding and managemental conditions. For the purpose, male mithun (n = 8) and male Tho-tho cattle (n = 8) of 1.5 years age, selected from the farm of National Research Centre on Mithun, Nagaland, India, were fed on mixed-tree-leaves-based ration as per the requirement of NRC (2001) for cattle for 12 months. Average daily gain (ADG), average dry matter intake (DMI), and feed conversion ratio (FCR) for all animals were recorded. A metabolic trial was conducted at 6 months of the experiment to assess the digestibility coefficient of different nutrients and nutritive value of ration. At 12 months of the experiment, rumen liquor was collected from all animals and analyzed for rumen enzyme profiles, viz., carboxymethylcellulase, xylanase, α-amylase, β-glucosidase, α-glucosidase, urease, and protease. It was found that ADG (507.8 g vs 392.8 g), DM intake (6.59 vs 5.85 kg/day) and DMI/W(0.75) (98.75 g vs 91.00 g/day), crude protein intake (780 vs 700 g/day), and total digestible nutrient intake (3.65 vs 3.32 kg/day) were higher (p < 0.05) in mithun than cattle. The nitrogen balance was higher and FCR was better (p < 0.05) in mithun compared with cattle. The digestibility coefficient of different nutrients was similar (p > 0.05) between the species. The microbial enzyme profiles of mithun and cattle were not different (p > 0.05). The better growth performance of mithun than cattle as found in the present study clearly indicates that the mithun has higher genetic potential for growth than Tho-tho cattle of north-eastern hilly region of India.
Ferreira, H. C.; Hannas, M. I.; Albino, L. F. T.; Rostagno, H. S.; Neme, R.; Faria, B. D.; Xavier, M. L.; Rennó, L. N.
2016-01-01
Three experiments were conducted to evaluate the effect of β-mannanase (BM) supplementation on the performance, metabolizable energy, amino acid digestibility, and immune function of broilers. A total of 1,600 broilers were randomly distributed in a 4 × 2 factorial arrangement (4 nutritional levels × 0 or 500 g/ton BM), with 10 replicates and 20 broilers per pen. The same design was used in the energy and digestibility experiments with 8 and 6 replicates, respectively, and 6 broilers per pen. The nutritional levels (NL) were formulated to meet the nutritional requirements of broilers (NL1); reductions of 100 kcal metabolizable energy (NL2); 3% of the total amino acids (NL3); and 100 kcal metabolizable energy and 3% total amino acids (NL4) from NL1. The serum immunoglobulin (Ig) concentration was determined in two broilers per pen, and these broilers were slaughtered to determine the relative weight of spleen, thymus, and bursa of Fabricius. Throughout the experiment, the lower nutritional levels reduced (P < 0.05) body weight gain (BWG) and increased (P < 0.05) feed conversion (FCR) for the NL4 treatment. The BM increased (P < 0.05) the BWG values and improved (P < 0.05) the FCR of the broilers. The apparent metabolizable energy corrected for nitrogen balance (AMEn) values were reduced (P < 0.05) for NL2 and NL3. The BM increased (P < 0.05) the AMEn values and reduced (P < 0.05) the excreted nitrogen. NL3 and NL4 reduced (P < 0.05) the true ileal digestibility coefficients (TIDc) of the amino acids cystine and glycine, and BM increased (P < 0.05) the TIDc for all amino acids. The addition of BM reduced (P < 0.05) the relative weights of the spleen and bursa. NL2 increased (P < 0.05) the Ig values, whereas BM reduced (P < 0.05) the serum IgA, IgG, and IgM values of the broilers. This study indicates that using suboptimal nutrient levels leads to losses in production parameters, whereas BM-supplemented diets were effective in improving performance, energy values, and TIDc levels of amino acids and immune response of broilers. PMID:27038422
Evaluation of M307 of FUT1 gene as a genetic marker for disease resistance breeding of Sutai pigs.
Bao, Wen-Bin; Ye, Lan; Zhu, Jing; Pan, Zhang-Yuan; Zhu, Guo-Qiang; Huang, Xue-Gen; Wu, Sheng-Long
2012-04-01
Alpha (1,2) fucosyltransferase (FUT1) gene has been identified as a candidate gene for controlling the expression of the receptor for ETEC F18. The genetic variations in the position of M307 nucleotide in open reading frame of FUT1 have been proposed as a marker for selecting ETEC F18 resistant pigs. The polymorphisms of M307 in FUT1 of breeding base group for ETEC F18 resistance of Sutai pigs (Duroc × Meishan) was detected and their correlations to some immune indexes, growth and development ability, carcass traits and meat quality were also analyzed, which aimed to investigate feasibility of further breeding for diseases resistance based on M307 of FUT1 for Sutai pigs. After digested by Hin6 I, M307 of FUT1 gene could be divided into three kinds of genotypes, AA, AG, and GG. The frequencies were 0.235, 0.609, and 0.156, respectively. The results indicated that Sutai pigs with the AA genotype in M307 of FUT1 gene not only have relatively strong general disease resistance ability in piglets, but also have higher growth and development ability and stable carcass traits and meat quality. It is entirely feasible to raise the new strains of Sutai pigs resistant to Escherichia coli F18 based on genetic marker of the M307 position in FUT1gene.
Fracture prediction using modified mohr coulomb theory for non-linear strain paths using AA3104-H19
NASA Astrophysics Data System (ADS)
Dick, Robert; Yoon, Jeong Whan
2016-08-01
Experiment results from uniaxial tensile tests, bi-axial bulge tests, and disk compression tests for a beverage can AA3104-H19 material are presented. The results from the experimental tests are used to determine material coefficients for both Yld2000 and Yld2004 models. Finite element simulations are developed to study the influence of materials model on the predicted earing profile. It is shown that only the YLD2004 model is capable of accurately predicting the earing profile as the YLD2000 model only predicts 4 ears. Excellent agreement with the experimental data for earing is achieved using the AA3104-H19 material data and the Yld2004 constitutive model. Mechanical tests are also conducted on the AA3104-H19 to generate fracture data under different stress triaxiality conditions. Tensile tests are performed on specimens with a central hole and notched specimens. Torsion of a double bridge specimen is conducted to generate points near pure shear conditions. The Nakajima test is utilized to produce points in bi-axial tension. The data from the experiments is used to develop the fracture locus in the principal strain space. Mapping from principal strain space to stress triaxiality space, principal stress space, and polar effective plastic strain space is accomplished using a generalized mapping technique. Finite element modeling is used to validate the Modified Mohr-Coulomb (MMC) fracture model in the polar space. Models of a hole expansion during cup drawing and a cup draw/reverse redraw/expand forming sequence demonstrate the robustness of the modified PEPS fracture theory for the condition with nonlinear forming paths and accurately predicts the onset of failure. The proposed methods can be widely used for predicting failure for the examples which undergo nonlinear strain path including rigid-packaging and automotive forming.
Kerr, B J; Weber, T E; Ziemer, C J
2015-05-01
Use of indigestible markers such as Cr2O3, Fe2O3, and TiO2 are commonly used in animal studies to evaluate digesta rate of passage and nutrient digestibility. Yet, the potential impact of indigestible markers on fecal microbial ecology and subsequent VFA generation is not known. Two experiments utilizing a total of 72 individually fed finishing pigs were conducted to describe the impact of dietary markers on fecal microbial ecology, fecal ammonia and VFA concentrations, nutrient digestibility, and pig performance. All pigs were fed a common diet with no marker or with 0.5% Cr2O3, Fe2O3, or TiO2. In Exp. 1, after 33 d of feeding, fresh fecal samples were collected for evaluation of microbial ecology, fecal ammonia and VFA concentrations, and nutrient digestibility, along with measures of animal performance. No differences were noted in total microbes or bacterial counts in pig feces obtained from pigs fed the different dietary markers while Archaea counts were decreased (P = 0.07) in feces obtained from pigs fed the diet containing Fe2O 3compared to pigs fed the control diet. Feeding Cr2O3, Fe2O3, or TiO2 increased fecal bacterial richness (P = 0.03, 0.01, and 0.10; respectively) when compared to pigs fed diets containing no marker, but no dietary marker effects were noted on fecal microbial evenness or the Shannon-Wiener index. Analysis of denaturing gradient gel electrophoresis gels did not reveal band pattern alterations due to inclusion of dietary markers in pig diets. There was no effect of dietary marker on fecal DM, ammonia, or VFA concentrations. Pigs fed diets containing Cr2O3 had greater Ca, Cu, Fe, and P (P ≤ 0.02), but lower Ti ( P= 0.08) digestibility compared to pigs fed the control diet. Pigs fed diets containing Fe2O3 had greater Ca (P = 0.08) but lower Ti (P = 0.01) digestibility compared to pigs fed the control diet. Pigs fed diets containing TiO2 had greater Fe and Zn (P ≤ 0.09), but lower Ti ( P= 0.01) digestibility compared to pigs fed the control diet. In Exp. 2, no effect of dietary marker on pig performance was noted. Overall, the data indicate that the inclusion of Cr2O3, Fe2O3, or TiO2 as digestibility markers have little to no impact on microbial ecology, fecal ammonia or VFA concentrations, nutrient digestibility, or pig growth performance indicating they are suitable for use in digestion studies.
[Determination of Cu in Shell of Preserved Egg by LIBS Coupled with PLS].
Hu, Hui-qin; Xu, Xue-hong; Liu, Mu-hua; Tu, Jian-ping; Huang, Le; Huang, Lin; Yao, Ming-yin; Chen, Tian-bing; Yang, Ping
2015-12-01
In this work, the content of copper in the shell of preserved eggs were determined directly by Laser induced breakdown spectroscopy (LIBS), and the characteristics lines of Cu was obtained. The samples of eggshell were pretreated by acid wet digestion, and the real content of Cu was obtained by atomic absorption spectrophotometer (AAS). Due to the test precision and accuracy of LIBS was influenced by a serious of factors, for example, the complex matrix effect of sample, the enviro nment noise, the system noise of the instrument, the stability of laser energy and so on. And the conventional unvariate linear calibration curve between LIBS intensity and content of element of sample, such as by use of Schiebe G-Lomakin equation, can not meet the requirement of quantitative analysis. In account of that, a kind of multivariate calibration method is needed. In this work, the data of LIBS spectra were processed by partial least squares (PLS), the precision and accuracy of PLS model were compared by different smoothing treatment and five pretreatment methods. The result showed that the correlation coefficient and the accuracy of the PLS model were improved, and the root mean square error and the average relative error were reduced effectively by 11 point smoothing with Multiplicative scatter correction (MSC) pretreatment. The results of the study show that, heavy metal Cu in preserved egg shells can be direct detected accurately by laser induced breakdown spectroscopy, and the next step batch tests will been conducted to find out the relationship of heavy metal Cu content in the preserved egg between the eggshell, egg white and egg yolk. And the goal of the contents of heavy metals in the egg white, egg yolk can be knew through determinate the eggshell by the LIBS can be achieved, to provide new method for rapid non-destructive testing technology for quality and satety of agricultural products.
NASA Astrophysics Data System (ADS)
Akter, Sharmin; Maejima, Satoshi; Kawauchi, Satoko; Sato, Shunichi; Hinoki, Akinari; Aosasa, Suefumi; Yamamoto, Junji; Nishidate, Izumi
2015-07-01
Diffuse reflectance spectroscopy (DRS) has been extensively used for characterization of biological tissues as a noninvasive optical technique to evaluate the optical properties of tissue. We investigated a method for evaluating the reduced scattering coefficient , the absorption coefficient μa, the tissue oxygen saturation StO2, and the reduction of heme aa3 in cytochrome c oxidase CcO of in vivo liver tissue using a single-reflectance fiber probe with two source-collector geometries. We performed in vivo recordings of diffuse reflectance spectra for exposed rat liver during the ischemia-reperfusion induced by the hepatic portal (hepatic artery, portal vein, and bile duct) occlusion. The time courses of μa at 500, 530, 570, and 584 nm indicated the hemodynamic change in liver tissue as well as StO2. Significant increase in μa(605)/μa(620) during ischemia and after euthanasia induced by nitrogen breathing was observed, which indicates the reduction of heme aa3, representing a sign of mitochondrial energy failure. The time courses of at 500, 530, 570, and 584 nm were well correlated with those of μa, which also reflect the scattering by red blood cells. On the other hand, at 700 and 800 nm, a temporary increase in and an irreversible decrease in were observed during ischemia-reperfusion and after euthanasia induced by nitrogen breathing, respectively. The change in in the near-infrared wavelength region during ischemia is indicative of the morphological changes in the cellular and subcellular structures induced by the ischemia, whereas that after euthanasia implies the hepatocyte vacuolation. The results of the present study indicate the potential application of the current DRS system for evaluating the pathophysiological conditions of in vivo liver tissue.
Correia, Carlos M; Teixeira, Joel
2014-12-01
Computationally efficient wave-front reconstruction techniques for astronomical adaptive-optics (AO) systems have seen great development in the past decade. Algorithms developed in the spatial-frequency (Fourier) domain have gathered much attention, especially for high-contrast imaging systems. In this paper we present the Wiener filter (resulting in the maximization of the Strehl ratio) and further develop formulae for the anti-aliasing (AA) Wiener filter that optimally takes into account high-order wave-front terms folded in-band during the sensing (i.e., discrete sampling) process. We employ a continuous spatial-frequency representation for the forward measurement operators and derive the Wiener filter when aliasing is explicitly taken into account. We further investigate and compare to classical estimates using least-squares filters the reconstructed wave-front, measurement noise, and aliasing propagation coefficients as a function of the system order. Regarding high-contrast systems, we provide achievable performance results as a function of an ensemble of forward models for the Shack-Hartmann wave-front sensor (using sparse and nonsparse representations) and compute point-spread-function raw intensities. We find that for a 32×32 single-conjugated AOs system the aliasing propagation coefficient is roughly 60% of the least-squares filters, whereas the noise propagation is around 80%. Contrast improvements of factors of up to 2 are achievable across the field in the H band. For current and next-generation high-contrast imagers, despite better aliasing mitigation, AA Wiener filtering cannot be used as a standalone method and must therefore be used in combination with optical spatial filters deployed before image formation actually takes place.
Takada, T; Hitosugi, M; Kadowaki, T; Kudo, M
1983-07-01
An energy dispersive X-ray fluorescence spectrometer (EDX) has been applied to determine multielements in the workplace air. The standards for X-ray fluorescence analysis were prepared by the chelate precipitation method on polyvinyl chloride (PVC) membrane filter. And, the specimens were prepared to deposit various metal compounds of different chemical forms by the suspension method on PVC membrane filter, and they were determined with EDX and atomic absorption spectrometer (AAS). The results obtained were as follows. Though there is a difference by each element, an amount less than 3 microgram/cm2 per unit area makes it possible to undergo multielement analysis, that is, is has no influence on fine particle effect (particle size; under 5 microns). Then, effects of the X-ray intensity by different chemical forms are negligible. At the presence the neighboring element and other elements this technique showed greater precision by carrying out on corrective treatment, etc. The coefficient of variation of this technique was in the range of 2.5-6.5% at DDTC-Cu of 0.5-5.0 micrograms/cm2, with the limit of detection for As : 0.002 microgram/cm2, Zn : 0.003 microgram/cm2, Pb : 0.003 microgram/cm2, Cu : 0.004 microgram/cm2, Ni : 0.003 microgram/cm2, Fe : 0.005 microgram/cm2, Mn : 0.008 microgram/cm2, Cr : 0.013 microgram/cm2, respectively. Aerosols collected at the workplace were analyzed with EDX and AAS, and the obtained results showed good agreement with such regression line as y = 1.04 chi + 0.04, the coefficient of correlation being r = 0.995. From these results, this technique was found to be a very excellent method for monitoring of multielements in the workplace air.
The Evaluation on the Cadmium Net Concentration for Soil Ecosystems.
Yao, Yu; Wang, Pei-Fang; Wang, Chao; Hou, Jun; Miao, Ling-Zhan
2017-03-12
Yixing, known as the "City of Ceramics", is facing a new dilemma: a raw material crisis. Cadmium (Cd) exists in extremely high concentrations in soil due to the considerable input of industrial wastewater into the soil ecosystem. The in situ technique of diffusive gradients in thin film (DGT), the ex situ static equilibrium approach (HAc, EDTA and CaCl2), and the dissolved concentration in soil solution, as well as microwave digestion, were applied to predict the Cd bioavailability of soil, aiming to provide a robust and accurate method for Cd bioavailability evaluation in Yixing. Moreover, the typical local cash crops-paddy and zizania aquatica-were selected for Cd accumulation, aiming to select the ideal plants with tolerance to the soil Cd contamination. The results indicated that the biomasses of the two applied plants were sufficiently sensitive to reflect the stark regional differences of different sampling sites. The zizania aquatica could effectively reduce the total Cd concentration, as indicated by the high accumulation coefficients. However, the fact that the zizania aquatica has extremely high transfer coefficients, and its stem, as the edible part, might accumulate large amounts of Cd, led to the conclusion that zizania aquatica was not an ideal cash crop in Yixing. Furthermore, the labile Cd concentrations which were obtained by the DGT technique and dissolved in the soil solution showed a significant correlation with the Cd concentrations of the biota accumulation. However, the ex situ methods and the microwave digestion-obtained Cd concentrations showed a poor correlation with the accumulated Cd concentration in plant tissue. Correspondingly, the multiple linear regression models were built for fundamental analysis of the performance of different methods available for Cd bioavailability evaluation. The correlation coefficients of DGT obtained by the improved multiple linear regression model have not significantly improved compared to the coefficients obtained by the simple linear regression model. The results revealed that DGT was a robust measurement, which could obtain the labile Cd concentrations independent of the physicochemical features' variation in the soil ecosystem. Consequently, these findings provide stronger evidence that DGT is an effective and ideal tool for labile Cd evaluation in Yixing.
The Evaluation on the Cadmium Net Concentration for Soil Ecosystems
Yao, Yu; Wang, Pei-Fang; Wang, Chao; Hou, Jun; Miao, Ling-Zhan
2017-01-01
Yixing, known as the “City of Ceramics”, is facing a new dilemma: a raw material crisis. Cadmium (Cd) exists in extremely high concentrations in soil due to the considerable input of industrial wastewater into the soil ecosystem. The in situ technique of diffusive gradients in thin film (DGT), the ex situ static equilibrium approach (HAc, EDTA and CaCl2), and the dissolved concentration in soil solution, as well as microwave digestion, were applied to predict the Cd bioavailability of soil, aiming to provide a robust and accurate method for Cd bioavailability evaluation in Yixing. Moreover, the typical local cash crops—paddy and zizania aquatica—were selected for Cd accumulation, aiming to select the ideal plants with tolerance to the soil Cd contamination. The results indicated that the biomasses of the two applied plants were sufficiently sensitive to reflect the stark regional differences of different sampling sites. The zizania aquatica could effectively reduce the total Cd concentration, as indicated by the high accumulation coefficients. However, the fact that the zizania aquatica has extremely high transfer coefficients, and its stem, as the edible part, might accumulate large amounts of Cd, led to the conclusion that zizania aquatica was not an ideal cash crop in Yixing. Furthermore, the labile Cd concentrations which were obtained by the DGT technique and dissolved in the soil solution showed a significant correlation with the Cd concentrations of the biota accumulation. However, the ex situ methods and the microwave digestion-obtained Cd concentrations showed a poor correlation with the accumulated Cd concentration in plant tissue. Correspondingly, the multiple linear regression models were built for fundamental analysis of the performance of different methods available for Cd bioavailability evaluation. The correlation coefficients of DGT obtained by the improved multiple linear regression model have not significantly improved compared to the coefficients obtained by the simple linear regression model. The results revealed that DGT was a robust measurement, which could obtain the labile Cd concentrations independent of the physicochemical features’ variation in the soil ecosystem. Consequently, these findings provide stronger evidence that DGT is an effective and ideal tool for labile Cd evaluation in Yixing. PMID:28287500
Yang, Ze-Min; Chen, Long-Hui; Zhang, Min; Lin, Jing; Zhang, Jie; Chen, Wei-Wen; Yang, Xiao-Rong
2015-01-01
It remains unclear how salivary alpha-amylase (sAA) levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1) copy number and protein expression (glycosylated and non-glycosylated) in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount) in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number × total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount) and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number × total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount, and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults.
Yang, Ze-Min; Chen, Long-Hui; Zhang, Min; Lin, Jing; Zhang, Jie; Chen, Wei-Wen; Yang, Xiao-Rong
2015-01-01
It remains unclear how salivary alpha-amylase (sAA) levels respond to mechanical stimuli in different age groups. In addition, the role played by the sAA gene (AMY1) copy number and protein expression (glycosylated and non-glycosylated) in sAA activity has also been rarely reported. In this study, we analyzed saliva samples collected before and after citric acid stimulation from 47 child and 47 adult Chinese subjects. We observed that adults had higher sAA activity and sAA glycosylated levels (glycosylated sAA amount/total sAA amount) in basal and stimulated saliva when compared with children, while no differences were found in total or glycosylated sAA amount between them. Interestingly, adults showed attenuated sAA activity levels increase over those of children after stimulation. Correlation analysis showed that total sAA amount, glycosylated sAA amount, and AMY1 copy number × total sAA amount were all positively correlated with sAA activity before and after stimulation in both groups. Interestingly, correlation r between sAA levels (glycosylated sAA amount and total sAA amount) and sAA activity decreased after stimulation in children, while adults showed an increase in correlation r. In addition, the correlation r between AMY1 copy number × total sAA amount and sAA activity was higher than that between AMY1 copy number, total sAA amount, and sAA activity, respectively. Taken together, our results suggest that total sAA amount, glycosylated sAA amount, and the positive interaction between AMY1 copy number and total sAA amount are crucial in influencing sAA activity before and after stimulation in children and adults. PMID:26635626
Nutritional evaluation of canola meals produced from new varieties of canola seeds for poultry.
Chen, X; Parr, C; Utterback, P; Parsons, C M
2015-05-01
This study evaluated the nutritional value of 14 canola meals from new varieties of canola and compared them to conventional canola meal samples and soybean meals in chickens. Five experiments that included different sources of canola meals or soybean meals were conducted. For each experiment, a precision-fed rooster assay with conventional or cecectomized roosters was conducted to determine TMEn or amino acid digestibility. Analyzed nutritional composition of the canola meal samples indicated increases in crude protein and amino acids for all test canola meals (49.41 to 50.58% crude protein on a dry matter basis) compared to conventional canola meals (40.73 to 43.01%). All test canola meals also contained lower amounts of neutral detergent fiber and acid detergent fiber. Most test canola meals had significantly higher TMEn values than the conventional canola meals (P < 0.05), but all were lower than the soybean meal (P < 0.05). The test canola meals had higher amino acid digestibility coefficients than conventional canola meals in Experiments 1, 2, and 4 (P < 0.05), and higher concentrations of digestible amino acids in all 5 experiments. The results of this study indicated that nutritional value of the canola meal from new varieties of canola was greater than conventional canola meal for poultry. © 2015 Poultry Science Association Inc.
da Silva, Gabriel Santana; Chaves Véras, Antônia Sherlanea; de Andrade Ferreira, Marcelo; Moreira Dutra, Wilson; Menezes Wanderley Neves, Maria Luciana; Oliveira Souza, Evaristo Jorge; Ramos de Carvalho, Francisco Fernando; de Lima, Dorgival Morais
2015-10-01
The objective of this study was to evaluate the influence of diets with increasing concentrate levels (170, 340, 510 and 680 g/kg of total dry matter) on dry matter intake, digestibility, performance and carcass characteristics of 25 Holstein-Zebu crossbred dairy steers in a feedlot. A completely randomized design was used, and data were submitted to analysis of variance and regression. The dry matter intake and digestibility coefficients of all nutrients increased linearly. The total weight gain and average daily gain added 1.16 kg and 9.90 g, respectively, for each 10 g/kg increase in concentrate. The empty body weight, hot carcass weight and cold carcass weight responded linearly to increasing concentrate. The hot carcass yield and cold carcass yield, gains in empty body weight and carcass gain were also influenced, as were the efficiencies of carcass deposition and carcass deposition rate. It is concluded that increasing concentrate levels in feedlot diets increase the intake and digestibility of dry matter and other nutrients, improving the feed efficiency, performance and physical characteristics of the carcass. Furthermore and of importance concerning the climate change debate, evidence from the literature indicates that enteric methane production would be reduced with increasing concentrate levels such as those used.
41 CFR 101-26.507-1 - Submission of requisitions.
Code of Federal Regulations, 2014 CFR
2014-07-01
... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...
41 CFR 101-26.507-1 - Submission of requisitions.
Code of Federal Regulations, 2011 CFR
2011-07-01
... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...
41 CFR 101-26.507-1 - Submission of requisitions.
Code of Federal Regulations, 2013 CFR
2013-07-01
... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...
41 CFR 101-26.507-1 - Submission of requisitions.
Code of Federal Regulations, 2012 CFR
2012-07-01
... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...
41 CFR 101-26.507-1 - Submission of requisitions.
Code of Federal Regulations, 2010 CFR
2010-07-01
... for security equipment covered by the latest edition of Federal specifications AA-F-357, AA-F-358, AA-F-363, AA-S-1518, and AA-D-600, and interim Federal specifications AA-F-00364 and AA-C-001697 shall...
Development of the Persian version of the Vertigo Symptom Scale: Validity and reliability
Kamalvand, Atefeh; Ghahraman, Mansoureh Adel; Jalaie, Shohreh
2017-01-01
Background: Vertigo Symptom Scale (VSS) is a proper instrument for assessing the patient status, clarifying the symptoms, and examining the relative impact of the vertigo and anxiety on reported handicap. Our aim is the translation and cross-cultural adaptation of the VSS into Persian language (VSS-P) and investigating its validity and reliability in patients with peripheral vestibular disorders. Materials and Methods: VSS was translated into Persian. Cross-cultural adaptation was carried out on 101 patients with peripheral vestibular disorders and 34 participants with no history of vertigo. They completed the Persian versions of VSS, dizziness handicap inventory (DHI), and Beck anxiety inventory (BAI). Internal, discriminant, and convergent validities, internal consistency, and test-retest reliability were determined. Results: The VSS-P showed good face validity. Internal validity was confirmed and demonstrated the presence of two vertigo (VSS-VER) and autonomic-anxiety (VSS-AA) subscales. Significant difference between the median scores for patient and healthy groups was reported in discriminate validity (P <0.001). Convergent validity revealed high correlation between both BAI and DHI with VSS-P. There was a high test-retest reliability; with intraclass correlation coefficient of 0.89, 0.86, and 0.91 for VSS-AA, VER, and VSS-P, respectively. The internal consistency was good with Cronbach's alpha 0.90 for VER subscale, 0.86 for VSS-AA subscale, and 0.92 for the overall VSS-P. Conclusion: The Persian version of the VSS could be used clinically as a valid and reliable tool. Thus, it is a key instrument to focus on the symptoms associated with dizziness. PMID:28616045
Development of the Persian version of the Vertigo Symptom Scale: Validity and reliability.
Kamalvand, Atefeh; Ghahraman, Mansoureh Adel; Jalaie, Shohreh
2017-01-01
Vertigo Symptom Scale (VSS) is a proper instrument for assessing the patient status, clarifying the symptoms, and examining the relative impact of the vertigo and anxiety on reported handicap. Our aim is the translation and cross-cultural adaptation of the VSS into Persian language (VSS-P) and investigating its validity and reliability in patients with peripheral vestibular disorders. VSS was translated into Persian. Cross-cultural adaptation was carried out on 101 patients with peripheral vestibular disorders and 34 participants with no history of vertigo. They completed the Persian versions of VSS, dizziness handicap inventory (DHI), and Beck anxiety inventory (BAI). Internal, discriminant, and convergent validities, internal consistency, and test-retest reliability were determined. The VSS-P showed good face validity. Internal validity was confirmed and demonstrated the presence of two vertigo (VSS-VER) and autonomic-anxiety (VSS-AA) subscales. Significant difference between the median scores for patient and healthy groups was reported in discriminate validity ( P <0.001). Convergent validity revealed high correlation between both BAI and DHI with VSS-P. There was a high test-retest reliability; with intraclass correlation coefficient of 0.89, 0.86, and 0.91 for VSS-AA, VER, and VSS-P, respectively. The internal consistency was good with Cronbach's alpha 0.90 for VER subscale, 0.86 for VSS-AA subscale, and 0.92 for the overall VSS-P. The Persian version of the VSS could be used clinically as a valid and reliable tool. Thus, it is a key instrument to focus on the symptoms associated with dizziness.
The roles of AMY1 copies and protein expression in human salivary α-amylase activity.
Yang, Ze-Min; Lin, Jing; Chen, Long-Hui; Zhang, Min; Chen, Wei-Wen; Yang, Xiao-Rong
2015-01-01
Salivary α-amylase (sAA) activity has been extensively investigated in nutrition and psychology. But few studies were performed to assess the role played by sAA gene (AMY1) copies and protein expression in basal and stimulus-induced sAA activity. The sAA activity, amount and AMY1 copy number were determined from 184 saliva samples pre- and post-citric acid stimulation. Our findings showed that citric acid could induce significant increase in sAA activity, total sAA amount, and glycosylated sAA amount, among which the glycosylated sAA amount had the largest response. The correlation analysis showed that AMY1 copy number, total sAA amount and AMY1 copy number×total sAA amount had significantly positive and successively increasing correlations with sAA activity in unstimulated and stimulated saliva, respectively, and furthermore, we observed higher correlations in unstimulated saliva when compared with the corresponding correlations in stimulated saliva. We also observed significant correlations between glycosylated sAA amount and sAA activity in unstimulated and stimulated saliva, respectively. Interestingly, the correlations were higher in stimulated saliva than in unstimulated saliva, and the correlations between glycosylated sAA amount and sAA activity were higher than that of between total sAA amount and sAA activity in stimulated saliva. Moreover, total sAA amount ratio and glycosylated sAA amount ratio showed significantly positive correlation with sAA activity ratio. AMY1 copy number had no correlation with sAA activity ratio. These findings suggested that AMY1 copy number and sAA amount played crucial roles in sAA activity; however, the roles were attenuated after stimulation due to fortified release of glycosylated sAA. Copyright © 2014 Elsevier Inc. All rights reserved.
Vaginal douching in adolescents attending a family planning clinic
Foch; McDaniel; Chacko
2000-05-01
Background: One of the variables most consistently associated with vaginal douching is race, with African-American women douching more regularly. Sparse data exists in the medical literature about the practice of vaginal douching among adolescents. The purpose of this study was to assess the prevalence, knowledge, attitude, and practices of vaginal douching among adolescent females attending a public family planning clinic, and determine whether African-American (AA) females douche to a greater degree than Caucasian females.Methods: In this cross-sectional study, a one-page questionnaire was administered to all adolescent females (=19 years of age) presenting to a public family planning clinic in a small southern city. Participant charts were abstracted for demographic and clinical information. Chi-square analysis, Pearson's correlation coefficient, and odds ratio were used in data analysis conducted in SPSS for Windows software.Results: Of the 169 participants, the mean age was 17.0 years (+/-1.5 years), 53% were Caucasian, 47% were AA, and 74% were nulliparous. Sixty-nine percent of participants reported vaginal douching, mostly for hygienic reasons (68%). Those reporting vaginal douching were more likely to have a history of one or more sexually transmitted diseases (O.R. 3. 7, 95% C.I. 1.5-9.0, p < 0.01). Age of first douche correlated positively with age of first sexual intercourse (r = 0.34, p < 0. 001). African-Americans did not douche to a greater degree than Caucasians. Among those who douched, AA females were more likely than Caucasians to believe that the reason women douche was after a period (p < 0.01) and after sex (p < 0.05), and to agree that douching clears up a discharge (p < 0.05) and odor (p < 0.01) from the vagina. Caucasians were more likely than AA to believe that some discharge from the vagina is normal (p < 0.05), and most women never need to douche (p < 0.01).Conclusions: Vaginal douching was a common practice among adolescent females attending a public family planning clinic in a small southern city, and racial differences were noted in knowledge of and attitude toward vaginal douching. This suggests development of a culturally-based educational program to convince AA and Caucasian adolescent females to cease vaginal douching.
Hullar, I; Meleg, I; Fekete, S; Romvari, R
1999-12-01
The digestibility coefficient and metabolizable energy (ME) content of the most important pigeon feeds (corn, wheat, barley, red and white millet, sorghum, canary seed, peas, lentils, sunflower, and hemp) were determined. The experiment was carried out using 10 adult male homing pigeons. All feeds were fed alone, in a whole-grain form, ad libitum. Drinking water and grit were offered to the birds on a continuous basis. Each feedstuff was fed to five pigeons in 1-wk cycles. There was no significant difference between the values determined in pigeons and those reported in the literature for chickens among the digestibilities of the CP of the various feeds. For pigeons, the digestibility of carbohydrates (N-free extracts, NFE) was lower (e.g., 62.37 vs 83.00% for barley and 63.45 vs 77.00% for peas), whereas the ether extract (EE) was higher (e.g., 75.58 vs 61.00% for barley and 82.59 vs 80.00% for peas) in pigeons compared with chickens. As a result, the AMEn values determined in pigeons did not differ significantly from those reported for chickens but tended to be slightly higher. For feeds of high-oil content, that difference may be somewhat larger. The correlation between the CP, EE, crude fiber (CF), and NFE contents of the feeds and the ME values determined in this experiment were calculated by multivariate linear regression. It was concluded that it was more accurate to determine and tabulate the ME contents of other potential pigeon feeds directly by experimental methods rather than using an equation.
Newton, Kyle C; Wraith, James; Dickson, Kathryn A
2015-08-01
Lamnid sharks are regionally endothermic fishes that maintain visceral temperatures elevated above the ambient water temperature. Visceral endothermy is thought to increase rates of digestion and food processing and allow thermal niche expansion. We tested the hypothesis that, at in vivo temperatures, the endothermic shortfin mako shark, Isurus oxyrinchus, has higher specific activities of three digestive enzymes-gastric pepsin and pancreatic trypsin and lipase-than the thresher shark, Alopias vulpinus, and the blue shark, Prionace glauca, neither of which can maintain elevated visceral temperatures. Homogenized stomach or pancreas tissue obtained from sharks collected by pelagic longline was incubated at both 15 and 25 °C, at saturating substrate concentrations, to quantify tissue enzymatic activity. The mako had significantly higher enzyme activities at 25 °C than did the thresher and blue sharks at 15 °C. This difference was not a simple temperature effect, because at 25 °C the mako had higher trypsin activity than the blue shark and higher activities for all enzymes than the thresher shark. We also hypothesized that the thermal coefficient, or Q 10 value, would be higher for the mako shark than for the thresher and blue sharks because of its more stable visceral temperature. However, the mako and thresher sharks had similar Q 10 values for all enzymes, perhaps because of their closer phylogenetic relationship. The higher in vivo digestive enzyme activities in the mako shark should result in higher rates of food processing and may represent a selective advantage of regional visceral endothermy.
Robayo-Torres, Claudia C.; Opekun, Antone R.; Quezada-Calvillo, Roberto; Xavier, Villa; Smith, E. O’Brian; Navarrete, Marilyn; Baker, S. Susan; Nichols, Buford L
2008-01-01
Congenital sucrase-isomaltase deficiency (CSID) is characterized by absence or deficiency of the mucosal sucrase-isomaltase enzyme. Specific diagnosis requires upper gastrointestinal biopsy with evidence of low to absent sucrase enzyme activity and normal histology. The hydrogen breath test (BT) is useful but is not specific for confirmation of CSID. We investigated a more specific 13C-sucrose labeled BT. Objectives were to determine if CSID can be detected with the 13C-sucrose BT without duodenal biopsy sucrase assay and if the 13C-sucrose BT can document restoration of sucrose digestion by CSID patients after oral supplementation with sacrosidase (Sucraid®). Methods Ten CSID patients were diagnosed by low biopsy sucrase activity. Ten controls were children who underwent endoscopy and biopsy because of dyspepsia or chronic diarrhea with normal mucosal enzymes activity and histology. Uniformly-labeled 13C-glucose and 13C-sucrose loads were orally administered. 13CO2 breath enrichments were assayed using an infrared spectrophotometer. In CSID patients the 13C-sucrose load was repeated adding Sucraid®. Sucrose digestion and oxidation were calculated as a mean % coefficient of glucose oxidation (% CGO) averaged between 30 and 90 minutes. Results Classification of patients by 13C-sucrose BT % CGO agreed with biopsy sucrase activity. The breath test also documented the return to normal of sucrose digestion and oxidation after supplementation of CSID patients with Sucraid®. Conclusion 13C-sucrose BT is an accurate and specific non-invasive confirmatory test for CSID and for enzyme replacement management. PMID:19330928